Science.gov

Sample records for frameshift mutations spotlight

  1. Frameshift mutation events in beta-glucosidases.

    PubMed

    Rojas, Antonio; Garcia-Vallvé, Santiago; Montero, Miguel A; Arola, Lluís; Romeu, Antoni

    2003-09-18

    Compensated frameshift mutation is a modification of the reading frame of a gene that takes place by way of various molecular events. It appears to be a widespread event that is only observed when homologous amino acid and nucleodotide sequences are compared. To identify these mutation events, the sequence analysis rationale was based on the search for short regions that would have much lower degrees of conservation in protein, but not in DNA, in well-conserved beta-glucosidase families. We have restricted our study to a seed set of sequences of O-glycoside hydrolase families 1 and 3. We found compensated frameshift mutation in the family of 1 beta-glucosidases for the Erwinia herbicola, Cellulomonas fimi, and (non-cyanogenic) Trifolium repens gene sequences, and in the family of 3 beta-glucosidases for the Clostridium thermocellum and Clostridium stercorarium gene sequences. By computational treatment, the observed mutation events in the gene frameshifting sub-sequence have been neutralised. Each nucleotide insertion must be eliminated and each nucleotide deletion must be substituted by the symbol N (any nucleotide). When the frameshifting fragments of the amino acid sequences were substituted by the computationally neutralised subsequences, the beta-glucosidase alignments were improved. We also discuss the structural implications of the compensated frameshift mutations events. PMID:14527732

  2. Atrial natriuretic peptide frameshift mutation in familial atrial fibrillation.

    PubMed

    Hodgson-Zingman, Denice M; Karst, Margaret L; Zingman, Leonid V; Heublein, Denise M; Darbar, Dawood; Herron, Kathleen J; Ballew, Jeffrey D; de Andrade, Mariza; Burnett, John C; Olson, Timothy M

    2008-07-10

    Atrial fibrillation is a common arrhythmia that is hereditary in a small subgroup of patients. In a family with 11 clinically affected members, we mapped an atrial fibrillation locus to chromosome 1p36-p35 and identified a heterozygous frameshift mutation in the gene encoding atrial natriuretic peptide. Circulating chimeric atrial natriuretic peptide (ANP) was detected in high concentration in subjects with the mutation, and shortened atrial action potentials were seen in an isolated heart model, creating a possible substrate for atrial fibrillation. This report implicates perturbation of the atrial natriuretic peptide-cyclic guanosine monophosphate (cGMP) pathway in cardiac electrical instability. PMID:18614783

  3. Adaptive Reversion of a Frameshift Mutation in Escherichia Coli

    PubMed Central

    Cairns, J.; Foster, P. L.

    1991-01-01

    Mutation rates are generally thought not to be influenced by selective forces. This doctrine rests on the results of certain classical studies of the mutations that make bacteria resistant to phages and antibiotics. We have studied a strain of Escherichia coli which constitutively expresses a lacI-lacZ fusion containing a frameshift mutation that renders it Lac(-). Reversion to Lac(+) is a rare event during exponential growth but occurs in stationary cultures when lactose is the only source of energy. No revertants accumulate in the absence of lactose, or in the presence of lactose if there is another, unfulfilled requirement for growth. The mechanism for such mutation in stationary phase is not known, but it requires some function of RecA which is apparently not required for mutation during exponential growth. PMID:1916241

  4. Novel Frameshift CHD7 Mutation Related to CHARGE Syndrome

    PubMed Central

    Martínez-Quintana, E.; Rodríguez-González, F.; Garay-Sánchez, P.; Tugores, A.

    2014-01-01

    CHARGE syndrome is a rare congenital condition characterized by 6 cardinal features: coloboma, heart defect, atresia choanae, retarded growth and development, genital anomalies, and ear anomalies/deafness. Mutations of the chromodomain helicase DNA-binding protein gene CHD7 are reported to be a major cause of CHARGE syndrome. Herein, we report the case of a 27-year-old patient presenting with typical symptoms who bears a novel heterozygous insertion in exon 2 of the CHD7 gene (c.327dupC) resulting in an amino acid substitution and a frameshift (p.Val110Argfs*22) that leads to a 131-amino-acid truncated polypeptide, likely representing a null allele. Parental genetic screening confirmed the sporadic origin of the mutation. PMID:24550764

  5. COMPLEX FRAMESHIFT MUTATIONS MEDIATED BY PLASMID PKM101: MUTATIONAL MECHANISMS DEDUCED FROM 4-AMINOBIPHENYL-INDUCED MUTATION SPECTRA IN SALMONELLA

    EPA Science Inventory

    We used colony probe hybridization and PCR/DNA sequencing to determine the mutations -aminobiphenyl (4-AB) +S9-induced revertants of the -1 frameshift allele in 2,300 4-aminobiphenyl of the base-substitution allele hisD3052 in strains TA1978, TA1538, and TA98 and were at strains ...

  6. Mechanisms of Spontaneous and Induced Frameshift Mutation in Bacteriophage T4

    PubMed Central

    Streisinger, George; Owen, Joyce Emrich

    1985-01-01

    Frequencies of spontaneous and proflavine-induced frameshift mutations increase dramatically as a function of the number of reiterated base pairs at each of two sites in the lysozyme gene of bacteriophage T4. At each site, proflavine induces addition mutations more frequently than deletion mutations. We confirm that the steroidal diamine, irehdiamine A, induces frameshift addition mutations. At sites of reiterated bases, we propose that base pairing is misaligned adjacent to a gap. The misaligned configuration is stabilized by the stacking of mutagen molecules around the extrahelical base, forming a sandwich. Proflavine induces addition mutations efficiently at a site without any reiterated bases. Mutagenesis at such sites may be due to mutagen-induced stuttering of the replication complex. PMID:3988038

  7. Frameshift mutations at two hotspots in vasopressin transcripts in post-mitotic neurons.

    PubMed Central

    Evans, D A; van der Kleij, A A; Sonnemans, M A; Burbach, J P; van Leeuwen, F W

    1994-01-01

    Mutations in DNA underlie carcinogenesis, inherited pathology, and aging and are generally thought to be introduced during meiosis and mitosis. Here we report that in post-mitotic neurons specific frameshift mutations occur at high frequency. These mutations were identified in vasopressin transcripts in magnocellular neurons of the homozygous Brattleboro rat and predominantly consist of a GA deletion in GAGAG motifs. Immunocytochemistry provides evidence for similar events in wild-type rats. However, the diseased state of the Brattleboro rat, resulting in a permanent activation of vasopressin neurons, enhanced the mutational rate. These data reveal hitherto unrecognized somatic mutations in nondividing neurons. Images PMID:8016115

  8. Frameshift mutations of a tumor suppressor gene ZNF292 in gastric and colorectal cancers with high microsatellite instability.

    PubMed

    Lee, Ju Hwa; Song, Sang Yong; Kim, Min Sung; Yoo, Nam Jin; Lee, Sug Hyung

    2016-07-01

    A transcription factor-encoding gene ZNF292 is considered a candidate tumor suppressor gene (TSG). Its mutations have been identified in cancers from liver, colon, and bone marrow. However, ZNF292 inactivating mutations that might suppress the TSG functions have not been reported in gastric (GC) and colorectal cancers (CRC) with microsatellite instability (MSI). In a public database, we found that ZNF292 gene had mononucleotide repeats in the coding sequences that might be mutation targets in the cancers with MSI. In this study, we analyzed 79 GCs and 124 CRCs including high MSI (MSI-H) and microsatellite stable/low MSI (MSS/MSI-L) cases for the detection of somatic mutations in the repeats. Overall, we identified frameshift mutations of ZNF292 in 3 (8.8%) GCs and 11 (13.9%) CRCs with MSI-H (14/113), but not in MSS/MSI-L cancers (0/90) (p < 0.001). Also, we studied intratumoral heterogeneity (ITH) of the ZNF292 frameshift mutations in 16 CRCs and found that two (12.5%) had regional ITH of the mutations. Our data show that ZNF292 gene harbors not only frameshift mutations but also mutational ITH, which together may be features of GC and CRC with MSI-H. Based on this, the ZNF292 frameshift mutations may possibly contribute to tumorigenesis by altering its TSG functions in GC and CRC. PMID:27150435

  9. An adolescent case of familial hyperparathyroidism with a germline frameshift mutation of the CDC73 gene.

    PubMed

    Takeuchi, Takako; Yoto, Yuko; Tsugawa, Takeshi; Kamasaki, Hotaka; Kondo, Atsushi; Ogino, Jiro; Hasegawa, Tadashi; Yama, Naoya; Anan, Sawa; Uchino, Shinya; Ishikawa, Aki; Sakurai, Akihiro; Tsutsumi, Hiroyuki

    2015-10-01

    A 13-yr-old boy who complained of persistent nausea, vomiting and weight loss had hypercalcemia and an elevated intact PTH level. Computed tomography confirmed two tumors in the thyroid gland. The tumors were surgically removed and pathologically confirmed as parathyroid adenoma. Because his maternal aunt and grandmother both had histories of parathyroid tumors, genetic investigation was undertaken for him, and a germline frameshift mutation of the CDC73 gene was identified. CDC73 gene analysis should be done on individuals who are at risk of familial hyperparathyroidism, including those who are asymptomatic, and they should be followed for potential primary hyperparathyroidism and associated disorders including resultant parathyroid carcinoma. PMID:26568659

  10. A novel frameshift mutation of CHD7 in a Japanese patient with CHARGE syndrome

    PubMed Central

    Kohmoto, Tomohiro; Shono, Miki; Naruto, Takuya; Watanabe, Miki; Suga, Ken-ichi; Nakagawa, Ryuji; Kagami, Shoji; Masuda, Kiyoshi; Imoto, Issei

    2016-01-01

    CHARGE syndrome is a rare autosomal dominant developmental disorder involving multiple organs. CHD7 is a major causative gene of CHARGE syndrome. We performed targeted-exome sequencing using a next-generation sequencer for molecular diagnosis of a 4-month-old male patient who was clinically suspected to have CHARGE syndrome, and report a novel monoallelic mutation in CHD7, NM_017780.3(CHD7_v001):c.2966del causing a reading frameshift [p.(Cys989Serfs*3)]. PMID:27081570

  11. A novel OTX2 gene frameshift mutation in a child with microphthalmia, ectopic pituitary and growth hormone deficiency.

    PubMed

    Lonero, Antonella; Delvecchio, Maurizio; Primignani, Paola; Caputo, Roberto; Bargiacchi, Sara; Penco, Silvana; Mauri, Lucia; Andreucci, Elena; Faienza, Maria Felicia; Cavallo, Luciano

    2016-05-01

    OTX2 mutations are reported in patients with eye maldevelopment and in some cases with brain or pituitary abnormalities. We describe a child carrying a novel OTX2 heterozygous mutation. She presented microphthalmia, absence of retinal vascularization, vitreal spots and optic nerve hypoplasia in the right eye and mild macular dystrophy in the left eye. Midline brain structures and cerebral parenchyma were normal, except for the ectopic posterior pituitary gland. OTX2 sequencing showed a heterozygous c.402del mutation. Most of OTX2 mutations are nonsense or frameshift introducing a premature termination codon and resulting in a truncated protein. More rarely missense mutations occur. Our novel OTX2 mutation (c.402del) is a frameshift mutation (p.S135Lfs*43), never reported before, causing a premature codon stop 43 amino-acids downstream, which is predicted to generate a premature truncation. The mutation was associated with microphthalmia and ectopic posterior pituitary. PMID:26974134

  12. Heterozygous frameshift mutation in keratin 5 in a family with Galli–Galli disease

    PubMed Central

    Reisenauer, AK; Wordingham, SV; York, J; Kokkonen, EWJ; Mclean, WHI; Wilson, NJ; Smith, FJD

    2014-01-01

    Background Reticulate pigmentary disorders include the rare autosomal dominant Galli–Galli disease (GGD) and Dowling–Degos disease (DDD). Clinical diagnosis between some of the subtypes can be difficult due to a degree of overlap between clinical features, therefore analysis at the molecular level may be necessary to confirm the diagnosis. Objectives To identify the underlying genetic defect in a 48-year-old Asian-American woman with a clinical diagnosis of GGD. Methods Histological analysis was performed on a skin biopsy using haematoxylin–eosin staining. KRT5 (the gene encoding keratin 5) was amplified from genomic DNA and directly sequenced. Results The patient had a history of pruritus and hyperpigmented erythematous macules and thin papules along the flexor surfaces of her arms, her upper back and neck, axillae and inframammary areas. Hypopigmented macules were seen among the hyperpigmentation. A heterozygous 1-bp insertion mutation in KRT5 (c.38dupG; p.Ser14GlnfsTer3) was identified in the proband. This mutation occurs within the head domain of the keratin 5 protein leading to a frameshift and premature stop codon. Conclusions From the histological findings and mutation analysis the individual was identified as having GGD due to haploinsufficiency of keratin 5. PMID:24372084

  13. A CHRNE frameshift mutation causes congenital myasthenic syndrome in young Jack Russell Terriers.

    PubMed

    Rinz, Caitlin J; Lennon, Vanda A; James, Fiona; Thoreson, James B; Tsai, Kate L; Starr-Moss, Alison N; Humphries, H Dale; Guo, Ling T; Palmer, Anthony C; Clark, Leigh Anne; Shelton, G Diane

    2015-12-01

    Congenital myasthenic syndromes (CMSs) are a group of rare genetic disorders of the neuromuscular junction resulting in structural or functional causes of fatigable weakness that usually begins early in life. Mutations in pre-synaptic, synaptic and post-synaptic proteins have been demonstrated in human cases, with more than half involving aberrations in nicotinic acetylcholine receptor (AChR) subunits. CMS was first recognized in dogs in 1974 as an autosomal recessive trait in Jack Russell Terriers (JRTs). A deficiency of junctional AChRs was demonstrated. Here we characterize a CMS in 2 contemporary cases of JRT littermates with classic clinical and electromyographic findings, and immunochemical confirmation of an approximately 90% reduction in AChR protein content. Loci encoding the 5 AChR subunits were evaluated using microsatellite markers, and CHRNB1 and CHRNE were identified as candidate genes. Sequences of the splice sites and exons of both genes revealed a single base insertion in exon 7 of CHRNE that predicts a frameshift mutation and a premature stop codon. We further demonstrated this pathogenic mutation in CHRNE in archival tissues from unrelated JRTs studied 34 years ago. PMID:26429099

  14. Novel SMC1A frameshift mutations in children with developmental delay and epilepsy.

    PubMed

    Goldstein, Jessica H R; Tim-Aroon, Thipwimol; Shieh, Joseph; Merrill, Michelle; Deeb, Kristin K; Zhang, Shulin; Bass, Nancy E; Bedoyan, Jirair K

    2015-10-01

    Cornelia de Lange syndrome (CdLS) is a rare dominantly inherited genetic multisystem developmental condition with considerable phenotypic and allelic heterogeneity. Missense and in-frame deletions within the SMC1A gene can be associated with epilepsy and milder craniofacial features. We report two females who presented with developmental delay and developed isolated medically refractory seizures with unrevealing initial laboratory, imaging and genetic evaluations. Whole exome sequencing (WES) analyses were performed and were instrumental in uncovering the genetic etiology for their conditions. WES identified two novel de novo heterozygous frameshift mutations in the SMC1A gene [c.2853_2856delTCAG (p.Ser951Argfs*12) and c.3549_3552dupGGCC (p.Ile1185Glyfs*23)]. We also observed marked skewing of X-inactivation in one patient. The individual with the p.Ser951Argfs*12 mutation represents an extreme on the CdLS phenotypic spectrum, with prominent neurological involvement of severe developmental delay and refractory epilepsy, with mild craniofacial features. Both individuals eventually had incomplete clinical responses to therapy with valproic acid. We review previous reports of SMC1A mutations with epilepsy. SMC1A should be included in clinical gene panels for early infantile and early childhood epileptic encephalopathy. PMID:26386245

  15. A frameshift mutation in GRXCR2 causes recessively inherited hearing loss

    PubMed Central

    Imtiaz, Ayesha; Kohrman, David C.; Naz, Sadaf

    2014-01-01

    More than 360 million humans are affected with some degree of hearing loss, either early or later in life. A genetic cause for the disorder is present in a majority of the cases. We mapped a locus (DFNB101) for hearing loss in humans to chromosome 5q in a consanguineous Pakistani family. Exome sequencing revealed an insertion mutation in GRXCR2 as the cause of moderate to severe and likely progressive hearing loss in the affected individuals of the family. The frameshift mutation is predicted to affect a conserved, cysteine-rich region of GRXCR2, and to result in an abnormal extension of the C-terminus. Functional studies by cell transfections demonstrated that the mutant protein is unstable and mislocalized relative to wild type GRXCR2, consistent with a loss of function mutation. Targeted disruption of Grxcr2 is concurrently reported to cause hearing loss in mice. The structural abnormalities in this animal model suggest a role for GRXCR2 in the development of stereocilia bundles, specialized structures on the apical surface of sensory cells in the cochlea that are critical for sound detection. Our results indicate that GRXCR2 should be considered in differential genetic diagnosis for individuals with early onset, moderate to severe and progressive hearing loss. PMID:24619944

  16. DVL1 Frameshift Mutations Clustering in the Penultimate Exon Cause Autosomal-Dominant Robinow Syndrome

    PubMed Central

    White, Janson; Mazzeu, Juliana F.; Hoischen, Alexander; Jhangiani, Shalini N.; Gambin, Tomasz; Alcino, Michele Calijorne; Penney, Samantha; Saraiva, Jorge M.; Hove, Hanne; Skovby, Flemming; Kayserili, Hülya; Estrella, Elicia; Vulto-van Silfhout, Anneke T.; Steehouwer, Marloes; Muzny, Donna M.; Sutton, V. Reid; Gibbs, Richard A.; Lupski, James R.; Brunner, Han G.; van Bon, Bregje W.M.; Carvalho, Claudia M.B.

    2015-01-01

    Robinow syndrome is a genetically heterogeneous disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features and for which both autosomal-recessive and autosomal-dominant inheritance patterns have been described. Causative variants in the non-canonical signaling gene WNT5A underlie a subset of autosomal-dominant Robinow syndrome (DRS) cases, but most individuals with DRS remain without a molecular diagnosis. We performed whole-exome sequencing in four unrelated DRS-affected individuals without coding mutations in WNT5A and found heterozygous DVL1 exon 14 mutations in three of them. Targeted Sanger sequencing in additional subjects with DRS uncovered DVL1 exon 14 mutations in five individuals, including a pair of monozygotic twins. In total, six distinct frameshift mutations were found in eight subjects, and all were heterozygous truncating variants within the penultimate exon of DVL1. In five families in which samples from unaffected parents were available, the variants were demonstrated to represent de novo mutations. All variant alleles are predicted to result in a premature termination codon within the last exon, escape nonsense-mediated decay (NMD), and most likely generate a C-terminally truncated protein with a distinct −1 reading-frame terminus. Study of the transcripts extracted from affected subjects’ leukocytes confirmed expression of both wild-type and variant alleles, supporting the hypothesis that mutant mRNA escapes NMD. Genomic variants identified in our study suggest that truncation of the C-terminal domain of DVL1, a protein hypothesized to have a downstream role in the Wnt-5a non-canonical pathway, is a common cause of DRS. PMID:25817016

  17. DVL1 frameshift mutations clustering in the penultimate exon cause autosomal-dominant Robinow syndrome.

    PubMed

    White, Janson; Mazzeu, Juliana F; Hoischen, Alexander; Jhangiani, Shalini N; Gambin, Tomasz; Alcino, Michele Calijorne; Penney, Samantha; Saraiva, Jorge M; Hove, Hanne; Skovby, Flemming; Kayserili, Hülya; Estrella, Elicia; Vulto-van Silfhout, Anneke T; Steehouwer, Marloes; Muzny, Donna M; Sutton, V Reid; Gibbs, Richard A; Lupski, James R; Brunner, Han G; van Bon, Bregje W M; Carvalho, Claudia M B

    2015-04-01

    Robinow syndrome is a genetically heterogeneous disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features and for which both autosomal-recessive and autosomal-dominant inheritance patterns have been described. Causative variants in the non-canonical signaling gene WNT5A underlie a subset of autosomal-dominant Robinow syndrome (DRS) cases, but most individuals with DRS remain without a molecular diagnosis. We performed whole-exome sequencing in four unrelated DRS-affected individuals without coding mutations in WNT5A and found heterozygous DVL1 exon 14 mutations in three of them. Targeted Sanger sequencing in additional subjects with DRS uncovered DVL1 exon 14 mutations in five individuals, including a pair of monozygotic twins. In total, six distinct frameshift mutations were found in eight subjects, and all were heterozygous truncating variants within the penultimate exon of DVL1. In five families in which samples from unaffected parents were available, the variants were demonstrated to represent de novo mutations. All variant alleles are predicted to result in a premature termination codon within the last exon, escape nonsense-mediated decay (NMD), and most likely generate a C-terminally truncated protein with a distinct -1 reading-frame terminus. Study of the transcripts extracted from affected subjects' leukocytes confirmed expression of both wild-type and variant alleles, supporting the hypothesis that mutant mRNA escapes NMD. Genomic variants identified in our study suggest that truncation of the C-terminal domain of DVL1, a protein hypothesized to have a downstream role in the Wnt-5a non-canonical pathway, is a common cause of DRS. PMID:25817016

  18. CCR4 frameshift mutation identifies a distinct group of adult T cell leukaemia/lymphoma with poor prognosis.

    PubMed

    Yoshida, Noriaki; Miyoshi, Hiroaki; Kato, Takeharu; Sakata-Yanagimoto, Mamiko; Niino, Daisuke; Taniguchi, Hiroaki; Moriuchi, Yukiyoshi; Miyahara, Masaharu; Kurita, Daisuke; Sasaki, Yuya; Shimono, Joji; Kawamoto, Keisuke; Utsunomiya, Atae; Imaizumi, Yoshitaka; Seto, Masao; Ohshima, Koichi

    2016-04-01

    Adult T cell leukaemia/lymphoma (ATLL) is an intractable T cell neoplasm caused by human T cell leukaemia virus type 1. Next-generation sequencing-based comprehensive mutation studies have revealed recurrent somatic CCR4 mutations in ATLL, although clinicopathological findings associated with CCR4 mutations remain to be delineated. In the current study, 184 cases of peripheral T cell lymphoma, including 113 cases of ATLL, were subjected to CCR4 mutation analysis. This sequence analysis identified mutations in 27% (30/113) of cases of ATLL and 9% (4/44) of cases of peripheral T cell lymphoma not otherwise specified. Identified mutations included nonsense (NS) and frameshift (FS) mutations. No significant differences in clinicopathological findings were observed between ATLL cases stratified by presence of CCR4 mutation. All ATLL cases with CCR4 mutations exhibited cell-surface CCR4 positivity. Semi-quantitative CCR4 protein analysis of immunohistochemical sections revealed higher CCR4 expression in cases with NS mutations of CCR4 than in cases with wild-type (WT) CCR4. Furthermore, among ATLL cases, FS mutation was significantly associated with a poor prognosis, compared with NS mutation and WT CCR4. These results suggest that CCR4 mutation is an important determinant of the clinical course in ATLL cases, and that NS and FS mutations of CCR4 behave differently with respect to ATLL pathophysiology. PMID:26847489

  19. Translational Compensation of a Frameshift Mutation Affecting Herpes Simplex Virus Thymidine Kinase Is Sufficient To Permit Reactivation from Latency

    PubMed Central

    Griffiths, Anthony; Chen, Shun-Hua; Horsburgh, Brian C.; Coen, Donald M.

    2003-01-01

    Herpes simplex virus thymidine kinase is important for reactivation of virus from its latent state and is a target for the antiviral drug acyclovir. Most acyclovir-resistant isolates have mutations in the thymidine kinase gene; however, how these mutations confer clinically relevant resistance is unclear. Reactivation from explanted mouse ganglia was previously observed with a patient-derived drug-resistant isolate carrying a single guanine insertion within a run of guanines in the thymidine kinase gene. Despite this mutation, low levels of active enzyme were synthesized following an unusual ribosomal frameshift. Here we report that a virus, generated from a pretherapy isolate from the same patient, engineered to lack thymidine kinase activity, was competent for reactivation. This suggested that the clinical isolate contains alleles of other genes that permit reactivation in the absence of thymidine kinase. Therefore, to establish whether thymidine kinase synthesized via a ribosomal frameshift was sufficient for reactivation under conditions where reactivation requires this enzyme, we introduced the mutation into the well-characterized strain KOS. This mutant virus reactivated from latency, albeit less efficiently than KOS. Plaque autoradiography revealed three phenotypes of reactivating viruses: uniformly low thymidine kinase activity, mixed high and low activity, and uniformly high activity. We generated a recombinant thymidine kinase-null virus from a reactivating virus expressing uniformly low activity. This virus did not reactivate, confirming that mutations in other genes that would influence reactivation had not arisen. Therefore, in strains that require thymidine kinase for reactivation from latency, low levels of enzyme synthesized via a ribosomal frameshift can suffice. PMID:12663777

  20. Dravet syndrome with favourable cognitive and behavioral development due to a novel SCN1A frameshift mutation.

    PubMed

    Jiang, Peifang; Shen, Jue; Yu, Yonglin; Jiang, Lihua; Xu, Jialu; Xu, Lu; Yu, Huimin; Gao, Feng

    2016-07-01

    Children with Dravet syndrome (DS) often have severe cognitive, behaviour and motor impairments. Patients with truncating mutations would logically have the more severe phenotype. Here we present a case of DS with an unusually favourable cognitive and behavioral development with a novel SCN1A frameshift mutation (c.4233-4234insAT). Under regular following up for ten years, the patient had normal expressive language and mild motor clumsiness. It is suggested that besides the type of SCN1A mutation, other mechanisms may be existed to influence the SCN1A phenotype, such as modifier genes, developmental variability, accumulation of somatic mutation in lifetime and environmental insults can all contribute to the cognitive and behavioral outcome. PMID:27209029

  1. Conformational Insights into the Mechanism of Acetylaminofluorene-dG-Induced Frameshift Mutations in the NarI Mutational Hotspot.

    PubMed

    Xu, Lifang; Cho, Bongsup P

    2016-02-15

    Frameshift mutagenesis encompasses the gain or loss of DNA base pairs, resulting in altered genetic outcomes. The NarI restriction site sequence 5'-G1G2CG3CX-3' in Escherichia coli is a well-known mutational hotspot, in which lesioning of acetylaminofluorene (AAF) at G3* induces a greater -2 deletion frequency than that at other guanine sites. Its mutational efficiency is modulated by the nature of the nucleotide in the X position (C ∼ A > G ≫ T). Here, we conducted a series of polymerase-free solution experiments that examine the conformational and thermodynamic basis underlying the propensity of adducted G3 to form a slipped mutagenic intermediate (SMI) and its sequence dependence during translesion synthesis (TLS). Instability of the AAF-dG3:dC pair at the replication fork promoted slippage to form a G*C bulge-out SMI structure, consisting of S- ("lesion stacked") and B-SMI ("lesion exposed") conformations, with conformational rigidity increasing as a function of primer elongation. We found greater stability of the S- compared to the B-SMI conformer throughout TLS. The dependence of their population ratios was determined by the 3'-next flanking base X at fully elongated bulge structures, with 59% B/41% S and 86% B/14% S for the dC and dT series, respectively. These results indicate the importance of direct interactions of the hydrophobic AAF lesion with the 3'-next flanking base pair and its stacking fit within the -2 bulge structure. A detailed conformational understanding of the SMI structures and their sequence dependence may provide a useful model for DNA polymerase complexes. PMID:26733364

  2. Correlation between Density of CD8+ T-cell Infiltrate in Microsatellite Unstable Colorectal Cancers and Frameshift Mutations: A Rationale for Personalized Immunotherapy.

    PubMed

    Maby, Pauline; Tougeron, David; Hamieh, Mohamad; Mlecnik, Bernhard; Kora, Hafid; Bindea, Gabriela; Angell, Helen K; Fredriksen, Tessa; Elie, Nicolas; Fauquembergue, Emilie; Drouet, Aurélie; Leprince, Jérôme; Benichou, Jacques; Mauillon, Jacques; Le Pessot, Florence; Sesboüé, Richard; Tuech, Jean-Jacques; Sabourin, Jean-Christophe; Michel, Pierre; Frébourg, Thierry; Galon, Jérôme; Latouche, Jean-Baptiste

    2015-09-01

    Colorectal cancers with microsatellite instability (MSI) represent 15% of all colorectal cancers, including Lynch syndrome as the most frequent hereditary form of this disease. Notably, MSI colorectal cancers have a higher density of tumor-infiltrating lymphocytes (TIL) than other colorectal cancers. This feature is thought to reflect the accumulation of frameshift mutations in sequences that are repeated within gene coding regions, thereby leading to the synthesis of neoantigens recognized by CD8(+) T cells. However, there has yet to be a clear link established between CD8(+) TIL density and frameshift mutations in colorectal cancer. In this study, we examined this link in 103 MSI colorectal cancers from two independent cohorts where frameshift mutations in 19 genes were analyzed and CD3(+), CD8(+), and FOXP3(+) TIL densities were quantitated. We found that CD8(+) TIL density correlated positively with the total number of frameshift mutations. TIL densities increased when frameshift mutations were present within the ASTE1, HNF1A, or TCF7L2 genes, increasing even further when at least one of these frameshift mutations was present in all tumor cells. Through in vitro assays using engineered antigen-presenting cells, we were able to stimulate peripheral cytotoxic T cells obtained from colorectal cancer patients with peptides derived from frameshift mutations found in their tumors. Taken together, our results highlight the importance of a CD8(+) T cell immune response against MSI colorectal cancer-specific neoantigens, establishing a preclinical rationale to target them as a personalized cellular immunotherapy strategy, an especially appealing goal for patients with Lynch syndrome. PMID:26060019

  3. Frameshift and nonsense p53 mutations in squamous-cell carcinoma of head and neck - non-reactivity with 3 anti-p53 monoclonal-antibodies.

    PubMed

    Chen, Y; Xu, L; Massey, L; Zlotolow, I; Huvos, A; Garinchesa, P; Old, L

    1994-03-01

    p53 mutations in human tumors are often associated with overexpression of p53, and immunohistochemical detection of p53 has frequently been chosen as a simpler method than genetic analysis to access p53 mutations. In this study, we analyzed the p53 gene by single-strand conformational polymorphism (SSCP) and DNA sequencing, and correlated findings to Ab staining results. In a series of 58 squamous cell carcinoma, 15 showed mutations in exons 5, 6, 7, 8 and 9 by SSCP. Of these 15 cases, 11 were positive by antibody staining, and DNA sequencing showed missense mutations but no frameshift or nonsense mutations. In contrast, the antibody-negative cases had frameshift or nonsense mutations, but no missense mutations. SSCP analysis of these 4 cases showed mutations in exon 6 (2 cases), exon 7 (1), and exon 8 (1), respectively. In case 1, sequencing data revealed a single-base addition in exon 6, leading to a truncated gene product of 207 amino acids (aa), in contrast to 393 aa in wild-type p53. Similar frameshift mutations were shown in case 2 and case 3. Case 4, instead of a frameshift mutation, carried a nonsense mutation, and a truncated peptide of 235 aa. All these mutations thus shared the feature of producing truncated p53 products nonreactive with antibodies. We conclude that frameshift mutations as well as nonsense mutations can lead to altered p53 undetectable by available monoclonal antibodies. Our finding indicates that the absence of Ab reactivity does not rule out genetic alterations of the p53 gene in human tumors. PMID:21566966

  4. A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma.

    PubMed

    Liu, Chunqiao; Widen, Sonya A; Williamson, Kathleen A; Ratnapriya, Rinki; Gerth-Kahlert, Christina; Rainger, Joe; Alur, Ramakrishna P; Strachan, Erin; Manjunath, Souparnika H; Balakrishnan, Archana; Floyd, James A; Li, Tiansen; Waskiewicz, Andrew; Brooks, Brian P; Lehmann, Ordan J; FitzPatrick, David R; Swaroop, Anand

    2016-04-01

    Ocular coloboma is a common eye malformation resulting from incomplete fusion of the optic fissure during development. Coloboma is often associated with microphthalmia and/or contralateral anophthalmia. Coloboma shows extensive locus heterogeneity associated with causative mutations identified in genes encoding developmental transcription factors or components of signaling pathways. We report an ultra-rare, heterozygous frameshift mutation in FZD5 (p.Ala219Glufs*49) that was identified independently in two branches of a large family with autosomal dominant non-syndromic coloboma. FZD5 has a single-coding exon and consequently a transcript with this frameshift variant is not a canonical substrate for nonsense-mediated decay. FZD5 encodes a transmembrane receptor with a conserved extracellular cysteine rich domain for ligand binding. The frameshift mutation results in the production of a truncated protein, which retains the Wingless-type MMTV integration site family member-ligand-binding domain, but lacks the transmembrane domain. The truncated protein was secreted from cells, and behaved as a dominant-negative FZD5 receptor, antagonizing both canonical and non-canonical WNT signaling. Expression of the resultant mutant protein caused coloboma and microphthalmia in zebrafish, and disruption of the apical junction of the retinal neural epithelium in mouse, mimicking the phenotype of Fz5/Fz8 compound conditional knockout mutants. Our studies have revealed a conserved role of Wnt-Frizzled (FZD) signaling in ocular development and directly implicate WNT-FZD signaling both in normal closure of the human optic fissure and pathogenesis of coloboma. PMID:26908622

  5. Whole-exome sequencing reveals a novel frameshift mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in the Indian population.

    PubMed

    Zhou, Yu; Saikia, Bibhuti B; Jiang, Zhilin; Zhu, Xiong; Liu, Yuqing; Huang, Lulin; Kim, Ramasamy; Yang, Yin; Qu, Chao; Hao, Fang; Gong, Bo; Tai, Zhengfu; Niu, Lihong; Yang, Zhenglin; Sundaresan, Periasamy; Zhu, Xianjun

    2015-10-01

    Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 50 genes. To identify genetic mutations underlying autosomal recessive RP (arRP), we performed whole-exome sequencing study on two consanguineous marriage Indian families (RP-252 and RP-182) and 100 sporadic RP patients. Here we reported novel mutation in FAM161A in RP-252 and RP-182 with two patients affected with RP in each family. The FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. By whole-exome sequencing we identified several homozygous genomic regions, one of which included the recently identified FAM161A gene mutated in RP28-linked arRP. Sequencing analysis revealed the presence of a novel homozygous frameshift mutation p.R592FsX2 in both patients of family RP-252 and family RP-182. In 100 sporadic Indian RP patients, this novel homozygous frameshift mutation p.R592FsX2 was identified in one sporadic patient ARRP-S-I-46 by whole-exome sequencing and validated by Sanger sequencing. Meanwhile, this homozygous frameshift mutation was absent in 1000 ethnicity-matched control samples screened by direct Sanger sequencing. In conclusion, we identified a novel homozygous frameshift mutations of RP28-linked RP gene FAM161A in Indian population. PMID:26246154

  6. A CNGB1 Frameshift Mutation in Papillon and Phalène Dogs with Progressive Retinal Atrophy

    PubMed Central

    Ahonen, Saija J.; Arumilli, Meharji; Lohi, Hannes

    2013-01-01

    Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA) or degeneration resembles human retinitis pigmentosa (RP) and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD) of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10−8) with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes. PMID:24015210

  7. A CNGB1 frameshift mutation in Papillon and Phalène dogs with progressive retinal atrophy.

    PubMed

    Ahonen, Saija J; Arumilli, Meharji; Lohi, Hannes

    2013-01-01

    Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA) or degeneration resembles human retinitis pigmentosa (RP) and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD) of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10(-8)) with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes. PMID:24015210

  8. Slipping and Sliding: frameshift mutations in herpes simplex virus thymidine kinase and drug-resistance

    PubMed Central

    Griffiths, Anthony

    2011-01-01

    Some of the most successful antiviral agents currently available are effective against herpes simplex virus. However, resistance to these drugs is frequently associated with significant morbidity, particularly in immunocompromised patients. In addition to the clinical implications of drug resistance, the range of biological processes exploited by the virus to attain resistance while maintaining pathogenicity is proving to be surprising. These mechanisms, which include ribosomal frameshifting, induced infidelity of the DNA polymerase, and internal ribosome entry, are discussed. PMID:21940196

  9. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

    PubMed

    Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

    2013-03-01

    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome. PMID:23526569

  10. De novo frameshift mutation in COUP-TFII (NR2F2) in human congenital diaphragmatic hernia.

    PubMed

    High, Frances A; Bhayani, Pooja; Wilson, Jay M; Bult, Carol J; Donahoe, Patricia K; Longoni, Mauro

    2016-09-01

    COUP-TFII (NR2F2) is mapped to the 15q26 deletion hotspot associated with the common and highly morbid congenital diaphragmatic hernia (CDH). Conditional homozygous deletions of COUP-TFII in mice result in diaphragmatic defects analogous to the human Bochdalek-type hernia phenotype. Despite evidence from animal models however, mutations in the coding sequence of COUP-TFII have not been reported in patients, prompting the speculation that additional coding or non-coding sequences in the 15q26 locus are necessary for diaphragmatic hernias to develop. In this report, we describe a case of a patient with a heterozygous de novo COUP-TFII frameshift mutation, presenting with CDH and an atrial septal defect. The p.Pro33AlafsTer77 mutation specifically disrupts protein isoform 1 which contains the DNA binding domain. In addition, we review other COUP-TFII sequence variations and deletions that have been described in cases of CDH. We conclude that COUP-TFII mutations can cause diaphragmatic hernias, and should be included in the differential diagnosis of CDH patients, particularly those with comorbid congenital heart defects. © 2016 Wiley Periodicals, Inc. PMID:27363585

  11. De Novo Frameshift Mutation in COUP-TFII (NR2F2) in Human Congenital Diaphragmatic Hernia

    PubMed Central

    High, Frances A.; Bhayani, Pooja; Wilson, Jay M.; Bult, Carol J.; Donahoe, Patricia K.; Longoni, Mauro

    2016-01-01

    COUP-TFII (NR2F2) is mapped to the 15q26 deletion hotspot associated with the common and highly morbid congenital diaphragmatic hernia (CDH). Conditional homozygous deletions of COUP-TFII in mice result in diaphragmatic defects analogous to the human Bochdalek-type hernia phenotype. Despite evidence from animal models however, mutations in the coding sequence of COUP-TFII have not been reported in patients, prompting the speculation that additional coding or non-coding sequences in the 15q26 locus are necessary for diaphragmatic hernias to develop. In this report, we describe a case of a patient with a heterozygous de novo COUP-TFII frameshift mutation, presenting with CDH and an atrial septal defect. The p.Pro33AlafsTer77 mutation specifically disrupts protein isoform 1 which contains the DNA binding domain. In addition, we review other COUP-TFII sequence variations and deletions that have been described in cases of CDH. We conclude that COUP-TFII mutations can cause diaphragmatic hernias, and should be included in the differential diagnosis of CDH patients, particularly those with comorbid congenital heart defects. PMID:27363585

  12. A new Frameshift mutation on the α2-globin gene causing α⁺-thalassemia: codon 43 (TTC>-TC or TTC>T-C).

    PubMed

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Barro, Claire; Francina, Alain

    2012-01-01

    We report a new mutation on the α2-globin gene causing α(+)-thalassemia (α(+)-thal) with a deletion of a single nucleotide (T) at amino acid residue 43 [HBA2:c.130delT or HBA2:c.131delT]. This frameshift deletion gives rise to a premature termination codon at codon 47. PMID:22738776

  13. MUTAGENICITY AND MUTATION SPECTRA OF 2-ACETYLAMINOFLUORENE AT FRAMESHIFT AND BASE-SUBSTITUTION ALLELES IN FOUR DNA REPAIR BACKGROUNDS OF SALMONELLA

    EPA Science Inventory

    We used colony probe hybridization procedures-to determine the mutations in 600 revertants of the -1 frameshift allele hisD3052 and 200 revertants of the base substitution allele hisG46 of Salmonella typhimurium induced by 2-acetylaminofluorene (2-AAF) in the presence of S9. -AAF...

  14. A frameshift mutation within LAMC2 is responsible for Herlitz type junctional epidermolysis bullosa (HJEB) in black headed mutton sheep.

    PubMed

    Mömke, Stefanie; Kerkmann, Andrea; Wöhlke, Anne; Ostmeier, Miriam; Hewicker-Trautwein, Marion; Ganter, Martin; Kijas, James; Distl, Ottmar

    2011-01-01

    Junctional epidermolysis bullosa (JEB) is a hereditary mechanobullous skin disease in humans and animals. A Herlitz type JEB was identified in German Black Headed Mutton (BHM) sheep and affected lambs were reproduced in a breeding trial. Affected lambs showed skin and mucous membranes blistering and all affected lambs died within the first weeks of life. The pedigree data were consistent with a monogenic autosomal recessive inheritance. Immunofluorescence showed a reduced expression of laminin 5 protein which consists of 3 subunits encoded by the genes LAMA3, LAMB3 and LAMC2. We screened these genes for polymorphisms. Linkage and genome-wide association analyses identified LAMC2 as the most likely candidate for HJEB. A two base pair deletion within exon 18 of the LAMC2 gene (FM872310:c.2746delCA) causes a frameshift mutation resulting in a premature stop codon (p.A928*) 13 triplets downstream of this mutation and in addition, introduces an alternative splicing of exon 18 LAMC2. This deletion showed a perfect co-segregation with HJEB in all 740 analysed BHM sheep. Identification of the LAMC2 deletion means an animal model for HJEB is now available to develop therapeutic approaches of relevance to the human form of this disease. PMID:21573221

  15. Whole exome sequencing identifies a novel frameshift mutation in GPC3 gene in a patient with overgrowth syndrome.

    PubMed

    Das Bhowmik, Aneek; Dalal, Ashwin

    2015-11-10

    Overgrowth syndromes are a heterogeneous group of diseases characterized by focal or generalized overgrowth. Many of the syndromes have overlapping clinical features and it is difficult to diagnose the condition based on clinical features alone. In the present study we report on a patient with overgrowth syndrome where extensive investigation did not reveal the cause of disease. Finally exome sequencing revealed a novel hemizygous single base pair deletion in exon 8 of GPC3 gene (chrX:132670203delA) resulting in a frameshift and creating a new stop codon at 62 amino acids downstream to codon 564 (c.1692delT; p.Leu565SerfsTer63) of the protein. The mutation was confirmed by Sanger sequencing. The mother was found to be heterozygous for the mutation. This variation is not reported in the 1000 Genomes, Exome Variant Server (EVS), Exome Aggregation Consortium (ExAC) and dbSNP databases and the region is conserved across primates. Exome sequencing was helpful in establishing diagnosis of Simpson-Golabi-Behmel syndrome type 1 (SGBS1) in a patient with unknown overgrowth syndrome. PMID:26321508

  16. An exon 53 frameshift mutation in CUBN abrogates cubam function and causes Imerslund-Gräsbeck syndrome in dogs.

    PubMed

    Fyfe, John C; Hemker, Shelby L; Venta, Patrick J; Fitzgerald, Caitlin A; Outerbridge, Catherine A; Myers, Sherry L; Giger, Urs

    2013-08-01

    Cobalamin malabsorption accompanied by selective proteinuria is an autosomal recessive disorder known as Imerslund-Gräsbeck syndrome in humans and was previously described in dogs due to amnionless (AMN) mutations. The resultant vitamin B12 deficiency causes dyshematopoiesis, lethargy, failure to thrive, and life-threatening metabolic disruption in the juvenile period. We studied 3 kindreds of border collies with cobalamin malabsorption and mapped the disease locus in affected dogs to a 2.9Mb region of homozygosity on canine chromosome 2. The region included CUBN, the locus encoding cubilin, a peripheral membrane protein that in concert with AMN forms the functional intrinsic factor-cobalamin receptor expressed in ileum and a multi-ligand receptor in renal proximal tubules. Cobalamin malabsorption and proteinuria comprising CUBN ligands were demonstrated by radiolabeled cobalamin uptake studies and SDS-PAGE, respectively. CUBN mRNA and protein expression were reduced ~10 fold and ~20 fold, respectively, in both ileum and kidney of affected dogs. DNA sequencing demonstrated a single base deletion in exon 53 predicting a translational frameshift and early termination codon likely triggering nonsense mediated mRNA decay. The mutant allele segregated with the disease in the border collie kindred. The border collie disorder indicates that a CUBN mutation far C-terminal from the intrinsic factor-cobalamin binding site can abrogate receptor expression and cause Imerslund-Gräsbeck syndrome. PMID:23746554

  17. Evidence that selected amplification of a bacterial lac frameshift allele stimulates Lac(+) reversion (adaptive mutation) with or without general hypermutability.

    PubMed Central

    Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R

    2002-01-01

    In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002

  18. A Tumor-Specific Neo-Antigen Caused by a Frameshift Mutation in BAP1 Is a Potential Personalized Biomarker in Malignant Peritoneal Mesothelioma

    PubMed Central

    Lai, Jun; Zhou, Zhan; Tang, Xiao-Jing; Gao, Zhi-Bin; Zhou, Jie; Chen, Shu-Qing

    2016-01-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive rare malignancy associated with asbestos exposure. A better understanding of the molecular pathogenesis of MPM will help develop a targeted therapy strategy. Oncogene targeted depth sequencing was performed on a tumor sample and paired peripheral blood DNA from a patient with malignant mesothelioma of the peritoneum. Four somatic base-substitutions in NOTCH2, NSD1, PDE4DIP, and ATP10B and 1 insert frameshift mutation in BAP1 were validated by the Sanger method at the transcriptional level. A 13-amino acids neo-peptide of the truncated Bap1 protein, which was produced as a result of this novel frameshift mutation, was predicted to be presented by this patient’s HLA-B protein. The polyclonal antibody of the synthesized 13-mer neo-peptide was produced in rabbits. Western blotting results showed a good antibody-neoantigen specificity, and Immunohistochemistry (IHC) staining with the antibody of the neo-peptide clearly differentiated neoplastic cells from normal cells. A search of the Catalogue of Somatic Mutations in Cancer (COSMIC) database also revealed that 53.2% of mutations in BAP1 were frameshift indels with neo-peptide formation. An identified tumor-specific neo-antigen could be the potential molecular biomarker for personalized diagnosis to precisely subtype rare malignancies such as MPM. PMID:27187383

  19. A Tumor-Specific Neo-Antigen Caused by a Frameshift Mutation in BAP1 Is a Potential Personalized Biomarker in Malignant Peritoneal Mesothelioma.

    PubMed

    Lai, Jun; Zhou, Zhan; Tang, Xiao-Jing; Gao, Zhi-Bin; Zhou, Jie; Chen, Shu-Qing

    2016-01-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive rare malignancy associated with asbestos exposure. A better understanding of the molecular pathogenesis of MPM will help develop a targeted therapy strategy. Oncogene targeted depth sequencing was performed on a tumor sample and paired peripheral blood DNA from a patient with malignant mesothelioma of the peritoneum. Four somatic base-substitutions in NOTCH2, NSD1, PDE4DIP, and ATP10B and 1 insert frameshift mutation in BAP1 were validated by the Sanger method at the transcriptional level. A 13-amino acids neo-peptide of the truncated Bap1 protein, which was produced as a result of this novel frameshift mutation, was predicted to be presented by this patient's HLA-B protein. The polyclonal antibody of the synthesized 13-mer neo-peptide was produced in rabbits. Western blotting results showed a good antibody-neoantigen specificity, and Immunohistochemistry (IHC) staining with the antibody of the neo-peptide clearly differentiated neoplastic cells from normal cells. A search of the Catalogue of Somatic Mutations in Cancer (COSMIC) database also revealed that 53.2% of mutations in BAP1 were frameshift indels with neo-peptide formation. An identified tumor-specific neo-antigen could be the potential molecular biomarker for personalized diagnosis to precisely subtype rare malignancies such as MPM. PMID:27187383

  20. Whole-exome sequencing identifies a novel homozygous frameshift mutation in the PROM1 gene as a causative mutation in two patients with sporadic retinitis pigmentosa.

    PubMed

    Liu, Sanmei; Xie, Lan; Yue, Jun; Ma, Tao; Peng, Chunyan; Qiu, Biyuan; Yang, Zhenglin; Yang, Jiyun

    2016-06-01

    Retinitis pigmentosa (RP) refers to a heterogeneous group of inherited retinal diseases caused by the loss of photoreceptors. The present study aimed to identify the gene mutations responsible for RP in two patients diagnosed with sporadic RP using next-generation sequencing technology. For this purpose, two patients with sporadic RP and family members (namely parents and siblings) were recruited into this study and underwent a complete ophthalmological assessment. Whole-exome sequencing (WES) was performed on genomic DNA samples isolated from peripheral leukocytes which had been obtained from the two patients diagnosed with sporadic RP. WES data were annotated and filtered against four public databases and one in-house database. Subsequently, Sanger sequencing was performed in order to determine whether any of the candidate variants co-segregated with the disease phenotype in the families. A homozygous frameshift mutation, c.1445dupT (p.F482fs) in exon 12 of the PROM1 gene (MIM: 604365), satisfied a recessive inheritance model and showed complete co-segregation of the mutation with the disease phenotype in the families. The same mutation was not detected in the 200 ethnically-matched control samples by Sanger sequencing. The novel homozygous mutation c.1445dupT (p.F482fs) in the PROM1 gene was identified as a causative mutation for RP. Thus, the identification of this mutation has further expanded the existing spectrum of PROM1 mutations in patients with RP, thereby assisting in the molecular diagnosis of RP and enhancing our understanding of genotype-phenotype correlations in order to provide effective genetic counseling. PMID:27082927

  1. Whole-exome sequencing identifies a novel homozygous frameshift mutation in the PROM1 gene as a causative mutation in two patients with sporadic retinitis pigmentosa

    PubMed Central

    LIU, SANMEI; XIE, LAN; YUE, JUN; MA, TAO; PENG, CHUNYAN; QIU, BIYUAN; YANG, ZHENGLIN; YANG, JIYUN

    2016-01-01

    Retinitis pigmentosa (RP) refers to a heterogeneous group of inherited retinal diseases caused by the loss of photoreceptors. The present study aimed to identify the gene mutations responsible for RP in two patients diagnosed with sporadic RP using next-generation sequencing technology. For this purpose, two patients with sporadic RP and family members (namely parents and siblings) were recruited into this study and underwent a complete ophthalmological assessment. Whole-exome sequencing (WES) was performed on genomic DNA samples isolated from peripheral leukocytes which had been obtained from the two patients diagnosed with sporadic RP. WES data were annotated and filtered against four public databases and one in-house database. Subsequently, Sanger sequencing was performed in order to determine whether any of the candidate variants co-segregated with the disease phenotype in the families. A homozygous frameshift mutation, c.1445dupT (p.F482fs) in exon 12 of the PROM1 gene (MIM: 604365), satisfied a recessive inheritance model and showed complete co-segregation of the mutation with the disease phenotype in the families. The same mutation was not detected in the 200 ethnically-matched control samples by Sanger sequencing. The novel homozygous mutation c.1445dupT (p.F482fs) in the PROM1 gene was identified as a causative mutation for RP. Thus, the identification of this mutation has further expanded the existing spectrum of PROM1 mutations in patients with RP, thereby assisting in the molecular diagnosis of RP and enhancing our understanding of genotype-phenotype correlations in order to provide effective genetic counseling. PMID:27082927

  2. A novel frameshift mutation in FGF14 causes an autosomal dominant episodic ataxia.

    PubMed

    Choquet, Karine; La Piana, Roberta; Brais, Bernard

    2015-07-01

    Episodic ataxias (EAs) are a heterogeneous group of neurological disorders characterized by recurrent attacks of ataxia. Mutations in KCNA1 and CACNA1A account for the majority of EA cases worldwide. We recruited a two-generation family affected with EA of unknown subtype and performed whole-exome sequencing on two affected members. This revealed a novel heterozygous mutation c.211_212insA (p.I71NfsX27) leading to a premature stop codon in FGF14. Mutations in FGF14 are known to cause spinocerebellar ataxia type 27 (SCA27). Sanger sequencing confirmed segregation within the family. Our findings expand the phenotypic spectrum of SCA27 by underlining the possible episodic nature of this ataxia. PMID:25566820

  3. Phase variation of gonococcal pili by frameshift mutation in pilC, a novel gene for pilus assembly.

    PubMed Central

    Jonsson, A B; Nyberg, G; Normark, S

    1991-01-01

    Pili prepared from Neisseria gonorrhoeae contain minor amounts of a 110 kd outer membrane protein denoted PilC. The corresponding gene exists in two copies, pilC1 and pilC2, in most strains of N.gonorrhoeae. In the piliated strain MS11(P+), only one of the genes, pilC2, was expressed. Inactivation of pilC2 by a mTnCm insertion resulted in a nonpiliated phenotype, while a mTnCm insertion in pilC1 had no effect on piliation. Expression of pilC was found to be controlled at the translational level by frameshift mutations in a run of G residues positioned in the region encoding the signal peptide. Nonpilated (P-), pilin expressing colony variants that did not express detectable levels of PilC were selected; all P+ backswitchers from these P-, PilC- clones were found to be PilC+. The structural gene for pilin, pilE, was sequenced and found to be identical in one P-, PilC- and P+, PilC+ pair. Most PilC- cells were completely bald whereas the PilC+ backswitcher had 10-40 pili per cell. Thus, a turn ON and turn OFF in the expression of PilC results in gonococcal pili phase variation. These results suggest that PilC is required for pilus assembly and/or translocation across the gonococcal outer membrane. Images PMID:1671354

  4. A de novo frameshift mutation in chromodomain helicase DNA-binding domain 8 (CHD8): A case report and literature review.

    PubMed

    Merner, Nancy; Forgeot d'Arc, Baudouin; Bell, Scott C; Maussion, Gilles; Peng, Huashan; Gauthier, Julie; Crapper, Liam; Hamdan, Fadi F; Michaud, Jacques L; Mottron, Laurent; Rouleau, Guy A; Ernst, Carl

    2016-05-01

    Mutations in chromodomain helicase DNA-binding domain 8 (CHD8) have been identified in independent genotyping studies of autism spectrum disorder. To better understand the phenotype associated with CHD8 mutations, we genotyped all CHD8 exons in carefully assessed cohorts of autism (n = 142), schizophrenia (SCZ; n = 143), and intellectual disability (ID; n = 94). We identified one frameshift mutation, seven non-synonymous variants, and six synonymous variants. The frameshift mutation, p.Asn2092Lysfs*2, which creates a premature stop codon leading to the loss of 212 amino acids of the protein, was from an autism case on whom we present multiple clinical assessments and pharmacological treatments spanning more than 10 years. RNA and protein analysis support a model where the transcript generated from the mutant allele results in haploinsufficiency of CHD8. This case report supports the association of CHD8 mutations with classical autism, macrocephaly, infantile hypotonia, speech delay, lack of major ID, and psychopathology in late adolescence caused by insufficient dosage of CHD8. Review of 16 other CHD8 mutation cases suggests that clinical features and their severity vary considerably across individuals; however, these data support a CHD8 mutation syndrome, further highlighting the importance of genomic medicine to guide clinical assessment and treatment. PMID:26789910

  5. NF1 frameshift mutation (c.6520_6523delGAGA) association with nervous system tumors and bone abnormalities in a Chinese patient with neurofibromatosis type 1.

    PubMed

    Su, S Y; Zhou, X; Pang, X M; Chen, C Y; Li, S H; Liu, J L

    2016-01-01

    Neurofibromatosis type 1, also known as NF1 or von Recklinghausen's disease, is a common neurocutaneous syndrome that presents with multiple café-au-lait patches, skinfold freckling, dermatofibromas, neurofibromas, and Lisch nodules. The mutations of the gene NF1, encoding the protein neurofibromin, have been identified as the cause of this disease. Here, we report a clinical and molecular study of a Chinese patient with multiple café-au-lait skin freckles, dermatofibroma, central and peripheral nervous system tumors, and bone abnormalities attributed to NF1. The patient showed >6 café-au-lait spots on the body and multiple dermatofibromas. A brain glioma and multiple nerve sheath tumors inside and outside the vertebral canal were identified by magnetic resonance imaging, which also showed multiple intercostal nerve schwannomas and hydrocephalies above the cerebellar tentorium. Talipes equinus was also apparent. A mutation analysis of the NF1 gene revealed a novel frameshift mutation in exon 43, consisting of a heterozygous deletion of four nucleotides (GAGA) between positions 6520 and 6523. No NF1 mutations were detected in the patient's parents or younger brother. These results extend the list of known mutations in this gene. The absence of the NF1 mutation in the healthy family members suggests that it is responsible for the NF1 phenotype. To our knowledge, this frameshift mutation represents a novel NF1 case, and may be associated with nervous system tumors and bone abnormalities. PMID:27173220

  6. Homozygous frameshift mutation in TMCO1 causes a syndrome with craniofacial dysmorphism, skeletal anomalies, and mental retardation

    PubMed Central

    Xin, Baozhong; Puffenberger, Erik G.; Turben, Susan; Tan, Haiyan; Zhou, Aimin; Wang, Heng

    2009-01-01

    We identified an autosomal recessive condition in 11 individuals in the Old Order Amish of northeastern Ohio. The syndrome was characterized by distinctive craniofacial dysmorphism, skeletal anomalies, and mental retardation. The typical craniofacial dysmorphism included brachycephaly, highly arched bushy eyebrows, synophrys, long eyelashes, low-set ears, microdontism of primary teeth, and generalized gingival hyperplasia, whereas Sprengel deformity of scapula, fusion of spine, rib abnormities, pectus excavatum, and pes planus represented skeletal anomalies. The genome-wide homozygosity mapping using six affected individuals localized the disease gene to a 3.3-Mb region on chromosome 1q23.3-q24.1. Candidate gene sequencing identified a homozygous frameshift mutation, c.139_140delAG, in the transmembrane and coiled-coil domains 1 (TMCO1) gene, as the pathogenic change in all affected members of the extended pedigree. This mutation is predicted to result in a severely truncated protein (p.Ser47Ter) of only one-fourth the original length. The TMCO1 gene product is a member of DUF841 superfamily of several eukaryotic proteins with unknown function. The gene has highly conserved amino acid sequence and is universally expressed in all human tissues examined. The high degree of conservation and the ubiquitous expression pattern in human adult and fetal tissues suggest a critical role for TMCO1. This report shows a TMCO1 sequence variant being associated with a genetic disorder in human. We propose “TMCO1 defect syndrome” as the name of this condition. PMID:20018682

  7. Hereditary desmoid disease due to a frameshift mutation at codon 1924 of the APC gene.

    PubMed Central

    Eccles, D. M.; van der Luijt, R.; Breukel, C.; Bullman, H.; Bunyan, D.; Fisher, A.; Barber, J.; du Boulay, C.; Primrose, J.; Burn, J.; Fodde, R.

    1996-01-01

    Desmoid tumors are slowly growing fibrous tumors highly resistant to therapy and often fatal. Here, we report hereditary desmoid disease (HDD), a novel autosomal dominant trait with 100% penetrance affecting a three-generation kindred. Desmoid tumors are usually a complication of familial adenomatous polyposis, a predisposition to the early development of premalignant adenomatous polyps in the colorectum due to chain-terminating mutations of the APC gene. In general, one or more members in approximately 10% of the FAP families manifest desmoid tumors. Affected individuals from the HDD kindred are characterized by multifocal fibromatosis of the paraspinal muscles, breast, occiput, arms, lower ribs, abdominal wall, and mesentery. Osteomas, epidermal cysts, and other congenital features were also observed. We show that HDD segregates with an unusual germ-line chain-terminating mutation at the 3' end of the APC gene (codon 1924) with somatic loss of the wild-type allele leading to tumor development. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:8940264

  8. Postmortem diagnosis of Marfan syndrome in a case of sudden death due to aortic rupture: Detection of a novel FBN1 frameshift mutation.

    PubMed

    Wang, Yunyun; Chen, Shu; Wang, Rongshuai; Huang, Sizhe; Yang, Mingzhen; Liu, Liang; Liu, Qian

    2016-04-01

    To investigate the sudden death of a 36-year-old Chinese man, a medicolegal autopsy was performed, combining forensic pathological examinations and genetic sequencing analysis to diagnose the cause of death. Genomic DNA samples were extracted from blood and subjected to high-throughput sequencing. Major findings included a dilated aortic root with a ruptured and dissected aorta and consequent tamponade of the pericardial sac. Moreover, arachnodactyly and other skeletal deformities were noted. By sequencing the fibrillin-1 gene (FBN1), five genetic variations were found, including four previously known single nucleotide polymorphisms (SNPs) and a novel frameshift mutation, leading to the diagnosis of Marfan syndrome. The frameshift mutation (c.4921delG, p.glu1641llysFsX9) detected in exon 40 led to a stop codon after the next 8 amino acids. The four SNPs included a splice site mutation (c.3464-5 G>A, rs11853943), a synonymous mutation (p.Asn625Asn, rs25458), and two missense mutations (p.Pro1148Ala, rs140598; p.Cys472Tyr, rs4775765). Genetic screening was recommended for the relatives as it was reported that the father and brother of the deceased had died at the ages of 40 and 25, respectively, from sudden cardiac failure. The son of the deceased lacked the relevant mutations. This report emphasizes the important contribution of medicolegal postmortem analysis on the molecular pathogenesis study of Marfan syndrome and early diagnosis of at-risk relatives. PMID:26905825

  9. Seven, eight and nine-membered anticodon loop mutants of tRNA(2Arg) which cause +1 frameshifting. Tolerance of DHU arm and other secondary mutations.

    PubMed

    Tuohy, T M; Thompson, S; Gesteland, R F; Atkins, J F

    1992-12-20

    The mutant tRNA(2Arg) encoded by the genetically-selected frameshift suppressor, sufT621, inserts arginine and causes a +1 reading-frame shift at the proline codon, CCG(U). There is an extra base, G36.1, in argV beta, one of the four identical genes for tRNA(2Arg) in the position between bases 36 and 37, corresponding to the 3' side of the anticodon. The new four-base anticodon, predicted from DNA sequencing to be 3' GGCA 5', is complementary to the four-base codon CCGU. Quadruplet translocation promoted by mutant argV does not require perfect complementarity between the codon and the anticodon since synthetic genes encoding derivatives of tRNA(2Arg) and tRNA(1Pro), with four-base anticodons complementary to three out of the four bases of CCGU, were also shown to be capable of frameshifting. Two other mutants of argV, inferred to have normal-size, seven-base anticodon loops, were also found to be capable of four-base-decoding demonstrating that quadruplet translocation promoted by mutant argV does not require an enlarged anticodon loop. Other alleles of argV, predicted to have nine bases in the anticodon loop, were also found to cause frameshifting. The DNA sequence of two of these showed in addition, either a deletion of G24, or a ten-base duplication in the region corresponding to the TFC arm. A general finding is that mutations in the DHU arm of tRNA(2Arg) are compatible with, and in one case necessary for, frameshifting. PMID:1474576

  10. Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa

    PubMed Central

    Karuthedath Vellarikkal, Shamsudheen; Jayarajan, Rijith; Verma, Ankit; Nair, Sreelata; Ravi, Rowmika; Senthivel, Vigneshwar; Sivasubbu, Sridhar; Scaria, Vinod

    2016-01-01

    Dystrophic epidermolysis bullosa simplex (DEB) is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB) is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES). Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India. PMID:27408687

  11. [Mechanisms of targeted frameshift mutations--insertion formation under error-prone or SOS synthesis of DNA containing CIS-SYN cyncyclobutane thymine dimers].

    PubMed

    Grebneva, E A

    2014-01-01

    Up to now the mechanism of formation of frameshift mutations caused by cyclobutane pyrimidine dimers has not been yet explained satisfactorily. Mechanisms of different mutations are usually considered in polymerase model. Here, the alternative polymerase-tautomer model of ultraviolet mutagenesis is developed. The mechanism of targeted insertion formation caused by cis-syn cyclobutane thymine dimers is proposed. Insertions are mutations when one or several DNA bases are inserted.Targeted insertions are mutations of a frameshift type--when one or severalnucleotides are inserted opposite damageswhich may stop synthesis of DNA. Targeted insertions are induced bycyclobutane pyrimidine dimmers. Ultraviolet irradiation may result in a change of tautomer state of DNA bases. A thymine base may form 5 rare tautomer forms that are stable if the base is a part of cyclobutane dimer. As it was shown by structural analysis, one rare tautomeric form of thymine forms hydrogen bonds with no one canonical DNA base. Therefore, under SOS or error-prone synthesis of DNA containing cis-syn cyclobutane thymine dimers with such rare tautomeric_form a specialize or modified DNA polymerase leaves a single nucleotide gap opposite the cis-syn cyclobutane thymine dimer. According to Streisinger model, if the DNA composition within this region is homogeneous, the end of the growing DNA strand can slip and form complementary pairs with a template nucleotide neighboring to the dimer of such type a loop is formed. Further elongation of the daughter strand leads to the appearance of targeted insertion in the daughter strand. Here, it is first shown that cis-syn cyclobutane thymine dimers with one or both bases in the specific tautomer conformation--opposite which it is impossible to insert a canonical base with a hydrogen bond formation--results in targeted insertions. Moreover, the model of forming targeted single--and several-base insertions is developed. The polymerase-tautomer model of

  12. Exome sequencing identifies a novel frameshift mutation of MYO6 as the cause of autosomal dominant nonsyndromic hearing loss in a Chinese family.

    PubMed

    Cheng, Jing; Zhou, Xueya; Lu, Yu; Chen, Jing; Han, Bing; Zhu, Yuhua; Liu, Liyang; Choy, Kwong-Wai; Han, Dongyi; Sham, Pak C; Zhang, Michael Q; Zhang, Xuegong; Yuan, Huijun

    2014-11-01

    Autosomal dominant types of nonsyndromic hearing loss (ADNSHL) are typically postlingual in onset and progressive. High genetic heterogeneity, late onset age, and possible confounding due to nongenetic factors hinder the timely molecular diagnoses for most patients. In this study, exome sequencing was applied to investigate a large Chinese family segregating ADNSHL in which we initially failed to find strong evidence of linkage to any locus by whole-genome linkage analysis. Two affected family members were selected for sequencing. We identified two novel mutations disrupting known ADNSHL genes and shared by the sequenced samples: c.328C>A in COCH (DFNA9) resulting in a p.Q110K substitution and a deletion c. 2814_2815delAA in MYO6 (DFNA22) causing a frameshift alteration p.R939Tfs*2. The pathogenicity of novel coding variants in ADNSHL genes was carefully evaluated by analysis of co-segregation with phenotype in the pedigree and in light of established genotype-phenotype correlations. The frameshift deletion in MYO6 was confirmed as the causative variant for this pedigree, whereas the missense mutation in COCH had no clinical significance. The results allowed us to retrospectively identify the phenocopy in one patient that contributed to the negative finding in the linkage scan. Our clinical data also supported the emerging genotype-phenotype correlation for DFNA22. PMID:25227905

  13. Phenotypic variability in a seven-generation Swedish family segregating autosomal dominant hearing impairment due to a novel EYA4 frameshift mutation.

    PubMed

    Frykholm, Carina; Klar, Joakim; Arnesson, Hanna; Rehnman, Anna-Carin; Lodahl, Marianne; Wedén, Ulla; Dahl, Niklas; Tranebjærg, Lisbeth; Rendtorff, Nanna D

    2015-05-25

    Linkage to an interval overlapping the DFNA10 locus on chromosome 6q22-23 was found through genome wide linkage analysis in a seven-generation Swedish family segregating postlingual, autosomal dominant nonsyndromic sensorineural hearing impairment. A novel heterozygous frame-shift mutation (c.579_580insTACC, p.(Asp194Tyrfs*52)) in EYA4 was identified that truncates the so-called variable region of the protein. The mutation is predicted to result in haploinsufficiency of the EYA4 product. No evidence for dilated cardiomyopathy was found in the family, contrasting to a previous family with a deletion resulting in a similar truncation in the variable region. A highly variable age of onset was seen in the mutation carriers. For assessment of the aetiology of this variability, clinical and audiometric data analyses were performed. The affected family members all had similar cross-sectional and longitudinal deterioration of pure tone average (PTA) once the process of hearing deterioration had started, and no gender, parent-of-origin or family branch differences on PTA could be found. Age at onset varied between the family branches. In summary, this is the ninth published genetically verified DFNA10 family. The results imply that unidentified factors, genetic or environmental, other than the EYA4 mutation, are of importance for the age at onset of DFNA10, and that mutation early in the variable region of the EYA4 protein can occur in the absence of dilated cardiomyopathy. PMID:25681523

  14. Clinical, cellular, and molecular features of an Israeli xeroderma pigmentosum family with a frameshift mutation in the XPC gene: sun protection prolongs life.

    PubMed

    Slor, H; Batko, S; Khan, S G; Sobe, T; Emmert, S; Khadavi, A; Frumkin, A; Busch, D B; Albert, R B; Kraemer, K H

    2000-12-01

    An Ashkenazi Jewish Israeli family with two children affected with severe xeroderma pigmentosum was investigated. A son, XP12TA, developed skin cancer at 2 y and died at 10 y. A daughter, XP25TA, now 24 y old, was sun protected and began developing skin cancers at 10 y. Their cultured skin fibroblasts showed reductions in post-ultraviolet survival (11% of normal), unscheduled DNA synthesis (10% of normal), global genome DNA repair (15% of normal), and plasmid host cell reactivation (5% of normal). Transcription-coupled DNA repair was normal, however. Northern blot analysis revealed greatly reduced xeroderma pigmentosum complementation group C mRNA. A plasmid host cell reactivation assay assigned the cells to xeroderma pigmentosum complementation group C. Cells from both parents and an unaffected child exhibited normal post-ultraviolet-C survival and normal DNA repair. Sequencing the xeroderma pigmentosum complementation group C cDNA of XP12TA and XP25TA revealed a homozygous deletion of two bases (del AT 669-670) in exon 5 with a new termination site 10 codons downstream that is expected to encode a truncated xeroderma pigmentosum complementation group C protein. Sequence analysis of the xeroderma pigmentosum complementation group C cDNA in cells from the parents found identical heterozygous mutations: one allele carries both the exon 5 frameshift and an exon 15 polymorphism and the other allele carries neither alteration. Cells from the unaffected brother had two normal xeroderma pigmentosum complementation group C alleles. This frameshift mutation in the xeroderma pigmentosum complementation group C gene led to reduced DNA repair with multiple skin cancers and early death. Sun protection delayed the onset of skin cancer and prolonged life in a sibling with the same mutation. PMID:11121128

  15. An exon-based comparative variant analysis pipeline to study the scale and role of frameshift and nonsense mutation in the human-chimpanzee divergence.

    PubMed

    Yu, GongXin

    2009-01-01

    Chimpanzees and humans are closely related but differ in many deadly human diseases and other characteristics in physiology, anatomy, and pathology. In spite of decades of extensive research, crucial questions about the molecular mechanisms behind the differences are yet to be understood. Here I report ExonVar, a novel computational pipeline for Exon-based human-chimpanzee comparative Variant analysis. The objective is to comparatively analyze mutations specifically those that caused the frameshift and nonsense mutations and to assess their scale and potential impacts on human-chimpanzee divergence. Genomewide analysis of human and chimpanzee exons with ExonVar identified a number of species-specific, exon-disrupting mutations in chimpanzees but much fewer in humans. Many were found on genes involved in important biological processes such as T cell lineage development, the pathogenesis of inflammatory diseases, and antigen induced cell death. A "less-is-more" model was previously established to illustrate the role of the gene inactivation and disruptions during human evolution. Here this analysis suggested a different model where the chimpanzee-specific exon-disrupting mutations may act as additional evolutionary force that drove the human-chimpanzee divergence. Finally, the analysis revealed a number of sequencing errors in the chimpanzee and human genome sequences and further illustrated that they could be corrected without resequencing. PMID:19859573

  16. Molecular characterization of WFS1 in an Iranian family with Wolfram syndrome reveals a novel frameshift mutation associated with early symptoms.

    PubMed

    Sobhani, Maryam; Tabatabaiefar, Mohammad Amin; Rajab, Asadollah; Kajbafzadeh, Abdol-Mohammad; Noori-Daloii, Mohammad Reza

    2013-10-10

    Wolfram syndrome (WS) is a rare autosomal recessive neurodegenerative disorder that represents a likely source of childhood diabetes especially among countries in the consanguinity belt. The main responsible gene is WFS1 for which over one hundred mutations have been reported from different ethnic groups. The aim of this study was to identify the molecular etiology of WS and to perform a possible genotype-phenotype correlation in Iranian kindred. An Iranian family with two patients was clinically studied and WS was suspected. Genetic linkage analysis via 5 STR markers was carried out. For identification of mutations, DNA sequencing of WFS1 including all the exons, exon-intron boundaries and the promoter was performed. Linkage analysis indicated linkage to the WFS1 region. After DNA sequencing of WFS1, one novel pathogenic mutation, which causes frameshift alteration c.2177_2178insTCTTC (or c.2173_2177dupTCTTC) in exon eight, was found. The genotype-phenotype correlation analysis suggests that the presence of the homozygous mutation may be associated with early onset of disease symptoms. This study stresses the necessity of considering the molecular analysis of WFS1 in childhood diabetes with some symptoms of WS. PMID:23845777

  17. Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1

    PubMed Central

    Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars; Rossing, Maria

    2016-01-01

    The increasing availability of genome-wide analysis has made it possible to rapidly sequence the exome of patients with undiagnosed or unresolved medical conditions. Here, we present the case of a 64-yr-old male patient with schistocytes in the peripheral blood smear and a complex and life-threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based on this finding, atypical hemolytic uremic syndrome was suspected because of a genetic predisposition, and a targeted treatment regime with eculizumab was initiated. Life-threatening hemostatic abnormalities would most likely have persisted had it not been for the implementation of whole-exome sequencing in this particular clinical setting. PMID:27551680

  18. The molecular pathology of progressive symmetric erythrokeratoderma: a frameshift mutation in the loricrin gene and perturbations in the cornified cell envelope.

    PubMed Central

    Ishida-Yamamoto, A; McGrath, J A; Lam, H; Iizuka, H; Friedman, R A; Christiano, A M

    1997-01-01

    The erythrokeratodermas (EKs) are a group of disorders characterized by erythematous plaques associated with variable features that include palmoplantar keratoderma. One type of EK is known as "progressive symmetric erythrokeratoderma" (PSEK). We studied members of a family of Japanese origin in which the index case with PSEK had had well-demarcated nonmigratory erythematous plaques on her extremities since birth. Sequence determination of the loricrin gene revealed an insertion of a C following nucleotide 709. The mutation results in a frameshift that changes the terminal 91 amino acids in the wild-type polypeptide into missense amino acids and adds 65 additional residues. This further implicates loricrin defects in the pathogenesis of disorders with palmoplantar keratoderma and pseudoainhum. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9326323

  19. The p.A897KfsX4 frameshift variation in desmocollin-2 is not a causative mutation in arrhythmogenic right ventricular cardiomyopathy

    PubMed Central

    De Bortoli, Marzia; Beffagna, Giorgia; Bauce, Barbara; Lorenzon, Alessandra; Smaniotto, Gessica; Rigato, Ilaria; Calore, Martina; Li Mura, Ilena E A; Basso, Cristina; Thiene, Gaetano; Lanfranchi, Gerolamo; Danieli, Gian Antonio; Nava, Andrea; Rampazzo, Alessandra

    2010-01-01

    Mutations in genes encoding desmosomal proteins have been reported to cause arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D), an autosomal-dominant disease characterised by progressive myocardial atrophy with fibro-fatty replacement. We screened 112 ARVC/D probands for mutations in desmocollin-2 (DSC2) gene and detected two different amino-acid substitutions (p.E102K, p.I345T) and a frameshift variation (p.A897KfsX4) in 7 (6.2%) patients. DSC2a variant p.A897KfsX4, previously reported as a p.E896fsX900 mutation, was identified in five unrelated probands. Four of them were found to carry one or two mutations in different ARVC/D genes. Unexpectedly, p.A897KfsX4 variation was also found in 6 (1.5%) out of 400 control chromosomes. In vitro functional studies showed that, unlike wild-type DSC2a, this C-terminal mutated protein was localised in the cytoplasm. p.A897KfsX4 variation affects the last five amino acids of the DSC2a isoform but not of DSC2b. In contrast with what we found in other human tissues, in the heart DSC2b is more expressed than DSC2a, suggesting that relative deficiency of DSC2a might be compensated by isoform b. In conclusion, DSC2 gene mutations are not frequently involved in ARVC/D. The p.A897KfsX4 variation, identified in several Italian healthy control subjects, which affects only one of the two DSC2 isoforms, may be considered a rare variant, though possibly affecting phenotypic expression of concomitant ARVC/D mutations. PMID:20197793

  20. fH-dependent complement evasion by disease-causing meningococcal strains with absent fHbp genes or frameshift mutations.

    PubMed

    Giuntini, Serena; Vu, David M; Granoff, Dan M

    2013-08-28

    Meningococci bind human fH to down-regulate complement, which enhances survival of the bacteria in serum. A major fH ligand is the vaccine candidate, factor H-binding protein (fHbp). Although fHbp has been considered an essential meningococcal virulence factor, rarely, invasive isolates with absent fHbp genes or frameshift mutations have been identified. In previous studies fH binding to these isolates was not detected. The aim of the present study was to investigate fH binding and complement evasion by invasive meningococcal serogroup B clinical isolates with absent fHbp genes or frameshift mutations. Four of the seven isolates tested bound human fH by flow cytometry and survived in IgG-depleted human serum. In all four, fH binding was decreased after inactivating the gene encoding NspA. Binding of fH to fHbp and NspA is specific for human fH. To investigate fH-dependent evasion of host defenses, human fH transgenic infant rats, or control littermates negative for human fH, were challenged IP with 10(3)-10(4)CFU of two of the isolates with no detectable fH binding by flow cytometry. At 6h, bacteremia caused by both strains was higher in human fH transgenic rats than in control rats (P<0.002). In conclusion, six of the seven isolates had evidence of fH binding and/or human fH-dependent complement evasion in transgenic rats. In four, NspA was as an alternative fH ligand. fHbp vaccination may select for mutants that do not require fHbp for complement evasion. Inclusion of additional target antigens in vaccines containing fHbp may delay emergence of these mutants. PMID:23791680

  1. Moderation of phenotypic severity in dystrophic and junctional forms of epidermolysis bullosa through in-frame skipping of exons containing non-sense or frameshift mutations.

    PubMed

    McGrath, J A; Ashton, G H; Mellerio, J E; Salas-Alanis, J C; Swensson, O; McMillan, J R; Eady, R A

    1999-09-01

    Non-sense mutations on both alleles of either the type VII collagen gene (COL7A1) or the genes encoding laminin 5 (LAMA3, LAMB3, or LAMC2) usually result in clinically severe forms of recessive dystrophic or junctional epidermolysis bullosa, respectively. In this study we assessed two unrelated families whose mutations in genomic DNA predicted severe recessive dystrophic epidermolysis bullosa or junctional epidermolysis bullosa phenotypes but in whom the manifestations were milder than expected. The recessive dystrophic epidermolysis bullosa patients had a homozygous single base-pair frameshift mutation in exon 19 of COL7A1 (2470insG). Clinically, there was generalized blistering but only mild scarring. Skin biopsy revealed positive type VII collagen immunoreactivity and recognizable anchoring fibrils. The junctional epidermolysis bullosa patients were compound heterozygotes for a frameshift/non-sense combination of mutations in exons 3 and 17 of LAMB3 (29insC/Q834X). These patients did not have the lethal form of junctional epidermolysis bullosa but, as adults, displayed the milder generalized atrophic benign epidermolysis bullosa variant. There was undetectable laminin 5 staining at the dermal-epidermal junction using an antibody to the beta3 chain, but faintly positive alpha3 and gamma2 chain labeling, and there was variable hypoplasia of hemidesmosomes. To explain the milder recessive dystrophic epidermolysis bullosa and junctional epidermolysis bullosa phenotypes in these families, reverse transcription-polymerase chain reaction, using RNA extracted from frozen skin, was able to provide evidence for some rescue of mutant mRNA transcripts with restoration of the open- reading frame. In the recessive dystrophic epidermolysis bullosa patients, transcripts containing in-frame skipping of exon 19 of COL7A1 in the cDNA were detected, and in the junctional epidermolysis bullosa patients transcripts with in-frame skipping of exon 17 of LAMB3 were identified. The

  2. Early Progressive Dilated Cardiomyopathy in a Family with Becker Muscular Dystrophy Related to a Novel Frameshift Mutation in the Dystrophin Gene Exon 27

    PubMed Central

    Tsuda, Takeshi; Fitzgerald, Kristi; Scavena, Mena; Gidding, Samuel; Cox, Mary O.; Marks, Harold; Flanigan, Kevin M.; Moore, Steven A.

    2014-01-01

    We report a family in which two male siblings with Becker muscular dystrophy (BMD) developed severe dilated cardiomyopathy (DCM) and progressive heart failure (HF) at age 11; one died at age 14 years while awaiting heart transplant and the other underwent left ventricular assist device (LVAD) implantation at the same age. Genetic analysis of one sibling showed a novel frameshift mutation in exon 27 of Duchenne muscular dystrophy (DMD) gene (c.3779_3785delCTTTGGAins GG), in which 7 base pairs are deleted and two are inserted. While this predicts an amino acid substitution and premature termination (p.Thr1260Argfs*8), muscle biopsy dystrophin immunostaining instead indicates that the mutation is more likely to alter splicing. Despite relatively preserved skeletal muscular performance, both siblings developed progressive heart failure secondary to early onset DCM. In addition, their 7 year old nephew with delayed gross motor development, mild proximal muscle weakness, and markedly elevated serum creatine kinase (CK) level (> 13,000 IU/L) at 16 months was recently demonstrated to have the familial DMD mutation. Here we report a novel genotype of BMD with early onset DCM and progressive lethal heart failure during early adolescence. PMID:25537791

  3. MUTATION SPECTRA OF GLU-P-1 IN SALMONELLA: INDUCTION OF HOTSPOT FRAMESHIFTS AND SITE-SPECIFIC BASE SUBSTITUTIONS

    EPA Science Inventory

    The mutations induced in approximately 2,000 mutants of Salmonella by the heterocyclic@ amine Glu-P-1 were determined by colony probe hybridization and PCR/DNA sequence analysis. ll of the mutations were at sites containing guanine, which is the base at which Glu-P-1 forms DNA ad...

  4. Identification of a novel SBF2 frameshift mutation in charcot-marie-tooth disease type 4B2 using whole-exome sequencing.

    PubMed

    Chen, Meiyan; Wu, Jing; Liang, Ning; Tang, Lihui; Chen, Yanhua; Chen, Huishuang; Wei, Wei; Wei, Tianying; Huang, Hui; Yi, Xin; Qi, Ming

    2014-10-01

    Charcot-Marie-Tooth disease type 4B2 with early-onset glaucoma (CMT4B2, OMIM 604563) is a genetically-heterogeneous childhood-onset neuromuscular disorder. Here, we report the case of a 15-year-old male adolescent with lower extremity weakness, gait abnormalities, foot deformities and early-onset glaucoma. Since clinical diagnosis alone was insufficient for providing pathogenetic evidence to indicate that the condition belonged to a consanguineous family, we applied whole-exome sequencing to samples from the patient, his parents and his younger brother, assuming that the patient's condition is transmitted in an autosomal recessive pattern. A frame-shift mutation, c.4571delG (P.Gly1524Glufs∗42), was revealed in the CMT4B2-related gene SBF2 (also known as MTMR13, MIM 607697), and this mutation was found to be homozygous in the proband and heterozygous in his parents and younger brother. Together with the results of clinical diagnosis, this case was diagnosed as CMT4B2. Our finding further demonstrates the use of whole-exome sequencing in the diagnosis and treatment of rare diseases. PMID:25462154

  5. A patient with a unique frameshift mutation in GPC3, causing Simpson-Golabi-Behmel syndrome, presenting with craniosynostosis, penoscrotal hypospadias, and a large prostatic utricle.

    PubMed

    Villarreal, Diana D; Villarreal, Humberto; Paez, Ana Maria; Peppas, Dennis; Lynch, Jane; Roeder, Elizabeth; Powers, George C

    2013-12-01

    We present a Hispanic male with the clinical and molecular diagnosis of Simpson-Golabi-Behmel syndrome (SGBS). The patient was born with multiple anomalies not entirely typical of SGBS patients, including penoscrotal hypospadias, a large prostatic utricle, and left coronal craniosynostosis. In addition, he demonstrated endocrine anomalies including a low random cortisol level suspicious for adrenal insufficiency and low testosterone level. To our knowledge, this is the first report of a prostatic utricle in SGBS and the second report of craniosynostosis. The unique disease-causing mutation likely arose de novo in the mother. It is a deletion-insertion that leads to a frameshift at the p.p. S359 [corrected] residue of GPC3 and a premature stop codon after five more amino acids. p. S359 [corrected] is the same residue that is normally cleaved by the Furin convertase, although the significance of this novel mutation with respect to the patient's multiple anomalies is unknown. We present this case as the perinatal course of a patient with unique features of SGBS and a confirmed molecular diagnosis. PMID:24115482

  6. A frameshift mutation in golden retriever dogs with progressive retinal atrophy endorses SLC4A3 as a candidate gene for human retinal degenerations.

    PubMed

    Downs, Louise M; Wallin-Håkansson, Berit; Boursnell, Mike; Marklund, Stefan; Hedhammar, Åke; Truvé, Katarina; Hübinette, Louise; Lindblad-Toh, Kerstin; Bergström, Tomas; Mellersh, Cathryn S

    2011-01-01

    Progressive retinal atrophy (PRA) in dogs, the canine equivalent of retinitis pigmentosa (RP) in humans, is characterised by vision loss due to degeneration of the photoreceptor cells in the retina, eventually leading to complete blindness. It affects more than 100 dog breeds, and is caused by numerous mutations. RP affects 1 in 4000 people in the Western world and 70% of causal mutations remain unknown. Canine diseases are natural models for the study of human diseases and are becoming increasingly useful for the development of therapies in humans. One variant, prcd-PRA, only accounts for a small proportion of PRA cases in the Golden Retriever (GR) breed. Using genome-wide association with 27 cases and 19 controls we identified a novel PRA locus on CFA37 (p(raw) = 1.94×10(-10), p(genome) = 1.0×10(-5)), where a 644 kb region was homozygous within cases. A frameshift mutation was identified in a solute carrier anion exchanger gene (SLC4A3) located within this region. This variant was present in 56% of PRA cases and 87% of obligate carriers, and displayed a recessive mode of inheritance with full penetrance within those lineages in which it segregated. Allele frequencies are approximately 4% in the UK, 6% in Sweden and 2% in France, but the variant has not been found in GRs from the US. A large proportion of cases (approximately 44%) remain unexplained, indicating that PRA in this breed is genetically heterogeneous and caused by at least three mutations. SLC4A3 is important for retinal function and has not previously been associated with spontaneously occurring retinal degenerations in any other species, including humans. PMID:21738669

  7. Localized frameshift mutation generates selective, high-frequency phase variation of a surface lipoprotein encoded by a mycoplasma ABC transporter operon.

    PubMed Central

    Theiss, P; Wise, K S

    1997-01-01

    The wall-less mycoplasmas have revealed unusual microbial strategies for adaptive variation of antigenic membrane proteins exposed during their surface colonization of host cells. In particular, high-frequency mutations affecting the expression of selected surface lipoproteins have been increasingly documented for this group of organisms. A novel manifestation of mutational phase variation is shown here to occur in Mycoplasma fermentans, a chronic human infectious agent and possible AIDS-associated pathogen. A putative ABC type transport operon encoding four gene products is identified. The 3' distal gene encoding P78, a known surface-exposed antigen and the proposed substrate-binding lipoprotein of the transporter, is subject to localized hypermutation in a short homopolymeric tract of adenine residues located in the N-terminal coding region of the mature product. High-frequency, reversible insertion/deletion frameshift mutations lead to selective phase variation in P78 expression, whereas the putative nucleotide-binding protein, P63, encoded by the most 5' gene of the operon, is continually expressed. Mutation-based phase variation in specific surface-exposed microbial transporter components may provide an adaptive advantage for immune evasion, while continued expression of other elements of the same transporter may preserve essential metabolic functions and confer alternative substrate specificity. These features could be critical in mycoplasmas, where limitations in both transcriptional regulators and transport systems may prevail. This study also documents that P63 contains an uncharacteristic hydrophobic sequence between predicted nucleotide binding motifs and displays an amphiphilic character in detergent fractionation. Both features are consistent with an evolutionary adaptation favoring integral association of this putative energy-transducing component with the single mycoplasma membrane. PMID:9190819

  8. A novel frameshift mutation of POU4F3 gene associated with autosomal dominant non-syndromic hearing loss

    SciTech Connect

    Lee, Hee Keun; Park, Hong-Joon; Lee, Kyu-Yup; Park, Rekil; Kim, Un-Kyung

    2010-06-04

    Autosomal dominant mutations in the transcription factor POU4F3 gene are associated with non-syndromic hearing loss in humans; however, there have been few reports of mutations in this gene worldwide. We performed a mutation analysis of the POU4F3 gene in 42 unrelated Koreans with autosomal dominant non-syndromic hearing loss, identifying a novel 14-bp deletion mutation in exon 2 (c.662del14) in one patient. Audiometric examination revealed severe bilateral sensorineural hearing loss in this patient. The novel mutation led to a truncated protein that lacked both functional POU domains. We further investigated the functional distinction between wild-type and mutant POU4F3 proteins using in vitro assays. The wild-type protein was completely localized in the nucleus, while the truncation of protein seriously affected its nuclear localization. In addition, the mutant failed to activate reporter gene expression. This is the first report of a POU4F3 mutation in Asia, and moreover our data suggest that further investigation will need to delineate ethnicity-specific genetic background for autosomal dominant non-syndromic hearing loss within Asian populations.

  9. Novel frameshift mutation in the CACNA1A gene causing a mixed phenotype of episodic ataxia and familiar hemiplegic migraine.

    PubMed

    Kinder, S; Ossig, C; Wienecke, M; Beyer, A; von der Hagen, M; Storch, A; Smitka, M

    2015-01-01

    Episodic ataxia type 2 (EA2, MIM#108500) is the most common form of EA and an autosomal-dominant inherited disorder characterized by paroxysmal episodes of ataxia. The disease causative gene CACNA1A encodes for the alpha 1A subunit of the voltage-gated P/Q-type calcium channel. We report on a family with a novel mutation in the CACNA1A gene. The clinical symptoms within the family varied from the typical clinical presentation of EA2 with dysarthria, gait ataxia and oculomotor symptoms to migraine and dystonia. A novel nonsense mutation of the CACNA1A gene was identified in all affected family members and is most likely the disease causing molecular defect. The pharmacological treatment with acetazolamide (AAA) was successful in three family members so far. Treatment with AAA led to a reduction of migraine attacks and an improvement of the dystonia. This relationship confirmed the hypothesis that this novel mutation results in a heterogeneous phenotype and confutes the coincidence with common migraine. Dystonia is potentially included as a further part of the phenotype spectrum of CACNA1A gene mutations. PMID:25468264

  10. A frameshift mutation in the pre-S region of the human hepatitis B virus genome allows production of surface antigen particles but eliminates binding to polymerized albumin.

    PubMed Central

    Persing, D H; Varmus, H E; Ganem, D

    1985-01-01

    The coding region for the major polypeptide (p24S) of hepatitis B surface antigen (HBsAg) is preceded by an in-phase open reading frame termed pre-S. The coding potential of the pre-S region was examined in mouse L cells transformed with cloned hepatitis B virus DNA. Such cells produce three HBsAg-related polypeptides of Mr 24,000, 27,000, and 35,000 organized into complex particles of 22 nm diameter. These HBsAg particles bind to polymerized human albumin, but not to polyalbumins of several other species. In contrast, cells transformed with hepatitis B virus DNA bearing a frameshift mutation near the 3' end of the pre-S region secrete immunoreactive HBsAg particles containing only the 24,000 and 27,000 Mr species. These mutant particles, which lack the 35,000 Mr species, are unable to bind polymerized human albumin. These studies indicate that the pre-S region encodes the 35,000 Mr species, that this product accounts for the known polyalbumin-binding activity of HBsAg but is not required for assembly and secretion of HBsAg 22-nm particles, and that the major polypeptide of HBsAg is not derived primarily by cleavage of larger precursors encoded by the pre-S region. Images PMID:3858831

  11. Whole-exome analysis of foetal autopsy tissue reveals a frameshift mutation in OBSL1, consistent with a diagnosis of 3-M Syndrome

    PubMed Central

    2015-01-01

    Background We report a consanguineous couple that has experienced three consecutive pregnancy losses following the foetal ultrasound finding of short limbs. Post-termination examination revealed no skeletal dysplasia, but some subtle proximal limb shortening in two foetuses, and a spectrum of mildly dysmorphic features. Karyotype was normal in all three foetuses (46, XX) and comparative genomic hybridization microarray analysis detected no pathogenic copy number variants. Results Whole-exome sequencing and genome-wide homozygosity mapping revealed a previously reported frameshift mutation in the OBSL1 gene (c.1273insA p.T425nfsX40), consistent with a diagnosis of 3-M Syndrome 2 (OMIM #612921), which had not been anticipated from the clinical findings. Conclusions Our study provides novel insight into the early clinical manifestations of this form of 3-M syndrome, and demonstrates the utility of whole exome sequencing as a tool for prenatal diagnosis in particular when there is a family history suggestive of a recurrent set of clinical symptoms. PMID:25923536

  12. Exome sequencing identifies a de novo frameshift mutation in the imprinted gene ZDBF2 in a sporadic patient with Nasopalpebral Lipoma-coloboma syndrome.

    PubMed

    Chacón-Camacho, Oscar F; Sobreira, Nara; You, Jing; Piña-Aguilar, Raul E; Villegas-Ruiz, Vanessa; Zenteno, Juan C

    2016-07-01

    Nasopalpebral lipoma-coloboma syndrome (NPLCS, OMIM%167730) is an uncommon malformation entity with autosomal dominant inheritance characterized by the combination of nasopalpebral lipoma, colobomas in upper and lower eyelids, telecanthus, and maxillary hypoplasia. To date, no genetic defects have been associated with familial or sporadic NPLCS cases and the etiology of the disease remains unknown. In this work, the results of whole exome sequencing in a sporadic NPLCS patient are presented. Exome sequencing identified a de novo heterozygous frameshift dinucleotide insertion c.6245_6246 insTT (p.His2082fs*67) in ZDBF2 (zinc finger, DBF-type containing 2), a gene located at 2q33.3. This variant was absent in parental DNA, in a set of 300 ethnically matched controls, and in public exome variant databases. This is the first genetic variant identified in a NPLCS patient and evidence supporting the pathogenicity of the identified mutation is discussed. © 2016 Wiley Periodicals, Inc. PMID:27139419

  13. Two coexisting heterozygous frameshift mutations in PROP1 are responsible for a different phenotype of combined pituitary hormone deficiency.

    PubMed

    Ziemnicka, K; Budny, B; Drobnik, K; Baszko-Błaszyk, D; Stajgis, M; Katulska, K; Waśko, R; Wrotkowska, E; Słomski, R; Ruchała, M

    2016-08-01

    The role of genetic background in childhood-onset combined pituitary hormone deficiency (CPHD) has been extensively studied. The major contributors are the PROP1, POU1F1, LHX3, LHX4 and HESX1 genes coding transcription factors implicated in pituitary organogenesis. The clinical consequences of mutations encompass impaired synthesis of a growth hormone (GH) and one or more concurrent pituitary hormones (i.e. LH, FSH, TSH, PRL). Manifestation of the disorder may vary due to various mutation impacts on the final gene products or an influence of environmental factors during pituitary organogenesis. We describe the clinical and molecular characteristics of two brothers aged 47 and 39 years presenting an uncommon manifestation of congenital hypopituitarism. Sequencing of the PROP1, POU1F1, LHX3, LHX4 and HESX1 genes was performed to confirm the genetic origin of the disorder. A compound heterozygosity in the PROP1 gene has been identified for both probands. The first change represents a mutational hot spot (c.150delA, p.R53fsX164), whereas the second is a novel alteration (p.R112X) that leads to protein disruption. Based on precise genetic diagnosis, an in silico prediction of a p.R112X mutation on protein architecture was performed. The resulting clinical phenotype was surprisingly distinct compared to most patients with genetic alterations in PROP1 reported in the current literature. This may be caused by a residual activity of a newly identified p.R112X protein that preserves over 70 % of the homeodomain structure. This examination may confirm a key role of a DNA-binding homeodomain in maintaining PROP1 functionality and suggests a conceivable explanation of an unusual phenotype. PMID:26608600

  14. Homozygosity for frameshift mutations in XYLT2 result in a spondylo-ocular syndrome with bone fragility, cataracts, and hearing defects.

    PubMed

    Munns, Craig F; Fahiminiya, Somayyeh; Poudel, Nabin; Munteanu, Maria Cristina; Majewski, Jacek; Sillence, David O; Metcalf, Jordan P; Biggin, Andrew; Glorieux, Francis; Fassier, François; Rauch, Frank; Hinsdale, Myron E

    2015-06-01

    Heparan and chondroitin/dermatan sulfated proteoglycans have a wide range of roles in cellular and tissue homeostasis including growth factor function, morphogen gradient formation, and co-receptor activity. Proteoglycan assembly initiates with a xylose monosaccharide covalently attached by either xylosyltransferase I or II. Three individuals from two families were found that exhibited similar phenotypes. The index case subjects were two brothers, individuals 1 and 2, who presented with osteoporosis, cataracts, sensorineural hearing loss, and mild learning defects. Whole exome sequence analyses showed that both individuals had a homozygous c.692dup mutation (GenBank: NM_022167.3) in the xylosyltransferase II locus (XYLT2) (MIM: 608125), causing reduced XYLT2 mRNA and low circulating xylosyltransferase (XylT) activity. In an unrelated boy (individual 3) from the second family, we noted low serum XylT activity. Sanger sequencing of XYLT2 in this individual revealed a c.520del mutation in exon 2 that resulted in a frameshift and premature stop codon (p.Ala174Profs(∗)35). Fibroblasts from individuals 1 and 2 showed a range of defects including reduced XylT activity, GAG incorporation of (35)SO4, and heparan sulfate proteoglycan assembly. These studies demonstrate that human XylT2 deficiency results in vertebral compression fractures, sensorineural hearing loss, eye defects, and heart defects, a phenotype that is similar to the autosomal-recessive disorder spondylo-ocular syndrome of unknown cause. This phenotype is different from what has been reported in individuals with other linker enzyme deficiencies. These studies illustrate that the cells of the lens, retina, heart muscle, inner ear, and bone are dependent on XylT2 for proteoglycan assembly in humans. PMID:26027496

  15. Juvenile-onset Sporadic Amyotrophic Lateral Sclerosis with a Frameshift FUS Gene Mutation Presenting Unique Neuroradiological Findings and Cognitive Impairment.

    PubMed

    Hirayanagi, Kimitoshi; Sato, Masayuki; Furuta, Natsumi; Makioka, Kouki; Ikeda, Yoshio

    2016-01-01

    A 24-year-old Japanese woman developed anterocollis, weakness of the proximal arms, and subsequent cognitive impairment. A neurological examination revealed amyotrophic lateral sclerosis (ALS) without a family history. Systemic muscle atrophy progressed rapidly. Cerebral MRI clearly exhibited high signal intensities along the bilateral pyramidal tracts. An analysis of the FUS gene revealed a heterozygous two-base pair deletion, c.1507-1508delAG (p.G504WfsX515). A subset of juvenile-onset familial/sporadic ALS cases with FUS gene mutations reportedly demonstrates mental retardation or learning difficulty. Our study emphasizes the importance of conducting a FUS gene analysis in juvenile-onset ALS cases, even when no family occurrence is confirmed. PMID:26984092

  16. Novel frame-shift mutation in Slc5a2 encoding SGLT2 in a strain of senescence-accelerated mouse SAMP10.

    PubMed

    Unno, Keiko; Yamamoto, Hiroyuki; Toda, Masateru; Hagiwara, Shiori; Iguchi, Kazuaki; Hoshino, Minoru; Takabayashi, Fumiyo; Hasegawa-Ishii, Sanae; Shimada, Atsuyoshi; Hosokawa, Masanori; Higuchi, Keiichi; Mori, Masayuki

    2014-11-01

    The senescence-accelerated mouse prone10 (SAMP10) strain, a model of aging, exhibits cognitive impairments and cerebral atrophy. We noticed that SAMP10/TaSlc mice, a SAMP10 substrain, have developed persistent glucosuria over the past few years. In the present study, we characterized SAMP10/TaSlc mice and further identified a spontaneous mutation in the Slc5a2 gene encoding sodium-glucose co-transporter (SGLT) 2. The mean concentration of urine glucose was high in SAMP10/TaSlc mice and increased further with advancing age, whereas other strains of senescence-accelerated mice, including SAMP1/SkuSlc, SAMP6/TaSlc and SAMP8/TaSlc or normal aging control SAMR1/TaSlc mice, exhibited no detectable glucose in urine. SAMP10/TaSlc mice consumed increasing amounts of food and water compared to SAMR1/TaSlc mice, suggesting the compensation of polyuria and the loss of glucose. Oral glucose tolerance tests showed decreased glucose reabsorption in the kidney of SAMP10/TaSlc mice. In addition, blood glucose levels decreased in an age-dependent fashion. The kidney was innately larger than that of control mice with no histological alterations. We examined the expression levels of glucose transporters in the kidney. Among SGLT1, SGLT2, glucose transporter (GLUT) 1 and GLUT2, we found a significant decrease only in the level of SGLT2. DNA sequencing of SGLT2 in SAMP10/TaSlc mice revealed a single nucleotide deletion of guanine at 1236, which resulted in a frameshift mutation that produced a truncated protein. We designate this strain as SAMP10/TaSlc-Slc5a2(slc) (SAMP10-ΔSglt2). Recently, SGLT2 inhibitors have been demonstrated to be effective for the treatment of patients with type 2 diabetes (T2D). SAMP10-ΔSglt2 mice may serve as a unique preclinical model to study the link between aging-related neurodegenerative disorders and T2D. PMID:25450362

  17. Classification of a frameshift/extended and a stop mutation in WT1 as gain-of-function mutations that activate cell cycle genes and promote Wilms tumour cell proliferation

    PubMed Central

    Busch, Maike; Schwindt, Heinrich; Brandt, Artur; Beier, Manfred; Görldt, Nicole; Romaniuk, Paul; Toska, Eneda; Roberts, Stefan; Royer, Hans-Dieter; Royer-Pokora, Brigitte

    2014-01-01

    The WT1 gene encodes a zinc finger transcription factor important for normal kidney development. WT1 is a suppressor for Wilms tumour development and an oncogene for diverse malignant tumours. We recently established cell lines from primary Wilms tumours with different WT1 mutations. To investigate the function of mutant WT1 proteins, we performed WT1 knockdown experiments in cell lines with a frameshift/extension (p.V432fsX87 = Wilms3) and a stop mutation (p.P362X = Wilms2) of WT1, followed by genome-wide gene expression analysis. We also expressed wild-type and mutant WT1 proteins in human mesenchymal stem cells and established gene expression profiles. A detailed analysis of gene expression data enabled us to classify the WT1 mutations as gain-of-function mutations. The mutant WT1Wilms2 and WT1Wilms3 proteins acquired an ability to modulate the expression of a highly significant number of genes from the G2/M phase of the cell cycle, and WT1 knockdown experiments showed that they are required for Wilms tumour cell proliferation. p53 negatively regulates the activity of a large number of these genes that are also part of a core proliferation cluster in diverse human cancers. Our data strongly suggest that mutant WT1 proteins facilitate expression of these cell cycle genes by antagonizing transcriptional repression mediated by p53. We show that mutant WT1 can physically interact with p53. Together the findings show for the first time that mutant WT1 proteins have a gain-of-function and act as oncogenes for Wilms tumour development by regulating Wilms tumour cell proliferation. PMID:24619359

  18. A stochastic model of translation with -1 programmed ribosomal frameshifting

    NASA Astrophysics Data System (ADS)

    Bailey, Brenae L.; Visscher, Koen; Watkins, Joseph

    2014-02-01

    Many viruses produce multiple proteins from a single mRNA sequence by encoding overlapping genes. One mechanism to decode both genes, which reside in alternate reading frames, is -1 programmed ribosomal frameshifting. Although recognized for over 25 years, the molecular and physical mechanism of -1 frameshifting remains poorly understood. We have developed a mathematical model that treats mRNA translation and associated -1 frameshifting as a stochastic process in which the transition probabilities are based on the energetics of local molecular interactions. The model predicts both the location and efficiency of -1 frameshift events in HIV-1. Moreover, we compute -1 frameshift efficiencies upon mutations in the viral mRNA sequence and variations in relative tRNA abundances, predictions that are directly testable in experiment.

  19. A Stochastic Model of RNA Translation with Frameshifting

    NASA Astrophysics Data System (ADS)

    Bailey, Brenae

    2011-10-01

    Many viruses can produce different proteins from the same RNA sequence by encoding them in overlapping genes. One mechanism that causes the ribosomes of infected cells to decode both genes is called programmed ribosomal frameshifting (PRF). Although PRF has been recognized for 25 years, the mechanism is not well understood. We have developed a model that treats RNA translation as a stochastic process in which the transition probabilities are based on the free energies of local molecular interactions. The model reproduces observed translation rates and frameshift efficiencies, and can be used to predict the effects of mutations in the viral RNA sequence on both the mean translation rate and the frameshift efficiency.

  20. Functional Characterization of a Novel Frameshift Mutation in the C-terminus of the Nav1.5 Channel Underlying a Brugada Syndrome with Variable Expression in a Spanish Family

    PubMed Central

    Núñez, Lucía; Barana, Adriana; Amorós, Irene; Matamoros, Marcos; Pérez-Hernández, Marta; González de la Fuente, Marta; Álvarez-López, Miguel; Macías-Ruiz, Rosa; Tercedor-Sánchez, Luis; Jiménez-Jáimez, Juan; Delpón, Eva; Caballero, Ricardo; Tamargo, Juan

    2013-01-01

    Introduction We functionally analyzed a frameshift mutation in the SCN5A gene encoding cardiac Na+ channels (Nav1.5) found in a proband with repeated episodes of ventricular fibrillation who presented bradycardia and paroxysmal atrial fibrillation. Seven relatives also carry the mutation and showed a Brugada syndrome with an incomplete and variable expression. The mutation (p.D1816VfsX7) resulted in a severe truncation (201 residues) of the Nav1.5 C-terminus. Methods and Results Wild-type (WT) and mutated Nav1.5 channels together with hNavβ1 were expressed in CHO cells and currents were recorded at room temperature using the whole-cell patch-clamp. Expression of p.D1816VfsX7 alone resulted in a marked reduction (≈90%) in peak Na+ current density compared with WT channels. Peak current density generated by p.D1816VfsX7+WT was ≈50% of that generated by WT channels. p.D1816VfsX7 positively shifted activation and inactivation curves, leading to a significant reduction of the window current. The mutation accelerated current activation and reactivation kinetics and increased the fraction of channels developing slow inactivation with prolonged depolarizations. However, late INa was not modified by the mutation. p.D1816VfsX7 produced a marked reduction of channel trafficking toward the membrane that was not restored by decreasing incubation temperature during cell culture or by incubation with 300 μM mexiletine and 5 mM 4-phenylbutirate. Conclusion Despite a severe truncation of the C-terminus, the resulting mutated channels generate currents, albeit with reduced amplitude and altered biophysical properties, confirming the key role of the C-terminal domain in the expression and function of the cardiac Na+ channel. PMID:24363796

  1. Spotlight Topics

    NASA Astrophysics Data System (ADS)

    A Spotlight Topic consists of a set of two or more review articles focused on a specific subject in surface science. The topics are recommended by the Board of Editors. A topic may be chosen because it is particularly new or fast-breaking, thus deserving introduction to the general readership. Or, it may be because a topic is especially controversial or confusing, requiring clarification by experts. Each review will give a critical assessment rather than an encyclopedic report. While our editors always will insist on fairness and accuracy, any review which forwards an opinion is bound to be somewhat subjective. Therefore, it is the editors' wish that the set of reviews written by different authors on the same subject matter will provide a broad and balanced viewpoint. It is often the case that an author who is an expert in a technique or method may be especially enthusiastic or critical about this technique or method. A companion review in the set may provide a different viewpoint. We are hopeful that the reader, after studying these reviews and checking some of the key references, will obtain an informed opinion of the subject. We think the set of reviews in a spotlight area will considerably shorten the ``learning time'' that a nonexpert would otherwise need to become knowledgeable about a subject. In this issue, we feature a spotlight topic on oxide surfaces. The set contains an overview article by Jacques Jupille, and four articles written by G. Pacchioni, F. Cosandey and T. E. Madey, B. G. Daniels, R. Lindsay and G. Thornton, and C. Noguera respectively. Of these, the article by Pacchioni has already appeared in SRL 7, 277 (2000). The other three articles appear in this issue. A reader who wishes to suggest a spotlight topic or recommend authors to write such reviews should contact the Editor-in-Chief. We would like to hear from you.

  2. Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

    PubMed

    Blazquez, A; Martín, M A; Lara, M C; Martí, R; Campos, Y; Cabello, A; Garesse, R; Bautista, J; Andreu, A L; Arenas, J

    2005-11-01

    We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP). PMID:16198108

  3. Balancing Selection of a Frame-Shift Mutation in the MRC2 Gene Accounts for the Outbreak of the Crooked Tail Syndrome in Belgian Blue Cattle

    PubMed Central

    Li, Wanbo; Dive, Marc; Tamma, Nico; Michaux, Charles; Druet, Tom; Huijbers, Ivo J.; Isacke, Clare M.; Coppieters, Wouter; Georges, Michel; Charlier, Carole

    2009-01-01

    We herein describe the positional identification of a 2-bp deletion in the open reading frame of the MRC2 receptor causing the recessive Crooked Tail Syndrome in cattle. The resulting frame-shift reveals a premature stop codon that causes nonsense-mediated decay of the mutant messenger RNA, and the virtual absence of functional Endo180 protein in affected animals. Cases exhibit skeletal anomalies thought to result from impaired extracellular matrix remodeling during ossification, and as of yet unexplained muscular symptoms. We demonstrate that carrier status is very significantly associated with desired characteristics in the general population, including enhanced muscular development, and that the resulting heterozygote advantage caused a selective sweep which explains the unexpectedly high frequency (25%) of carriers in the Belgian Blue Cattle Breed. PMID:19779552

  4. Balancing selection of a frame-shift mutation in the MRC2 gene accounts for the outbreak of the Crooked Tail Syndrome in Belgian Blue Cattle.

    PubMed

    Fasquelle, Corinne; Sartelet, Arnaud; Li, Wanbo; Dive, Marc; Tamma, Nico; Michaux, Charles; Druet, Tom; Huijbers, Ivo J; Isacke, Clare M; Coppieters, Wouter; Georges, Michel; Charlier, Carole

    2009-09-01

    We herein describe the positional identification of a 2-bp deletion in the open reading frame of the MRC2 receptor causing the recessive Crooked Tail Syndrome in cattle. The resulting frame-shift reveals a premature stop codon that causes nonsense-mediated decay of the mutant messenger RNA, and the virtual absence of functional Endo180 protein in affected animals. Cases exhibit skeletal anomalies thought to result from impaired extracellular matrix remodeling during ossification, and as of yet unexplained muscular symptoms. We demonstrate that carrier status is very significantly associated with desired characteristics in the general population, including enhanced muscular development, and that the resulting heterozygote advantage caused a selective sweep which explains the unexpectedly high frequency (25%) of carriers in the Belgian Blue Cattle Breed. PMID:19779552

  5. A frameshift mutation in the LYST gene is responsible for the Aleutian color and the associated Chédiak-Higashi syndrome in American mink.

    PubMed

    Anistoroaei, R; Krogh, A K; Christensen, K

    2013-04-01

    One of the colors of mink is Aleutian (aa)-a specific gun-metal gray pigmentation of the fur-commonly used in combination with other color loci to generate popular colors such as Violet (aammpp) and Sapphire (aapp). The Aleutian color allele is a manifestation of mink Chédiak-Higashi syndrome (CHS), which has been described in humans and several other species. As with forms of CHS in other species, we report that the mink CHS is linked to the lysosomal trafficking regulator ( LYST ) gene. Furthermore, we have identified a base deletion (c.9468delC) in exon 40 of LYST, which causes a frameshift and virtually terminates the LYST product prematurely (p.Leu3156Phefs*37). We investigated the blood parameters of three wild-type mink and three CHS mink. No difference in the platelet number between the two groups was observed, but an accumulation of platelets between the groups appears different when collagen is used as a coagulant. Microscopic analysis of peripheral blood indicates giant inclusions in the neutrophils of the Aleutian mink types. Molecular findings at the LYST locus enable the development of genetic tests for analyzing the color selection in American mink. PMID:22762706

  6. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    SciTech Connect

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  7. Reverse genetic screen for loss-of-function mutations uncovers a frameshifting deletion in the melanophilin gene accountable for a distinctive coat color in Belgian Blue cattle.

    PubMed

    Li, Wanbo; Sartelet, Arnaud; Tamma, Nico; Coppieters, Wouter; Georges, Michel; Charlier, Carole

    2016-02-01

    In the course of a reverse genetic screen in the Belgian Blue cattle breed, we uncovered a 10-bp deletion (c.87_96del) in the first coding exon of the melanophilin gene (MLPH), which introduces a premature stop codon (p.Glu32Aspfs*1) in the same exon, truncating 94% of the protein. Recessive damaging mutations in the MLPH gene are well known to cause skin, hair, coat or plumage color dilution phenotypes in numerous species, including human, mice, dog, cat, mink, rabbit, chicken and quail. Large-scale array genotyping undertaken to identify p.Glu32Aspfs*1 homozygous mutant animals revealed a mutation frequency of 5% in the breed and allowed for the identification of 10 homozygous mutants. As expression of a colored coat requires at least one wild-type allele at the co-dominant Roan locus encoded by the KIT ligand gene (KITLG), homozygous mutants for p.Ala227Asp corresponding with the missense mutation were excluded. The six remaining colored calves displayed a distinctive dilution phenotype as anticipated. This new coat color was named 'cool gray'. It is the first damaging mutation in the MLPH gene described in cattle and extends the already long list of species with diluted color due to recessive mutations in MLPH and broadens the color palette of gray in this breed. PMID:26582259

  8. First application of next-generation sequencing in Moroccan breast/ovarian cancer families and report of a novel frameshift mutation of the BRCA1 gene

    PubMed Central

    Jouali, Farah; Laarabi, Fatima-Zahra; Marchoudi, Nabila; Ratbi, Ilham; Elalaoui, Siham Chafai; Rhaissi, Houria; Fekkak, Jamal; Sefiani, Abdelaziz

    2016-01-01

    At present, breast cancer is the most common type of cancer in females. The majority of cases are sporadic, but 5–10% are due to an inherited predisposition to develop breast and ovarian cancers, which are transmitted as an autosomal dominant form with incomplete penetrance. The beneficial effects of clinical genetic testing, including next generation sequencing (NGS) for BRCA1/2 mutations, is major; in particular, it benefits the care of patients and the counseling of relatives that are at risk of breast cancer, in order to reduce breast cancer mortality. BRCA genetic testing was performed in 15 patients with breast cancer and a family with positivity for the heterozygous c.6428C>A mutation of the BRCA2 gene. Informed consent was obtained from all the subjects. Genomic DNAs were extracted and the NGS for genes was performed using the Ion Torrent Personal Genome Machine (PGM) with a 316 chip. The reads were aligned with the human reference HG19 genome to elucidate variants in the BRCA1 and BRCA2 genes. Mutations detected by the PGM platform were confirmed by target direct Sanger sequencing on a second patient DNA sample. In total, 4 BRCA variants were identified in 6 families by NGS. Of these, 3 mutations had been previously reported: c.2126insA of BRCA1, and c.1310_1313delAAGA and c.7235insG of BRCA2. The fourth variant, c.3453delT in BRCA1, has, to the best of our knowledge, never been previously reported. The present study is the first to apply NGS of the BRCA1 and BRCA2 genes to a Moroccan population, prompting additional investigation into local founder mutations and variant characteristics in the region. The variants with no clear clinical significance may present a diagnostic challenge when performing targeted resequencing. These results confirm that an NGS approach based on Ampliseq libraries and PGM sequencing is a highly efficient, speedy and high-throughput mutation detection method, which may be preferable in lower income countries. PMID:27446417

  9. A Three-Stemmed mRNA Pseudoknot in the SARS Coronavirus Frameshift Signal

    PubMed Central

    2005-01-01

    A wide range of RNA viruses use programmed −1 ribosomal frameshifting for the production of viral fusion proteins. Inspection of the overlap regions between ORF1a and ORF1b of the SARS-CoV genome revealed that, similar to all coronaviruses, a programmed −1 ribosomal frameshift could be used by the virus to produce a fusion protein. Computational analyses of the frameshift signal predicted the presence of an mRNA pseudoknot containing three double-stranded RNA stem structures rather than two. Phylogenetic analyses showed the conservation of potential three-stemmed pseudoknots in the frameshift signals of all other coronaviruses in the GenBank database. Though the presence of the three-stemmed structure is supported by nuclease mapping and two-dimensional nuclear magnetic resonance studies, our findings suggest that interactions between the stem structures may result in local distortions in the A-form RNA. These distortions are particularly evident in the vicinity of predicted A-bulges in stems 2 and 3. In vitro and in vivo frameshifting assays showed that the SARS-CoV frameshift signal is functionally similar to other viral frameshift signals: it promotes efficient frameshifting in all of the standard assay systems, and it is sensitive to a drug and a genetic mutation that are known to affect frameshifting efficiency of a yeast virus. Mutagenesis studies reveal that both the specific sequences and structures of stems 2 and 3 are important for efficient frameshifting. We have identified a new RNA structural motif that is capable of promoting efficient programmed ribosomal frameshifting. The high degree of conservation of three-stemmed mRNA pseudoknot structures among the coronaviruses suggests that this presents a novel target for antiviral therapeutics. PMID:15884978

  10. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    PubMed

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events). PMID:23161689

  11. A molecular characterization of spontaneous frameshift mutagenesis within the trpA gene of Escherichia coli

    PubMed Central

    Hardin, Aaron; Villalta, Christopher F.; Doan, Michael; Jabri, Mouna; Chockalingham, Valliammal; White, Steven J.; Fowler, Robert G.

    2007-01-01

    Spontaneous frameshift mutations are an important source of genetic variation in all species and cause a large number of genetic disorders in humans. To enhance our understanding of the molecular mechanisms of frameshift mutagenesis, 583 spontaneous Trp+ revertants of two trpA frameshift alleles in Escherichia coli were isolated and DNA sequenced. In order to measure the contribution of methyl-directed mismatch repair to frameshift production, mutational spectra were constructed for both mismatch repair-proficient and repair-defective strains. The molecular origins of practically all of the frameshifts analyzed could be explained by one of six simple models based upon misalignment of the template or nascent DNA strands with or without misincoroporation of primer nucleotides during DNA replication. Most frameshifts occurred within mononucleotide runs as has been shown often in previous studies but the location of the 76 frameshift sites was usually outside of runs. Mismatch repair generally was most effective in preventing the occurrence of frameshifts within runs but there was much variation from site to site. Most frameshift sites outside of runs appear to be refractory to mismatch repair although the small number of occurrences at most of these sites make firm conclusions impossible. There was a dense pattern of reversion sites within the trpA DNA region where reversion events could occur, suggesting that, in general, most DNA sequences are capable of undergoing spontaneous mutational events during replication that can lead to small deletions and insertions. Many of these errors are likely to occur at low frequencies and be tolerated as events too costly to prevent or repair. These studies also revealed an unpredicted flexibility in the primary amino acid sequence of the trpA product, the α subunit of tryptophan synthase. PMID:17084112

  12. Spotlight on Minority Students

    ERIC Educational Resources Information Center

    Yous, Phakdey Chea; Mahamed, Hodman; Kost, Kimberly

    2009-01-01

    This article spotlights minority students in school psychology training programs. Three students from underrepresented backgrounds were asked to reflect on what aspects of their program made them feel welcome and supported. In their discussions, they took the task a step further and furnished ideas about ways in which school psychology training…

  13. Spotlight on Teaching Orchestra

    ERIC Educational Resources Information Center

    Rowman & Littlefield Education, 2005

    2005-01-01

    This publication provides orchestra teachers with techniques for conducting, choosing repertoire, program development, recruiting, playing styles, and preparing for competitions. It is the latest in MENC's popular Spotlight series, comprising articles that have appeared in state MEA journals. It is made up of 9 sections, and has a total of 53…

  14. Parent Group Spotlight

    ERIC Educational Resources Information Center

    Parenting for High Potential, 2014

    2014-01-01

    This issue's "Parent Group Spotlight" features Deborah Simon, president of West Sound Gifted, Talented & Twice-Exceptional (WSGT2e), who started a parent group in Washington in 2013. In just one year, this small, but mighty group has held community forums, attended school board meetings, and helped influence local gifted programming.…

  15. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    SciTech Connect

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  16. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus.

    PubMed

    Gao, Feng; Simon, Anne E

    2016-01-29

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5'-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3' terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  17. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

    PubMed Central

    Gao, Feng; Simon, Anne E.

    2016-01-01

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  18. Spotlight-8 Image Analysis Software

    NASA Technical Reports Server (NTRS)

    Klimek, Robert; Wright, Ted

    2006-01-01

    Spotlight is a cross-platform GUI-based software package designed to perform image analysis on sequences of images generated by combustion and fluid physics experiments run in a microgravity environment. Spotlight can perform analysis on a single image in an interactive mode or perform analysis on a sequence of images in an automated fashion. Image processing operations can be employed to enhance the image before various statistics and measurement operations are performed. An arbitrarily large number of objects can be analyzed simultaneously with independent areas of interest. Spotlight saves results in a text file that can be imported into other programs for graphing or further analysis. Spotlight can be run on Microsoft Windows, Linux, and Apple OS X platforms.

  19. In the Spotlight: Bioinformatics

    PubMed Central

    Wang, May Dongmei

    2016-01-01

    During 2012, next generation sequencing (NGS) has attracted great attention in the biomedical research community, especially for personalized medicine. Also, third generation sequencing has become available. Therefore, state-of-art sequencing technology and analysis are reviewed in this Bioinformatics spotlight on 2012. Next-generation sequencing (NGS) is high-throughput nucleic acid sequencing technology with wide dynamic range and single base resolution. The full promise of NGS depends on the optimization of NGS platforms, sequence alignment and assembly algorithms, data analytics, novel algorithms for integrating NGS data with existing genomic, proteomic, or metabolomic data, and quantitative assessment of NGS technology in comparing to more established technologies such as microarrays. NGS technology has been predicated to become a cornerstone of personalized medicine. It is argued that NGS is a promising field for motivated young researchers who are looking for opportunities in bioinformatics. PMID:23192635

  20. DVL3 Alleles Resulting in a -1 Frameshift of the Last Exon Mediate Autosomal-Dominant Robinow Syndrome.

    PubMed

    White, Janson J; Mazzeu, Juliana F; Hoischen, Alexander; Bayram, Yavuz; Withers, Marjorie; Gezdirici, Alper; Kimonis, Virginia; Steehouwer, Marloes; Jhangiani, Shalini N; Muzny, Donna M; Gibbs, Richard A; van Bon, Bregje W M; Sutton, V Reid; Lupski, James R; Brunner, Han G; Carvalho, Claudia M B

    2016-03-01

    Robinow syndrome is a rare congenital disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features. Recent reports have identified, in individuals with dominant Robinow syndrome, a specific type of variant characterized by being uniformly located in the penultimate exon of DVL1 and resulting in a -1 frameshift allele with a premature termination codon that escapes nonsense-mediated decay. Here, we studied a cohort of individuals who had been clinically diagnosed with Robinow syndrome but who had not received a molecular diagnosis from variant studies of DVL1, WNT5A, and ROR2. Because of the uniform location of frameshift variants in DVL1-mediated Robinow syndrome and the functional redundancy of DVL1, DVL2, and DVL3, we elected to pursue direct Sanger sequencing of the penultimate exon of DVL1 and its paralogs DVL2 and DVL3 to search for potential disease-associated variants. Remarkably, targeted sequencing identified five unrelated individuals harboring heterozygous, de novo frameshift variants in DVL3, including two splice acceptor mutations and three 1 bp deletions. Similar to the variants observed in DVL1-mediated Robinow syndrome, all variants in DVL3 result in a -1 frameshift, indicating that these highly specific alterations might be a common cause of dominant Robinow syndrome. Here, we review the current knowledge of these peculiar variant alleles in DVL1- and DVL3-mediated Robinow syndrome and further elucidate the phenotypic features present in subjects with DVL1 and DVL3 frameshift mutations. PMID:26924530

  1. Net -1 frameshifting on a noncanonical sequence in a herpes simplex virus drug-resistant mutant is stimulated by nonstop mRNA.

    PubMed

    Pan, Dongli; Coen, Donald M

    2012-09-11

    Ribosomal frameshifting entails slippage of the translational machinery during elongation. Frameshifting permits expression of more than one polypeptide from an otherwise monocistronic mRNA, and can restore expression of polypeptides in the face of frameshift mutations. A common mutation conferring acyclovir resistance in patients with herpes simplex virus disease deletes one cytosine from a run of six cytosines (C-chord) in the viral thymidine kinase (tk) gene. However, this mutation does not abolish TK activity, which is important for pathogenicity. To investigate how this mutant retains TK activity, we engineered and analyzed viruses expressing epitope-tagged TK. We found that the mutant's TK activity can be accounted for by low levels of full-length TK polypeptide produced by net -1 frameshifting during translation. The efficiency of frameshifting was relatively high, 3-5%, as the polypeptide from the reading frame generated by the deletion, which lacks stop codons (nonstop), was poorly expressed mainly because of inefficient protein synthesis. Stop codons introduced into this reading frame greatly increased its expression, but greatly decreased the level of full-length TK, indicating that frameshifting is strongly stimulated by a new mechanism, nonstop mRNA, which we hypothesize involves stalling of ribosomes on the polyA tail. Mutational studies indicated that frameshifting occurs on or near the C-chord, a region lacking a canonical slippery sequence. Nonstop stimulation of frameshifting also occurred when the C-chord was replaced with a canonical slippery sequence from HIV. This mechanism thus permits biologically and clinically relevant TK synthesis, and may occur more generally. PMID:22927407

  2. Net −1 frameshifting on a noncanonical sequence in a herpes simplex virus drug-resistant mutant is stimulated by nonstop mRNA

    PubMed Central

    Pan, Dongli; Coen, Donald M.

    2012-01-01

    Ribosomal frameshifting entails slippage of the translational machinery during elongation. Frameshifting permits expression of more than one polypeptide from an otherwise monocistronic mRNA, and can restore expression of polypeptides in the face of frameshift mutations. A common mutation conferring acyclovir resistance in patients with herpes simplex virus disease deletes one cytosine from a run of six cytosines (C-chord) in the viral thymidine kinase (tk) gene. However, this mutation does not abolish TK activity, which is important for pathogenicity. To investigate how this mutant retains TK activity, we engineered and analyzed viruses expressing epitope-tagged TK. We found that the mutant's TK activity can be accounted for by low levels of full-length TK polypeptide produced by net −1 frameshifting during translation. The efficiency of frameshifting was relatively high, 3–5%, as the polypeptide from the reading frame generated by the deletion, which lacks stop codons (nonstop), was poorly expressed mainly because of inefficient protein synthesis. Stop codons introduced into this reading frame greatly increased its expression, but greatly decreased the level of full-length TK, indicating that frameshifting is strongly stimulated by a new mechanism, nonstop mRNA, which we hypothesize involves stalling of ribosomes on the polyA tail. Mutational studies indicated that frameshifting occurs on or near the C-chord, a region lacking a canonical slippery sequence. Nonstop stimulation of frameshifting also occurred when the C-chord was replaced with a canonical slippery sequence from HIV. This mechanism thus permits biologically and clinically relevant TK synthesis, and may occur more generally. PMID:22927407

  3. Role of the pks15/1 gene in the biosynthesis of phenolglycolipids in the Mycobacterium tuberculosis complex. Evidence that all strains synthesize glycosylated p-hydroxybenzoic methyl esters and that strains devoid of phenolglycolipids harbor a frameshift mutation in the pks15/1 gene.

    PubMed

    Constant, Patricia; Perez, Esther; Malaga, Wladimir; Lanéelle, Marie-Antoinette; Saurel, Olivier; Daffé, Mamadou; Guilhot, Christophe

    2002-10-11

    Diesters of phthiocerol and phenolphthiocerol are important virulence factors of Mycobacterium tuberculosis and Mycobacterium leprae, the two main mycobacterial pathogens in humans. They are both long-chain beta-diols, and their biosynthetic pathway is beginning to be elucidated. Although the two classes of molecules share a common lipid core, phthiocerol diesters have been found in all the strains of the M. tuberculosis complex examined although phenolphthiocerol diesters are produced by only a few groups of strains. To address the question of the origin of this diversity 8 reference strains and 10 clinical isolates of M. tuberculosis were analyzed. We report the presence of glycosylated p-hydroxybenzoic acid methyl esters, structurally related to the type-specific phenolphthiocerol glycolipids, in the culture media of all reference strains of M. tuberculosis, suggesting that the strains devoid of phenolphthiocerol derivatives are unable to elongate the putative p-hydroxybenzoic acid precursor. We also show that all the strains of M. tuberculosis examined and deficient in the production of phenolphthiocerol derivatives are natural mutants with a frameshift mutation in pks15/1 whereas a single open reading frame for pks15/1 is found in Mycobacterium bovis BCG, M. leprae, and strains of M. tuberculosis that produce phenolphthiocerol derivatives. Complementation of the H37Rv strain of M. tuberculosis, which is devoid of phenolphthiocerol derivatives, with the fused pks15/1 gene from M. bovis BCG restored phenolphthiocerol glycolipids production. Conversely, disruption of the pks15/1 gene in M. bovis BCG led to the abolition of the synthesis of type-specific phenolphthiocerol glycolipid. These data indicate that Pks15/1 is involved in the elongation of p-hydroxybenzoic acid to give p-hydroxyphenylalkanoates, which in turn are converted, presumably by the PpsA-E synthase, to phenolphthiocerol derivatives. PMID:12138124

  4. ETS Research Spotlight: Issue 2

    ERIC Educational Resources Information Center

    Johnson, Jeff, Ed.

    2009-01-01

    In four articles adapted from the Educational Testing Service (ETS) Research Report Series, Issue 2 of ETS Research Spotlight provides a small taste of the range of assessment-related research capabilities of the ETS Research and Development Division. Those articles cover assessment-related research aimed at developing models of student learning,…

  5. Another functional frame-shift polymorphism of DEFB126 (rs11467497) associated with male infertility

    PubMed Central

    Duan, Shiwei; Shi, Changgeng; Chen, Guowu; Zheng, Ju-fen; Wu, Bin; Diao, Hua; Ji, Lindan; Gu, Yihua; Xin, Aijie; Wu, Yancheng; Zhou, Weijin; Miao, Maohua; Xu, Limin; Li, Zheng; Yuan, Yao; Wang, Peng; Shi, Huijuan

    2015-01-01

    DEFB126 rs140685149 mutation was shown to cause sperm dysfunction and subfertility. Indel rs11467497 is another 4-nucleotide frame-shift mutation (151bp upstream of rs140685149) that leads to the premature termination of translation and the expression of peptide truncated at the carboxyl terminus. In the present study, we performed a comprehensive association study to check the contribution of rs140685149 and rs11467497 to male infertility. Our results confirmed the previous findings that there was no association between rs140685149 and sperm motility. In contrast, we found a significant association of another indel rs11467497 with male infertility. Moreover, rs11467497 was shown to be associated with higher number of round cells in the infertile males with low sperm motility. Surprisingly, the two mutations commonly existed in the sperm donors (n = 672), suggesting a potential application of the two indels in the screening for eligible sperm donors. Western blotting assays showed the sperms with rs140685149 2-nt deletion tended to have unstable DEFB126 protein in contrast of no DEFB126 protein expressed in the sperms with rs11467497 4-nt deletion, suggesting a more severe consequence caused by rs11467497 mutation. In conclusion, our study presented a significant contribution of another functional frame-shift polymorphism of DEFB126 (rs11467497) to male infertility. PMID:25721098

  6. Role of frameshift ubiquitin B protein in Alzheimer's disease.

    PubMed

    Chen, Xin; Petranovic, Dina

    2016-07-01

    Alzheimer's disease (AD) is the most common neurodegenerative disease and is characterized by accumulation of misfolded and aggregated proteins. Since the ubiquitin-proteasome system (UPS) is the major intracellular protein quality control (PQC) system in eukaryotic cells, it is likely involved in the etiology of AD. The frameshift form of ubiquitin (Ubb(+1) ) accumulates in the neuritic plaques and neurofibrillary tangles in patients with AD. Ubb(+1) accumulates in an age-dependent manner as a result of RNA-polymerase mediated molecular misreading during transcription, which allows the formation of mutant proteins in the absence of gene mutations. The accumulation of the Ubb(+1) protein may act as an endogenous reporter for proteasome dysfunction and a growing number of studies have shown that Ubb(+1) may play more important pathogenic roles in AD etiology than previously hypothesized. The yeast Saccharomyces cerevisiae shares many conserved biological processes with all eukaryotic cells, including human neurons. This organism has been regarded as a model system for investigating the fundamental intracellular mechanisms, including those underlying neurodegeneration. We propose here that yeast systems biology approaches, combined with cell and molecular biology approaches will increase the relevant knowledge needed for advancement and elucidation of mechanisms and complex traits, which could provide new targets for therapeutic intervention in AD. WIREs Syst Biol Med 2016, 8:300-313. doi: 10.1002/wsbm.1340 For further resources related to this article, please visit the WIREs website. PMID:27240056

  7. The gene of an archaeal α-l-fucosidase is expressed by translational frameshifting

    PubMed Central

    Cobucci-Ponzano, Beatrice; Conte, Fiorella; Benelli, Dario; Londei, Paola; Flagiello, Angela; Monti, Maria; Pucci, Piero; Rossi, Mosè; Moracci, Marco

    2006-01-01

    The standard rules of genetic translational decoding are altered in specific genes by different events that are globally termed recoding. In Archaea recoding has been unequivocally determined so far only for termination codon readthrough events. We study here the mechanism of expression of a gene encoding for a α-l-fucosidase from the archaeon Sulfolobus solfataricus (fucA1), which is split in two open reading frames separated by a −1 frameshifting. The expression in Escherichia coli of the wild-type split gene led to the production by frameshifting of full-length polypeptides with an efficiency of 5%. Mutations in the regulatory site where the shift takes place demonstrate that the expression in vivo occurs in a programmed way. Further, we identify a full-length product of fucA1 in S.solfataricus extracts, which translate this gene in vitro by following programmed −1 frameshifting. This is the first experimental demonstration that this kind of recoding is present in Archaea. PMID:16920738

  8. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein.

    PubMed

    Fang, Ying; Treffers, Emmely E; Li, Yanhua; Tas, Ali; Sun, Zhi; van der Meer, Yvonne; de Ru, Arnoud H; van Veelen, Peter A; Atkins, John F; Snijder, Eric J; Firth, Andrew E

    2012-10-23

    Programmed -1 ribosomal frameshifting (-1 PRF) is a gene-expression mechanism used to express many viral and some cellular genes. In contrast, efficient natural utilization of -2 PRF has not been demonstrated previously in eukaryotic systems. Like all nidoviruses, members of the Arteriviridae (a family of positive-stranded RNA viruses) express their replicase polyproteins pp1a and pp1ab from two long ORFs (1a and 1b), where synthesis of pp1ab depends on -1 PRF. These polyproteins are posttranslationally cleaved into at least 13 functional nonstructural proteins. Here we report that porcine reproductive and respiratory syndrome virus (PRRSV), and apparently most other arteriviruses, use an additional PRF mechanism to access a conserved alternative ORF that overlaps the nsp2-encoding region of ORF1a in the +1 frame. We show here that this ORF is translated via -2 PRF at a conserved G_GUU_UUU sequence (underscores separate ORF1a codons) at an estimated efficiency of around 20%, yielding a transframe fusion (nsp2TF) with the N-terminal two thirds of nsp2. Expression of nsp2TF in PRRSV-infected cells was verified using specific Abs, and the site and direction of frameshifting were determined via mass spectrometric analysis of nsp2TF. Further, mutagenesis showed that the frameshift site and an unusual frameshift-stimulatory element (a conserved CCCANCUCC motif 11 nucleotides downstream) are required to direct efficient -2 PRF. Mutations preventing nsp2TF expression impair PRRSV replication and produce a small-plaque phenotype. Our findings demonstrate that -2 PRF is a functional gene-expression mechanism in eukaryotes and add another layer to the complexity of arterivirus genome expression. PMID:23043113

  9. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  10. Evolution of +1 programmed frameshifting signals and frameshift-regulating tRNAs in the order Saccharomycetales.

    PubMed

    Farabaugh, Philip J; Kramer, Emily; Vallabhaneni, Haritha; Raman, Ana

    2006-10-01

    Programmed translational frameshifting is a ubiquitous but rare mechanism of gene expression in which mRNA sequences cause the translational machinery to shift reading frames with extreme efficiency, up to at least 50%. The mRNA sequences responsible are deceptively simple; the sequence CUU-AGG-C causes about 40% frameshifting when inserted into an mRNA in the yeast Saccharomyces cerevisiae. The high efficiency of this site depends on a set of S. cerevisiae tRNA isoacceptors that perturb the mechanism of translation to cause the programmed translational error. The simplicity of the system might suggest that it could evolve frequently and perhaps be lost as easily. We have investigated the history of programmed +1 frameshifting in fungi. We find that frameshifting has persisted in two structural genes in budding yeasts, ABP140 and EST3 for about 150 million years. Further, the tRNAs that stimulate the event are equally old. Species that diverged from the lineage earlier both do not employ frameshifting and have a different complement of tRNAs predicted to be inimical to frameshifting. The stability of the coevolution of protein coding genes and tRNAs suggests that frameshifting has been selected for during the divergence of these species. PMID:16838213

  11. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency.

    PubMed

    Kontos, H; Napthine, S; Brierley, I

    2001-12-01

    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  12. Mechanisms and Implications of Programmed Translational Frameshifting

    PubMed Central

    2012-01-01

    While ribosomes must maintain translational reading frame in order to translate primary genetic information into polypeptides, cis-acting signals located on mRNAs represent higher order information content that can be used to fine tune gene expression. Classes of signals have been identified that direct a fraction of elongating ribosomes to shift reading frame by one base in the 5′ (−1) or 3′ (+1) direction. This is called programmed ribosomal frameshifting (PRF). Although mechanisms of PRF differ, a common feature is induction of ribosome pausing, which alters kinetic partitioning rates between in-frame and out-of-frame codons at specific “slippery” sequences. Many viruses use PRF to ensure synthesis of the correct ratios of virus-encoded proteins required for proper viral particle assembly and maturation, thus identifying PRF as an attractive target for antiviral therapeutics. In contrast, recent studies indicate that PRF signals may primarily function as mRNA destabilizing elements in cellular mRNAs. These studies suggest that PRF may be used to fine-tune gene expression through mRNA decay pathways. The possible regulation of PRF by non-coding RNAs is also discussed. PMID:22715123

  13. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    PubMed

    Mathew, Suneeth F; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S; McKinney, Cushla; Poole, Elizabeth S; Tate, Warren P

    2015-01-01

    HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon') contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1. PMID:25807539

  14. Transactivation of programmed ribosomal frameshifting by a viral protein.

    PubMed

    Li, Yanhua; Treffers, Emmely E; Napthine, Sawsan; Tas, Ali; Zhu, Longchao; Sun, Zhi; Bell, Susanne; Mark, Brian L; van Veelen, Peter A; van Hemert, Martijn J; Firth, Andrew E; Brierley, Ian; Snijder, Eric J; Fang, Ying

    2014-05-27

    Programmed -1 ribosomal frameshifting (-1 PRF) is a widely used translational mechanism facilitating the expression of two polypeptides from a single mRNA. Commonly, the ribosome interacts with an mRNA secondary structure that promotes -1 frameshifting on a homopolymeric slippery sequence. Recently, we described an unusual -2 frameshifting (-2 PRF) signal directing efficient expression of a transframe protein [nonstructural protein 2TF (nsp2TF)] of porcine reproductive and respiratory syndrome virus (PRRSV) from an alternative reading frame overlapping the viral replicase gene. Unusually, this arterivirus PRF signal lacks an obvious stimulatory RNA secondary structure, but as confirmed here, can also direct the occurrence of -1 PRF, yielding a third, truncated nsp2 variant named "nsp2N." Remarkably, we now show that both -2 and -1 PRF are transactivated by a protein factor, specifically a PRRSV replicase subunit (nsp1β). Embedded in nsp1β's papain-like autoproteinase domain, we identified a highly conserved, putative RNA-binding motif that is critical for PRF transactivation. The minimal RNA sequence required for PRF was mapped within a 34-nt region that includes the slippery sequence and a downstream conserved CCCANCUCC motif. Interaction of nsp1β with the PRF signal was demonstrated in pull-down assays. These studies demonstrate for the first time, to our knowledge, that a protein can function as a transactivator of ribosomal frameshifting. The newly identified frameshifting determinants provide potential antiviral targets for arterivirus disease control and prevention. Moreover, protein-induced transactivation of frameshifting may be a widely used mechanism, potentially including previously undiscovered viral strategies to regulate viral gene expression and/or modulate host cell translation upon infection. PMID:24825891

  15. Genetic analysis of the E site during RF2 programmed frameshifting

    PubMed Central

    Sanders, Christina L.; Curran, James F.

    2007-01-01

    The roles of the ribosomal E site are not fully understood. Prior evidence suggests that deacyl-tRNA in the E site can prevent frameshifting. We hypothesized that if the E-site codon must dissociate from its tRNA to allow for frameshifting, then weak codon:anticodon duplexes should allow for greater frameshifting than stronger duplexes. Using the well-characterized Escherichia coli RF2 (prfB) programmed frameshift to study frameshifting, we mutagenized the E-site triplet to all Unn and Cnn codons. Those variants should represent a very wide range of duplex stability. Duplex stability was estimated using two different methods. Frameshifting is inversely correlated with stability, as estimated by either method. These findings indicate that pairing between the deacyl-tRNA and the E-site codon opposes frameshifting. We discuss the implications of these findings on frame maintenance and on the RF2 programmed frameshift mechanism. PMID:17660276

  16. Molecular consequences of a frameshifted DLX3 mutant leading to Tricho-Dento-Osseous syndrome.

    PubMed

    Duverger, Olivier; Lee, Delia; Hassan, Mohammad Q; Chen, Susie X; Jaisser, Frederic; Lian, Jane B; Morasso, Maria I

    2008-07-18

    The homeodomain protein Distal-less-3 (Dlx3) plays a crucial role during embryonic development. This transcription factor is known to be essential for placental formation and to be involved in skin and skeletal organogenesis. In humans, a frameshift mutation in the coding sequence of the DLX3 gene results in an ectodermal dysplasia called Tricho-Dento-Osseous syndrome (TDO). The main features of this autosomal dominant disorder are defects in hair, teeth, and bone. To investigate the functional alterations caused by the mutated DLX3(TDO) isoform ex vivo, we used tetracycline-inducible osteoblastic and keratinocyte cell lines and calvarial derived osteoblasts in which the expression of DLX3(WT) and/or DLX3(TDO) could be regulated and monitored. Immunocytochemical analysis revealed that both DLX3(WT) and DLX3(TDO) recombinant proteins are targeted to the nucleus. However, as demonstrated by electrophoresis mobility shift assay, DLX3(TDO) is not able to bind to the canonical Dlx3 binding site. Furthermore, we demonstrate that the frameshifted C-terminal domain in DLX3(TDO) is accountable for the loss of DNA binding activity because the C-terminal domain in DLX3(WT) is not required for DNA binding activity. Although DLX3(TDO) alone cannot bind to a Dlx3 responsive element, when DLX3(WT) and DLX3(TDO) are co-expressed they form a complex that can bind DNA. Concomitant with the inability to bind DNA, DLX3(TDO) has a defective transcriptional activity. Moreover, the transcriptional activity of DLX3(WT) is significantly reduced in the presence of the mutated isoform, indicating that DLX3(TDO) has a dominant negative effect on DLX3(WT) transcriptional activity. PMID:18492670

  17. RNA dimerization plays a role in ribosomal frameshifting of the SARS coronavirus

    PubMed Central

    Ishimaru, Daniella; Plant, Ewan P.; Sims, Amy C.; Yount, Boyd L.; Roth, Braden M.; Eldho, Nadukkudy V.; Pérez-Alvarado, Gabriela C.; Armbruster, David W.; Baric, Ralph S.; Dinman, Jonathan D.; Taylor, Deborah R.; Hennig, Mirko

    2013-01-01

    Messenger RNA encoded signals that are involved in programmed -1 ribosomal frameshifting (-1 PRF) are typically two-stemmed hairpin (H)-type pseudoknots (pks). We previously described an unusual three-stemmed pseudoknot from the severe acute respiratory syndrome (SARS) coronavirus (CoV) that stimulated -1 PRF. The conserved existence of a third stem–loop suggested an important hitherto unknown function. Here we present new information describing structure and function of the third stem of the SARS pseudoknot. We uncovered RNA dimerization through a palindromic sequence embedded in the SARS-CoV Stem 3. Further in vitro analysis revealed that SARS-CoV RNA dimers assemble through ‘kissing’ loop–loop interactions. We also show that loop–loop kissing complex formation becomes more efficient at physiological temperature and in the presence of magnesium. When the palindromic sequence was mutated, in vitro RNA dimerization was abolished, and frameshifting was reduced from 15 to 5.7%. Furthermore, the inability to dimerize caused by the silent codon change in Stem 3 of SARS-CoV changed the viral growth kinetics and affected the levels of genomic and subgenomic RNA in infected cells. These results suggest that the homodimeric RNA complex formed by the SARS pseudoknot occurs in the cellular environment and that loop–loop kissing interactions involving Stem 3 modulate -1 PRF and play a role in subgenomic and full-length RNA synthesis. PMID:23275571

  18. Genome-Wide Scan Reveals Mutation Associated with Melanoma

    MedlinePlus

    ... 1999 Spotlight on Research 2012 July 2012 (historical) Genome-Wide Scan Reveals Mutation Associated with Melanoma A ... out to see if a technology called whole genome sequencing would help them find other genetic risk ...

  19. A cryptic melibiose transporter gene possessing a frameshift from Citrobacter freundii.

    PubMed

    Shimamoto, T; Shimamoto, T; Xu, X J; Okazaki, N; Kawakami, H; Tsuchiya, T

    2001-04-01

    Wild-type Citrobacter freundii cannot grow on melibiose as a sole source of carbon. The melibiose transporter gene melB was cloned from a C. freundii mutant M4 that could utilize melibiose as a sole carbon source. Although the cloned melB gene is closely similar to the melB genes of other bacteria, it is cryptic because of a frameshift mutation. Site-directed mutagenesis was used to construct a functional melB gene by deleting one nucleotide, resulting in the production of an active melibiose transporter. The active MelB transporter could utilize Na(+) and H(+) as coupling cations to melibiose transport. The amino acid sequence of the C. freundii MelB was found to be most similar to those of Salmonella typhimurium and Escherichia coli MelB. These facts are consistent with the phylogenetic relationship of bacteria and the cation coupling properties of the melibiose transporters. PMID:11275561

  20. An Expanded CAG Repeat in Huntingtin Causes +1 Frameshifting.

    PubMed

    Saffert, Paul; Adamla, Frauke; Schieweck, Rico; Atkins, John F; Ignatova, Zoya

    2016-08-26

    Maintenance of triplet decoding is crucial for the expression of functional protein because deviations either into the -1 or +1 reading frames are often non-functional. We report here that expression of huntingtin (Htt) exon 1 with expanded CAG repeats, implicated in Huntington pathology, undergoes a sporadic +1 frameshift to generate from the CAG repeat a trans-frame AGC repeat-encoded product. This +1 recoding is exclusively detected in pathological Htt variants, i.e. those with expanded repeats with more than 35 consecutive CAG codons. An atypical +1 shift site, UUC C at the 5' end of CAG repeats, which has some resemblance to the influenza A virus shift site, triggers the +1 frameshifting and is enhanced by the increased propensity of the expanded CAG repeats to form a stem-loop structure. The +1 trans-frame-encoded product can directly influence the aggregation of the parental Htt exon 1. PMID:27382061

  1. SAR digital spotlight implementation in MATLAB

    NASA Astrophysics Data System (ADS)

    Dungan, Kerry E.; Gorham, LeRoy A.; Moore, Linda J.

    2013-05-01

    Legacy synthetic aperture radar (SAR) exploitation algorithms were image-based algorithms, designed to exploit complex and/or detected SAR imagery. In order to improve the efficiency of the algorithms, image chips, or region of interest (ROI) chips, containing candidate targets were extracted. These image chips were then used directly by exploitation algorithms for the purposes of target discrimination or identification. Recent exploitation research has suggested that performance can be improved by processing the underlying phase history data instead of standard SAR imagery. Digital Spotlighting takes the phase history data of a large image and extracts the phase history data corresponding to a smaller spatial subset of the image. In a typical scenario, this spotlighted phase history data will contain much fewer samples than the original data but will still result in an alias-free image of the ROI. The Digital Spotlight algorithm can be considered the first stage in a "two-stage backprojection" image formation process. As the first stage in two-stage backprojection, Digital Spotlighting filters the original phase history data into a number of "pseudo"-phase histories that segment the scene into patches, each of which contain a reduced number of samples compared to the original data. The second stage of the imaging process consists of standard backprojection. The data rate reduction offered by Digital Spotlighting improves the computational efficiency of the overall imaging process by significantly reducing the total number of backprojection operations. This paper describes the Digital Spotlight algorithm in detail and provides an implementation in MATLAB.

  2. Programmed -1 frameshifting by kinetic partitioning during impeded translocation.

    PubMed

    Caliskan, Neva; Katunin, Vladimir I; Belardinelli, Riccardo; Peske, Frank; Rodnina, Marina V

    2014-06-19

    Programmed -1 ribosomal frameshifting (-1PRF) is an mRNA recoding event utilized by cells to enhance the information content of the genome and to regulate gene expression. The mechanism of -1PRF and its timing during translation elongation are unclear. Here, we identified the steps that govern -1PRF by following the stepwise movement of the ribosome through the frameshifting site of a model mRNA derived from the IBV 1a/1b gene in a reconstituted in vitro translation system from Escherichia coli. Frameshifting occurs at a late stage of translocation when the two tRNAs are bound to adjacent slippery sequence codons of the mRNA. The downstream pseudoknot in the mRNA impairs the closing movement of the 30S subunit head, the dissociation of EF-G, and the release of tRNA from the ribosome. The slippage of the ribosome into the -1 frame accelerates the completion of translocation, thereby further favoring translation in the new reading frame. PMID:24949973

  3. A nucleotide deletion and frame-shift cause analbuminemia in a Turkish family

    PubMed Central

    Caridi, Gianluca; Gulec, Elif Yilmaz; Campagnoli, Monica; Lugani, Francesca; Onal, Hasan; Kilic, Duzgun; Galliano, Monica; Minchiotti, Lorenzo

    2016-01-01

    Congenital analbuminemia is an autosomal recessive disorder, in which albumin, the major blood protein, is present only in a minute amount. The condition is a rare allelic heterogeneous defect, only about seventy cases have been reported worldwide. To date, more than twenty different mutations within the albumin gene have been found to cause the trait. In our continuing study of the molecular genetics of congenital analbuminemia, we report here the clinical and biochemical findings and the mutation analysis of the gene in two Turkish infants. For the molecular analysis, we used our strategy, based on the screening of the gene by single-strand conformation polymorphism, heteroduplex analysis and direct DNA sequencing. The results showed that both patients are homozygous for the deletion of a cytosine residue in exon 5, in a stretch of four cytosines starting from nucleotide position 524 and ending at position 527 (NM_000477.5(ALB):c.527delC). The subsequent frame-shift inserts a stop codon in position 215, markedly reducing the size of the predicted protein product. The parents are both heterozygous for the same mutation, for which we propose the name Erzurum from the city of origin of the family. In conclusion, our results show that in this family congenital analbuminemia is caused by a novel frame-shift/deletion defect, confirm the inheritance of the trait, and contribute to advance our understanding of the molecular basis underlying this condition. PMID:27346974

  4. A nucleotide deletion and frame-shift cause analbuminemia in a Turkish family.

    PubMed

    Caridi, Gianluca; Gulec, Elif Yilmaz; Campagnoli, Monica; Lugani, Francesca; Onal, Hasan; Kilic, Duzgun; Galliano, Monica; Minchiotti, Lorenzo

    2016-01-01

    Congenital analbuminemia is an autosomal recessive disorder, in which albumin, the major blood protein, is present only in a minute amount. The condition is a rare allelic heterogeneous defect, only about seventy cases have been reported worldwide. To date, more than twenty different mutations within the albumin gene have been found to cause the trait. In our continuing study of the molecular genetics of congenital analbuminemia, we report here the clinical and biochemical findings and the mutation analysis of the gene in two Turkish infants. For the molecular analysis, we used our strategy, based on the screening of the gene by single-strand conformation polymorphism, heteroduplex analysis and direct DNA sequencing. The results showed that both patients are homozygous for the deletion of a cytosine residue in exon 5, in a stretch of four cytosines starting from nucleotide position 524 and ending at position 527 (NM_000477.5(ALB):c.527delC). The subsequent frame-shift inserts a stop codon in position 215, markedly reducing the size of the predicted protein product. The parents are both heterozygous for the same mutation, for which we propose the name Erzurum from the city of origin of the family. In conclusion, our results show that in this family congenital analbuminemia is caused by a novel frame-shift/deletion defect, confirm the inheritance of the trait, and contribute to advance our understanding of the molecular basis underlying this condition. PMID:27346974

  5. FSscan: a mechanism-based program to identify +1 ribosomal frameshift hotspots

    PubMed Central

    Liao, Pei-Yu; Choi, Yong Seok; Lee, Kelvin H.

    2009-01-01

    In +1 programmed ribosomal frameshifting (PRF), ribosomes skip one nucleotide toward the 3′-end during translation. Most of the genes known to demonstrate +1 PRF have been discovered by chance or by searching homologous genes. Here, a bioinformatic framework called FSscan is developed to perform a systematic search for potential +1 frameshift sites in the Escherichia coli genome. Based on a current state of the art understanding of the mechanism of +1 PRF, FSscan calculates scores for a 16-nt window along a gene sequence according to different effects of the stimulatory signals, and ribosome E-, P- and A-site interactions. FSscan successfully identified the +1 PRF site in prfB and predicted yehP, pepP, nuoE and cheA as +1 frameshift candidates in the E. coli genome. Empirical results demonstrated that potential +1 frameshift sequences identified promoted significant levels of +1 frameshifting in vivo. Mass spectrometry analysis confirmed the presence of the frameshifted proteins expressed from a yehP-egfp fusion construct. FSscan allows a genome-wide and systematic search for +1 frameshift sites in E. coli. The results have implications for bioinformatic identification of novel frameshift proteins, ribosomal frameshifting, coding sequence detection and the application of mass spectrometry on studying frameshift proteins. PMID:19783813

  6. Spotlight on Making Music with Special Learners

    ERIC Educational Resources Information Center

    Rowman & Littlefield Education, 2004

    2004-01-01

    The newest publication in the Spotlight series, this book gathers articles from state music educators association journals that give music teachers ideas on how to include special needs students, discuss why special learners benefit from music education, offer suggestions for dealing with specific types of special needs students, and address…

  7. Transfer, Honors and Excellence: Six Districts Spotlighted.

    ERIC Educational Resources Information Center

    CSCC Bulletin, 1982

    1982-01-01

    Brief descriptions are provided of the honors programs offered at six community college districts. After an introductory discussion of the benefits, goals, and elements of honors programs, spotlighted programs are described, with some variation, in terms of activities, admissions requirements, academic standards, faculty involvement, association…

  8. Spotlight on Transition to Teaching Music

    ERIC Educational Resources Information Center

    MENC: The National Association for Music Education, 2004

    2004-01-01

    The latest title in the popular Spotlight series, this timely book focuses on issues involving recruitment and retention of music teachers, a crucial issue in these days of budget constraints. Arranged chronologically, it features a collection of articles from state journals focusing on issues such as mentoring, teacher shortages, burnout, and…

  9. High frequency of +1 programmed ribosomal frameshifting in Euplotes octocarinatus

    PubMed Central

    Wang, Ruanlin; Xiong, Jie; Wang, Wei; Miao, Wei; Liang, Aihua

    2016-01-01

    Programmed −1 ribosomal frameshifting (−1 PRF) has been identified as a mechanism to regulate the expression of many viral genes and some cellular genes. The slippery site of −1 PRF has been well characterized, whereas the +1 PRF signal and the mechanism involved in +1 PRF remain poorly understood. Previous study confirmed that +1 PRF is required for the synthesis of protein products in several genes of ciliates from the genus Euplotes. To accurately assess the frequency of genes requiring frameshift in Euplotes, the macronuclear genome and transcriptome of Euplotes octocarinatus were analyzed in this study. A total of 3,700 +1 PRF candidate genes were identified from 32,353 transcripts, and the gene products of these putative +1 PRFs were mainly identified as protein kinases. Furthermore, we reported a putative suppressor tRNA of UAA which may provide new insights into the mechanism of +1 PRF in euplotids. For the first time, our transcriptome-wide survey of +1 PRF in E. octocarinatus provided a dataset which serves as a valuable resource for the future understanding of the mechanism underlying +1 PRF. PMID:26891713

  10. Dystrophin in frameshift deletion patients with Becker Muscular Dystrophy

    SciTech Connect

    Gangopadhyay, S.B.; Ray, P.N.; Worton, R.G.; Sherratt, T.G.; Heckmatt, J.Z.; Dubowitz, V.; Strong, P.N.; Miller, G. ); Shokeir, M. )

    1992-09-01

    In a previous study the authors identified 14 cases with Duchenne muscular dystrophy (DMD) or its milder variant, Becker muscular dystrophy (BMD), with a deletion of exons 3-7, a deletion that would be expected to shift the translational reading frame of the mRNA and give a severe phenotype. They have examined dystrophin and its mRNA from muscle biopsies of seven cases with either mild or intermediate phenotypes. In all cases they detected slightly lower-molecular-weight dystrophin in 12%-15% abundance relative to the normal. By sequencing amplified mRNA they have found that exon 2 is spliced to exon 8, a splice that produces a frameshifted mRNA, and have found no evidence for alternate splicing that might be involved in restoration of dystrophin mRNA reading frame in the patients with a mild phenotype. Other transcriptional and posttranscriptional mechanisms such as cryptic promoter, ribosomal frameshifting, and reinitiation are suggested that might play some role in restoring the reading frame. 34 refs., 5 figs. 1 tab.

  11. Ribosomal frameshifting and dual-target antiactivation restrict quorum-sensing–activated transfer of a mobile genetic element

    PubMed Central

    Ramsay, Joshua P.; Tester, Laura G. L.; Major, Anthony S.; Sullivan, John T.; Edgar, Christina D.; Kleffmann, Torsten; Patterson-House, Jackson R.; Hall, Drew A.; Tate, Warren P.; Hynes, Michael F.; Ronson, Clive W.

    2015-01-01

    Symbiosis islands are integrative and conjugative mobile genetic elements that convert nonsymbiotic rhizobia into nitrogen-fixing symbionts of leguminous plants. Excision of the Mesorhizobium loti symbiosis island ICEMlSymR7A is indirectly activated by quorum sensing through TraR-dependent activation of the excisionase gene rdfS. Here we show that a +1 programmed ribosomal frameshift (PRF) fuses the coding sequences of two TraR-activated genes, msi172 and msi171, producing an activator of rdfS expression named Frameshifted excision activator (FseA). Mass-spectrometry and mutational analyses indicated that the PRF occurred through +1 slippage of the tRNAphe from UUU to UUC within a conserved msi172-encoded motif. FseA activated rdfS expression in the absence of ICEMlSymR7A, suggesting that it directly activated rdfS transcription, despite being unrelated to any characterized DNA-binding proteins. Bacterial two-hybrid and gene-reporter assays demonstrated that FseA was also bound and inhibited by the ICEMlSymR7A-encoded quorum-sensing antiactivator QseM. Thus, activation of ICEMlSymR7A excision is counteracted by TraR antiactivation, ribosomal frameshifting, and FseA antiactivation. This robust suppression likely dampens the inherent biological noise present in the quorum-sensing autoinduction circuit and ensures that ICEMlSymR7A transfer only occurs in a subpopulation of cells in which both qseM expression is repressed and FseA is translated. The architecture of the ICEMlSymR7A transfer regulatory system provides an example of how a set of modular components have assembled through evolution to form a robust genetic toggle that regulates gene transcription and translation at both single-cell and cell-population levels. PMID:25787256

  12. Activity Suppression Behavior Phenotype in SULT4A1 Frameshift Mutant Zebrafish

    PubMed Central

    Crittenden, Frank; Thomas, Holly R.; Parant, John M.

    2015-01-01

    Since its identification in 2000, sulfotransferase (SULT) 4A1 has presented an enigma to the field of cytosolic SULT biology. SULT4A1 is exclusively expressed in neural tissue, is highly conserved, and has been identified in every vertebrate studied to date. Despite this singular level of conservation, no substrate or function for SULT4A1 has been identified. Previous studies demonstrated that SULT4A1 does not bind the obligate sulfate donor, 3′-phosphoadenosine-5′-phosphosulfate, yet SULT4A1 is classified as a SULT superfamily member based on sequence and structural similarities to the other SULTs. In this study, transcription activator-like effector nucleases were used to generate heritable mutations in the SULT4A1 gene of zebrafish. The mutation (SULT4A1Δ8) consists of an 8-nucleotide deletion within the second exon of the gene, resulting in a frameshift mutation and premature stop codon after 132 AA. During early adulthood, casual observations were made that mutant zebrafish were exhibiting excessively sedentary behavior during the day. These observations were inconsistent with published reports on activity in zebrafish that are largely diurnal organisms and are highly active during the day. Thus, a decrease in activity during the day represents an abnormal behavior and warranted further systematic analysis. EthoVision video tracking software was used to monitor activity levels in wild-type (WT) and SULT4A1Δ8/Δ8 fish over 48 hours of a normal light/dark cycle. SULT4A1Δ8/Δ8 fish were shown to exhibit increased inactivity bout length and frequency as well as a general decrease in daytime activity levels when compared with their WT counterparts. PMID:25934576

  13. Activity Suppression Behavior Phenotype in SULT4A1 Frameshift Mutant Zebrafish.

    PubMed

    Crittenden, Frank; Thomas, Holly R; Parant, John M; Falany, Charles N

    2015-07-01

    Since its identification in 2000, sulfotransferase (SULT) 4A1 has presented an enigma to the field of cytosolic SULT biology. SULT4A1 is exclusively expressed in neural tissue, is highly conserved, and has been identified in every vertebrate studied to date. Despite this singular level of conservation, no substrate or function for SULT4A1 has been identified. Previous studies demonstrated that SULT4A1 does not bind the obligate sulfate donor, 3'-phosphoadenosine-5'-phosphosulfate, yet SULT4A1 is classified as a SULT superfamily member based on sequence and structural similarities to the other SULTs. In this study, transcription activator-like effector nucleases were used to generate heritable mutations in the SULT4A1 gene of zebrafish. The mutation (SULT4A1(Δ8)) consists of an 8-nucleotide deletion within the second exon of the gene, resulting in a frameshift mutation and premature stop codon after 132 AA. During early adulthood, casual observations were made that mutant zebrafish were exhibiting excessively sedentary behavior during the day. These observations were inconsistent with published reports on activity in zebrafish that are largely diurnal organisms and are highly active during the day. Thus, a decrease in activity during the day represents an abnormal behavior and warranted further systematic analysis. EthoVision video tracking software was used to monitor activity levels in wild-type (WT) and SULT4A1(Δ8/Δ8) fish over 48 hours of a normal light/dark cycle. SULT4A1(Δ8/Δ8) fish were shown to exhibit increased inactivity bout length and frequency as well as a general decrease in daytime activity levels when compared with their WT counterparts. PMID:25934576

  14. Programmed Ribosomal Frameshifting Mediates Expression of the α-Carboxysome.

    PubMed

    Chaijarasphong, Thawatchai; Nichols, Robert J; Kortright, Kaitlyn E; Nixon, Charlotte F; Teng, Poh K; Oltrogge, Luke M; Savage, David F

    2016-01-16

    Many bacteria employ a protein organelle, the carboxysome, to catalyze carbon dioxide fixation in the Calvin Cycle. Only 10 genes from Halothiobacillus neapolitanus are sufficient for heterologous expression of carboxysomes in Escherichia coli, opening the door to detailed mechanistic analysis of the assembly process of this complex (more than 200MDa). One of these genes, csoS2, has been implicated in assembly but ascribing a molecular function is confounded by the observation that the single csoS2 gene yields expression of two gene products and both display an apparent molecular weight incongruent with the predicted amino acid sequence. Here, we elucidate the co-translational mechanism responsible for the expression of the two protein isoforms. Specifically, csoS2 was found to possess -1 frameshifting elements that lead to the production of the full-length protein, CsoS2B, and a truncated protein, CsoS2A, which possesses a C-terminus translated from the alternate frame. The frameshifting elements comprise both a ribosomal slippery sequence and a 3' secondary structure, and ablation of either sequence is sufficient to eliminate the slip. Using these mutants, we investigated the individual roles of CsoS2B and CsoS2A on carboxysome formation. In this in vivo formation assay, cells expressing only the CsoS2B isoform were capable of producing intact carboxysomes, while those with only CsoS2A were not. Thus, we have answered a long-standing question about the nature of CsoS2 in this model microcompartment and demonstrate that CsoS2B is functionally distinct from CsoS2A in the assembly of α-carboxysomes. PMID:26608811

  15. Efficient sliding spotlight SAR raw signal simulation of extended scenes

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Huang, Pingping; Deng, Yunkai

    2011-12-01

    Sliding spotlight mode is a novel synthetic aperture radar (SAR) imaging scheme with an achieved azimuth resolution better than stripmap mode and ground coverage larger than spotlight configuration. However, its raw signal simulation of extended scenes may not be efficiently implemented in the two-dimensional (2D) Fourier transformed domain. This article presents a novel sliding spotlight raw signal simulation approach from the wide-beam SAR imaging modes. This approach can generate sliding spotlight raw signal not only from raw data evaluated by the simulators, but also from real data in the stripmap/spotlight mode. In order to obtain the desired raw data from conventional stripmap/spotlight mode, the azimuth time-varying filtering, which is implemented by de-rotation and low-pass filtering, is adopted. As raw signal of extended scenes in the stripmap/spotlight mode can efficiently be evaluated in the 2D Fourier domain, the proposed approach provides an efficient sliding spotlight SAR simulator of extended scenes. Simulation results validate this efficient simulator.

  16. The Learning Management System Evolution. CDS Spotlight Report. Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service (CDS) to better understand how higher education institutions approach learning management systems (LMSs). Information provided for this Spotlight was derived from Module 8 of the Core Data Service, which contains several questions regarding information systems and applications.…

  17. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene

    PubMed Central

    Moncayo-Arlandi, Javier; Allegue, Catarina; Iglesias, Anna; Mangas, Alipio; Brugada, Ramon

    2016-01-01

    Background Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations. Methods and Results Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64) in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased), 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment. Conclusions We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures. PMID:27391596

  18. Spotlight on Technology in Education. No. 7 in the Harvard Education Letter Spotlight Series

    ERIC Educational Resources Information Center

    Walser, Nancy, Ed.

    2011-01-01

    This edited volume covers the range of critical trends in the use of computers and other devices for classroom teaching, online learning, professional development, school improvement, and student assessment. "Spotlight on Technology in Education" draws on expert sources including teacher-leaders, librarians, researchers, and trainers who share…

  19. Spotlight on Student Engagement, Motivation, and Achievement. No. 5 in the Harvard Education Letter Spotlight Series

    ERIC Educational Resources Information Center

    Chauncey, Caroline T., Ed.; Walser, Nancy, Ed.

    2009-01-01

    Only when students feel engaged both socially and academically can schools and teachers lay the groundwork to motivate achievement. This volume, the fifth in the "Harvard Education Letter" Spotlight series, brings together fifteen seminal articles that examine research and practice on these complex and interrelated issues. Contributors include:…

  20. Structural and Functional Characterization of Programmed Ribosomal Frameshift Signals in West Nile Virus Strains Reveals High Structural Plasticity Among cis-Acting RNA Elements.

    PubMed

    Moomau, Christine; Musalgaonkar, Sharmishtha; Khan, Yousuf A; Jones, John E; Dinman, Jonathan D

    2016-07-22

    West Nile virus (WNV) is a prototypical emerging virus for which no effective therapeutics currently exist. WNV uses programmed -1 ribosomal frameshifting (-1 PRF) to synthesize the NS1' protein, a C terminally extended version of its non-structural protein 1, the expression of which enhances neuro-invasiveness and viral RNA abundance. Here, the NS1' frameshift signals derived from four WNV strains were investigated to better understand -1 PRF in this quasispecies. Sequences previously predicted to promote -1 PRF strongly promote this activity, but frameshifting was significantly more efficient upon inclusion of additional 3' sequence information. The observation of different rates of -1 PRF, and by inference differences in the expression of NS1', may account for the greater degrees of pathogenesis associated with specific WNV strains. Chemical modification and mutational analyses of the longer and shorter forms of the -1 PRF signals suggests dynamic structural rearrangements between tandem stem-loop and mRNA pseudoknot structures in two of the strains. A model is suggested in which this is employed as a molecular switch to fine tune the relative expression of structural to non-structural proteins during different phases of the viral replication cycle. PMID:27226636

  1. Crystal Structure of a Luteoviral RNA Pseudoknot and Model for a Minimal Ribosomal Frameshifting Motif

    SciTech Connect

    Pallan, Pradeep S.; Marshall, William S.; Harp, Joel; Jewett III, Frederic C.; Wawrzak, Zdzislaw; Brown II, Bernard A.; Rich, Alexander; Egli, Martin

    2010-03-08

    To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter. Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.

  2. The three transfer RNAs occupying the A, P and E sites on the ribosome are involved in viral programmed -1 ribosomal frameshift

    PubMed Central

    Léger, Mélissa; Dulude, Dominic; Steinberg, Sergey V.; Brakier-Gingras, Léa

    2007-01-01

    The -1 programmed ribosomal frameshifts (PRF), which are used by many viruses, occur at a heptanucleotide slippery sequence and are currently thought to involve the tRNAs interacting with the ribosomal P- and A-site codons. We investigated here whether the tRNA occupying the ribosomal E site that precedes a slippery site influences -1 PRF. Using the human immunodeficiency virus type 1 (HIV-1) frameshift region, we found that mutating the E-site codon altered the -1 PRF efficiency. When the HIV-1 slippery sequence was replaced with other viral slippery sequences, mutating the E-site codon also altered the -1 PRF efficiency. Because HIV-1 -1 PRF can be recapitulated in bacteria, we used a bacterial ribosome system to select, by random mutagenesis, 16S ribosomal RNA (rRNA) mutations that modify the expression of a reporter requiring HIV-1 -1 PRF. Three mutants were isolated, which are located in helices 21 and 22 of 16S rRNA, a region involved in translocation and E-site tRNA binding. We propose a novel model where -1 PRF is triggered by an incomplete translocation and depends not only on the tRNAs interacting with the P- and A-site codons, but also on the tRNA occupying the E site. PMID:17704133

  3. HIV-1 and Human PEG10 Frameshift Elements Are Functionally Distinct and Distinguished by Novel Small Molecule Modulators

    PubMed Central

    Sleebs, Brad E.; Lackovic, Kurt; Parisot, John P.; Moss, Rebecca M.; Crowe-McAuliffe, Caillan; Mathew, Suneeth F.; Edgar, Christina D.; Kleffmann, Torsten; Tate, Warren P.

    2015-01-01

    Frameshifting during translation of viral or in rare cases cellular mRNA results in the synthesis of proteins from two overlapping reading frames within the same mRNA. In HIV-1 the protease, reverse transcriptase, and integrase enzymes are in a second reading frame relative to the structural group-specific antigen (gag), and their synthesis is dependent upon frameshifting. This ensures that a strictly regulated ratio of structural proteins and enzymes, which is critical for HIV-1 replication and viral infectivity, is maintained during protein synthesis. The frameshift element in HIV-1 RNA is an attractive target for the development of a new class of anti HIV-1 drugs. However, a number of examples are now emerging of human genes using −1 frameshifting, such as PEG10 and CCR5. In this study we have compared the HIV-1 and PEG10 frameshift elements and shown they have distinct functional characteristics. Frameshifting occurs at several points within each element. Moreover, frameshift modulators that were isolated by high-throughput screening of a library of 114,000 lead-like compounds behaved differently with the PEG10 frameshift element. The most effective compounds affecting the HIV-1 element enhanced frameshifting by 2.5-fold at 10 μM in two different frameshift reporter assay systems. HIV-1 protease:gag protein ratio was affected by a similar amount in a specific assay of virally-infected cultured cell, but the modulation of frameshifting of the first-iteration compounds was not sufficient to show significant effects on viral infectivity. Importantly, two compounds did not affect frameshifting with the human PEG10 element, while one modestly inhibited rather than enhanced frameshifting at the human element. These studies indicate that frameshift elements have unique characteristics that may allow targeting of HIV-1 and of other viruses specifically for development of antiviral therapeutic molecules without effect on human genes like PEG10 that use the same

  4. Nuclear Fuels & Materials Spotlight Volume 4

    SciTech Connect

    I. J. van Rooyen,; T. M. Lillo; Y. Q. WU; P.A. Demkowicz; L. Scott; D.M. Scates; E. L. Reber; J. H. Jackson; J. A. Smith; D.L. Cottle; B.H. Rabin; M.R. Tonks; S.B. Biner; Y. Zhang; R.L. Williamson; S.R. Novascone; B.W. Spencer; J.D. Hales; D.R. Gaston; C.J. Permann; D. Anders; S.L. Hayes; P.C. Millett; D. Andersson; C. Stanek; R. Ali; S.L. Garrett; J.E. Daw; J.L. Rempe; J. Palmer; B. Tittmann; B. Reinhardt; G. Kohse; P. Ramuhali; H.T. Chien; T. Unruh; B.M. Chase; D.W. Nigg; G. Imel; J. T. Harris

    2014-04-01

    As the nation's nuclear energy laboratory, Idaho National Laboratory brings together talented people and specialized nuclear research capability to accomplish our mission. This edition of the Nuclear Fuels and Materials Division Spotlight provides an overview of some of our recent accomplishments in research and capability development. These accomplishments include: • The first identification of silver and palladium migrating through the SiC layer in TRISO fuel • A description of irradiation assisted stress corrosion testing capabilities that support commercial light water reactor life extension • Results of high-temperature safety testing on coated particle fuels irradiated in the ATR • New methods for testing the integrity of irradiated plate-type reactor fuel • Description of a 'Smart Fuel' concept that wirelessly provides real time information about changes in nuclear fuel properties and operating conditions • Development and testing of ultrasonic transducers and real-time flux sensors for use inside reactor cores, and • An example of a capsule irradiation test. Throughout Spotlight, you'll find examples of productive partnerships with academia, industry, and government agencies that deliver high-impact outcomes. The work conducted at Idaho National Laboratory helps to spur innovation in nuclear energy applications that drive economic growth and energy security. We appreciate your interest in our work here at INL, and hope that you find this issue informative.

  5. Isoleucine starvation caused by sulfometuron methyl in Salmonella typhimurium measured by translational frameshifting.

    PubMed

    Kaplun, Alexander; Chipman, David M; Barak, Ze'ev

    2002-03-01

    The authors have developed a tool for the study of inhibitor-induced amino acid starvation in bacteria which exploits the phenomenon of translational frameshifting. The inhibition of acetohydroxyacid synthase II by the herbicide sulfometuron methyl (SMM) has complex effects on branched-chain amino acid biosynthesis. Experiments were done with Salmonella typhimurium containing a plasmid with an isoleucine codon in a 'shifty' region, prone to translational frameshifting. SMM did not cause translational frameshifting in minimal medium under conditions that inhibit growth. A 20-fold higher concentration of SMM was required to cause starvation for isoleucine, e.g. in the presence of valine. This starvation was reflected in translational frameshifting correlated with inhibition of growth. These observations support the authors' previous suggestions based on other techniques. The method used here could be generalized for the study of complex metabolic effects related to amino acids. PMID:11882705

  6. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use

    PubMed Central

    Atkins, John F.; Loughran, Gary; Bhatt, Pramod R.; Firth, Andrew E.; Baranov, Pavel V.

    2016-01-01

    Genetic decoding is not ‘frozen’ as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational ‘correction’ of problem or ‘savior’ indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5′ or 3′ of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3′ from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. PMID:27436286

  7. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    PubMed

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-01

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. PMID:27436286

  8. Analysis of tetra- and hepta-nucleotides motifs promoting -1 ribosomal frameshifting in Escherichia coli

    PubMed Central

    Sharma, Virag; Prère, Marie-Françoise; Canal, Isabelle; Firth, Andrew E.; Atkins, John F.; Baranov, Pavel V.; Fayet, Olivier

    2014-01-01

    Programmed ribosomal -1 frameshifting is a non-standard decoding process occurring when ribosomes encounter a signal embedded in the mRNA of certain eukaryotic and prokaryotic genes. This signal has a mandatory component, the frameshift motif: it is either a Z_ZZN tetramer or a X_XXZ_ZZN heptamer (where ZZZ and XXX are three identical nucleotides) allowing cognate or near-cognate repairing to the -1 frame of the A site or A and P sites tRNAs. Depending on the signal, the frameshifting frequency can vary over a wide range, from less than 1% to more than 50%. The present study combines experimental and bioinformatics approaches to carry out (i) a systematic analysis of the frameshift propensity of all possible motifs (16 Z_ZZN tetramers and 64 X_XXZ_ZZN heptamers) in Escherichia coli and (ii) the identification of genes potentially using this mode of expression amongst 36 Enterobacteriaceae genomes. While motif efficiency varies widely, a major distinctive rule of bacterial -1 frameshifting is that the most efficient motifs are those allowing cognate re-pairing of the A site tRNA from ZZN to ZZZ. The outcome of the genomic search is a set of 69 gene clusters, 59 of which constitute new candidates for functional utilization of -1 frameshifting. PMID:24875478

  9. Analysis of tetra- and hepta-nucleotides motifs promoting -1 ribosomal frameshifting in Escherichia coli.

    PubMed

    Sharma, Virag; Prère, Marie-Françoise; Canal, Isabelle; Firth, Andrew E; Atkins, John F; Baranov, Pavel V; Fayet, Olivier

    2014-06-01

    Programmed ribosomal -1 frameshifting is a non-standard decoding process occurring when ribosomes encounter a signal embedded in the mRNA of certain eukaryotic and prokaryotic genes. This signal has a mandatory component, the frameshift motif: it is either a Z_ZZN tetramer or a X_XXZ_ZZN heptamer (where ZZZ and XXX are three identical nucleotides) allowing cognate or near-cognate repairing to the -1 frame of the A site or A and P sites tRNAs. Depending on the signal, the frameshifting frequency can vary over a wide range, from less than 1% to more than 50%. The present study combines experimental and bioinformatics approaches to carry out (i) a systematic analysis of the frameshift propensity of all possible motifs (16 Z_ZZN tetramers and 64 X_XXZ_ZZN heptamers) in Escherichia coli and (ii) the identification of genes potentially using this mode of expression amongst 36 Enterobacteriaceae genomes. While motif efficiency varies widely, a major distinctive rule of bacterial -1 frameshifting is that the most efficient motifs are those allowing cognate re-pairing of the A site tRNA from ZZN to ZZZ. The outcome of the genomic search is a set of 69 gene clusters, 59 of which constitute new candidates for functional utilization of -1 frameshifting. PMID:24875478

  10. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  11. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    PubMed Central

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  12. Spacer-length dependence of programmed −1 or −2 ribosomal frameshifting on a U6A heptamer supports a role for messenger RNA (mRNA) tension in frameshifting

    PubMed Central

    Lin, Zhaoru; Gilbert, Robert J. C.; Brierley, Ian

    2012-01-01

    Programmed −1 ribosomal frameshifting is employed in the expression of a number of viral and cellular genes. In this process, the ribosome slips backwards by a single nucleotide and continues translation of an overlapping reading frame, generating a fusion protein. Frameshifting signals comprise a heptanucleotide slippery sequence, where the ribosome changes frame, and a stimulatory RNA structure, a stem–loop or RNA pseudoknot. Antisense oligonucleotides annealed appropriately 3′ of a slippery sequence have also shown activity in frameshifting, at least in vitro. Here we examined frameshifting at the U6A slippery sequence of the HIV gag/pol signal and found high levels of both −1 and −2 frameshifting with stem–loop, pseudoknot or antisense oligonucleotide stimulators. By examining −1 and −2 frameshifting outcomes on mRNAs with varying slippery sequence-stimulatory RNA spacing distances, we found that −2 frameshifting was optimal at a spacer length 1–2 nucleotides shorter than that optimal for −1 frameshifting with all stimulatory RNAs tested. We propose that the shorter spacer increases the tension on the mRNA such that when the tRNA detaches, it more readily enters the −2 frame on the U6A heptamer. We propose that mRNA tension is central to frameshifting, whether promoted by stem–loop, pseudoknot or antisense oligonucleotide stimulator. PMID:22743270

  13. Transcriptional Profile Analysis of RPGRORF15 Frameshift Mutation Identifies Novel Genes Associated with Retinal Degeneration

    PubMed Central

    Genini, Sem; Zangerl, Barbara; Slavik, Julianna; Acland, Gregory M.; Beltran, William A.

    2010-01-01

    Purpose. To identify genes and molecular mechanisms associated with photoreceptor degeneration in a canine model of XLRP caused by an RPGR exon ORF15 microdeletion. Methods. Expression profiles of mutant and normal retinas were compared by using canine retinal custom cDNA microarrays. qRT-PCR, Western blot analysis, and immunohistochemistry (IHC) were applied to selected genes, to confirm and expand the microarray results. Results. At 7 and 16 weeks, respectively, 56 and 18 transcripts were downregulated in the mutant retinas, but none were differentially expressed (DE) at both ages, suggesting the involvement of temporally distinct pathways. Downregulated genes included the known retina-relevant genes PAX6, CHML, and RDH11 at 7 weeks and CRX and SAG at 16 weeks. Genes directly or indirectly active in apoptotic processes were altered at 7 weeks (CAMK2G, NTRK2, PRKCB, RALA, RBBP6, RNF41, SMYD3, SPP1, and TUBB2C) and 16 weeks (SLC25A5 and NKAP). Furthermore, the DE genes at 7 weeks (ELOVL6, GLOD4, NDUFS4, and REEP1) and 16 weeks (SLC25A5 and TARS2) are related to mitochondrial functions. qRT-PCR of 18 genes confirmed the microarray results and showed DE of additional genes not on the array. Only GFAP was DE at 3 weeks of age. Western blot and IHC analyses also confirmed the high reliability of the transcriptomic data. Conclusions. Several DE genes were identified in mutant retinas. At 7 weeks, a combination of nonclassic anti- and proapoptosis genes appear to be involved in photoreceptor degeneration, whereas at both 7 and 16 weeks, the expression of mitochondria-related genes indicates that they may play a relevant role in the disease process. PMID:20574030

  14. TCF12 is mutated in anaplastic oligodendroglioma.

    PubMed

    Labreche, Karim; Simeonova, Iva; Kamoun, Aurélie; Gleize, Vincent; Chubb, Daniel; Letouzé, Eric; Riazalhosseini, Yasser; Dobbins, Sara E; Elarouci, Nabila; Ducray, Francois; de Reyniès, Aurélien; Zelenika, Diana; Wardell, Christopher P; Frampton, Mathew; Saulnier, Olivier; Pastinen, Tomi; Hallout, Sabrina; Figarella-Branger, Dominique; Dehais, Caroline; Idbaih, Ahmed; Mokhtari, Karima; Delattre, Jean-Yves; Huillard, Emmanuelle; Mark Lathrop, G; Sanson, Marc; Houlston, Richard S

    2015-01-01

    Anaplastic oligodendroglioma (AO) are rare primary brain tumours that are generally incurable, with heterogeneous prognosis and few treatment targets identified. Most oligodendrogliomas have chromosomes 1p/19q co-deletion and an IDH mutation. Here we analysed 51 AO by whole-exome sequencing, identifying previously reported frequent somatic mutations in CIC and FUBP1. We also identified recurrent mutations in TCF12 and in an additional series of 83 AO. Overall, 7.5% of AO are mutated for TCF12, which encodes an oligodendrocyte-related transcription factor. Eighty percent of TCF12 mutations identified were in either the bHLH domain, which is important for TCF12 function as a transcription factor, or were frameshift mutations leading to TCF12 truncated for this domain. We show that these mutations compromise TCF12 transcriptional activity and are associated with a more aggressive tumour type. Our analysis provides further insights into the unique and shared pathways driving AO. PMID:26068201

  15. TCF12 is mutated in anaplastic oligodendroglioma

    PubMed Central

    Labreche, Karim; Simeonova, Iva; Kamoun, Aurélie; Gleize, Vincent; Chubb, Daniel; Letouzé, Eric; Riazalhosseini, Yasser; Dobbins, Sara E.; Elarouci, Nabila; Ducray, Francois; de Reyniès, Aurélien; Zelenika, Diana; Wardell, Christopher P.; Frampton, Mathew; Saulnier, Olivier; Pastinen, Tomi; Hallout, Sabrina; Figarella-Branger, Dominique; Dehais, Caroline; Idbaih, Ahmed; Mokhtari, Karima; Delattre, Jean-Yves; Huillard, Emmanuelle; Mark Lathrop, G.; Sanson, Marc; Houlston, Richard S.; Adam, Clovis; Andraud, Marie; Aubriot-Lorton, Marie-Hélène; Bauchet, Luc; Beauchesne, Patrick; Blechet, Claire; Campone, Mario; Carpentier, Antoine; Carpentier, Catherine; Carpiuc, Ioana; Chenard, Marie-Pierre; Chiforeanu, Danchristian; Chinot, Olivier; Cohen-Moyal, Elisabeth; Colin, Philippe; Dam-Hieu, Phong; Desenclos, Christine; Desse, Nicolas; Dhermain, Frederic; Diebold, Marie-Danièle; Eimer, Sandrine; Faillot, Thierry; Fesneau, Mélanie; Fontaine, Denys; Gaillard, Stéphane; Gauchotte, Guillaume; Gaultier, Claude; Ghiringhelli, Francois; Godard, Joel; Marcel Gueye, Edouard; Sebastien Guillamo, Jean; Hamdi-Elouadhani, Selma; Honnorat, Jerome; Louis Kemeny, Jean; Khallil, Toufik; Jouvet, Anne; Labrousse, Francois; Langlois, Olivier; Laquerriere, Annie; Lechapt-Zalcman, Emmanuelle; Le Guérinel, Caroline; Levillain, Pierre-Marie; Loiseau, Hugues; Loussouarn, Delphine; Maurage, Claude-Alain; Menei, Philippe; Janette Motsuo Fotso, Marie; Noel, Georges; Parker, Fabrice; Peoc'h, Michel; Polivka, Marc; Quintin-Roué, Isabelle; Ramirez, Carole; Ricard, Damien; Richard, Pomone; Rigau, Valérie; Rousseau, Audrey; Runavot, Gwenaelle; Sevestre, Henri; Christine Tortel, Marie; Uro-Coste, Emmanuelle; Burel-Vandenbos, Fanny; Vauleon, Elodie; Viennet, Gabriel; Villa, Chiara; Wager, Michel

    2015-01-01

    Anaplastic oligodendroglioma (AO) are rare primary brain tumours that are generally incurable, with heterogeneous prognosis and few treatment targets identified. Most oligodendrogliomas have chromosomes 1p/19q co-deletion and an IDH mutation. Here we analysed 51 AO by whole-exome sequencing, identifying previously reported frequent somatic mutations in CIC and FUBP1. We also identified recurrent mutations in TCF12 and in an additional series of 83 AO. Overall, 7.5% of AO are mutated for TCF12, which encodes an oligodendrocyte-related transcription factor. Eighty percent of TCF12 mutations identified were in either the bHLH domain, which is important for TCF12 function as a transcription factor, or were frameshift mutations leading to TCF12 truncated for this domain. We show that these mutations compromise TCF12 transcriptional activity and are associated with a more aggressive tumour type. Our analysis provides further insights into the unique and shared pathways driving AO. PMID:26068201

  16. Leber congenital amaurosis: from darkness to spotlight.

    PubMed

    Kaplan, Josseline

    2008-09-01

    Almost 150 years ago, Theodor Leber described a severe form of vision loss at or near birth which was later given his name. During the century that followed this description, ophthalmologists dedicated efforts to give an accurate definition of the disease but patients were neglected because of the inability of physicians to provide them with treatment. In the 90s, at the time of the Golden Age of Linkage, the first LCA locus was mapped to a human chromosome and shortly after identified as the gene for guanylate cyclase. This discovery was the spark that made the disease emerge from the shadows as illustrated by the flood of LCA genes identified in the following ten-year period. During the same time period, the clinical variability of the disease was rediscovered and an unexpected physiopathological heterogeneity demonstrated. In the beginning of the third millennium, LCA came out definitively from the tunnel to shine under the bright spotlights with the RPE65 gene therapy trial that succeeded to restore vision in a dog model and opened the door to gene therapy trials in humans. PMID:18766987

  17. A general strategy to inhibiting viral -1 frameshifting based on upstream attenuation duplex formation.

    PubMed

    Hu, Hao-Teng; Cho, Che-Pei; Lin, Ya-Hui; Chang, Kung-Yao

    2016-01-01

    Viral -1 programmed ribosomal frameshifting (PRF) as a potential antiviral target has attracted interest because many human viral pathogens, including human immunodeficiency virus (HIV) and coronaviruses, rely on -1 PRF for optimal propagation. Efficient eukaryotic -1 PRF requires an optimally placed stimulator structure downstream of the frameshifting site and different strategies targeting viral -1 PRF stimulators have been developed. However, accessing particular -1 PRF stimulator information represents a bottle-neck in combating the emerging epidemic viral pathogens such as Middle East respiratory syndrome coronavirus (MERS-CoV). Recently, an RNA hairpin upstream of frameshifting site was shown to act as a cis-element to attenuate -1 PRF with mechanism unknown. Here, we show that an upstream duplex formed in-trans, by annealing an antisense to its complementary mRNA sequence upstream of frameshifting site, can replace an upstream hairpin to attenuate -1 PRF efficiently. This finding indicates that the formation of a proximal upstream duplex is the main determining factor responsible for -1 PRF attenuation and provides mechanistic insight. Additionally, the antisense-mediated upstream duplex approach downregulates -1 PRF stimulated by distinct -1 PRF stimulators, including those of MERS-CoV, suggesting its general application potential as a robust means to evaluating viral -1 PRF inhibition as soon as the sequence information of an emerging human coronavirus is available. PMID:26612863

  18. A general strategy to inhibiting viral −1 frameshifting based on upstream attenuation duplex formation

    PubMed Central

    Hu, Hao-Teng; Cho, Che-Pei; Lin, Ya-Hui; Chang, Kung-Yao

    2016-01-01

    Viral −1 programmed ribosomal frameshifting (PRF) as a potential antiviral target has attracted interest because many human viral pathogens, including human immunodeficiency virus (HIV) and coronaviruses, rely on −1 PRF for optimal propagation. Efficient eukaryotic −1 PRF requires an optimally placed stimulator structure downstream of the frameshifting site and different strategies targeting viral −1 PRF stimulators have been developed. However, accessing particular −1 PRF stimulator information represents a bottle-neck in combating the emerging epidemic viral pathogens such as Middle East respiratory syndrome coronavirus (MERS-CoV). Recently, an RNA hairpin upstream of frameshifting site was shown to act as a cis-element to attenuate −1 PRF with mechanism unknown. Here, we show that an upstream duplex formed in-trans, by annealing an antisense to its complementary mRNA sequence upstream of frameshifting site, can replace an upstream hairpin to attenuate −1 PRF efficiently. This finding indicates that the formation of a proximal upstream duplex is the main determining factor responsible for −1 PRF attenuation and provides mechanistic insight. Additionally, the antisense-mediated upstream duplex approach downregulates −1 PRF stimulated by distinct −1 PRF stimulators, including those of MERS-CoV, suggesting its general application potential as a robust means to evaluating viral −1 PRF inhibition as soon as the sequence information of an emerging human coronavirus is available. PMID:26612863

  19. Iron status in patients with pyruvate kinase deficiency: neonatal hyperferritinaemia associated with a novel frameshift deletion in the PKLR gene (p.Arg518fs), and low hepcidin to ferritin ratios.

    PubMed

    Mojzikova, Renata; Koralkova, Pavla; Holub, Dusan; Zidova, Zuzana; Pospisilova, Dagmar; Cermak, Jaroslav; Striezencova Laluhova, Zuzana; Indrak, Karel; Sukova, Martina; Partschova, Martina; Kucerova, Jana; Horvathova, Monika; Divoky, Vladimir

    2014-05-01

    Pyruvate kinase (PK) deficiency is an iron-loading anaemia characterized by chronic haemolysis, ineffective erythropoiesis and a requirement for blood transfusion in most cases. We studied 11 patients from 10 unrelated families and found nine different disease-causing PKLR mutations. Two of these mutations - the point mutation c.878A>T (p.Asp293Val) and the frameshift deletion c.1553delG (p.(Arg518Leufs*12)) - have not been previously described in the literature. This frameshift deletion was associated with an unusually severe phenotype involving neonatal hyperferritinaemia that is not typical of PK deficiency. No disease-causing mutations in genes associated with haemochromatosis could be found. Inappropriately low levels of hepcidin with respect to iron loading were detected in all PK-deficient patients with increased ferritin, confirming the predominant effect of accelerated erythropoiesis on hepcidin production. Although the levels of a putative hepcidin suppressor, growth differentiation factor-15, were increased in PK-deficient patients, no negative correlation with hepcidin was found. This result indicates the existence of another as-yet unidentified erythroid regulator of hepcidin synthesis in PK deficiency. PMID:24533562

  20. Birt-Hogg-Dubé syndrome: novel FLCN frameshift deletion in daughter and father with renal cell carcinomas.

    PubMed

    Näf, Ernst; Laubscher, Dominik; Hopfer, Helmut; Streit, Markus; Matyas, Gabor

    2016-01-01

    Germline mutation of the FLCN gene causes Birt-Hogg-Dubé syndrome (BHD), a rare autosomal dominant condition characterized by skin fibrofolliculomas, lung cysts, spontaneous pneumothorax and renal tumours. We identified a hitherto unreported pathogenic FLCN frameshift deletion c.563delT (p.Phe188Serfs*35) in a family of a 46-year-old woman presented with macrohematuria due to bilateral chromophobe renal carcinomas. A heritable renal cancer was suspected due to the bilaterality of the tumour and as the father of this woman had suffered from renal cancer. Initially, however, BHD was overlooked by the medical team despite the highly suggestive clinical presentation. We assume that BHD is underdiagnosed, at least partially, due to low awareness of this variable condition and to insufficient use of appropriate genetic testing. Our study indicates that BHD and FLCN testing should be routinely considered in patients with positive family or personal history of renal tumours. In addition, we demonstrate how patients and their families can play a driving role in initiating genetic diagnosis, presymptomatic testing of at-risk relatives, targeted disease management, and genetic counselling of rare diseases such as BHD. PMID:26342594

  1. Calreticulin Mutations in Myeloproliferative Neoplasms

    PubMed Central

    Lavi, Noa

    2014-01-01

    With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph−) myeloproliferative neoplasms (MPNs) in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET) and primary myelofibrosis (PMF). At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR) using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations) and recurrent 5-bp insertions (type 2 mutations) in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin) were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph− MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review. PMID:25386351

  2. Calreticulin mutations in myeloproliferative neoplasms.

    PubMed

    Lavi, Noa

    2014-10-01

    With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph(-)) myeloproliferative neoplasms (MPNs) in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET) and primary myelofibrosis (PMF). At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR) using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations) and recurrent 5-bp insertions (type 2 mutations) in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin) were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph(-) MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review. PMID:25386351

  3. Spotlight on rice: an update from the Rice Division

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This short paper is a 'spotlight' on the Rice Division of the Marican Association of Cereal Chemists, International and features an update and future challenges in rice research and industry. Since rice is consumed largely as milled white rice intact kernals, size, shape, color, appearance, function...

  4. Spotlight on General Music: Teaching Toward the Standards

    ERIC Educational Resources Information Center

    Rowman & Littlefield Education, 2005

    2005-01-01

    General music teachers at all levels--elementary, middle school, and high school--will find ideas, suggestions, and lesson plans for teaching to the National Standards in this new addition to the popular Spotlight series. It includes sections on teaching each of the nine standards, as well as chapters about secondary general music, assessment, and…

  5. New England after 3 PM: Spotlight on Connecticut

    ERIC Educational Resources Information Center

    Afterschool Alliance, 2007

    2007-01-01

    "Spotlight on Connecticut" is the second installment in "New England After 3 PM". The first release in May 2006 took a look at afterschool across the region with a special focus on Massachusetts. Additional reports focusing on other states in the region will follow. For this report, the Afterschool Alliance worked with the Connecticut After…

  6. Early Childhood Teacher Institutions Listed. NCEDL Spotlights, No. 22.

    ERIC Educational Resources Information Center

    National Center for Early Development & Learning, Chapel Hill, NC.

    This issue of the NCEDL Spotlights series announces the availability of a national directory of institutions offering programs for early childhood teachers, "The National Directory of Early Childhood Teacher Preparation Institutions," published by NCEDL and the Council for Professional Recognition. The directory contains listings for nearly 1,400…

  7. A Nascent Peptide Signal Responsive to Endogenous Levels of Polyamines Acts to Stimulate Regulatory Frameshifting on Antizyme mRNA*

    PubMed Central

    Yordanova, Martina M.; Wu, Cheng; Andreev, Dmitry E.; Sachs, Matthew S.; Atkins, John F.

    2015-01-01

    The protein antizyme is a negative regulator of cellular polyamine concentrations from yeast to mammals. Synthesis of functional antizyme requires programmed +1 ribosomal frameshifting at the 3′ end of the first of two partially overlapping ORFs. The frameshift is the sensor and effector in an autoregulatory circuit. Except for Saccharomyces cerevisiae antizyme mRNA, the frameshift site alone only supports low levels of frameshifting. The high levels usually observed depend on the presence of cis-acting stimulatory elements located 5′ and 3′ of the frameshift site. Antizyme genes from different evolutionary branches have evolved different stimulatory elements. Prior and new multiple alignments of fungal antizyme mRNA sequences from the Agaricomycetes class of Basidiomycota show a distinct pattern of conservation 5′ of the frameshift site consistent with a function at the amino acid level. As shown here when tested in Schizosaccharomyces pombe and mammalian HEK293T cells, the 5′ part of this conserved sequence acts at the nascent peptide level to stimulate the frameshifting, without involving stalling detectable by toe-printing. However, the peptide is only part of the signal. The 3′ part of the stimulator functions largely independently and acts at least mostly at the nucleotide level. When polyamine levels were varied, the stimulatory effect was seen to be especially responsive in the endogenous polyamine concentration range, and this effect may be more general. A conserved RNA secondary structure 3′ of the frameshift site has weaker stimulatory and polyamine sensitizing effects on frameshifting. PMID:25998126

  8. Enhancement on spotlight COSMO-SkyMed SAR products

    NASA Astrophysics Data System (ADS)

    Lorusso, R.; Milillo, G.

    2015-10-01

    COSMO-SkyMed (CSK) satellites are providing images with a resolution in the meter regime using the sliding spotlight mode (SL). This is an imaging mode which can obtain better azimuth resolution at the expense of azimuth imaged area than stripmap mode .Spotlight SAR data processing is already an established topic; efficient and accurate solutions in frequency domain have been proposed over the last years. However, the assumptions of these algorithms start to be invalid when applied to high-resolution spotlight SAR data acquired in spaceborne low Earth orbit (LEO) configurations. The assumption of a hyperbolic range history is no longer accurate for sub-metric spatial resolutions due to the satellite curved orbit. Since velocity of a space-borne platform is quite uniform, a simple focusing scheme had been designed in order to handle no straight line trajectory, using both approximated and accurate ω-k focusing kernel. Moreover, when getting close to decimeter resolution (at X-band) other several effects appear; in particular the motion of the satellite during the transmission and reception of the chirp signal deteriorate the impulse response function (IRF), if not properly considered (so called stop-and-go approximation). This paper shows that also CSK SL SAR data, with a resolution close to 1 meter, are not immune to disturbance effects when the stop-and-go approximation is assumed. The ω-k algorithm with satellite curved orbit handling is used to focus CSK spotlight data, and the stop-and-go approximation correction is included in the data processing chain. Experimental results with CSK spotlight data are provided to show quality enhancement on SAR standard focused products.

  9. Golden Retriever dogs with neuronal ceroid lipofuscinosis have a two-base-pair deletion and frameshift in CLN5.

    PubMed

    Gilliam, D; Kolicheski, A; Johnson, G S; Mhlanga-Mutangadura, T; Taylor, J F; Schnabel, R D; Katz, M L

    2015-01-01

    We studied a recessive, progressive neurodegenerative disease occurring in Golden Retriever siblings with an onset of signs at 15 months of age. As the disease progressed these signs included ataxia, anxiety, pacing and circling, tremors, aggression, visual impairment and localized and generalized seizures. A whole genome sequence, generated with DNA from one affected dog, contained a plausibly causal homozygous mutation: CLN5:c.934_935delAG. This mutation was predicted to produce a frameshift and premature termination codon and encode a protein variant, CLN5:p.E312Vfs*6, which would lack 39 C-terminal amino acids. Eighteen DNA samples from the Golden Retriever family members were genotyped at CLN5:c.934_935delAG. Three clinically affected dogs were homozygous for the deletion allele; whereas, the clinically normal family members were either heterozygotes (n = 11) or homozygous for the reference allele (n = 4). Among archived Golden Retrievers DNA samples with incomplete clinical records that were also genotyped at the CLN5:c.934_935delAG variant, 1053 of 1062 were homozygous for the reference allele, 8 were heterozygotes and one was a deletion-allele homozygote. When contacted, the owner of this homozygote indicated that their dog had been euthanized because of a neurologic disease that progressed similarly to that of the affected Golden Retriever siblings. We have collected and stored semen from a heterozygous Golden Retriever, thereby preserving an opportunity for us or others to establish a colony of CLN5-deficient dogs. PMID:25934231

  10. The Evolutionary Potential of Phenotypic Mutations

    PubMed Central

    Yanagida, Hayato; Gispan, Ariel; Kadouri, Noam; Rozen, Shelly; Sharon, Michal; Barkai, Naama; Tawfik, Dan S.

    2015-01-01

    Errors in protein synthesis, so-called phenotypic mutations, are orders-of-magnitude more frequent than genetic mutations. Here, we provide direct evidence that alternative protein forms and phenotypic variability derived from translational errors paved the path to genetic, evolutionary adaptations via gene duplication. We explored the evolutionary origins of Saccharomyces cerevisiae IDP3 - an NADP-dependent isocitrate dehydrogenase mediating fatty acids ß-oxidation in the peroxisome. Following the yeast whole genome duplication, IDP3 diverged from a cytosolic ancestral gene by acquisition of a C-terminal peroxisomal targeting signal. We discovered that the pre-duplicated cytosolic IDPs are partially localized to the peroxisome owing to +1 translational frameshifts that bypass the stop codon and unveil cryptic peroxisomal targeting signals within the 3’-UTR. Exploring putative cryptic signals in all 3’-UTRs of yeast genomes, we found that other enzymes related to NADPH production such as pyruvate carboxylase 1 (PYC1) might be prone to peroxisomal localization via cryptic signals. Using laboratory evolution we found that these translational frameshifts are rapidly imprinted via genetic single base deletions occurring within the very same gene location. Further, as exemplified here, the sequences that promote translational frameshifts are also more prone to genetic deletions. Thus, genotypes conferring higher phenotypic variability not only meet immediate challenges by unveiling cryptic 3’-UTR sequences, but also boost the potential for future genetic adaptations. PMID:26244544

  11. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    NASA Technical Reports Server (NTRS)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  12. A novel role for poly(C) binding proteins in programmed ribosomal frameshifting

    PubMed Central

    Napthine, Sawsan; Treffers, Emmely E.; Bell, Susanne; Goodfellow, Ian; Fang, Ying; Firth, Andrew E.; Snijder, Eric J.; Brierley, Ian

    2016-01-01

    Translational control through programmed ribosomal frameshifting (PRF) is exploited widely by viruses and increasingly documented in cellular genes. Frameshifting is induced by mRNA secondary structures that compromise ribosome fidelity during decoding of a heptanucleotide ‘slippery’ sequence. The nsp2 PRF signal of porcine reproductive and respiratory syndrome virus is distinctive in directing both −2 and −1 PRF and in its requirement for a trans-acting protein factor, the viral replicase subunit nsp1β. Here we show that the the trans-activation of frameshifting is carried out by a protein complex composed of nsp1β and a cellular poly(C) binding protein (PCBP). From the results of in vitro translation and electrophoretic mobility shift assays, we demonstrate that a PCBP/nsp1β complex binds to a C-rich sequence downstream of the slippery sequence and here mimics the activity of a structured mRNA stimulator of PRF. This is the first description of a role for a trans-acting cellular protein in PRF. The discovery broadens the repertoire of activities associated with poly(C) binding proteins and prototypes a new class of virus–host interactions. PMID:27257056

  13. RAN translation and frameshifting as translational challenges at simple repeats of human neurodegenerative disorders

    PubMed Central

    Wojciechowska, Marzena; Olejniczak, Marta; Galka-Marciniak, Paulina; Jazurek, Magdalena; Krzyzosiak, Wlodzimierz J.

    2014-01-01

    Repeat-associated disorders caused by expansions of short sequences have been classified as coding and noncoding and are thought to be caused by protein gain-of-function and RNA gain-of-function mechanisms, respectively. The boundary between such classifications has recently been blurred by the discovery of repeat-associated non-AUG (RAN) translation reported in spinocerebellar ataxia type 8, myotonic dystrophy type 1, fragile X tremor/ataxia syndrome and C9ORF72 amyotrophic lateral sclerosis and frontotemporal dementia. This noncanonical translation requires no AUG start codon and can initiate in multiple frames of CAG, CGG and GGGGCC repeats of the sense and antisense strands of disease-relevant transcripts. RNA structures formed by the repeats have been suggested as possible triggers; however, the precise mechanism of the translation initiation remains elusive. Templates containing expansions of microsatellites have also been shown to challenge translation elongation, as frameshifting has been recognized across CAG repeats in spinocerebellar ataxia type 3 and Huntington's disease. Determining the critical requirements for RAN translation and frameshifting is essential to decipher the mechanisms that govern these processes. The contribution of unusual translation products to pathogenesis needs to be better understood. In this review, we present current knowledge regarding RAN translation and frameshifting and discuss the proposed mechanisms of translational challenges imposed by simple repeat expansions. PMID:25217582

  14. A novel role for poly(C) binding proteins in programmed ribosomal frameshifting.

    PubMed

    Napthine, Sawsan; Treffers, Emmely E; Bell, Susanne; Goodfellow, Ian; Fang, Ying; Firth, Andrew E; Snijder, Eric J; Brierley, Ian

    2016-07-01

    Translational control through programmed ribosomal frameshifting (PRF) is exploited widely by viruses and increasingly documented in cellular genes. Frameshifting is induced by mRNA secondary structures that compromise ribosome fidelity during decoding of a heptanucleotide 'slippery' sequence. The nsp2 PRF signal of porcine reproductive and respiratory syndrome virus is distinctive in directing both -2 and -1 PRF and in its requirement for a trans-acting protein factor, the viral replicase subunit nsp1β. Here we show that the the trans-activation of frameshifting is carried out by a protein complex composed of nsp1β and a cellular poly(C) binding protein (PCBP). From the results of in vitro translation and electrophoretic mobility shift assays, we demonstrate that a PCBP/nsp1β complex binds to a C-rich sequence downstream of the slippery sequence and here mimics the activity of a structured mRNA stimulator of PRF. This is the first description of a role for a trans-acting cellular protein in PRF. The discovery broadens the repertoire of activities associated with poly(C) binding proteins and prototypes a new class of virus-host interactions. PMID:27257056

  15. Identification of a novel frameshift heterozygous deletion in exon 8 of the PAX6 gene in a pedigree with aniridia.

    PubMed

    Giray Bozkaya, Ozlem; Ataman, Esra; Aksel Kilicarslan, Ozge; Cankaya, Tufan; Ulgenalp, Ayfer

    2016-09-01

    Aniridia is a congenital, panocular abnormality which is characterized by partial or complete absence of iris and various degrees of iris hypoplasia. Mutations in the PAX6 gene are found in ~90% of cases with aniridia. The human PAX6 gene is located at chromosome 11p13 and encodes a transcriptional regulator that has crucial roles in the development of the eyes, central nervous system and pancreatic islets. The present study performed a clinical and genomic analysis of two families containing multiple cases of aniridia. All exons of the PAX6 gene of the probands were sequenced using the Sanger sequencing technique. A heterozygous non‑stop mutation in exon 14 was identified in the first family, which has been previously reported for a different ophthalmological pathology. This mutation causes on‑going translation of the mRNA into the 3'‑untranslated region. In the second family, a novel frameshift heterozygous deletion in exon 8 was identified. PMID:27431685

  16. The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) β(0) -thalassaemia homozygotes.

    PubMed

    Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Farrell, John J; Davis, Lance; Théberge, Roger; Benson, Katherine A; Riolueang, Suchada; Viprakasit, Vip; Al-Allawi, Nasir A S; Ünal, Sule; Gümrük, Fatma; Akar, Nejat; Başak, A Nazli; Osorio, Leonor; Badens, Catherine; Pissard, Serge; Joly, Philippe; Campbell, Andrew D; Gallagher, Patrick G; Steinberg, Martin H; Forget, Bernard G; Chui, David H K

    2016-03-01

    Two 21-year old dizygotic twin men of Iraqi descent were homozygous for HBB codon 8, deletion of two nucleotides (-AA) frame-shift β(0) -thalassaemia mutation (FSC8; HBB:c25_26delAA). Both were clinically well, had splenomegaly, and were never transfused. They had mild microcytic anaemia (Hb 120-130 g/l) and 98% of their haemoglobin was fetal haemoglobin (HbF). Both were carriers of Hph α-thalassaemia mutation. On the three major HbF quantitative trait loci (QTL), the twins were homozygous for G>A HBG2 Xmn1 site at single nucleotide polymorphism (SNP) rs7482144, homozygous for 3-bp deletion HBS1L-MYB intergenic polymorphism (HMIP) at rs66650371, and heterozygous for the A>C BCL11A intron 2 polymorphism at rs766432. These findings were compared with those found in 22 other FSC8 homozygote patients: four presented with thalassaemia intermedia phenotype, and 18 were transfusion dependent. The inheritance of homozygosity for HMIP 3-bp deletion at rs66650371 and heterozygosity for Hph α-thalassaemia mutation was found in the twins and not found in any of the other 22 patients. Further studies are needed to uncover likely additional genetic variants that could contribute to the exceptionally high HbF levels and mild phenotype in these twins. PMID:26771086

  17. Generalized energy-aperture product limit for multi-beam and spotlight SARs

    SciTech Connect

    Karr, T.J.

    1995-12-21

    The SAR energy-aperture product limit is extended to multi-beam SARS, Spotlight and moving spotlight SARS. This fundamental limit bounds the tradeoff between energy and antenna size. The kinematic relations between design variables such as platform speed, pulse repetition frequency, beam width and area rate are analyzed in a unified framework applicable to a wide variety of SARs including strip maps, spotlights, vermer arrays and multi-beam SARS, both scanning and swept-beam. Then the energy-aperture product limit is derived from the signal-to noise requirement and the kinematic constraints. The derivation clarifies impact of multiple beams and spotlighting on SAR performance.

  18. Programmed Ribosomal Frameshift Alters Expression of West Nile Virus Genes and Facilitates Virus Replication in Birds and Mosquitoes

    PubMed Central

    Du, Fangyao; Owens, Nick; Bosco-Lauth, Angela M.; Nagasaki, Tomoko; Rudd, Stephen; Brault, Aaron C.; Bowen, Richard A.; Hall, Roy A.; van den Hurk, Andrew F.; Khromykh, Alexander A.

    2014-01-01

    West Nile virus (WNV) is a human pathogen of significant medical importance with close to 40,000 cases of encephalitis and more than 1,600 deaths reported in the US alone since its first emergence in New York in 1999. Previous studies identified a motif in the beginning of non-structural gene NS2A of encephalitic flaviviruses including WNV which induces programmed −1 ribosomal frameshift (PRF) resulting in production of an additional NS protein NS1′. We have previously demonstrated that mutant WNV with abolished PRF was attenuated in mice. Here we have extended our previous observations by showing that PRF does not appear to have a significant role in virus replication, virion formation, and viral spread in several cell lines in vitro. However, we have also shown that PRF induces an over production of structural proteins over non-structural proteins in virus-infected cells and that mutation abolishing PRF is present in ∼11% of the wild type virus population. In vivo experiments in house sparrows using wild type and PRF mutant of New York 99 strain of WNV viruses showed some attenuation for the PRF mutant virus. Moreover, PRF mutant of Kunjin strain of WNV showed significant decrease compared to wild type virus infection in dissemination of the virus from the midgut through the haemocoel, and ultimately the capacity of infected mosquitoes to transmit virus. Thus our results demonstrate an important role for PRF in regulating expression of viral genes and consequently virus replication in avian and mosquito hosts. PMID:25375107

  19. Selective spatial enhancement: Attentional spotlight size impacts spatial but not temporal perception.

    PubMed

    Goodhew, Stephanie C; Shen, Elizabeth; Edwards, Mark

    2016-08-01

    An important but often neglected aspect of attention is how changes in the attentional spotlight size impact perception. The zoom-lens model predicts that a small ("focal") attentional spotlight enhances all aspects of perception relative to a larger ("diffuse" spotlight). However, based on the physiological properties of the two major classes of visual cells (magnocellular and parvocellular neurons) we predicted trade-offs in spatial and temporal acuity as a function of spotlight size. Contrary to both of these accounts, however, across two experiments we found that attentional spotlight size affected spatial acuity, such that spatial acuity was enhanced for a focal relative to a diffuse spotlight, whereas the same modulations in spotlight size had no impact on temporal acuity. This likely reflects the function of attention: to induce the high spatial resolution of the fovea in periphery, where spatial resolution is poor but temporal resolution is good. It is adaptive, therefore, for the attentional spotlight to enhance spatial acuity, whereas enhancing temporal acuity does not confer the same benefit. PMID:27294427

  20. The Financial Management System: A Pivotal Tool for Fiscal Viability. CDS Spotlight. ECAR Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This spotlight focuses on data from the 2013 CDS to better understand how higher education institutions approach financial management systems. Information provided for this spotlight was derived from Module 8 of Core Data Service (CDS), which asked several questions regarding information systems and applications. Responses from 525 institutions…

  1. BI Reporting, Data Warehouse Systems, and Beyond. CDS Spotlight Report. Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service [CDS] to better understand how higher education institutions approach business intelligence (BI) reporting and data warehouse systems (see the Sidebar for definitions). Information provided for this Spotlight was derived from Module 8 of CDS, which contains several questions regarding…

  2. Maximize Institutional Relationships with CRMs. CDS Spotlight Report. ECAR Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service (CDS) to better understand how higher education institutions approach customer relationship management (CRM) systems. Information provided for this Spotlight was derived from Module 8 of the Core Data survey, which asked several questions regarding information systems and applications.…

  3. Salt Effects on the Thermodynamics of a Frameshifting RNA Pseudoknot under Tension.

    PubMed

    Hori, Naoto; Denesyuk, Natalia A; Thirumalai, D

    2016-07-17

    Because of the potential link between -1 programmed ribosomal frameshifting and response of a pseudoknot (PK) RNA to force, a number of single-molecule pulling experiments have been performed on PKs to decipher the mechanism of programmed ribosomal frameshifting. Motivated in part by these experiments, we performed simulations using a coarse-grained model of RNA to describe the response of a PK over a range of mechanical forces (fs) and monovalent salt concentrations (Cs). The coarse-grained simulations quantitatively reproduce the multistep thermal melting observed in experiments, thus validating our model. The free energy changes obtained in simulations are in excellent agreement with experiments. By varying f and C, we calculated the phase diagram that shows a sequence of structural transitions, populating distinct intermediate states. As f and C are changed, the stem-loop tertiary interactions rupture first, followed by unfolding of the 3'-end hairpin (I⇌F). Finally, the 5'-end hairpin unravels, producing an extended state (E⇌I). A theoretical analysis of the phase boundaries shows that the critical force for rupture scales as (logCm)(α) with α=1(0.5) for E⇌I (I⇌F) transition. This relation is used to obtain the preferential ion-RNA interaction coefficient, which can be quantitatively measured in single-molecule experiments, as done previously for DNA hairpins. A by-product of our work is the suggestion that the frameshift efficiency is likely determined by the stability of the 5'-end hairpin that the ribosome first encounters during translation. PMID:27315694

  4. Translational recoding as a feedback controller: systems approaches reveal polyamine-specific effects on the antizyme ribosomal frameshift.

    PubMed

    Rato, Claudia; Amirova, Svetlana R; Bates, Declan G; Stansfield, Ian; Wallace, Heather M

    2011-06-01

    The antizyme protein, Oaz1, regulates synthesis of the polyamines putrescine, spermidine and spermine by controlling stability of the polyamine biosynthetic enzyme, ornithine decarboxylase. Antizyme mRNA translation depends upon a polyamine-stimulated +1 ribosomal frameshift, forming a complex negative feedback system in which the translational frameshifting event may be viewed in engineering terms as a feedback controller for intracellular polyamine concentrations. In this article, we present the first systems level study of the characteristics of this feedback controller, using an integrated experimental and modeling approach. Quantitative analysis of mutant yeast strains in which polyamine synthesis and interconversion were blocked revealed marked variations in frameshift responses to the different polyamines. Putrescine and spermine, but not spermidine, showed evidence of co-operative stimulation of frameshifting and the existence of multiple ribosome binding sites. Combinatorial polyamine treatments showed polyamines compete for binding to common ribosome sites. Using concepts from enzyme kinetics and control engineering, a mathematical model of the translational controller was developed to describe these complex ribosomal responses to combinatorial polyamine effects. Each one of a range of model predictions was successfully validated against experimental frameshift frequencies measured in S-adenosylmethionine-decarboxylase and antizyme mutants, as well as in the wild-type genetic background. PMID:21303766

  5. Mutation hot spots in the canine herpesvirus thymidine kinase gene.

    PubMed

    Yamada, Shinya; Matsumoto, Yasunobu; Takashima, Yasuhiro; Otsuka, Haruki

    2005-08-01

    The guanine and cytosine content (GC-content) of alpha-herpesvirus genes are highly variable despite similar genome structures. It is known that drug resistant HSV, which has the genome with a high GC-content (approximately 70%), commonly includes frameshift mutations in homopolymer stretches of guanine (G) and cytosine (C) within the thymidine kinase (TK) gene. However, whether such mutation hotspots exist in the TK gene of canine herpesvirus (CHV) which has a low GC-content was unknown. In this study, we investigated mutations in the TK gene of CHV. CHV was passaged in the presence of iodo-deoxyuridine (IDU), and IDU-resistant clones were isolated. In all IDU-resistant virus clones, mutations in the TK gene were observed. The majority of these mutations were frameshift mutations of an adenine (A) insertion or deletion within either of 2 stretches of eight A's in the TK gene. It was demonstrated that CHV TK mutations frequently occur at a limited number of hot spots within long homopolymer nucleotide stretches. PMID:15965615

  6. Bestrophin gene mutations in patients with Best vitelliform macular dystrophy.

    PubMed

    Caldwell, G M; Kakuk, L E; Griesinger, I B; Simpson, S A; Nowak, N J; Small, K W; Maumenee, I H; Rosenfeld, P J; Sieving, P A; Shows, T B; Ayyagari, R

    1999-05-15

    Best vitelliform macular dystrophy (VMD2) is an autosomal dominant dystrophy with a juvenile age of onset. Mutations in the Bestrophin gene were shown in patients affected with VMD2. In a mutation study, we made three new and interesting observations. First, we identified possible mutation hotspots within the gene, suggesting that particular regions of the protein have greater functional significance than others. Second, we described a 2-bp deletion in a part of the gene where mutations have not previously been reported; this mutation causes a frameshift and subsequent premature termination of the protein. Finally, we have evidence that some mutations are associated with variable expression of the disease, suggesting the involvement of other factors or genes in the disease phenotype. PMID:10331951

  7. Large-scale mass spectrometry-based analysis of Euplotes octocarinatus supports the high frequency of +1 programmed ribosomal frameshift

    PubMed Central

    Wang, Ruanlin; Zhang, Zhiyun; Du, Jun; Fu, Yuejun; Liang, Aihua

    2016-01-01

    Programmed ribosomal frameshifting (PRF) is commonly used to express many viral and some cellular genes. We conducted a genome-wide investigation of +1 PRF in ciliate Euplotes octocarinatus through genome and transcriptome sequencing and our results demonstrated that approximately 11.4% of genes require +1 PRF to produce complete gene products. While nucleic acid-based evidence for candidate genes with +1 PRF is strong, only very limited information is available at protein levels to date. In this study, E. octocarinatus was subjected to large-scale mass spectrometry-based analysis to verify the high frequency of +1 PRF and 226 +1 PRF gene products were identified. Based on the amino acid sequences of the peptides spanning the frameshift sites, typical frameshift motif AAA-UAR for +1 PRF in Euplotes was identified. Our data in this study provide very useful insight into the understanding of the molecular mechanism of +1 PRF. PMID:27597422

  8. Large-scale mass spectrometry-based analysis of Euplotes octocarinatus supports the high frequency of +1 programmed ribosomal frameshift.

    PubMed

    Wang, Ruanlin; Zhang, Zhiyun; Du, Jun; Fu, Yuejun; Liang, Aihua

    2016-01-01

    Programmed ribosomal frameshifting (PRF) is commonly used to express many viral and some cellular genes. We conducted a genome-wide investigation of +1 PRF in ciliate Euplotes octocarinatus through genome and transcriptome sequencing and our results demonstrated that approximately 11.4% of genes require +1 PRF to produce complete gene products. While nucleic acid-based evidence for candidate genes with +1 PRF is strong, only very limited information is available at protein levels to date. In this study, E. octocarinatus was subjected to large-scale mass spectrometry-based analysis to verify the high frequency of +1 PRF and 226 +1 PRF gene products were identified. Based on the amino acid sequences of the peptides spanning the frameshift sites, typical frameshift motif AAA-UAR for +1 PRF in Euplotes was identified. Our data in this study provide very useful insight into the understanding of the molecular mechanism of +1 PRF. PMID:27597422

  9. Color uniformity in spotlights optimized with reflectors and TIR lenses.

    PubMed

    Teupner, Anne; Bergenek, Krister; Wirth, Ralph; Benítez, Pablo; Miñano, Juan Carlos

    2015-02-01

    We analyze the color uniformity in the far field of spotlight systems to estimate visual perception with a merit function derived from human factor experiments. A multi-colored light-emitting diode (LED) light engine with different light mixing levels is combined with several reflectors and total internal reflection (TIR) lenses. The optimized systems are analyzed at several color uniformity levels with regard to the efficiency, peak luminous intensity and dimensions. It is shown that these properties cannot all be optimized at the same time. Furthermore, excellent color uniformity can be reached by a light mixing layer in the light engine or by adding mixing elements to the secondary optics. PMID:25836237

  10. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    SciTech Connect

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan; Firth, Andrew E.; Wang, David

    2014-02-15

    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

  11. Stimulation of -1 programmed ribosomal frameshifting by a metabolite-responsive RNA pseudoknot.

    PubMed

    Chou, Ming-Yuan; Lin, Szu-Chieh; Chang, Kung-Yao

    2010-06-01

    Specific recognition of metabolites by functional RNA motifs within mRNAs has emerged as a crucial regulatory strategy for feedback control of biochemical reactions. Such riboswitches have been demonstrated to regulate different gene expression processes, including transcriptional termination and translational initiation in prokaryotic cells, as well as splicing in eukaryotic cells. The regulatory process is usually mediated by modulating the accessibility of specific sequence information of the expression platforms via metabolite-induced RNA conformational rearrangement. In eukaryotic systems, viral and the more limited number of cellular decoding -1 programmed ribosomal frameshifting (PRF) are commonly promoted by a 3' mRNA pseudoknot. In addition, such -1 PRF is generally constitutive rather than being regulatory, and usually results in a fixed ratio of products. We report here an RNA pseudoknot capable of stimulating -1 PRF whose efficiency can be tuned in response to the concentration of S-adenosylhomocysteine (SAH), and the improvement of its frameshifting efficiency by RNA engineering. In addition to providing an alternative approach for small-molecule regulation of gene expression in eukaryotic cells, such a metabolite-responsive pseudoknot suggests a plausible mechanism for metabolite-driven translational regulation of gene expression in eukaryotic systems. PMID:20435898

  12. APC germline mutations in families with familial adenomatous polyposis.

    PubMed

    De Queiroz Rossanese, Lillian Barbosa; De Lima Marson, Fernando Augusto; Ribeiro, José Dirceu; Coy, Claudio Saddy Rodrigues; Bertuzzo, Carmen Silvia

    2013-11-01

    Adenomatous polyposis coli (APC) germline mutations are responsible for the occurrence of familial adenomatous polyposis (FAP). Somatic mutations lead to malignant transformation of adenomas. In this context, considering the significance of APC germline mutations in FAP, we aimed to identify APC germline mutations. In the present study, 20 FAP patients were enrolled. The determination of APC germline mutations was performed using sequencing, and the mutations were compared with clinical markers (gender, age at diagnosis, smoking habits, TNM stage, Astler‑Coller stage, degree of differentiation of adenocarcinoma). The data were compared using the SPSS program, with the Fisher's exact test and χ2 test, considering α=0.05. According to the main results in our sample, 16 alleles with deleterious mutations (80% of the patients) were identified while 7 (35%) patients had no deleterious mutations. There was a predominance of nonsense (45% of the patients) and frameshift (20% of the patients) mutations. There was no statistical significance between the APC germline mutations identified and the clinical variables considered in our study. Only TNM stage was associated with the presence of deleterious mutations. Patients with deleterious mutations had an OR, 0.086 (IC=0.001-0.984); TNM stage I+II in comparison with III+IV, when compared with the patients with no deleterious mutations identified. In this context, as a conclusion, we demonstrated the molecular heterogeneity of APC germline mutations in FAP and the difficulty to perform molecular diagnostics in a Brazilian population, considering the admixed population analyzed. PMID:23970361

  13. TP53 Mutational Spectrum in Endometrioid and Serous Endometrial Cancers.

    PubMed

    Schultheis, Anne M; Martelotto, Luciano G; De Filippo, Maria R; Piscuglio, Salvatore; Ng, Charlotte K Y; Hussein, Yaser R; Reis-Filho, Jorge S; Soslow, Robert A; Weigelt, Britta

    2016-07-01

    Endometrial carcinomas (ECs) are heterogeneous at the genetic level. Although TP53 mutations are highly recurrent in serous endometrial carcinomas (SECs), these are also present in a subset of endometrioid endometrial carcinomas (EECs). Here, we sought to define the frequency, pattern, distribution, and type of TP53 somatic mutations in ECs by performing a reanalysis of the publicly available data from The Cancer Genome Atlas (TCGA). A total of 228 EECs (n=186) and SECs (n=42) from the TCGA data set, for which an integrated genomic characterization was performed, were interrogated for the presence and type of TP53 mutations, and for mutations in genes frequently mutated in ECs. TP53 mutations were found in 15% of EECs and 88% of SECs, and in 91% of copy-number-high and 35% of polymerase (DNA directed), epsilon, catalytic subunit (POLE) integrative genomic subtypes. In addition to differences in prevalence, variations in the type and pattern of TP53 mutations were observed between histologic types and between integrative genomic subtypes. TP53 hotspot mutations were significantly more frequently found in SECs (46%) than in EECs (15%). TP53-mutant EECs significantly more frequently harbored a co-occurring PTEN mutation than TP53-mutant SECs. Finally, a subset of TP53-mutant ECs (22%) was found to harbor frameshift or nonsense mutations. Given that nonsense and frameshift TP53 mutations result in distinct p53 immunohistochemical results that require careful interpretation, and that EECs and SECs display different patterns, types, and distributions of TP53 mutations, the use of the TP53/p53 status alone for the differential diagnosis of EECs and SECs may not be sufficient. PMID:26556035

  14. The evolution of cellular deficiency in GATA2 mutation

    PubMed Central

    Dickinson, Rachel E.; Milne, Paul; Jardine, Laura; Zandi, Sasan; Swierczek, Sabina I.; McGovern, Naomi; Cookson, Sharon; Ferozepurwalla, Zaveyna; Langridge, Alexander; Pagan, Sarah; Gennery, Andrew; Heiskanen-Kosma, Tarja; Hämäläinen, Sari; Seppänen, Mikko; Helbert, Matthew; Tholouli, Eleni; Gambineri, Eleonora; Reykdal, Sigrún; Gottfreðsson, Magnús; Thaventhiran, James E.; Morris, Emma; Hirschfield, Gideon; Richter, Alex G.; Jolles, Stephen; Bacon, Chris M.; Hambleton, Sophie; Haniffa, Muzlifah; Bryceson, Yenan; Allen, Carl; Prchal, Josef T.; Dick, John E.; Bigley, Venetia

    2014-01-01

    Constitutive heterozygous GATA2 mutation is associated with deafness, lymphedema, mononuclear cytopenias, infection, myelodysplasia (MDS), and acute myeloid leukemia. In this study, we describe a cross-sectional analysis of 24 patients and 6 relatives with 14 different frameshift or substitution mutations of GATA2. A pattern of dendritic cell, monocyte, B, and natural killer (NK) lymphoid deficiency (DCML deficiency) with elevated Fms-like tyrosine kinase 3 ligand (Flt3L) was observed in all 20 patients phenotyped, including patients with Emberger syndrome, monocytopenia with Mycobacterium avium complex (MonoMAC), and MDS. Four unaffected relatives had a normal phenotype indicating that cellular deficiency may evolve over time or is incompletely penetrant, while 2 developed subclinical cytopenias or elevated Flt3L. Patients with GATA2 mutation maintained higher hemoglobin, neutrophils, and platelets and were younger than controls with acquired MDS and wild-type GATA2. Frameshift mutations were associated with earlier age of clinical presentation than substitution mutations. Elevated Flt3L, loss of bone marrow progenitors, and clonal myelopoiesis were early signs of disease evolution. Clinical progression was associated with increasingly elevated Flt3L, depletion of transitional B cells, CD56bright NK cells, naïve T cells, and accumulation of terminally differentiated NK and CD8+ memory T cells. These studies provide a framework for clinical and laboratory monitoring of patients with GATA2 mutation and may inform therapeutic decision-making. PMID:24345756

  15. Spotlighting quantum critical points via quantum correlations at finite temperatures

    SciTech Connect

    Werlang, T.; Ribeiro, G. A. P.; Rigolin, Gustavo

    2011-06-15

    We extend the program initiated by T. Werlang et al. [Phys. Rev. Lett. 105, 095702 (2010)] in several directions. Firstly, we investigate how useful quantum correlations, such as entanglement and quantum discord, are in the detection of critical points of quantum phase transitions when the system is at finite temperatures. For that purpose we study several thermalized spin models in the thermodynamic limit, namely, the XXZ model, the XY model, and the Ising model, all of which with an external magnetic field. We compare the ability of quantum discord, entanglement, and some thermodynamic quantities to spotlight the quantum critical points for several different temperatures. Secondly, for some models we go beyond nearest neighbors and also study the behavior of entanglement and quantum discord for second nearest neighbors around the critical point at finite temperature. Finally, we furnish a more quantitative description of how good all these quantities are in spotlighting critical points of quantum phase transitions at finite T, bridging the gap between experimental data and those theoretical descriptions solely based on the unattainable absolute zero assumption.

  16. Using frequency-scaling approach to process squint-mode spotlight SAR data

    NASA Astrophysics Data System (ADS)

    Sun, Jinping; Mao, Shiyi; Liu, Zhongkan; Hong, Wen Q.

    2001-08-01

    Frequency scaling approach is a new spotlight SAR image formation algorithm. It precisely performs the range cell migration correction for dechirped raw data without interpolation by using a novel frequency scaling operation while residual video phase is corrected simultaneously. The computation requirements are lower than the other spotlight SAR image formation approaches such as polar format algorithm and range migration algorithm. In this paper, frequency scaling algorithm is applied to process high squint spotlight data. The new squint illumination geometry is defined and some modifications to the basic algorithm are presented. Point target simulations up to 45 deg squint angle are carried out to show the validity of the algorithm.

  17. Clinical features of X linked juvenile retinoschisis in Chinese families associated with novel mutations in the RS1 gene

    PubMed Central

    Ma, Xiang; Tao, Yong

    2007-01-01

    Purpose To describe the clinical phenotype of X linked juvenile retinoschisis (XLRS) in 12 Chinese families with 11 different mutations in the XLRS1 (RS1) gene. Methods Complete ophthalmic examinations were carried out in 29 affected males (12 probands), 38 heterozygous females carriers, and 100 controls. The coding regions of the RS1 gene that encodes retinoschisin were amplified by polymerase chain reaction and directly sequenced. Results Of the 29 male participants, 28 (96.6%) displayed typical foveal schisis. Eleven different RS1 mutations were identified in 12 families; four of these mutations, two frameshift mutations (26 del T of exon 1 and 488 del G of exon 5), and two missense mutations (Asp145His and Arg156Gly) of exon 5, had not been previously described. One non-disease-related polymorphism (NSP): 576C to T (Pro192Pro) change was also newly reported herein. We compared genotypes and observed more severe clinical features in families with the following mutations: frameshift mutation (26 del T) of exon 1, the splice donor site mutation (IVS1+2T to C),or Arg102Gln, Arg209His, and Arg213Gln mutations. Conclusions Severe XLRS phenotypes are associated with the frameshift mutation 26 del T, splice donor site mutation (IVS1+2T to C), and Arg102Gln, Asp145His, Arg209His, and Arg213Gln mutations. The wide variability in the phenotype in Chinese patients with XLRS and different mutations in the RS1 gene is described. Identification of mutations in the RS1 gene and expanded information on clinical manifestations will facilitate early diagnosis, appropriate early therapy, and genetic counseling regarding the prognosis of XLRS. PMID:17615541

  18. Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

    PubMed Central

    Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

    2015-01-01

    Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

  19. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and kelp fly virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Solenopsis invicta virus 3 (SINV-3) is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF) of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the stru...

  20. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    SciTech Connect

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-03-30

    Flaviviruses have a positive-sense, single-stranded RNA genome of approx11 kb, encoding a large polyprotein that is cleaved to produce approx10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  1. Legius Syndrome: two novel mutations in the SPRED1 gene

    PubMed Central

    Bianchi, Marika; Saletti, Veronica; Micheli, Roberto; Esposito, Silvia; Molinaro, Anna; Gagliardi, Stella; Orcesi, Simona; Cereda, Cristina

    2015-01-01

    The SPRED1 gene encodes a protein involved in the Ras/MAPK (mitogen-activated protein kinase) signaling pathway. Mutations in SPRED1 have been reported to cause Legius Syndrome, a rare developmental disorder that shares some clinical features with Neurofibromatosis-1. Direct sequencing was used to define SPRED1 mutations. We present two previously undescribed mutations: a frameshift mutation causing a stop codon, which was identified in an Italian family (p.Ile60Tyrfs*18) and a missense variation, which was identified in one sporadic Italian case (p.Pro422Arg). Our results led us to hypothesize that these modifications may contribute to the Legius Syndrome phenotype. Further studies will be needed to determine the roles of these mutations in the mechanisms of Legius Syndrome. PMID:27081556

  2. Changed in translation: mRNA recoding by -1 programmed ribosomal frameshifting.

    PubMed

    Caliskan, Neva; Peske, Frank; Rodnina, Marina V

    2015-05-01

    Programmed -1 ribosomal frameshifting (-1PRF) is an mRNA recoding event commonly utilized by viruses and bacteria to increase the information content of their genomes. Recent results have implicated -1PRF in quality control of mRNA and DNA stability in eukaryotes. Biophysical experiments demonstrated that the ribosome changes the reading frame while attempting to move over a slippery sequence of the mRNA--when a roadblock formed by a folded downstream segment in the mRNA stalls the ribosome in a metastable conformational state. The efficiency of -1PRF is modulated not only by cis-regulatory elements in the mRNA but also by trans-acting factors such as proteins, miRNAs, and antibiotics. These recent results suggest a molecular mechanism and new important cellular roles for -1PRF. PMID:25850333

  3. Frameshift Sequence Variants in the Human Lipase-H Gene Causing Hypotrichosis.

    PubMed

    Mehmood, Sabba; Shah, Sayed Hajan; Jan, Abid; Younus, Muhammad; Ahmad, Farooq; Ayub, Muhammad; Ahmad, Wasim

    2016-01-01

    Hypotrichosis is a condition of abnormal hair pattern characterized by sparse to absent hair on different parts of the body, including the scalp. The condition is often characterized by tightly curled woolly hairs, discoloration of hair, and development of multiple keratin filled cysts or papules on the body. Sequence analysis of the lipase H (LIPH) gene, mapped on chromosome 3q27.3, led to the identification of a novel frameshift deletion variant (c.932delC, p.Pro311Leufs*3) in one family and previously reported 2-bp deletion (c.659_660delTA) in five other families, inherited hypotrichosis, and woolly hair in an autosomal recessive pattern. The study further extends the body of evidence that sequence variants in the LIPH gene result in hypotrichosis and woolly hair phenotype. PMID:26645693

  4. COSMO-SkyMed Spotlight interometry over rural areas: the Slumgullion landslide in Colorado, USA

    USGS Publications Warehouse

    Milillo, Pietro; Fielding, Eric J.; Schulz, William H.; Delbridge, Brent; Burgmann, Roland

    2014-01-01

    In the last 7 years, spaceborne synthetic aperture radar (SAR) data with resolution of better than a meter acquired by satellites in spotlight mode offered an unprecedented improvement in SAR interferometry (InSAR). Most attention has been focused on monitoring urban areas and man-made infrastructure exploiting geometric accuracy, stability, and phase fidelity of the spotlight mode. In this paper, we explore the potential application of the COSMO-SkyMed® Spotlight mode to rural areas where decorrelation is substantial and rapidly increases with time. We focus on the rapid repeat times of as short as one day possible with the COSMO-SkyMed® constellation. We further present a qualitative analysis of spotlight interferometry over the Slumgullion landslide in southwest Colorado, which moves at rates of more than 1 cm/day.

  5. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    PubMed Central

    Thyssen, Gregory N.; Fang, David D.; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D.; Condon, Tracy L.; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  6. A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1' may derive from ribosomal frameshifting

    PubMed Central

    Firth, Andrew E; Atkins, John F

    2009-01-01

    Japanese encephalitis, West Nile, Usutu and Murray Valley encephalitis viruses form a tight subgroup within the larger Flavivirus genus. These viruses utilize a single-polyprotein expression strategy, resulting in ~10 mature proteins. Plotting the conservation at synonymous sites along the polyprotein coding sequence reveals strong conservation peaks at the very 5' end of the coding sequence, and also at the 5' end of the sequence encoding the NS2A protein. Such peaks are generally indicative of functionally important non-coding sequence elements. The second peak corresponds to a predicted stable pseudoknot structure whose biological importance is supported by compensatory mutations that preserve the structure. The pseudoknot is preceded by a conserved slippery heptanucleotide (Y CCU UUU), thus forming a classical stimulatory motif for -1 ribosomal frameshifting. We hypothesize, therefore, that the functional importance of the pseudoknot is to stimulate a portion of ribosomes to shift -1 nt into a short (45 codon), conserved, overlapping open reading frame, termed foo. Since cleavage at the NS1-NS2A boundary is known to require synthesis of NS2A in cis, the resulting transframe fusion protein is predicted to be NS1-NS2AN-term-FOO. We hypothesize that this may explain the origin of the previously identified NS1 'extension' protein in JEV-group flaviviruses, known as NS1'. PMID:19196463

  7. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  8. WT1 mutations in T-ALL.

    PubMed

    Tosello, Valeria; Mansour, Marc R; Barnes, Kelly; Paganin, Maddalena; Sulis, Maria Luisa; Jenkinson, Sarah; Allen, Christopher G; Gale, Rosemary E; Linch, David C; Palomero, Teresa; Real, Pedro; Murty, Vundavalli; Yao, Xiaopan; Richards, Susan M; Goldstone, Anthony; Rowe, Jacob; Basso, Giuseppe; Wiernik, Peter H; Paietta, Elisabeth; Pieters, Rob; Horstmann, Martin; Meijerink, Jules P P; Ferrando, Adolfo A

    2009-07-30

    The molecular mechanisms involved in disease progression and relapse in T-cell acute lymphoblastic leukemia (T-ALL) are poorly understood. We used single nucleotide polymorphism array analysis to analyze paired diagnostic and relapsed T-ALL samples to identify recurrent genetic alterations in T-ALL. This analysis showed that diagnosis and relapsed cases have common genetic alterations, but also that relapsed samples frequently lose chromosomal markers present at diagnosis, suggesting that relapsed T-ALL emerges from an ancestral clone different from the major leukemic population at diagnosis. In addition, we identified deletions and associated mutations in the WT1 tumor suppressor gene in 2 of 9 samples. Subsequent analysis showed WT1 mutations in 28 of 211 (13.2%) of pediatric and 10 of 85 (11.7%) of adult T-ALL cases. WT1 mutations present in T-ALL are predominantly heterozygous frameshift mutations resulting in truncation of the C-terminal zinc finger domains of this transcription factor. WT1 mutations are most prominently found in T-ALL cases with aberrant rearrangements of the oncogenic TLX1, TLX3, and HOXA transcription factor oncogenes. Survival analysis demonstrated that WT1 mutations do not confer adverse prognosis in pediatric and adult T-ALL. Overall, these results identify the presence of WT1 mutations as a recurrent genetic alteration in T-ALL. PMID:19494353

  9. APC mutations in colorectal tumors with mismatch repair deficiency.

    PubMed Central

    Huang, J; Papadopoulos, N; McKinley, A J; Farrington, S M; Curtis, L J; Wyllie, A H; Zheng, S; Willson, J K; Markowitz, S D; Morin, P; Kinzler, K W; Vogelstein, B; Dunlop, M G

    1996-01-01

    We have investigated the influence of genetic instability [replication error (RER) phenotype] on APC (adenomatous polyposis coli), a gene thought to initiate colorectal tumorigenesis. The prevalence of APC mutations was similar in RER and non-RER tumors, indicating that both tumor types share this step in neoplastic transformation. However, in a total of 101 sequenced mutations, we noted a substantial excess of APC frameshift mutations in the RER cases (70% in RER tumors versus 47% in non-RER tumors, P < 0.04). These frameshifts were characteristic of mutations arising in cells deficient in DNA mismatch repair, with a predilection for mononucleotide repeats in the RER tumors (P < 0.0002), particularly (A)n tracts (P < 0.00007). These findings suggest that the genetic instability that is reflected by the RER phenotype precedes, and is responsible for, APC mutation in RER large bowel tumors and have important implications for understanding the very earliest stages of neoplasia in patients with tumors deficient in mismatch repair. Images Fig. 2 PMID:8799152

  10. Genetic subgroup of small ruminant lentiviruses that infects sheep homozygous for TMEM154 frameshift deletion mutation A4delta53

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Small Ruminant Lentivirus (SRLV) infections of sheep are influenced by genetics on both the host and pathogen sides. Genetic variation in the ovine transmembrane 154 (TMEM154) gene associates with infection susceptibility, and distinct SRLV genetic subtypes infect sheep in association with their TM...

  11. A novel mutation of the HNF1B gene associated with hypoplastic glomerulocystic kidney disease and neonatal renal failure: a case report and mutation update.

    PubMed

    Alvelos, Maria Inês; Rodrigues, Magda; Lobo, Luísa; Medeira, Ana; Sousa, Ana Berta; Simão, Carla; Lemos, Manuel Carlos

    2015-02-01

    Hepatocyte nuclear factor 1 beta (HNF1B) plays an important role in embryonic development, namely in the kidney, pancreas, liver, genital tract, and gut. Heterozygous germline mutations of HNF1B are associated with the renal cysts and diabetes syndrome (RCAD). Affected individuals may present a variety of renal developmental abnormalities and/or maturity-onset diabetes of the young (MODY). A Portuguese 19-month-old male infant was evaluated due to hypoplastic glomerulocystic kidney disease and renal dysfunction diagnosed in the neonatal period that progressed to stage 5 chronic renal disease during the first year of life. His mother was diagnosed with a solitary hypoplastic microcystic left kidney at age 20, with stage 2 chronic renal disease established at age 35, and presented bicornuate uterus, pancreatic atrophy, and gestational diabetes. DNA sequence analysis of HNF1B revealed a novel germline frameshift insertion (c.110_111insC or c.110dupC) in both the child and the mother. A review of the literature revealed a total of 106 different HNF1B mutations, in 236 mutation-positive families, comprising gross deletions (34%), missense mutations (31%), frameshift deletions or insertions (15%), nonsense mutations (11%), and splice-site mutations (8%). The study of this family with an unusual presentation of hypoplastic glomerulocystic kidney disease with neonatal renal dysfunction identified a previously unreported mutation of the HNF1B gene, thereby expanding the spectrum of known mutations associated with renal developmental disorders. PMID:25700310

  12. Identification of mutator genes and mutational pathways in Escherichia coli using a multicopy cloning approach.

    PubMed

    Yang, Hanjing; Wolff, Erika; Kim, Mandy; Diep, Amy; Miller, Jeffrey H

    2004-07-01

    We searched for genes that create mutator phenotypes when put on to a multicopy plasmid in Escherichia coli. In many cases, this will result in overexpression of the gene in question. We constructed a random shotgun library with E. coli genomic fragments between 3 and 5 kbp in length on a multicopy plasmid vector that was transformed into E. coli to screen for frameshift mutators. We identified a total of 115 independent genomic fragments that covered 17 regions on the E. coli chromosome. Further studies identified 12 genes not previously known as causing mutator phenotypes when overproduced. A striking finding is that overproduction of the multidrug resistance transcription regulator, EmrR, results in a large increase in frameshift and base substitution mutagenesis. This suggests a link between multidrug resistance and mutagenesis. Other identified genes include those encoding DNA helicases (UvrD, RecG, RecQ), truncated forms of the DNA mismatch repair protein (MutS) and a primosomal component (DnaT), a negative modulator of initiation of replication/GATC-binding protein (SeqA), a stationary phase regulator AppY, a transcriptional regulator PaaX and three putative open reading frames, ycgW, yfjY and yjiD, encoding hypothetical proteins. In addition, we found three genes encoding proteins that were previously known to cause mutator effects under overexpression conditions: error-prone polymerase IV (DinB), DNA methylase (Dam) and sigma S factor (RpoS). This genomic strategy offers an approach to identify novel mutator effects resulting from the multicopy cloning (MCC) of specific genes and therefore complementing the conventional gene inactivation approach to finding mutators. PMID:15225322

  13. Hepatitis C Virus Frameshift/Alternate Reading Frame Protein Suppresses Interferon Responses Mediated by Pattern Recognition Receptor Retinoic-Acid-Inducible Gene-I

    PubMed Central

    Park, Seung Bum; Seronello, Scott; Mayer, Wasima; Ojcius, David M.

    2016-01-01

    Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I (RIG-I)-mediated IFN induction. Expression of frameshift/alternate reading frame protein (F/ARFP) from HCV -2/+1 frame in Huh7 hepatoma cells suppressed type I IFN responses stimulated by HCV RNA pathogen-associated molecular pattern (PAMP) and poly(IC). The suppression occurred independently of other HCV factors; and activation of interferon stimulated genes, TNFα, IFN-λ1, and IFN-λ2/3 was likewise suppressed by HCV F/ARFP. Point mutations in the full-length HCV sequence (JFH1 genotype 2a strain) were made to introduce premature termination codons in the -2/+1 reading frame coding for F/ARFP while preserving the original reading frame, which enhanced IFNα and IFNβ induction by HCV. The potentiation of IFN response by the F/ARFP mutations was diminished in Huh7.5 cells, which already have a defective RIG-I, and by decreasing RIG-I expression in Huh7 cells. Furthermore, adding F/ARFP back via trans-complementation suppressed IFN induction in the F/ARFP mutant. The F/ARFP mutants, on the other hand, were not resistant to exogenous IFNα. Finally, HCV-infected human liver samples showed significant F/ARFP antibody reactivity, compared to HCV-uninfected control livers. Therefore, HCV F/ARFP likely cooperates with other viral factors to suppress type I and III IFN induction occurring through the RIG-I signaling pathway. This study identifies a novel mechanism of pattern recognition receptor modulation by HCV and suggests a biological function of the HCV alternate reading frame in the modulation of host innate immunity. PMID:27404108

  14. Lack of HLA class I antigen expression by melanoma cells SK-MEL-33 caused by a reading frameshift in beta 2-microglobulin messenger RNA.

    PubMed Central

    Wang, Z; Cao, Y; Albino, A P; Zeff, R A; Houghton, A; Ferrone, S

    1993-01-01

    The lack of HLA class I antigen expression by the melanoma cell line SK-MEL-33 is caused by a unique lesion in beta 2-microglobulin (beta 2-mu). Sequencing of beta 2-mu mRNA detected a guanosine deletion at position 323 in codon 76 that causes a frameshift with a subsequent introduction of a stop codon at a position 54 base upstream of the normal position of the stop codon in the message. The loss of 18 amino acids and the change of 6 amino acids, including a cysteine at position 80 in the carboxy terminus of beta 2-mu, are likely to cause marked changes in the structure of the polypeptide. The latter may account for the inability of beta 2-mu to associate with HLA class I heavy chains and for its lack of reactivity with the anti-beta 2-mu mAb tested. HLA class I antigen expression on SK-MEL-33 cells was reconstituted after transfection with a wild-type B2m gene, therefore indicating that the abnormality of endogenous B2m gene is the only mechanism underlying lack of HLA class I antigen expression by SK-MEL-33 cells. The guanosine deletion in B2m gene was detected also in the melanoma tissue from which SK-MEL-33 cells had originated. Therefore, the molecular lesion identified in the SK-MEL-33 melanoma cell line is not caused by a mutation acquired during growth in vitro but is likely to reflect a somatic mutation during tumor progression. Images PMID:8432869

  15. Identification of new mutations in Israeli patients with X-linked adrenoleukodystrophy.

    PubMed

    Neumann, S; Topper, A; Mandel, H; Shapira, I; Golan, O; Gazit, E; Loewenthal, R

    2001-01-01

    X-linked adrenoleukodystrophy (ALD) is a peroxisomal disorder characterized by impaired peroxisomal betaoxidation of very-long-chain fatty acids (VLCFAs). This is probably due to reduced activation of the VLCFAs and results in demyelination of the nervous system and adrenocortical insufficiency. The ALD gene is localized on Xq28, has 10 exons and encodes a protein of 745 amino acids with significant homology to the membrane peroxisomal protein PMP70. Characterizing the disease causing mutations is of importance in prenatal diagnosis because 12-20% of women who are obligatory carriers show false-negative results when tested for VLCFA in plasma. We have analyzed DNA from blood samples of 7 Jewish (5 Sephardi and 2 Ashkenazi) and 3 Arab Israeli families suffering from ALD. Five missense-type mutations were identified: R104H, Y174C, L229P, R401Q, and G512C. A single mutation, R464X, was nonsense, and two, Y171 frameshift and E471 frameshift, were frameshift. Interestingly, a single mutation was identified in three families of Moroccan Jewish descent, probably due to a founder effect. PMID:11336405

  16. A novel ECGF1 mutation in a Thai patient with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE).

    PubMed

    Kintarak, Jutatip; Liewluck, Teerin; Sangruchi, Tumtip; Hirano, Michio; Kulkantrakorn, Kongkiat; Muengtaweepongsa, Sombat

    2007-09-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive, multisystem disorder, which is clinically defined by ptosis, ophthalmoparesis, gastrointestinal dysmotility, cachexia, peripheral neuropathy, and leukoencephalopathy. MNGIE is caused by mutations in the nuclear gene, endothelial cell growth factor 1 (ECGF1), encoding thymidine phosphorylase (TP). ECGF1 mutations cause severe loss of TP activity, abnormal accumulations of thymidine and deoxyuridine in plasma, and alterations of mitochondrial DNA. Here, we report the first Thai patient with MNGIE confirmed genetically by the identification of a homozygous novel ECGF1 gene mutation, c.100insC, which causes a frameshift and premature truncation of TP protein. PMID:17544574

  17. Frequent somatic reversion of KRT1 mutations in ichthyosis with confetti

    PubMed Central

    Choate, Keith A.; Lu, Yin; Zhou, Jing; Elias, Peter M.; Zaidi, Samir; Paller, Amy S.; Farhi, Anita; Nelson-Williams, Carol; Crumrine, Debra; Milstone, Leonard M.; Lifton, Richard P.

    2015-01-01

    Widespread reversion of genetic disease is rare; however, such events are particularly evident in some skin disorders in which normal clones develop on a background of affected skin. We previously demonstrated that mutations in keratin 10 (KRT10) cause ichthyosis with confetti (IWC), a severe dominant disorder that is characterized by progressive development of hundreds of normal skin spots via revertant mosaicism. Here, we report on a clinical and histological IWC subtype in which affected subjects have red, scaly skin at birth, experience worsening palmoplantar keratoderma in childhood, and develop hundreds of normal skin spots, beginning at around 20 years of age, that increase in size and number over time. We identified a causal de novo mutation in keratin 1 (KRT1). Similar to IWC-causing KRT10 mutations, this mutation in KRT1 resulted in a C-terminal frameshift, replacing 22 C-terminal amino acids with an alternate 30-residue peptide. Mutant KRT1 caused partial collapse of the cytoplasmic intermediate filament network and mislocalized to the nucleus. As with KRT10 mutations causing IWC, reversion of KRT1 mutations occurred via mitotic recombination. Because reversion is not observed with other disease-causing keratin mutations, the results of this study implicate KRT1 and KRT10 C-terminal frameshift mutations in the high frequency of revertant mosaicism in IWC. PMID:25774499

  18. Adaptive mutation and amplification in Escherichia coli: two pathways of genome adaptation under stress.

    PubMed

    Hersh, Megan N; Ponder, Rebecca G; Hastings, P J; Rosenberg, Susan M

    2004-06-01

    The neo-Darwinists suggested that evolution is constant and gradual, and thus that genetic changes that drive evolution should be too. However, more recent understanding of phenomena called adaptive mutation in microbes indicates that mutation rates can be elevated in response to stress, producing beneficial and other mutations. We review evidence that, in Escherichia coli, two separate mechanisms of stress-induced genetic change occur that revert a lac frameshift allele allowing growth on lactose medium. First, compensatory frameshift ("point") mutations occur by a mechanism that includes DNA double-strand breaks and (we have suggested) their error-prone repair. Point mutation requires induction of the RpoS-dependent general stress response, and the SOS DNA damage response leading to upregulation of the error-prone DNA polymerase DinB (Pol IV), and occurs during a transient limitation of post-replicative mismatch repair activity. A second mechanism, adaptive amplification, entails amplification of the leaky lac allele to 20-50 tandem repeats. These provide sufficient beta-galactosidase activity for growth, thereby apparently deflecting cells from the point mutation pathway. Unlike point mutation, amplification neither occurs in hypermutating cells nor requires SOS or DinB, but like point mutation, amplification requires the RpoS-dependent stress response. Similar processes are being found in other bacterial systems and yeast. Stress-induced genetic changes may underlie much of microbial evolution, pathogenesis and antibiotic resistance, and also cancer formation, progression and drug resistance. PMID:15207867

  19. Frequent somatic reversion of KRT1 mutations in ichthyosis with confetti.

    PubMed

    Choate, Keith A; Lu, Yin; Zhou, Jing; Elias, Peter M; Zaidi, Samir; Paller, Amy S; Farhi, Anita; Nelson-Williams, Carol; Crumrine, Debra; Milstone, Leonard M; Lifton, Richard P

    2015-04-01

    Widespread reversion of genetic disease is rare; however, such events are particularly evident in some skin disorders in which normal clones develop on a background of affected skin. We previously demonstrated that mutations in keratin 10 (KRT10) cause ichthyosis with confetti (IWC), a severe dominant disorder that is characterized by progressive development of hundreds of normal skin spots via revertant mosaicism. Here, we report on a clinical and histological IWC subtype in which affected subjects have red, scaly skin at birth, experience worsening palmoplantar keratoderma in childhood, and develop hundreds of normal skin spots, beginning at around 20 years of age, that increase in size and number over time. We identified a causal de novo mutation in keratin 1 (KRT1). Similar to IWC-causing KRT10 mutations, this mutation in KRT1 resulted in a C-terminal frameshift, replacing 22 C-terminal amino acids with an alternate 30-residue peptide. Mutant KRT1 caused partial collapse of the cytoplasmic intermediate filament network and mislocalized to the nucleus. As with KRT10 mutations causing IWC, reversion of KRT1 mutations occurred via mitotic recombination. Because reversion is not observed with other disease-causing keratin mutations, the results of this study implicate KRT1 and KRT10 C-terminal frameshift mutations in the high frequency of revertant mosaicism in IWC. PMID:25774499

  20. Frequent Mutation of BAP1 in Metastasizing Uveal Melanomas

    PubMed Central

    Harbour, J. William; Onken, Michael D.; Roberson, Elisha D.O.; Duan, Shenghui; Cao, Li; Worley, Lori A.; Council, M. Laurin; Matatall, Katie A.; Helms, Cynthia; Bowcock, Anne M.

    2011-01-01

    Metastasis is a defining feature of malignant tumors and is the most common cause of cancer-related death, yet the genetics of metastasis are poorly understood. We used massively parallel exome sequencing coupled with Sanger re-sequencing to search for metastasis-related mutations in highly metastatic uveal melanomas of the eye. Inactivating somatic mutations were identified in the gene encoding BRCA1-associated protein 1 (BAP1) on chromosome 3p21.1 in 26 of 31 (84%) metastasizing tumors, including 15 mutations causing premature protein termination, and six affecting its ubiquitin carboxy-terminal hydrolase (UCH) domains. One tumor harbored a frameshift mutation that was germline in origin, thus representing a susceptibility allele. These findings implicate loss of BAP1 in uveal melanoma metastasis and suggest the BAP1 pathway as a therapeutic target. PMID:21051595

  1. A negative feedback modulator of antigen processing evolved from a frameshift in the cowpox virus genome.

    PubMed

    Lin, Jiacheng; Eggensperger, Sabine; Hank, Susanne; Wycisk, Agnes I; Wieneke, Ralph; Mayerhofer, Peter U; Tampé, Robert

    2014-12-01

    Coevolution of viruses and their hosts represents a dynamic molecular battle between the immune system and viral factors that mediate immune evasion. After the abandonment of smallpox vaccination, cowpox virus infections are an emerging zoonotic health threat, especially for immunocompromised patients. Here we delineate the mechanistic basis of how cowpox viral CPXV012 interferes with MHC class I antigen processing. This type II membrane protein inhibits the coreTAP complex at the step after peptide binding and peptide-induced conformational change, in blocking ATP binding and hydrolysis. Distinct from other immune evasion mechanisms, TAP inhibition is mediated by a short ER-lumenal fragment of CPXV012, which results from a frameshift in the cowpox virus genome. Tethered to the ER membrane, this fragment mimics a high ER-lumenal peptide concentration, thus provoking a trans-inhibition of antigen translocation as supply for MHC I loading. These findings illuminate the evolution of viral immune modulators and the basis of a fine-balanced regulation of antigen processing. PMID:25503639

  2. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting.

    PubMed

    Maynard, Nathaniel D; Macklin, Derek N; Kirkegaard, Karla; Covert, Markus W

    2012-01-01

    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNA(Lys) uridine 34 modification inhibits PRF to influence the ratio of lambda phage proteins gpG and gpGT. Computational modeling and experiments suggest that the role of the iron-sulfur cluster biosynthesis pathway in infection is indirect, via competitive binding of the shared sulfur donor IscS. Based on the universality of many key components of this network, in both the host and the virus, we anticipate that these findings may have broad relevance to understanding other infections, including viral infection of humans. PMID:22294093

  3. Silencing quorum sensing and ICE mobility through antiactivation and ribosomal frameshifting

    PubMed Central

    Ramsay, Joshua P; Ronson, Clive W

    2015-01-01

    Mobile genetic elements run an evolutionary gauntlet to maintain their mobility in the face of selection against their selfish dissemination but, paradoxically, they can accelerate the adaptability of bacteria through the gene-transfer events that they facilitate. These temporally conflicting evolutionary forces have shaped exquisite regulation systems that silence mobility and maximize the competitive fitness of the host bacterium, but maintain the ability of the element to deliver itself to a new host should the opportunity arise. Here we review the excision regulation system of the Mesorhizobium loti symbiosis island ICEMlSymR7A, a 502-kb integrative and conjugative element (ICE) capable of converting non-symbiotic mesorhizobia into plant symbionts. ICEMlSymR7A excision is activated by quorum sensing, however, both quorum sensing and excision are strongly repressed in the vast majority of cells by dual-target antiactivation and programmed ribosomal-frameshifting mechanisms. We examine these recently discovered regulatory features under the light of natural selection and discuss common themes that can be drawn from recent developments in ICE biology. PMID:26942047

  4. CAG tract of MJD-1 may be prone to frameshifts causing polyalanine accumulation.

    PubMed

    Gaspar, C; Jannatipour, M; Dion, P; Laganière, J; Sequeiros, J; Brais, B; Rouleau, G A

    2000-08-12

    Machado-Joseph disease (MJD) is one of several disorders caused by the expansion of a coding CAG repeat (exp-CAG). The presence of intranuclear inclusions (INIs) in patients and cellular models of exp-CAG-associated diseases has lead to a nuclear toxicity model. Similar INIs are found in oculopharyngeal muscular dystrophy, which is caused by a short expansion of an alanine-encoding GCG repeat. Here we propose that transcriptional or translational frameshifts occurring within expanded CAG tracts result in the production and accumulation of polyalanine-containing mutant proteins. We hypothesize that these alanine polymers deposit in cells forming INIs and may contribute to nuclear toxicity. We show evidence that supports our hypothesis in lymphoblast cells from MJD patients, as well as in pontine neurons of MJD brain and in in vitro cell culture models of the disease. We also provide evidence that alanine polymers alone are harmful to cells and predict that a similar pathogenic mechanism may occur in the other CAG repeat disorders. PMID:10942424

  5. Cell cycle control (and more) by programmed −1 ribosomal frameshifting: implications for disease and therapeutics

    PubMed Central

    Belew, Ashton T; Dinman, Jonathan D

    2015-01-01

    Abstract Like most basic molecular mechanisms, programmed –1 ribosomal frameshifting (−1 PRF) was first identified in viruses. Early observations that global dysregulation of −1 PRF had deleterious effects on yeast cell growth suggested that −1 PRF may be used to control cellular gene expression, and the cell cycle in particular. Collection of sufficient numbers of viral −1 PRF signals coupled with advances in computer sciences enabled 2 complementary computational approaches to identify −1 PRF signals in free living organisms. The unexpected observation that almost all −1 PRF events on eukaryotic mRNAs direct ribosomes to premature termination codons engendered the hypothesis that −1 PRF signals post-transcriptionally regulate gene expression by functioning as mRNA destabilizing elements. Emerging research suggests that some human diseases are associated with global defects in −1 PRF. The recent discovery of −1 PRF signal-specific trans-acting regulators may provide insight into novel therapeutic strategies aimed at treating diseases caused by changes in gene expression patterns. PMID:25584829

  6. Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

    SciTech Connect

    Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. ); Vulliamy, T. )

    1993-11-01

    Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

  7. Identification and characterization of a -1 reading frameshift in the heavy chain constant region of an IgG1 recombinant monoclonal antibody produced in CHO cells.

    PubMed

    Lian, Zhirui; Wu, Qindong; Wang, Tongtong

    2016-01-01

    Frameshifts lead to complete alteration of the intended amino acid sequences, and therefore may affect the biological activities of protein therapeutics and pose potential immunogenicity risks. We report here the identification and characterization of a novel -1 frameshift variant in a recombinant IgG1 therapeutic monoclonal antibody (mAb) produced in Chinese hamster ovary cells during the cell line selection studies. The variant was initially observed as an atypical post-monomer fragment peak in size exclusion chromatography. Characterization of the fragment peak using intact and reduced liquid chromatography-mass spectrometry (LC-MS) analyses determined that the fragment consisted of a normal light chain disulfide-linked to an aberrant 26 kDa fragment that could not be assigned to any HC fragment even after considering common modifications. Further analysis using LC-MS/MS peptide mapping revealed that the aberrant fragment contained the expected HC amino acid sequence (1-232) followed by a 20-mer novel sequence corresponding to expression of heavy chain DNA sequence in the -1 reading frame. Examination of the DNA sequence around the frameshift initiation site revealed that a mononucleotide repeat GGGGGG located in the IgG1 HC constant region was most likely the structural root cause of the frameshift. Rapid identification of the frameshift allowed us to avoid use of a problematic cell line containing the frameshift as the production cell line. The frameshift reported here may be observed in other mAb products and the hypothesis-driven analytical approaches employed here may be valuable for rapid identification and characterization of frameshift variants in other recombinant proteins. PMID:26652198

  8. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    PubMed Central

    Cheng, Qiang; Du, Zhihua

    2013-01-01

    Programmed −1 ribosomal frameshifting (PRF) and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event. PMID:24298557

  9. Mutations of the KIT (Mast/Stem cell growth factor receptor) proto-oncogene account for a continuous range of phenotypes in human piebaldism

    SciTech Connect

    Spritz, R.A.; Holmes, S.A. ); Ramesar, R.; Greenberg, J.; Beighton, P.; Curtis, D.

    1992-11-01

    Piebaldism is a rare autosomal dominant disorder of pigmentation, characterized by congenital patches of white skin and hair from which melanocytes are absent. The authors have previously shown that piebaldism can result from missense and frameshift mutations of the KIT proto-oncogene, which encodes the cellular receptor tyrosine kinase for the mast/stem cell growth factor. Here, the authors report two novel KIT mutations associated with human piebaldism. A proximal frameshift is associated with a mild piebald phenotype, and a splice-junction mutation is associated with a highly variable piebald phenotype. They discuss the apparent relationship between the predicted impact of specific KIT mutations on total KIT-dependent signal transduction and the severity of the resultant piebald phenotypes. 35 refs., 5 figs.

  10. Adapting the Established SIS to Meet Higher Education's Increasingly Dynamic Needs. CDS Spotlight Report. ECAR Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service (CDS) to better understand how higher education institutions approach student information systems (SISs). Information provided for this spotlight was derived from Module 8 of the CDS survey, which asked several questions regarding information systems and applications. Responses from…

  11. A comparison of spotlight synthetic aperture radar image formation techniques

    SciTech Connect

    Knittle, C.D.; Doren, N.E.; Jakowatz, C.V.

    1996-10-01

    Spotlight synthetic aperture radar images can be formed from the complex phase history data using two main techniques: (1) polar-to-cartesian interpolation followed by two-dimensional inverse Fourier transform (2DFFT), and (2) convolution backprojection (CBP). CBP has been widely used to reconstruct medical images in computer aided tomography, and only recently has been applied to form synthetic aperture radar imagery. It is alleged that CBP yields higher quality images because (1) all the Fourier data are used and (2) the polar formatted data is used directly to form a 2D Cartesian image and therefore 2D interpolation is not required. This report compares the quality of images formed by CBP and several modified versions of the 2DFFT method. We show from an image quality point of view that CBP is equivalent to first windowing the phase history data and then interpolating to an exscribed rectangle. From a mathematical perspective, we should expect this conclusion since the same Fourier data are used to form the SAR image. We next address the issue of parallel implementation of each algorithm. We dispute previous claims that CBP is more readily parallelizable than the 2DFFT method. Our conclusions are supported by comparing execution times between massively parallel implementations of both algorithms, showing that both experience similar decreases in computation time, but that CBP takes significantly longer to form an image.

  12. Two novel NIPBL gene mutations in Chinese patients with Cornelia de Lange syndrome.

    PubMed

    Mei, Libin; Liang, Desheng; Huang, Yanru; Pan, Qian; Wu, Lingqian

    2015-01-25

    Cornelia de Lange syndrome (CdLS) is a dominantly inherited developmental disorder characterized by distinctive facial features, mental retardation, and upper limb defects, with the involvement of multiple organs and systems. To date, mutations have been identified in five genes responsible for CdLS: NIPBL, SMC1A, SMC3, RAD21, and HDAC8. Here, we present a clinical and molecular characterization of five unrelated Chinese patients whose clinical presentation is consistent with that of CdLS. There were no chromosomal abnormalities in the five children. In three patients, DNA sequencing revealed a previously reported frameshift mutation c.2479delA (p.Arg827GlyfsX20), and two novel mutations including a heterozygous mutation c.6272 G>T (p.Cys2091Phe) and a frameshift mutation c.1672delA (p.Thr558LeufsX7) in NIPBL. For the remaining patients, large deletions and/or duplications within the NIPBL gene were excluded as playing a role in the pathogenesis, by Multiplex Ligation-dependent Probe Amplification (MLPA) analysis. These findings broaden the mutation spectrum of NIPBL and further our understanding of the diverse and variable effects of NIPBL mutations on CdLS. PMID:25447906

  13. Important role of indels in somatic mutations of human cancer genes

    PubMed Central

    2010-01-01

    Background Cancer is clonal proliferation that arises owing to mutations in a subset of genes that confer growth advantage. More and more cancer related genes are found to have accumulated somatic mutations. However, little has been reported about mutational patterns of insertions/deletions (indels) in these genes. Results We analyzed indels' abundance and distribution, the relative ratio between indels and somatic base substitutions and the association between those two forms of mutations in a large number of somatic mutations in the Catalogue of Somatic Mutations in Cancer database. We found a strong correlation between indels and base substitutions in cancer-related genes and showed that they tend to concentrate at the same locus in the coding sequences within the same samples. More importantly, a much higher proportion of indels were observed in somatic mutations, as compared to meiotic ones. Furthermore, our analysis demonstrated a great diversity of indels at some loci of cancer-related genes. Particularly in the genes with abundant mutations, the proportion of 3n indels in oncogenes is 7.9 times higher than that in tumor suppressor genes. Conclusions There are three distinct patterns of indel distribution in somatic mutations: high proportion, great abundance and non-random distribution. Because of the great influence of indels on gene function (e.g., the effect of frameshift mutation), these patterns indicate that indels are frequently under positive selection and can often be the 'driver mutations' in oncogenesis. Such driver forces can better explain why much less frameshift mutations are in oncogenes while much more in tumor suppressor genes, because of their different function in oncogenesis. These findings contribute to our understanding of mutational patterns and the relationship between indels and cancer. PMID:20807447

  14. Detection of eight BRCA1 mutations in 10 breast/ovarian cancer families, including 1 family with male breast cancer

    SciTech Connect

    Sruewing, J.P.; Brody, L.C.; Erdos, M.R.

    1995-07-01

    Genetic epidemiological evidence suggests that mutations in BRCA1 may be responsible for approximately one half of early onset familial breast cancer and the majority of familial breast/ovarian cancer. The recent cloning of BRCA1 allows for the direct detection of mutations, but the feasibility of presymptomatic screening for cancer susceptibility is unknown. We analyzed genomic DNA from one affected individual from each of 24 families with at least three cases of ovarian or breast cancer, using SSCP assays. Variant SSCP bands were subcloned and sequenced. Allele-specific oligonucleotide hybridization was used to verify sequence changes and to screen DNA from control individuals. Six frameshift and two missense mutations were detected in 10 different families. A frameshift mutation was detected in a male proband affected with both breast and prostate cancer. A 40-bp deletion was detected in a patient who developed intra-abdominal carcinomatosis 1 year after prophylactic oophorectomy. Mutations were detected throughout the gene, and only one was detected in more than a single family. These results provide further evidence that inherited breast and ovarian cancer can occur as a consequence of a wide array of BRCA1 mutations. These results suggests that development of a screening test for BRCA1 mutations will be technically challenging. The finding of a mutation in a family with male breast cancer, not previously thought to be related to BRCA1, also illustrates the potential difficulties of genetic counseling for individuals known to carry mutations. 37 refs., 1 fig., 1 tab.

  15. Mutation analysis of the gene involved in adrenoleukodystrophy

    SciTech Connect

    Oost, B.A. van; Ligtenberg, M.J.L.; Kemp, S.; Bolhuis, P.A.

    1994-09-01

    A gene responsible for the X-linked genetic disorder adrenoleukodystrophy (ALD) that is characterized by demyelination of the nervous system and adrenocortical insufficiency has been identified by positional cloning. The gene encodes an ATP-binding transporter which is located in the peroxisomal membrane. Deficiency of the gene leads to accumulation of unsaturated very long chain fatty acids due to impaired peroxisomal {beta}-oxidation. A systematic analysis of the open reading frame of the ALD gene unraveled the mutations in 28 different families using reverse transcriptase-PCR followed by direct sequencing. No entire gene deletions or drastic promoter mutations have been detected. Only in one family did the mutation involved multiple exons. The remaining mutations were subtle alterations leading to missense (about 50%) or nonsense mutations, frameshifts or splice acceptor site defects. In one patient a single codon was missing. Mutations affecting a single amino acid were concentrated in the region between the third and fourth putative membrane spanning fragments and in the ATP-binding domain. This overview of mutations aids in the determination of structural and functional important regions and facilitates the screening for mutations in other ALD patients. The detection of mutations in virtually all ALD families tested indicates that the isolated gene is the only gene responsible for ALD located in Xq28.

  16. Analysis of mutations using PCR and denaturing gradient gel electrophoresis

    SciTech Connect

    Cariello, N.F.; Swenberg, J.A. Duke Univ., Durham, NC ); DeBellis, A.; Skopek, T.R. )

    1991-01-01

    Denaturing gradient gel electrophoresis (DGGE) separates DNA molecules based on primary sequence. Under the appropriate conditions, all base pair (bp) substitutions, frameshifts, and deletions less than about 10 bp can be resolved from the wild type sequence using DGGE. Polymerase chain reaction (PCR) permits facile amplification of a given region of the genome. The authors have combined PCR and DGGE to: (1) localize mutations in the X-linked human androgen receptor gene; (2) analyze thousands of thioguanine-resistant mutants simultaneously; (3) examine the fidelity of several DNA polymerases used in PCR.

  17. Haematopoietic and immune defects associated with GATA2 mutation

    PubMed Central

    Collin, Matthew; Dickinson, Rachel; Bigley, Venetia

    2015-01-01

    Heterozygous familial or sporadic GATA2 mutations cause a multifaceted disorder, encompassing susceptibility to infection, pulmonary dysfunction, autoimmunity, lymphoedema and malignancy. Although often healthy in childhood, carriers of defective GATA2 alleles develop progressive loss of mononuclear cells (dendritic cells, monocytes, B and Natural Killer lymphocytes), elevated FLT3 ligand, and a 90% risk of clinical complications, including progression to myelodysplastic syndrome (MDS) by 60 years of age. Premature death may occur from childhood due to infection, pulmonary dysfunction, solid malignancy and MDS/acute myeloid leukaemia. GATA2 mutations include frameshifts, amino acid substitutions, insertions and deletions scattered throughout the gene but concentrated in the region encoding the two zinc finger domains. Mutations appear to cause haplo-insufficiency, which is known to impair haematopoietic stem cell survival in animal models. Management includes genetic counselling, prevention of infection, cancer surveillance, haematopoietic monitoring and, ultimately, stem cell transplantation upon the development of MDS or another life-threatening complication. PMID:25707267

  18. [Correlation of adult AML Npm1 mutations with prognosis and its relationship with gene mutation of FLT3 and CEBPA].

    PubMed

    Bao, Li-Yan; Wang, Ji-Shi

    2010-02-01

    This study was aimed to investigate the correlation of 12th exon mutations in the npm1 gene with prognosis of adult AML patients and to explore the relationship of 12th exon mutation with other gene mutations. The specimen of bone marrow and peripheral blood from AML patients, the informations of medical history, symptoms, related image examinations, blood routine examination, NAP, oxygen saturation level in artery blood and EPO level in serum were collected; the bcr/abl fusion gene was detected by routine examination of bone marrow + biopsy + chromosome mapping + FISH. The patients were typed according to WHO classification. The DNA in cells was extracted, the npm1 gene mutation was detected by allele specific PCR combined were the sequencing. The results indicated that the npm1 heterozygote gene mutation was found in 72 out of 150 AML patients with normal cytogenetics (48%, 72/150). 48% patients showed a frameshift mutation in the C-terminal region of the NPM1 protein. The AML patients with npm1 gene mutation had specific clinical, phenotypic and genetic characteristics. The statistical analysis demonstrated the relationship between npm1 and flt3 ITDs. The patients with npm1 mutation showed a better response to induction therapy, furthermore, the overall survival (OS) rate of patients without flt3 ITD mutation was enhanced. The multivariate analysis demonstrated that the npm1 gene mutation and cebpa mutation positively correlated to the OS rate, and the correlation of flt3 mutation to OS rate showed negative. It is concluded that npm1 mutation is a favorable independent prognostic factor for adult AML patients with normal cytogenetics under conditions without FIT3 gene mutation. PMID:20137111

  19. Novel Patched 1 mutations in patients with nevoid basal cell carcinoma syndrome – case report

    PubMed Central

    Škodrić-Trifunović, Vesna; Stjepanović, Mihailo; Savić, Živorad; Ilić, Miroslav; Kavečan, Ivana; Jovanović Privrodski, Jadranka; Spasovski, Vesna; Stojiljković, Maja; Pavlović, Sonja

    2015-01-01

    Nevoid basal cell carcinoma syndrome (Gorlin syndrome) is a rare autosomal dominant disorder characterized by numerous basal cell carcinomas, keratocystic odontogenic tumors of the jaws, and diverse developmental defects. This disorder is associated with mutations in tumor suppressor gene Patched 1 (PTCH1). We present two patients with Gorlin syndrome, one sporadic and one familial. Clinical examination, radiological, and CT imaging, and mutation screening of PTCH1 gene were performed. Family members, as well as eleven healthy controls were included in the study. Both patients fulfilled the specific criteria for diagnosis of Gorlin syndrome. Molecular analysis of the first patient showed a novel frameshift mutation in exon 6 of PTCH1gene (c.903delT). Additionally, a somatic frameshift mutation in exon 21 (c.3524delT) along with germline mutation in exon 6 was detected in tumor-derived tissue sample of this patient. Analysis of the second patient, as well as two affected family members, revealed a novel nonsense germline mutation in exon 8 (c.1148 C>A). PMID:25727044

  20. Identification of two novel mutations in patients with X-linked primary immunodeficiencies.

    PubMed

    Yu, Li; Wang, Xike; Wang, Yuchuan; Wang, Jian

    2015-04-01

    Primary immunodeficiency diseases (PID) are a heterogeneous group of inherited disorders with defects in one or more component of the immune system. In this study, we analyzed gene mutations in four X-linked PID pedigrees, which include one X- linked agammaglobulinemia (XLA) pedigree, one X-linked chronic granulomatous disease (XCGD) pedigree, and two X-linked Hyper IgM syndrome (XHIGM) pedigrees. Sequence analysis of the BTK gene revealed a novel mutation (c.1802_1803delinsGCC, p.Phe601CysfsX3) which results in the developmental arrest of B cells in the bone marrow. Sequence analysis of the CYBB gene revealed a recurrent frameshift mutation (c.1313_1314delinsT) in exon 10, which generates a premature stop codon (p.Lys438IlefsX63). One novel frameshift mutation (c.114delG, p.Ser39GlnfsX14) and one recurrent missense mutation (c.499G>C, p.Gly167Arg) were found in the CD40LG gene and cause defective T cell functioning. In conclusion, our study identified two novel mutations on the BTK and CD40LG genes in Chinese patients and established accurate and simple genetic diagnostic methods for three X-linked PID. PMID:25353698

  1. Truncating and missense mutations in IGHMBP2 cause Charcot-Marie Tooth disease type 2.

    PubMed

    Cottenie, Ellen; Kochanski, Andrzej; Jordanova, Albena; Bansagi, Boglarka; Zimon, Magdalena; Horga, Alejandro; Jaunmuktane, Zane; Saveri, Paola; Rasic, Vedrana Milic; Baets, Jonathan; Bartsakoulia, Marina; Ploski, Rafal; Teterycz, Pawel; Nikolic, Milos; Quinlivan, Ros; Laura, Matilde; Sweeney, Mary G; Taroni, Franco; Lunn, Michael P; Moroni, Isabella; Gonzalez, Michael; Hanna, Michael G; Bettencourt, Conceicao; Chabrol, Elodie; Franke, Andre; von Au, Katja; Schilhabel, Markus; Kabzińska, Dagmara; Hausmanowa-Petrusewicz, Irena; Brandner, Sebastian; Lim, Siew Choo; Song, Haiwei; Choi, Byung-Ok; Horvath, Rita; Chung, Ki-Wha; Zuchner, Stephan; Pareyson, Davide; Harms, Matthew; Reilly, Mary M; Houlden, Henry

    2014-11-01

    Using a combination of exome sequencing and linkage analysis, we investigated an English family with two affected siblings in their 40s with recessive Charcot-Marie Tooth disease type 2 (CMT2). Compound heterozygous mutations in the immunoglobulin-helicase-μ-binding protein 2 (IGHMBP2) gene were identified. Further sequencing revealed a total of 11 CMT2 families with recessively inherited IGHMBP2 gene mutations. IGHMBP2 mutations usually lead to spinal muscular atrophy with respiratory distress type 1 (SMARD1), where most infants die before 1 year of age. The individuals with CMT2 described here, have slowly progressive weakness, wasting and sensory loss, with an axonal neuropathy typical of CMT2, but no significant respiratory compromise. Segregating IGHMBP2 mutations in CMT2 were mainly loss-of-function nonsense in the 5' region of the gene in combination with a truncating frameshift, missense, or homozygous frameshift mutations in the last exon. Mutations in CMT2 were predicted to be less aggressive as compared to those in SMARD1, and fibroblast and lymphoblast studies indicate that the IGHMBP2 protein levels are significantly higher in CMT2 than SMARD1, but lower than controls, suggesting that the clinical phenotype differences are related to the IGHMBP2 protein levels. PMID:25439726

  2. Concentration of mutations causing Schmid metaphyseal chondrodysplasia in the NC1 domain of type X collagen

    SciTech Connect

    McIntosh, I.; Abbott, M.H.; Francomano, C.A.

    1994-09-01

    Schmid metaphyseal chondrodysplasia (SMCD, MIM 156500) is an autosomal dominant disorder of the osseous skeleton resulting in short stature, coxa vara and a waddling gait. Type X collagen is an extracellular matrix protein expressed exclusively by hypertrophic chondrocytes. We have previously identified four mutations in the type X collagen gene (COL10A1) in patients with SMCD. Each of these mutations, as well as another three reported by other investigators, are in the carboxy-terminal non-collagenous domain (NC1). Here, we present data for another three mutations each predicted to cause premature termination of translation within the NC1 domain. Two are nonsense mutations, Y628X and W651X, while the third is a frameshift resulting from the deletion of two nucleotides, 1856delCC. Each of these mutations occurred de novo, resulting in sporadic cases of SMCD. Four frameshift mutations have now been reported to initiate within 10bp of each other in the NC1 domain, namely 1865delC, 1856delCC, 1856del13 and 1866del10. These findings further support the hypothesis that SMCD is the result of the mutant type X collagen molecule being unable to participate in trimerization, although a dominant-negative model of disease pathogenesis has not been formally excluded.

  3. Mutations in DVL1 Cause an Osteosclerotic Form of Robinow Syndrome

    PubMed Central

    Bunn, Kieran J.; Daniel, Phil; Rösken, Heleen S.; O’Neill, Adam C.; Cameron-Christie, Sophia R.; Morgan, Tim; Brunner, Han G.; Lai, Angeline; Kunst, Henricus P.M.; Markie, David M.; Robertson, Stephen P.

    2015-01-01

    Robinow syndrome (RS) is a phenotypically and genetically heterogeneous condition that can be caused by mutations in genes encoding components of the non-canonical Wnt signaling pathway. In contrast, germline mutations that act to increase canonical Wnt signaling lead to distinctive osteosclerotic phenotypes. Here, we identified de novo frameshift mutations in DVL1, a mediator of both canonical and non-canonical Wnt signaling, as the cause of RS-OS, an RS subtype involving osteosclerosis, in three unrelated individuals. The mutations all delete the DVL1 C terminus and replace it, in each instance, with a novel, highly basic sequence. We showed the presence of mutant transcript in fibroblasts from one individual with RS-OS and demonstrated unimpaired protein stability with transfected GFP-tagged constructs bearing a frameshift mutation. In vitro TOPFlash assays, in apparent contradiction to the osteosclerotic phenotype, revealed that the mutant allele was less active than the wild-type allele in the canonical Wnt signaling pathway. However, when the mutant and wild-type alleles were co-expressed, canonical Wnt activity was 2-fold higher than that in the wild-type construct alone. This work establishes that DVL1 mutations cause a specific RS subtype, RS-OS, and that the osteosclerosis associated with this subtype might be the result of an interaction between the wild-type and mutant alleles and thus lead to elevated canonical Wnt signaling. PMID:25817014

  4. Letter to the Editor: A Novel Mutation in the CREBBP Gene of a Korean Girl with Rubinstein-Taybi syndrome.

    PubMed

    Huh, Rimm; Cho, Sung Yoon; Kim, Jinsup; Ki, Chang-Seok; Jin, Dong-Kyu

    2015-01-01

    Rubinstein-Taybi syndrome (RTS) is a rare congenital disorder characterized by broad thumbs and halluces, dysmorphic facial features, mental retardation, and short stature. Mutations in the cAMP-response element binding protein-BP (CREBBP) gene (50-60% of cases) and E1A-binding protein (EP300, 3%) are known genetic causes in affected individuals. Here, we describe a genetically confirmed Korean RTS patient with atypical features, including Hirschsprung disease and growth hormone deficiency. Mutational analysis revealed a novel heterozygous frameshift mutation, c.2064_2077del14 (p.Gly689Cysfs*32) in the CREBBP gene. PMID:26275701

  5. Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

    SciTech Connect

    Ionasescu, V.; Ionasescu, R.; Searby, C.

    1996-06-14

    We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these families showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.

  6. A Novel Mutation of the HNF1B Gene Associated With Hypoplastic Glomerulocystic Kidney Disease and Neonatal Renal Failure

    PubMed Central

    Alvelos, Maria Inês; Rodrigues, Magda; Lobo, Luísa; Medeira, Ana; Sousa, Ana Berta; Simão, Carla; Lemos, Manuel Carlos

    2015-01-01

    Abstract Hepatocyte nuclear factor 1 beta (HNF1B) plays an important role in embryonic development, namely in the kidney, pancreas, liver, genital tract, and gut. Heterozygous germline mutations of HNF1B are associated with the renal cysts and diabetes syndrome (RCAD). Affected individuals may present a variety of renal developmental abnormalities and/or maturity-onset diabetes of the young (MODY). A Portuguese 19-month-old male infant was evaluated due to hypoplastic glomerulocystic kidney disease and renal dysfunction diagnosed in the neonatal period that progressed to stage 5 chronic renal disease during the first year of life. His mother was diagnosed with a solitary hypoplastic microcystic left kidney at age 20, with stage 2 chronic renal disease established at age 35, and presented bicornuate uterus, pancreatic atrophy, and gestational diabetes. DNA sequence analysis of HNF1B revealed a novel germline frameshift insertion (c.110_111insC or c.110dupC) in both the child and the mother. A review of the literature revealed a total of 106 different HNF1B mutations, in 236 mutation-positive families, comprising gross deletions (34%), missense mutations (31%), frameshift deletions or insertions (15%), nonsense mutations (11%), and splice-site mutations (8%). The study of this family with an unusual presentation of hypoplastic glomerulocystic kidney disease with neonatal renal dysfunction identified a previously unreported mutation of the HNF1B gene, thereby expanding the spectrum of known mutations associated with renal developmental disorders. PMID:25700310

  7. Germline RECQL mutations in high risk Chinese breast cancer patients.

    PubMed

    Kwong, Ava; Shin, Vivian Y; Cheuk, Isabella W Y; Chen, Jiawei; Au, Chun H; Ho, Dona N; Chan, Tsun L; Ma, Edmond S K; Akbari, Mohammad R; Narod, Steven A

    2016-06-01

    Recently, RECQL was reported as a new breast cancer susceptibility gene. RECQL belongs to the RECQ DNA helicase family which unwinds double strand DNA and involved in the DNA replication stress response, telomere maintenance and DNA repair. RECQL deficient mice cells are prone to spontaneous chromosomal instability and aneuploidy, suggesting a tumor-suppressive role of RECQL in cancer. In this study, RECQL gene mutation screening was performed on 1110 breast cancer patients who were negative for BRCA1, BRCA2, TP53 and PTEN gene mutations and recruited from March 2007 to June 2015 in the Hong Kong Hereditary and High Risk Breast Cancer Program. Four different RECQL pathogenic mutations were identified in six of the 1110 (0.54 %) tested breast cancer patients. The identified mutations include one frame-shift deletion (c.974_977delAAGA), two splicing site mutations (c.394+1G>A, c.867+1G>T) and one nonsense mutation (c.796C>T, p.Gln266Ter). Two of the mutations (c.867+1G>T and p.Gln266Ter) were seen in more than one patients. This study provides the basis for existing of pathogenic RECQL mutations in Southern Chinese breast cancer patients. The significance of rare variants in RECQL gene in the estimation of breast cancer risk warranted further investigation in larger cohort of patients and in other ethnic groups. PMID:27125668

  8. Pancreatic adenocarcinomas frequently show p53 gene mutations.

    PubMed Central

    Scarpa, A.; Capelli, P.; Mukai, K.; Zamboni, G.; Oda, T.; Iacono, C.; Hirohashi, S.

    1993-01-01

    Thirty-four pancreatic adenocarcinomas were studied for the presence of p53 gene mutations by the single-strand conformation polymorphism method and by direct sequencing of PCR-amplified fragments. p53 protein expression was immunohistochemically evaluated using monoclonal PAb1801 and polyclonal CM1 antibodies. Mutations were detected in 14 cases. The transitions were six G to A and two A to G; the transversions were one C to G and two A to C; the remaining three were frameshift mutations. Immunostaining results were identical with both antibodies. Nuclear immunohistochemical p53-positive cells were found in nine p53 mutated cases and in 12 cases in which no mutation was detected. In most of these latter cases only a minority of cancer cells showed immunohistochemical positivity. Twenty-nine cases, including all p53 mutated cancers, were known to contain codon 12 Ki-ras gene mutations. Also in the light of the demonstrated cooperation of ras and p53 gene alterations in the transformation of cultured cells, our data suggest that p53 mutation is one of the genetic defects that may have a role in the pathogenesis of a proportion of pancreatic cancers. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8494051

  9. New developmental evidence supports a homeotic frameshift of digit identity in the evolution of the bird wing

    PubMed Central

    2014-01-01

    Background The homology of the digits in the bird wing is a high-profile controversy in developmental and evolutionary biology. The embryonic position of the digits cartilages with respect to the primary axis (ulnare and ulna) corresponds to 2, 3, 4, but comparative-evolutionary morphology supports 1, 2, 3. A homeotic frameshift of digit identity in evolution could explain how cells in embryonic positions 2, 3, 4 began developing morphologies 1, 2, 3. Another alternative is that no re-patterning of cell fates occurred, and the primary axis shifted its position by some other mechanism. In the wing, only the anterior digit lacks expression of HoxD10 and HoxD12, resembling digit 1 of other limbs, as predicted by 1, 2, 3. However, upon loss of digit 1 in evolution, the most anterior digit 2 could have lost their expression, deceitfully resembling a digit 1. To test this notion, we observed HoxD10 and HoxD12 in a limb where digit 2 is the most anterior digit: The rabbit foot. We also explored whether early inhibition of Shh signalling in the embryonic wing bud induces an experimental homeotic frameshift, or an experimental axis shift. We tested these hypotheses using DiI injections to study the fate of cells in these experimental wings. Results We found strong transcription of HoxD10 and HoxD12 was present in the most anterior digit 2 of the rabbit foot. Thus, we found no evidence to question the use of HoxD expression as support for 1, 2, 3. When Shh signalling in early wing buds is inhibited, our fate maps demonstrate that an experimental homeotic frameshift is induced. Conclusion Along with comparative morphology, HoxD expression provides strong support for 1, 2, 3 identity of wing digits. As an explanation for the offset 2, 3, 4 embryological position, the homeotic frameshift hypothesis is consistent with known mechanisms of limb development, and further proven to be experimentally possible. In contrast, the underlying mechanisms and experimental plausibility of an

  10. Somatic CALR Mutations in Myeloproliferative Neoplasms with Nonmutated JAK2

    PubMed Central

    Baxter, E.J.; Nice, F.L.; Gundem, G.; Wedge, D.C.; Avezov, E.; Li, J.; Kollmann, K.; Kent, D.G.; Aziz, A.; Godfrey, A.L.; Hinton, J.; Martincorena, I.; Van Loo, P.; Jones, A.V.; Guglielmelli, P.; Tarpey, P.; Harding, H.P.; Fitzpatrick, J.D.; Goudie, C.T.; Ortmann, C.A.; Loughran, S.J.; Raine, K.; Jones, D.R.; Butler, A.P.; Teague, J.W.; O’Meara, S.; McLaren, S.; Bianchi, M.; Silber, Y.; Dimitropoulou, D.; Bloxham, D.; Mudie, L.; Maddison, M.; Robinson, B.; Keohane, C.; Maclean, C.; Hill, K.; Orchard, K.; Tauro, S.; Du, M.-Q.; Greaves, M.; Bowen, D.; Huntly, B.J.P.; Harrison, C.N.; Cross, N.C.P.; Ron, D.; Vannucchi, A.M.; Papaemmanuil, E.; Campbell, P.J.; Green, A.R.

    2014-01-01

    BACKGROUND Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. METHODS We performed exome sequencing of samples obtained from 151 patients with myeloproliferative neoplasms. The mutation status of the gene encoding calreticulin (CALR) was assessed in an additional 1345 hematologic cancers, 1517 other cancers, and 550 controls. We established phylogenetic trees using hematopoietic colonies. We assessed calreticulin subcellular localization using immunofluorescence and flow cytometry. RESULTS Exome sequencing identified 1498 mutations in 151 patients, with medians of 6.5, 6.5, and 13.0 mutations per patient in samples of polycythemia vera, essential thrombocythemia, and myelofibrosis, respectively. Somatic CALR mutations were found in 70 to 84% of samples of myeloproliferative neoplasms with nonmutated JAK2, in 8% of myelodysplasia samples, in occasional samples of other myeloid cancers, and in none of the other cancers. A total of 148 CALR mutations were identified with 19 distinct variants. Mutations were located in exon 9 and generated a +1 base-pair frameshift, which would result in a mutant protein with a novel C-terminal. Mutant calreticulin was observed in the endoplasmic reticulum without increased cell-surface or Golgi accumulation. Patients with myeloproliferative neoplasms carrying CALR mutations presented with higher platelet counts and lower hemoglobin levels than patients with mutated JAK2. Mutation of CALR was detected in hematopoietic stem and progenitor cells. Clonal analyses showed CALR mutations in the earliest phylogenetic node, a finding consistent with its role as an initiating mutation in some patients. CONCLUSIONS Somatic mutations in the endoplasmic reticulum chaperone CALR were found in a majority of patients with myeloproliferative neoplasms with