Science.gov

Sample records for frameshift mutations spotlight

  1. Frameshift mutation events in beta-glucosidases.

    PubMed

    Rojas, Antonio; Garcia-Vallvé, Santiago; Montero, Miguel A; Arola, Lluís; Romeu, Antoni

    2003-09-18

    Compensated frameshift mutation is a modification of the reading frame of a gene that takes place by way of various molecular events. It appears to be a widespread event that is only observed when homologous amino acid and nucleodotide sequences are compared. To identify these mutation events, the sequence analysis rationale was based on the search for short regions that would have much lower degrees of conservation in protein, but not in DNA, in well-conserved beta-glucosidase families. We have restricted our study to a seed set of sequences of O-glycoside hydrolase families 1 and 3. We found compensated frameshift mutation in the family of 1 beta-glucosidases for the Erwinia herbicola, Cellulomonas fimi, and (non-cyanogenic) Trifolium repens gene sequences, and in the family of 3 beta-glucosidases for the Clostridium thermocellum and Clostridium stercorarium gene sequences. By computational treatment, the observed mutation events in the gene frameshifting sub-sequence have been neutralised. Each nucleotide insertion must be eliminated and each nucleotide deletion must be substituted by the symbol N (any nucleotide). When the frameshifting fragments of the amino acid sequences were substituted by the computationally neutralised subsequences, the beta-glucosidase alignments were improved. We also discuss the structural implications of the compensated frameshift mutations events. PMID:14527732

  2. Atrial natriuretic peptide frameshift mutation in familial atrial fibrillation.

    PubMed

    Hodgson-Zingman, Denice M; Karst, Margaret L; Zingman, Leonid V; Heublein, Denise M; Darbar, Dawood; Herron, Kathleen J; Ballew, Jeffrey D; de Andrade, Mariza; Burnett, John C; Olson, Timothy M

    2008-07-10

    Atrial fibrillation is a common arrhythmia that is hereditary in a small subgroup of patients. In a family with 11 clinically affected members, we mapped an atrial fibrillation locus to chromosome 1p36-p35 and identified a heterozygous frameshift mutation in the gene encoding atrial natriuretic peptide. Circulating chimeric atrial natriuretic peptide (ANP) was detected in high concentration in subjects with the mutation, and shortened atrial action potentials were seen in an isolated heart model, creating a possible substrate for atrial fibrillation. This report implicates perturbation of the atrial natriuretic peptide-cyclic guanosine monophosphate (cGMP) pathway in cardiac electrical instability. PMID:18614783

  3. Adaptive Reversion of a Frameshift Mutation in Escherichia Coli

    PubMed Central

    Cairns, J.; Foster, P. L.

    1991-01-01

    Mutation rates are generally thought not to be influenced by selective forces. This doctrine rests on the results of certain classical studies of the mutations that make bacteria resistant to phages and antibiotics. We have studied a strain of Escherichia coli which constitutively expresses a lacI-lacZ fusion containing a frameshift mutation that renders it Lac(-). Reversion to Lac(+) is a rare event during exponential growth but occurs in stationary cultures when lactose is the only source of energy. No revertants accumulate in the absence of lactose, or in the presence of lactose if there is another, unfulfilled requirement for growth. The mechanism for such mutation in stationary phase is not known, but it requires some function of RecA which is apparently not required for mutation during exponential growth. PMID:1916241

  4. Novel Frameshift CHD7 Mutation Related to CHARGE Syndrome

    PubMed Central

    Martínez-Quintana, E.; Rodríguez-González, F.; Garay-Sánchez, P.; Tugores, A.

    2014-01-01

    CHARGE syndrome is a rare congenital condition characterized by 6 cardinal features: coloboma, heart defect, atresia choanae, retarded growth and development, genital anomalies, and ear anomalies/deafness. Mutations of the chromodomain helicase DNA-binding protein gene CHD7 are reported to be a major cause of CHARGE syndrome. Herein, we report the case of a 27-year-old patient presenting with typical symptoms who bears a novel heterozygous insertion in exon 2 of the CHD7 gene (c.327dupC) resulting in an amino acid substitution and a frameshift (p.Val110Argfs*22) that leads to a 131-amino-acid truncated polypeptide, likely representing a null allele. Parental genetic screening confirmed the sporadic origin of the mutation. PMID:24550764

  5. COMPLEX FRAMESHIFT MUTATIONS MEDIATED BY PLASMID PKM101: MUTATIONAL MECHANISMS DEDUCED FROM 4-AMINOBIPHENYL-INDUCED MUTATION SPECTRA IN SALMONELLA

    EPA Science Inventory

    We used colony probe hybridization and PCR/DNA sequencing to determine the mutations -aminobiphenyl (4-AB) +S9-induced revertants of the -1 frameshift allele in 2,300 4-aminobiphenyl of the base-substitution allele hisD3052 in strains TA1978, TA1538, and TA98 and were at strains ...

  6. Mechanisms of Spontaneous and Induced Frameshift Mutation in Bacteriophage T4

    PubMed Central

    Streisinger, George; Owen, Joyce Emrich

    1985-01-01

    Frequencies of spontaneous and proflavine-induced frameshift mutations increase dramatically as a function of the number of reiterated base pairs at each of two sites in the lysozyme gene of bacteriophage T4. At each site, proflavine induces addition mutations more frequently than deletion mutations. We confirm that the steroidal diamine, irehdiamine A, induces frameshift addition mutations. At sites of reiterated bases, we propose that base pairing is misaligned adjacent to a gap. The misaligned configuration is stabilized by the stacking of mutagen molecules around the extrahelical base, forming a sandwich. Proflavine induces addition mutations efficiently at a site without any reiterated bases. Mutagenesis at such sites may be due to mutagen-induced stuttering of the replication complex. PMID:3988038

  7. Frameshift mutations at two hotspots in vasopressin transcripts in post-mitotic neurons.

    PubMed Central

    Evans, D A; van der Kleij, A A; Sonnemans, M A; Burbach, J P; van Leeuwen, F W

    1994-01-01

    Mutations in DNA underlie carcinogenesis, inherited pathology, and aging and are generally thought to be introduced during meiosis and mitosis. Here we report that in post-mitotic neurons specific frameshift mutations occur at high frequency. These mutations were identified in vasopressin transcripts in magnocellular neurons of the homozygous Brattleboro rat and predominantly consist of a GA deletion in GAGAG motifs. Immunocytochemistry provides evidence for similar events in wild-type rats. However, the diseased state of the Brattleboro rat, resulting in a permanent activation of vasopressin neurons, enhanced the mutational rate. These data reveal hitherto unrecognized somatic mutations in nondividing neurons. Images PMID:8016115

  8. Frameshift mutations of a tumor suppressor gene ZNF292 in gastric and colorectal cancers with high microsatellite instability.

    PubMed

    Lee, Ju Hwa; Song, Sang Yong; Kim, Min Sung; Yoo, Nam Jin; Lee, Sug Hyung

    2016-07-01

    A transcription factor-encoding gene ZNF292 is considered a candidate tumor suppressor gene (TSG). Its mutations have been identified in cancers from liver, colon, and bone marrow. However, ZNF292 inactivating mutations that might suppress the TSG functions have not been reported in gastric (GC) and colorectal cancers (CRC) with microsatellite instability (MSI). In a public database, we found that ZNF292 gene had mononucleotide repeats in the coding sequences that might be mutation targets in the cancers with MSI. In this study, we analyzed 79 GCs and 124 CRCs including high MSI (MSI-H) and microsatellite stable/low MSI (MSS/MSI-L) cases for the detection of somatic mutations in the repeats. Overall, we identified frameshift mutations of ZNF292 in 3 (8.8%) GCs and 11 (13.9%) CRCs with MSI-H (14/113), but not in MSS/MSI-L cancers (0/90) (p < 0.001). Also, we studied intratumoral heterogeneity (ITH) of the ZNF292 frameshift mutations in 16 CRCs and found that two (12.5%) had regional ITH of the mutations. Our data show that ZNF292 gene harbors not only frameshift mutations but also mutational ITH, which together may be features of GC and CRC with MSI-H. Based on this, the ZNF292 frameshift mutations may possibly contribute to tumorigenesis by altering its TSG functions in GC and CRC. PMID:27150435

  9. An adolescent case of familial hyperparathyroidism with a germline frameshift mutation of the CDC73 gene.

    PubMed

    Takeuchi, Takako; Yoto, Yuko; Tsugawa, Takeshi; Kamasaki, Hotaka; Kondo, Atsushi; Ogino, Jiro; Hasegawa, Tadashi; Yama, Naoya; Anan, Sawa; Uchino, Shinya; Ishikawa, Aki; Sakurai, Akihiro; Tsutsumi, Hiroyuki

    2015-10-01

    A 13-yr-old boy who complained of persistent nausea, vomiting and weight loss had hypercalcemia and an elevated intact PTH level. Computed tomography confirmed two tumors in the thyroid gland. The tumors were surgically removed and pathologically confirmed as parathyroid adenoma. Because his maternal aunt and grandmother both had histories of parathyroid tumors, genetic investigation was undertaken for him, and a germline frameshift mutation of the CDC73 gene was identified. CDC73 gene analysis should be done on individuals who are at risk of familial hyperparathyroidism, including those who are asymptomatic, and they should be followed for potential primary hyperparathyroidism and associated disorders including resultant parathyroid carcinoma. PMID:26568659

  10. A novel frameshift mutation of CHD7 in a Japanese patient with CHARGE syndrome

    PubMed Central

    Kohmoto, Tomohiro; Shono, Miki; Naruto, Takuya; Watanabe, Miki; Suga, Ken-ichi; Nakagawa, Ryuji; Kagami, Shoji; Masuda, Kiyoshi; Imoto, Issei

    2016-01-01

    CHARGE syndrome is a rare autosomal dominant developmental disorder involving multiple organs. CHD7 is a major causative gene of CHARGE syndrome. We performed targeted-exome sequencing using a next-generation sequencer for molecular diagnosis of a 4-month-old male patient who was clinically suspected to have CHARGE syndrome, and report a novel monoallelic mutation in CHD7, NM_017780.3(CHD7_v001):c.2966del causing a reading frameshift [p.(Cys989Serfs*3)]. PMID:27081570

  11. A novel OTX2 gene frameshift mutation in a child with microphthalmia, ectopic pituitary and growth hormone deficiency.

    PubMed

    Lonero, Antonella; Delvecchio, Maurizio; Primignani, Paola; Caputo, Roberto; Bargiacchi, Sara; Penco, Silvana; Mauri, Lucia; Andreucci, Elena; Faienza, Maria Felicia; Cavallo, Luciano

    2016-05-01

    OTX2 mutations are reported in patients with eye maldevelopment and in some cases with brain or pituitary abnormalities. We describe a child carrying a novel OTX2 heterozygous mutation. She presented microphthalmia, absence of retinal vascularization, vitreal spots and optic nerve hypoplasia in the right eye and mild macular dystrophy in the left eye. Midline brain structures and cerebral parenchyma were normal, except for the ectopic posterior pituitary gland. OTX2 sequencing showed a heterozygous c.402del mutation. Most of OTX2 mutations are nonsense or frameshift introducing a premature termination codon and resulting in a truncated protein. More rarely missense mutations occur. Our novel OTX2 mutation (c.402del) is a frameshift mutation (p.S135Lfs*43), never reported before, causing a premature codon stop 43 amino-acids downstream, which is predicted to generate a premature truncation. The mutation was associated with microphthalmia and ectopic posterior pituitary. PMID:26974134

  12. Heterozygous frameshift mutation in keratin 5 in a family with Galli–Galli disease

    PubMed Central

    Reisenauer, AK; Wordingham, SV; York, J; Kokkonen, EWJ; Mclean, WHI; Wilson, NJ; Smith, FJD

    2014-01-01

    Background Reticulate pigmentary disorders include the rare autosomal dominant Galli–Galli disease (GGD) and Dowling–Degos disease (DDD). Clinical diagnosis between some of the subtypes can be difficult due to a degree of overlap between clinical features, therefore analysis at the molecular level may be necessary to confirm the diagnosis. Objectives To identify the underlying genetic defect in a 48-year-old Asian-American woman with a clinical diagnosis of GGD. Methods Histological analysis was performed on a skin biopsy using haematoxylin–eosin staining. KRT5 (the gene encoding keratin 5) was amplified from genomic DNA and directly sequenced. Results The patient had a history of pruritus and hyperpigmented erythematous macules and thin papules along the flexor surfaces of her arms, her upper back and neck, axillae and inframammary areas. Hypopigmented macules were seen among the hyperpigmentation. A heterozygous 1-bp insertion mutation in KRT5 (c.38dupG; p.Ser14GlnfsTer3) was identified in the proband. This mutation occurs within the head domain of the keratin 5 protein leading to a frameshift and premature stop codon. Conclusions From the histological findings and mutation analysis the individual was identified as having GGD due to haploinsufficiency of keratin 5. PMID:24372084

  13. A CHRNE frameshift mutation causes congenital myasthenic syndrome in young Jack Russell Terriers.

    PubMed

    Rinz, Caitlin J; Lennon, Vanda A; James, Fiona; Thoreson, James B; Tsai, Kate L; Starr-Moss, Alison N; Humphries, H Dale; Guo, Ling T; Palmer, Anthony C; Clark, Leigh Anne; Shelton, G Diane

    2015-12-01

    Congenital myasthenic syndromes (CMSs) are a group of rare genetic disorders of the neuromuscular junction resulting in structural or functional causes of fatigable weakness that usually begins early in life. Mutations in pre-synaptic, synaptic and post-synaptic proteins have been demonstrated in human cases, with more than half involving aberrations in nicotinic acetylcholine receptor (AChR) subunits. CMS was first recognized in dogs in 1974 as an autosomal recessive trait in Jack Russell Terriers (JRTs). A deficiency of junctional AChRs was demonstrated. Here we characterize a CMS in 2 contemporary cases of JRT littermates with classic clinical and electromyographic findings, and immunochemical confirmation of an approximately 90% reduction in AChR protein content. Loci encoding the 5 AChR subunits were evaluated using microsatellite markers, and CHRNB1 and CHRNE were identified as candidate genes. Sequences of the splice sites and exons of both genes revealed a single base insertion in exon 7 of CHRNE that predicts a frameshift mutation and a premature stop codon. We further demonstrated this pathogenic mutation in CHRNE in archival tissues from unrelated JRTs studied 34 years ago. PMID:26429099

  14. Novel SMC1A frameshift mutations in children with developmental delay and epilepsy.

    PubMed

    Goldstein, Jessica H R; Tim-Aroon, Thipwimol; Shieh, Joseph; Merrill, Michelle; Deeb, Kristin K; Zhang, Shulin; Bass, Nancy E; Bedoyan, Jirair K

    2015-10-01

    Cornelia de Lange syndrome (CdLS) is a rare dominantly inherited genetic multisystem developmental condition with considerable phenotypic and allelic heterogeneity. Missense and in-frame deletions within the SMC1A gene can be associated with epilepsy and milder craniofacial features. We report two females who presented with developmental delay and developed isolated medically refractory seizures with unrevealing initial laboratory, imaging and genetic evaluations. Whole exome sequencing (WES) analyses were performed and were instrumental in uncovering the genetic etiology for their conditions. WES identified two novel de novo heterozygous frameshift mutations in the SMC1A gene [c.2853_2856delTCAG (p.Ser951Argfs*12) and c.3549_3552dupGGCC (p.Ile1185Glyfs*23)]. We also observed marked skewing of X-inactivation in one patient. The individual with the p.Ser951Argfs*12 mutation represents an extreme on the CdLS phenotypic spectrum, with prominent neurological involvement of severe developmental delay and refractory epilepsy, with mild craniofacial features. Both individuals eventually had incomplete clinical responses to therapy with valproic acid. We review previous reports of SMC1A mutations with epilepsy. SMC1A should be included in clinical gene panels for early infantile and early childhood epileptic encephalopathy. PMID:26386245

  15. A frameshift mutation in GRXCR2 causes recessively inherited hearing loss

    PubMed Central

    Imtiaz, Ayesha; Kohrman, David C.; Naz, Sadaf

    2014-01-01

    More than 360 million humans are affected with some degree of hearing loss, either early or later in life. A genetic cause for the disorder is present in a majority of the cases. We mapped a locus (DFNB101) for hearing loss in humans to chromosome 5q in a consanguineous Pakistani family. Exome sequencing revealed an insertion mutation in GRXCR2 as the cause of moderate to severe and likely progressive hearing loss in the affected individuals of the family. The frameshift mutation is predicted to affect a conserved, cysteine-rich region of GRXCR2, and to result in an abnormal extension of the C-terminus. Functional studies by cell transfections demonstrated that the mutant protein is unstable and mislocalized relative to wild type GRXCR2, consistent with a loss of function mutation. Targeted disruption of Grxcr2 is concurrently reported to cause hearing loss in mice. The structural abnormalities in this animal model suggest a role for GRXCR2 in the development of stereocilia bundles, specialized structures on the apical surface of sensory cells in the cochlea that are critical for sound detection. Our results indicate that GRXCR2 should be considered in differential genetic diagnosis for individuals with early onset, moderate to severe and progressive hearing loss. PMID:24619944

  16. DVL1 Frameshift Mutations Clustering in the Penultimate Exon Cause Autosomal-Dominant Robinow Syndrome

    PubMed Central

    White, Janson; Mazzeu, Juliana F.; Hoischen, Alexander; Jhangiani, Shalini N.; Gambin, Tomasz; Alcino, Michele Calijorne; Penney, Samantha; Saraiva, Jorge M.; Hove, Hanne; Skovby, Flemming; Kayserili, Hülya; Estrella, Elicia; Vulto-van Silfhout, Anneke T.; Steehouwer, Marloes; Muzny, Donna M.; Sutton, V. Reid; Gibbs, Richard A.; Lupski, James R.; Brunner, Han G.; van Bon, Bregje W.M.; Carvalho, Claudia M.B.

    2015-01-01

    Robinow syndrome is a genetically heterogeneous disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features and for which both autosomal-recessive and autosomal-dominant inheritance patterns have been described. Causative variants in the non-canonical signaling gene WNT5A underlie a subset of autosomal-dominant Robinow syndrome (DRS) cases, but most individuals with DRS remain without a molecular diagnosis. We performed whole-exome sequencing in four unrelated DRS-affected individuals without coding mutations in WNT5A and found heterozygous DVL1 exon 14 mutations in three of them. Targeted Sanger sequencing in additional subjects with DRS uncovered DVL1 exon 14 mutations in five individuals, including a pair of monozygotic twins. In total, six distinct frameshift mutations were found in eight subjects, and all were heterozygous truncating variants within the penultimate exon of DVL1. In five families in which samples from unaffected parents were available, the variants were demonstrated to represent de novo mutations. All variant alleles are predicted to result in a premature termination codon within the last exon, escape nonsense-mediated decay (NMD), and most likely generate a C-terminally truncated protein with a distinct −1 reading-frame terminus. Study of the transcripts extracted from affected subjects’ leukocytes confirmed expression of both wild-type and variant alleles, supporting the hypothesis that mutant mRNA escapes NMD. Genomic variants identified in our study suggest that truncation of the C-terminal domain of DVL1, a protein hypothesized to have a downstream role in the Wnt-5a non-canonical pathway, is a common cause of DRS. PMID:25817016

  17. DVL1 frameshift mutations clustering in the penultimate exon cause autosomal-dominant Robinow syndrome.

    PubMed

    White, Janson; Mazzeu, Juliana F; Hoischen, Alexander; Jhangiani, Shalini N; Gambin, Tomasz; Alcino, Michele Calijorne; Penney, Samantha; Saraiva, Jorge M; Hove, Hanne; Skovby, Flemming; Kayserili, Hülya; Estrella, Elicia; Vulto-van Silfhout, Anneke T; Steehouwer, Marloes; Muzny, Donna M; Sutton, V Reid; Gibbs, Richard A; Lupski, James R; Brunner, Han G; van Bon, Bregje W M; Carvalho, Claudia M B

    2015-04-01

    Robinow syndrome is a genetically heterogeneous disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features and for which both autosomal-recessive and autosomal-dominant inheritance patterns have been described. Causative variants in the non-canonical signaling gene WNT5A underlie a subset of autosomal-dominant Robinow syndrome (DRS) cases, but most individuals with DRS remain without a molecular diagnosis. We performed whole-exome sequencing in four unrelated DRS-affected individuals without coding mutations in WNT5A and found heterozygous DVL1 exon 14 mutations in three of them. Targeted Sanger sequencing in additional subjects with DRS uncovered DVL1 exon 14 mutations in five individuals, including a pair of monozygotic twins. In total, six distinct frameshift mutations were found in eight subjects, and all were heterozygous truncating variants within the penultimate exon of DVL1. In five families in which samples from unaffected parents were available, the variants were demonstrated to represent de novo mutations. All variant alleles are predicted to result in a premature termination codon within the last exon, escape nonsense-mediated decay (NMD), and most likely generate a C-terminally truncated protein with a distinct -1 reading-frame terminus. Study of the transcripts extracted from affected subjects' leukocytes confirmed expression of both wild-type and variant alleles, supporting the hypothesis that mutant mRNA escapes NMD. Genomic variants identified in our study suggest that truncation of the C-terminal domain of DVL1, a protein hypothesized to have a downstream role in the Wnt-5a non-canonical pathway, is a common cause of DRS. PMID:25817016

  18. CCR4 frameshift mutation identifies a distinct group of adult T cell leukaemia/lymphoma with poor prognosis.

    PubMed

    Yoshida, Noriaki; Miyoshi, Hiroaki; Kato, Takeharu; Sakata-Yanagimoto, Mamiko; Niino, Daisuke; Taniguchi, Hiroaki; Moriuchi, Yukiyoshi; Miyahara, Masaharu; Kurita, Daisuke; Sasaki, Yuya; Shimono, Joji; Kawamoto, Keisuke; Utsunomiya, Atae; Imaizumi, Yoshitaka; Seto, Masao; Ohshima, Koichi

    2016-04-01

    Adult T cell leukaemia/lymphoma (ATLL) is an intractable T cell neoplasm caused by human T cell leukaemia virus type 1. Next-generation sequencing-based comprehensive mutation studies have revealed recurrent somatic CCR4 mutations in ATLL, although clinicopathological findings associated with CCR4 mutations remain to be delineated. In the current study, 184 cases of peripheral T cell lymphoma, including 113 cases of ATLL, were subjected to CCR4 mutation analysis. This sequence analysis identified mutations in 27% (30/113) of cases of ATLL and 9% (4/44) of cases of peripheral T cell lymphoma not otherwise specified. Identified mutations included nonsense (NS) and frameshift (FS) mutations. No significant differences in clinicopathological findings were observed between ATLL cases stratified by presence of CCR4 mutation. All ATLL cases with CCR4 mutations exhibited cell-surface CCR4 positivity. Semi-quantitative CCR4 protein analysis of immunohistochemical sections revealed higher CCR4 expression in cases with NS mutations of CCR4 than in cases with wild-type (WT) CCR4. Furthermore, among ATLL cases, FS mutation was significantly associated with a poor prognosis, compared with NS mutation and WT CCR4. These results suggest that CCR4 mutation is an important determinant of the clinical course in ATLL cases, and that NS and FS mutations of CCR4 behave differently with respect to ATLL pathophysiology. PMID:26847489

  19. Translational Compensation of a Frameshift Mutation Affecting Herpes Simplex Virus Thymidine Kinase Is Sufficient To Permit Reactivation from Latency

    PubMed Central

    Griffiths, Anthony; Chen, Shun-Hua; Horsburgh, Brian C.; Coen, Donald M.

    2003-01-01

    Herpes simplex virus thymidine kinase is important for reactivation of virus from its latent state and is a target for the antiviral drug acyclovir. Most acyclovir-resistant isolates have mutations in the thymidine kinase gene; however, how these mutations confer clinically relevant resistance is unclear. Reactivation from explanted mouse ganglia was previously observed with a patient-derived drug-resistant isolate carrying a single guanine insertion within a run of guanines in the thymidine kinase gene. Despite this mutation, low levels of active enzyme were synthesized following an unusual ribosomal frameshift. Here we report that a virus, generated from a pretherapy isolate from the same patient, engineered to lack thymidine kinase activity, was competent for reactivation. This suggested that the clinical isolate contains alleles of other genes that permit reactivation in the absence of thymidine kinase. Therefore, to establish whether thymidine kinase synthesized via a ribosomal frameshift was sufficient for reactivation under conditions where reactivation requires this enzyme, we introduced the mutation into the well-characterized strain KOS. This mutant virus reactivated from latency, albeit less efficiently than KOS. Plaque autoradiography revealed three phenotypes of reactivating viruses: uniformly low thymidine kinase activity, mixed high and low activity, and uniformly high activity. We generated a recombinant thymidine kinase-null virus from a reactivating virus expressing uniformly low activity. This virus did not reactivate, confirming that mutations in other genes that would influence reactivation had not arisen. Therefore, in strains that require thymidine kinase for reactivation from latency, low levels of enzyme synthesized via a ribosomal frameshift can suffice. PMID:12663777

  20. Dravet syndrome with favourable cognitive and behavioral development due to a novel SCN1A frameshift mutation.

    PubMed

    Jiang, Peifang; Shen, Jue; Yu, Yonglin; Jiang, Lihua; Xu, Jialu; Xu, Lu; Yu, Huimin; Gao, Feng

    2016-07-01

    Children with Dravet syndrome (DS) often have severe cognitive, behaviour and motor impairments. Patients with truncating mutations would logically have the more severe phenotype. Here we present a case of DS with an unusually favourable cognitive and behavioral development with a novel SCN1A frameshift mutation (c.4233-4234insAT). Under regular following up for ten years, the patient had normal expressive language and mild motor clumsiness. It is suggested that besides the type of SCN1A mutation, other mechanisms may be existed to influence the SCN1A phenotype, such as modifier genes, developmental variability, accumulation of somatic mutation in lifetime and environmental insults can all contribute to the cognitive and behavioral outcome. PMID:27209029

  1. Conformational Insights into the Mechanism of Acetylaminofluorene-dG-Induced Frameshift Mutations in the NarI Mutational Hotspot.

    PubMed

    Xu, Lifang; Cho, Bongsup P

    2016-02-15

    Frameshift mutagenesis encompasses the gain or loss of DNA base pairs, resulting in altered genetic outcomes. The NarI restriction site sequence 5'-G1G2CG3CX-3' in Escherichia coli is a well-known mutational hotspot, in which lesioning of acetylaminofluorene (AAF) at G3* induces a greater -2 deletion frequency than that at other guanine sites. Its mutational efficiency is modulated by the nature of the nucleotide in the X position (C ∼ A > G ≫ T). Here, we conducted a series of polymerase-free solution experiments that examine the conformational and thermodynamic basis underlying the propensity of adducted G3 to form a slipped mutagenic intermediate (SMI) and its sequence dependence during translesion synthesis (TLS). Instability of the AAF-dG3:dC pair at the replication fork promoted slippage to form a G*C bulge-out SMI structure, consisting of S- ("lesion stacked") and B-SMI ("lesion exposed") conformations, with conformational rigidity increasing as a function of primer elongation. We found greater stability of the S- compared to the B-SMI conformer throughout TLS. The dependence of their population ratios was determined by the 3'-next flanking base X at fully elongated bulge structures, with 59% B/41% S and 86% B/14% S for the dC and dT series, respectively. These results indicate the importance of direct interactions of the hydrophobic AAF lesion with the 3'-next flanking base pair and its stacking fit within the -2 bulge structure. A detailed conformational understanding of the SMI structures and their sequence dependence may provide a useful model for DNA polymerase complexes. PMID:26733364

  2. Correlation between Density of CD8+ T-cell Infiltrate in Microsatellite Unstable Colorectal Cancers and Frameshift Mutations: A Rationale for Personalized Immunotherapy.

    PubMed

    Maby, Pauline; Tougeron, David; Hamieh, Mohamad; Mlecnik, Bernhard; Kora, Hafid; Bindea, Gabriela; Angell, Helen K; Fredriksen, Tessa; Elie, Nicolas; Fauquembergue, Emilie; Drouet, Aurélie; Leprince, Jérôme; Benichou, Jacques; Mauillon, Jacques; Le Pessot, Florence; Sesboüé, Richard; Tuech, Jean-Jacques; Sabourin, Jean-Christophe; Michel, Pierre; Frébourg, Thierry; Galon, Jérôme; Latouche, Jean-Baptiste

    2015-09-01

    Colorectal cancers with microsatellite instability (MSI) represent 15% of all colorectal cancers, including Lynch syndrome as the most frequent hereditary form of this disease. Notably, MSI colorectal cancers have a higher density of tumor-infiltrating lymphocytes (TIL) than other colorectal cancers. This feature is thought to reflect the accumulation of frameshift mutations in sequences that are repeated within gene coding regions, thereby leading to the synthesis of neoantigens recognized by CD8(+) T cells. However, there has yet to be a clear link established between CD8(+) TIL density and frameshift mutations in colorectal cancer. In this study, we examined this link in 103 MSI colorectal cancers from two independent cohorts where frameshift mutations in 19 genes were analyzed and CD3(+), CD8(+), and FOXP3(+) TIL densities were quantitated. We found that CD8(+) TIL density correlated positively with the total number of frameshift mutations. TIL densities increased when frameshift mutations were present within the ASTE1, HNF1A, or TCF7L2 genes, increasing even further when at least one of these frameshift mutations was present in all tumor cells. Through in vitro assays using engineered antigen-presenting cells, we were able to stimulate peripheral cytotoxic T cells obtained from colorectal cancer patients with peptides derived from frameshift mutations found in their tumors. Taken together, our results highlight the importance of a CD8(+) T cell immune response against MSI colorectal cancer-specific neoantigens, establishing a preclinical rationale to target them as a personalized cellular immunotherapy strategy, an especially appealing goal for patients with Lynch syndrome. PMID:26060019

  3. Frameshift and nonsense p53 mutations in squamous-cell carcinoma of head and neck - non-reactivity with 3 anti-p53 monoclonal-antibodies.

    PubMed

    Chen, Y; Xu, L; Massey, L; Zlotolow, I; Huvos, A; Garinchesa, P; Old, L

    1994-03-01

    p53 mutations in human tumors are often associated with overexpression of p53, and immunohistochemical detection of p53 has frequently been chosen as a simpler method than genetic analysis to access p53 mutations. In this study, we analyzed the p53 gene by single-strand conformational polymorphism (SSCP) and DNA sequencing, and correlated findings to Ab staining results. In a series of 58 squamous cell carcinoma, 15 showed mutations in exons 5, 6, 7, 8 and 9 by SSCP. Of these 15 cases, 11 were positive by antibody staining, and DNA sequencing showed missense mutations but no frameshift or nonsense mutations. In contrast, the antibody-negative cases had frameshift or nonsense mutations, but no missense mutations. SSCP analysis of these 4 cases showed mutations in exon 6 (2 cases), exon 7 (1), and exon 8 (1), respectively. In case 1, sequencing data revealed a single-base addition in exon 6, leading to a truncated gene product of 207 amino acids (aa), in contrast to 393 aa in wild-type p53. Similar frameshift mutations were shown in case 2 and case 3. Case 4, instead of a frameshift mutation, carried a nonsense mutation, and a truncated peptide of 235 aa. All these mutations thus shared the feature of producing truncated p53 products nonreactive with antibodies. We conclude that frameshift mutations as well as nonsense mutations can lead to altered p53 undetectable by available monoclonal antibodies. Our finding indicates that the absence of Ab reactivity does not rule out genetic alterations of the p53 gene in human tumors. PMID:21566966

  4. A secreted WNT-ligand-binding domain of FZD5 generated by a frameshift mutation causes autosomal dominant coloboma.

    PubMed

    Liu, Chunqiao; Widen, Sonya A; Williamson, Kathleen A; Ratnapriya, Rinki; Gerth-Kahlert, Christina; Rainger, Joe; Alur, Ramakrishna P; Strachan, Erin; Manjunath, Souparnika H; Balakrishnan, Archana; Floyd, James A; Li, Tiansen; Waskiewicz, Andrew; Brooks, Brian P; Lehmann, Ordan J; FitzPatrick, David R; Swaroop, Anand

    2016-04-01

    Ocular coloboma is a common eye malformation resulting from incomplete fusion of the optic fissure during development. Coloboma is often associated with microphthalmia and/or contralateral anophthalmia. Coloboma shows extensive locus heterogeneity associated with causative mutations identified in genes encoding developmental transcription factors or components of signaling pathways. We report an ultra-rare, heterozygous frameshift mutation in FZD5 (p.Ala219Glufs*49) that was identified independently in two branches of a large family with autosomal dominant non-syndromic coloboma. FZD5 has a single-coding exon and consequently a transcript with this frameshift variant is not a canonical substrate for nonsense-mediated decay. FZD5 encodes a transmembrane receptor with a conserved extracellular cysteine rich domain for ligand binding. The frameshift mutation results in the production of a truncated protein, which retains the Wingless-type MMTV integration site family member-ligand-binding domain, but lacks the transmembrane domain. The truncated protein was secreted from cells, and behaved as a dominant-negative FZD5 receptor, antagonizing both canonical and non-canonical WNT signaling. Expression of the resultant mutant protein caused coloboma and microphthalmia in zebrafish, and disruption of the apical junction of the retinal neural epithelium in mouse, mimicking the phenotype of Fz5/Fz8 compound conditional knockout mutants. Our studies have revealed a conserved role of Wnt-Frizzled (FZD) signaling in ocular development and directly implicate WNT-FZD signaling both in normal closure of the human optic fissure and pathogenesis of coloboma. PMID:26908622

  5. Whole-exome sequencing reveals a novel frameshift mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in the Indian population.

    PubMed

    Zhou, Yu; Saikia, Bibhuti B; Jiang, Zhilin; Zhu, Xiong; Liu, Yuqing; Huang, Lulin; Kim, Ramasamy; Yang, Yin; Qu, Chao; Hao, Fang; Gong, Bo; Tai, Zhengfu; Niu, Lihong; Yang, Zhenglin; Sundaresan, Periasamy; Zhu, Xianjun

    2015-10-01

    Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 50 genes. To identify genetic mutations underlying autosomal recessive RP (arRP), we performed whole-exome sequencing study on two consanguineous marriage Indian families (RP-252 and RP-182) and 100 sporadic RP patients. Here we reported novel mutation in FAM161A in RP-252 and RP-182 with two patients affected with RP in each family. The FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. By whole-exome sequencing we identified several homozygous genomic regions, one of which included the recently identified FAM161A gene mutated in RP28-linked arRP. Sequencing analysis revealed the presence of a novel homozygous frameshift mutation p.R592FsX2 in both patients of family RP-252 and family RP-182. In 100 sporadic Indian RP patients, this novel homozygous frameshift mutation p.R592FsX2 was identified in one sporadic patient ARRP-S-I-46 by whole-exome sequencing and validated by Sanger sequencing. Meanwhile, this homozygous frameshift mutation was absent in 1000 ethnicity-matched control samples screened by direct Sanger sequencing. In conclusion, we identified a novel homozygous frameshift mutations of RP28-linked RP gene FAM161A in Indian population. PMID:26246154

  6. A CNGB1 Frameshift Mutation in Papillon and Phalène Dogs with Progressive Retinal Atrophy

    PubMed Central

    Ahonen, Saija J.; Arumilli, Meharji; Lohi, Hannes

    2013-01-01

    Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA) or degeneration resembles human retinitis pigmentosa (RP) and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD) of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10−8) with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes. PMID:24015210

  7. A CNGB1 frameshift mutation in Papillon and Phalène dogs with progressive retinal atrophy.

    PubMed

    Ahonen, Saija J; Arumilli, Meharji; Lohi, Hannes

    2013-01-01

    Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA) or degeneration resembles human retinitis pigmentosa (RP) and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD) of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10(-8)) with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes. PMID:24015210

  8. Slipping and Sliding: frameshift mutations in herpes simplex virus thymidine kinase and drug-resistance

    PubMed Central

    Griffiths, Anthony

    2011-01-01

    Some of the most successful antiviral agents currently available are effective against herpes simplex virus. However, resistance to these drugs is frequently associated with significant morbidity, particularly in immunocompromised patients. In addition to the clinical implications of drug resistance, the range of biological processes exploited by the virus to attain resistance while maintaining pathogenicity is proving to be surprising. These mechanisms, which include ribosomal frameshifting, induced infidelity of the DNA polymerase, and internal ribosome entry, are discussed. PMID:21940196

  9. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

    PubMed

    Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

    2013-03-01

    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome. PMID:23526569

  10. De novo frameshift mutation in COUP-TFII (NR2F2) in human congenital diaphragmatic hernia.

    PubMed

    High, Frances A; Bhayani, Pooja; Wilson, Jay M; Bult, Carol J; Donahoe, Patricia K; Longoni, Mauro

    2016-09-01

    COUP-TFII (NR2F2) is mapped to the 15q26 deletion hotspot associated with the common and highly morbid congenital diaphragmatic hernia (CDH). Conditional homozygous deletions of COUP-TFII in mice result in diaphragmatic defects analogous to the human Bochdalek-type hernia phenotype. Despite evidence from animal models however, mutations in the coding sequence of COUP-TFII have not been reported in patients, prompting the speculation that additional coding or non-coding sequences in the 15q26 locus are necessary for diaphragmatic hernias to develop. In this report, we describe a case of a patient with a heterozygous de novo COUP-TFII frameshift mutation, presenting with CDH and an atrial septal defect. The p.Pro33AlafsTer77 mutation specifically disrupts protein isoform 1 which contains the DNA binding domain. In addition, we review other COUP-TFII sequence variations and deletions that have been described in cases of CDH. We conclude that COUP-TFII mutations can cause diaphragmatic hernias, and should be included in the differential diagnosis of CDH patients, particularly those with comorbid congenital heart defects. © 2016 Wiley Periodicals, Inc. PMID:27363585

  11. De Novo Frameshift Mutation in COUP-TFII (NR2F2) in Human Congenital Diaphragmatic Hernia

    PubMed Central

    High, Frances A.; Bhayani, Pooja; Wilson, Jay M.; Bult, Carol J.; Donahoe, Patricia K.; Longoni, Mauro

    2016-01-01

    COUP-TFII (NR2F2) is mapped to the 15q26 deletion hotspot associated with the common and highly morbid congenital diaphragmatic hernia (CDH). Conditional homozygous deletions of COUP-TFII in mice result in diaphragmatic defects analogous to the human Bochdalek-type hernia phenotype. Despite evidence from animal models however, mutations in the coding sequence of COUP-TFII have not been reported in patients, prompting the speculation that additional coding or non-coding sequences in the 15q26 locus are necessary for diaphragmatic hernias to develop. In this report, we describe a case of a patient with a heterozygous de novo COUP-TFII frameshift mutation, presenting with CDH and an atrial septal defect. The p.Pro33AlafsTer77 mutation specifically disrupts protein isoform 1 which contains the DNA binding domain. In addition, we review other COUP-TFII sequence variations and deletions that have been described in cases of CDH. We conclude that COUP-TFII mutations can cause diaphragmatic hernias, and should be included in the differential diagnosis of CDH patients, particularly those with comorbid congenital heart defects. PMID:27363585

  12. A new Frameshift mutation on the α2-globin gene causing α⁺-thalassemia: codon 43 (TTC>-TC or TTC>T-C).

    PubMed

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Barro, Claire; Francina, Alain

    2012-01-01

    We report a new mutation on the α2-globin gene causing α(+)-thalassemia (α(+)-thal) with a deletion of a single nucleotide (T) at amino acid residue 43 [HBA2:c.130delT or HBA2:c.131delT]. This frameshift deletion gives rise to a premature termination codon at codon 47. PMID:22738776

  13. MUTAGENICITY AND MUTATION SPECTRA OF 2-ACETYLAMINOFLUORENE AT FRAMESHIFT AND BASE-SUBSTITUTION ALLELES IN FOUR DNA REPAIR BACKGROUNDS OF SALMONELLA

    EPA Science Inventory

    We used colony probe hybridization procedures-to determine the mutations in 600 revertants of the -1 frameshift allele hisD3052 and 200 revertants of the base substitution allele hisG46 of Salmonella typhimurium induced by 2-acetylaminofluorene (2-AAF) in the presence of S9. -AAF...

  14. An exon 53 frameshift mutation in CUBN abrogates cubam function and causes Imerslund-Gräsbeck syndrome in dogs.

    PubMed

    Fyfe, John C; Hemker, Shelby L; Venta, Patrick J; Fitzgerald, Caitlin A; Outerbridge, Catherine A; Myers, Sherry L; Giger, Urs

    2013-08-01

    Cobalamin malabsorption accompanied by selective proteinuria is an autosomal recessive disorder known as Imerslund-Gräsbeck syndrome in humans and was previously described in dogs due to amnionless (AMN) mutations. The resultant vitamin B12 deficiency causes dyshematopoiesis, lethargy, failure to thrive, and life-threatening metabolic disruption in the juvenile period. We studied 3 kindreds of border collies with cobalamin malabsorption and mapped the disease locus in affected dogs to a 2.9Mb region of homozygosity on canine chromosome 2. The region included CUBN, the locus encoding cubilin, a peripheral membrane protein that in concert with AMN forms the functional intrinsic factor-cobalamin receptor expressed in ileum and a multi-ligand receptor in renal proximal tubules. Cobalamin malabsorption and proteinuria comprising CUBN ligands were demonstrated by radiolabeled cobalamin uptake studies and SDS-PAGE, respectively. CUBN mRNA and protein expression were reduced ~10 fold and ~20 fold, respectively, in both ileum and kidney of affected dogs. DNA sequencing demonstrated a single base deletion in exon 53 predicting a translational frameshift and early termination codon likely triggering nonsense mediated mRNA decay. The mutant allele segregated with the disease in the border collie kindred. The border collie disorder indicates that a CUBN mutation far C-terminal from the intrinsic factor-cobalamin binding site can abrogate receptor expression and cause Imerslund-Gräsbeck syndrome. PMID:23746554

  15. A frameshift mutation within LAMC2 is responsible for Herlitz type junctional epidermolysis bullosa (HJEB) in black headed mutton sheep.

    PubMed

    Mömke, Stefanie; Kerkmann, Andrea; Wöhlke, Anne; Ostmeier, Miriam; Hewicker-Trautwein, Marion; Ganter, Martin; Kijas, James; Distl, Ottmar

    2011-01-01

    Junctional epidermolysis bullosa (JEB) is a hereditary mechanobullous skin disease in humans and animals. A Herlitz type JEB was identified in German Black Headed Mutton (BHM) sheep and affected lambs were reproduced in a breeding trial. Affected lambs showed skin and mucous membranes blistering and all affected lambs died within the first weeks of life. The pedigree data were consistent with a monogenic autosomal recessive inheritance. Immunofluorescence showed a reduced expression of laminin 5 protein which consists of 3 subunits encoded by the genes LAMA3, LAMB3 and LAMC2. We screened these genes for polymorphisms. Linkage and genome-wide association analyses identified LAMC2 as the most likely candidate for HJEB. A two base pair deletion within exon 18 of the LAMC2 gene (FM872310:c.2746delCA) causes a frameshift mutation resulting in a premature stop codon (p.A928*) 13 triplets downstream of this mutation and in addition, introduces an alternative splicing of exon 18 LAMC2. This deletion showed a perfect co-segregation with HJEB in all 740 analysed BHM sheep. Identification of the LAMC2 deletion means an animal model for HJEB is now available to develop therapeutic approaches of relevance to the human form of this disease. PMID:21573221

  16. Whole exome sequencing identifies a novel frameshift mutation in GPC3 gene in a patient with overgrowth syndrome.

    PubMed

    Das Bhowmik, Aneek; Dalal, Ashwin

    2015-11-10

    Overgrowth syndromes are a heterogeneous group of diseases characterized by focal or generalized overgrowth. Many of the syndromes have overlapping clinical features and it is difficult to diagnose the condition based on clinical features alone. In the present study we report on a patient with overgrowth syndrome where extensive investigation did not reveal the cause of disease. Finally exome sequencing revealed a novel hemizygous single base pair deletion in exon 8 of GPC3 gene (chrX:132670203delA) resulting in a frameshift and creating a new stop codon at 62 amino acids downstream to codon 564 (c.1692delT; p.Leu565SerfsTer63) of the protein. The mutation was confirmed by Sanger sequencing. The mother was found to be heterozygous for the mutation. This variation is not reported in the 1000 Genomes, Exome Variant Server (EVS), Exome Aggregation Consortium (ExAC) and dbSNP databases and the region is conserved across primates. Exome sequencing was helpful in establishing diagnosis of Simpson-Golabi-Behmel syndrome type 1 (SGBS1) in a patient with unknown overgrowth syndrome. PMID:26321508

  17. Evidence that selected amplification of a bacterial lac frameshift allele stimulates Lac(+) reversion (adaptive mutation) with or without general hypermutability.

    PubMed Central

    Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R

    2002-01-01

    In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002

  18. A Tumor-Specific Neo-Antigen Caused by a Frameshift Mutation in BAP1 Is a Potential Personalized Biomarker in Malignant Peritoneal Mesothelioma

    PubMed Central

    Lai, Jun; Zhou, Zhan; Tang, Xiao-Jing; Gao, Zhi-Bin; Zhou, Jie; Chen, Shu-Qing

    2016-01-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive rare malignancy associated with asbestos exposure. A better understanding of the molecular pathogenesis of MPM will help develop a targeted therapy strategy. Oncogene targeted depth sequencing was performed on a tumor sample and paired peripheral blood DNA from a patient with malignant mesothelioma of the peritoneum. Four somatic base-substitutions in NOTCH2, NSD1, PDE4DIP, and ATP10B and 1 insert frameshift mutation in BAP1 were validated by the Sanger method at the transcriptional level. A 13-amino acids neo-peptide of the truncated Bap1 protein, which was produced as a result of this novel frameshift mutation, was predicted to be presented by this patient’s HLA-B protein. The polyclonal antibody of the synthesized 13-mer neo-peptide was produced in rabbits. Western blotting results showed a good antibody-neoantigen specificity, and Immunohistochemistry (IHC) staining with the antibody of the neo-peptide clearly differentiated neoplastic cells from normal cells. A search of the Catalogue of Somatic Mutations in Cancer (COSMIC) database also revealed that 53.2% of mutations in BAP1 were frameshift indels with neo-peptide formation. An identified tumor-specific neo-antigen could be the potential molecular biomarker for personalized diagnosis to precisely subtype rare malignancies such as MPM. PMID:27187383

  19. A Tumor-Specific Neo-Antigen Caused by a Frameshift Mutation in BAP1 Is a Potential Personalized Biomarker in Malignant Peritoneal Mesothelioma.

    PubMed

    Lai, Jun; Zhou, Zhan; Tang, Xiao-Jing; Gao, Zhi-Bin; Zhou, Jie; Chen, Shu-Qing

    2016-01-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive rare malignancy associated with asbestos exposure. A better understanding of the molecular pathogenesis of MPM will help develop a targeted therapy strategy. Oncogene targeted depth sequencing was performed on a tumor sample and paired peripheral blood DNA from a patient with malignant mesothelioma of the peritoneum. Four somatic base-substitutions in NOTCH2, NSD1, PDE4DIP, and ATP10B and 1 insert frameshift mutation in BAP1 were validated by the Sanger method at the transcriptional level. A 13-amino acids neo-peptide of the truncated Bap1 protein, which was produced as a result of this novel frameshift mutation, was predicted to be presented by this patient's HLA-B protein. The polyclonal antibody of the synthesized 13-mer neo-peptide was produced in rabbits. Western blotting results showed a good antibody-neoantigen specificity, and Immunohistochemistry (IHC) staining with the antibody of the neo-peptide clearly differentiated neoplastic cells from normal cells. A search of the Catalogue of Somatic Mutations in Cancer (COSMIC) database also revealed that 53.2% of mutations in BAP1 were frameshift indels with neo-peptide formation. An identified tumor-specific neo-antigen could be the potential molecular biomarker for personalized diagnosis to precisely subtype rare malignancies such as MPM. PMID:27187383

  20. Whole-exome sequencing identifies a novel homozygous frameshift mutation in the PROM1 gene as a causative mutation in two patients with sporadic retinitis pigmentosa.

    PubMed

    Liu, Sanmei; Xie, Lan; Yue, Jun; Ma, Tao; Peng, Chunyan; Qiu, Biyuan; Yang, Zhenglin; Yang, Jiyun

    2016-06-01

    Retinitis pigmentosa (RP) refers to a heterogeneous group of inherited retinal diseases caused by the loss of photoreceptors. The present study aimed to identify the gene mutations responsible for RP in two patients diagnosed with sporadic RP using next-generation sequencing technology. For this purpose, two patients with sporadic RP and family members (namely parents and siblings) were recruited into this study and underwent a complete ophthalmological assessment. Whole-exome sequencing (WES) was performed on genomic DNA samples isolated from peripheral leukocytes which had been obtained from the two patients diagnosed with sporadic RP. WES data were annotated and filtered against four public databases and one in-house database. Subsequently, Sanger sequencing was performed in order to determine whether any of the candidate variants co-segregated with the disease phenotype in the families. A homozygous frameshift mutation, c.1445dupT (p.F482fs) in exon 12 of the PROM1 gene (MIM: 604365), satisfied a recessive inheritance model and showed complete co-segregation of the mutation with the disease phenotype in the families. The same mutation was not detected in the 200 ethnically-matched control samples by Sanger sequencing. The novel homozygous mutation c.1445dupT (p.F482fs) in the PROM1 gene was identified as a causative mutation for RP. Thus, the identification of this mutation has further expanded the existing spectrum of PROM1 mutations in patients with RP, thereby assisting in the molecular diagnosis of RP and enhancing our understanding of genotype-phenotype correlations in order to provide effective genetic counseling. PMID:27082927

  1. Whole-exome sequencing identifies a novel homozygous frameshift mutation in the PROM1 gene as a causative mutation in two patients with sporadic retinitis pigmentosa

    PubMed Central

    LIU, SANMEI; XIE, LAN; YUE, JUN; MA, TAO; PENG, CHUNYAN; QIU, BIYUAN; YANG, ZHENGLIN; YANG, JIYUN

    2016-01-01

    Retinitis pigmentosa (RP) refers to a heterogeneous group of inherited retinal diseases caused by the loss of photoreceptors. The present study aimed to identify the gene mutations responsible for RP in two patients diagnosed with sporadic RP using next-generation sequencing technology. For this purpose, two patients with sporadic RP and family members (namely parents and siblings) were recruited into this study and underwent a complete ophthalmological assessment. Whole-exome sequencing (WES) was performed on genomic DNA samples isolated from peripheral leukocytes which had been obtained from the two patients diagnosed with sporadic RP. WES data were annotated and filtered against four public databases and one in-house database. Subsequently, Sanger sequencing was performed in order to determine whether any of the candidate variants co-segregated with the disease phenotype in the families. A homozygous frameshift mutation, c.1445dupT (p.F482fs) in exon 12 of the PROM1 gene (MIM: 604365), satisfied a recessive inheritance model and showed complete co-segregation of the mutation with the disease phenotype in the families. The same mutation was not detected in the 200 ethnically-matched control samples by Sanger sequencing. The novel homozygous mutation c.1445dupT (p.F482fs) in the PROM1 gene was identified as a causative mutation for RP. Thus, the identification of this mutation has further expanded the existing spectrum of PROM1 mutations in patients with RP, thereby assisting in the molecular diagnosis of RP and enhancing our understanding of genotype-phenotype correlations in order to provide effective genetic counseling. PMID:27082927

  2. A novel frameshift mutation in FGF14 causes an autosomal dominant episodic ataxia.

    PubMed

    Choquet, Karine; La Piana, Roberta; Brais, Bernard

    2015-07-01

    Episodic ataxias (EAs) are a heterogeneous group of neurological disorders characterized by recurrent attacks of ataxia. Mutations in KCNA1 and CACNA1A account for the majority of EA cases worldwide. We recruited a two-generation family affected with EA of unknown subtype and performed whole-exome sequencing on two affected members. This revealed a novel heterozygous mutation c.211_212insA (p.I71NfsX27) leading to a premature stop codon in FGF14. Mutations in FGF14 are known to cause spinocerebellar ataxia type 27 (SCA27). Sanger sequencing confirmed segregation within the family. Our findings expand the phenotypic spectrum of SCA27 by underlining the possible episodic nature of this ataxia. PMID:25566820

  3. Phase variation of gonococcal pili by frameshift mutation in pilC, a novel gene for pilus assembly.

    PubMed Central

    Jonsson, A B; Nyberg, G; Normark, S

    1991-01-01

    Pili prepared from Neisseria gonorrhoeae contain minor amounts of a 110 kd outer membrane protein denoted PilC. The corresponding gene exists in two copies, pilC1 and pilC2, in most strains of N.gonorrhoeae. In the piliated strain MS11(P+), only one of the genes, pilC2, was expressed. Inactivation of pilC2 by a mTnCm insertion resulted in a nonpiliated phenotype, while a mTnCm insertion in pilC1 had no effect on piliation. Expression of pilC was found to be controlled at the translational level by frameshift mutations in a run of G residues positioned in the region encoding the signal peptide. Nonpilated (P-), pilin expressing colony variants that did not express detectable levels of PilC were selected; all P+ backswitchers from these P-, PilC- clones were found to be PilC+. The structural gene for pilin, pilE, was sequenced and found to be identical in one P-, PilC- and P+, PilC+ pair. Most PilC- cells were completely bald whereas the PilC+ backswitcher had 10-40 pili per cell. Thus, a turn ON and turn OFF in the expression of PilC results in gonococcal pili phase variation. These results suggest that PilC is required for pilus assembly and/or translocation across the gonococcal outer membrane. Images PMID:1671354

  4. A de novo frameshift mutation in chromodomain helicase DNA-binding domain 8 (CHD8): A case report and literature review.

    PubMed

    Merner, Nancy; Forgeot d'Arc, Baudouin; Bell, Scott C; Maussion, Gilles; Peng, Huashan; Gauthier, Julie; Crapper, Liam; Hamdan, Fadi F; Michaud, Jacques L; Mottron, Laurent; Rouleau, Guy A; Ernst, Carl

    2016-05-01

    Mutations in chromodomain helicase DNA-binding domain 8 (CHD8) have been identified in independent genotyping studies of autism spectrum disorder. To better understand the phenotype associated with CHD8 mutations, we genotyped all CHD8 exons in carefully assessed cohorts of autism (n = 142), schizophrenia (SCZ; n = 143), and intellectual disability (ID; n = 94). We identified one frameshift mutation, seven non-synonymous variants, and six synonymous variants. The frameshift mutation, p.Asn2092Lysfs*2, which creates a premature stop codon leading to the loss of 212 amino acids of the protein, was from an autism case on whom we present multiple clinical assessments and pharmacological treatments spanning more than 10 years. RNA and protein analysis support a model where the transcript generated from the mutant allele results in haploinsufficiency of CHD8. This case report supports the association of CHD8 mutations with classical autism, macrocephaly, infantile hypotonia, speech delay, lack of major ID, and psychopathology in late adolescence caused by insufficient dosage of CHD8. Review of 16 other CHD8 mutation cases suggests that clinical features and their severity vary considerably across individuals; however, these data support a CHD8 mutation syndrome, further highlighting the importance of genomic medicine to guide clinical assessment and treatment. PMID:26789910

  5. NF1 frameshift mutation (c.6520_6523delGAGA) association with nervous system tumors and bone abnormalities in a Chinese patient with neurofibromatosis type 1.

    PubMed

    Su, S Y; Zhou, X; Pang, X M; Chen, C Y; Li, S H; Liu, J L

    2016-01-01

    Neurofibromatosis type 1, also known as NF1 or von Recklinghausen's disease, is a common neurocutaneous syndrome that presents with multiple café-au-lait patches, skinfold freckling, dermatofibromas, neurofibromas, and Lisch nodules. The mutations of the gene NF1, encoding the protein neurofibromin, have been identified as the cause of this disease. Here, we report a clinical and molecular study of a Chinese patient with multiple café-au-lait skin freckles, dermatofibroma, central and peripheral nervous system tumors, and bone abnormalities attributed to NF1. The patient showed >6 café-au-lait spots on the body and multiple dermatofibromas. A brain glioma and multiple nerve sheath tumors inside and outside the vertebral canal were identified by magnetic resonance imaging, which also showed multiple intercostal nerve schwannomas and hydrocephalies above the cerebellar tentorium. Talipes equinus was also apparent. A mutation analysis of the NF1 gene revealed a novel frameshift mutation in exon 43, consisting of a heterozygous deletion of four nucleotides (GAGA) between positions 6520 and 6523. No NF1 mutations were detected in the patient's parents or younger brother. These results extend the list of known mutations in this gene. The absence of the NF1 mutation in the healthy family members suggests that it is responsible for the NF1 phenotype. To our knowledge, this frameshift mutation represents a novel NF1 case, and may be associated with nervous system tumors and bone abnormalities. PMID:27173220

  6. Homozygous frameshift mutation in TMCO1 causes a syndrome with craniofacial dysmorphism, skeletal anomalies, and mental retardation

    PubMed Central

    Xin, Baozhong; Puffenberger, Erik G.; Turben, Susan; Tan, Haiyan; Zhou, Aimin; Wang, Heng

    2009-01-01

    We identified an autosomal recessive condition in 11 individuals in the Old Order Amish of northeastern Ohio. The syndrome was characterized by distinctive craniofacial dysmorphism, skeletal anomalies, and mental retardation. The typical craniofacial dysmorphism included brachycephaly, highly arched bushy eyebrows, synophrys, long eyelashes, low-set ears, microdontism of primary teeth, and generalized gingival hyperplasia, whereas Sprengel deformity of scapula, fusion of spine, rib abnormities, pectus excavatum, and pes planus represented skeletal anomalies. The genome-wide homozygosity mapping using six affected individuals localized the disease gene to a 3.3-Mb region on chromosome 1q23.3-q24.1. Candidate gene sequencing identified a homozygous frameshift mutation, c.139_140delAG, in the transmembrane and coiled-coil domains 1 (TMCO1) gene, as the pathogenic change in all affected members of the extended pedigree. This mutation is predicted to result in a severely truncated protein (p.Ser47Ter) of only one-fourth the original length. The TMCO1 gene product is a member of DUF841 superfamily of several eukaryotic proteins with unknown function. The gene has highly conserved amino acid sequence and is universally expressed in all human tissues examined. The high degree of conservation and the ubiquitous expression pattern in human adult and fetal tissues suggest a critical role for TMCO1. This report shows a TMCO1 sequence variant being associated with a genetic disorder in human. We propose “TMCO1 defect syndrome” as the name of this condition. PMID:20018682

  7. Hereditary desmoid disease due to a frameshift mutation at codon 1924 of the APC gene.

    PubMed Central

    Eccles, D. M.; van der Luijt, R.; Breukel, C.; Bullman, H.; Bunyan, D.; Fisher, A.; Barber, J.; du Boulay, C.; Primrose, J.; Burn, J.; Fodde, R.

    1996-01-01

    Desmoid tumors are slowly growing fibrous tumors highly resistant to therapy and often fatal. Here, we report hereditary desmoid disease (HDD), a novel autosomal dominant trait with 100% penetrance affecting a three-generation kindred. Desmoid tumors are usually a complication of familial adenomatous polyposis, a predisposition to the early development of premalignant adenomatous polyps in the colorectum due to chain-terminating mutations of the APC gene. In general, one or more members in approximately 10% of the FAP families manifest desmoid tumors. Affected individuals from the HDD kindred are characterized by multifocal fibromatosis of the paraspinal muscles, breast, occiput, arms, lower ribs, abdominal wall, and mesentery. Osteomas, epidermal cysts, and other congenital features were also observed. We show that HDD segregates with an unusual germ-line chain-terminating mutation at the 3' end of the APC gene (codon 1924) with somatic loss of the wild-type allele leading to tumor development. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:8940264

  8. Postmortem diagnosis of Marfan syndrome in a case of sudden death due to aortic rupture: Detection of a novel FBN1 frameshift mutation.

    PubMed

    Wang, Yunyun; Chen, Shu; Wang, Rongshuai; Huang, Sizhe; Yang, Mingzhen; Liu, Liang; Liu, Qian

    2016-04-01

    To investigate the sudden death of a 36-year-old Chinese man, a medicolegal autopsy was performed, combining forensic pathological examinations and genetic sequencing analysis to diagnose the cause of death. Genomic DNA samples were extracted from blood and subjected to high-throughput sequencing. Major findings included a dilated aortic root with a ruptured and dissected aorta and consequent tamponade of the pericardial sac. Moreover, arachnodactyly and other skeletal deformities were noted. By sequencing the fibrillin-1 gene (FBN1), five genetic variations were found, including four previously known single nucleotide polymorphisms (SNPs) and a novel frameshift mutation, leading to the diagnosis of Marfan syndrome. The frameshift mutation (c.4921delG, p.glu1641llysFsX9) detected in exon 40 led to a stop codon after the next 8 amino acids. The four SNPs included a splice site mutation (c.3464-5 G>A, rs11853943), a synonymous mutation (p.Asn625Asn, rs25458), and two missense mutations (p.Pro1148Ala, rs140598; p.Cys472Tyr, rs4775765). Genetic screening was recommended for the relatives as it was reported that the father and brother of the deceased had died at the ages of 40 and 25, respectively, from sudden cardiac failure. The son of the deceased lacked the relevant mutations. This report emphasizes the important contribution of medicolegal postmortem analysis on the molecular pathogenesis study of Marfan syndrome and early diagnosis of at-risk relatives. PMID:26905825

  9. Seven, eight and nine-membered anticodon loop mutants of tRNA(2Arg) which cause +1 frameshifting. Tolerance of DHU arm and other secondary mutations.

    PubMed

    Tuohy, T M; Thompson, S; Gesteland, R F; Atkins, J F

    1992-12-20

    The mutant tRNA(2Arg) encoded by the genetically-selected frameshift suppressor, sufT621, inserts arginine and causes a +1 reading-frame shift at the proline codon, CCG(U). There is an extra base, G36.1, in argV beta, one of the four identical genes for tRNA(2Arg) in the position between bases 36 and 37, corresponding to the 3' side of the anticodon. The new four-base anticodon, predicted from DNA sequencing to be 3' GGCA 5', is complementary to the four-base codon CCGU. Quadruplet translocation promoted by mutant argV does not require perfect complementarity between the codon and the anticodon since synthetic genes encoding derivatives of tRNA(2Arg) and tRNA(1Pro), with four-base anticodons complementary to three out of the four bases of CCGU, were also shown to be capable of frameshifting. Two other mutants of argV, inferred to have normal-size, seven-base anticodon loops, were also found to be capable of four-base-decoding demonstrating that quadruplet translocation promoted by mutant argV does not require an enlarged anticodon loop. Other alleles of argV, predicted to have nine bases in the anticodon loop, were also found to cause frameshifting. The DNA sequence of two of these showed in addition, either a deletion of G24, or a ten-base duplication in the region corresponding to the TFC arm. A general finding is that mutations in the DHU arm of tRNA(2Arg) are compatible with, and in one case necessary for, frameshifting. PMID:1474576

  10. Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa

    PubMed Central

    Karuthedath Vellarikkal, Shamsudheen; Jayarajan, Rijith; Verma, Ankit; Nair, Sreelata; Ravi, Rowmika; Senthivel, Vigneshwar; Sivasubbu, Sridhar; Scaria, Vinod

    2016-01-01

    Dystrophic epidermolysis bullosa simplex (DEB) is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB) is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES). Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India. PMID:27408687

  11. [Mechanisms of targeted frameshift mutations--insertion formation under error-prone or SOS synthesis of DNA containing CIS-SYN cyncyclobutane thymine dimers].

    PubMed

    Grebneva, E A

    2014-01-01

    Up to now the mechanism of formation of frameshift mutations caused by cyclobutane pyrimidine dimers has not been yet explained satisfactorily. Mechanisms of different mutations are usually considered in polymerase model. Here, the alternative polymerase-tautomer model of ultraviolet mutagenesis is developed. The mechanism of targeted insertion formation caused by cis-syn cyclobutane thymine dimers is proposed. Insertions are mutations when one or several DNA bases are inserted.Targeted insertions are mutations of a frameshift type--when one or severalnucleotides are inserted opposite damageswhich may stop synthesis of DNA. Targeted insertions are induced bycyclobutane pyrimidine dimmers. Ultraviolet irradiation may result in a change of tautomer state of DNA bases. A thymine base may form 5 rare tautomer forms that are stable if the base is a part of cyclobutane dimer. As it was shown by structural analysis, one rare tautomeric form of thymine forms hydrogen bonds with no one canonical DNA base. Therefore, under SOS or error-prone synthesis of DNA containing cis-syn cyclobutane thymine dimers with such rare tautomeric_form a specialize or modified DNA polymerase leaves a single nucleotide gap opposite the cis-syn cyclobutane thymine dimer. According to Streisinger model, if the DNA composition within this region is homogeneous, the end of the growing DNA strand can slip and form complementary pairs with a template nucleotide neighboring to the dimer of such type a loop is formed. Further elongation of the daughter strand leads to the appearance of targeted insertion in the daughter strand. Here, it is first shown that cis-syn cyclobutane thymine dimers with one or both bases in the specific tautomer conformation--opposite which it is impossible to insert a canonical base with a hydrogen bond formation--results in targeted insertions. Moreover, the model of forming targeted single--and several-base insertions is developed. The polymerase-tautomer model of

  12. Exome sequencing identifies a novel frameshift mutation of MYO6 as the cause of autosomal dominant nonsyndromic hearing loss in a Chinese family.

    PubMed

    Cheng, Jing; Zhou, Xueya; Lu, Yu; Chen, Jing; Han, Bing; Zhu, Yuhua; Liu, Liyang; Choy, Kwong-Wai; Han, Dongyi; Sham, Pak C; Zhang, Michael Q; Zhang, Xuegong; Yuan, Huijun

    2014-11-01

    Autosomal dominant types of nonsyndromic hearing loss (ADNSHL) are typically postlingual in onset and progressive. High genetic heterogeneity, late onset age, and possible confounding due to nongenetic factors hinder the timely molecular diagnoses for most patients. In this study, exome sequencing was applied to investigate a large Chinese family segregating ADNSHL in which we initially failed to find strong evidence of linkage to any locus by whole-genome linkage analysis. Two affected family members were selected for sequencing. We identified two novel mutations disrupting known ADNSHL genes and shared by the sequenced samples: c.328C>A in COCH (DFNA9) resulting in a p.Q110K substitution and a deletion c. 2814_2815delAA in MYO6 (DFNA22) causing a frameshift alteration p.R939Tfs*2. The pathogenicity of novel coding variants in ADNSHL genes was carefully evaluated by analysis of co-segregation with phenotype in the pedigree and in light of established genotype-phenotype correlations. The frameshift deletion in MYO6 was confirmed as the causative variant for this pedigree, whereas the missense mutation in COCH had no clinical significance. The results allowed us to retrospectively identify the phenocopy in one patient that contributed to the negative finding in the linkage scan. Our clinical data also supported the emerging genotype-phenotype correlation for DFNA22. PMID:25227905

  13. Phenotypic variability in a seven-generation Swedish family segregating autosomal dominant hearing impairment due to a novel EYA4 frameshift mutation.

    PubMed

    Frykholm, Carina; Klar, Joakim; Arnesson, Hanna; Rehnman, Anna-Carin; Lodahl, Marianne; Wedén, Ulla; Dahl, Niklas; Tranebjærg, Lisbeth; Rendtorff, Nanna D

    2015-05-25

    Linkage to an interval overlapping the DFNA10 locus on chromosome 6q22-23 was found through genome wide linkage analysis in a seven-generation Swedish family segregating postlingual, autosomal dominant nonsyndromic sensorineural hearing impairment. A novel heterozygous frame-shift mutation (c.579_580insTACC, p.(Asp194Tyrfs*52)) in EYA4 was identified that truncates the so-called variable region of the protein. The mutation is predicted to result in haploinsufficiency of the EYA4 product. No evidence for dilated cardiomyopathy was found in the family, contrasting to a previous family with a deletion resulting in a similar truncation in the variable region. A highly variable age of onset was seen in the mutation carriers. For assessment of the aetiology of this variability, clinical and audiometric data analyses were performed. The affected family members all had similar cross-sectional and longitudinal deterioration of pure tone average (PTA) once the process of hearing deterioration had started, and no gender, parent-of-origin or family branch differences on PTA could be found. Age at onset varied between the family branches. In summary, this is the ninth published genetically verified DFNA10 family. The results imply that unidentified factors, genetic or environmental, other than the EYA4 mutation, are of importance for the age at onset of DFNA10, and that mutation early in the variable region of the EYA4 protein can occur in the absence of dilated cardiomyopathy. PMID:25681523

  14. Clinical, cellular, and molecular features of an Israeli xeroderma pigmentosum family with a frameshift mutation in the XPC gene: sun protection prolongs life.

    PubMed

    Slor, H; Batko, S; Khan, S G; Sobe, T; Emmert, S; Khadavi, A; Frumkin, A; Busch, D B; Albert, R B; Kraemer, K H

    2000-12-01

    An Ashkenazi Jewish Israeli family with two children affected with severe xeroderma pigmentosum was investigated. A son, XP12TA, developed skin cancer at 2 y and died at 10 y. A daughter, XP25TA, now 24 y old, was sun protected and began developing skin cancers at 10 y. Their cultured skin fibroblasts showed reductions in post-ultraviolet survival (11% of normal), unscheduled DNA synthesis (10% of normal), global genome DNA repair (15% of normal), and plasmid host cell reactivation (5% of normal). Transcription-coupled DNA repair was normal, however. Northern blot analysis revealed greatly reduced xeroderma pigmentosum complementation group C mRNA. A plasmid host cell reactivation assay assigned the cells to xeroderma pigmentosum complementation group C. Cells from both parents and an unaffected child exhibited normal post-ultraviolet-C survival and normal DNA repair. Sequencing the xeroderma pigmentosum complementation group C cDNA of XP12TA and XP25TA revealed a homozygous deletion of two bases (del AT 669-670) in exon 5 with a new termination site 10 codons downstream that is expected to encode a truncated xeroderma pigmentosum complementation group C protein. Sequence analysis of the xeroderma pigmentosum complementation group C cDNA in cells from the parents found identical heterozygous mutations: one allele carries both the exon 5 frameshift and an exon 15 polymorphism and the other allele carries neither alteration. Cells from the unaffected brother had two normal xeroderma pigmentosum complementation group C alleles. This frameshift mutation in the xeroderma pigmentosum complementation group C gene led to reduced DNA repair with multiple skin cancers and early death. Sun protection delayed the onset of skin cancer and prolonged life in a sibling with the same mutation. PMID:11121128

  15. An exon-based comparative variant analysis pipeline to study the scale and role of frameshift and nonsense mutation in the human-chimpanzee divergence.

    PubMed

    Yu, GongXin

    2009-01-01

    Chimpanzees and humans are closely related but differ in many deadly human diseases and other characteristics in physiology, anatomy, and pathology. In spite of decades of extensive research, crucial questions about the molecular mechanisms behind the differences are yet to be understood. Here I report ExonVar, a novel computational pipeline for Exon-based human-chimpanzee comparative Variant analysis. The objective is to comparatively analyze mutations specifically those that caused the frameshift and nonsense mutations and to assess their scale and potential impacts on human-chimpanzee divergence. Genomewide analysis of human and chimpanzee exons with ExonVar identified a number of species-specific, exon-disrupting mutations in chimpanzees but much fewer in humans. Many were found on genes involved in important biological processes such as T cell lineage development, the pathogenesis of inflammatory diseases, and antigen induced cell death. A "less-is-more" model was previously established to illustrate the role of the gene inactivation and disruptions during human evolution. Here this analysis suggested a different model where the chimpanzee-specific exon-disrupting mutations may act as additional evolutionary force that drove the human-chimpanzee divergence. Finally, the analysis revealed a number of sequencing errors in the chimpanzee and human genome sequences and further illustrated that they could be corrected without resequencing. PMID:19859573

  16. Molecular characterization of WFS1 in an Iranian family with Wolfram syndrome reveals a novel frameshift mutation associated with early symptoms.

    PubMed

    Sobhani, Maryam; Tabatabaiefar, Mohammad Amin; Rajab, Asadollah; Kajbafzadeh, Abdol-Mohammad; Noori-Daloii, Mohammad Reza

    2013-10-10

    Wolfram syndrome (WS) is a rare autosomal recessive neurodegenerative disorder that represents a likely source of childhood diabetes especially among countries in the consanguinity belt. The main responsible gene is WFS1 for which over one hundred mutations have been reported from different ethnic groups. The aim of this study was to identify the molecular etiology of WS and to perform a possible genotype-phenotype correlation in Iranian kindred. An Iranian family with two patients was clinically studied and WS was suspected. Genetic linkage analysis via 5 STR markers was carried out. For identification of mutations, DNA sequencing of WFS1 including all the exons, exon-intron boundaries and the promoter was performed. Linkage analysis indicated linkage to the WFS1 region. After DNA sequencing of WFS1, one novel pathogenic mutation, which causes frameshift alteration c.2177_2178insTCTTC (or c.2173_2177dupTCTTC) in exon eight, was found. The genotype-phenotype correlation analysis suggests that the presence of the homozygous mutation may be associated with early onset of disease symptoms. This study stresses the necessity of considering the molecular analysis of WFS1 in childhood diabetes with some symptoms of WS. PMID:23845777

  17. Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1

    PubMed Central

    Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars; Rossing, Maria

    2016-01-01

    The increasing availability of genome-wide analysis has made it possible to rapidly sequence the exome of patients with undiagnosed or unresolved medical conditions. Here, we present the case of a 64-yr-old male patient with schistocytes in the peripheral blood smear and a complex and life-threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based on this finding, atypical hemolytic uremic syndrome was suspected because of a genetic predisposition, and a targeted treatment regime with eculizumab was initiated. Life-threatening hemostatic abnormalities would most likely have persisted had it not been for the implementation of whole-exome sequencing in this particular clinical setting. PMID:27551680

  18. The molecular pathology of progressive symmetric erythrokeratoderma: a frameshift mutation in the loricrin gene and perturbations in the cornified cell envelope.

    PubMed Central

    Ishida-Yamamoto, A; McGrath, J A; Lam, H; Iizuka, H; Friedman, R A; Christiano, A M

    1997-01-01

    The erythrokeratodermas (EKs) are a group of disorders characterized by erythematous plaques associated with variable features that include palmoplantar keratoderma. One type of EK is known as "progressive symmetric erythrokeratoderma" (PSEK). We studied members of a family of Japanese origin in which the index case with PSEK had had well-demarcated nonmigratory erythematous plaques on her extremities since birth. Sequence determination of the loricrin gene revealed an insertion of a C following nucleotide 709. The mutation results in a frameshift that changes the terminal 91 amino acids in the wild-type polypeptide into missense amino acids and adds 65 additional residues. This further implicates loricrin defects in the pathogenesis of disorders with palmoplantar keratoderma and pseudoainhum. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9326323

  19. The p.A897KfsX4 frameshift variation in desmocollin-2 is not a causative mutation in arrhythmogenic right ventricular cardiomyopathy

    PubMed Central

    De Bortoli, Marzia; Beffagna, Giorgia; Bauce, Barbara; Lorenzon, Alessandra; Smaniotto, Gessica; Rigato, Ilaria; Calore, Martina; Li Mura, Ilena E A; Basso, Cristina; Thiene, Gaetano; Lanfranchi, Gerolamo; Danieli, Gian Antonio; Nava, Andrea; Rampazzo, Alessandra

    2010-01-01

    Mutations in genes encoding desmosomal proteins have been reported to cause arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D), an autosomal-dominant disease characterised by progressive myocardial atrophy with fibro-fatty replacement. We screened 112 ARVC/D probands for mutations in desmocollin-2 (DSC2) gene and detected two different amino-acid substitutions (p.E102K, p.I345T) and a frameshift variation (p.A897KfsX4) in 7 (6.2%) patients. DSC2a variant p.A897KfsX4, previously reported as a p.E896fsX900 mutation, was identified in five unrelated probands. Four of them were found to carry one or two mutations in different ARVC/D genes. Unexpectedly, p.A897KfsX4 variation was also found in 6 (1.5%) out of 400 control chromosomes. In vitro functional studies showed that, unlike wild-type DSC2a, this C-terminal mutated protein was localised in the cytoplasm. p.A897KfsX4 variation affects the last five amino acids of the DSC2a isoform but not of DSC2b. In contrast with what we found in other human tissues, in the heart DSC2b is more expressed than DSC2a, suggesting that relative deficiency of DSC2a might be compensated by isoform b. In conclusion, DSC2 gene mutations are not frequently involved in ARVC/D. The p.A897KfsX4 variation, identified in several Italian healthy control subjects, which affects only one of the two DSC2 isoforms, may be considered a rare variant, though possibly affecting phenotypic expression of concomitant ARVC/D mutations. PMID:20197793

  20. fH-dependent complement evasion by disease-causing meningococcal strains with absent fHbp genes or frameshift mutations.

    PubMed

    Giuntini, Serena; Vu, David M; Granoff, Dan M

    2013-08-28

    Meningococci bind human fH to down-regulate complement, which enhances survival of the bacteria in serum. A major fH ligand is the vaccine candidate, factor H-binding protein (fHbp). Although fHbp has been considered an essential meningococcal virulence factor, rarely, invasive isolates with absent fHbp genes or frameshift mutations have been identified. In previous studies fH binding to these isolates was not detected. The aim of the present study was to investigate fH binding and complement evasion by invasive meningococcal serogroup B clinical isolates with absent fHbp genes or frameshift mutations. Four of the seven isolates tested bound human fH by flow cytometry and survived in IgG-depleted human serum. In all four, fH binding was decreased after inactivating the gene encoding NspA. Binding of fH to fHbp and NspA is specific for human fH. To investigate fH-dependent evasion of host defenses, human fH transgenic infant rats, or control littermates negative for human fH, were challenged IP with 10(3)-10(4)CFU of two of the isolates with no detectable fH binding by flow cytometry. At 6h, bacteremia caused by both strains was higher in human fH transgenic rats than in control rats (P<0.002). In conclusion, six of the seven isolates had evidence of fH binding and/or human fH-dependent complement evasion in transgenic rats. In four, NspA was as an alternative fH ligand. fHbp vaccination may select for mutants that do not require fHbp for complement evasion. Inclusion of additional target antigens in vaccines containing fHbp may delay emergence of these mutants. PMID:23791680

  1. Moderation of phenotypic severity in dystrophic and junctional forms of epidermolysis bullosa through in-frame skipping of exons containing non-sense or frameshift mutations.

    PubMed

    McGrath, J A; Ashton, G H; Mellerio, J E; Salas-Alanis, J C; Swensson, O; McMillan, J R; Eady, R A

    1999-09-01

    Non-sense mutations on both alleles of either the type VII collagen gene (COL7A1) or the genes encoding laminin 5 (LAMA3, LAMB3, or LAMC2) usually result in clinically severe forms of recessive dystrophic or junctional epidermolysis bullosa, respectively. In this study we assessed two unrelated families whose mutations in genomic DNA predicted severe recessive dystrophic epidermolysis bullosa or junctional epidermolysis bullosa phenotypes but in whom the manifestations were milder than expected. The recessive dystrophic epidermolysis bullosa patients had a homozygous single base-pair frameshift mutation in exon 19 of COL7A1 (2470insG). Clinically, there was generalized blistering but only mild scarring. Skin biopsy revealed positive type VII collagen immunoreactivity and recognizable anchoring fibrils. The junctional epidermolysis bullosa patients were compound heterozygotes for a frameshift/non-sense combination of mutations in exons 3 and 17 of LAMB3 (29insC/Q834X). These patients did not have the lethal form of junctional epidermolysis bullosa but, as adults, displayed the milder generalized atrophic benign epidermolysis bullosa variant. There was undetectable laminin 5 staining at the dermal-epidermal junction using an antibody to the beta3 chain, but faintly positive alpha3 and gamma2 chain labeling, and there was variable hypoplasia of hemidesmosomes. To explain the milder recessive dystrophic epidermolysis bullosa and junctional epidermolysis bullosa phenotypes in these families, reverse transcription-polymerase chain reaction, using RNA extracted from frozen skin, was able to provide evidence for some rescue of mutant mRNA transcripts with restoration of the open- reading frame. In the recessive dystrophic epidermolysis bullosa patients, transcripts containing in-frame skipping of exon 19 of COL7A1 in the cDNA were detected, and in the junctional epidermolysis bullosa patients transcripts with in-frame skipping of exon 17 of LAMB3 were identified. The

  2. Early Progressive Dilated Cardiomyopathy in a Family with Becker Muscular Dystrophy Related to a Novel Frameshift Mutation in the Dystrophin Gene Exon 27

    PubMed Central

    Tsuda, Takeshi; Fitzgerald, Kristi; Scavena, Mena; Gidding, Samuel; Cox, Mary O.; Marks, Harold; Flanigan, Kevin M.; Moore, Steven A.

    2014-01-01

    We report a family in which two male siblings with Becker muscular dystrophy (BMD) developed severe dilated cardiomyopathy (DCM) and progressive heart failure (HF) at age 11; one died at age 14 years while awaiting heart transplant and the other underwent left ventricular assist device (LVAD) implantation at the same age. Genetic analysis of one sibling showed a novel frameshift mutation in exon 27 of Duchenne muscular dystrophy (DMD) gene (c.3779_3785delCTTTGGAins GG), in which 7 base pairs are deleted and two are inserted. While this predicts an amino acid substitution and premature termination (p.Thr1260Argfs*8), muscle biopsy dystrophin immunostaining instead indicates that the mutation is more likely to alter splicing. Despite relatively preserved skeletal muscular performance, both siblings developed progressive heart failure secondary to early onset DCM. In addition, their 7 year old nephew with delayed gross motor development, mild proximal muscle weakness, and markedly elevated serum creatine kinase (CK) level (> 13,000 IU/L) at 16 months was recently demonstrated to have the familial DMD mutation. Here we report a novel genotype of BMD with early onset DCM and progressive lethal heart failure during early adolescence. PMID:25537791

  3. MUTATION SPECTRA OF GLU-P-1 IN SALMONELLA: INDUCTION OF HOTSPOT FRAMESHIFTS AND SITE-SPECIFIC BASE SUBSTITUTIONS

    EPA Science Inventory

    The mutations induced in approximately 2,000 mutants of Salmonella by the heterocyclic@ amine Glu-P-1 were determined by colony probe hybridization and PCR/DNA sequence analysis. ll of the mutations were at sites containing guanine, which is the base at which Glu-P-1 forms DNA ad...

  4. A patient with a unique frameshift mutation in GPC3, causing Simpson-Golabi-Behmel syndrome, presenting with craniosynostosis, penoscrotal hypospadias, and a large prostatic utricle.

    PubMed

    Villarreal, Diana D; Villarreal, Humberto; Paez, Ana Maria; Peppas, Dennis; Lynch, Jane; Roeder, Elizabeth; Powers, George C

    2013-12-01

    We present a Hispanic male with the clinical and molecular diagnosis of Simpson-Golabi-Behmel syndrome (SGBS). The patient was born with multiple anomalies not entirely typical of SGBS patients, including penoscrotal hypospadias, a large prostatic utricle, and left coronal craniosynostosis. In addition, he demonstrated endocrine anomalies including a low random cortisol level suspicious for adrenal insufficiency and low testosterone level. To our knowledge, this is the first report of a prostatic utricle in SGBS and the second report of craniosynostosis. The unique disease-causing mutation likely arose de novo in the mother. It is a deletion-insertion that leads to a frameshift at the p.p. S359 [corrected] residue of GPC3 and a premature stop codon after five more amino acids. p. S359 [corrected] is the same residue that is normally cleaved by the Furin convertase, although the significance of this novel mutation with respect to the patient's multiple anomalies is unknown. We present this case as the perinatal course of a patient with unique features of SGBS and a confirmed molecular diagnosis. PMID:24115482

  5. Identification of a novel SBF2 frameshift mutation in charcot-marie-tooth disease type 4B2 using whole-exome sequencing.

    PubMed

    Chen, Meiyan; Wu, Jing; Liang, Ning; Tang, Lihui; Chen, Yanhua; Chen, Huishuang; Wei, Wei; Wei, Tianying; Huang, Hui; Yi, Xin; Qi, Ming

    2014-10-01

    Charcot-Marie-Tooth disease type 4B2 with early-onset glaucoma (CMT4B2, OMIM 604563) is a genetically-heterogeneous childhood-onset neuromuscular disorder. Here, we report the case of a 15-year-old male adolescent with lower extremity weakness, gait abnormalities, foot deformities and early-onset glaucoma. Since clinical diagnosis alone was insufficient for providing pathogenetic evidence to indicate that the condition belonged to a consanguineous family, we applied whole-exome sequencing to samples from the patient, his parents and his younger brother, assuming that the patient's condition is transmitted in an autosomal recessive pattern. A frame-shift mutation, c.4571delG (P.Gly1524Glufs∗42), was revealed in the CMT4B2-related gene SBF2 (also known as MTMR13, MIM 607697), and this mutation was found to be homozygous in the proband and heterozygous in his parents and younger brother. Together with the results of clinical diagnosis, this case was diagnosed as CMT4B2. Our finding further demonstrates the use of whole-exome sequencing in the diagnosis and treatment of rare diseases. PMID:25462154

  6. A frameshift mutation in golden retriever dogs with progressive retinal atrophy endorses SLC4A3 as a candidate gene for human retinal degenerations.

    PubMed

    Downs, Louise M; Wallin-Håkansson, Berit; Boursnell, Mike; Marklund, Stefan; Hedhammar, Åke; Truvé, Katarina; Hübinette, Louise; Lindblad-Toh, Kerstin; Bergström, Tomas; Mellersh, Cathryn S

    2011-01-01

    Progressive retinal atrophy (PRA) in dogs, the canine equivalent of retinitis pigmentosa (RP) in humans, is characterised by vision loss due to degeneration of the photoreceptor cells in the retina, eventually leading to complete blindness. It affects more than 100 dog breeds, and is caused by numerous mutations. RP affects 1 in 4000 people in the Western world and 70% of causal mutations remain unknown. Canine diseases are natural models for the study of human diseases and are becoming increasingly useful for the development of therapies in humans. One variant, prcd-PRA, only accounts for a small proportion of PRA cases in the Golden Retriever (GR) breed. Using genome-wide association with 27 cases and 19 controls we identified a novel PRA locus on CFA37 (p(raw) = 1.94×10(-10), p(genome) = 1.0×10(-5)), where a 644 kb region was homozygous within cases. A frameshift mutation was identified in a solute carrier anion exchanger gene (SLC4A3) located within this region. This variant was present in 56% of PRA cases and 87% of obligate carriers, and displayed a recessive mode of inheritance with full penetrance within those lineages in which it segregated. Allele frequencies are approximately 4% in the UK, 6% in Sweden and 2% in France, but the variant has not been found in GRs from the US. A large proportion of cases (approximately 44%) remain unexplained, indicating that PRA in this breed is genetically heterogeneous and caused by at least three mutations. SLC4A3 is important for retinal function and has not previously been associated with spontaneously occurring retinal degenerations in any other species, including humans. PMID:21738669

  7. Localized frameshift mutation generates selective, high-frequency phase variation of a surface lipoprotein encoded by a mycoplasma ABC transporter operon.

    PubMed Central

    Theiss, P; Wise, K S

    1997-01-01

    The wall-less mycoplasmas have revealed unusual microbial strategies for adaptive variation of antigenic membrane proteins exposed during their surface colonization of host cells. In particular, high-frequency mutations affecting the expression of selected surface lipoproteins have been increasingly documented for this group of organisms. A novel manifestation of mutational phase variation is shown here to occur in Mycoplasma fermentans, a chronic human infectious agent and possible AIDS-associated pathogen. A putative ABC type transport operon encoding four gene products is identified. The 3' distal gene encoding P78, a known surface-exposed antigen and the proposed substrate-binding lipoprotein of the transporter, is subject to localized hypermutation in a short homopolymeric tract of adenine residues located in the N-terminal coding region of the mature product. High-frequency, reversible insertion/deletion frameshift mutations lead to selective phase variation in P78 expression, whereas the putative nucleotide-binding protein, P63, encoded by the most 5' gene of the operon, is continually expressed. Mutation-based phase variation in specific surface-exposed microbial transporter components may provide an adaptive advantage for immune evasion, while continued expression of other elements of the same transporter may preserve essential metabolic functions and confer alternative substrate specificity. These features could be critical in mycoplasmas, where limitations in both transcriptional regulators and transport systems may prevail. This study also documents that P63 contains an uncharacteristic hydrophobic sequence between predicted nucleotide binding motifs and displays an amphiphilic character in detergent fractionation. Both features are consistent with an evolutionary adaptation favoring integral association of this putative energy-transducing component with the single mycoplasma membrane. PMID:9190819

  8. A novel frameshift mutation of POU4F3 gene associated with autosomal dominant non-syndromic hearing loss

    SciTech Connect

    Lee, Hee Keun; Park, Hong-Joon; Lee, Kyu-Yup; Park, Rekil; Kim, Un-Kyung

    2010-06-04

    Autosomal dominant mutations in the transcription factor POU4F3 gene are associated with non-syndromic hearing loss in humans; however, there have been few reports of mutations in this gene worldwide. We performed a mutation analysis of the POU4F3 gene in 42 unrelated Koreans with autosomal dominant non-syndromic hearing loss, identifying a novel 14-bp deletion mutation in exon 2 (c.662del14) in one patient. Audiometric examination revealed severe bilateral sensorineural hearing loss in this patient. The novel mutation led to a truncated protein that lacked both functional POU domains. We further investigated the functional distinction between wild-type and mutant POU4F3 proteins using in vitro assays. The wild-type protein was completely localized in the nucleus, while the truncation of protein seriously affected its nuclear localization. In addition, the mutant failed to activate reporter gene expression. This is the first report of a POU4F3 mutation in Asia, and moreover our data suggest that further investigation will need to delineate ethnicity-specific genetic background for autosomal dominant non-syndromic hearing loss within Asian populations.

  9. Novel frameshift mutation in the CACNA1A gene causing a mixed phenotype of episodic ataxia and familiar hemiplegic migraine.

    PubMed

    Kinder, S; Ossig, C; Wienecke, M; Beyer, A; von der Hagen, M; Storch, A; Smitka, M

    2015-01-01

    Episodic ataxia type 2 (EA2, MIM#108500) is the most common form of EA and an autosomal-dominant inherited disorder characterized by paroxysmal episodes of ataxia. The disease causative gene CACNA1A encodes for the alpha 1A subunit of the voltage-gated P/Q-type calcium channel. We report on a family with a novel mutation in the CACNA1A gene. The clinical symptoms within the family varied from the typical clinical presentation of EA2 with dysarthria, gait ataxia and oculomotor symptoms to migraine and dystonia. A novel nonsense mutation of the CACNA1A gene was identified in all affected family members and is most likely the disease causing molecular defect. The pharmacological treatment with acetazolamide (AAA) was successful in three family members so far. Treatment with AAA led to a reduction of migraine attacks and an improvement of the dystonia. This relationship confirmed the hypothesis that this novel mutation results in a heterogeneous phenotype and confutes the coincidence with common migraine. Dystonia is potentially included as a further part of the phenotype spectrum of CACNA1A gene mutations. PMID:25468264

  10. Whole-exome analysis of foetal autopsy tissue reveals a frameshift mutation in OBSL1, consistent with a diagnosis of 3-M Syndrome

    PubMed Central

    2015-01-01

    Background We report a consanguineous couple that has experienced three consecutive pregnancy losses following the foetal ultrasound finding of short limbs. Post-termination examination revealed no skeletal dysplasia, but some subtle proximal limb shortening in two foetuses, and a spectrum of mildly dysmorphic features. Karyotype was normal in all three foetuses (46, XX) and comparative genomic hybridization microarray analysis detected no pathogenic copy number variants. Results Whole-exome sequencing and genome-wide homozygosity mapping revealed a previously reported frameshift mutation in the OBSL1 gene (c.1273insA p.T425nfsX40), consistent with a diagnosis of 3-M Syndrome 2 (OMIM #612921), which had not been anticipated from the clinical findings. Conclusions Our study provides novel insight into the early clinical manifestations of this form of 3-M syndrome, and demonstrates the utility of whole exome sequencing as a tool for prenatal diagnosis in particular when there is a family history suggestive of a recurrent set of clinical symptoms. PMID:25923536

  11. A frameshift mutation in the pre-S region of the human hepatitis B virus genome allows production of surface antigen particles but eliminates binding to polymerized albumin.

    PubMed Central

    Persing, D H; Varmus, H E; Ganem, D

    1985-01-01

    The coding region for the major polypeptide (p24S) of hepatitis B surface antigen (HBsAg) is preceded by an in-phase open reading frame termed pre-S. The coding potential of the pre-S region was examined in mouse L cells transformed with cloned hepatitis B virus DNA. Such cells produce three HBsAg-related polypeptides of Mr 24,000, 27,000, and 35,000 organized into complex particles of 22 nm diameter. These HBsAg particles bind to polymerized human albumin, but not to polyalbumins of several other species. In contrast, cells transformed with hepatitis B virus DNA bearing a frameshift mutation near the 3' end of the pre-S region secrete immunoreactive HBsAg particles containing only the 24,000 and 27,000 Mr species. These mutant particles, which lack the 35,000 Mr species, are unable to bind polymerized human albumin. These studies indicate that the pre-S region encodes the 35,000 Mr species, that this product accounts for the known polyalbumin-binding activity of HBsAg but is not required for assembly and secretion of HBsAg 22-nm particles, and that the major polypeptide of HBsAg is not derived primarily by cleavage of larger precursors encoded by the pre-S region. Images PMID:3858831

  12. Exome sequencing identifies a de novo frameshift mutation in the imprinted gene ZDBF2 in a sporadic patient with Nasopalpebral Lipoma-coloboma syndrome.

    PubMed

    Chacón-Camacho, Oscar F; Sobreira, Nara; You, Jing; Piña-Aguilar, Raul E; Villegas-Ruiz, Vanessa; Zenteno, Juan C

    2016-07-01

    Nasopalpebral lipoma-coloboma syndrome (NPLCS, OMIM%167730) is an uncommon malformation entity with autosomal dominant inheritance characterized by the combination of nasopalpebral lipoma, colobomas in upper and lower eyelids, telecanthus, and maxillary hypoplasia. To date, no genetic defects have been associated with familial or sporadic NPLCS cases and the etiology of the disease remains unknown. In this work, the results of whole exome sequencing in a sporadic NPLCS patient are presented. Exome sequencing identified a de novo heterozygous frameshift dinucleotide insertion c.6245_6246 insTT (p.His2082fs*67) in ZDBF2 (zinc finger, DBF-type containing 2), a gene located at 2q33.3. This variant was absent in parental DNA, in a set of 300 ethnically matched controls, and in public exome variant databases. This is the first genetic variant identified in a NPLCS patient and evidence supporting the pathogenicity of the identified mutation is discussed. © 2016 Wiley Periodicals, Inc. PMID:27139419

  13. Two coexisting heterozygous frameshift mutations in PROP1 are responsible for a different phenotype of combined pituitary hormone deficiency.

    PubMed

    Ziemnicka, K; Budny, B; Drobnik, K; Baszko-Błaszyk, D; Stajgis, M; Katulska, K; Waśko, R; Wrotkowska, E; Słomski, R; Ruchała, M

    2016-08-01

    The role of genetic background in childhood-onset combined pituitary hormone deficiency (CPHD) has been extensively studied. The major contributors are the PROP1, POU1F1, LHX3, LHX4 and HESX1 genes coding transcription factors implicated in pituitary organogenesis. The clinical consequences of mutations encompass impaired synthesis of a growth hormone (GH) and one or more concurrent pituitary hormones (i.e. LH, FSH, TSH, PRL). Manifestation of the disorder may vary due to various mutation impacts on the final gene products or an influence of environmental factors during pituitary organogenesis. We describe the clinical and molecular characteristics of two brothers aged 47 and 39 years presenting an uncommon manifestation of congenital hypopituitarism. Sequencing of the PROP1, POU1F1, LHX3, LHX4 and HESX1 genes was performed to confirm the genetic origin of the disorder. A compound heterozygosity in the PROP1 gene has been identified for both probands. The first change represents a mutational hot spot (c.150delA, p.R53fsX164), whereas the second is a novel alteration (p.R112X) that leads to protein disruption. Based on precise genetic diagnosis, an in silico prediction of a p.R112X mutation on protein architecture was performed. The resulting clinical phenotype was surprisingly distinct compared to most patients with genetic alterations in PROP1 reported in the current literature. This may be caused by a residual activity of a newly identified p.R112X protein that preserves over 70 % of the homeodomain structure. This examination may confirm a key role of a DNA-binding homeodomain in maintaining PROP1 functionality and suggests a conceivable explanation of an unusual phenotype. PMID:26608600

  14. Homozygosity for frameshift mutations in XYLT2 result in a spondylo-ocular syndrome with bone fragility, cataracts, and hearing defects.

    PubMed

    Munns, Craig F; Fahiminiya, Somayyeh; Poudel, Nabin; Munteanu, Maria Cristina; Majewski, Jacek; Sillence, David O; Metcalf, Jordan P; Biggin, Andrew; Glorieux, Francis; Fassier, François; Rauch, Frank; Hinsdale, Myron E

    2015-06-01

    Heparan and chondroitin/dermatan sulfated proteoglycans have a wide range of roles in cellular and tissue homeostasis including growth factor function, morphogen gradient formation, and co-receptor activity. Proteoglycan assembly initiates with a xylose monosaccharide covalently attached by either xylosyltransferase I or II. Three individuals from two families were found that exhibited similar phenotypes. The index case subjects were two brothers, individuals 1 and 2, who presented with osteoporosis, cataracts, sensorineural hearing loss, and mild learning defects. Whole exome sequence analyses showed that both individuals had a homozygous c.692dup mutation (GenBank: NM_022167.3) in the xylosyltransferase II locus (XYLT2) (MIM: 608125), causing reduced XYLT2 mRNA and low circulating xylosyltransferase (XylT) activity. In an unrelated boy (individual 3) from the second family, we noted low serum XylT activity. Sanger sequencing of XYLT2 in this individual revealed a c.520del mutation in exon 2 that resulted in a frameshift and premature stop codon (p.Ala174Profs(∗)35). Fibroblasts from individuals 1 and 2 showed a range of defects including reduced XylT activity, GAG incorporation of (35)SO4, and heparan sulfate proteoglycan assembly. These studies demonstrate that human XylT2 deficiency results in vertebral compression fractures, sensorineural hearing loss, eye defects, and heart defects, a phenotype that is similar to the autosomal-recessive disorder spondylo-ocular syndrome of unknown cause. This phenotype is different from what has been reported in individuals with other linker enzyme deficiencies. These studies illustrate that the cells of the lens, retina, heart muscle, inner ear, and bone are dependent on XylT2 for proteoglycan assembly in humans. PMID:26027496

  15. Juvenile-onset Sporadic Amyotrophic Lateral Sclerosis with a Frameshift FUS Gene Mutation Presenting Unique Neuroradiological Findings and Cognitive Impairment.

    PubMed

    Hirayanagi, Kimitoshi; Sato, Masayuki; Furuta, Natsumi; Makioka, Kouki; Ikeda, Yoshio

    2016-01-01

    A 24-year-old Japanese woman developed anterocollis, weakness of the proximal arms, and subsequent cognitive impairment. A neurological examination revealed amyotrophic lateral sclerosis (ALS) without a family history. Systemic muscle atrophy progressed rapidly. Cerebral MRI clearly exhibited high signal intensities along the bilateral pyramidal tracts. An analysis of the FUS gene revealed a heterozygous two-base pair deletion, c.1507-1508delAG (p.G504WfsX515). A subset of juvenile-onset familial/sporadic ALS cases with FUS gene mutations reportedly demonstrates mental retardation or learning difficulty. Our study emphasizes the importance of conducting a FUS gene analysis in juvenile-onset ALS cases, even when no family occurrence is confirmed. PMID:26984092

  16. Novel frame-shift mutation in Slc5a2 encoding SGLT2 in a strain of senescence-accelerated mouse SAMP10.

    PubMed

    Unno, Keiko; Yamamoto, Hiroyuki; Toda, Masateru; Hagiwara, Shiori; Iguchi, Kazuaki; Hoshino, Minoru; Takabayashi, Fumiyo; Hasegawa-Ishii, Sanae; Shimada, Atsuyoshi; Hosokawa, Masanori; Higuchi, Keiichi; Mori, Masayuki

    2014-11-01

    The senescence-accelerated mouse prone10 (SAMP10) strain, a model of aging, exhibits cognitive impairments and cerebral atrophy. We noticed that SAMP10/TaSlc mice, a SAMP10 substrain, have developed persistent glucosuria over the past few years. In the present study, we characterized SAMP10/TaSlc mice and further identified a spontaneous mutation in the Slc5a2 gene encoding sodium-glucose co-transporter (SGLT) 2. The mean concentration of urine glucose was high in SAMP10/TaSlc mice and increased further with advancing age, whereas other strains of senescence-accelerated mice, including SAMP1/SkuSlc, SAMP6/TaSlc and SAMP8/TaSlc or normal aging control SAMR1/TaSlc mice, exhibited no detectable glucose in urine. SAMP10/TaSlc mice consumed increasing amounts of food and water compared to SAMR1/TaSlc mice, suggesting the compensation of polyuria and the loss of glucose. Oral glucose tolerance tests showed decreased glucose reabsorption in the kidney of SAMP10/TaSlc mice. In addition, blood glucose levels decreased in an age-dependent fashion. The kidney was innately larger than that of control mice with no histological alterations. We examined the expression levels of glucose transporters in the kidney. Among SGLT1, SGLT2, glucose transporter (GLUT) 1 and GLUT2, we found a significant decrease only in the level of SGLT2. DNA sequencing of SGLT2 in SAMP10/TaSlc mice revealed a single nucleotide deletion of guanine at 1236, which resulted in a frameshift mutation that produced a truncated protein. We designate this strain as SAMP10/TaSlc-Slc5a2(slc) (SAMP10-ΔSglt2). Recently, SGLT2 inhibitors have been demonstrated to be effective for the treatment of patients with type 2 diabetes (T2D). SAMP10-ΔSglt2 mice may serve as a unique preclinical model to study the link between aging-related neurodegenerative disorders and T2D. PMID:25450362

  17. Classification of a frameshift/extended and a stop mutation in WT1 as gain-of-function mutations that activate cell cycle genes and promote Wilms tumour cell proliferation

    PubMed Central

    Busch, Maike; Schwindt, Heinrich; Brandt, Artur; Beier, Manfred; Görldt, Nicole; Romaniuk, Paul; Toska, Eneda; Roberts, Stefan; Royer, Hans-Dieter; Royer-Pokora, Brigitte

    2014-01-01

    The WT1 gene encodes a zinc finger transcription factor important for normal kidney development. WT1 is a suppressor for Wilms tumour development and an oncogene for diverse malignant tumours. We recently established cell lines from primary Wilms tumours with different WT1 mutations. To investigate the function of mutant WT1 proteins, we performed WT1 knockdown experiments in cell lines with a frameshift/extension (p.V432fsX87 = Wilms3) and a stop mutation (p.P362X = Wilms2) of WT1, followed by genome-wide gene expression analysis. We also expressed wild-type and mutant WT1 proteins in human mesenchymal stem cells and established gene expression profiles. A detailed analysis of gene expression data enabled us to classify the WT1 mutations as gain-of-function mutations. The mutant WT1Wilms2 and WT1Wilms3 proteins acquired an ability to modulate the expression of a highly significant number of genes from the G2/M phase of the cell cycle, and WT1 knockdown experiments showed that they are required for Wilms tumour cell proliferation. p53 negatively regulates the activity of a large number of these genes that are also part of a core proliferation cluster in diverse human cancers. Our data strongly suggest that mutant WT1 proteins facilitate expression of these cell cycle genes by antagonizing transcriptional repression mediated by p53. We show that mutant WT1 can physically interact with p53. Together the findings show for the first time that mutant WT1 proteins have a gain-of-function and act as oncogenes for Wilms tumour development by regulating Wilms tumour cell proliferation. PMID:24619359

  18. A stochastic model of translation with -1 programmed ribosomal frameshifting

    NASA Astrophysics Data System (ADS)

    Bailey, Brenae L.; Visscher, Koen; Watkins, Joseph

    2014-02-01

    Many viruses produce multiple proteins from a single mRNA sequence by encoding overlapping genes. One mechanism to decode both genes, which reside in alternate reading frames, is -1 programmed ribosomal frameshifting. Although recognized for over 25 years, the molecular and physical mechanism of -1 frameshifting remains poorly understood. We have developed a mathematical model that treats mRNA translation and associated -1 frameshifting as a stochastic process in which the transition probabilities are based on the energetics of local molecular interactions. The model predicts both the location and efficiency of -1 frameshift events in HIV-1. Moreover, we compute -1 frameshift efficiencies upon mutations in the viral mRNA sequence and variations in relative tRNA abundances, predictions that are directly testable in experiment.

  19. Spotlight Topics

    NASA Astrophysics Data System (ADS)

    A Spotlight Topic consists of a set of two or more review articles focused on a specific subject in surface science. The topics are recommended by the Board of Editors. A topic may be chosen because it is particularly new or fast-breaking, thus deserving introduction to the general readership. Or, it may be because a topic is especially controversial or confusing, requiring clarification by experts. Each review will give a critical assessment rather than an encyclopedic report. While our editors always will insist on fairness and accuracy, any review which forwards an opinion is bound to be somewhat subjective. Therefore, it is the editors' wish that the set of reviews written by different authors on the same subject matter will provide a broad and balanced viewpoint. It is often the case that an author who is an expert in a technique or method may be especially enthusiastic or critical about this technique or method. A companion review in the set may provide a different viewpoint. We are hopeful that the reader, after studying these reviews and checking some of the key references, will obtain an informed opinion of the subject. We think the set of reviews in a spotlight area will considerably shorten the ``learning time'' that a nonexpert would otherwise need to become knowledgeable about a subject. In this issue, we feature a spotlight topic on oxide surfaces. The set contains an overview article by Jacques Jupille, and four articles written by G. Pacchioni, F. Cosandey and T. E. Madey, B. G. Daniels, R. Lindsay and G. Thornton, and C. Noguera respectively. Of these, the article by Pacchioni has already appeared in SRL 7, 277 (2000). The other three articles appear in this issue. A reader who wishes to suggest a spotlight topic or recommend authors to write such reviews should contact the Editor-in-Chief. We would like to hear from you.

  20. A Stochastic Model of RNA Translation with Frameshifting

    NASA Astrophysics Data System (ADS)

    Bailey, Brenae

    2011-10-01

    Many viruses can produce different proteins from the same RNA sequence by encoding them in overlapping genes. One mechanism that causes the ribosomes of infected cells to decode both genes is called programmed ribosomal frameshifting (PRF). Although PRF has been recognized for 25 years, the mechanism is not well understood. We have developed a model that treats RNA translation as a stochastic process in which the transition probabilities are based on the free energies of local molecular interactions. The model reproduces observed translation rates and frameshift efficiencies, and can be used to predict the effects of mutations in the viral RNA sequence on both the mean translation rate and the frameshift efficiency.

  1. Functional Characterization of a Novel Frameshift Mutation in the C-terminus of the Nav1.5 Channel Underlying a Brugada Syndrome with Variable Expression in a Spanish Family

    PubMed Central

    Núñez, Lucía; Barana, Adriana; Amorós, Irene; Matamoros, Marcos; Pérez-Hernández, Marta; González de la Fuente, Marta; Álvarez-López, Miguel; Macías-Ruiz, Rosa; Tercedor-Sánchez, Luis; Jiménez-Jáimez, Juan; Delpón, Eva; Caballero, Ricardo; Tamargo, Juan

    2013-01-01

    Introduction We functionally analyzed a frameshift mutation in the SCN5A gene encoding cardiac Na+ channels (Nav1.5) found in a proband with repeated episodes of ventricular fibrillation who presented bradycardia and paroxysmal atrial fibrillation. Seven relatives also carry the mutation and showed a Brugada syndrome with an incomplete and variable expression. The mutation (p.D1816VfsX7) resulted in a severe truncation (201 residues) of the Nav1.5 C-terminus. Methods and Results Wild-type (WT) and mutated Nav1.5 channels together with hNavβ1 were expressed in CHO cells and currents were recorded at room temperature using the whole-cell patch-clamp. Expression of p.D1816VfsX7 alone resulted in a marked reduction (≈90%) in peak Na+ current density compared with WT channels. Peak current density generated by p.D1816VfsX7+WT was ≈50% of that generated by WT channels. p.D1816VfsX7 positively shifted activation and inactivation curves, leading to a significant reduction of the window current. The mutation accelerated current activation and reactivation kinetics and increased the fraction of channels developing slow inactivation with prolonged depolarizations. However, late INa was not modified by the mutation. p.D1816VfsX7 produced a marked reduction of channel trafficking toward the membrane that was not restored by decreasing incubation temperature during cell culture or by incubation with 300 μM mexiletine and 5 mM 4-phenylbutirate. Conclusion Despite a severe truncation of the C-terminus, the resulting mutated channels generate currents, albeit with reduced amplitude and altered biophysical properties, confirming the key role of the C-terminal domain in the expression and function of the cardiac Na+ channel. PMID:24363796

  2. Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

    PubMed

    Blazquez, A; Martín, M A; Lara, M C; Martí, R; Campos, Y; Cabello, A; Garesse, R; Bautista, J; Andreu, A L; Arenas, J

    2005-11-01

    We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP). PMID:16198108

  3. Balancing Selection of a Frame-Shift Mutation in the MRC2 Gene Accounts for the Outbreak of the Crooked Tail Syndrome in Belgian Blue Cattle

    PubMed Central

    Li, Wanbo; Dive, Marc; Tamma, Nico; Michaux, Charles; Druet, Tom; Huijbers, Ivo J.; Isacke, Clare M.; Coppieters, Wouter; Georges, Michel; Charlier, Carole

    2009-01-01

    We herein describe the positional identification of a 2-bp deletion in the open reading frame of the MRC2 receptor causing the recessive Crooked Tail Syndrome in cattle. The resulting frame-shift reveals a premature stop codon that causes nonsense-mediated decay of the mutant messenger RNA, and the virtual absence of functional Endo180 protein in affected animals. Cases exhibit skeletal anomalies thought to result from impaired extracellular matrix remodeling during ossification, and as of yet unexplained muscular symptoms. We demonstrate that carrier status is very significantly associated with desired characteristics in the general population, including enhanced muscular development, and that the resulting heterozygote advantage caused a selective sweep which explains the unexpectedly high frequency (25%) of carriers in the Belgian Blue Cattle Breed. PMID:19779552

  4. Balancing selection of a frame-shift mutation in the MRC2 gene accounts for the outbreak of the Crooked Tail Syndrome in Belgian Blue Cattle.

    PubMed

    Fasquelle, Corinne; Sartelet, Arnaud; Li, Wanbo; Dive, Marc; Tamma, Nico; Michaux, Charles; Druet, Tom; Huijbers, Ivo J; Isacke, Clare M; Coppieters, Wouter; Georges, Michel; Charlier, Carole

    2009-09-01

    We herein describe the positional identification of a 2-bp deletion in the open reading frame of the MRC2 receptor causing the recessive Crooked Tail Syndrome in cattle. The resulting frame-shift reveals a premature stop codon that causes nonsense-mediated decay of the mutant messenger RNA, and the virtual absence of functional Endo180 protein in affected animals. Cases exhibit skeletal anomalies thought to result from impaired extracellular matrix remodeling during ossification, and as of yet unexplained muscular symptoms. We demonstrate that carrier status is very significantly associated with desired characteristics in the general population, including enhanced muscular development, and that the resulting heterozygote advantage caused a selective sweep which explains the unexpectedly high frequency (25%) of carriers in the Belgian Blue Cattle Breed. PMID:19779552

  5. A frameshift mutation in the LYST gene is responsible for the Aleutian color and the associated Chédiak-Higashi syndrome in American mink.

    PubMed

    Anistoroaei, R; Krogh, A K; Christensen, K

    2013-04-01

    One of the colors of mink is Aleutian (aa)-a specific gun-metal gray pigmentation of the fur-commonly used in combination with other color loci to generate popular colors such as Violet (aammpp) and Sapphire (aapp). The Aleutian color allele is a manifestation of mink Chédiak-Higashi syndrome (CHS), which has been described in humans and several other species. As with forms of CHS in other species, we report that the mink CHS is linked to the lysosomal trafficking regulator ( LYST ) gene. Furthermore, we have identified a base deletion (c.9468delC) in exon 40 of LYST, which causes a frameshift and virtually terminates the LYST product prematurely (p.Leu3156Phefs*37). We investigated the blood parameters of three wild-type mink and three CHS mink. No difference in the platelet number between the two groups was observed, but an accumulation of platelets between the groups appears different when collagen is used as a coagulant. Microscopic analysis of peripheral blood indicates giant inclusions in the neutrophils of the Aleutian mink types. Molecular findings at the LYST locus enable the development of genetic tests for analyzing the color selection in American mink. PMID:22762706

  6. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    SciTech Connect

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  7. Reverse genetic screen for loss-of-function mutations uncovers a frameshifting deletion in the melanophilin gene accountable for a distinctive coat color in Belgian Blue cattle.

    PubMed

    Li, Wanbo; Sartelet, Arnaud; Tamma, Nico; Coppieters, Wouter; Georges, Michel; Charlier, Carole

    2016-02-01

    In the course of a reverse genetic screen in the Belgian Blue cattle breed, we uncovered a 10-bp deletion (c.87_96del) in the first coding exon of the melanophilin gene (MLPH), which introduces a premature stop codon (p.Glu32Aspfs*1) in the same exon, truncating 94% of the protein. Recessive damaging mutations in the MLPH gene are well known to cause skin, hair, coat or plumage color dilution phenotypes in numerous species, including human, mice, dog, cat, mink, rabbit, chicken and quail. Large-scale array genotyping undertaken to identify p.Glu32Aspfs*1 homozygous mutant animals revealed a mutation frequency of 5% in the breed and allowed for the identification of 10 homozygous mutants. As expression of a colored coat requires at least one wild-type allele at the co-dominant Roan locus encoded by the KIT ligand gene (KITLG), homozygous mutants for p.Ala227Asp corresponding with the missense mutation were excluded. The six remaining colored calves displayed a distinctive dilution phenotype as anticipated. This new coat color was named 'cool gray'. It is the first damaging mutation in the MLPH gene described in cattle and extends the already long list of species with diluted color due to recessive mutations in MLPH and broadens the color palette of gray in this breed. PMID:26582259

  8. First application of next-generation sequencing in Moroccan breast/ovarian cancer families and report of a novel frameshift mutation of the BRCA1 gene

    PubMed Central

    Jouali, Farah; Laarabi, Fatima-Zahra; Marchoudi, Nabila; Ratbi, Ilham; Elalaoui, Siham Chafai; Rhaissi, Houria; Fekkak, Jamal; Sefiani, Abdelaziz

    2016-01-01

    At present, breast cancer is the most common type of cancer in females. The majority of cases are sporadic, but 5–10% are due to an inherited predisposition to develop breast and ovarian cancers, which are transmitted as an autosomal dominant form with incomplete penetrance. The beneficial effects of clinical genetic testing, including next generation sequencing (NGS) for BRCA1/2 mutations, is major; in particular, it benefits the care of patients and the counseling of relatives that are at risk of breast cancer, in order to reduce breast cancer mortality. BRCA genetic testing was performed in 15 patients with breast cancer and a family with positivity for the heterozygous c.6428C>A mutation of the BRCA2 gene. Informed consent was obtained from all the subjects. Genomic DNAs were extracted and the NGS for genes was performed using the Ion Torrent Personal Genome Machine (PGM) with a 316 chip. The reads were aligned with the human reference HG19 genome to elucidate variants in the BRCA1 and BRCA2 genes. Mutations detected by the PGM platform were confirmed by target direct Sanger sequencing on a second patient DNA sample. In total, 4 BRCA variants were identified in 6 families by NGS. Of these, 3 mutations had been previously reported: c.2126insA of BRCA1, and c.1310_1313delAAGA and c.7235insG of BRCA2. The fourth variant, c.3453delT in BRCA1, has, to the best of our knowledge, never been previously reported. The present study is the first to apply NGS of the BRCA1 and BRCA2 genes to a Moroccan population, prompting additional investigation into local founder mutations and variant characteristics in the region. The variants with no clear clinical significance may present a diagnostic challenge when performing targeted resequencing. These results confirm that an NGS approach based on Ampliseq libraries and PGM sequencing is a highly efficient, speedy and high-throughput mutation detection method, which may be preferable in lower income countries. PMID:27446417

  9. A Three-Stemmed mRNA Pseudoknot in the SARS Coronavirus Frameshift Signal

    PubMed Central

    2005-01-01

    A wide range of RNA viruses use programmed −1 ribosomal frameshifting for the production of viral fusion proteins. Inspection of the overlap regions between ORF1a and ORF1b of the SARS-CoV genome revealed that, similar to all coronaviruses, a programmed −1 ribosomal frameshift could be used by the virus to produce a fusion protein. Computational analyses of the frameshift signal predicted the presence of an mRNA pseudoknot containing three double-stranded RNA stem structures rather than two. Phylogenetic analyses showed the conservation of potential three-stemmed pseudoknots in the frameshift signals of all other coronaviruses in the GenBank database. Though the presence of the three-stemmed structure is supported by nuclease mapping and two-dimensional nuclear magnetic resonance studies, our findings suggest that interactions between the stem structures may result in local distortions in the A-form RNA. These distortions are particularly evident in the vicinity of predicted A-bulges in stems 2 and 3. In vitro and in vivo frameshifting assays showed that the SARS-CoV frameshift signal is functionally similar to other viral frameshift signals: it promotes efficient frameshifting in all of the standard assay systems, and it is sensitive to a drug and a genetic mutation that are known to affect frameshifting efficiency of a yeast virus. Mutagenesis studies reveal that both the specific sequences and structures of stems 2 and 3 are important for efficient frameshifting. We have identified a new RNA structural motif that is capable of promoting efficient programmed ribosomal frameshifting. The high degree of conservation of three-stemmed mRNA pseudoknot structures among the coronaviruses suggests that this presents a novel target for antiviral therapeutics. PMID:15884978

  10. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    PubMed

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events). PMID:23161689

  11. A molecular characterization of spontaneous frameshift mutagenesis within the trpA gene of Escherichia coli

    PubMed Central

    Hardin, Aaron; Villalta, Christopher F.; Doan, Michael; Jabri, Mouna; Chockalingham, Valliammal; White, Steven J.; Fowler, Robert G.

    2007-01-01

    Spontaneous frameshift mutations are an important source of genetic variation in all species and cause a large number of genetic disorders in humans. To enhance our understanding of the molecular mechanisms of frameshift mutagenesis, 583 spontaneous Trp+ revertants of two trpA frameshift alleles in Escherichia coli were isolated and DNA sequenced. In order to measure the contribution of methyl-directed mismatch repair to frameshift production, mutational spectra were constructed for both mismatch repair-proficient and repair-defective strains. The molecular origins of practically all of the frameshifts analyzed could be explained by one of six simple models based upon misalignment of the template or nascent DNA strands with or without misincoroporation of primer nucleotides during DNA replication. Most frameshifts occurred within mononucleotide runs as has been shown often in previous studies but the location of the 76 frameshift sites was usually outside of runs. Mismatch repair generally was most effective in preventing the occurrence of frameshifts within runs but there was much variation from site to site. Most frameshift sites outside of runs appear to be refractory to mismatch repair although the small number of occurrences at most of these sites make firm conclusions impossible. There was a dense pattern of reversion sites within the trpA DNA region where reversion events could occur, suggesting that, in general, most DNA sequences are capable of undergoing spontaneous mutational events during replication that can lead to small deletions and insertions. Many of these errors are likely to occur at low frequencies and be tolerated as events too costly to prevent or repair. These studies also revealed an unpredicted flexibility in the primary amino acid sequence of the trpA product, the α subunit of tryptophan synthase. PMID:17084112

  12. Spotlight on Minority Students

    ERIC Educational Resources Information Center

    Yous, Phakdey Chea; Mahamed, Hodman; Kost, Kimberly

    2009-01-01

    This article spotlights minority students in school psychology training programs. Three students from underrepresented backgrounds were asked to reflect on what aspects of their program made them feel welcome and supported. In their discussions, they took the task a step further and furnished ideas about ways in which school psychology training…

  13. Spotlight on Teaching Orchestra

    ERIC Educational Resources Information Center

    Rowman & Littlefield Education, 2005

    2005-01-01

    This publication provides orchestra teachers with techniques for conducting, choosing repertoire, program development, recruiting, playing styles, and preparing for competitions. It is the latest in MENC's popular Spotlight series, comprising articles that have appeared in state MEA journals. It is made up of 9 sections, and has a total of 53…

  14. Parent Group Spotlight

    ERIC Educational Resources Information Center

    Parenting for High Potential, 2014

    2014-01-01

    This issue's "Parent Group Spotlight" features Deborah Simon, president of West Sound Gifted, Talented & Twice-Exceptional (WSGT2e), who started a parent group in Washington in 2013. In just one year, this small, but mighty group has held community forums, attended school board meetings, and helped influence local gifted programming.…

  15. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus.

    PubMed

    Gao, Feng; Simon, Anne E

    2016-01-29

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5'-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3' terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  16. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    SciTech Connect

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  17. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

    PubMed Central

    Gao, Feng; Simon, Anne E.

    2016-01-01

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  18. Spotlight-8 Image Analysis Software

    NASA Technical Reports Server (NTRS)

    Klimek, Robert; Wright, Ted

    2006-01-01

    Spotlight is a cross-platform GUI-based software package designed to perform image analysis on sequences of images generated by combustion and fluid physics experiments run in a microgravity environment. Spotlight can perform analysis on a single image in an interactive mode or perform analysis on a sequence of images in an automated fashion. Image processing operations can be employed to enhance the image before various statistics and measurement operations are performed. An arbitrarily large number of objects can be analyzed simultaneously with independent areas of interest. Spotlight saves results in a text file that can be imported into other programs for graphing or further analysis. Spotlight can be run on Microsoft Windows, Linux, and Apple OS X platforms.

  19. In the Spotlight: Bioinformatics

    PubMed Central

    Wang, May Dongmei

    2016-01-01

    During 2012, next generation sequencing (NGS) has attracted great attention in the biomedical research community, especially for personalized medicine. Also, third generation sequencing has become available. Therefore, state-of-art sequencing technology and analysis are reviewed in this Bioinformatics spotlight on 2012. Next-generation sequencing (NGS) is high-throughput nucleic acid sequencing technology with wide dynamic range and single base resolution. The full promise of NGS depends on the optimization of NGS platforms, sequence alignment and assembly algorithms, data analytics, novel algorithms for integrating NGS data with existing genomic, proteomic, or metabolomic data, and quantitative assessment of NGS technology in comparing to more established technologies such as microarrays. NGS technology has been predicated to become a cornerstone of personalized medicine. It is argued that NGS is a promising field for motivated young researchers who are looking for opportunities in bioinformatics. PMID:23192635

  20. DVL3 Alleles Resulting in a -1 Frameshift of the Last Exon Mediate Autosomal-Dominant Robinow Syndrome.

    PubMed

    White, Janson J; Mazzeu, Juliana F; Hoischen, Alexander; Bayram, Yavuz; Withers, Marjorie; Gezdirici, Alper; Kimonis, Virginia; Steehouwer, Marloes; Jhangiani, Shalini N; Muzny, Donna M; Gibbs, Richard A; van Bon, Bregje W M; Sutton, V Reid; Lupski, James R; Brunner, Han G; Carvalho, Claudia M B

    2016-03-01

    Robinow syndrome is a rare congenital disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features. Recent reports have identified, in individuals with dominant Robinow syndrome, a specific type of variant characterized by being uniformly located in the penultimate exon of DVL1 and resulting in a -1 frameshift allele with a premature termination codon that escapes nonsense-mediated decay. Here, we studied a cohort of individuals who had been clinically diagnosed with Robinow syndrome but who had not received a molecular diagnosis from variant studies of DVL1, WNT5A, and ROR2. Because of the uniform location of frameshift variants in DVL1-mediated Robinow syndrome and the functional redundancy of DVL1, DVL2, and DVL3, we elected to pursue direct Sanger sequencing of the penultimate exon of DVL1 and its paralogs DVL2 and DVL3 to search for potential disease-associated variants. Remarkably, targeted sequencing identified five unrelated individuals harboring heterozygous, de novo frameshift variants in DVL3, including two splice acceptor mutations and three 1 bp deletions. Similar to the variants observed in DVL1-mediated Robinow syndrome, all variants in DVL3 result in a -1 frameshift, indicating that these highly specific alterations might be a common cause of dominant Robinow syndrome. Here, we review the current knowledge of these peculiar variant alleles in DVL1- and DVL3-mediated Robinow syndrome and further elucidate the phenotypic features present in subjects with DVL1 and DVL3 frameshift mutations. PMID:26924530

  1. Net -1 frameshifting on a noncanonical sequence in a herpes simplex virus drug-resistant mutant is stimulated by nonstop mRNA.

    PubMed

    Pan, Dongli; Coen, Donald M

    2012-09-11

    Ribosomal frameshifting entails slippage of the translational machinery during elongation. Frameshifting permits expression of more than one polypeptide from an otherwise monocistronic mRNA, and can restore expression of polypeptides in the face of frameshift mutations. A common mutation conferring acyclovir resistance in patients with herpes simplex virus disease deletes one cytosine from a run of six cytosines (C-chord) in the viral thymidine kinase (tk) gene. However, this mutation does not abolish TK activity, which is important for pathogenicity. To investigate how this mutant retains TK activity, we engineered and analyzed viruses expressing epitope-tagged TK. We found that the mutant's TK activity can be accounted for by low levels of full-length TK polypeptide produced by net -1 frameshifting during translation. The efficiency of frameshifting was relatively high, 3-5%, as the polypeptide from the reading frame generated by the deletion, which lacks stop codons (nonstop), was poorly expressed mainly because of inefficient protein synthesis. Stop codons introduced into this reading frame greatly increased its expression, but greatly decreased the level of full-length TK, indicating that frameshifting is strongly stimulated by a new mechanism, nonstop mRNA, which we hypothesize involves stalling of ribosomes on the polyA tail. Mutational studies indicated that frameshifting occurs on or near the C-chord, a region lacking a canonical slippery sequence. Nonstop stimulation of frameshifting also occurred when the C-chord was replaced with a canonical slippery sequence from HIV. This mechanism thus permits biologically and clinically relevant TK synthesis, and may occur more generally. PMID:22927407

  2. Net −1 frameshifting on a noncanonical sequence in a herpes simplex virus drug-resistant mutant is stimulated by nonstop mRNA

    PubMed Central

    Pan, Dongli; Coen, Donald M.

    2012-01-01

    Ribosomal frameshifting entails slippage of the translational machinery during elongation. Frameshifting permits expression of more than one polypeptide from an otherwise monocistronic mRNA, and can restore expression of polypeptides in the face of frameshift mutations. A common mutation conferring acyclovir resistance in patients with herpes simplex virus disease deletes one cytosine from a run of six cytosines (C-chord) in the viral thymidine kinase (tk) gene. However, this mutation does not abolish TK activity, which is important for pathogenicity. To investigate how this mutant retains TK activity, we engineered and analyzed viruses expressing epitope-tagged TK. We found that the mutant's TK activity can be accounted for by low levels of full-length TK polypeptide produced by net −1 frameshifting during translation. The efficiency of frameshifting was relatively high, 3–5%, as the polypeptide from the reading frame generated by the deletion, which lacks stop codons (nonstop), was poorly expressed mainly because of inefficient protein synthesis. Stop codons introduced into this reading frame greatly increased its expression, but greatly decreased the level of full-length TK, indicating that frameshifting is strongly stimulated by a new mechanism, nonstop mRNA, which we hypothesize involves stalling of ribosomes on the polyA tail. Mutational studies indicated that frameshifting occurs on or near the C-chord, a region lacking a canonical slippery sequence. Nonstop stimulation of frameshifting also occurred when the C-chord was replaced with a canonical slippery sequence from HIV. This mechanism thus permits biologically and clinically relevant TK synthesis, and may occur more generally. PMID:22927407

  3. Role of the pks15/1 gene in the biosynthesis of phenolglycolipids in the Mycobacterium tuberculosis complex. Evidence that all strains synthesize glycosylated p-hydroxybenzoic methyl esters and that strains devoid of phenolglycolipids harbor a frameshift mutation in the pks15/1 gene.

    PubMed

    Constant, Patricia; Perez, Esther; Malaga, Wladimir; Lanéelle, Marie-Antoinette; Saurel, Olivier; Daffé, Mamadou; Guilhot, Christophe

    2002-10-11

    Diesters of phthiocerol and phenolphthiocerol are important virulence factors of Mycobacterium tuberculosis and Mycobacterium leprae, the two main mycobacterial pathogens in humans. They are both long-chain beta-diols, and their biosynthetic pathway is beginning to be elucidated. Although the two classes of molecules share a common lipid core, phthiocerol diesters have been found in all the strains of the M. tuberculosis complex examined although phenolphthiocerol diesters are produced by only a few groups of strains. To address the question of the origin of this diversity 8 reference strains and 10 clinical isolates of M. tuberculosis were analyzed. We report the presence of glycosylated p-hydroxybenzoic acid methyl esters, structurally related to the type-specific phenolphthiocerol glycolipids, in the culture media of all reference strains of M. tuberculosis, suggesting that the strains devoid of phenolphthiocerol derivatives are unable to elongate the putative p-hydroxybenzoic acid precursor. We also show that all the strains of M. tuberculosis examined and deficient in the production of phenolphthiocerol derivatives are natural mutants with a frameshift mutation in pks15/1 whereas a single open reading frame for pks15/1 is found in Mycobacterium bovis BCG, M. leprae, and strains of M. tuberculosis that produce phenolphthiocerol derivatives. Complementation of the H37Rv strain of M. tuberculosis, which is devoid of phenolphthiocerol derivatives, with the fused pks15/1 gene from M. bovis BCG restored phenolphthiocerol glycolipids production. Conversely, disruption of the pks15/1 gene in M. bovis BCG led to the abolition of the synthesis of type-specific phenolphthiocerol glycolipid. These data indicate that Pks15/1 is involved in the elongation of p-hydroxybenzoic acid to give p-hydroxyphenylalkanoates, which in turn are converted, presumably by the PpsA-E synthase, to phenolphthiocerol derivatives. PMID:12138124

  4. ETS Research Spotlight: Issue 2

    ERIC Educational Resources Information Center

    Johnson, Jeff, Ed.

    2009-01-01

    In four articles adapted from the Educational Testing Service (ETS) Research Report Series, Issue 2 of ETS Research Spotlight provides a small taste of the range of assessment-related research capabilities of the ETS Research and Development Division. Those articles cover assessment-related research aimed at developing models of student learning,…

  5. Another functional frame-shift polymorphism of DEFB126 (rs11467497) associated with male infertility

    PubMed Central

    Duan, Shiwei; Shi, Changgeng; Chen, Guowu; Zheng, Ju-fen; Wu, Bin; Diao, Hua; Ji, Lindan; Gu, Yihua; Xin, Aijie; Wu, Yancheng; Zhou, Weijin; Miao, Maohua; Xu, Limin; Li, Zheng; Yuan, Yao; Wang, Peng; Shi, Huijuan

    2015-01-01

    DEFB126 rs140685149 mutation was shown to cause sperm dysfunction and subfertility. Indel rs11467497 is another 4-nucleotide frame-shift mutation (151bp upstream of rs140685149) that leads to the premature termination of translation and the expression of peptide truncated at the carboxyl terminus. In the present study, we performed a comprehensive association study to check the contribution of rs140685149 and rs11467497 to male infertility. Our results confirmed the previous findings that there was no association between rs140685149 and sperm motility. In contrast, we found a significant association of another indel rs11467497 with male infertility. Moreover, rs11467497 was shown to be associated with higher number of round cells in the infertile males with low sperm motility. Surprisingly, the two mutations commonly existed in the sperm donors (n = 672), suggesting a potential application of the two indels in the screening for eligible sperm donors. Western blotting assays showed the sperms with rs140685149 2-nt deletion tended to have unstable DEFB126 protein in contrast of no DEFB126 protein expressed in the sperms with rs11467497 4-nt deletion, suggesting a more severe consequence caused by rs11467497 mutation. In conclusion, our study presented a significant contribution of another functional frame-shift polymorphism of DEFB126 (rs11467497) to male infertility. PMID:25721098

  6. Role of frameshift ubiquitin B protein in Alzheimer's disease.

    PubMed

    Chen, Xin; Petranovic, Dina

    2016-07-01

    Alzheimer's disease (AD) is the most common neurodegenerative disease and is characterized by accumulation of misfolded and aggregated proteins. Since the ubiquitin-proteasome system (UPS) is the major intracellular protein quality control (PQC) system in eukaryotic cells, it is likely involved in the etiology of AD. The frameshift form of ubiquitin (Ubb(+1) ) accumulates in the neuritic plaques and neurofibrillary tangles in patients with AD. Ubb(+1) accumulates in an age-dependent manner as a result of RNA-polymerase mediated molecular misreading during transcription, which allows the formation of mutant proteins in the absence of gene mutations. The accumulation of the Ubb(+1) protein may act as an endogenous reporter for proteasome dysfunction and a growing number of studies have shown that Ubb(+1) may play more important pathogenic roles in AD etiology than previously hypothesized. The yeast Saccharomyces cerevisiae shares many conserved biological processes with all eukaryotic cells, including human neurons. This organism has been regarded as a model system for investigating the fundamental intracellular mechanisms, including those underlying neurodegeneration. We propose here that yeast systems biology approaches, combined with cell and molecular biology approaches will increase the relevant knowledge needed for advancement and elucidation of mechanisms and complex traits, which could provide new targets for therapeutic intervention in AD. WIREs Syst Biol Med 2016, 8:300-313. doi: 10.1002/wsbm.1340 For further resources related to this article, please visit the WIREs website. PMID:27240056

  7. The gene of an archaeal α-l-fucosidase is expressed by translational frameshifting

    PubMed Central

    Cobucci-Ponzano, Beatrice; Conte, Fiorella; Benelli, Dario; Londei, Paola; Flagiello, Angela; Monti, Maria; Pucci, Piero; Rossi, Mosè; Moracci, Marco

    2006-01-01

    The standard rules of genetic translational decoding are altered in specific genes by different events that are globally termed recoding. In Archaea recoding has been unequivocally determined so far only for termination codon readthrough events. We study here the mechanism of expression of a gene encoding for a α-l-fucosidase from the archaeon Sulfolobus solfataricus (fucA1), which is split in two open reading frames separated by a −1 frameshifting. The expression in Escherichia coli of the wild-type split gene led to the production by frameshifting of full-length polypeptides with an efficiency of 5%. Mutations in the regulatory site where the shift takes place demonstrate that the expression in vivo occurs in a programmed way. Further, we identify a full-length product of fucA1 in S.solfataricus extracts, which translate this gene in vitro by following programmed −1 frameshifting. This is the first experimental demonstration that this kind of recoding is present in Archaea. PMID:16920738

  8. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein.

    PubMed

    Fang, Ying; Treffers, Emmely E; Li, Yanhua; Tas, Ali; Sun, Zhi; van der Meer, Yvonne; de Ru, Arnoud H; van Veelen, Peter A; Atkins, John F; Snijder, Eric J; Firth, Andrew E

    2012-10-23

    Programmed -1 ribosomal frameshifting (-1 PRF) is a gene-expression mechanism used to express many viral and some cellular genes. In contrast, efficient natural utilization of -2 PRF has not been demonstrated previously in eukaryotic systems. Like all nidoviruses, members of the Arteriviridae (a family of positive-stranded RNA viruses) express their replicase polyproteins pp1a and pp1ab from two long ORFs (1a and 1b), where synthesis of pp1ab depends on -1 PRF. These polyproteins are posttranslationally cleaved into at least 13 functional nonstructural proteins. Here we report that porcine reproductive and respiratory syndrome virus (PRRSV), and apparently most other arteriviruses, use an additional PRF mechanism to access a conserved alternative ORF that overlaps the nsp2-encoding region of ORF1a in the +1 frame. We show here that this ORF is translated via -2 PRF at a conserved G_GUU_UUU sequence (underscores separate ORF1a codons) at an estimated efficiency of around 20%, yielding a transframe fusion (nsp2TF) with the N-terminal two thirds of nsp2. Expression of nsp2TF in PRRSV-infected cells was verified using specific Abs, and the site and direction of frameshifting were determined via mass spectrometric analysis of nsp2TF. Further, mutagenesis showed that the frameshift site and an unusual frameshift-stimulatory element (a conserved CCCANCUCC motif 11 nucleotides downstream) are required to direct efficient -2 PRF. Mutations preventing nsp2TF expression impair PRRSV replication and produce a small-plaque phenotype. Our findings demonstrate that -2 PRF is a functional gene-expression mechanism in eukaryotes and add another layer to the complexity of arterivirus genome expression. PMID:23043113

  9. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  10. Evolution of +1 programmed frameshifting signals and frameshift-regulating tRNAs in the order Saccharomycetales.

    PubMed

    Farabaugh, Philip J; Kramer, Emily; Vallabhaneni, Haritha; Raman, Ana

    2006-10-01

    Programmed translational frameshifting is a ubiquitous but rare mechanism of gene expression in which mRNA sequences cause the translational machinery to shift reading frames with extreme efficiency, up to at least 50%. The mRNA sequences responsible are deceptively simple; the sequence CUU-AGG-C causes about 40% frameshifting when inserted into an mRNA in the yeast Saccharomyces cerevisiae. The high efficiency of this site depends on a set of S. cerevisiae tRNA isoacceptors that perturb the mechanism of translation to cause the programmed translational error. The simplicity of the system might suggest that it could evolve frequently and perhaps be lost as easily. We have investigated the history of programmed +1 frameshifting in fungi. We find that frameshifting has persisted in two structural genes in budding yeasts, ABP140 and EST3 for about 150 million years. Further, the tRNAs that stimulate the event are equally old. Species that diverged from the lineage earlier both do not employ frameshifting and have a different complement of tRNAs predicted to be inimical to frameshifting. The stability of the coevolution of protein coding genes and tRNAs suggests that frameshifting has been selected for during the divergence of these species. PMID:16838213

  11. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency.

    PubMed

    Kontos, H; Napthine, S; Brierley, I

    2001-12-01

    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  12. Mechanisms and Implications of Programmed Translational Frameshifting

    PubMed Central

    2012-01-01

    While ribosomes must maintain translational reading frame in order to translate primary genetic information into polypeptides, cis-acting signals located on mRNAs represent higher order information content that can be used to fine tune gene expression. Classes of signals have been identified that direct a fraction of elongating ribosomes to shift reading frame by one base in the 5′ (−1) or 3′ (+1) direction. This is called programmed ribosomal frameshifting (PRF). Although mechanisms of PRF differ, a common feature is induction of ribosome pausing, which alters kinetic partitioning rates between in-frame and out-of-frame codons at specific “slippery” sequences. Many viruses use PRF to ensure synthesis of the correct ratios of virus-encoded proteins required for proper viral particle assembly and maturation, thus identifying PRF as an attractive target for antiviral therapeutics. In contrast, recent studies indicate that PRF signals may primarily function as mRNA destabilizing elements in cellular mRNAs. These studies suggest that PRF may be used to fine-tune gene expression through mRNA decay pathways. The possible regulation of PRF by non-coding RNAs is also discussed. PMID:22715123

  13. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    PubMed

    Mathew, Suneeth F; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S; McKinney, Cushla; Poole, Elizabeth S; Tate, Warren P

    2015-01-01

    HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon') contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1. PMID:25807539

  14. Transactivation of programmed ribosomal frameshifting by a viral protein.

    PubMed

    Li, Yanhua; Treffers, Emmely E; Napthine, Sawsan; Tas, Ali; Zhu, Longchao; Sun, Zhi; Bell, Susanne; Mark, Brian L; van Veelen, Peter A; van Hemert, Martijn J; Firth, Andrew E; Brierley, Ian; Snijder, Eric J; Fang, Ying

    2014-05-27

    Programmed -1 ribosomal frameshifting (-1 PRF) is a widely used translational mechanism facilitating the expression of two polypeptides from a single mRNA. Commonly, the ribosome interacts with an mRNA secondary structure that promotes -1 frameshifting on a homopolymeric slippery sequence. Recently, we described an unusual -2 frameshifting (-2 PRF) signal directing efficient expression of a transframe protein [nonstructural protein 2TF (nsp2TF)] of porcine reproductive and respiratory syndrome virus (PRRSV) from an alternative reading frame overlapping the viral replicase gene. Unusually, this arterivirus PRF signal lacks an obvious stimulatory RNA secondary structure, but as confirmed here, can also direct the occurrence of -1 PRF, yielding a third, truncated nsp2 variant named "nsp2N." Remarkably, we now show that both -2 and -1 PRF are transactivated by a protein factor, specifically a PRRSV replicase subunit (nsp1β). Embedded in nsp1β's papain-like autoproteinase domain, we identified a highly conserved, putative RNA-binding motif that is critical for PRF transactivation. The minimal RNA sequence required for PRF was mapped within a 34-nt region that includes the slippery sequence and a downstream conserved CCCANCUCC motif. Interaction of nsp1β with the PRF signal was demonstrated in pull-down assays. These studies demonstrate for the first time, to our knowledge, that a protein can function as a transactivator of ribosomal frameshifting. The newly identified frameshifting determinants provide potential antiviral targets for arterivirus disease control and prevention. Moreover, protein-induced transactivation of frameshifting may be a widely used mechanism, potentially including previously undiscovered viral strategies to regulate viral gene expression and/or modulate host cell translation upon infection. PMID:24825891

  15. Genetic analysis of the E site during RF2 programmed frameshifting

    PubMed Central

    Sanders, Christina L.; Curran, James F.

    2007-01-01

    The roles of the ribosomal E site are not fully understood. Prior evidence suggests that deacyl-tRNA in the E site can prevent frameshifting. We hypothesized that if the E-site codon must dissociate from its tRNA to allow for frameshifting, then weak codon:anticodon duplexes should allow for greater frameshifting than stronger duplexes. Using the well-characterized Escherichia coli RF2 (prfB) programmed frameshift to study frameshifting, we mutagenized the E-site triplet to all Unn and Cnn codons. Those variants should represent a very wide range of duplex stability. Duplex stability was estimated using two different methods. Frameshifting is inversely correlated with stability, as estimated by either method. These findings indicate that pairing between the deacyl-tRNA and the E-site codon opposes frameshifting. We discuss the implications of these findings on frame maintenance and on the RF2 programmed frameshift mechanism. PMID:17660276

  16. Molecular consequences of a frameshifted DLX3 mutant leading to Tricho-Dento-Osseous syndrome.

    PubMed

    Duverger, Olivier; Lee, Delia; Hassan, Mohammad Q; Chen, Susie X; Jaisser, Frederic; Lian, Jane B; Morasso, Maria I

    2008-07-18

    The homeodomain protein Distal-less-3 (Dlx3) plays a crucial role during embryonic development. This transcription factor is known to be essential for placental formation and to be involved in skin and skeletal organogenesis. In humans, a frameshift mutation in the coding sequence of the DLX3 gene results in an ectodermal dysplasia called Tricho-Dento-Osseous syndrome (TDO). The main features of this autosomal dominant disorder are defects in hair, teeth, and bone. To investigate the functional alterations caused by the mutated DLX3(TDO) isoform ex vivo, we used tetracycline-inducible osteoblastic and keratinocyte cell lines and calvarial derived osteoblasts in which the expression of DLX3(WT) and/or DLX3(TDO) could be regulated and monitored. Immunocytochemical analysis revealed that both DLX3(WT) and DLX3(TDO) recombinant proteins are targeted to the nucleus. However, as demonstrated by electrophoresis mobility shift assay, DLX3(TDO) is not able to bind to the canonical Dlx3 binding site. Furthermore, we demonstrate that the frameshifted C-terminal domain in DLX3(TDO) is accountable for the loss of DNA binding activity because the C-terminal domain in DLX3(WT) is not required for DNA binding activity. Although DLX3(TDO) alone cannot bind to a Dlx3 responsive element, when DLX3(WT) and DLX3(TDO) are co-expressed they form a complex that can bind DNA. Concomitant with the inability to bind DNA, DLX3(TDO) has a defective transcriptional activity. Moreover, the transcriptional activity of DLX3(WT) is significantly reduced in the presence of the mutated isoform, indicating that DLX3(TDO) has a dominant negative effect on DLX3(WT) transcriptional activity. PMID:18492670

  17. RNA dimerization plays a role in ribosomal frameshifting of the SARS coronavirus

    PubMed Central

    Ishimaru, Daniella; Plant, Ewan P.; Sims, Amy C.; Yount, Boyd L.; Roth, Braden M.; Eldho, Nadukkudy V.; Pérez-Alvarado, Gabriela C.; Armbruster, David W.; Baric, Ralph S.; Dinman, Jonathan D.; Taylor, Deborah R.; Hennig, Mirko

    2013-01-01

    Messenger RNA encoded signals that are involved in programmed -1 ribosomal frameshifting (-1 PRF) are typically two-stemmed hairpin (H)-type pseudoknots (pks). We previously described an unusual three-stemmed pseudoknot from the severe acute respiratory syndrome (SARS) coronavirus (CoV) that stimulated -1 PRF. The conserved existence of a third stem–loop suggested an important hitherto unknown function. Here we present new information describing structure and function of the third stem of the SARS pseudoknot. We uncovered RNA dimerization through a palindromic sequence embedded in the SARS-CoV Stem 3. Further in vitro analysis revealed that SARS-CoV RNA dimers assemble through ‘kissing’ loop–loop interactions. We also show that loop–loop kissing complex formation becomes more efficient at physiological temperature and in the presence of magnesium. When the palindromic sequence was mutated, in vitro RNA dimerization was abolished, and frameshifting was reduced from 15 to 5.7%. Furthermore, the inability to dimerize caused by the silent codon change in Stem 3 of SARS-CoV changed the viral growth kinetics and affected the levels of genomic and subgenomic RNA in infected cells. These results suggest that the homodimeric RNA complex formed by the SARS pseudoknot occurs in the cellular environment and that loop–loop kissing interactions involving Stem 3 modulate -1 PRF and play a role in subgenomic and full-length RNA synthesis. PMID:23275571

  18. Genome-Wide Scan Reveals Mutation Associated with Melanoma

    MedlinePlus

    ... 1999 Spotlight on Research 2012 July 2012 (historical) Genome-Wide Scan Reveals Mutation Associated with Melanoma A ... out to see if a technology called whole genome sequencing would help them find other genetic risk ...

  19. SAR digital spotlight implementation in MATLAB

    NASA Astrophysics Data System (ADS)

    Dungan, Kerry E.; Gorham, LeRoy A.; Moore, Linda J.

    2013-05-01

    Legacy synthetic aperture radar (SAR) exploitation algorithms were image-based algorithms, designed to exploit complex and/or detected SAR imagery. In order to improve the efficiency of the algorithms, image chips, or region of interest (ROI) chips, containing candidate targets were extracted. These image chips were then used directly by exploitation algorithms for the purposes of target discrimination or identification. Recent exploitation research has suggested that performance can be improved by processing the underlying phase history data instead of standard SAR imagery. Digital Spotlighting takes the phase history data of a large image and extracts the phase history data corresponding to a smaller spatial subset of the image. In a typical scenario, this spotlighted phase history data will contain much fewer samples than the original data but will still result in an alias-free image of the ROI. The Digital Spotlight algorithm can be considered the first stage in a "two-stage backprojection" image formation process. As the first stage in two-stage backprojection, Digital Spotlighting filters the original phase history data into a number of "pseudo"-phase histories that segment the scene into patches, each of which contain a reduced number of samples compared to the original data. The second stage of the imaging process consists of standard backprojection. The data rate reduction offered by Digital Spotlighting improves the computational efficiency of the overall imaging process by significantly reducing the total number of backprojection operations. This paper describes the Digital Spotlight algorithm in detail and provides an implementation in MATLAB.

  20. A cryptic melibiose transporter gene possessing a frameshift from Citrobacter freundii.

    PubMed

    Shimamoto, T; Shimamoto, T; Xu, X J; Okazaki, N; Kawakami, H; Tsuchiya, T

    2001-04-01

    Wild-type Citrobacter freundii cannot grow on melibiose as a sole source of carbon. The melibiose transporter gene melB was cloned from a C. freundii mutant M4 that could utilize melibiose as a sole carbon source. Although the cloned melB gene is closely similar to the melB genes of other bacteria, it is cryptic because of a frameshift mutation. Site-directed mutagenesis was used to construct a functional melB gene by deleting one nucleotide, resulting in the production of an active melibiose transporter. The active MelB transporter could utilize Na(+) and H(+) as coupling cations to melibiose transport. The amino acid sequence of the C. freundii MelB was found to be most similar to those of Salmonella typhimurium and Escherichia coli MelB. These facts are consistent with the phylogenetic relationship of bacteria and the cation coupling properties of the melibiose transporters. PMID:11275561

  1. Spotlight on Making Music with Special Learners

    ERIC Educational Resources Information Center

    Rowman & Littlefield Education, 2004

    2004-01-01

    The newest publication in the Spotlight series, this book gathers articles from state music educators association journals that give music teachers ideas on how to include special needs students, discuss why special learners benefit from music education, offer suggestions for dealing with specific types of special needs students, and address…

  2. Transfer, Honors and Excellence: Six Districts Spotlighted.

    ERIC Educational Resources Information Center

    CSCC Bulletin, 1982

    1982-01-01

    Brief descriptions are provided of the honors programs offered at six community college districts. After an introductory discussion of the benefits, goals, and elements of honors programs, spotlighted programs are described, with some variation, in terms of activities, admissions requirements, academic standards, faculty involvement, association…

  3. Spotlight on Transition to Teaching Music

    ERIC Educational Resources Information Center

    MENC: The National Association for Music Education, 2004

    2004-01-01

    The latest title in the popular Spotlight series, this timely book focuses on issues involving recruitment and retention of music teachers, a crucial issue in these days of budget constraints. Arranged chronologically, it features a collection of articles from state journals focusing on issues such as mentoring, teacher shortages, burnout, and…

  4. An Expanded CAG Repeat in Huntingtin Causes +1 Frameshifting.

    PubMed

    Saffert, Paul; Adamla, Frauke; Schieweck, Rico; Atkins, John F; Ignatova, Zoya

    2016-08-26

    Maintenance of triplet decoding is crucial for the expression of functional protein because deviations either into the -1 or +1 reading frames are often non-functional. We report here that expression of huntingtin (Htt) exon 1 with expanded CAG repeats, implicated in Huntington pathology, undergoes a sporadic +1 frameshift to generate from the CAG repeat a trans-frame AGC repeat-encoded product. This +1 recoding is exclusively detected in pathological Htt variants, i.e. those with expanded repeats with more than 35 consecutive CAG codons. An atypical +1 shift site, UUC C at the 5' end of CAG repeats, which has some resemblance to the influenza A virus shift site, triggers the +1 frameshifting and is enhanced by the increased propensity of the expanded CAG repeats to form a stem-loop structure. The +1 trans-frame-encoded product can directly influence the aggregation of the parental Htt exon 1. PMID:27382061

  5. Programmed -1 frameshifting by kinetic partitioning during impeded translocation.

    PubMed

    Caliskan, Neva; Katunin, Vladimir I; Belardinelli, Riccardo; Peske, Frank; Rodnina, Marina V

    2014-06-19

    Programmed -1 ribosomal frameshifting (-1PRF) is an mRNA recoding event utilized by cells to enhance the information content of the genome and to regulate gene expression. The mechanism of -1PRF and its timing during translation elongation are unclear. Here, we identified the steps that govern -1PRF by following the stepwise movement of the ribosome through the frameshifting site of a model mRNA derived from the IBV 1a/1b gene in a reconstituted in vitro translation system from Escherichia coli. Frameshifting occurs at a late stage of translocation when the two tRNAs are bound to adjacent slippery sequence codons of the mRNA. The downstream pseudoknot in the mRNA impairs the closing movement of the 30S subunit head, the dissociation of EF-G, and the release of tRNA from the ribosome. The slippage of the ribosome into the -1 frame accelerates the completion of translocation, thereby further favoring translation in the new reading frame. PMID:24949973

  6. A nucleotide deletion and frame-shift cause analbuminemia in a Turkish family.

    PubMed

    Caridi, Gianluca; Gulec, Elif Yilmaz; Campagnoli, Monica; Lugani, Francesca; Onal, Hasan; Kilic, Duzgun; Galliano, Monica; Minchiotti, Lorenzo

    2016-01-01

    Congenital analbuminemia is an autosomal recessive disorder, in which albumin, the major blood protein, is present only in a minute amount. The condition is a rare allelic heterogeneous defect, only about seventy cases have been reported worldwide. To date, more than twenty different mutations within the albumin gene have been found to cause the trait. In our continuing study of the molecular genetics of congenital analbuminemia, we report here the clinical and biochemical findings and the mutation analysis of the gene in two Turkish infants. For the molecular analysis, we used our strategy, based on the screening of the gene by single-strand conformation polymorphism, heteroduplex analysis and direct DNA sequencing. The results showed that both patients are homozygous for the deletion of a cytosine residue in exon 5, in a stretch of four cytosines starting from nucleotide position 524 and ending at position 527 (NM_000477.5(ALB):c.527delC). The subsequent frame-shift inserts a stop codon in position 215, markedly reducing the size of the predicted protein product. The parents are both heterozygous for the same mutation, for which we propose the name Erzurum from the city of origin of the family. In conclusion, our results show that in this family congenital analbuminemia is caused by a novel frame-shift/deletion defect, confirm the inheritance of the trait, and contribute to advance our understanding of the molecular basis underlying this condition. PMID:27346974

  7. A nucleotide deletion and frame-shift cause analbuminemia in a Turkish family

    PubMed Central

    Caridi, Gianluca; Gulec, Elif Yilmaz; Campagnoli, Monica; Lugani, Francesca; Onal, Hasan; Kilic, Duzgun; Galliano, Monica; Minchiotti, Lorenzo

    2016-01-01

    Congenital analbuminemia is an autosomal recessive disorder, in which albumin, the major blood protein, is present only in a minute amount. The condition is a rare allelic heterogeneous defect, only about seventy cases have been reported worldwide. To date, more than twenty different mutations within the albumin gene have been found to cause the trait. In our continuing study of the molecular genetics of congenital analbuminemia, we report here the clinical and biochemical findings and the mutation analysis of the gene in two Turkish infants. For the molecular analysis, we used our strategy, based on the screening of the gene by single-strand conformation polymorphism, heteroduplex analysis and direct DNA sequencing. The results showed that both patients are homozygous for the deletion of a cytosine residue in exon 5, in a stretch of four cytosines starting from nucleotide position 524 and ending at position 527 (NM_000477.5(ALB):c.527delC). The subsequent frame-shift inserts a stop codon in position 215, markedly reducing the size of the predicted protein product. The parents are both heterozygous for the same mutation, for which we propose the name Erzurum from the city of origin of the family. In conclusion, our results show that in this family congenital analbuminemia is caused by a novel frame-shift/deletion defect, confirm the inheritance of the trait, and contribute to advance our understanding of the molecular basis underlying this condition. PMID:27346974

  8. FSscan: a mechanism-based program to identify +1 ribosomal frameshift hotspots

    PubMed Central

    Liao, Pei-Yu; Choi, Yong Seok; Lee, Kelvin H.

    2009-01-01

    In +1 programmed ribosomal frameshifting (PRF), ribosomes skip one nucleotide toward the 3′-end during translation. Most of the genes known to demonstrate +1 PRF have been discovered by chance or by searching homologous genes. Here, a bioinformatic framework called FSscan is developed to perform a systematic search for potential +1 frameshift sites in the Escherichia coli genome. Based on a current state of the art understanding of the mechanism of +1 PRF, FSscan calculates scores for a 16-nt window along a gene sequence according to different effects of the stimulatory signals, and ribosome E-, P- and A-site interactions. FSscan successfully identified the +1 PRF site in prfB and predicted yehP, pepP, nuoE and cheA as +1 frameshift candidates in the E. coli genome. Empirical results demonstrated that potential +1 frameshift sequences identified promoted significant levels of +1 frameshifting in vivo. Mass spectrometry analysis confirmed the presence of the frameshifted proteins expressed from a yehP-egfp fusion construct. FSscan allows a genome-wide and systematic search for +1 frameshift sites in E. coli. The results have implications for bioinformatic identification of novel frameshift proteins, ribosomal frameshifting, coding sequence detection and the application of mass spectrometry on studying frameshift proteins. PMID:19783813

  9. Dystrophin in frameshift deletion patients with Becker Muscular Dystrophy

    SciTech Connect

    Gangopadhyay, S.B.; Ray, P.N.; Worton, R.G.; Sherratt, T.G.; Heckmatt, J.Z.; Dubowitz, V.; Strong, P.N.; Miller, G. ); Shokeir, M. )

    1992-09-01

    In a previous study the authors identified 14 cases with Duchenne muscular dystrophy (DMD) or its milder variant, Becker muscular dystrophy (BMD), with a deletion of exons 3-7, a deletion that would be expected to shift the translational reading frame of the mRNA and give a severe phenotype. They have examined dystrophin and its mRNA from muscle biopsies of seven cases with either mild or intermediate phenotypes. In all cases they detected slightly lower-molecular-weight dystrophin in 12%-15% abundance relative to the normal. By sequencing amplified mRNA they have found that exon 2 is spliced to exon 8, a splice that produces a frameshifted mRNA, and have found no evidence for alternate splicing that might be involved in restoration of dystrophin mRNA reading frame in the patients with a mild phenotype. Other transcriptional and posttranscriptional mechanisms such as cryptic promoter, ribosomal frameshifting, and reinitiation are suggested that might play some role in restoring the reading frame. 34 refs., 5 figs. 1 tab.

  10. High frequency of +1 programmed ribosomal frameshifting in Euplotes octocarinatus

    PubMed Central

    Wang, Ruanlin; Xiong, Jie; Wang, Wei; Miao, Wei; Liang, Aihua

    2016-01-01

    Programmed −1 ribosomal frameshifting (−1 PRF) has been identified as a mechanism to regulate the expression of many viral genes and some cellular genes. The slippery site of −1 PRF has been well characterized, whereas the +1 PRF signal and the mechanism involved in +1 PRF remain poorly understood. Previous study confirmed that +1 PRF is required for the synthesis of protein products in several genes of ciliates from the genus Euplotes. To accurately assess the frequency of genes requiring frameshift in Euplotes, the macronuclear genome and transcriptome of Euplotes octocarinatus were analyzed in this study. A total of 3,700 +1 PRF candidate genes were identified from 32,353 transcripts, and the gene products of these putative +1 PRFs were mainly identified as protein kinases. Furthermore, we reported a putative suppressor tRNA of UAA which may provide new insights into the mechanism of +1 PRF in euplotids. For the first time, our transcriptome-wide survey of +1 PRF in E. octocarinatus provided a dataset which serves as a valuable resource for the future understanding of the mechanism underlying +1 PRF. PMID:26891713

  11. Ribosomal frameshifting and dual-target antiactivation restrict quorum-sensing–activated transfer of a mobile genetic element

    PubMed Central

    Ramsay, Joshua P.; Tester, Laura G. L.; Major, Anthony S.; Sullivan, John T.; Edgar, Christina D.; Kleffmann, Torsten; Patterson-House, Jackson R.; Hall, Drew A.; Tate, Warren P.; Hynes, Michael F.; Ronson, Clive W.

    2015-01-01

    Symbiosis islands are integrative and conjugative mobile genetic elements that convert nonsymbiotic rhizobia into nitrogen-fixing symbionts of leguminous plants. Excision of the Mesorhizobium loti symbiosis island ICEMlSymR7A is indirectly activated by quorum sensing through TraR-dependent activation of the excisionase gene rdfS. Here we show that a +1 programmed ribosomal frameshift (PRF) fuses the coding sequences of two TraR-activated genes, msi172 and msi171, producing an activator of rdfS expression named Frameshifted excision activator (FseA). Mass-spectrometry and mutational analyses indicated that the PRF occurred through +1 slippage of the tRNAphe from UUU to UUC within a conserved msi172-encoded motif. FseA activated rdfS expression in the absence of ICEMlSymR7A, suggesting that it directly activated rdfS transcription, despite being unrelated to any characterized DNA-binding proteins. Bacterial two-hybrid and gene-reporter assays demonstrated that FseA was also bound and inhibited by the ICEMlSymR7A-encoded quorum-sensing antiactivator QseM. Thus, activation of ICEMlSymR7A excision is counteracted by TraR antiactivation, ribosomal frameshifting, and FseA antiactivation. This robust suppression likely dampens the inherent biological noise present in the quorum-sensing autoinduction circuit and ensures that ICEMlSymR7A transfer only occurs in a subpopulation of cells in which both qseM expression is repressed and FseA is translated. The architecture of the ICEMlSymR7A transfer regulatory system provides an example of how a set of modular components have assembled through evolution to form a robust genetic toggle that regulates gene transcription and translation at both single-cell and cell-population levels. PMID:25787256

  12. Efficient sliding spotlight SAR raw signal simulation of extended scenes

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Huang, Pingping; Deng, Yunkai

    2011-12-01

    Sliding spotlight mode is a novel synthetic aperture radar (SAR) imaging scheme with an achieved azimuth resolution better than stripmap mode and ground coverage larger than spotlight configuration. However, its raw signal simulation of extended scenes may not be efficiently implemented in the two-dimensional (2D) Fourier transformed domain. This article presents a novel sliding spotlight raw signal simulation approach from the wide-beam SAR imaging modes. This approach can generate sliding spotlight raw signal not only from raw data evaluated by the simulators, but also from real data in the stripmap/spotlight mode. In order to obtain the desired raw data from conventional stripmap/spotlight mode, the azimuth time-varying filtering, which is implemented by de-rotation and low-pass filtering, is adopted. As raw signal of extended scenes in the stripmap/spotlight mode can efficiently be evaluated in the 2D Fourier domain, the proposed approach provides an efficient sliding spotlight SAR simulator of extended scenes. Simulation results validate this efficient simulator.

  13. The Learning Management System Evolution. CDS Spotlight Report. Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service (CDS) to better understand how higher education institutions approach learning management systems (LMSs). Information provided for this Spotlight was derived from Module 8 of the Core Data Service, which contains several questions regarding information systems and applications.…

  14. Spotlight on Technology in Education. No. 7 in the Harvard Education Letter Spotlight Series

    ERIC Educational Resources Information Center

    Walser, Nancy, Ed.

    2011-01-01

    This edited volume covers the range of critical trends in the use of computers and other devices for classroom teaching, online learning, professional development, school improvement, and student assessment. "Spotlight on Technology in Education" draws on expert sources including teacher-leaders, librarians, researchers, and trainers who share…

  15. Spotlight on Student Engagement, Motivation, and Achievement. No. 5 in the Harvard Education Letter Spotlight Series

    ERIC Educational Resources Information Center

    Chauncey, Caroline T., Ed.; Walser, Nancy, Ed.

    2009-01-01

    Only when students feel engaged both socially and academically can schools and teachers lay the groundwork to motivate achievement. This volume, the fifth in the "Harvard Education Letter" Spotlight series, brings together fifteen seminal articles that examine research and practice on these complex and interrelated issues. Contributors include:…

  16. Activity Suppression Behavior Phenotype in SULT4A1 Frameshift Mutant Zebrafish.

    PubMed

    Crittenden, Frank; Thomas, Holly R; Parant, John M; Falany, Charles N

    2015-07-01

    Since its identification in 2000, sulfotransferase (SULT) 4A1 has presented an enigma to the field of cytosolic SULT biology. SULT4A1 is exclusively expressed in neural tissue, is highly conserved, and has been identified in every vertebrate studied to date. Despite this singular level of conservation, no substrate or function for SULT4A1 has been identified. Previous studies demonstrated that SULT4A1 does not bind the obligate sulfate donor, 3'-phosphoadenosine-5'-phosphosulfate, yet SULT4A1 is classified as a SULT superfamily member based on sequence and structural similarities to the other SULTs. In this study, transcription activator-like effector nucleases were used to generate heritable mutations in the SULT4A1 gene of zebrafish. The mutation (SULT4A1(Δ8)) consists of an 8-nucleotide deletion within the second exon of the gene, resulting in a frameshift mutation and premature stop codon after 132 AA. During early adulthood, casual observations were made that mutant zebrafish were exhibiting excessively sedentary behavior during the day. These observations were inconsistent with published reports on activity in zebrafish that are largely diurnal organisms and are highly active during the day. Thus, a decrease in activity during the day represents an abnormal behavior and warranted further systematic analysis. EthoVision video tracking software was used to monitor activity levels in wild-type (WT) and SULT4A1(Δ8/Δ8) fish over 48 hours of a normal light/dark cycle. SULT4A1(Δ8/Δ8) fish were shown to exhibit increased inactivity bout length and frequency as well as a general decrease in daytime activity levels when compared with their WT counterparts. PMID:25934576

  17. Activity Suppression Behavior Phenotype in SULT4A1 Frameshift Mutant Zebrafish

    PubMed Central

    Crittenden, Frank; Thomas, Holly R.; Parant, John M.

    2015-01-01

    Since its identification in 2000, sulfotransferase (SULT) 4A1 has presented an enigma to the field of cytosolic SULT biology. SULT4A1 is exclusively expressed in neural tissue, is highly conserved, and has been identified in every vertebrate studied to date. Despite this singular level of conservation, no substrate or function for SULT4A1 has been identified. Previous studies demonstrated that SULT4A1 does not bind the obligate sulfate donor, 3′-phosphoadenosine-5′-phosphosulfate, yet SULT4A1 is classified as a SULT superfamily member based on sequence and structural similarities to the other SULTs. In this study, transcription activator-like effector nucleases were used to generate heritable mutations in the SULT4A1 gene of zebrafish. The mutation (SULT4A1Δ8) consists of an 8-nucleotide deletion within the second exon of the gene, resulting in a frameshift mutation and premature stop codon after 132 AA. During early adulthood, casual observations were made that mutant zebrafish were exhibiting excessively sedentary behavior during the day. These observations were inconsistent with published reports on activity in zebrafish that are largely diurnal organisms and are highly active during the day. Thus, a decrease in activity during the day represents an abnormal behavior and warranted further systematic analysis. EthoVision video tracking software was used to monitor activity levels in wild-type (WT) and SULT4A1Δ8/Δ8 fish over 48 hours of a normal light/dark cycle. SULT4A1Δ8/Δ8 fish were shown to exhibit increased inactivity bout length and frequency as well as a general decrease in daytime activity levels when compared with their WT counterparts. PMID:25934576

  18. Programmed Ribosomal Frameshifting Mediates Expression of the α-Carboxysome.

    PubMed

    Chaijarasphong, Thawatchai; Nichols, Robert J; Kortright, Kaitlyn E; Nixon, Charlotte F; Teng, Poh K; Oltrogge, Luke M; Savage, David F

    2016-01-16

    Many bacteria employ a protein organelle, the carboxysome, to catalyze carbon dioxide fixation in the Calvin Cycle. Only 10 genes from Halothiobacillus neapolitanus are sufficient for heterologous expression of carboxysomes in Escherichia coli, opening the door to detailed mechanistic analysis of the assembly process of this complex (more than 200MDa). One of these genes, csoS2, has been implicated in assembly but ascribing a molecular function is confounded by the observation that the single csoS2 gene yields expression of two gene products and both display an apparent molecular weight incongruent with the predicted amino acid sequence. Here, we elucidate the co-translational mechanism responsible for the expression of the two protein isoforms. Specifically, csoS2 was found to possess -1 frameshifting elements that lead to the production of the full-length protein, CsoS2B, and a truncated protein, CsoS2A, which possesses a C-terminus translated from the alternate frame. The frameshifting elements comprise both a ribosomal slippery sequence and a 3' secondary structure, and ablation of either sequence is sufficient to eliminate the slip. Using these mutants, we investigated the individual roles of CsoS2B and CsoS2A on carboxysome formation. In this in vivo formation assay, cells expressing only the CsoS2B isoform were capable of producing intact carboxysomes, while those with only CsoS2A were not. Thus, we have answered a long-standing question about the nature of CsoS2 in this model microcompartment and demonstrate that CsoS2B is functionally distinct from CsoS2A in the assembly of α-carboxysomes. PMID:26608811

  19. Nuclear Fuels & Materials Spotlight Volume 4

    SciTech Connect

    I. J. van Rooyen,; T. M. Lillo; Y. Q. WU; P.A. Demkowicz; L. Scott; D.M. Scates; E. L. Reber; J. H. Jackson; J. A. Smith; D.L. Cottle; B.H. Rabin; M.R. Tonks; S.B. Biner; Y. Zhang; R.L. Williamson; S.R. Novascone; B.W. Spencer; J.D. Hales; D.R. Gaston; C.J. Permann; D. Anders; S.L. Hayes; P.C. Millett; D. Andersson; C. Stanek; R. Ali; S.L. Garrett; J.E. Daw; J.L. Rempe; J. Palmer; B. Tittmann; B. Reinhardt; G. Kohse; P. Ramuhali; H.T. Chien; T. Unruh; B.M. Chase; D.W. Nigg; G. Imel; J. T. Harris

    2014-04-01

    As the nation's nuclear energy laboratory, Idaho National Laboratory brings together talented people and specialized nuclear research capability to accomplish our mission. This edition of the Nuclear Fuels and Materials Division Spotlight provides an overview of some of our recent accomplishments in research and capability development. These accomplishments include: • The first identification of silver and palladium migrating through the SiC layer in TRISO fuel • A description of irradiation assisted stress corrosion testing capabilities that support commercial light water reactor life extension • Results of high-temperature safety testing on coated particle fuels irradiated in the ATR • New methods for testing the integrity of irradiated plate-type reactor fuel • Description of a 'Smart Fuel' concept that wirelessly provides real time information about changes in nuclear fuel properties and operating conditions • Development and testing of ultrasonic transducers and real-time flux sensors for use inside reactor cores, and • An example of a capsule irradiation test. Throughout Spotlight, you'll find examples of productive partnerships with academia, industry, and government agencies that deliver high-impact outcomes. The work conducted at Idaho National Laboratory helps to spur innovation in nuclear energy applications that drive economic growth and energy security. We appreciate your interest in our work here at INL, and hope that you find this issue informative.

  20. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene

    PubMed Central

    Moncayo-Arlandi, Javier; Allegue, Catarina; Iglesias, Anna; Mangas, Alipio; Brugada, Ramon

    2016-01-01

    Background Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations. Methods and Results Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64) in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased), 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment. Conclusions We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures. PMID:27391596

  1. Structural and Functional Characterization of Programmed Ribosomal Frameshift Signals in West Nile Virus Strains Reveals High Structural Plasticity Among cis-Acting RNA Elements.

    PubMed

    Moomau, Christine; Musalgaonkar, Sharmishtha; Khan, Yousuf A; Jones, John E; Dinman, Jonathan D

    2016-07-22

    West Nile virus (WNV) is a prototypical emerging virus for which no effective therapeutics currently exist. WNV uses programmed -1 ribosomal frameshifting (-1 PRF) to synthesize the NS1' protein, a C terminally extended version of its non-structural protein 1, the expression of which enhances neuro-invasiveness and viral RNA abundance. Here, the NS1' frameshift signals derived from four WNV strains were investigated to better understand -1 PRF in this quasispecies. Sequences previously predicted to promote -1 PRF strongly promote this activity, but frameshifting was significantly more efficient upon inclusion of additional 3' sequence information. The observation of different rates of -1 PRF, and by inference differences in the expression of NS1', may account for the greater degrees of pathogenesis associated with specific WNV strains. Chemical modification and mutational analyses of the longer and shorter forms of the -1 PRF signals suggests dynamic structural rearrangements between tandem stem-loop and mRNA pseudoknot structures in two of the strains. A model is suggested in which this is employed as a molecular switch to fine tune the relative expression of structural to non-structural proteins during different phases of the viral replication cycle. PMID:27226636

  2. Crystal Structure of a Luteoviral RNA Pseudoknot and Model for a Minimal Ribosomal Frameshifting Motif

    SciTech Connect

    Pallan, Pradeep S.; Marshall, William S.; Harp, Joel; Jewett III, Frederic C.; Wawrzak, Zdzislaw; Brown II, Bernard A.; Rich, Alexander; Egli, Martin

    2010-03-08

    To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter. Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.

  3. The three transfer RNAs occupying the A, P and E sites on the ribosome are involved in viral programmed -1 ribosomal frameshift

    PubMed Central

    Léger, Mélissa; Dulude, Dominic; Steinberg, Sergey V.; Brakier-Gingras, Léa

    2007-01-01

    The -1 programmed ribosomal frameshifts (PRF), which are used by many viruses, occur at a heptanucleotide slippery sequence and are currently thought to involve the tRNAs interacting with the ribosomal P- and A-site codons. We investigated here whether the tRNA occupying the ribosomal E site that precedes a slippery site influences -1 PRF. Using the human immunodeficiency virus type 1 (HIV-1) frameshift region, we found that mutating the E-site codon altered the -1 PRF efficiency. When the HIV-1 slippery sequence was replaced with other viral slippery sequences, mutating the E-site codon also altered the -1 PRF efficiency. Because HIV-1 -1 PRF can be recapitulated in bacteria, we used a bacterial ribosome system to select, by random mutagenesis, 16S ribosomal RNA (rRNA) mutations that modify the expression of a reporter requiring HIV-1 -1 PRF. Three mutants were isolated, which are located in helices 21 and 22 of 16S rRNA, a region involved in translocation and E-site tRNA binding. We propose a novel model where -1 PRF is triggered by an incomplete translocation and depends not only on the tRNAs interacting with the P- and A-site codons, but also on the tRNA occupying the E site. PMID:17704133

  4. HIV-1 and Human PEG10 Frameshift Elements Are Functionally Distinct and Distinguished by Novel Small Molecule Modulators

    PubMed Central

    Sleebs, Brad E.; Lackovic, Kurt; Parisot, John P.; Moss, Rebecca M.; Crowe-McAuliffe, Caillan; Mathew, Suneeth F.; Edgar, Christina D.; Kleffmann, Torsten; Tate, Warren P.

    2015-01-01

    Frameshifting during translation of viral or in rare cases cellular mRNA results in the synthesis of proteins from two overlapping reading frames within the same mRNA. In HIV-1 the protease, reverse transcriptase, and integrase enzymes are in a second reading frame relative to the structural group-specific antigen (gag), and their synthesis is dependent upon frameshifting. This ensures that a strictly regulated ratio of structural proteins and enzymes, which is critical for HIV-1 replication and viral infectivity, is maintained during protein synthesis. The frameshift element in HIV-1 RNA is an attractive target for the development of a new class of anti HIV-1 drugs. However, a number of examples are now emerging of human genes using −1 frameshifting, such as PEG10 and CCR5. In this study we have compared the HIV-1 and PEG10 frameshift elements and shown they have distinct functional characteristics. Frameshifting occurs at several points within each element. Moreover, frameshift modulators that were isolated by high-throughput screening of a library of 114,000 lead-like compounds behaved differently with the PEG10 frameshift element. The most effective compounds affecting the HIV-1 element enhanced frameshifting by 2.5-fold at 10 μM in two different frameshift reporter assay systems. HIV-1 protease:gag protein ratio was affected by a similar amount in a specific assay of virally-infected cultured cell, but the modulation of frameshifting of the first-iteration compounds was not sufficient to show significant effects on viral infectivity. Importantly, two compounds did not affect frameshifting with the human PEG10 element, while one modestly inhibited rather than enhanced frameshifting at the human element. These studies indicate that frameshift elements have unique characteristics that may allow targeting of HIV-1 and of other viruses specifically for development of antiviral therapeutic molecules without effect on human genes like PEG10 that use the same

  5. Isoleucine starvation caused by sulfometuron methyl in Salmonella typhimurium measured by translational frameshifting.

    PubMed

    Kaplun, Alexander; Chipman, David M; Barak, Ze'ev

    2002-03-01

    The authors have developed a tool for the study of inhibitor-induced amino acid starvation in bacteria which exploits the phenomenon of translational frameshifting. The inhibition of acetohydroxyacid synthase II by the herbicide sulfometuron methyl (SMM) has complex effects on branched-chain amino acid biosynthesis. Experiments were done with Salmonella typhimurium containing a plasmid with an isoleucine codon in a 'shifty' region, prone to translational frameshifting. SMM did not cause translational frameshifting in minimal medium under conditions that inhibit growth. A 20-fold higher concentration of SMM was required to cause starvation for isoleucine, e.g. in the presence of valine. This starvation was reflected in translational frameshifting correlated with inhibition of growth. These observations support the authors' previous suggestions based on other techniques. The method used here could be generalized for the study of complex metabolic effects related to amino acids. PMID:11882705

  6. Analysis of tetra- and hepta-nucleotides motifs promoting -1 ribosomal frameshifting in Escherichia coli

    PubMed Central

    Sharma, Virag; Prère, Marie-Françoise; Canal, Isabelle; Firth, Andrew E.; Atkins, John F.; Baranov, Pavel V.; Fayet, Olivier

    2014-01-01

    Programmed ribosomal -1 frameshifting is a non-standard decoding process occurring when ribosomes encounter a signal embedded in the mRNA of certain eukaryotic and prokaryotic genes. This signal has a mandatory component, the frameshift motif: it is either a Z_ZZN tetramer or a X_XXZ_ZZN heptamer (where ZZZ and XXX are three identical nucleotides) allowing cognate or near-cognate repairing to the -1 frame of the A site or A and P sites tRNAs. Depending on the signal, the frameshifting frequency can vary over a wide range, from less than 1% to more than 50%. The present study combines experimental and bioinformatics approaches to carry out (i) a systematic analysis of the frameshift propensity of all possible motifs (16 Z_ZZN tetramers and 64 X_XXZ_ZZN heptamers) in Escherichia coli and (ii) the identification of genes potentially using this mode of expression amongst 36 Enterobacteriaceae genomes. While motif efficiency varies widely, a major distinctive rule of bacterial -1 frameshifting is that the most efficient motifs are those allowing cognate re-pairing of the A site tRNA from ZZN to ZZZ. The outcome of the genomic search is a set of 69 gene clusters, 59 of which constitute new candidates for functional utilization of -1 frameshifting. PMID:24875478

  7. Analysis of tetra- and hepta-nucleotides motifs promoting -1 ribosomal frameshifting in Escherichia coli.

    PubMed

    Sharma, Virag; Prère, Marie-Françoise; Canal, Isabelle; Firth, Andrew E; Atkins, John F; Baranov, Pavel V; Fayet, Olivier

    2014-06-01

    Programmed ribosomal -1 frameshifting is a non-standard decoding process occurring when ribosomes encounter a signal embedded in the mRNA of certain eukaryotic and prokaryotic genes. This signal has a mandatory component, the frameshift motif: it is either a Z_ZZN tetramer or a X_XXZ_ZZN heptamer (where ZZZ and XXX are three identical nucleotides) allowing cognate or near-cognate repairing to the -1 frame of the A site or A and P sites tRNAs. Depending on the signal, the frameshifting frequency can vary over a wide range, from less than 1% to more than 50%. The present study combines experimental and bioinformatics approaches to carry out (i) a systematic analysis of the frameshift propensity of all possible motifs (16 Z_ZZN tetramers and 64 X_XXZ_ZZN heptamers) in Escherichia coli and (ii) the identification of genes potentially using this mode of expression amongst 36 Enterobacteriaceae genomes. While motif efficiency varies widely, a major distinctive rule of bacterial -1 frameshifting is that the most efficient motifs are those allowing cognate re-pairing of the A site tRNA from ZZN to ZZZ. The outcome of the genomic search is a set of 69 gene clusters, 59 of which constitute new candidates for functional utilization of -1 frameshifting. PMID:24875478

  8. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use

    PubMed Central

    Atkins, John F.; Loughran, Gary; Bhatt, Pramod R.; Firth, Andrew E.; Baranov, Pavel V.

    2016-01-01

    Genetic decoding is not ‘frozen’ as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational ‘correction’ of problem or ‘savior’ indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5′ or 3′ of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3′ from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. PMID:27436286

  9. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    PubMed

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-01

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. PMID:27436286

  10. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  11. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    PubMed Central

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  12. Spacer-length dependence of programmed −1 or −2 ribosomal frameshifting on a U6A heptamer supports a role for messenger RNA (mRNA) tension in frameshifting

    PubMed Central

    Lin, Zhaoru; Gilbert, Robert J. C.; Brierley, Ian

    2012-01-01

    Programmed −1 ribosomal frameshifting is employed in the expression of a number of viral and cellular genes. In this process, the ribosome slips backwards by a single nucleotide and continues translation of an overlapping reading frame, generating a fusion protein. Frameshifting signals comprise a heptanucleotide slippery sequence, where the ribosome changes frame, and a stimulatory RNA structure, a stem–loop or RNA pseudoknot. Antisense oligonucleotides annealed appropriately 3′ of a slippery sequence have also shown activity in frameshifting, at least in vitro. Here we examined frameshifting at the U6A slippery sequence of the HIV gag/pol signal and found high levels of both −1 and −2 frameshifting with stem–loop, pseudoknot or antisense oligonucleotide stimulators. By examining −1 and −2 frameshifting outcomes on mRNAs with varying slippery sequence-stimulatory RNA spacing distances, we found that −2 frameshifting was optimal at a spacer length 1–2 nucleotides shorter than that optimal for −1 frameshifting with all stimulatory RNAs tested. We propose that the shorter spacer increases the tension on the mRNA such that when the tRNA detaches, it more readily enters the −2 frame on the U6A heptamer. We propose that mRNA tension is central to frameshifting, whether promoted by stem–loop, pseudoknot or antisense oligonucleotide stimulator. PMID:22743270

  13. Leber congenital amaurosis: from darkness to spotlight.

    PubMed

    Kaplan, Josseline

    2008-09-01

    Almost 150 years ago, Theodor Leber described a severe form of vision loss at or near birth which was later given his name. During the century that followed this description, ophthalmologists dedicated efforts to give an accurate definition of the disease but patients were neglected because of the inability of physicians to provide them with treatment. In the 90s, at the time of the Golden Age of Linkage, the first LCA locus was mapped to a human chromosome and shortly after identified as the gene for guanylate cyclase. This discovery was the spark that made the disease emerge from the shadows as illustrated by the flood of LCA genes identified in the following ten-year period. During the same time period, the clinical variability of the disease was rediscovered and an unexpected physiopathological heterogeneity demonstrated. In the beginning of the third millennium, LCA came out definitively from the tunnel to shine under the bright spotlights with the RPE65 gene therapy trial that succeeded to restore vision in a dog model and opened the door to gene therapy trials in humans. PMID:18766987

  14. Transcriptional Profile Analysis of RPGRORF15 Frameshift Mutation Identifies Novel Genes Associated with Retinal Degeneration

    PubMed Central

    Genini, Sem; Zangerl, Barbara; Slavik, Julianna; Acland, Gregory M.; Beltran, William A.

    2010-01-01

    Purpose. To identify genes and molecular mechanisms associated with photoreceptor degeneration in a canine model of XLRP caused by an RPGR exon ORF15 microdeletion. Methods. Expression profiles of mutant and normal retinas were compared by using canine retinal custom cDNA microarrays. qRT-PCR, Western blot analysis, and immunohistochemistry (IHC) were applied to selected genes, to confirm and expand the microarray results. Results. At 7 and 16 weeks, respectively, 56 and 18 transcripts were downregulated in the mutant retinas, but none were differentially expressed (DE) at both ages, suggesting the involvement of temporally distinct pathways. Downregulated genes included the known retina-relevant genes PAX6, CHML, and RDH11 at 7 weeks and CRX and SAG at 16 weeks. Genes directly or indirectly active in apoptotic processes were altered at 7 weeks (CAMK2G, NTRK2, PRKCB, RALA, RBBP6, RNF41, SMYD3, SPP1, and TUBB2C) and 16 weeks (SLC25A5 and NKAP). Furthermore, the DE genes at 7 weeks (ELOVL6, GLOD4, NDUFS4, and REEP1) and 16 weeks (SLC25A5 and TARS2) are related to mitochondrial functions. qRT-PCR of 18 genes confirmed the microarray results and showed DE of additional genes not on the array. Only GFAP was DE at 3 weeks of age. Western blot and IHC analyses also confirmed the high reliability of the transcriptomic data. Conclusions. Several DE genes were identified in mutant retinas. At 7 weeks, a combination of nonclassic anti- and proapoptosis genes appear to be involved in photoreceptor degeneration, whereas at both 7 and 16 weeks, the expression of mitochondria-related genes indicates that they may play a relevant role in the disease process. PMID:20574030

  15. TCF12 is mutated in anaplastic oligodendroglioma.

    PubMed

    Labreche, Karim; Simeonova, Iva; Kamoun, Aurélie; Gleize, Vincent; Chubb, Daniel; Letouzé, Eric; Riazalhosseini, Yasser; Dobbins, Sara E; Elarouci, Nabila; Ducray, Francois; de Reyniès, Aurélien; Zelenika, Diana; Wardell, Christopher P; Frampton, Mathew; Saulnier, Olivier; Pastinen, Tomi; Hallout, Sabrina; Figarella-Branger, Dominique; Dehais, Caroline; Idbaih, Ahmed; Mokhtari, Karima; Delattre, Jean-Yves; Huillard, Emmanuelle; Mark Lathrop, G; Sanson, Marc; Houlston, Richard S

    2015-01-01

    Anaplastic oligodendroglioma (AO) are rare primary brain tumours that are generally incurable, with heterogeneous prognosis and few treatment targets identified. Most oligodendrogliomas have chromosomes 1p/19q co-deletion and an IDH mutation. Here we analysed 51 AO by whole-exome sequencing, identifying previously reported frequent somatic mutations in CIC and FUBP1. We also identified recurrent mutations in TCF12 and in an additional series of 83 AO. Overall, 7.5% of AO are mutated for TCF12, which encodes an oligodendrocyte-related transcription factor. Eighty percent of TCF12 mutations identified were in either the bHLH domain, which is important for TCF12 function as a transcription factor, or were frameshift mutations leading to TCF12 truncated for this domain. We show that these mutations compromise TCF12 transcriptional activity and are associated with a more aggressive tumour type. Our analysis provides further insights into the unique and shared pathways driving AO. PMID:26068201

  16. TCF12 is mutated in anaplastic oligodendroglioma

    PubMed Central

    Labreche, Karim; Simeonova, Iva; Kamoun, Aurélie; Gleize, Vincent; Chubb, Daniel; Letouzé, Eric; Riazalhosseini, Yasser; Dobbins, Sara E.; Elarouci, Nabila; Ducray, Francois; de Reyniès, Aurélien; Zelenika, Diana; Wardell, Christopher P.; Frampton, Mathew; Saulnier, Olivier; Pastinen, Tomi; Hallout, Sabrina; Figarella-Branger, Dominique; Dehais, Caroline; Idbaih, Ahmed; Mokhtari, Karima; Delattre, Jean-Yves; Huillard, Emmanuelle; Mark Lathrop, G.; Sanson, Marc; Houlston, Richard S.; Adam, Clovis; Andraud, Marie; Aubriot-Lorton, Marie-Hélène; Bauchet, Luc; Beauchesne, Patrick; Blechet, Claire; Campone, Mario; Carpentier, Antoine; Carpentier, Catherine; Carpiuc, Ioana; Chenard, Marie-Pierre; Chiforeanu, Danchristian; Chinot, Olivier; Cohen-Moyal, Elisabeth; Colin, Philippe; Dam-Hieu, Phong; Desenclos, Christine; Desse, Nicolas; Dhermain, Frederic; Diebold, Marie-Danièle; Eimer, Sandrine; Faillot, Thierry; Fesneau, Mélanie; Fontaine, Denys; Gaillard, Stéphane; Gauchotte, Guillaume; Gaultier, Claude; Ghiringhelli, Francois; Godard, Joel; Marcel Gueye, Edouard; Sebastien Guillamo, Jean; Hamdi-Elouadhani, Selma; Honnorat, Jerome; Louis Kemeny, Jean; Khallil, Toufik; Jouvet, Anne; Labrousse, Francois; Langlois, Olivier; Laquerriere, Annie; Lechapt-Zalcman, Emmanuelle; Le Guérinel, Caroline; Levillain, Pierre-Marie; Loiseau, Hugues; Loussouarn, Delphine; Maurage, Claude-Alain; Menei, Philippe; Janette Motsuo Fotso, Marie; Noel, Georges; Parker, Fabrice; Peoc'h, Michel; Polivka, Marc; Quintin-Roué, Isabelle; Ramirez, Carole; Ricard, Damien; Richard, Pomone; Rigau, Valérie; Rousseau, Audrey; Runavot, Gwenaelle; Sevestre, Henri; Christine Tortel, Marie; Uro-Coste, Emmanuelle; Burel-Vandenbos, Fanny; Vauleon, Elodie; Viennet, Gabriel; Villa, Chiara; Wager, Michel

    2015-01-01

    Anaplastic oligodendroglioma (AO) are rare primary brain tumours that are generally incurable, with heterogeneous prognosis and few treatment targets identified. Most oligodendrogliomas have chromosomes 1p/19q co-deletion and an IDH mutation. Here we analysed 51 AO by whole-exome sequencing, identifying previously reported frequent somatic mutations in CIC and FUBP1. We also identified recurrent mutations in TCF12 and in an additional series of 83 AO. Overall, 7.5% of AO are mutated for TCF12, which encodes an oligodendrocyte-related transcription factor. Eighty percent of TCF12 mutations identified were in either the bHLH domain, which is important for TCF12 function as a transcription factor, or were frameshift mutations leading to TCF12 truncated for this domain. We show that these mutations compromise TCF12 transcriptional activity and are associated with a more aggressive tumour type. Our analysis provides further insights into the unique and shared pathways driving AO. PMID:26068201

  17. Spotlight on rice: an update from the Rice Division

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This short paper is a 'spotlight' on the Rice Division of the Marican Association of Cereal Chemists, International and features an update and future challenges in rice research and industry. Since rice is consumed largely as milled white rice intact kernals, size, shape, color, appearance, function...

  18. Spotlight on General Music: Teaching Toward the Standards

    ERIC Educational Resources Information Center

    Rowman & Littlefield Education, 2005

    2005-01-01

    General music teachers at all levels--elementary, middle school, and high school--will find ideas, suggestions, and lesson plans for teaching to the National Standards in this new addition to the popular Spotlight series. It includes sections on teaching each of the nine standards, as well as chapters about secondary general music, assessment, and…

  19. New England after 3 PM: Spotlight on Connecticut

    ERIC Educational Resources Information Center

    Afterschool Alliance, 2007

    2007-01-01

    "Spotlight on Connecticut" is the second installment in "New England After 3 PM". The first release in May 2006 took a look at afterschool across the region with a special focus on Massachusetts. Additional reports focusing on other states in the region will follow. For this report, the Afterschool Alliance worked with the Connecticut After…

  20. Early Childhood Teacher Institutions Listed. NCEDL Spotlights, No. 22.

    ERIC Educational Resources Information Center

    National Center for Early Development & Learning, Chapel Hill, NC.

    This issue of the NCEDL Spotlights series announces the availability of a national directory of institutions offering programs for early childhood teachers, "The National Directory of Early Childhood Teacher Preparation Institutions," published by NCEDL and the Council for Professional Recognition. The directory contains listings for nearly 1,400…

  1. Enhancement on spotlight COSMO-SkyMed SAR products

    NASA Astrophysics Data System (ADS)

    Lorusso, R.; Milillo, G.

    2015-10-01

    COSMO-SkyMed (CSK) satellites are providing images with a resolution in the meter regime using the sliding spotlight mode (SL). This is an imaging mode which can obtain better azimuth resolution at the expense of azimuth imaged area than stripmap mode .Spotlight SAR data processing is already an established topic; efficient and accurate solutions in frequency domain have been proposed over the last years. However, the assumptions of these algorithms start to be invalid when applied to high-resolution spotlight SAR data acquired in spaceborne low Earth orbit (LEO) configurations. The assumption of a hyperbolic range history is no longer accurate for sub-metric spatial resolutions due to the satellite curved orbit. Since velocity of a space-borne platform is quite uniform, a simple focusing scheme had been designed in order to handle no straight line trajectory, using both approximated and accurate ω-k focusing kernel. Moreover, when getting close to decimeter resolution (at X-band) other several effects appear; in particular the motion of the satellite during the transmission and reception of the chirp signal deteriorate the impulse response function (IRF), if not properly considered (so called stop-and-go approximation). This paper shows that also CSK SL SAR data, with a resolution close to 1 meter, are not immune to disturbance effects when the stop-and-go approximation is assumed. The ω-k algorithm with satellite curved orbit handling is used to focus CSK spotlight data, and the stop-and-go approximation correction is included in the data processing chain. Experimental results with CSK spotlight data are provided to show quality enhancement on SAR standard focused products.

  2. A general strategy to inhibiting viral -1 frameshifting based on upstream attenuation duplex formation.

    PubMed

    Hu, Hao-Teng; Cho, Che-Pei; Lin, Ya-Hui; Chang, Kung-Yao

    2016-01-01

    Viral -1 programmed ribosomal frameshifting (PRF) as a potential antiviral target has attracted interest because many human viral pathogens, including human immunodeficiency virus (HIV) and coronaviruses, rely on -1 PRF for optimal propagation. Efficient eukaryotic -1 PRF requires an optimally placed stimulator structure downstream of the frameshifting site and different strategies targeting viral -1 PRF stimulators have been developed. However, accessing particular -1 PRF stimulator information represents a bottle-neck in combating the emerging epidemic viral pathogens such as Middle East respiratory syndrome coronavirus (MERS-CoV). Recently, an RNA hairpin upstream of frameshifting site was shown to act as a cis-element to attenuate -1 PRF with mechanism unknown. Here, we show that an upstream duplex formed in-trans, by annealing an antisense to its complementary mRNA sequence upstream of frameshifting site, can replace an upstream hairpin to attenuate -1 PRF efficiently. This finding indicates that the formation of a proximal upstream duplex is the main determining factor responsible for -1 PRF attenuation and provides mechanistic insight. Additionally, the antisense-mediated upstream duplex approach downregulates -1 PRF stimulated by distinct -1 PRF stimulators, including those of MERS-CoV, suggesting its general application potential as a robust means to evaluating viral -1 PRF inhibition as soon as the sequence information of an emerging human coronavirus is available. PMID:26612863

  3. A general strategy to inhibiting viral −1 frameshifting based on upstream attenuation duplex formation

    PubMed Central

    Hu, Hao-Teng; Cho, Che-Pei; Lin, Ya-Hui; Chang, Kung-Yao

    2016-01-01

    Viral −1 programmed ribosomal frameshifting (PRF) as a potential antiviral target has attracted interest because many human viral pathogens, including human immunodeficiency virus (HIV) and coronaviruses, rely on −1 PRF for optimal propagation. Efficient eukaryotic −1 PRF requires an optimally placed stimulator structure downstream of the frameshifting site and different strategies targeting viral −1 PRF stimulators have been developed. However, accessing particular −1 PRF stimulator information represents a bottle-neck in combating the emerging epidemic viral pathogens such as Middle East respiratory syndrome coronavirus (MERS-CoV). Recently, an RNA hairpin upstream of frameshifting site was shown to act as a cis-element to attenuate −1 PRF with mechanism unknown. Here, we show that an upstream duplex formed in-trans, by annealing an antisense to its complementary mRNA sequence upstream of frameshifting site, can replace an upstream hairpin to attenuate −1 PRF efficiently. This finding indicates that the formation of a proximal upstream duplex is the main determining factor responsible for −1 PRF attenuation and provides mechanistic insight. Additionally, the antisense-mediated upstream duplex approach downregulates −1 PRF stimulated by distinct −1 PRF stimulators, including those of MERS-CoV, suggesting its general application potential as a robust means to evaluating viral −1 PRF inhibition as soon as the sequence information of an emerging human coronavirus is available. PMID:26612863

  4. Iron status in patients with pyruvate kinase deficiency: neonatal hyperferritinaemia associated with a novel frameshift deletion in the PKLR gene (p.Arg518fs), and low hepcidin to ferritin ratios.

    PubMed

    Mojzikova, Renata; Koralkova, Pavla; Holub, Dusan; Zidova, Zuzana; Pospisilova, Dagmar; Cermak, Jaroslav; Striezencova Laluhova, Zuzana; Indrak, Karel; Sukova, Martina; Partschova, Martina; Kucerova, Jana; Horvathova, Monika; Divoky, Vladimir

    2014-05-01

    Pyruvate kinase (PK) deficiency is an iron-loading anaemia characterized by chronic haemolysis, ineffective erythropoiesis and a requirement for blood transfusion in most cases. We studied 11 patients from 10 unrelated families and found nine different disease-causing PKLR mutations. Two of these mutations - the point mutation c.878A>T (p.Asp293Val) and the frameshift deletion c.1553delG (p.(Arg518Leufs*12)) - have not been previously described in the literature. This frameshift deletion was associated with an unusually severe phenotype involving neonatal hyperferritinaemia that is not typical of PK deficiency. No disease-causing mutations in genes associated with haemochromatosis could be found. Inappropriately low levels of hepcidin with respect to iron loading were detected in all PK-deficient patients with increased ferritin, confirming the predominant effect of accelerated erythropoiesis on hepcidin production. Although the levels of a putative hepcidin suppressor, growth differentiation factor-15, were increased in PK-deficient patients, no negative correlation with hepcidin was found. This result indicates the existence of another as-yet unidentified erythroid regulator of hepcidin synthesis in PK deficiency. PMID:24533562

  5. Birt-Hogg-Dubé syndrome: novel FLCN frameshift deletion in daughter and father with renal cell carcinomas.

    PubMed

    Näf, Ernst; Laubscher, Dominik; Hopfer, Helmut; Streit, Markus; Matyas, Gabor

    2016-01-01

    Germline mutation of the FLCN gene causes Birt-Hogg-Dubé syndrome (BHD), a rare autosomal dominant condition characterized by skin fibrofolliculomas, lung cysts, spontaneous pneumothorax and renal tumours. We identified a hitherto unreported pathogenic FLCN frameshift deletion c.563delT (p.Phe188Serfs*35) in a family of a 46-year-old woman presented with macrohematuria due to bilateral chromophobe renal carcinomas. A heritable renal cancer was suspected due to the bilaterality of the tumour and as the father of this woman had suffered from renal cancer. Initially, however, BHD was overlooked by the medical team despite the highly suggestive clinical presentation. We assume that BHD is underdiagnosed, at least partially, due to low awareness of this variable condition and to insufficient use of appropriate genetic testing. Our study indicates that BHD and FLCN testing should be routinely considered in patients with positive family or personal history of renal tumours. In addition, we demonstrate how patients and their families can play a driving role in initiating genetic diagnosis, presymptomatic testing of at-risk relatives, targeted disease management, and genetic counselling of rare diseases such as BHD. PMID:26342594

  6. Calreticulin Mutations in Myeloproliferative Neoplasms

    PubMed Central

    Lavi, Noa

    2014-01-01

    With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph−) myeloproliferative neoplasms (MPNs) in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET) and primary myelofibrosis (PMF). At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR) using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations) and recurrent 5-bp insertions (type 2 mutations) in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin) were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph− MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review. PMID:25386351

  7. Calreticulin mutations in myeloproliferative neoplasms.

    PubMed

    Lavi, Noa

    2014-10-01

    With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph(-)) myeloproliferative neoplasms (MPNs) in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET) and primary myelofibrosis (PMF). At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR) using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations) and recurrent 5-bp insertions (type 2 mutations) in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin) were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph(-) MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review. PMID:25386351

  8. A Nascent Peptide Signal Responsive to Endogenous Levels of Polyamines Acts to Stimulate Regulatory Frameshifting on Antizyme mRNA*

    PubMed Central

    Yordanova, Martina M.; Wu, Cheng; Andreev, Dmitry E.; Sachs, Matthew S.; Atkins, John F.

    2015-01-01

    The protein antizyme is a negative regulator of cellular polyamine concentrations from yeast to mammals. Synthesis of functional antizyme requires programmed +1 ribosomal frameshifting at the 3′ end of the first of two partially overlapping ORFs. The frameshift is the sensor and effector in an autoregulatory circuit. Except for Saccharomyces cerevisiae antizyme mRNA, the frameshift site alone only supports low levels of frameshifting. The high levels usually observed depend on the presence of cis-acting stimulatory elements located 5′ and 3′ of the frameshift site. Antizyme genes from different evolutionary branches have evolved different stimulatory elements. Prior and new multiple alignments of fungal antizyme mRNA sequences from the Agaricomycetes class of Basidiomycota show a distinct pattern of conservation 5′ of the frameshift site consistent with a function at the amino acid level. As shown here when tested in Schizosaccharomyces pombe and mammalian HEK293T cells, the 5′ part of this conserved sequence acts at the nascent peptide level to stimulate the frameshifting, without involving stalling detectable by toe-printing. However, the peptide is only part of the signal. The 3′ part of the stimulator functions largely independently and acts at least mostly at the nucleotide level. When polyamine levels were varied, the stimulatory effect was seen to be especially responsive in the endogenous polyamine concentration range, and this effect may be more general. A conserved RNA secondary structure 3′ of the frameshift site has weaker stimulatory and polyamine sensitizing effects on frameshifting. PMID:25998126

  9. Golden Retriever dogs with neuronal ceroid lipofuscinosis have a two-base-pair deletion and frameshift in CLN5.

    PubMed

    Gilliam, D; Kolicheski, A; Johnson, G S; Mhlanga-Mutangadura, T; Taylor, J F; Schnabel, R D; Katz, M L

    2015-01-01

    We studied a recessive, progressive neurodegenerative disease occurring in Golden Retriever siblings with an onset of signs at 15 months of age. As the disease progressed these signs included ataxia, anxiety, pacing and circling, tremors, aggression, visual impairment and localized and generalized seizures. A whole genome sequence, generated with DNA from one affected dog, contained a plausibly causal homozygous mutation: CLN5:c.934_935delAG. This mutation was predicted to produce a frameshift and premature termination codon and encode a protein variant, CLN5:p.E312Vfs*6, which would lack 39 C-terminal amino acids. Eighteen DNA samples from the Golden Retriever family members were genotyped at CLN5:c.934_935delAG. Three clinically affected dogs were homozygous for the deletion allele; whereas, the clinically normal family members were either heterozygotes (n = 11) or homozygous for the reference allele (n = 4). Among archived Golden Retrievers DNA samples with incomplete clinical records that were also genotyped at the CLN5:c.934_935delAG variant, 1053 of 1062 were homozygous for the reference allele, 8 were heterozygotes and one was a deletion-allele homozygote. When contacted, the owner of this homozygote indicated that their dog had been euthanized because of a neurologic disease that progressed similarly to that of the affected Golden Retriever siblings. We have collected and stored semen from a heterozygous Golden Retriever, thereby preserving an opportunity for us or others to establish a colony of CLN5-deficient dogs. PMID:25934231

  10. Generalized energy-aperture product limit for multi-beam and spotlight SARs

    SciTech Connect

    Karr, T.J.

    1995-12-21

    The SAR energy-aperture product limit is extended to multi-beam SARS, Spotlight and moving spotlight SARS. This fundamental limit bounds the tradeoff between energy and antenna size. The kinematic relations between design variables such as platform speed, pulse repetition frequency, beam width and area rate are analyzed in a unified framework applicable to a wide variety of SARs including strip maps, spotlights, vermer arrays and multi-beam SARS, both scanning and swept-beam. Then the energy-aperture product limit is derived from the signal-to noise requirement and the kinematic constraints. The derivation clarifies impact of multiple beams and spotlighting on SAR performance.

  11. The Evolutionary Potential of Phenotypic Mutations

    PubMed Central

    Yanagida, Hayato; Gispan, Ariel; Kadouri, Noam; Rozen, Shelly; Sharon, Michal; Barkai, Naama; Tawfik, Dan S.

    2015-01-01

    Errors in protein synthesis, so-called phenotypic mutations, are orders-of-magnitude more frequent than genetic mutations. Here, we provide direct evidence that alternative protein forms and phenotypic variability derived from translational errors paved the path to genetic, evolutionary adaptations via gene duplication. We explored the evolutionary origins of Saccharomyces cerevisiae IDP3 - an NADP-dependent isocitrate dehydrogenase mediating fatty acids ß-oxidation in the peroxisome. Following the yeast whole genome duplication, IDP3 diverged from a cytosolic ancestral gene by acquisition of a C-terminal peroxisomal targeting signal. We discovered that the pre-duplicated cytosolic IDPs are partially localized to the peroxisome owing to +1 translational frameshifts that bypass the stop codon and unveil cryptic peroxisomal targeting signals within the 3’-UTR. Exploring putative cryptic signals in all 3’-UTRs of yeast genomes, we found that other enzymes related to NADPH production such as pyruvate carboxylase 1 (PYC1) might be prone to peroxisomal localization via cryptic signals. Using laboratory evolution we found that these translational frameshifts are rapidly imprinted via genetic single base deletions occurring within the very same gene location. Further, as exemplified here, the sequences that promote translational frameshifts are also more prone to genetic deletions. Thus, genotypes conferring higher phenotypic variability not only meet immediate challenges by unveiling cryptic 3’-UTR sequences, but also boost the potential for future genetic adaptations. PMID:26244544

  12. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    NASA Technical Reports Server (NTRS)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  13. RAN translation and frameshifting as translational challenges at simple repeats of human neurodegenerative disorders

    PubMed Central

    Wojciechowska, Marzena; Olejniczak, Marta; Galka-Marciniak, Paulina; Jazurek, Magdalena; Krzyzosiak, Wlodzimierz J.

    2014-01-01

    Repeat-associated disorders caused by expansions of short sequences have been classified as coding and noncoding and are thought to be caused by protein gain-of-function and RNA gain-of-function mechanisms, respectively. The boundary between such classifications has recently been blurred by the discovery of repeat-associated non-AUG (RAN) translation reported in spinocerebellar ataxia type 8, myotonic dystrophy type 1, fragile X tremor/ataxia syndrome and C9ORF72 amyotrophic lateral sclerosis and frontotemporal dementia. This noncanonical translation requires no AUG start codon and can initiate in multiple frames of CAG, CGG and GGGGCC repeats of the sense and antisense strands of disease-relevant transcripts. RNA structures formed by the repeats have been suggested as possible triggers; however, the precise mechanism of the translation initiation remains elusive. Templates containing expansions of microsatellites have also been shown to challenge translation elongation, as frameshifting has been recognized across CAG repeats in spinocerebellar ataxia type 3 and Huntington's disease. Determining the critical requirements for RAN translation and frameshifting is essential to decipher the mechanisms that govern these processes. The contribution of unusual translation products to pathogenesis needs to be better understood. In this review, we present current knowledge regarding RAN translation and frameshifting and discuss the proposed mechanisms of translational challenges imposed by simple repeat expansions. PMID:25217582

  14. A novel role for poly(C) binding proteins in programmed ribosomal frameshifting

    PubMed Central

    Napthine, Sawsan; Treffers, Emmely E.; Bell, Susanne; Goodfellow, Ian; Fang, Ying; Firth, Andrew E.; Snijder, Eric J.; Brierley, Ian

    2016-01-01

    Translational control through programmed ribosomal frameshifting (PRF) is exploited widely by viruses and increasingly documented in cellular genes. Frameshifting is induced by mRNA secondary structures that compromise ribosome fidelity during decoding of a heptanucleotide ‘slippery’ sequence. The nsp2 PRF signal of porcine reproductive and respiratory syndrome virus is distinctive in directing both −2 and −1 PRF and in its requirement for a trans-acting protein factor, the viral replicase subunit nsp1β. Here we show that the the trans-activation of frameshifting is carried out by a protein complex composed of nsp1β and a cellular poly(C) binding protein (PCBP). From the results of in vitro translation and electrophoretic mobility shift assays, we demonstrate that a PCBP/nsp1β complex binds to a C-rich sequence downstream of the slippery sequence and here mimics the activity of a structured mRNA stimulator of PRF. This is the first description of a role for a trans-acting cellular protein in PRF. The discovery broadens the repertoire of activities associated with poly(C) binding proteins and prototypes a new class of virus–host interactions. PMID:27257056

  15. A novel role for poly(C) binding proteins in programmed ribosomal frameshifting.

    PubMed

    Napthine, Sawsan; Treffers, Emmely E; Bell, Susanne; Goodfellow, Ian; Fang, Ying; Firth, Andrew E; Snijder, Eric J; Brierley, Ian

    2016-07-01

    Translational control through programmed ribosomal frameshifting (PRF) is exploited widely by viruses and increasingly documented in cellular genes. Frameshifting is induced by mRNA secondary structures that compromise ribosome fidelity during decoding of a heptanucleotide 'slippery' sequence. The nsp2 PRF signal of porcine reproductive and respiratory syndrome virus is distinctive in directing both -2 and -1 PRF and in its requirement for a trans-acting protein factor, the viral replicase subunit nsp1β. Here we show that the the trans-activation of frameshifting is carried out by a protein complex composed of nsp1β and a cellular poly(C) binding protein (PCBP). From the results of in vitro translation and electrophoretic mobility shift assays, we demonstrate that a PCBP/nsp1β complex binds to a C-rich sequence downstream of the slippery sequence and here mimics the activity of a structured mRNA stimulator of PRF. This is the first description of a role for a trans-acting cellular protein in PRF. The discovery broadens the repertoire of activities associated with poly(C) binding proteins and prototypes a new class of virus-host interactions. PMID:27257056

  16. The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) β(0) -thalassaemia homozygotes.

    PubMed

    Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Farrell, John J; Davis, Lance; Théberge, Roger; Benson, Katherine A; Riolueang, Suchada; Viprakasit, Vip; Al-Allawi, Nasir A S; Ünal, Sule; Gümrük, Fatma; Akar, Nejat; Başak, A Nazli; Osorio, Leonor; Badens, Catherine; Pissard, Serge; Joly, Philippe; Campbell, Andrew D; Gallagher, Patrick G; Steinberg, Martin H; Forget, Bernard G; Chui, David H K

    2016-03-01

    Two 21-year old dizygotic twin men of Iraqi descent were homozygous for HBB codon 8, deletion of two nucleotides (-AA) frame-shift β(0) -thalassaemia mutation (FSC8; HBB:c25_26delAA). Both were clinically well, had splenomegaly, and were never transfused. They had mild microcytic anaemia (Hb 120-130 g/l) and 98% of their haemoglobin was fetal haemoglobin (HbF). Both were carriers of Hph α-thalassaemia mutation. On the three major HbF quantitative trait loci (QTL), the twins were homozygous for G>A HBG2 Xmn1 site at single nucleotide polymorphism (SNP) rs7482144, homozygous for 3-bp deletion HBS1L-MYB intergenic polymorphism (HMIP) at rs66650371, and heterozygous for the A>C BCL11A intron 2 polymorphism at rs766432. These findings were compared with those found in 22 other FSC8 homozygote patients: four presented with thalassaemia intermedia phenotype, and 18 were transfusion dependent. The inheritance of homozygosity for HMIP 3-bp deletion at rs66650371 and heterozygosity for Hph α-thalassaemia mutation was found in the twins and not found in any of the other 22 patients. Further studies are needed to uncover likely additional genetic variants that could contribute to the exceptionally high HbF levels and mild phenotype in these twins. PMID:26771086

  17. Identification of a novel frameshift heterozygous deletion in exon 8 of the PAX6 gene in a pedigree with aniridia.

    PubMed

    Giray Bozkaya, Ozlem; Ataman, Esra; Aksel Kilicarslan, Ozge; Cankaya, Tufan; Ulgenalp, Ayfer

    2016-09-01

    Aniridia is a congenital, panocular abnormality which is characterized by partial or complete absence of iris and various degrees of iris hypoplasia. Mutations in the PAX6 gene are found in ~90% of cases with aniridia. The human PAX6 gene is located at chromosome 11p13 and encodes a transcriptional regulator that has crucial roles in the development of the eyes, central nervous system and pancreatic islets. The present study performed a clinical and genomic analysis of two families containing multiple cases of aniridia. All exons of the PAX6 gene of the probands were sequenced using the Sanger sequencing technique. A heterozygous non‑stop mutation in exon 14 was identified in the first family, which has been previously reported for a different ophthalmological pathology. This mutation causes on‑going translation of the mRNA into the 3'‑untranslated region. In the second family, a novel frameshift heterozygous deletion in exon 8 was identified. PMID:27431685

  18. BI Reporting, Data Warehouse Systems, and Beyond. CDS Spotlight Report. Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service [CDS] to better understand how higher education institutions approach business intelligence (BI) reporting and data warehouse systems (see the Sidebar for definitions). Information provided for this Spotlight was derived from Module 8 of CDS, which contains several questions regarding…

  19. Selective spatial enhancement: Attentional spotlight size impacts spatial but not temporal perception.

    PubMed

    Goodhew, Stephanie C; Shen, Elizabeth; Edwards, Mark

    2016-08-01

    An important but often neglected aspect of attention is how changes in the attentional spotlight size impact perception. The zoom-lens model predicts that a small ("focal") attentional spotlight enhances all aspects of perception relative to a larger ("diffuse" spotlight). However, based on the physiological properties of the two major classes of visual cells (magnocellular and parvocellular neurons) we predicted trade-offs in spatial and temporal acuity as a function of spotlight size. Contrary to both of these accounts, however, across two experiments we found that attentional spotlight size affected spatial acuity, such that spatial acuity was enhanced for a focal relative to a diffuse spotlight, whereas the same modulations in spotlight size had no impact on temporal acuity. This likely reflects the function of attention: to induce the high spatial resolution of the fovea in periphery, where spatial resolution is poor but temporal resolution is good. It is adaptive, therefore, for the attentional spotlight to enhance spatial acuity, whereas enhancing temporal acuity does not confer the same benefit. PMID:27294427

  20. The Financial Management System: A Pivotal Tool for Fiscal Viability. CDS Spotlight. ECAR Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This spotlight focuses on data from the 2013 CDS to better understand how higher education institutions approach financial management systems. Information provided for this spotlight was derived from Module 8 of Core Data Service (CDS), which asked several questions regarding information systems and applications. Responses from 525 institutions…

  1. Maximize Institutional Relationships with CRMs. CDS Spotlight Report. ECAR Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service (CDS) to better understand how higher education institutions approach customer relationship management (CRM) systems. Information provided for this Spotlight was derived from Module 8 of the Core Data survey, which asked several questions regarding information systems and applications.…

  2. Programmed Ribosomal Frameshift Alters Expression of West Nile Virus Genes and Facilitates Virus Replication in Birds and Mosquitoes

    PubMed Central

    Du, Fangyao; Owens, Nick; Bosco-Lauth, Angela M.; Nagasaki, Tomoko; Rudd, Stephen; Brault, Aaron C.; Bowen, Richard A.; Hall, Roy A.; van den Hurk, Andrew F.; Khromykh, Alexander A.

    2014-01-01

    West Nile virus (WNV) is a human pathogen of significant medical importance with close to 40,000 cases of encephalitis and more than 1,600 deaths reported in the US alone since its first emergence in New York in 1999. Previous studies identified a motif in the beginning of non-structural gene NS2A of encephalitic flaviviruses including WNV which induces programmed −1 ribosomal frameshift (PRF) resulting in production of an additional NS protein NS1′. We have previously demonstrated that mutant WNV with abolished PRF was attenuated in mice. Here we have extended our previous observations by showing that PRF does not appear to have a significant role in virus replication, virion formation, and viral spread in several cell lines in vitro. However, we have also shown that PRF induces an over production of structural proteins over non-structural proteins in virus-infected cells and that mutation abolishing PRF is present in ∼11% of the wild type virus population. In vivo experiments in house sparrows using wild type and PRF mutant of New York 99 strain of WNV viruses showed some attenuation for the PRF mutant virus. Moreover, PRF mutant of Kunjin strain of WNV showed significant decrease compared to wild type virus infection in dissemination of the virus from the midgut through the haemocoel, and ultimately the capacity of infected mosquitoes to transmit virus. Thus our results demonstrate an important role for PRF in regulating expression of viral genes and consequently virus replication in avian and mosquito hosts. PMID:25375107

  3. Color uniformity in spotlights optimized with reflectors and TIR lenses.

    PubMed

    Teupner, Anne; Bergenek, Krister; Wirth, Ralph; Benítez, Pablo; Miñano, Juan Carlos

    2015-02-01

    We analyze the color uniformity in the far field of spotlight systems to estimate visual perception with a merit function derived from human factor experiments. A multi-colored light-emitting diode (LED) light engine with different light mixing levels is combined with several reflectors and total internal reflection (TIR) lenses. The optimized systems are analyzed at several color uniformity levels with regard to the efficiency, peak luminous intensity and dimensions. It is shown that these properties cannot all be optimized at the same time. Furthermore, excellent color uniformity can be reached by a light mixing layer in the light engine or by adding mixing elements to the secondary optics. PMID:25836237

  4. Salt Effects on the Thermodynamics of a Frameshifting RNA Pseudoknot under Tension.

    PubMed

    Hori, Naoto; Denesyuk, Natalia A; Thirumalai, D

    2016-07-17

    Because of the potential link between -1 programmed ribosomal frameshifting and response of a pseudoknot (PK) RNA to force, a number of single-molecule pulling experiments have been performed on PKs to decipher the mechanism of programmed ribosomal frameshifting. Motivated in part by these experiments, we performed simulations using a coarse-grained model of RNA to describe the response of a PK over a range of mechanical forces (fs) and monovalent salt concentrations (Cs). The coarse-grained simulations quantitatively reproduce the multistep thermal melting observed in experiments, thus validating our model. The free energy changes obtained in simulations are in excellent agreement with experiments. By varying f and C, we calculated the phase diagram that shows a sequence of structural transitions, populating distinct intermediate states. As f and C are changed, the stem-loop tertiary interactions rupture first, followed by unfolding of the 3'-end hairpin (I⇌F). Finally, the 5'-end hairpin unravels, producing an extended state (E⇌I). A theoretical analysis of the phase boundaries shows that the critical force for rupture scales as (logCm)(α) with α=1(0.5) for E⇌I (I⇌F) transition. This relation is used to obtain the preferential ion-RNA interaction coefficient, which can be quantitatively measured in single-molecule experiments, as done previously for DNA hairpins. A by-product of our work is the suggestion that the frameshift efficiency is likely determined by the stability of the 5'-end hairpin that the ribosome first encounters during translation. PMID:27315694

  5. Translational recoding as a feedback controller: systems approaches reveal polyamine-specific effects on the antizyme ribosomal frameshift.

    PubMed

    Rato, Claudia; Amirova, Svetlana R; Bates, Declan G; Stansfield, Ian; Wallace, Heather M

    2011-06-01

    The antizyme protein, Oaz1, regulates synthesis of the polyamines putrescine, spermidine and spermine by controlling stability of the polyamine biosynthetic enzyme, ornithine decarboxylase. Antizyme mRNA translation depends upon a polyamine-stimulated +1 ribosomal frameshift, forming a complex negative feedback system in which the translational frameshifting event may be viewed in engineering terms as a feedback controller for intracellular polyamine concentrations. In this article, we present the first systems level study of the characteristics of this feedback controller, using an integrated experimental and modeling approach. Quantitative analysis of mutant yeast strains in which polyamine synthesis and interconversion were blocked revealed marked variations in frameshift responses to the different polyamines. Putrescine and spermine, but not spermidine, showed evidence of co-operative stimulation of frameshifting and the existence of multiple ribosome binding sites. Combinatorial polyamine treatments showed polyamines compete for binding to common ribosome sites. Using concepts from enzyme kinetics and control engineering, a mathematical model of the translational controller was developed to describe these complex ribosomal responses to combinatorial polyamine effects. Each one of a range of model predictions was successfully validated against experimental frameshift frequencies measured in S-adenosylmethionine-decarboxylase and antizyme mutants, as well as in the wild-type genetic background. PMID:21303766

  6. Spotlighting quantum critical points via quantum correlations at finite temperatures

    SciTech Connect

    Werlang, T.; Ribeiro, G. A. P.; Rigolin, Gustavo

    2011-06-15

    We extend the program initiated by T. Werlang et al. [Phys. Rev. Lett. 105, 095702 (2010)] in several directions. Firstly, we investigate how useful quantum correlations, such as entanglement and quantum discord, are in the detection of critical points of quantum phase transitions when the system is at finite temperatures. For that purpose we study several thermalized spin models in the thermodynamic limit, namely, the XXZ model, the XY model, and the Ising model, all of which with an external magnetic field. We compare the ability of quantum discord, entanglement, and some thermodynamic quantities to spotlight the quantum critical points for several different temperatures. Secondly, for some models we go beyond nearest neighbors and also study the behavior of entanglement and quantum discord for second nearest neighbors around the critical point at finite temperature. Finally, we furnish a more quantitative description of how good all these quantities are in spotlighting critical points of quantum phase transitions at finite T, bridging the gap between experimental data and those theoretical descriptions solely based on the unattainable absolute zero assumption.

  7. Mutation hot spots in the canine herpesvirus thymidine kinase gene.

    PubMed

    Yamada, Shinya; Matsumoto, Yasunobu; Takashima, Yasuhiro; Otsuka, Haruki

    2005-08-01

    The guanine and cytosine content (GC-content) of alpha-herpesvirus genes are highly variable despite similar genome structures. It is known that drug resistant HSV, which has the genome with a high GC-content (approximately 70%), commonly includes frameshift mutations in homopolymer stretches of guanine (G) and cytosine (C) within the thymidine kinase (TK) gene. However, whether such mutation hotspots exist in the TK gene of canine herpesvirus (CHV) which has a low GC-content was unknown. In this study, we investigated mutations in the TK gene of CHV. CHV was passaged in the presence of iodo-deoxyuridine (IDU), and IDU-resistant clones were isolated. In all IDU-resistant virus clones, mutations in the TK gene were observed. The majority of these mutations were frameshift mutations of an adenine (A) insertion or deletion within either of 2 stretches of eight A's in the TK gene. It was demonstrated that CHV TK mutations frequently occur at a limited number of hot spots within long homopolymer nucleotide stretches. PMID:15965615

  8. Using frequency-scaling approach to process squint-mode spotlight SAR data

    NASA Astrophysics Data System (ADS)

    Sun, Jinping; Mao, Shiyi; Liu, Zhongkan; Hong, Wen Q.

    2001-08-01

    Frequency scaling approach is a new spotlight SAR image formation algorithm. It precisely performs the range cell migration correction for dechirped raw data without interpolation by using a novel frequency scaling operation while residual video phase is corrected simultaneously. The computation requirements are lower than the other spotlight SAR image formation approaches such as polar format algorithm and range migration algorithm. In this paper, frequency scaling algorithm is applied to process high squint spotlight data. The new squint illumination geometry is defined and some modifications to the basic algorithm are presented. Point target simulations up to 45 deg squint angle are carried out to show the validity of the algorithm.

  9. Bestrophin gene mutations in patients with Best vitelliform macular dystrophy.

    PubMed

    Caldwell, G M; Kakuk, L E; Griesinger, I B; Simpson, S A; Nowak, N J; Small, K W; Maumenee, I H; Rosenfeld, P J; Sieving, P A; Shows, T B; Ayyagari, R

    1999-05-15

    Best vitelliform macular dystrophy (VMD2) is an autosomal dominant dystrophy with a juvenile age of onset. Mutations in the Bestrophin gene were shown in patients affected with VMD2. In a mutation study, we made three new and interesting observations. First, we identified possible mutation hotspots within the gene, suggesting that particular regions of the protein have greater functional significance than others. Second, we described a 2-bp deletion in a part of the gene where mutations have not previously been reported; this mutation causes a frameshift and subsequent premature termination of the protein. Finally, we have evidence that some mutations are associated with variable expression of the disease, suggesting the involvement of other factors or genes in the disease phenotype. PMID:10331951

  10. Large-scale mass spectrometry-based analysis of Euplotes octocarinatus supports the high frequency of +1 programmed ribosomal frameshift

    PubMed Central

    Wang, Ruanlin; Zhang, Zhiyun; Du, Jun; Fu, Yuejun; Liang, Aihua

    2016-01-01

    Programmed ribosomal frameshifting (PRF) is commonly used to express many viral and some cellular genes. We conducted a genome-wide investigation of +1 PRF in ciliate Euplotes octocarinatus through genome and transcriptome sequencing and our results demonstrated that approximately 11.4% of genes require +1 PRF to produce complete gene products. While nucleic acid-based evidence for candidate genes with +1 PRF is strong, only very limited information is available at protein levels to date. In this study, E. octocarinatus was subjected to large-scale mass spectrometry-based analysis to verify the high frequency of +1 PRF and 226 +1 PRF gene products were identified. Based on the amino acid sequences of the peptides spanning the frameshift sites, typical frameshift motif AAA-UAR for +1 PRF in Euplotes was identified. Our data in this study provide very useful insight into the understanding of the molecular mechanism of +1 PRF. PMID:27597422

  11. Large-scale mass spectrometry-based analysis of Euplotes octocarinatus supports the high frequency of +1 programmed ribosomal frameshift.

    PubMed

    Wang, Ruanlin; Zhang, Zhiyun; Du, Jun; Fu, Yuejun; Liang, Aihua

    2016-01-01

    Programmed ribosomal frameshifting (PRF) is commonly used to express many viral and some cellular genes. We conducted a genome-wide investigation of +1 PRF in ciliate Euplotes octocarinatus through genome and transcriptome sequencing and our results demonstrated that approximately 11.4% of genes require +1 PRF to produce complete gene products. While nucleic acid-based evidence for candidate genes with +1 PRF is strong, only very limited information is available at protein levels to date. In this study, E. octocarinatus was subjected to large-scale mass spectrometry-based analysis to verify the high frequency of +1 PRF and 226 +1 PRF gene products were identified. Based on the amino acid sequences of the peptides spanning the frameshift sites, typical frameshift motif AAA-UAR for +1 PRF in Euplotes was identified. Our data in this study provide very useful insight into the understanding of the molecular mechanism of +1 PRF. PMID:27597422

  12. Stimulation of -1 programmed ribosomal frameshifting by a metabolite-responsive RNA pseudoknot.

    PubMed

    Chou, Ming-Yuan; Lin, Szu-Chieh; Chang, Kung-Yao

    2010-06-01

    Specific recognition of metabolites by functional RNA motifs within mRNAs has emerged as a crucial regulatory strategy for feedback control of biochemical reactions. Such riboswitches have been demonstrated to regulate different gene expression processes, including transcriptional termination and translational initiation in prokaryotic cells, as well as splicing in eukaryotic cells. The regulatory process is usually mediated by modulating the accessibility of specific sequence information of the expression platforms via metabolite-induced RNA conformational rearrangement. In eukaryotic systems, viral and the more limited number of cellular decoding -1 programmed ribosomal frameshifting (PRF) are commonly promoted by a 3' mRNA pseudoknot. In addition, such -1 PRF is generally constitutive rather than being regulatory, and usually results in a fixed ratio of products. We report here an RNA pseudoknot capable of stimulating -1 PRF whose efficiency can be tuned in response to the concentration of S-adenosylhomocysteine (SAH), and the improvement of its frameshifting efficiency by RNA engineering. In addition to providing an alternative approach for small-molecule regulation of gene expression in eukaryotic cells, such a metabolite-responsive pseudoknot suggests a plausible mechanism for metabolite-driven translational regulation of gene expression in eukaryotic systems. PMID:20435898

  13. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    SciTech Connect

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan; Firth, Andrew E.; Wang, David

    2014-02-15

    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

  14. APC germline mutations in families with familial adenomatous polyposis.

    PubMed

    De Queiroz Rossanese, Lillian Barbosa; De Lima Marson, Fernando Augusto; Ribeiro, José Dirceu; Coy, Claudio Saddy Rodrigues; Bertuzzo, Carmen Silvia

    2013-11-01

    Adenomatous polyposis coli (APC) germline mutations are responsible for the occurrence of familial adenomatous polyposis (FAP). Somatic mutations lead to malignant transformation of adenomas. In this context, considering the significance of APC germline mutations in FAP, we aimed to identify APC germline mutations. In the present study, 20 FAP patients were enrolled. The determination of APC germline mutations was performed using sequencing, and the mutations were compared with clinical markers (gender, age at diagnosis, smoking habits, TNM stage, Astler‑Coller stage, degree of differentiation of adenocarcinoma). The data were compared using the SPSS program, with the Fisher's exact test and χ2 test, considering α=0.05. According to the main results in our sample, 16 alleles with deleterious mutations (80% of the patients) were identified while 7 (35%) patients had no deleterious mutations. There was a predominance of nonsense (45% of the patients) and frameshift (20% of the patients) mutations. There was no statistical significance between the APC germline mutations identified and the clinical variables considered in our study. Only TNM stage was associated with the presence of deleterious mutations. Patients with deleterious mutations had an OR, 0.086 (IC=0.001-0.984); TNM stage I+II in comparison with III+IV, when compared with the patients with no deleterious mutations identified. In this context, as a conclusion, we demonstrated the molecular heterogeneity of APC germline mutations in FAP and the difficulty to perform molecular diagnostics in a Brazilian population, considering the admixed population analyzed. PMID:23970361

  15. TP53 Mutational Spectrum in Endometrioid and Serous Endometrial Cancers.

    PubMed

    Schultheis, Anne M; Martelotto, Luciano G; De Filippo, Maria R; Piscuglio, Salvatore; Ng, Charlotte K Y; Hussein, Yaser R; Reis-Filho, Jorge S; Soslow, Robert A; Weigelt, Britta

    2016-07-01

    Endometrial carcinomas (ECs) are heterogeneous at the genetic level. Although TP53 mutations are highly recurrent in serous endometrial carcinomas (SECs), these are also present in a subset of endometrioid endometrial carcinomas (EECs). Here, we sought to define the frequency, pattern, distribution, and type of TP53 somatic mutations in ECs by performing a reanalysis of the publicly available data from The Cancer Genome Atlas (TCGA). A total of 228 EECs (n=186) and SECs (n=42) from the TCGA data set, for which an integrated genomic characterization was performed, were interrogated for the presence and type of TP53 mutations, and for mutations in genes frequently mutated in ECs. TP53 mutations were found in 15% of EECs and 88% of SECs, and in 91% of copy-number-high and 35% of polymerase (DNA directed), epsilon, catalytic subunit (POLE) integrative genomic subtypes. In addition to differences in prevalence, variations in the type and pattern of TP53 mutations were observed between histologic types and between integrative genomic subtypes. TP53 hotspot mutations were significantly more frequently found in SECs (46%) than in EECs (15%). TP53-mutant EECs significantly more frequently harbored a co-occurring PTEN mutation than TP53-mutant SECs. Finally, a subset of TP53-mutant ECs (22%) was found to harbor frameshift or nonsense mutations. Given that nonsense and frameshift TP53 mutations result in distinct p53 immunohistochemical results that require careful interpretation, and that EECs and SECs display different patterns, types, and distributions of TP53 mutations, the use of the TP53/p53 status alone for the differential diagnosis of EECs and SECs may not be sufficient. PMID:26556035

  16. COSMO-SkyMed Spotlight interometry over rural areas: the Slumgullion landslide in Colorado, USA

    USGS Publications Warehouse

    Milillo, Pietro; Fielding, Eric J.; Schulz, William H.; Delbridge, Brent; Burgmann, Roland

    2014-01-01

    In the last 7 years, spaceborne synthetic aperture radar (SAR) data with resolution of better than a meter acquired by satellites in spotlight mode offered an unprecedented improvement in SAR interferometry (InSAR). Most attention has been focused on monitoring urban areas and man-made infrastructure exploiting geometric accuracy, stability, and phase fidelity of the spotlight mode. In this paper, we explore the potential application of the COSMO-SkyMed® Spotlight mode to rural areas where decorrelation is substantial and rapidly increases with time. We focus on the rapid repeat times of as short as one day possible with the COSMO-SkyMed® constellation. We further present a qualitative analysis of spotlight interferometry over the Slumgullion landslide in southwest Colorado, which moves at rates of more than 1 cm/day.

  17. The evolution of cellular deficiency in GATA2 mutation

    PubMed Central

    Dickinson, Rachel E.; Milne, Paul; Jardine, Laura; Zandi, Sasan; Swierczek, Sabina I.; McGovern, Naomi; Cookson, Sharon; Ferozepurwalla, Zaveyna; Langridge, Alexander; Pagan, Sarah; Gennery, Andrew; Heiskanen-Kosma, Tarja; Hämäläinen, Sari; Seppänen, Mikko; Helbert, Matthew; Tholouli, Eleni; Gambineri, Eleonora; Reykdal, Sigrún; Gottfreðsson, Magnús; Thaventhiran, James E.; Morris, Emma; Hirschfield, Gideon; Richter, Alex G.; Jolles, Stephen; Bacon, Chris M.; Hambleton, Sophie; Haniffa, Muzlifah; Bryceson, Yenan; Allen, Carl; Prchal, Josef T.; Dick, John E.; Bigley, Venetia

    2014-01-01

    Constitutive heterozygous GATA2 mutation is associated with deafness, lymphedema, mononuclear cytopenias, infection, myelodysplasia (MDS), and acute myeloid leukemia. In this study, we describe a cross-sectional analysis of 24 patients and 6 relatives with 14 different frameshift or substitution mutations of GATA2. A pattern of dendritic cell, monocyte, B, and natural killer (NK) lymphoid deficiency (DCML deficiency) with elevated Fms-like tyrosine kinase 3 ligand (Flt3L) was observed in all 20 patients phenotyped, including patients with Emberger syndrome, monocytopenia with Mycobacterium avium complex (MonoMAC), and MDS. Four unaffected relatives had a normal phenotype indicating that cellular deficiency may evolve over time or is incompletely penetrant, while 2 developed subclinical cytopenias or elevated Flt3L. Patients with GATA2 mutation maintained higher hemoglobin, neutrophils, and platelets and were younger than controls with acquired MDS and wild-type GATA2. Frameshift mutations were associated with earlier age of clinical presentation than substitution mutations. Elevated Flt3L, loss of bone marrow progenitors, and clonal myelopoiesis were early signs of disease evolution. Clinical progression was associated with increasingly elevated Flt3L, depletion of transitional B cells, CD56bright NK cells, naïve T cells, and accumulation of terminally differentiated NK and CD8+ memory T cells. These studies provide a framework for clinical and laboratory monitoring of patients with GATA2 mutation and may inform therapeutic decision-making. PMID:24345756

  18. Clinical features of X linked juvenile retinoschisis in Chinese families associated with novel mutations in the RS1 gene

    PubMed Central

    Ma, Xiang; Tao, Yong

    2007-01-01

    Purpose To describe the clinical phenotype of X linked juvenile retinoschisis (XLRS) in 12 Chinese families with 11 different mutations in the XLRS1 (RS1) gene. Methods Complete ophthalmic examinations were carried out in 29 affected males (12 probands), 38 heterozygous females carriers, and 100 controls. The coding regions of the RS1 gene that encodes retinoschisin were amplified by polymerase chain reaction and directly sequenced. Results Of the 29 male participants, 28 (96.6%) displayed typical foveal schisis. Eleven different RS1 mutations were identified in 12 families; four of these mutations, two frameshift mutations (26 del T of exon 1 and 488 del G of exon 5), and two missense mutations (Asp145His and Arg156Gly) of exon 5, had not been previously described. One non-disease-related polymorphism (NSP): 576C to T (Pro192Pro) change was also newly reported herein. We compared genotypes and observed more severe clinical features in families with the following mutations: frameshift mutation (26 del T) of exon 1, the splice donor site mutation (IVS1+2T to C),or Arg102Gln, Arg209His, and Arg213Gln mutations. Conclusions Severe XLRS phenotypes are associated with the frameshift mutation 26 del T, splice donor site mutation (IVS1+2T to C), and Arg102Gln, Asp145His, Arg209His, and Arg213Gln mutations. The wide variability in the phenotype in Chinese patients with XLRS and different mutations in the RS1 gene is described. Identification of mutations in the RS1 gene and expanded information on clinical manifestations will facilitate early diagnosis, appropriate early therapy, and genetic counseling regarding the prognosis of XLRS. PMID:17615541

  19. Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

    PubMed Central

    Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

    2015-01-01

    Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

  20. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    SciTech Connect

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-03-30

    Flaviviruses have a positive-sense, single-stranded RNA genome of approx11 kb, encoding a large polyprotein that is cleaved to produce approx10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  1. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and kelp fly virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Solenopsis invicta virus 3 (SINV-3) is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF) of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the stru...

  2. Legius Syndrome: two novel mutations in the SPRED1 gene

    PubMed Central

    Bianchi, Marika; Saletti, Veronica; Micheli, Roberto; Esposito, Silvia; Molinaro, Anna; Gagliardi, Stella; Orcesi, Simona; Cereda, Cristina

    2015-01-01

    The SPRED1 gene encodes a protein involved in the Ras/MAPK (mitogen-activated protein kinase) signaling pathway. Mutations in SPRED1 have been reported to cause Legius Syndrome, a rare developmental disorder that shares some clinical features with Neurofibromatosis-1. Direct sequencing was used to define SPRED1 mutations. We present two previously undescribed mutations: a frameshift mutation causing a stop codon, which was identified in an Italian family (p.Ile60Tyrfs*18) and a missense variation, which was identified in one sporadic Italian case (p.Pro422Arg). Our results led us to hypothesize that these modifications may contribute to the Legius Syndrome phenotype. Further studies will be needed to determine the roles of these mutations in the mechanisms of Legius Syndrome. PMID:27081556

  3. Changed in translation: mRNA recoding by -1 programmed ribosomal frameshifting.

    PubMed

    Caliskan, Neva; Peske, Frank; Rodnina, Marina V

    2015-05-01

    Programmed -1 ribosomal frameshifting (-1PRF) is an mRNA recoding event commonly utilized by viruses and bacteria to increase the information content of their genomes. Recent results have implicated -1PRF in quality control of mRNA and DNA stability in eukaryotes. Biophysical experiments demonstrated that the ribosome changes the reading frame while attempting to move over a slippery sequence of the mRNA--when a roadblock formed by a folded downstream segment in the mRNA stalls the ribosome in a metastable conformational state. The efficiency of -1PRF is modulated not only by cis-regulatory elements in the mRNA but also by trans-acting factors such as proteins, miRNAs, and antibiotics. These recent results suggest a molecular mechanism and new important cellular roles for -1PRF. PMID:25850333

  4. Frameshift Sequence Variants in the Human Lipase-H Gene Causing Hypotrichosis.

    PubMed

    Mehmood, Sabba; Shah, Sayed Hajan; Jan, Abid; Younus, Muhammad; Ahmad, Farooq; Ayub, Muhammad; Ahmad, Wasim

    2016-01-01

    Hypotrichosis is a condition of abnormal hair pattern characterized by sparse to absent hair on different parts of the body, including the scalp. The condition is often characterized by tightly curled woolly hairs, discoloration of hair, and development of multiple keratin filled cysts or papules on the body. Sequence analysis of the lipase H (LIPH) gene, mapped on chromosome 3q27.3, led to the identification of a novel frameshift deletion variant (c.932delC, p.Pro311Leufs*3) in one family and previously reported 2-bp deletion (c.659_660delTA) in five other families, inherited hypotrichosis, and woolly hair in an autosomal recessive pattern. The study further extends the body of evidence that sequence variants in the LIPH gene result in hypotrichosis and woolly hair phenotype. PMID:26645693

  5. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    PubMed Central

    Thyssen, Gregory N.; Fang, David D.; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D.; Condon, Tracy L.; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  6. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  7. A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1' may derive from ribosomal frameshifting

    PubMed Central

    Firth, Andrew E; Atkins, John F

    2009-01-01

    Japanese encephalitis, West Nile, Usutu and Murray Valley encephalitis viruses form a tight subgroup within the larger Flavivirus genus. These viruses utilize a single-polyprotein expression strategy, resulting in ~10 mature proteins. Plotting the conservation at synonymous sites along the polyprotein coding sequence reveals strong conservation peaks at the very 5' end of the coding sequence, and also at the 5' end of the sequence encoding the NS2A protein. Such peaks are generally indicative of functionally important non-coding sequence elements. The second peak corresponds to a predicted stable pseudoknot structure whose biological importance is supported by compensatory mutations that preserve the structure. The pseudoknot is preceded by a conserved slippery heptanucleotide (Y CCU UUU), thus forming a classical stimulatory motif for -1 ribosomal frameshifting. We hypothesize, therefore, that the functional importance of the pseudoknot is to stimulate a portion of ribosomes to shift -1 nt into a short (45 codon), conserved, overlapping open reading frame, termed foo. Since cleavage at the NS1-NS2A boundary is known to require synthesis of NS2A in cis, the resulting transframe fusion protein is predicted to be NS1-NS2AN-term-FOO. We hypothesize that this may explain the origin of the previously identified NS1 'extension' protein in JEV-group flaviviruses, known as NS1'. PMID:19196463

  8. WT1 mutations in T-ALL.

    PubMed

    Tosello, Valeria; Mansour, Marc R; Barnes, Kelly; Paganin, Maddalena; Sulis, Maria Luisa; Jenkinson, Sarah; Allen, Christopher G; Gale, Rosemary E; Linch, David C; Palomero, Teresa; Real, Pedro; Murty, Vundavalli; Yao, Xiaopan; Richards, Susan M; Goldstone, Anthony; Rowe, Jacob; Basso, Giuseppe; Wiernik, Peter H; Paietta, Elisabeth; Pieters, Rob; Horstmann, Martin; Meijerink, Jules P P; Ferrando, Adolfo A

    2009-07-30

    The molecular mechanisms involved in disease progression and relapse in T-cell acute lymphoblastic leukemia (T-ALL) are poorly understood. We used single nucleotide polymorphism array analysis to analyze paired diagnostic and relapsed T-ALL samples to identify recurrent genetic alterations in T-ALL. This analysis showed that diagnosis and relapsed cases have common genetic alterations, but also that relapsed samples frequently lose chromosomal markers present at diagnosis, suggesting that relapsed T-ALL emerges from an ancestral clone different from the major leukemic population at diagnosis. In addition, we identified deletions and associated mutations in the WT1 tumor suppressor gene in 2 of 9 samples. Subsequent analysis showed WT1 mutations in 28 of 211 (13.2%) of pediatric and 10 of 85 (11.7%) of adult T-ALL cases. WT1 mutations present in T-ALL are predominantly heterozygous frameshift mutations resulting in truncation of the C-terminal zinc finger domains of this transcription factor. WT1 mutations are most prominently found in T-ALL cases with aberrant rearrangements of the oncogenic TLX1, TLX3, and HOXA transcription factor oncogenes. Survival analysis demonstrated that WT1 mutations do not confer adverse prognosis in pediatric and adult T-ALL. Overall, these results identify the presence of WT1 mutations as a recurrent genetic alteration in T-ALL. PMID:19494353

  9. APC mutations in colorectal tumors with mismatch repair deficiency.

    PubMed Central

    Huang, J; Papadopoulos, N; McKinley, A J; Farrington, S M; Curtis, L J; Wyllie, A H; Zheng, S; Willson, J K; Markowitz, S D; Morin, P; Kinzler, K W; Vogelstein, B; Dunlop, M G

    1996-01-01

    We have investigated the influence of genetic instability [replication error (RER) phenotype] on APC (adenomatous polyposis coli), a gene thought to initiate colorectal tumorigenesis. The prevalence of APC mutations was similar in RER and non-RER tumors, indicating that both tumor types share this step in neoplastic transformation. However, in a total of 101 sequenced mutations, we noted a substantial excess of APC frameshift mutations in the RER cases (70% in RER tumors versus 47% in non-RER tumors, P < 0.04). These frameshifts were characteristic of mutations arising in cells deficient in DNA mismatch repair, with a predilection for mononucleotide repeats in the RER tumors (P < 0.0002), particularly (A)n tracts (P < 0.00007). These findings suggest that the genetic instability that is reflected by the RER phenotype precedes, and is responsible for, APC mutation in RER large bowel tumors and have important implications for understanding the very earliest stages of neoplasia in patients with tumors deficient in mismatch repair. Images Fig. 2 PMID:8799152

  10. Genetic subgroup of small ruminant lentiviruses that infects sheep homozygous for TMEM154 frameshift deletion mutation A4delta53

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Small Ruminant Lentivirus (SRLV) infections of sheep are influenced by genetics on both the host and pathogen sides. Genetic variation in the ovine transmembrane 154 (TMEM154) gene associates with infection susceptibility, and distinct SRLV genetic subtypes infect sheep in association with their TM...

  11. A novel mutation of the HNF1B gene associated with hypoplastic glomerulocystic kidney disease and neonatal renal failure: a case report and mutation update.

    PubMed

    Alvelos, Maria Inês; Rodrigues, Magda; Lobo, Luísa; Medeira, Ana; Sousa, Ana Berta; Simão, Carla; Lemos, Manuel Carlos

    2015-02-01

    Hepatocyte nuclear factor 1 beta (HNF1B) plays an important role in embryonic development, namely in the kidney, pancreas, liver, genital tract, and gut. Heterozygous germline mutations of HNF1B are associated with the renal cysts and diabetes syndrome (RCAD). Affected individuals may present a variety of renal developmental abnormalities and/or maturity-onset diabetes of the young (MODY). A Portuguese 19-month-old male infant was evaluated due to hypoplastic glomerulocystic kidney disease and renal dysfunction diagnosed in the neonatal period that progressed to stage 5 chronic renal disease during the first year of life. His mother was diagnosed with a solitary hypoplastic microcystic left kidney at age 20, with stage 2 chronic renal disease established at age 35, and presented bicornuate uterus, pancreatic atrophy, and gestational diabetes. DNA sequence analysis of HNF1B revealed a novel germline frameshift insertion (c.110_111insC or c.110dupC) in both the child and the mother. A review of the literature revealed a total of 106 different HNF1B mutations, in 236 mutation-positive families, comprising gross deletions (34%), missense mutations (31%), frameshift deletions or insertions (15%), nonsense mutations (11%), and splice-site mutations (8%). The study of this family with an unusual presentation of hypoplastic glomerulocystic kidney disease with neonatal renal dysfunction identified a previously unreported mutation of the HNF1B gene, thereby expanding the spectrum of known mutations associated with renal developmental disorders. PMID:25700310

  12. Identification of mutator genes and mutational pathways in Escherichia coli using a multicopy cloning approach.

    PubMed

    Yang, Hanjing; Wolff, Erika; Kim, Mandy; Diep, Amy; Miller, Jeffrey H

    2004-07-01

    We searched for genes that create mutator phenotypes when put on to a multicopy plasmid in Escherichia coli. In many cases, this will result in overexpression of the gene in question. We constructed a random shotgun library with E. coli genomic fragments between 3 and 5 kbp in length on a multicopy plasmid vector that was transformed into E. coli to screen for frameshift mutators. We identified a total of 115 independent genomic fragments that covered 17 regions on the E. coli chromosome. Further studies identified 12 genes not previously known as causing mutator phenotypes when overproduced. A striking finding is that overproduction of the multidrug resistance transcription regulator, EmrR, results in a large increase in frameshift and base substitution mutagenesis. This suggests a link between multidrug resistance and mutagenesis. Other identified genes include those encoding DNA helicases (UvrD, RecG, RecQ), truncated forms of the DNA mismatch repair protein (MutS) and a primosomal component (DnaT), a negative modulator of initiation of replication/GATC-binding protein (SeqA), a stationary phase regulator AppY, a transcriptional regulator PaaX and three putative open reading frames, ycgW, yfjY and yjiD, encoding hypothetical proteins. In addition, we found three genes encoding proteins that were previously known to cause mutator effects under overexpression conditions: error-prone polymerase IV (DinB), DNA methylase (Dam) and sigma S factor (RpoS). This genomic strategy offers an approach to identify novel mutator effects resulting from the multicopy cloning (MCC) of specific genes and therefore complementing the conventional gene inactivation approach to finding mutators. PMID:15225322

  13. Lack of HLA class I antigen expression by melanoma cells SK-MEL-33 caused by a reading frameshift in beta 2-microglobulin messenger RNA.

    PubMed Central

    Wang, Z; Cao, Y; Albino, A P; Zeff, R A; Houghton, A; Ferrone, S

    1993-01-01

    The lack of HLA class I antigen expression by the melanoma cell line SK-MEL-33 is caused by a unique lesion in beta 2-microglobulin (beta 2-mu). Sequencing of beta 2-mu mRNA detected a guanosine deletion at position 323 in codon 76 that causes a frameshift with a subsequent introduction of a stop codon at a position 54 base upstream of the normal position of the stop codon in the message. The loss of 18 amino acids and the change of 6 amino acids, including a cysteine at position 80 in the carboxy terminus of beta 2-mu, are likely to cause marked changes in the structure of the polypeptide. The latter may account for the inability of beta 2-mu to associate with HLA class I heavy chains and for its lack of reactivity with the anti-beta 2-mu mAb tested. HLA class I antigen expression on SK-MEL-33 cells was reconstituted after transfection with a wild-type B2m gene, therefore indicating that the abnormality of endogenous B2m gene is the only mechanism underlying lack of HLA class I antigen expression by SK-MEL-33 cells. The guanosine deletion in B2m gene was detected also in the melanoma tissue from which SK-MEL-33 cells had originated. Therefore, the molecular lesion identified in the SK-MEL-33 melanoma cell line is not caused by a mutation acquired during growth in vitro but is likely to reflect a somatic mutation during tumor progression. Images PMID:8432869

  14. Hepatitis C Virus Frameshift/Alternate Reading Frame Protein Suppresses Interferon Responses Mediated by Pattern Recognition Receptor Retinoic-Acid-Inducible Gene-I

    PubMed Central

    Park, Seung Bum; Seronello, Scott; Mayer, Wasima; Ojcius, David M.

    2016-01-01

    Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I (RIG-I)-mediated IFN induction. Expression of frameshift/alternate reading frame protein (F/ARFP) from HCV -2/+1 frame in Huh7 hepatoma cells suppressed type I IFN responses stimulated by HCV RNA pathogen-associated molecular pattern (PAMP) and poly(IC). The suppression occurred independently of other HCV factors; and activation of interferon stimulated genes, TNFα, IFN-λ1, and IFN-λ2/3 was likewise suppressed by HCV F/ARFP. Point mutations in the full-length HCV sequence (JFH1 genotype 2a strain) were made to introduce premature termination codons in the -2/+1 reading frame coding for F/ARFP while preserving the original reading frame, which enhanced IFNα and IFNβ induction by HCV. The potentiation of IFN response by the F/ARFP mutations was diminished in Huh7.5 cells, which already have a defective RIG-I, and by decreasing RIG-I expression in Huh7 cells. Furthermore, adding F/ARFP back via trans-complementation suppressed IFN induction in the F/ARFP mutant. The F/ARFP mutants, on the other hand, were not resistant to exogenous IFNα. Finally, HCV-infected human liver samples showed significant F/ARFP antibody reactivity, compared to HCV-uninfected control livers. Therefore, HCV F/ARFP likely cooperates with other viral factors to suppress type I and III IFN induction occurring through the RIG-I signaling pathway. This study identifies a novel mechanism of pattern recognition receptor modulation by HCV and suggests a biological function of the HCV alternate reading frame in the modulation of host innate immunity. PMID:27404108

  15. Identification of new mutations in Israeli patients with X-linked adrenoleukodystrophy.

    PubMed

    Neumann, S; Topper, A; Mandel, H; Shapira, I; Golan, O; Gazit, E; Loewenthal, R

    2001-01-01

    X-linked adrenoleukodystrophy (ALD) is a peroxisomal disorder characterized by impaired peroxisomal betaoxidation of very-long-chain fatty acids (VLCFAs). This is probably due to reduced activation of the VLCFAs and results in demyelination of the nervous system and adrenocortical insufficiency. The ALD gene is localized on Xq28, has 10 exons and encodes a protein of 745 amino acids with significant homology to the membrane peroxisomal protein PMP70. Characterizing the disease causing mutations is of importance in prenatal diagnosis because 12-20% of women who are obligatory carriers show false-negative results when tested for VLCFA in plasma. We have analyzed DNA from blood samples of 7 Jewish (5 Sephardi and 2 Ashkenazi) and 3 Arab Israeli families suffering from ALD. Five missense-type mutations were identified: R104H, Y174C, L229P, R401Q, and G512C. A single mutation, R464X, was nonsense, and two, Y171 frameshift and E471 frameshift, were frameshift. Interestingly, a single mutation was identified in three families of Moroccan Jewish descent, probably due to a founder effect. PMID:11336405

  16. A comparison of spotlight synthetic aperture radar image formation techniques

    SciTech Connect

    Knittle, C.D.; Doren, N.E.; Jakowatz, C.V.

    1996-10-01

    Spotlight synthetic aperture radar images can be formed from the complex phase history data using two main techniques: (1) polar-to-cartesian interpolation followed by two-dimensional inverse Fourier transform (2DFFT), and (2) convolution backprojection (CBP). CBP has been widely used to reconstruct medical images in computer aided tomography, and only recently has been applied to form synthetic aperture radar imagery. It is alleged that CBP yields higher quality images because (1) all the Fourier data are used and (2) the polar formatted data is used directly to form a 2D Cartesian image and therefore 2D interpolation is not required. This report compares the quality of images formed by CBP and several modified versions of the 2DFFT method. We show from an image quality point of view that CBP is equivalent to first windowing the phase history data and then interpolating to an exscribed rectangle. From a mathematical perspective, we should expect this conclusion since the same Fourier data are used to form the SAR image. We next address the issue of parallel implementation of each algorithm. We dispute previous claims that CBP is more readily parallelizable than the 2DFFT method. Our conclusions are supported by comparing execution times between massively parallel implementations of both algorithms, showing that both experience similar decreases in computation time, but that CBP takes significantly longer to form an image.

  17. Adapting the Established SIS to Meet Higher Education's Increasingly Dynamic Needs. CDS Spotlight Report. ECAR Research Bulletin

    ERIC Educational Resources Information Center

    Lang, Leah; Pirani, Judith A.

    2014-01-01

    This Spotlight focuses on data from the 2013 Core Data Service (CDS) to better understand how higher education institutions approach student information systems (SISs). Information provided for this spotlight was derived from Module 8 of the CDS survey, which asked several questions regarding information systems and applications. Responses from…

  18. A novel ECGF1 mutation in a Thai patient with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE).

    PubMed

    Kintarak, Jutatip; Liewluck, Teerin; Sangruchi, Tumtip; Hirano, Michio; Kulkantrakorn, Kongkiat; Muengtaweepongsa, Sombat

    2007-09-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive, multisystem disorder, which is clinically defined by ptosis, ophthalmoparesis, gastrointestinal dysmotility, cachexia, peripheral neuropathy, and leukoencephalopathy. MNGIE is caused by mutations in the nuclear gene, endothelial cell growth factor 1 (ECGF1), encoding thymidine phosphorylase (TP). ECGF1 mutations cause severe loss of TP activity, abnormal accumulations of thymidine and deoxyuridine in plasma, and alterations of mitochondrial DNA. Here, we report the first Thai patient with MNGIE confirmed genetically by the identification of a homozygous novel ECGF1 gene mutation, c.100insC, which causes a frameshift and premature truncation of TP protein. PMID:17544574

  19. Adaptive mutation and amplification in Escherichia coli: two pathways of genome adaptation under stress.

    PubMed

    Hersh, Megan N; Ponder, Rebecca G; Hastings, P J; Rosenberg, Susan M

    2004-06-01

    The neo-Darwinists suggested that evolution is constant and gradual, and thus that genetic changes that drive evolution should be too. However, more recent understanding of phenomena called adaptive mutation in microbes indicates that mutation rates can be elevated in response to stress, producing beneficial and other mutations. We review evidence that, in Escherichia coli, two separate mechanisms of stress-induced genetic change occur that revert a lac frameshift allele allowing growth on lactose medium. First, compensatory frameshift ("point") mutations occur by a mechanism that includes DNA double-strand breaks and (we have suggested) their error-prone repair. Point mutation requires induction of the RpoS-dependent general stress response, and the SOS DNA damage response leading to upregulation of the error-prone DNA polymerase DinB (Pol IV), and occurs during a transient limitation of post-replicative mismatch repair activity. A second mechanism, adaptive amplification, entails amplification of the leaky lac allele to 20-50 tandem repeats. These provide sufficient beta-galactosidase activity for growth, thereby apparently deflecting cells from the point mutation pathway. Unlike point mutation, amplification neither occurs in hypermutating cells nor requires SOS or DinB, but like point mutation, amplification requires the RpoS-dependent stress response. Similar processes are being found in other bacterial systems and yeast. Stress-induced genetic changes may underlie much of microbial evolution, pathogenesis and antibiotic resistance, and also cancer formation, progression and drug resistance. PMID:15207867

  20. Frequent somatic reversion of KRT1 mutations in ichthyosis with confetti.

    PubMed

    Choate, Keith A; Lu, Yin; Zhou, Jing; Elias, Peter M; Zaidi, Samir; Paller, Amy S; Farhi, Anita; Nelson-Williams, Carol; Crumrine, Debra; Milstone, Leonard M; Lifton, Richard P

    2015-04-01

    Widespread reversion of genetic disease is rare; however, such events are particularly evident in some skin disorders in which normal clones develop on a background of affected skin. We previously demonstrated that mutations in keratin 10 (KRT10) cause ichthyosis with confetti (IWC), a severe dominant disorder that is characterized by progressive development of hundreds of normal skin spots via revertant mosaicism. Here, we report on a clinical and histological IWC subtype in which affected subjects have red, scaly skin at birth, experience worsening palmoplantar keratoderma in childhood, and develop hundreds of normal skin spots, beginning at around 20 years of age, that increase in size and number over time. We identified a causal de novo mutation in keratin 1 (KRT1). Similar to IWC-causing KRT10 mutations, this mutation in KRT1 resulted in a C-terminal frameshift, replacing 22 C-terminal amino acids with an alternate 30-residue peptide. Mutant KRT1 caused partial collapse of the cytoplasmic intermediate filament network and mislocalized to the nucleus. As with KRT10 mutations causing IWC, reversion of KRT1 mutations occurred via mitotic recombination. Because reversion is not observed with other disease-causing keratin mutations, the results of this study implicate KRT1 and KRT10 C-terminal frameshift mutations in the high frequency of revertant mosaicism in IWC. PMID:25774499

  1. Frequent somatic reversion of KRT1 mutations in ichthyosis with confetti

    PubMed Central

    Choate, Keith A.; Lu, Yin; Zhou, Jing; Elias, Peter M.; Zaidi, Samir; Paller, Amy S.; Farhi, Anita; Nelson-Williams, Carol; Crumrine, Debra; Milstone, Leonard M.; Lifton, Richard P.

    2015-01-01

    Widespread reversion of genetic disease is rare; however, such events are particularly evident in some skin disorders in which normal clones develop on a background of affected skin. We previously demonstrated that mutations in keratin 10 (KRT10) cause ichthyosis with confetti (IWC), a severe dominant disorder that is characterized by progressive development of hundreds of normal skin spots via revertant mosaicism. Here, we report on a clinical and histological IWC subtype in which affected subjects have red, scaly skin at birth, experience worsening palmoplantar keratoderma in childhood, and develop hundreds of normal skin spots, beginning at around 20 years of age, that increase in size and number over time. We identified a causal de novo mutation in keratin 1 (KRT1). Similar to IWC-causing KRT10 mutations, this mutation in KRT1 resulted in a C-terminal frameshift, replacing 22 C-terminal amino acids with an alternate 30-residue peptide. Mutant KRT1 caused partial collapse of the cytoplasmic intermediate filament network and mislocalized to the nucleus. As with KRT10 mutations causing IWC, reversion of KRT1 mutations occurred via mitotic recombination. Because reversion is not observed with other disease-causing keratin mutations, the results of this study implicate KRT1 and KRT10 C-terminal frameshift mutations in the high frequency of revertant mosaicism in IWC. PMID:25774499

  2. Frequent Mutation of BAP1 in Metastasizing Uveal Melanomas

    PubMed Central

    Harbour, J. William; Onken, Michael D.; Roberson, Elisha D.O.; Duan, Shenghui; Cao, Li; Worley, Lori A.; Council, M. Laurin; Matatall, Katie A.; Helms, Cynthia; Bowcock, Anne M.

    2011-01-01

    Metastasis is a defining feature of malignant tumors and is the most common cause of cancer-related death, yet the genetics of metastasis are poorly understood. We used massively parallel exome sequencing coupled with Sanger re-sequencing to search for metastasis-related mutations in highly metastatic uveal melanomas of the eye. Inactivating somatic mutations were identified in the gene encoding BRCA1-associated protein 1 (BAP1) on chromosome 3p21.1 in 26 of 31 (84%) metastasizing tumors, including 15 mutations causing premature protein termination, and six affecting its ubiquitin carboxy-terminal hydrolase (UCH) domains. One tumor harbored a frameshift mutation that was germline in origin, thus representing a susceptibility allele. These findings implicate loss of BAP1 in uveal melanoma metastasis and suggest the BAP1 pathway as a therapeutic target. PMID:21051595

  3. Cell cycle control (and more) by programmed −1 ribosomal frameshifting: implications for disease and therapeutics

    PubMed Central

    Belew, Ashton T; Dinman, Jonathan D

    2015-01-01

    Abstract Like most basic molecular mechanisms, programmed –1 ribosomal frameshifting (−1 PRF) was first identified in viruses. Early observations that global dysregulation of −1 PRF had deleterious effects on yeast cell growth suggested that −1 PRF may be used to control cellular gene expression, and the cell cycle in particular. Collection of sufficient numbers of viral −1 PRF signals coupled with advances in computer sciences enabled 2 complementary computational approaches to identify −1 PRF signals in free living organisms. The unexpected observation that almost all −1 PRF events on eukaryotic mRNAs direct ribosomes to premature termination codons engendered the hypothesis that −1 PRF signals post-transcriptionally regulate gene expression by functioning as mRNA destabilizing elements. Emerging research suggests that some human diseases are associated with global defects in −1 PRF. The recent discovery of −1 PRF signal-specific trans-acting regulators may provide insight into novel therapeutic strategies aimed at treating diseases caused by changes in gene expression patterns. PMID:25584829

  4. A negative feedback modulator of antigen processing evolved from a frameshift in the cowpox virus genome.

    PubMed

    Lin, Jiacheng; Eggensperger, Sabine; Hank, Susanne; Wycisk, Agnes I; Wieneke, Ralph; Mayerhofer, Peter U; Tampé, Robert

    2014-12-01

    Coevolution of viruses and their hosts represents a dynamic molecular battle between the immune system and viral factors that mediate immune evasion. After the abandonment of smallpox vaccination, cowpox virus infections are an emerging zoonotic health threat, especially for immunocompromised patients. Here we delineate the mechanistic basis of how cowpox viral CPXV012 interferes with MHC class I antigen processing. This type II membrane protein inhibits the coreTAP complex at the step after peptide binding and peptide-induced conformational change, in blocking ATP binding and hydrolysis. Distinct from other immune evasion mechanisms, TAP inhibition is mediated by a short ER-lumenal fragment of CPXV012, which results from a frameshift in the cowpox virus genome. Tethered to the ER membrane, this fragment mimics a high ER-lumenal peptide concentration, thus provoking a trans-inhibition of antigen translocation as supply for MHC I loading. These findings illuminate the evolution of viral immune modulators and the basis of a fine-balanced regulation of antigen processing. PMID:25503639

  5. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting.

    PubMed

    Maynard, Nathaniel D; Macklin, Derek N; Kirkegaard, Karla; Covert, Markus W

    2012-01-01

    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNA(Lys) uridine 34 modification inhibits PRF to influence the ratio of lambda phage proteins gpG and gpGT. Computational modeling and experiments suggest that the role of the iron-sulfur cluster biosynthesis pathway in infection is indirect, via competitive binding of the shared sulfur donor IscS. Based on the universality of many key components of this network, in both the host and the virus, we anticipate that these findings may have broad relevance to understanding other infections, including viral infection of humans. PMID:22294093

  6. Silencing quorum sensing and ICE mobility through antiactivation and ribosomal frameshifting

    PubMed Central

    Ramsay, Joshua P; Ronson, Clive W

    2015-01-01

    Mobile genetic elements run an evolutionary gauntlet to maintain their mobility in the face of selection against their selfish dissemination but, paradoxically, they can accelerate the adaptability of bacteria through the gene-transfer events that they facilitate. These temporally conflicting evolutionary forces have shaped exquisite regulation systems that silence mobility and maximize the competitive fitness of the host bacterium, but maintain the ability of the element to deliver itself to a new host should the opportunity arise. Here we review the excision regulation system of the Mesorhizobium loti symbiosis island ICEMlSymR7A, a 502-kb integrative and conjugative element (ICE) capable of converting non-symbiotic mesorhizobia into plant symbionts. ICEMlSymR7A excision is activated by quorum sensing, however, both quorum sensing and excision are strongly repressed in the vast majority of cells by dual-target antiactivation and programmed ribosomal-frameshifting mechanisms. We examine these recently discovered regulatory features under the light of natural selection and discuss common themes that can be drawn from recent developments in ICE biology. PMID:26942047

  7. CAG tract of MJD-1 may be prone to frameshifts causing polyalanine accumulation.

    PubMed

    Gaspar, C; Jannatipour, M; Dion, P; Laganière, J; Sequeiros, J; Brais, B; Rouleau, G A

    2000-08-12

    Machado-Joseph disease (MJD) is one of several disorders caused by the expansion of a coding CAG repeat (exp-CAG). The presence of intranuclear inclusions (INIs) in patients and cellular models of exp-CAG-associated diseases has lead to a nuclear toxicity model. Similar INIs are found in oculopharyngeal muscular dystrophy, which is caused by a short expansion of an alanine-encoding GCG repeat. Here we propose that transcriptional or translational frameshifts occurring within expanded CAG tracts result in the production and accumulation of polyalanine-containing mutant proteins. We hypothesize that these alanine polymers deposit in cells forming INIs and may contribute to nuclear toxicity. We show evidence that supports our hypothesis in lymphoblast cells from MJD patients, as well as in pontine neurons of MJD brain and in in vitro cell culture models of the disease. We also provide evidence that alanine polymers alone are harmful to cells and predict that a similar pathogenic mechanism may occur in the other CAG repeat disorders. PMID:10942424

  8. Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

    SciTech Connect

    Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. ); Vulliamy, T. )

    1993-11-01

    Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

  9. Identification and characterization of a -1 reading frameshift in the heavy chain constant region of an IgG1 recombinant monoclonal antibody produced in CHO cells.

    PubMed

    Lian, Zhirui; Wu, Qindong; Wang, Tongtong

    2016-01-01

    Frameshifts lead to complete alteration of the intended amino acid sequences, and therefore may affect the biological activities of protein therapeutics and pose potential immunogenicity risks. We report here the identification and characterization of a novel -1 frameshift variant in a recombinant IgG1 therapeutic monoclonal antibody (mAb) produced in Chinese hamster ovary cells during the cell line selection studies. The variant was initially observed as an atypical post-monomer fragment peak in size exclusion chromatography. Characterization of the fragment peak using intact and reduced liquid chromatography-mass spectrometry (LC-MS) analyses determined that the fragment consisted of a normal light chain disulfide-linked to an aberrant 26 kDa fragment that could not be assigned to any HC fragment even after considering common modifications. Further analysis using LC-MS/MS peptide mapping revealed that the aberrant fragment contained the expected HC amino acid sequence (1-232) followed by a 20-mer novel sequence corresponding to expression of heavy chain DNA sequence in the -1 reading frame. Examination of the DNA sequence around the frameshift initiation site revealed that a mononucleotide repeat GGGGGG located in the IgG1 HC constant region was most likely the structural root cause of the frameshift. Rapid identification of the frameshift allowed us to avoid use of a problematic cell line containing the frameshift as the production cell line. The frameshift reported here may be observed in other mAb products and the hypothesis-driven analytical approaches employed here may be valuable for rapid identification and characterization of frameshift variants in other recombinant proteins. PMID:26652198

  10. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    PubMed Central

    Cheng, Qiang; Du, Zhihua

    2013-01-01

    Programmed −1 ribosomal frameshifting (PRF) and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event. PMID:24298557

  11. Mutations of the KIT (Mast/Stem cell growth factor receptor) proto-oncogene account for a continuous range of phenotypes in human piebaldism

    SciTech Connect

    Spritz, R.A.; Holmes, S.A. ); Ramesar, R.; Greenberg, J.; Beighton, P.; Curtis, D.

    1992-11-01

    Piebaldism is a rare autosomal dominant disorder of pigmentation, characterized by congenital patches of white skin and hair from which melanocytes are absent. The authors have previously shown that piebaldism can result from missense and frameshift mutations of the KIT proto-oncogene, which encodes the cellular receptor tyrosine kinase for the mast/stem cell growth factor. Here, the authors report two novel KIT mutations associated with human piebaldism. A proximal frameshift is associated with a mild piebald phenotype, and a splice-junction mutation is associated with a highly variable piebald phenotype. They discuss the apparent relationship between the predicted impact of specific KIT mutations on total KIT-dependent signal transduction and the severity of the resultant piebald phenotypes. 35 refs., 5 figs.

  12. Two novel NIPBL gene mutations in Chinese patients with Cornelia de Lange syndrome.

    PubMed

    Mei, Libin; Liang, Desheng; Huang, Yanru; Pan, Qian; Wu, Lingqian

    2015-01-25

    Cornelia de Lange syndrome (CdLS) is a dominantly inherited developmental disorder characterized by distinctive facial features, mental retardation, and upper limb defects, with the involvement of multiple organs and systems. To date, mutations have been identified in five genes responsible for CdLS: NIPBL, SMC1A, SMC3, RAD21, and HDAC8. Here, we present a clinical and molecular characterization of five unrelated Chinese patients whose clinical presentation is consistent with that of CdLS. There were no chromosomal abnormalities in the five children. In three patients, DNA sequencing revealed a previously reported frameshift mutation c.2479delA (p.Arg827GlyfsX20), and two novel mutations including a heterozygous mutation c.6272 G>T (p.Cys2091Phe) and a frameshift mutation c.1672delA (p.Thr558LeufsX7) in NIPBL. For the remaining patients, large deletions and/or duplications within the NIPBL gene were excluded as playing a role in the pathogenesis, by Multiplex Ligation-dependent Probe Amplification (MLPA) analysis. These findings broaden the mutation spectrum of NIPBL and further our understanding of the diverse and variable effects of NIPBL mutations on CdLS. PMID:25447906

  13. Important role of indels in somatic mutations of human cancer genes

    PubMed Central

    2010-01-01

    Background Cancer is clonal proliferation that arises owing to mutations in a subset of genes that confer growth advantage. More and more cancer related genes are found to have accumulated somatic mutations. However, little has been reported about mutational patterns of insertions/deletions (indels) in these genes. Results We analyzed indels' abundance and distribution, the relative ratio between indels and somatic base substitutions and the association between those two forms of mutations in a large number of somatic mutations in the Catalogue of Somatic Mutations in Cancer database. We found a strong correlation between indels and base substitutions in cancer-related genes and showed that they tend to concentrate at the same locus in the coding sequences within the same samples. More importantly, a much higher proportion of indels were observed in somatic mutations, as compared to meiotic ones. Furthermore, our analysis demonstrated a great diversity of indels at some loci of cancer-related genes. Particularly in the genes with abundant mutations, the proportion of 3n indels in oncogenes is 7.9 times higher than that in tumor suppressor genes. Conclusions There are three distinct patterns of indel distribution in somatic mutations: high proportion, great abundance and non-random distribution. Because of the great influence of indels on gene function (e.g., the effect of frameshift mutation), these patterns indicate that indels are frequently under positive selection and can often be the 'driver mutations' in oncogenesis. Such driver forces can better explain why much less frameshift mutations are in oncogenes while much more in tumor suppressor genes, because of their different function in oncogenesis. These findings contribute to our understanding of mutational patterns and the relationship between indels and cancer. PMID:20807447

  14. Detection of eight BRCA1 mutations in 10 breast/ovarian cancer families, including 1 family with male breast cancer

    SciTech Connect

    Sruewing, J.P.; Brody, L.C.; Erdos, M.R.

    1995-07-01

    Genetic epidemiological evidence suggests that mutations in BRCA1 may be responsible for approximately one half of early onset familial breast cancer and the majority of familial breast/ovarian cancer. The recent cloning of BRCA1 allows for the direct detection of mutations, but the feasibility of presymptomatic screening for cancer susceptibility is unknown. We analyzed genomic DNA from one affected individual from each of 24 families with at least three cases of ovarian or breast cancer, using SSCP assays. Variant SSCP bands were subcloned and sequenced. Allele-specific oligonucleotide hybridization was used to verify sequence changes and to screen DNA from control individuals. Six frameshift and two missense mutations were detected in 10 different families. A frameshift mutation was detected in a male proband affected with both breast and prostate cancer. A 40-bp deletion was detected in a patient who developed intra-abdominal carcinomatosis 1 year after prophylactic oophorectomy. Mutations were detected throughout the gene, and only one was detected in more than a single family. These results provide further evidence that inherited breast and ovarian cancer can occur as a consequence of a wide array of BRCA1 mutations. These results suggests that development of a screening test for BRCA1 mutations will be technically challenging. The finding of a mutation in a family with male breast cancer, not previously thought to be related to BRCA1, also illustrates the potential difficulties of genetic counseling for individuals known to carry mutations. 37 refs., 1 fig., 1 tab.

  15. Mutation analysis of the gene involved in adrenoleukodystrophy

    SciTech Connect

    Oost, B.A. van; Ligtenberg, M.J.L.; Kemp, S.; Bolhuis, P.A.

    1994-09-01

    A gene responsible for the X-linked genetic disorder adrenoleukodystrophy (ALD) that is characterized by demyelination of the nervous system and adrenocortical insufficiency has been identified by positional cloning. The gene encodes an ATP-binding transporter which is located in the peroxisomal membrane. Deficiency of the gene leads to accumulation of unsaturated very long chain fatty acids due to impaired peroxisomal {beta}-oxidation. A systematic analysis of the open reading frame of the ALD gene unraveled the mutations in 28 different families using reverse transcriptase-PCR followed by direct sequencing. No entire gene deletions or drastic promoter mutations have been detected. Only in one family did the mutation involved multiple exons. The remaining mutations were subtle alterations leading to missense (about 50%) or nonsense mutations, frameshifts or splice acceptor site defects. In one patient a single codon was missing. Mutations affecting a single amino acid were concentrated in the region between the third and fourth putative membrane spanning fragments and in the ATP-binding domain. This overview of mutations aids in the determination of structural and functional important regions and facilitates the screening for mutations in other ALD patients. The detection of mutations in virtually all ALD families tested indicates that the isolated gene is the only gene responsible for ALD located in Xq28.

  16. Analysis of mutations using PCR and denaturing gradient gel electrophoresis

    SciTech Connect

    Cariello, N.F.; Swenberg, J.A. Duke Univ., Durham, NC ); DeBellis, A.; Skopek, T.R. )

    1991-01-01

    Denaturing gradient gel electrophoresis (DGGE) separates DNA molecules based on primary sequence. Under the appropriate conditions, all base pair (bp) substitutions, frameshifts, and deletions less than about 10 bp can be resolved from the wild type sequence using DGGE. Polymerase chain reaction (PCR) permits facile amplification of a given region of the genome. The authors have combined PCR and DGGE to: (1) localize mutations in the X-linked human androgen receptor gene; (2) analyze thousands of thioguanine-resistant mutants simultaneously; (3) examine the fidelity of several DNA polymerases used in PCR.

  17. Spotlight on Speech Codes 2007: The State of Free Speech on Our Nation's Campuses

    ERIC Educational Resources Information Center

    Foundation for Individual Rights in Education (NJ1), 2007

    2007-01-01

    Last year, the Foundation for Individual Rights in Education (FIRE) conducted its first-ever comprehensive study of restrictions on speech at America's colleges and universities, "Spotlight on Speech Codes 2006: The State of Free Speech on our Nation's Campuses." In light of the essentiality of free expression to a truly liberal education, its…

  18. Respiratory Infections: Respiratory Infections Challenge Child Care Centers. NCEDL Spotlights, No. 5.

    ERIC Educational Resources Information Center

    Collier, Albert M.; Henderson, Frederick W.

    This report, the fifth in the National Center for Early Development & Learning's (NCEDL) "Spotlight" series, is based on excerpts from a paper presented during the "Research into Practice in Infant/Toddler Care" synthesis conference in fall 1997. The report addresses preventing respiratory infections in child care centers. Findings on the subject…

  19. "Libel Tourism" Puts British and American Defamation Standards in the Spotlight

    ERIC Educational Resources Information Center

    Howard, Jennifer

    2008-01-01

    This article reports on the College Art Association's decision to settle with a scholar who felt defamed by an article in one of its scholarly journals which shines a spotlight on so-called "libel tourism." When the College Art Association decided recently to settle rather than fight a possible libel action in Britain over a book review published…

  20. Diarrhea & Child Care: Controlling Diarrhea in Out-of-Home Child Care. NCEDL Spotlights, No. 4.

    ERIC Educational Resources Information Center

    Churchill, Robin B.; Pickering, Larry K.

    This report, the fourth in the National Center for Early Development and Learning's (NCEDL) "Spotlights" series, is based on excerpts from a paper presented during a "Research into Practice in Infant/Toddler Care" synthesis conference in fall 1997. The report addresses controlling diarrhea in out-of-home child care. The report notes that the rate…

  1. The Ever-Present Demand for Public Computing Resources. CDS Spotlight

    ERIC Educational Resources Information Center

    Pirani, Judith A.

    2014-01-01

    This Core Data Service (CDS) Spotlight focuses on public computing resources, including lab/cluster workstations in buildings, virtual lab/cluster workstations, kiosks, laptop and tablet checkout programs, and workstation access in unscheduled classrooms. The findings are derived from 758 CDS 2012 participating institutions. A dataset of 529…

  2. Haematopoietic and immune defects associated with GATA2 mutation

    PubMed Central

    Collin, Matthew; Dickinson, Rachel; Bigley, Venetia

    2015-01-01

    Heterozygous familial or sporadic GATA2 mutations cause a multifaceted disorder, encompassing susceptibility to infection, pulmonary dysfunction, autoimmunity, lymphoedema and malignancy. Although often healthy in childhood, carriers of defective GATA2 alleles develop progressive loss of mononuclear cells (dendritic cells, monocytes, B and Natural Killer lymphocytes), elevated FLT3 ligand, and a 90% risk of clinical complications, including progression to myelodysplastic syndrome (MDS) by 60 years of age. Premature death may occur from childhood due to infection, pulmonary dysfunction, solid malignancy and MDS/acute myeloid leukaemia. GATA2 mutations include frameshifts, amino acid substitutions, insertions and deletions scattered throughout the gene but concentrated in the region encoding the two zinc finger domains. Mutations appear to cause haplo-insufficiency, which is known to impair haematopoietic stem cell survival in animal models. Management includes genetic counselling, prevention of infection, cancer surveillance, haematopoietic monitoring and, ultimately, stem cell transplantation upon the development of MDS or another life-threatening complication. PMID:25707267

  3. [Correlation of adult AML Npm1 mutations with prognosis and its relationship with gene mutation of FLT3 and CEBPA].

    PubMed

    Bao, Li-Yan; Wang, Ji-Shi

    2010-02-01

    This study was aimed to investigate the correlation of 12th exon mutations in the npm1 gene with prognosis of adult AML patients and to explore the relationship of 12th exon mutation with other gene mutations. The specimen of bone marrow and peripheral blood from AML patients, the informations of medical history, symptoms, related image examinations, blood routine examination, NAP, oxygen saturation level in artery blood and EPO level in serum were collected; the bcr/abl fusion gene was detected by routine examination of bone marrow + biopsy + chromosome mapping + FISH. The patients were typed according to WHO classification. The DNA in cells was extracted, the npm1 gene mutation was detected by allele specific PCR combined were the sequencing. The results indicated that the npm1 heterozygote gene mutation was found in 72 out of 150 AML patients with normal cytogenetics (48%, 72/150). 48% patients showed a frameshift mutation in the C-terminal region of the NPM1 protein. The AML patients with npm1 gene mutation had specific clinical, phenotypic and genetic characteristics. The statistical analysis demonstrated the relationship between npm1 and flt3 ITDs. The patients with npm1 mutation showed a better response to induction therapy, furthermore, the overall survival (OS) rate of patients without flt3 ITD mutation was enhanced. The multivariate analysis demonstrated that the npm1 gene mutation and cebpa mutation positively correlated to the OS rate, and the correlation of flt3 mutation to OS rate showed negative. It is concluded that npm1 mutation is a favorable independent prognostic factor for adult AML patients with normal cytogenetics under conditions without FIT3 gene mutation. PMID:20137111

  4. Novel Patched 1 mutations in patients with nevoid basal cell carcinoma syndrome – case report

    PubMed Central

    Škodrić-Trifunović, Vesna; Stjepanović, Mihailo; Savić, Živorad; Ilić, Miroslav; Kavečan, Ivana; Jovanović Privrodski, Jadranka; Spasovski, Vesna; Stojiljković, Maja; Pavlović, Sonja

    2015-01-01

    Nevoid basal cell carcinoma syndrome (Gorlin syndrome) is a rare autosomal dominant disorder characterized by numerous basal cell carcinomas, keratocystic odontogenic tumors of the jaws, and diverse developmental defects. This disorder is associated with mutations in tumor suppressor gene Patched 1 (PTCH1). We present two patients with Gorlin syndrome, one sporadic and one familial. Clinical examination, radiological, and CT imaging, and mutation screening of PTCH1 gene were performed. Family members, as well as eleven healthy controls were included in the study. Both patients fulfilled the specific criteria for diagnosis of Gorlin syndrome. Molecular analysis of the first patient showed a novel frameshift mutation in exon 6 of PTCH1gene (c.903delT). Additionally, a somatic frameshift mutation in exon 21 (c.3524delT) along with germline mutation in exon 6 was detected in tumor-derived tissue sample of this patient. Analysis of the second patient, as well as two affected family members, revealed a novel nonsense germline mutation in exon 8 (c.1148 C>A). PMID:25727044

  5. Identification of two novel mutations in patients with X-linked primary immunodeficiencies.

    PubMed

    Yu, Li; Wang, Xike; Wang, Yuchuan; Wang, Jian

    2015-04-01

    Primary immunodeficiency diseases (PID) are a heterogeneous group of inherited disorders with defects in one or more component of the immune system. In this study, we analyzed gene mutations in four X-linked PID pedigrees, which include one X- linked agammaglobulinemia (XLA) pedigree, one X-linked chronic granulomatous disease (XCGD) pedigree, and two X-linked Hyper IgM syndrome (XHIGM) pedigrees. Sequence analysis of the BTK gene revealed a novel mutation (c.1802_1803delinsGCC, p.Phe601CysfsX3) which results in the developmental arrest of B cells in the bone marrow. Sequence analysis of the CYBB gene revealed a recurrent frameshift mutation (c.1313_1314delinsT) in exon 10, which generates a premature stop codon (p.Lys438IlefsX63). One novel frameshift mutation (c.114delG, p.Ser39GlnfsX14) and one recurrent missense mutation (c.499G>C, p.Gly167Arg) were found in the CD40LG gene and cause defective T cell functioning. In conclusion, our study identified two novel mutations on the BTK and CD40LG genes in Chinese patients and established accurate and simple genetic diagnostic methods for three X-linked PID. PMID:25353698

  6. Truncating and missense mutations in IGHMBP2 cause Charcot-Marie Tooth disease type 2.

    PubMed

    Cottenie, Ellen; Kochanski, Andrzej; Jordanova, Albena; Bansagi, Boglarka; Zimon, Magdalena; Horga, Alejandro; Jaunmuktane, Zane; Saveri, Paola; Rasic, Vedrana Milic; Baets, Jonathan; Bartsakoulia, Marina; Ploski, Rafal; Teterycz, Pawel; Nikolic, Milos; Quinlivan, Ros; Laura, Matilde; Sweeney, Mary G; Taroni, Franco; Lunn, Michael P; Moroni, Isabella; Gonzalez, Michael; Hanna, Michael G; Bettencourt, Conceicao; Chabrol, Elodie; Franke, Andre; von Au, Katja; Schilhabel, Markus; Kabzińska, Dagmara; Hausmanowa-Petrusewicz, Irena; Brandner, Sebastian; Lim, Siew Choo; Song, Haiwei; Choi, Byung-Ok; Horvath, Rita; Chung, Ki-Wha; Zuchner, Stephan; Pareyson, Davide; Harms, Matthew; Reilly, Mary M; Houlden, Henry

    2014-11-01

    Using a combination of exome sequencing and linkage analysis, we investigated an English family with two affected siblings in their 40s with recessive Charcot-Marie Tooth disease type 2 (CMT2). Compound heterozygous mutations in the immunoglobulin-helicase-μ-binding protein 2 (IGHMBP2) gene were identified. Further sequencing revealed a total of 11 CMT2 families with recessively inherited IGHMBP2 gene mutations. IGHMBP2 mutations usually lead to spinal muscular atrophy with respiratory distress type 1 (SMARD1), where most infants die before 1 year of age. The individuals with CMT2 described here, have slowly progressive weakness, wasting and sensory loss, with an axonal neuropathy typical of CMT2, but no significant respiratory compromise. Segregating IGHMBP2 mutations in CMT2 were mainly loss-of-function nonsense in the 5' region of the gene in combination with a truncating frameshift, missense, or homozygous frameshift mutations in the last exon. Mutations in CMT2 were predicted to be less aggressive as compared to those in SMARD1, and fibroblast and lymphoblast studies indicate that the IGHMBP2 protein levels are significantly higher in CMT2 than SMARD1, but lower than controls, suggesting that the clinical phenotype differences are related to the IGHMBP2 protein levels. PMID:25439726

  7. Concentration of mutations causing Schmid metaphyseal chondrodysplasia in the NC1 domain of type X collagen

    SciTech Connect

    McIntosh, I.; Abbott, M.H.; Francomano, C.A.

    1994-09-01

    Schmid metaphyseal chondrodysplasia (SMCD, MIM 156500) is an autosomal dominant disorder of the osseous skeleton resulting in short stature, coxa vara and a waddling gait. Type X collagen is an extracellular matrix protein expressed exclusively by hypertrophic chondrocytes. We have previously identified four mutations in the type X collagen gene (COL10A1) in patients with SMCD. Each of these mutations, as well as another three reported by other investigators, are in the carboxy-terminal non-collagenous domain (NC1). Here, we present data for another three mutations each predicted to cause premature termination of translation within the NC1 domain. Two are nonsense mutations, Y628X and W651X, while the third is a frameshift resulting from the deletion of two nucleotides, 1856delCC. Each of these mutations occurred de novo, resulting in sporadic cases of SMCD. Four frameshift mutations have now been reported to initiate within 10bp of each other in the NC1 domain, namely 1865delC, 1856delCC, 1856del13 and 1866del10. These findings further support the hypothesis that SMCD is the result of the mutant type X collagen molecule being unable to participate in trimerization, although a dominant-negative model of disease pathogenesis has not been formally excluded.

  8. Mutations in DVL1 Cause an Osteosclerotic Form of Robinow Syndrome

    PubMed Central

    Bunn, Kieran J.; Daniel, Phil; Rösken, Heleen S.; O’Neill, Adam C.; Cameron-Christie, Sophia R.; Morgan, Tim; Brunner, Han G.; Lai, Angeline; Kunst, Henricus P.M.; Markie, David M.; Robertson, Stephen P.

    2015-01-01

    Robinow syndrome (RS) is a phenotypically and genetically heterogeneous condition that can be caused by mutations in genes encoding components of the non-canonical Wnt signaling pathway. In contrast, germline mutations that act to increase canonical Wnt signaling lead to distinctive osteosclerotic phenotypes. Here, we identified de novo frameshift mutations in DVL1, a mediator of both canonical and non-canonical Wnt signaling, as the cause of RS-OS, an RS subtype involving osteosclerosis, in three unrelated individuals. The mutations all delete the DVL1 C terminus and replace it, in each instance, with a novel, highly basic sequence. We showed the presence of mutant transcript in fibroblasts from one individual with RS-OS and demonstrated unimpaired protein stability with transfected GFP-tagged constructs bearing a frameshift mutation. In vitro TOPFlash assays, in apparent contradiction to the osteosclerotic phenotype, revealed that the mutant allele was less active than the wild-type allele in the canonical Wnt signaling pathway. However, when the mutant and wild-type alleles were co-expressed, canonical Wnt activity was 2-fold higher than that in the wild-type construct alone. This work establishes that DVL1 mutations cause a specific RS subtype, RS-OS, and that the osteosclerosis associated with this subtype might be the result of an interaction between the wild-type and mutant alleles and thus lead to elevated canonical Wnt signaling. PMID:25817014

  9. Letter to the Editor: A Novel Mutation in the CREBBP Gene of a Korean Girl with Rubinstein-Taybi syndrome.

    PubMed

    Huh, Rimm; Cho, Sung Yoon; Kim, Jinsup; Ki, Chang-Seok; Jin, Dong-Kyu

    2015-01-01

    Rubinstein-Taybi syndrome (RTS) is a rare congenital disorder characterized by broad thumbs and halluces, dysmorphic facial features, mental retardation, and short stature. Mutations in the cAMP-response element binding protein-BP (CREBBP) gene (50-60% of cases) and E1A-binding protein (EP300, 3%) are known genetic causes in affected individuals. Here, we describe a genetically confirmed Korean RTS patient with atypical features, including Hirschsprung disease and growth hormone deficiency. Mutational analysis revealed a novel heterozygous frameshift mutation, c.2064_2077del14 (p.Gly689Cysfs*32) in the CREBBP gene. PMID:26275701

  10. Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

    SciTech Connect

    Ionasescu, V.; Ionasescu, R.; Searby, C.

    1996-06-14

    We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these families showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.

  11. A Novel Mutation of the HNF1B Gene Associated With Hypoplastic Glomerulocystic Kidney Disease and Neonatal Renal Failure

    PubMed Central

    Alvelos, Maria Inês; Rodrigues, Magda; Lobo, Luísa; Medeira, Ana; Sousa, Ana Berta; Simão, Carla; Lemos, Manuel Carlos

    2015-01-01

    Abstract Hepatocyte nuclear factor 1 beta (HNF1B) plays an important role in embryonic development, namely in the kidney, pancreas, liver, genital tract, and gut. Heterozygous germline mutations of HNF1B are associated with the renal cysts and diabetes syndrome (RCAD). Affected individuals may present a variety of renal developmental abnormalities and/or maturity-onset diabetes of the young (MODY). A Portuguese 19-month-old male infant was evaluated due to hypoplastic glomerulocystic kidney disease and renal dysfunction diagnosed in the neonatal period that progressed to stage 5 chronic renal disease during the first year of life. His mother was diagnosed with a solitary hypoplastic microcystic left kidney at age 20, with stage 2 chronic renal disease established at age 35, and presented bicornuate uterus, pancreatic atrophy, and gestational diabetes. DNA sequence analysis of HNF1B revealed a novel germline frameshift insertion (c.110_111insC or c.110dupC) in both the child and the mother. A review of the literature revealed a total of 106 different HNF1B mutations, in 236 mutation-positive families, comprising gross deletions (34%), missense mutations (31%), frameshift deletions or insertions (15%), nonsense mutations (11%), and splice-site mutations (8%). The study of this family with an unusual presentation of hypoplastic glomerulocystic kidney disease with neonatal renal dysfunction identified a previously unreported mutation of the HNF1B gene, thereby expanding the spectrum of known mutations associated with renal developmental disorders. PMID:25700310

  12. Pancreatic adenocarcinomas frequently show p53 gene mutations.

    PubMed Central

    Scarpa, A.; Capelli, P.; Mukai, K.; Zamboni, G.; Oda, T.; Iacono, C.; Hirohashi, S.

    1993-01-01

    Thirty-four pancreatic adenocarcinomas were studied for the presence of p53 gene mutations by the single-strand conformation polymorphism method and by direct sequencing of PCR-amplified fragments. p53 protein expression was immunohistochemically evaluated using monoclonal PAb1801 and polyclonal CM1 antibodies. Mutations were detected in 14 cases. The transitions were six G to A and two A to G; the transversions were one C to G and two A to C; the remaining three were frameshift mutations. Immunostaining results were identical with both antibodies. Nuclear immunohistochemical p53-positive cells were found in nine p53 mutated cases and in 12 cases in which no mutation was detected. In most of these latter cases only a minority of cancer cells showed immunohistochemical positivity. Twenty-nine cases, including all p53 mutated cancers, were known to contain codon 12 Ki-ras gene mutations. Also in the light of the demonstrated cooperation of ras and p53 gene alterations in the transformation of cultured cells, our data suggest that p53 mutation is one of the genetic defects that may have a role in the pathogenesis of a proportion of pancreatic cancers. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8494051

  13. Germline RECQL mutations in high risk Chinese breast cancer patients.

    PubMed

    Kwong, Ava; Shin, Vivian Y; Cheuk, Isabella W Y; Chen, Jiawei; Au, Chun H; Ho, Dona N; Chan, Tsun L; Ma, Edmond S K; Akbari, Mohammad R; Narod, Steven A

    2016-06-01

    Recently, RECQL was reported as a new breast cancer susceptibility gene. RECQL belongs to the RECQ DNA helicase family which unwinds double strand DNA and involved in the DNA replication stress response, telomere maintenance and DNA repair. RECQL deficient mice cells are prone to spontaneous chromosomal instability and aneuploidy, suggesting a tumor-suppressive role of RECQL in cancer. In this study, RECQL gene mutation screening was performed on 1110 breast cancer patients who were negative for BRCA1, BRCA2, TP53 and PTEN gene mutations and recruited from March 2007 to June 2015 in the Hong Kong Hereditary and High Risk Breast Cancer Program. Four different RECQL pathogenic mutations were identified in six of the 1110 (0.54 %) tested breast cancer patients. The identified mutations include one frame-shift deletion (c.974_977delAAGA), two splicing site mutations (c.394+1G>A, c.867+1G>T) and one nonsense mutation (c.796C>T, p.Gln266Ter). Two of the mutations (c.867+1G>T and p.Gln266Ter) were seen in more than one patients. This study provides the basis for existing of pathogenic RECQL mutations in Southern Chinese breast cancer patients. The significance of rare variants in RECQL gene in the estimation of breast cancer risk warranted further investigation in larger cohort of patients and in other ethnic groups. PMID:27125668

  14. New developmental evidence supports a homeotic frameshift of digit identity in the evolution of the bird wing

    PubMed Central

    2014-01-01

    Background The homology of the digits in the bird wing is a high-profile controversy in developmental and evolutionary biology. The embryonic position of the digits cartilages with respect to the primary axis (ulnare and ulna) corresponds to 2, 3, 4, but comparative-evolutionary morphology supports 1, 2, 3. A homeotic frameshift of digit identity in evolution could explain how cells in embryonic positions 2, 3, 4 began developing morphologies 1, 2, 3. Another alternative is that no re-patterning of cell fates occurred, and the primary axis shifted its position by some other mechanism. In the wing, only the anterior digit lacks expression of HoxD10 and HoxD12, resembling digit 1 of other limbs, as predicted by 1, 2, 3. However, upon loss of digit 1 in evolution, the most anterior digit 2 could have lost their expression, deceitfully resembling a digit 1. To test this notion, we observed HoxD10 and HoxD12 in a limb where digit 2 is the most anterior digit: The rabbit foot. We also explored whether early inhibition of Shh signalling in the embryonic wing bud induces an experimental homeotic frameshift, or an experimental axis shift. We tested these hypotheses using DiI injections to study the fate of cells in these experimental wings. Results We found strong transcription of HoxD10 and HoxD12 was present in the most anterior digit 2 of the rabbit foot. Thus, we found no evidence to question the use of HoxD expression as support for 1, 2, 3. When Shh signalling in early wing buds is inhibited, our fate maps demonstrate that an experimental homeotic frameshift is induced. Conclusion Along with comparative morphology, HoxD expression provides strong support for 1, 2, 3 identity of wing digits. As an explanation for the offset 2, 3, 4 embryological position, the homeotic frameshift hypothesis is consistent with known mechanisms of limb development, and further proven to be experimentally possible. In contrast, the underlying mechanisms and experimental plausibility of an

  15. SERPINB11 Frameshift Variant Associated with Novel Hoof Specific Phenotype in Connemara Ponies

    PubMed Central

    Young, Amy; Affolter, Verena; Joshi, Nikhil A.; Ramsay, Sheila; Bannasch, Danika L.

    2015-01-01

    Horses belong to the order Perissodactyla and bear the majority of their weight on their third toe; therefore, tremendous force is applied to each hoof. An inherited disease characterized by a phenotype restricted to the dorsal hoof wall was identified in the Connemara pony. Hoof wall separation disease (HWSD) manifests clinically as separation of the dorsal hoof wall along the weight-bearing surface of the hoof during the first year of life. Parents of affected ponies appeared clinically normal, suggesting an autosomal recessive mode of inheritance. A case-control allelic genome wide association analysis was performed (ncases = 15, ncontrols = 24). Population stratification (λ = 1.48) was successfully improved by removing outliers (ncontrols = 7) identified on a multidimensional scaling plot. A genome-wide significant association was detected on chromosome 8 (praw = 1.37x10-10, pgenome = 1.92x10-5). A homozygous region identified in affected ponies spanned from 79,936,024-81,676,900 bp and contained a family of 13 annotated SERPINB genes. Whole genome next-generation sequencing at 6x coverage of two cases and two controls revealed 9,758 SNVs and 1,230 indels within the ~1.7-Mb haplotype, of which 17 and 5, respectively, segregated with the disease and were located within or adjacent to genes. Additional genotyping of these 22 putative functional variants in 369 Connemara ponies (ncases = 23, ncontrols = 346) and 169 horses of other breeds revealed segregation of three putative variants adjacent or within four SERPIN genes. Two of the variants were non-coding and one was an insertion within SERPINB11 that introduced a frameshift resulting in a premature stop codon. Evaluation of mRNA levels at the proximal hoof capsule (ncases = 4, ncontrols = 4) revealed that SERPINB11 expression was significantly reduced in affected ponies (p<0.001). Carrier frequency was estimated at 14.8%. This study describes the first genetic variant associated with a hoof wall specific

  16. SERPINB11 frameshift variant associated with novel hoof specific phenotype in Connemara ponies.

    PubMed

    Finno, Carrie J; Stevens, Carlynn; Young, Amy; Affolter, Verena; Joshi, Nikhil A; Ramsay, Sheila; Bannasch, Danika L

    2015-04-01

    Horses belong to the order Perissodactyla and bear the majority of their weight on their third toe; therefore, tremendous force is applied to each hoof. An inherited disease characterized by a phenotype restricted to the dorsal hoof wall was identified in the Connemara pony. Hoof wall separation disease (HWSD) manifests clinically as separation of the dorsal hoof wall along the weight-bearing surface of the hoof during the first year of life. Parents of affected ponies appeared clinically normal, suggesting an autosomal recessive mode of inheritance. A case-control allelic genome wide association analysis was performed (ncases = 15, ncontrols = 24). Population stratification (λ = 1.48) was successfully improved by removing outliers (ncontrols = 7) identified on a multidimensional scaling plot. A genome-wide significant association was detected on chromosome 8 (praw = 1.37x10-10, pgenome = 1.92x10-5). A homozygous region identified in affected ponies spanned from 79,936,024-81,676,900 bp and contained a family of 13 annotated SERPINB genes. Whole genome next-generation sequencing at 6x coverage of two cases and two controls revealed 9,758 SNVs and 1,230 indels within the ~1.7-Mb haplotype, of which 17 and 5, respectively, segregated with the disease and were located within or adjacent to genes. Additional genotyping of these 22 putative functional variants in 369 Connemara ponies (ncases = 23, ncontrols = 346) and 169 horses of other breeds revealed segregation of three putative variants adjacent or within four SERPIN genes. Two of the variants were non-coding and one was an insertion within SERPINB11 that introduced a frameshift resulting in a premature stop codon. Evaluation of mRNA levels at the proximal hoof capsule (ncases = 4, ncontrols = 4) revealed that SERPINB11 expression was significantly reduced in affected ponies (p<0.001). Carrier frequency was estimated at 14.8%. This study describes the first genetic variant associated with a hoof wall specific

  17. Somatic CALR Mutations in Myeloproliferative Neoplasms with Nonmutated JAK2

    PubMed Central

    Baxter, E.J.; Nice, F.L.; Gundem, G.; Wedge, D.C.; Avezov, E.; Li, J.; Kollmann, K.; Kent, D.G.; Aziz, A.; Godfrey, A.L.; Hinton, J.; Martincorena, I.; Van Loo, P.; Jones, A.V.; Guglielmelli, P.; Tarpey, P.; Harding, H.P.; Fitzpatrick, J.D.; Goudie, C.T.; Ortmann, C.A.; Loughran, S.J.; Raine, K.; Jones, D.R.; Butler, A.P.; Teague, J.W.; O’Meara, S.; McLaren, S.; Bianchi, M.; Silber, Y.; Dimitropoulou, D.; Bloxham, D.; Mudie, L.; Maddison, M.; Robinson, B.; Keohane, C.; Maclean, C.; Hill, K.; Orchard, K.; Tauro, S.; Du, M.-Q.; Greaves, M.; Bowen, D.; Huntly, B.J.P.; Harrison, C.N.; Cross, N.C.P.; Ron, D.; Vannucchi, A.M.; Papaemmanuil, E.; Campbell, P.J.; Green, A.R.

    2014-01-01

    BACKGROUND Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. METHODS We performed exome sequencing of samples obtained from 151 patients with myeloproliferative neoplasms. The mutation status of the gene encoding calreticulin (CALR) was assessed in an additional 1345 hematologic cancers, 1517 other cancers, and 550 controls. We established phylogenetic trees using hematopoietic colonies. We assessed calreticulin subcellular localization using immunofluorescence and flow cytometry. RESULTS Exome sequencing identified 1498 mutations in 151 patients, with medians of 6.5, 6.5, and 13.0 mutations per patient in samples of polycythemia vera, essential thrombocythemia, and myelofibrosis, respectively. Somatic CALR mutations were found in 70 to 84% of samples of myeloproliferative neoplasms with nonmutated JAK2, in 8% of myelodysplasia samples, in occasional samples of other myeloid cancers, and in none of the other cancers. A total of 148 CALR mutations were identified with 19 distinct variants. Mutations were located in exon 9 and generated a +1 base-pair frameshift, which would result in a mutant protein with a novel C-terminal. Mutant calreticulin was observed in the endoplasmic reticulum without increased cell-surface or Golgi accumulation. Patients with myeloproliferative neoplasms carrying CALR mutations presented with higher platelet counts and lower hemoglobin levels than patients with mutated JAK2. Mutation of CALR was detected in hematopoietic stem and progenitor cells. Clonal analyses showed CALR mutations in the earliest phylogenetic node, a finding consistent with its role as an initiating mutation in some patients. CONCLUSIONS Somatic mutations in the endoplasmic reticulum chaperone CALR were found in a majority of patients with myeloproliferative neoplasms with

  18. Exome sequencing identified null mutations in LOXL3 associated with early-onset high myopia

    PubMed Central

    Li, Jiali; Gao, Bei; Xiao, Xueshan; Li, Shiqiang; Jia, Xiaoyun; Sun, Wenmin; Guo, Xiangming

    2016-01-01

    Purpose To identify null mutations in novel genes associated with early-onset high myopia using whole exome sequencing. Methods Null mutations, including homozygous and compound heterozygous truncations, were selected from whole exome sequencing data for 298 probands with early-onset high myopia. These data were compared with those of 507 probands with other forms of eye diseases. Null mutations specific to early-onset high myopia were considered potential candidates. Candidate mutations were confirmed with Sanger sequencing and were subsequently evaluated in available family members and 480 healthy controls. Results A homozygous frameshift mutation (c.39dup; p.L14Afs*21) and a compound heterozygous frameshift mutation (c.39dup; p.L14Afs*21 and c.594delG; p.Q199Kfs*35) in LOXL3 were separately identified in two of the 298 probands with early-onset high myopia. These mutations were confirmed with Sanger sequencing and were not detected in 1,974 alleles of the controls from the same region (507 individuals with other conditions and 480 healthy control individuals). These two probands were singleton cases, and their parents had only heterozygous mutations. A homozygous missense mutation in LOXL3 was recently reported in a consanguineous family with Stickler syndrome. Conclusions Our results suggest that null mutations in LOXL3 are likely associated with autosomal recessive early-onset high myopia. LOXL3 is a potential candidate gene for high myopia, but this possibility should be confirmed in additional studies. LOXL3 null mutations in human beings are not lethal, providing a phenotype contrary to that in mice. PMID:26957899

  19. A novel PCCB mutation in a Thai patient with propionic acidemia identified by exome sequencing.

    PubMed

    Porntaveetus, Thantrira; Srichomthong, Chalurmpon; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

    2015-01-01

    Propionic acidemia (PA) is an inborn error of metabolism, caused by mutations in either the PCCA or PCCB gene, leading to mitochondrial accumulation of propionyl-CoA and its by-products. Here we report a 6-year-old Thai boy with PA who was born to consanguineous parents. Exome sequencing identified a novel homozygous frameshift insertion (c.379_380insA; p.T127NfsX160) in the PCCB gene, expanding its mutational spectrum. PMID:27081542

  20. A novel PCCB mutation in a Thai patient with propionic acidemia identified by exome sequencing

    PubMed Central

    Porntaveetus, Thantrira; Srichomthong, Chalurmpon; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

    2015-01-01

    Propionic acidemia (PA) is an inborn error of metabolism, caused by mutations in either the PCCA or PCCB gene, leading to mitochondrial accumulation of propionyl-CoA and its by-products. Here we report a 6-year-old Thai boy with PA who was born to consanguineous parents. Exome sequencing identified a novel homozygous frameshift insertion (c.379_380insA; p.T127NfsX160) in the PCCB gene, expanding its mutational spectrum. PMID:27081542

  1. Mutational analysis of the Drosophila DNA repair and recombination gene mei-9.

    PubMed Central

    Yildiz, Ozlem; Kearney, Hutton; Kramer, Benjamin C; Sekelsky, Jeff J

    2004-01-01

    Drosophila mei-9 is essential for several DNA repair and recombination pathways, including nucleotide excision repair (NER), interstrand crosslink repair, and meiotic recombination. To better understand the role of MEI-9 in these processes, we characterized 10 unique mutant alleles of mei-9. These include a P-element insertion that disrupts repair functions but not the meiotic function; three nonsense mutations, one of which has nearly wild-type levels of protein; three missense mutations, one of which disrupts the meiotic function but not repair functions; two small in-frame deletions; and one frameshift. PMID:15166153

  2. Primary adrenal insufficiency caused by a novel mutation in DAX1 gene.

    PubMed

    Evliyaoğlu, Olcay; Dokurel, İpek; Bucak, Feride; Özcabı, Bahar; Ercan, Özcabı; Ceylaner, Serdar

    2013-01-01

    Adrenal hypoplasia congenita (AHC) is a rare disorder. The X-linked form is related to mutations in the DAX1 (NROB1) gene. Here, we report a newborn who had a novel hemizygous frameshift mutation in DAX1(c.543delA) and presented with primary adrenal failure that was initially misdiagnosed as congenital adrenal hyperplasia. This report highlights the value of genetic testing for definite diagnosis in children with primary adrenal failure due to abnormal adrenal gland development, providing the possibility both for presymptomatic, and in cases with a sibling with this condition, for prenatal diagnosis. PMID:23367499

  3. Nocturnal frontal lobe epilepsy caused by a mutation in the GATOR1 complex gene NPRL3.

    PubMed

    Korenke, Georg-Christoph; Eggert, Marlene; Thiele, Holger; Nürnberg, Peter; Sander, Thomas; Steinlein, Ortrud K

    2016-03-01

    Mutations in NPRL3, one of three genes that encode proteins of the mTORC1-regulating GATOR1 complex, have recently been reported to cause cortical dysplasia with focal epilepsy. We have now analyzed a multiplex epilepsy family by whole exome sequencing and identified a frameshift mutation (NM_001077350.2; c.1522delG; p.E508Rfs*46) within exon 13 of NPRL3. This truncating mutation causes an epilepsy phenotype characterized by early childhood onset of mainly nocturnal frontal lobe epilepsy. The penetrance in our family was low (three affected out of six mutation carriers), compared to families with either ion channel- or DEPDC5-associated familial nocturnal frontal lobe epilepsy. The absence of apparent structural brain abnormalities suggests that mutations in NPRL3 are not necessarily associated with focal cortical dysplasia but might be able to cause epilepsy by different, yet unknown pathomechanisms. PMID:26786403

  4. Mutations in the SLC3A1 Transporter Gene in Cystinuria

    PubMed Central

    Pras, Elon; Raben, Nina; Golomb, Eliahu; Arber, Nadir; Aksentijevich, Ivona; Schapiro, Jonathan M.; Harel, Daniela; Katz, Giora; Liberman, Uri; Pras, Mordechai; Kastner, Daniel L.

    1995-01-01

    Cystinuria is an autosomal recessive disease characterized by the development of kidney stones. Guided by the identification of the SLC3A1 amino acid–transport gene on chromosome 2, we recently established genetic linkage of cystinuria to chromosome 2p in 17 families, without evidence for locus heterogeneity. Other authors have independently identified missense mutations in SLC3A1 in cystinuria patients. In this report we describe four additional cystinuria-associated mutations in this gene: a frameshift, a deletion, a transversion inducing a critical amino acid change, and a nonsense mutation. The latter stop codon was found in all of eight Ashkenazi Jewish carrier chromosomes examined. This report brings the number of disease-associated mutations in this gene to 10. We also assess the frequency of these mutations in our 17 cystinuria families. ImagesFigure 2Figure 3Figure 4 PMID:7539209

  5. Mutations in the SLC3A1 transporter gene in cystinuria

    SciTech Connect

    Pras, E.; Raben, N.; Aksentijevich, I.

    1995-06-01

    Cystinuria is an autosomal recessive disease characterized by the development of kidney stones. Guided by the identification of the SLC3A1 amino acid-transport gene on chromosome 2, we recently established genetic linkage of cystinuria to chromosome 2p in 17 families, without evidence for locus heterogeneity. Other authors have independently identified missense mutations in SLC3A1 in cystinuria patients. In this report we describe four additional cystinuria-associated mutations in this gene: a frameshift, a deletion, a transversion inducing a critical amino acid change, and a nonsense mutation. The latter stop codon was found in all of eight Ashkenazi Jewish carrier chromosomes examined. This report brings the number of disease-associated mutations in this gene to 10. We also assess the frequency of these mutations in our 17 cystinuria families. 24 refs., 4 figs., 1 tab.

  6. Identification of three rare beta-thalassemia mutations in the Pakistani population.

    PubMed

    Khan, S N; Riazuddin, S; Galanello, R

    2000-02-01

    Three rare beta-thalassemia mutations, not reported previously in Asian Indians or the Pakistani population, were identified by single strand conformation polymorphism analysis followed by direct sequencing. Two mutations, IVS-II-848 (C-->A) and initiation codon (ATG-->ACG), were found in the homozygous condition in patients belonging to Balochi and Sindhi ethnic groups of Pakistan, together with heterozygous and homozygous alpha(-3.7) deletions, respectively. A frameshift mutation at codon 44 (-C) was identified in a patient belonging to the Gujrati ethnic group together with IVS-I-1 (G-->T) and a normal complement of four a-globin genes. Haplotype analysis was performed to identify the chromosomal background associated with these mutations, and for tracing the origin and spread of these mutations. PMID:10722111

  7. TP53 Mutation Spectrum in Smokers and Never Smoking Lung Cancer Patients

    PubMed Central

    Halvorsen, Ann R.; Silwal-Pandit, Laxmi; Meza-Zepeda, Leonardo A.; Vodak, Daniel; Vu, Phuong; Sagerup, Camilla; Hovig, Eivind; Myklebost, Ola; Børresen-Dale, Anne-Lise; Brustugun, Odd T.; Helland, Åslaug

    2016-01-01

    Background: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer. Methods: We analyzed tumor tissue from 394 non-small cell carcinomas including adenocarcinomas (n = 229), squamous cell carcinomas (n = 112), large cell carcinomas (n = 30), and others (n = 23) for mutations in TP53 by the use of Sanger sequencing (n = 394) and next generation sequencing (n = 100). Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65%) of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3%) compared to adenocarcinomas (9.1%). Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, and are also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers. PMID:27242894

  8. Novel GABRG2 mutations cause familial febrile seizures

    PubMed Central

    Boillot, Morgane; Morin-Brureau, Mélanie; Picard, Fabienne; Weckhuysen, Sarah; Lambrecq, Virginie; Minetti, Carlo; Striano, Pasquale; Zara, Federico; Iacomino, Michele; Ishida, Saeko; An-Gourfinkel, Isabelle; Daniau, Mailys; Hardies, Katia; Baulac, Michel; Dulac, Olivier; Leguern, Eric; Nabbout, Rima

    2015-01-01

    Objective: To identify the genetic cause in a large family with febrile seizures (FS) and temporal lobe epilepsy (TLE) and subsequently search for additional mutations in a cohort of 107 families with FS, with or without epilepsy. Methods: The cohort consisted of 1 large family with FS and TLE, 64 smaller French families recruited through a national French campaign, and 43 Italian families. Molecular analyses consisted of whole-exome sequencing and mutational screening. Results: Exome sequencing revealed a p.Glu402fs*3 mutation in the γ2 subunit of the GABAA receptor gene (GABRG2) in the large family with FS and TLE. Three additional nonsense and frameshift GABRG2 mutations (p.Arg136*, p.Val462fs*33, and p.Pro59fs*12), 1 missense mutation (p.Met199Val), and 1 exonic deletion were subsequently identified in 5 families of the follow-up cohort. Conclusions: We report GABRG2 mutations in 5.6% (6/108) of families with FS, with or without associated epilepsy. This study provides evidence that GABRG2 mutations are linked to the FS phenotype, rather than epilepsy, and that loss-of-function of GABAA receptor γ2 subunit is the probable underlying pathogenic mechanism. PMID:27066572

  9. Mutations in STK11 gene in Czech Peutz-Jeghers patients

    PubMed Central

    Vasovčák, Peter; Puchmajerová, Alena; Roubalík, Jan; Křepelová, Anna

    2009-01-01

    Background Peutz-Jeghers syndrome (PJS) is an autosomal dominant hereditary disease characterized by mucocutaneous pigmentation and gastrointestinal hamartomatous polyposis. The germline mutations in the serine/threonine kinase 11 (STK11) gene have been shown to be associated with the disease. Individuals with PJS are at increased risk for development of various neoplasms. The aim of the present study was to characterize the genotype and phenotype of Czech patients with PJS. Methods We examined genomic DNA of 8 individuals from five Czech families by sequencing analysis of STK11 gene, covering its promotor region, the entire coding region and the splice-site boundaries, and by multiplex ligation-dependent probe amplification (MLPA) assay designed for the identification of large exonic deletions or duplications of STK11 gene. Results We found pathogenic mutations in STK11 gene in two families fulfilling the diagnostic criteria of PJS and in one of three sporadic cases not complying with the criteria. The patient with the frameshift mutation in STK11 gene developed aggressive gastric cancer. No other studied proband has developed a carcinoma so far. Conclusion Our results showed that a germline mutation of STK11 gene can be found not only in probands fulfilling the PJS diagnostic criteria, but also in some sporadic cases not complying with the criteria. Moreover, we observed a new case of aggressive gastric cancer in a young patient with a frameshift mutation of STK11 gene. PMID:19615099

  10. The Direction Cosine Method of Scatterer Location Extended to Spotlight-Mode IFSAR

    SciTech Connect

    EICHEL,PAUL H.

    2000-10-26

    In this paper we have shown how the direction cosine method of stripmap-mode IFSAR maybe modified for use in the spotlight-mode case. Spotlight-mode IFSAR geometry dictates a common aperture phase center, velocity vector, and baseline vector for every pixel in an image. Angle with respect to the velocity vector is the same for every pixel in a given column and can be computed from the column index, the Doppler of the motion compensation point and the Doppler column sample spacing used in image formation. With these modifications, the direction cosines and length of the line of sight vector to every scatterer in the scene may be computed directly from the raw radar measurements of range, Doppler, and interferometric phase.

  11. Spotlight-Mode Synthetic Aperture Radar Processing for High-Resolution Lunar Mapping

    NASA Technical Reports Server (NTRS)

    Harcke, Leif; Weintraub, Lawrence; Yun, Sang-Ho; Dickinson, Richard; Gurrola, Eric; Hensley, Scott; Marechal, Nicholas

    2010-01-01

    During the 2008-2009 year, the Goldstone Solar System Radar was upgraded to support radar mapping of the lunar poles at 4 m resolution. The finer resolution of the new system and the accompanying migration through resolution cells called for spotlight, rather than delay-Doppler, imaging techniques. A new pre-processing system supports fast-time Doppler removal and motion compensation to a point. Two spotlight imaging techniques which compensate for phase errors due to i) out of focus-plane motion of the radar and ii) local topography, have been implemented and tested. One is based on the polar format algorithm followed by a unique autofocus technique, the other is a full bistatic time-domain backprojection technique. The processing system yields imagery of the specified resolution. Products enabled by this new system include topographic mapping through radar interferometry, and change detection techniques (amplitude and coherent change) for geolocation of the NASA LCROSS mission impact site.

  12. 7-Methoxy-2-nitronaphtho[2,1-b]furan (R7000)-induced mutation spectrum in the lacI gene of Escherichia coli: influence of SOS mutagenesis.

    PubMed

    Touati, E; Krin, E; Quillardet, P; Hofnung, M

    1996-12-01

    The mutagenic specificity of 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000), a very potent genotoxic 2-nitrofuran, was investigated in the lacI gene of E.coli. To analyze the influence of SOS-mutagenesis on R7000-induced mutations, 86 and 84 LacI- mutants were respectively isolated from umuC+ and umuC strains. Treatment of bacteria with increasing concentrations of R7000, affected 2-4 times more the survival rate in the umuC context, as compared to umuC+. 80% of all mutations occurred primarily at G:C base pairs and were substitution events and single-base frameshifts (-1) in the same proportions. The six possible substitution events were observed in both strains. In the umuC+ context, they were dominated by G:C-->T:A transversions. 38% of substitutions at G:C base pairs occurred in the consensus sequence 5'TGGCG3' or 5'TGGC3' where the G was mutated. When umuC was deficient G:C-->C:G transversions were mainly observed. The proportions of substitution mutations were very similar to those that have been reported for apurinic (AP) sites, suggesting strongly that one mechanism for R7000-induced mutations is the formation of intermediate abasic sites that serve as a substrate for error-prone repair. Single frameshift events consisted essentially of deletions of one (G:C) base pair in runs of contiguous G or C residues. Frameshift frequency increased with the length of the reiterated sequence, suggesting a strand-slippage process. Other mutational classes were recovered to a lower extent, including double-base frameshifts and large deletions. In addition, 10% of the mutants presented two proximate mutations. Comparison of the mutations induced by R7000 in the umuC+/umuC backgrounds suggests an influence of the umuC product on strand specificity of R7000-induced mutations, particularly in the case of frameshift events. PMID:9006087

  13. Spotlight on gefitinib in non-small-cell lung cancer.

    PubMed

    Frampton, James E; Easthope, Stephanie E

    2005-01-01

    Gefitinib (Iressa), the first commercially available epidermal growth factor receptor-tyrosine kinase (EGFR-TK) inhibitor, is indicated in the management of patients with locally advanced or metastatic non-small-cell lung cancer (NSCLC). However, approved uses differ between countries; in most markets, gefitinib is approved for third-line use only (e.g. the US, Canada and Switzerland), although in some it is approved for both second- and third-line use (e.g. Japan and Australia) and, additionally, in patients considered unsuitable for chemotherapy (e.g. Indonesia and the Philippines). Few third-line treatment options exist for patients with inoperable advanced NSCLC who have failed both docetaxel and platinum-based chemotherapy regimens. Gefitinib represents a significant advance in the treatment of this population; a once-daily oral dosage of 250 mg/day was well tolerated, produced objective tumour responses and disease stabilization, and improved disease-related symptoms and quality of life. It also produced overall survival outcomes that compared favorably with historical outcomes in a similar group of patients treated with three or four different chemotherapy regimens. These findings have been supported by observations from a global compassionate-use program. Ongoing or planned clinical trials are designed to confirm and/or further define the role of the drug in the above and other clinical settings. Preliminary data demonstrate the presence of activating mutations in EGFR-TK among patients whose disease was highly responsive to treatment with gefitinib, although such mutations have not been correlated to all patients who benefit from the drug. Further studies are needed to fully elucidate the clinical implications of EGFR mutations and to identify patients likely to benefit from EGFR-targeted therapy. PMID:15813676

  14. p63 Gene Mutations in EEC Syndrome, Limb-Mammary Syndrome, and Isolated Split Hand–Split Foot Malformation Suggest a Genotype-Phenotype Correlation

    PubMed Central

    van Bokhoven, Hans; Hamel, Ben C. J.; Bamshad, Mike; Sangiorgi, Eugenio; Gurrieri, Fiorella; Duijf, Pascal H. G.; Vanmolkot, Kaate R. J.; van Beusekom, Ellen; van Beersum, Sylvia E. C.; Celli, Jacopo; Merkx, Gerard F. M.; Tenconi, Romano; Fryns, Jean Pierre; Verloes, Alain; Newbury-Ecob, Ruth A.; Raas-Rotschild, Annick; Majewski, Frank; Beemer, Frits A.; Janecke, Andreas; Chitayat, David; Crisponi, Giangiorgio; Kayserili, Hülya; Yates, John R. W.; Neri, Giovanni; Brunner, Han G.

    2001-01-01

    p63 mutations have been associated with EEC syndrome (ectrodactyly, ectodermal dysplasia, and cleft lip/palate), as well as with nonsyndromic split hand–split foot malformation (SHFM). We performed p63 mutation analysis in a sample of 43 individuals and families affected with EEC syndrome, in 35 individuals affected with SHFM, and in three families with the EEC-like condition limb-mammary syndrome (LMS), which is characterized by ectrodactyly, cleft palate, and mammary-gland abnormalities. The results differed for these three conditions. p63 gene mutations were detected in almost all (40/43) individuals affected with EEC syndrome. Apart from a frameshift mutation in exon 13, all other EEC mutations were missense, predominantly involving codons 204, 227, 279, 280, and 304. In contrast, p63 mutations were detected in only a small proportion (4/35) of patients with isolated SHFM. p63 mutations in SHFM included three novel mutations: a missense mutation (K193E), a nonsense mutation (Q634X), and a mutation in the 3′ splice site for exon 5. The fourth SHFM mutation (R280H) in this series was also found in a patient with classical EEC syndrome, suggesting partial overlap between the EEC and SHFM mutational spectra. The original family with LMS (van Bokhoven et al. 1999) had no detectable p63 mutation, although it clearly localizes to the p63 locus in 3q27. In two other small kindreds affected with LMS, frameshift mutations were detected in exons 13 and 14, respectively. The combined data show that p63 is the major gene for EEC syndrome, and that it makes a modest contribution to SHFM. There appears to be a genotype-phenotype correlation, in that there is a specific pattern of missense mutations in EEC syndrome that are not generally found in SHFM or LMS. PMID:11462173

  15. Whole-exome Sequencing Analysis Identifies Mutations in the EYS Gene in Retinitis Pigmentosa in the Indian Population.

    PubMed

    Di, Yanan; Huang, Lulin; Sundaresan, Periasamy; Li, Shujin; Kim, Ramasamy; Ballav Saikia, Bibhuti; Qu, Chao; Zhu, Xiong; Zhou, Yu; Jiang, Zhilin; Zhang, Lin; Lin, Ying; Zhang, Dingding; Li, Yuanfen; Zhang, Houbin; Yin, Yibing; Lu, Fang; Zhu, Xianjun; Yang, Zhenglin

    2016-01-01

    Retinitis pigmentosa (RP) is a rare heterogeneous genetic retinal dystrophy disease, and despite years of research, known genetic mutations can explain only approximately 60% of RP cases. We sought to identify the underlying genetic mutations in a cohort of fourteen Indian autosomal recessive retinitis pigmentosa (arRP) families and 100 Indian sporadic RP cases. Whole-exome sequencing (WES) was performed on the probands of the arRP families and sporadic RP patients, and direct Sanger sequencing was used to confirm the causal mutations identified by WES. We found that the mutations of EYS are likely pathogenic mutations in two arRP families and eight sporadic patients. Specifically, we found a novel pair of compound heterozygous mutations and a novel homozygous mutation in two separate arRP families, and found two novel heterozygous mutations in two sporadic RP patients, whereas we found six novel homozygous mutations in six sporadic RP patients. Of these, one was a frameshift mutation, two were stop-gain mutations, one was a splicing mutation, and the others were missense mutations. In conclusion, our findings expand the spectrum of EYS mutations in RP in the Indian population and provide further support for the role of EYS in the pathogenesis and clinical diagnosis of RP. PMID:26787102

  16. Whole-exome Sequencing Analysis Identifies Mutations in the EYS Gene in Retinitis Pigmentosa in the Indian Population

    PubMed Central

    Di, Yanan; Huang, Lulin; Sundaresan, Periasamy; Li, Shujin; Kim, Ramasamy; Ballav Saikia, Bibhuti; Qu, Chao; Zhu, Xiong; Zhou, Yu; Jiang, Zhilin; Zhang, Lin; Lin, Ying; Zhang, Dingding; Li, Yuanfen; Zhang, Houbin; Yin, Yibing; Lu, Fang; Zhu, Xianjun; Yang, Zhenglin

    2016-01-01

    Retinitis pigmentosa (RP) is a rare heterogeneous genetic retinal dystrophy disease, and despite years of research, known genetic mutations can explain only approximately 60% of RP cases. We sought to identify the underlying genetic mutations in a cohort of fourteen Indian autosomal recessive retinitis pigmentosa (arRP) families and 100 Indian sporadic RP cases. Whole-exome sequencing (WES) was performed on the probands of the arRP families and sporadic RP patients, and direct Sanger sequencing was used to confirm the causal mutations identified by WES. We found that the mutations of EYS are likely pathogenic mutations in two arRP families and eight sporadic patients. Specifically, we found a novel pair of compound heterozygous mutations and a novel homozygous mutation in two separate arRP families, and found two novel heterozygous mutations in two sporadic RP patients, whereas we found six novel homozygous mutations in six sporadic RP patients. Of these, one was a frameshift mutation, two were stop-gain mutations, one was a splicing mutation, and the others were missense mutations. In conclusion, our findings expand the spectrum of EYS mutations in RP in the Indian population and provide further support for the role of EYS in the pathogenesis and clinical diagnosis of RP. PMID:26787102

  17. Diverse growth hormone receptor gene mutations in Laron syndrome

    SciTech Connect

    Berg, M.A.; Francke, U. ); Gracia, R.; Rosenbloom, A.; Toledo, S.P.A. ); Chernausek, S. ); Guevara-Aguirre, J. ); Hopp, M. ); Rosenbloom, A.; Argente, J. ); Toledo, S.P.A. )

    1993-05-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), the authors analysed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. They amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). They identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71+1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, they determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. The authors conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. 35 refs., 3 figs., 1 tab.

  18. Exonic microdeletions in the X-linked PQBP1 gene in mentally retarded patients: a pathogenic mutation and in-frame deletions of uncertain effect.

    PubMed

    Cossée, Mireille; Demeer, Bénédicte; Blanchet, Patricia; Echenne, Bernard; Singh, Deepika; Hagens, Olivier; Antin, Manuela; Finck, Sonja; Vallee, Louis; Dollfus, Hélène; Hegde, Sridevi; Springell, Kelly; Thelma, B K; Woods, Geoffrey; Kalscheuer, Vera; Mandel, Jean-Louis

    2006-04-01

    Mutations in PQBP1 were recently identified in families with syndromic and non-syndromic X-linked mental retardation (XLMR). Clinical features frequently associated with MR were microcephaly and/or short stature. The predominant mutations detected so far affect a stretch of six AG dinucleotides in the polar-amino-acid-rich domain (PRD), causing frameshifts in the fourth coding exon. We searched for PQBP1 exon 4 frameshifts in 57 mentally retarded males in whom initial referral description indicated at least one of the following criteria: microcephaly, short stature, spastic paraplegia or family history compatible with XLMR, and in 772 mentally retarded males not selected for specific clinical features or family history. We identified a novel frameshift mutation (23 bp deletion) in two half-brothers with specific clinical features, and performed prenatal diagnosis in this family. We also found two different 21 bp in-frame deletions (c.334-354del(21 bp) and c.393-413del(21 bp)) in four unrelated probands from various ethnic origins, each deleting one of five copies of an imperfect seven amino-acid repeat. Although such deletions have not been detected in 1180 X chromosomes from European controls, the c. 334-354del(21 bp) was subsequently found in two of 477 Xs from Indian controls. We conclude that pathogenic frameshift mutations in PQBP1 are rare in mentally retarded patients lacking specific associated signs and that the 21 bp in-frame deletions may be non-pathogenic, or alternatively could act subtly on PQBP1 function. This touches upon a common dilemma in XLMR, that is, how to distinguish between mutations and variants that may be non-pathogenic or represent risk factors for cognitive impairment. PMID:16493439

  19. Mutational characteristics of ANK1 and SPTB genes in hereditary spherocytosis.

    PubMed

    Park, J; Jeong, D-C; Yoo, J; Jang, W; Chae, H; Kim, J; Kwon, A; Choi, H; Lee, J W; Chung, N-G; Kim, M; Kim, Y

    2016-07-01

    The aim of this study was to describe the mutational characteristics in Korean hereditary spherocytosis (HS) patients. Relevant literatures including genetically confirmed cases with well-documented clinical summaries and relevant information were also reviewed to investigate the mutational gene- or domain-specific laboratory and clinical association. Twenty-five HS patients carried one heterozygous mutation of ANK1 (n = 13) or SPTB (n = 12) but not in SPTA1, SLC4A1, or EPB42. Deleterious mutations including frameshift, nonsense, and splice site mutations were identified in 91% (21/23), and non-hotspot mutations were dispersed across multiple exons. Genotype-phenotype correlation was clarified after combined analysis of the cases and the literature review; anemia was most severe in HS patients with mutations on the ANK1 spectrin-binding domain (p < 0.05), and SPTB mutations in HS patients spared the tetramerization domain in which mutations of hereditary elliptocytosis and pyropoikilocytosis are located. Splenectomy (17/75) was more frequent in ANK1 mutant HS (32%) than in HS with SPTB mutation (10%) (p = 0.028). Aplastic crisis occurred in 32.0% of the patients (8/25; 3 ANK1 and 5 SPTB), and parvovirus B19 was detected in 88%. The study clarifies ANK1 or SPTB mutational characteristics in HS Korean patients. The genetic association of laboratory and clinical aspects suggests comprehensive considerations for genetic-based management of HS. PMID:26830532

  20. ADIPOR1 Is Mutated in Syndromic Retinitis Pigmentosa.

    PubMed

    Xu, Mingchu; Eblimit, Aiden; Wang, Jing; Li, Jianli; Wang, Feng; Zhao, Li; Wang, Xia; Xiao, Ningna; Li, Yumei; Wong, Lee-Jun C; Lewis, Richard A; Chen, Rui

    2016-03-01

    Retinitis pigmentosa (RP) is a genetically heterogeneous retinal disorder. Despite the numerous genes associated with RP already identified, the genetic basis remains unknown in a substantial number of patients and families. In this study, we performed whole-exome sequencing to investigate the molecular basis of a syndromic RP case that cannot be solved by mutations in known disease-causing genes. After applying a series of variant filtering strategies, we identified an apparently homozygous frameshift mutation, c.31delC (p.Q11Rfs*24) in the ADIPOR1 gene. The reported phenotypes of Adipor1-null mice contain retinal dystrophy, obesity, and behavioral abnormalities, which highly mimic those in the syndromic RP patient. We further confirmed ADIPOR1 retina expression by immunohistochemistry. Our results established ADIPOR1 as a novel disease-causing gene for syndromic RP and highlight the importance of fatty acid transport in the retina. PMID:26662040

  1. Ribosomal frameshifting used in influenza A virus expression occurs within the sequence UCC_UUU_CGU and is in the +1 direction.

    PubMed

    Firth, A E; Jagger, B W; Wise, H M; Nelson, C C; Parsawar, K; Wills, N M; Napthine, S; Taubenberger, J K; Digard, P; Atkins, J F

    2012-10-01

    Programmed ribosomal frameshifting is used in the expression of many virus genes and some cellular genes. In eukaryotic systems, the most well-characterized mechanism involves -1 tandem tRNA slippage on an X_XXY_YYZ motif. By contrast, the mechanisms involved in programmed +1 (or -2) slippage are more varied and often poorly characterized. Recently, a novel gene, PA-X, was discovered in influenza A virus and found to be expressed via a shift to the +1 reading frame. Here, we identify, by mass spectrometric analysis, both the site (UCC_UUU_CGU) and direction (+1) of the frameshifting that is involved in PA-X expression. Related sites are identified in other virus genes that have previously been proposed to be expressed via +1 frameshifting. As these viruses infect insects (chronic bee paralysis virus), plants (fijiviruses and amalgamaviruses) and vertebrates (influenza A virus), such motifs may form a new class of +1 frameshift-inducing sequences that are active in diverse eukaryotes. PMID:23155484

  2. Ribosomal frameshifting used in influenza A virus expression occurs within the sequence UCC_UUU_CGU and is in the +1 direction

    PubMed Central

    Firth, A. E.; Jagger, B. W.; Wise, H. M.; Nelson, C. C.; Parsawar, K.; Wills, N. M.; Napthine, S.; Taubenberger, J. K.; Digard, P.; Atkins, J. F.

    2012-01-01

    Programmed ribosomal frameshifting is used in the expression of many virus genes and some cellular genes. In eukaryotic systems, the most well-characterized mechanism involves –1 tandem tRNA slippage on an X_XXY_YYZ motif. By contrast, the mechanisms involved in programmed +1 (or −2) slippage are more varied and often poorly characterized. Recently, a novel gene, PA-X, was discovered in influenza A virus and found to be expressed via a shift to the +1 reading frame. Here, we identify, by mass spectrometric analysis, both the site (UCC_UUU_CGU) and direction (+1) of the frameshifting that is involved in PA-X expression. Related sites are identified in other virus genes that have previously been proposed to be expressed via +1 frameshifting. As these viruses infect insects (chronic bee paralysis virus), plants (fijiviruses and amalgamaviruses) and vertebrates (influenza A virus), such motifs may form a new class of +1 frameshift-inducing sequences that are active in diverse eukaryotes. PMID:23155484

  3. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

    2010-01-01

    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  4. FERMT1 promoter mutations in patients with Kindler syndrome.

    PubMed

    Has, C; Chmel, N; Levati, L; Neri, I; Sonnenwald, T; Pigors, M; Godbole, K; Dudhbhate, A; Bruckner-Tuderman, L; Zambruno, G; Castiglia, D

    2015-09-01

    Mutations in the FERMT1 gene, encoding the focal adhesion protein kindlin-1 underlie the Kindler syndrome (KS), an autosomal recessive skin disorder with a phenotype comprising skin blistering, photosensitivity, progressive poikiloderma with extensive skin atrophy, and propensity to skin cancer. The FERMT1 mutational spectrum comprises gross genomic deletions, splice site, nonsense, and frameshift mutations, which are scattered over the coding region spanning exon 2-15. We now report three KS families with mutations affecting the promoter region of FERMT1. Two of these mutations are large deletions (∼38.0 and 1.9 kb in size) and one is a single nucleotide variant (c.-20A>G) within the 5' untranslated region (UTR). Each mutation resulted in loss of gene expression in patient skin or cultured keratinocytes. Reporter assays showed the functional relevance of the genomic regions deleted in our patients for FERMT1 gene transcription and proved the causal role of the c.-20A>G variant in reducing transcriptional activity. PMID:25156791

  5. The identification of point mutations in Duchenne muscular dystrophy patients by using reverse-transcription PCR and the protein truncation test

    SciTech Connect

    Gardner, R.J.; Bobrow, M.; Roberts, R.G.

    1995-08-01

    The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.

  6. Solenopsis invicta virus 3: Mapping of Structural Proteins, Ribosomal Frameshifting, and Similarities to Acyrthosiphon pisum virus and Kelp fly virus

    PubMed Central

    Valles, Steven M.; Bell, Susanne; Firth, Andrew E.

    2014-01-01

    Solenopsis invicta virus 3 (SINV-3) is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF) of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV), an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order. PMID:24686475

  7. A Novel Loss-of-Sclerostin Function Mutation in a First Egyptian Family with Sclerosteosis

    PubMed Central

    Fayez, Alaaeldin; Aglan, Mona; Esmaiel, Nora; El Zanaty, Taher; Abdel Kader, Mohamed; El Ruby, Mona

    2015-01-01

    Sclerosteosis is a rare autosomal recessive condition characterized by increased bone density. Mutations in SOST gene coding for sclerostin are linked to sclerosteosis. Two Egyptian brothers with sclerosteosis and their apparently normal consanguineous parents were included in this study. Clinical evaluation and genomic sequencing of the SOST gene were performed followed by in silico analysis of the resulting variation. A novel homozygous frameshift mutation in the SOST gene, characterized as one nucleotide cytosine insertion that led to premature stop codon and loss of functional sclerostin, was identified in the two affected brothers. Their parents were heterozygous for the same mutation. To our knowledge this is the first Egyptian study of sclerosteosis and SOST gene causing mutation. PMID:25984533

  8. A novel de novo mutation in LAMB3 causes localized hypoplastic enamel in the molar region.

    PubMed

    Kim, Young-Jae; Shin, Teo J; Hyun, Hong-Keun; Lee, Sang-Hoon; Lee, Zang H; Kim, Jung-Wook

    2016-08-01

    Amelogenesis imperfecta (AI) is a collection of diseases characterized by hereditary enamel defects and is heterogeneous in genetic etiology and clinical phenotype. In this study, we recruited a nuclear AI family with a proband having unique irregular hypoplastic pits and grooves in all surfaces of the deciduous molar teeth but not in the deciduous anterior teeth. Based on the candidate gene approach, we screened the laminin subunit beta 3 (LAMB3) gene and identified a novel de novo mutation in the proband. The mutation was a frameshift mutation caused by a heterozygous 7-bp deletion in the last exon (c.3452_3458delAGAAGCG, p.Glu1151Valfs*57). This study not only expands the mutational spectrum of the LAMB3 gene causing isolated AI but also broadens the understanding of genotype-phenotype correlations. PMID:27220909

  9. KRAS Mutation

    PubMed Central

    Franklin, Wilbur A.; Haney, Jerry; Sugita, Michio; Bemis, Lynne; Jimeno, Antonio; Messersmith, Wells A.

    2010-01-01

    Treatment of colon carcinoma with the anti-epidermal growth factor receptor antibody Cetuximab is reported to be ineffective in KRAS-mutant tumors. Mutation testing techniques have therefore become an urgent concern. We have compared three methods for detecting KRAS mutations in 59 cases of colon carcinoma: 1) high resolution melting, 2) the amplification refractory mutation system using a bifunctional self-probing primer (ARMS/Scorpion, ARMS/S), and 3) direct sequencing. We also evaluated the effects of the methods of sectioning and coring of paraffin blocks to obtain tumor DNA on assay sensitivity and specificity. The most sensitive and specific combination of block sampling and mutational analysis was ARMS/S performed on DNA derived from 1-mm paraffin cores. This combination of tissue sampling and testing method detected KRAS mutations in 46% of colon tumors. Four samples were positive by ARMS/S, but initially negative by direct sequencing. Cloned DNA samples were retested by direct sequencing, and in all four cases KRAS mutations were identified in the DNA. In six cases, high resolution melting abnormalities could not be confirmed as specific mutations either by ARMS/S or direct sequencing. We conclude that coring of the paraffin blocks and testing by ARMS/S is a sensitive, specific, and efficient method for KRAS testing. PMID:20007845

  10. Infantile onset spinocerebellar ataxia caused by compound heterozygosity for Twinkle mutations and modeling of Twinkle mutations causing recessive disease.

    PubMed

    Pierce, Sarah B; Gulsuner, Suleyman; Stapleton, Gail A; Walsh, Tom; Lee, Ming K; Mandell, Jessica B; Morales, Augusto; Klevit, Rachel E; King, Mary-Claire; Rogers, R Curtis

    2016-07-01

    Mutations in nuclear genes required for the replication and maintenance of mitochondrial DNA cause progressive multisystemic neuromuscular disorders with overlapping phenotypes. Biallelic mutations in C10orf2, encoding the Twinkle mitochondrial DNA helicase, lead to infantile-onset cerebellar ataxia (IOSCA), as well as milder and more severe phenotypes. We present a 13-year-old girl with ataxia, severe hearing loss, optic atrophy, peripheral neuropathy, and hypergonadotropic hypogonadism. Whole-exome sequencing revealed that the patient is compound heterozygous for previously unreported variants in the C10orf2 gene: a paternally inherited frameshift variant (c.333delT; p.L112Sfs*3) and a maternally inherited missense variant (c.904C>T; p.R302W). The identification of novel C10orf2 mutations extends the spectrum of mutations in the Twinkle helicase causing recessive disease, in particular the intermediate IOSCA phenotype. Structural modeling suggests that the p.R302W mutation and many other recessively inherited Twinkle mutations impact the position or interactions of the linker region, which is critical for the oligomeric ring structure and activity of the helicase. This study emphasizes the utility of whole-exome sequencing for the genetic diagnosis of a complex multisystemic disorder. PMID:27551684

  11. Infantile onset spinocerebellar ataxia caused by compound heterozygosity for Twinkle mutations and modeling of Twinkle mutations causing recessive disease

    PubMed Central

    Gulsuner, Suleyman; Stapleton, Gail A.; Walsh, Tom; Lee, Ming K.; Mandell, Jessica B.; Morales, Augusto; Klevit, Rachel E.; King, Mary-Claire; Rogers, R. Curtis

    2016-01-01

    Mutations in nuclear genes required for the replication and maintenance of mitochondrial DNA cause progressive multisystemic neuromuscular disorders with overlapping phenotypes. Biallelic mutations in C10orf2, encoding the Twinkle mitochondrial DNA helicase, lead to infantile-onset cerebellar ataxia (IOSCA), as well as milder and more severe phenotypes. We present a 13-year-old girl with ataxia, severe hearing loss, optic atrophy, peripheral neuropathy, and hypergonadotropic hypogonadism. Whole-exome sequencing revealed that the patient is compound heterozygous for previously unreported variants in the C10orf2 gene: a paternally inherited frameshift variant (c.333delT; p.L112Sfs*3) and a maternally inherited missense variant (c.904C>T; p.R302W). The identification of novel C10orf2 mutations extends the spectrum of mutations in the Twinkle helicase causing recessive disease, in particular the intermediate IOSCA phenotype. Structural modeling suggests that the p.R302W mutation and many other recessively inherited Twinkle mutations impact the position or interactions of the linker region, which is critical for the oligomeric ring structure and activity of the helicase. This study emphasizes the utility of whole-exome sequencing for the genetic diagnosis of a complex multisystemic disorder. PMID:27551684

  12. Steroid 21-hydroxylase deficiency: three additional mutated alleles and establishment of phenotype-genotype relationships of common mutations.

    PubMed Central

    Wedell, A; Ritzén, E M; Haglund-Stengler, B; Luthman, H

    1992-01-01

    Lesions in the gene encoding steroid 21-hydroxylase [steroid hydrogen-donor: oxygen oxidoreductase (21-hydroxylating), EC 1.14.99.10] result in defective adrenal steroid synthesis; the severe forms are known as congenital adrenal hyperplasia. To facilitate complete characterization of mutations in this region of tandemly repeated genes, we have developed selective PCR amplification and direct sequencing of full-length nonpseudogene steroid 21-hydroxylase genes. This technique identifies known mutations, characterizes or excludes unknown mutations, and determines the gene-copy number. Three additional defective alleles were found. A Gly-292----Ser mutation and a frameshift mutation at Arg-484 (GG----C) were identified in patients with severe steroid 21-hydroxylase deficiency. An allele with three additional sequence variations--C----T at 4 bases upstream of translation initiation, Pro-106----Leu, and Pro-454----Ser--were identified in two siblings with late-onset deficiency. Pro-454 is conserved in four species, indicating its importance for normal enzyme function. Functional consequences of individual alleles have been determined in vivo by studying individuals with only one steroid 21-hydroxylase gene. Detailed analyses of clinical data revealed that genotyping could predict the clinical course of the disease. The locations of disease-causing mutations on different haplotypes of the steroid 21-hydroxylase gene region are described. Images PMID:1496017

  13. Scientist Spotlight Homework Assignments Shift Students' Stereotypes of Scientists and Enhance Science Identity in a Diverse Introductory Science Class.

    PubMed

    Schinske, Jeffrey N; Perkins, Heather; Snyder, Amanda; Wyer, Mary

    2016-01-01

    Research into science identity, stereotype threat, and possible selves suggests a lack of diverse representations of scientists could impede traditionally underserved students from persisting and succeeding in science. We evaluated a series of metacognitive homework assignments ("Scientist Spotlights") that featured counterstereotypical examples of scientists in an introductory biology class at a diverse community college. Scientist Spotlights additionally served as tools for content coverage, as scientists were selected to match topics covered each week. We analyzed beginning- and end-of-course essays completed by students during each of five courses with Scientist Spotlights and two courses with equivalent homework assignments that lacked connections to the stories of diverse scientists. Students completing Scientist Spotlights shifted toward counterstereotypical descriptions of scientists and conveyed an enhanced ability to personally relate to scientists following the intervention. Longitudinal data suggested these shifts were maintained 6 months after the completion of the course. Analyses further uncovered correlations between these shifts, interest in science, and course grades. As Scientist Spotlights require very little class time and complement existing curricula, they represent a promising tool for enhancing science identity, shifting stereotypes, and connecting content to issues of equity and diversity in a broad range of STEM classrooms. PMID:27587856

  14. Ten novel mutations in VMD2 associated with Best macular dystrophy (BMD).

    PubMed

    Krämer, Franziska; Mohr, Nicole; Kellner, Ulrich; Rudolph, Günther; Weber, Bernhard H F

    2003-11-01

    Mutations in the vitelliform macular dystrophy 2 (VMD2) gene encoding besrtophin are responsible for Best macular dystrophy (BMD), a juvenile-onset autosomal dominant disorder of the central retina. Here, we report ten novel VMD2 mutations identified in clinically diagnosed BMD patients. The heterozygous alterations include nine missense mutations (c.32A>T, c.76G>C, c.85T>C, c.122T>C, c.122T>C, c.310G>C, c.722C>A, c.880C>G, c.893T>C) resulting in amino acid changes (respectively: Asn11Ile, Gly26Arg, Tyr29His, Leu41Pro, Trp102Arg, Asp104His, Thr241Asn, Leu294Val and Phe298Ser) located within four previously defined hotspot regions of the gene. In addition, a silent exonic mutation (c.624G>A) was identified in a two generation BMD pedigree. To determine a possible pathogenic effect of this variant, the consequences on splicing behaviour and potential exonic splice enhancer (ESE) motifs were analyzed. Finally, a 1-bp deletion (c.779delC) resulting in a frameshift mutation (Pro260fsX288) was found in exon 7, representing the first case of a potential frameshift mutation that affects the N-terminal half of the VMD2 protein. Besides a dominant negative effect which is likely attributable to the identified missense mutations, the deletion mutation suggests haploinsufficiency as an infrequent disease-causing mechanism in BMD. PMID:14517959

  15. The spectrum of mutations that underlie the neuromuscular junction synaptopathy in DOK7 congenital myasthenic syndrome.

    PubMed

    Cossins, Judith; Liu, Wei Wei; Belaya, Katsiaryna; Maxwell, Susan; Oldridge, Michael; Lester, Tracy; Robb, Stephanie; Beeson, David

    2012-09-01

    Congenital myasthenic syndromes (CMS) are a group of inherited diseases that affect synaptic transmission at the neuromuscular junction and result in fatiguable muscle weakness. A subgroup of CMS patients have a recessively inherited limb-girdle pattern of weakness caused by mutations in DOK7. DOK7 encodes DOK7, an adaptor protein that is expressed in the skeletal muscle and heart and that is essential for the development and maintenance of the neuromuscular junction. We have screened the DOK7 gene for mutations by polymerase chain reaction amplification and bi-directional sequencing of exonic and promoter regions and performed acetylcholine receptor (AChR) clustering assays and used exon trapping to determine the pathogenicity of detected variants. Approximately 18% of genetically diagnosed CMSs in the UK have mutations in DOK7, with mutations in this gene identified in more than 60 kinships to date. Thirty-four different pathogenic mutations were identified as well as 27 variants likely to be non-pathogenic. An exon 7 frameshift duplication c.1124_1127dupTGCC is commonly found in at least one allele. We analyse the effect of the common frameshift c.1124_1127dupTGCC and show that 10/11 suspected missense mutations have a deleterious effect on AChR clustering. We identify for the first time homozygous or compound heterozygous mutations that are localized 5' to exon 7. In addition, three silent variants in the N-terminal half of DOK7 are predicted to alter the splicing of the DOK7 RNA transcript. The DOK7 gene is highly polymorphic, and within these many variants, we define a spectrum of mutations that can underlie DOK7 CMS that will inform in managing this disorder. PMID:22661499

  16. Next-generation sequencing identifies novel CACNA1A gene mutations in episodic ataxia type 2.

    PubMed

    Maksemous, Neven; Roy, Bishakha; Smith, Robert A; Griffiths, Lyn R

    2016-03-01

    Episodic Ataxia type 2 (EA2) is a rare autosomal dominantly inherited neurological disorder characterized by recurrent disabling imbalance, vertigo, and episodes of ataxia lasting minutes to hours. EA2 is caused most often by loss of function mutations of the calcium channel gene CACNA1A. In addition to EA2, mutations in CACNA1A are responsible for two other allelic disorders: familial hemiplegic migraine type 1 (FHM1) and spinocerebellar ataxia type 6 (SCA6). Herein, we have utilized next-generation sequencing (NGS) to screen the coding sequence, exon-intron boundaries, and Untranslated Regions (UTRs) of five genes where mutation is known to produce symptoms related to EA2, including CACNA1A. We performed this screening in a group of 31 unrelated patients with EA2 symptoms. Both novel and known mutations were detected through NGS technology, and confirmed through Sanger sequencing. Genetic testing showed in total 15 mutation bearing patients (48%), of which nine were novel mutations (6 missense and 3 small frameshift deletion mutations) and six known mutations (4 missense and 2 nonsense).These results demonstrate the efficiency of our NGS-panel for detecting known and novel mutations for EA2 in the CACNA1A gene, also identifying a novel missense mutation in ATP1A2 which is not a normal target for EA2 screening. PMID:27066515

  17. Three novel ZBTB24 mutations identified in Japanese and Cape Verdean type 2 ICF syndrome patients.

    PubMed

    Nitta, Hirohisa; Unoki, Motoko; Ichiyanagi, Kenji; Kosho, Tomoki; Shigemura, Tomonari; Takahashi, Hiroshi; Velasco, Guillaume; Francastel, Claire; Picard, Capucine; Kubota, Takeo; Sasaki, Hiroyuki

    2013-07-01

    Immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disorder that shows DNA hypomethylation at pericentromeric satellite-2 and -3 repeats in chromosomes 1, 9 and 16. ICF syndrome is classified into two groups: type 1 (ICF1) patients have mutations in the DNMT3B gene and about half of type 2 (ICF2) patients have mutations in the ZBTB24 gene. Besides satellite-2 and -3 repeats, α-satellite repeats are also hypomethylated in ICF2. In this study, we report three novel ZBTB24 mutations in ICF2. A Japanese patient was homozygous for a missense mutation (C383Y), and a Cape Verdean patient was compound heterozygous for a nonsense mutation (K263X) and a frame-shift mutation (C327W fsX54). In addition, the second Japanese patient was homozygous for a previously reported nonsense mutation (R320X). The C383Y mutation abolished a C2H2 motif in one of the eight zinc-finger domains, and the other three mutations caused a complete or large loss of the zinc-finger domains. Our immunofluorescence analysis revealed that mouse Zbtb24 proteins possessing a mutation corresponding to either C383Y or R320X are mislocalized from pericentrometic heterochromatin, suggesting the importance of the zinc-finger domains in proper intranuclear localization of this protein. We further revealed that the proper localization of wild-type Zbtb24 protein does not require DNA methylation. PMID:23739126

  18. Importance of lunar and temporal conditions for spotlight surveys of adult black-footed ferrets

    USGS Publications Warehouse

    Eads, David A.; Jachowski, David S.; Millspaugh, Joshua J.; Biggins, Dean E.

    2012-01-01

    Black-footed ferrets (Mustela nigripes) spend most daylight hours underground in prairie dog (Cynomys) burrows and exhibit aboveground movements primarily at night. Moonlight can influence the activity patterns of ferrets and, consequently, might influence the efficiency of spotlight surveys used by biologists to monitor ferret populations. We related detection of adult ferrets during postbreeding spotlight surveys to lunar and temporal conditions. We most frequently located ferrets during surveys in which the moon breached the horizon. The data suggested intersexual differences in response to moonlight. We located male ferrets most frequently during nights with greater moon illumination, but we did not detect a correlation between moon illumination and spotlight detection of female ferrets. In general, moonlight could facilitate aboveground navigation by ferrets. However, it seems activity under bright moonlight could be costly for female ferrets while they raise young. Detection of ferrets also varied among months. We detected female ferrets most frequently in August–September, when mothers increase hunting efforts to acquire prey for growing offspring (kits). Detection of adult female ferrets declined in October, when kits were likely independent of their mother. We located male ferrets most frequently in September–October, when males might increase activity to monitor female ferrets and male competitors. Consideration of lunar and temporal influences and standardization of postbreeding surveys could enhance site-specific assessment of reintroduction success and across-site assessment of species recoveiy progress. We suggest that postbreeding surveys for ferrets should be enhanced by concentrating efforts in August–September during moonlit nights when the moon is above the horizon.

  19. Splice-site mutation of the p53 gene in a family with hereditary breast-ovarian cancer.

    PubMed

    Jolly, K W; Malkin, D; Douglass, E C; Brown, T F; Sinclair, A E; Look, A T

    1994-01-01

    Germline mutations within evolutionary conserved exons of the p53 gene predispose to tumor development in several familial cancer syndromes. We now report identification of a novel p53 mutation affecting the splice acceptor site of exon 6 in the germline DNA of a family with hereditary breast-ovarian cancer. This splice-site mutation, which results in omission of exon 6 and creates a frame-shift and premature stop codon in transcripts from the mutant allele, was found in seven family members--four of whom have developed breast, ovarian or choroid plexus tumors before age 35. Our finding suggests the need to examine the entire p53 gene for splice-site, frame-shift, and nonsense (as well as missense) mutations in families with early-onset hereditary breast and breast-ovarian cancers not linked to the BRCA1 gene on chromosome 17q. We propose that the term 'p53 familial cancer syndrome' be applied to clusters of tumors in families with documented germline p53 mutations, regardless of the histopathologic findings or pattern of tumor development. PMID:8302608

  20. Truncating Mutations of MAGEL2, a Gene within the Prader-Willi Locus, Are Responsible for Severe Arthrogryposis.

    PubMed

    Mejlachowicz, Dan; Nolent, Flora; Maluenda, Jérome; Ranjatoelina-Randrianaivo, Hanitra; Giuliano, Fabienne; Gut, Ivo; Sternberg, Damien; Laquerrière, Annie; Melki, Judith

    2015-10-01

    Arthrogryposis multiplex congenita (AMC) is characterized by the presence of multiple joint contractures resulting from reduced or absent fetal movement. Here, we report two unrelated families affected by lethal AMC. By genetic mapping and whole-exome sequencing in a multiplex family, a heterozygous truncating MAGEL2 mutation leading to frameshift and a premature stop codon (c.1996delC, p.Gln666Serfs∗36) and inherited from the father was identified in the probands. In another family, a distinct heterozygous truncating mutation leading to frameshift (c.2118delT, p.Leu708Trpfs∗7) and occurring de novo on the paternal allele of MAGEL2 was identified in the affected individual. In both families, RNA analysis identified the mutated paternal MAGEL2 transcripts only in affected individuals. MAGEL2 is one of the paternally expressed genes within the Prader-Willi syndrome (PWS) locus. PWS is associated with, to varying extents, reduced fetal mobility, severe infantile hypotonia, childhood-onset obesity, hypogonadism, and intellectual disability. MAGEL2 mutations have been recently reported in affected individuals with features resembling PWS and called Schaaf-Yang syndrome. Here, we show that paternal MAGEL2 mutations are also responsible for lethal AMC, recapitulating the clinical spectrum of PWS and suggesting that MAGEL2 is a PWS-determining gene. PMID:26365340

  1. Mutations in TMEM76* Cause Mucopolysaccharidosis IIIC (Sanfilippo C Syndrome)

    PubMed Central

    Hřebíček, Martin; Mrázová, Lenka; Seyrantepe, Volkan; Durand, Stéphanie; Roslin, Nicole M.; Nosková, Lenka; Hartmannová, Hana; Ivánek, Robert; Čížková, Alena; Poupětová, Helena; Sikora, Jakub; Uřinovská, Jana; Stránecký, Viktor; Zeman, Jiří; Lepage, Pierre; Roquis, David; Verner, Andrei; Ausseil, Jérôme; Beesley, Clare E.; Maire, Irène; Poorthuis, Ben J. H. M.; van de Kamp, Jiddeke; van Diggelen, Otto P.; Wevers, Ron A.; Hudson, Thomas J.; Fujiwara, T. Mary; Majewski, Jacek; Morgan, Kenneth; Kmoch, Stanislav; Pshezhetsky, Alexey V.

    2006-01-01

    Mucopolysaccharidosis IIIC (MPS IIIC, or Sanfilippo C syndrome) is a lysosomal storage disorder caused by the inherited deficiency of the lysosomal membrane enzyme acetyl–coenzyme A:α-glucosaminide N-acetyltransferase (N-acetyltransferase), which leads to impaired degradation of heparan sulfate. We report the narrowing of the candidate region to a 2.6-cM interval between D8S1051 and D8S1831 and the identification of the transmembrane protein 76 gene (TMEM76), which encodes a 73-kDa protein with predicted multiple transmembrane domains and glycosylation sites, as the gene that causes MPS IIIC when it is mutated. Four nonsense mutations, 3 frameshift mutations due to deletions or a duplication, 6 splice-site mutations, and 14 missense mutations were identified among 30 probands with MPS IIIC. Functional expression of human TMEM76 and the mouse ortholog demonstrates that it is the gene that encodes the lysosomal N-acetyltransferase and suggests that this enzyme belongs to a new structural class of proteins that transport the activated acetyl residues across the cell membrane. PMID:17033958

  2. Cherry Featured in NCI’s Spotlight on Scientists Video Series | Poster

    Cancer.gov

    James Cherry, Ph.D., learned at an early age that education is crucial to success. He credits his mentors, some of whom include his grandmother, Shepherd University professor Burton Lidgerding, Ph.D., David Munroe, Ph.D., Frederick National Lab, and Robert J. Hohman, Ph.D., National Institute of Allergy and Infectious Diseases, for guiding him to the career he has today. Cherry, scientific program director, Office of Scientific Operations (OSO), NCI at Frederick, is one of the scientists featured in NCI’s Spotlight on Scientists video series.

  3. Cherry Featured in NCI’s Spotlight on Scientists Video Series | Poster

    Cancer.gov

    James Cherry, Ph.D., learned at an early age that education is crucial to success. He credits his mentors, some of whom include his grandmother, Shepherd University professor Burton Lidgerding, Ph.D., David Munroe, Ph.D., Frederick National Lab, and Robert J. Hohman, Ph.D., National Institute of Allergy and Infectious Diseases, for guiding him to the career he has today. Cherry, scientific program director, Office of Scientific Operations (OSO), NCI at Frederick, is one of the scientists featured in NCI’s Spotlight on Scientists video series.

  4. Direct Geolocation of TerraSAR-X Spotlight Mode Image and Error Correction

    NASA Astrophysics Data System (ADS)

    Zhou, Xiao; Zeng, Qiming; Jiao, Jian; Zhang, Jingfa; Gong, Lixia

    2013-01-01

    The research dealt with direct geolocation of spaceborne high-resolution SAR image. The TerraSAR-X spotlight mode image was chosen as the study object. The mathematical model of SAR geolocation is Range-Doppler (RD) model. Its resolving algorithms had been studied and the ASF algorithm was chosen because of its high accuracy. The focus of this research laid on the error sources and their correction method which could affect the geolocation accuracy, such as the orbit errors, azimuth timing errors and range timing errors. At last, the accuracy of this method was verified by the experiment results.

  5. A de novo frameshift in HNRNPK causing a Kabuki-like syndrome with nodular heterotopia.

    PubMed

    Lange, L; Pagnamenta, A T; Lise, S; Clasper, S; Stewart, H; Akha, E S; Quaghebeur, G; Knight, S J L; Keays, D A; Taylor, J C; Kini, U

    2016-09-01

    Kabuki syndrome is a heterogeneous condition characterized by distinctive facial features, intellectual disability, growth retardation, skeletal abnormalities and a range of organ malformations. Although at least two major causative genes have been identified, these do not explain all cases. Here we describe a patient with a complex Kabuki-like syndrome that included nodular heterotopia, in whom testing for several single-gene disorders had proved negative. Exome sequencing uncovered a de novo c.931_932insTT variant in HNRNPK (heterogeneous nuclear ribonucleoprotein K). Although this variant was identified in March 2012, its clinical relevance could only be confirmed following the August 2015 publication of two cases with HNRNPK mutations and an overlapping phenotype that included intellectual disability, distinctive facial dysmorphism and skeletal/connective tissue abnormalities. Whilst we had attempted (unsuccessfully) to identify additional cases through existing collaborators, the two published cases were 'matched' using GeneMatcher, a web-based tool for connecting researchers and clinicians working on identical genes. Our report therefore exemplifies the importance of such online tools in clinical genetics research and the benefits of periodically reviewing cases with variants of unproven significance. Our study also suggests that loss of function variants in HNRNPK should be considered as a molecular basis for patients with Kabuki-like syndrome. PMID:26954065

  6. Laminin gene LAMB4 is somatically mutated and expressionally altered in gastric and colorectal cancers.

    PubMed

    Choi, Mi Ryoung; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung

    2015-01-01

    Laminins are important in tumor invasion and metastasis as well as in maintenance of normal epithelial cell structures. However, mutation status of laminin chain-encoding genes remains unknown in cancers. Aim of this study was to explore whether laminin chain genes are mutated and expressionally altered in gastric (GC) and colorectal cancers (CRC). In a public database, we found that laminin chain genes LAMA1, LAMA3, LAMB1 and LAMB4 had mononucleotide repeats in the coding sequences that might be mutation targets in the cancers with microsatellite instability (MSI). We analyzed the genes in 88 GC and 139 CRC [high MSI (MSI-H) or stable MSI/low MSI (MSS/MSI-L)] by single strand conformation polymorphism analysis and DNA sequencing. In the present study, we found LAMB4 (11.8% of GC and 7.6% of CRC with MSI-H), LAMA3 (2.9% of GC and 2.5 of CRC with MSI-H), LAMA1 (5.9% of GC with MSI-H) and LAMB1 frameshift mutations (1.3% of CRC with MSI-H). These mutations were not found in MSS/MSI-L (0/114). We also analyzed LAMB4 expression in GC and CRC by immunohistochemistry. Loss of LAMB4 expression was identified in 17-32% of the GC and CRC. Of note, the loss expression was more common in the cancers with LAMB4 mutation or those with MSI-H. Our data show that frameshift mutations of LAMA1, LAMA3, LAMB1 and LAMB4, and loss of LAMB4 may be features of GC and CRC with MSI-H. PMID:25257191

  7. Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient

    SciTech Connect

    Choy, F.Y.M.; Humphries, M.L.; Ferreira, P.

    1997-01-20

    Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed while the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.

  8. Laminin-5 mutational analysis in an Italian cohort of patients with junctional epidermolysis bullosa.

    PubMed

    Posteraro, Patrizia; De Luca, Naomi; Meneguzzi, Guerrino; El Hachem, May; Angelo, Corrado; Gobello, Tommaso; Tadini, Gianluca; Zambruno, Giovanna; Castiglia, Daniele

    2004-10-01

    Junctional epidermolysis bullosa (JEB) is a rare genodermatosis characterized by dermal-epidermal separation that is caused by mutations in the genes encoding hemidesmosomal components and laminin-5, the major epithelial adhesion ligand. Here, we report on the mutational analysis of LAMA3, LAMB3, and LAMC2 genes encoding laminin-5 chains in 19 Italian patients, 11 affected with the severe Herlitz (H JEB) and eight with the mild non-Herlitz variant of JEB (non-H JEB). Eighteen mutations, seven of which were novel, were identified and their consequences analyzed at the mRNA and protein level. Premature termination codon mutations in both alleles of LAMB3 or LAMC2 genes were found in nine of the 11 H JEB patients, with a prevalence of mutations in LAMC2. In one case, a homozygous frameshift mutation in LAMB3 was associated to illegitimate splicing leading to non-H JEB. One H JEB patient showed a large intragenic duplication within LAMC2, a genetic defect so far uncovered in laminin-5 genes. Splicing or missense mutations, were prevalent in non-H JEB patients. Collectively, five mutations appeared to be frequent in laminin-5 JEB patients: R635X, 29insC, E210K, W143X in LAMB3 and R95X in LAMC2. These recurrent mutations account for approximately 44% of laminin-5 JEB alleles in Italian patients. PMID:15373767

  9. Polynucleotide phosphorylase plays an important role in the generation of spontaneous mutations in Escherichia coli.

    PubMed

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander; Miller, Jeffrey H

    2012-10-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rif(r) and the gyrB gene leading to Nal(r) and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  10. Polynucleotide Phosphorylase Plays an Important Role in the Generation of Spontaneous Mutations in Escherichia coli

    PubMed Central

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander

    2012-01-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rifr and the gyrB gene leading to Nalr and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  11. A novel AMH missense mutation in a patient with persistent Müllerian duct syndrome.

    PubMed

    van der Zwan, Y G; Brüggenwirth, H T; Drop, S L S; Wolffenbuttel, K P; Madern, G C; Looijenga, L H J; Visser, J A

    2012-01-01

    Persistent Müllerian duct syndrome (PMDS) is characterized by the presence of a uterus, fallopian tubes, and the upper part of the vagina in phenotypic normal male patients. Here, we report a patient diagnosed with PMDS with a novel homozygous missense mutation in the anti-Müllerian hormone (AMH) gene (single nucleotide insertion (C) at position 208 (c.208dup, p.Leu70fs)) leading to a frameshift and the introduction of a premature stop codon. Biopsy of both gonads revealed that germ cells were present in an irregular distribution. However, the absence of OCT3/4, PLAP and c-KIT expression indicated physiological maturation. PMID:22797409

  12. Novel loss-of-function PRRT2 mutation causes paroxysmal kinesigenic dyskinesia in a Han Chinese family

    PubMed Central

    2014-01-01

    Background Mutations in proline-rich transmembrane protein 2 (PRRT2) are a cause of paroxysmal kinesigenic dyskinesia (PKD). In this study, we investigated the PRRT2 gene mutation in a Chinese Han family with PKD and study the pathogenesis of the mutation with PRRT2 gene. Methods Peripheral venous blood was taken from the family members. Sanger sequencing was used for novel mutation sequencing. For the pathogenesis with the novel mutation was analyzed by bioinformatics, real-time PCR, subcellular localization and Western blot. Results The Sanger sequencing showed a novel mutation, c.186-187delGC, a deletion mutation, in exon 2 of the PRRT2 gene, the frameshift mutation generated a truncated protein that was stably expressed in transfected Human embryonic kidney (HEK) 293 cells. A subcellular localization assay in COS-7 cells with GFP-tagged protein showed nuclear localization for the mutant protein while the wild-type protein was localized in membranes. Co-transfection of HEK293 cells with wild-type and mutant expression plasmids cells did not influence mRNA or protein expression from the wild-type plasmid. Conclusions Our findings demonstrated that the c.186-187delGC mutation resulted in a truncated protein from the PRRT2 gene to involve in PKD pathogenesis with haploinsufficiency. The results extend the mutation spectrum of the PRRT2 gene and provide a new example for studying the pathogenesis of the mutated PRRT2 gene. PMID:25027704

  13. Mutations in the GlyT2 Gene (SLC6A5) Are a Second Major Cause of Startle Disease*

    PubMed Central

    Carta, Eloisa; Chung, Seo-Kyung; James, Victoria M.; Robinson, Angela; Gill, Jennifer L.; Remy, Nathalie; Vanbellinghen, Jean-François; Drew, Cheney J. G.; Cagdas, Sophie; Cameron, Duncan; Cowan, Frances M.; Del Toro, Mireria; Graham, Gail E.; Manzur, Adnan Y.; Masri, Amira; Rivera, Serge; Scalais, Emmanuel; Shiang, Rita; Sinclair, Kate; Stuart, Catriona A.; Tijssen, Marina A. J.; Wise, Grahame; Zuberi, Sameer M.; Harvey, Kirsten; Pearce, Brian R.; Topf, Maya; Thomas, Rhys H.; Supplisson, Stéphane; Rees, Mark I.; Harvey, Robert J.

    2012-01-01

    Hereditary hyperekplexia or startle disease is characterized by an exaggerated startle response, evoked by tactile or auditory stimuli, leading to hypertonia and apnea episodes. Missense, nonsense, frameshift, splice site mutations, and large deletions in the human glycine receptor α1 subunit gene (GLRA1) are the major known cause of this disorder. However, mutations are also found in the genes encoding the glycine receptor β subunit (GLRB) and the presynaptic Na+/Cl−-dependent glycine transporter GlyT2 (SLC6A5). In this study, systematic DNA sequencing of SLC6A5 in 93 new unrelated human hyperekplexia patients revealed 20 sequence variants in 17 index cases presenting with homozygous or compound heterozygous recessive inheritance. Five apparently unrelated cases had the truncating mutation R439X. Genotype-phenotype analysis revealed a high rate of neonatal apneas and learning difficulties associated with SLC6A5 mutations. From the 20 SLC6A5 sequence variants, we investigated glycine uptake for 16 novel mutations, confirming that all were defective in glycine transport. Although the most common mechanism of disrupting GlyT2 function is protein truncation, new pathogenic mechanisms included splice site mutations and missense mutations affecting residues implicated in Cl− binding, conformational changes mediated by extracellular loop 4, and cation-π interactions. Detailed electrophysiology of mutation A275T revealed that this substitution results in a voltage-sensitive decrease in glycine transport caused by lower Na+ affinity. This study firmly establishes the combination of missense, nonsense, frameshift, and splice site mutations in the GlyT2 gene as the second major cause of startle disease. PMID:22700964

  14. A new look at spotlight mode synthetic aperture radar as tomography: imaging 3-D targets.

    PubMed

    Jakowatz, C V; Thompson, P A

    1995-01-01

    A new 3D tomographic formulation of spotlight mode synthetic aperture radar (SAR) is developed. This extends the pioneering work of Munson et al. (1983), who first formally described SAR in terms of tomography but who made the simplifying assumption that the target scene was 2D. The present authors treat the more general and practical case in which the radar target reflectivities comprise a 3D function. The main goal is to demonstrate that the demodulated radar return data from a spotlight mode collection represent a certain set of samples of the 3D Fourier transform of the target reflectivity function and to do so using a tomographic paradigm instead of traditional range-Doppler analysis. They also show that the tomographic approach is useful in interpreting the reconstructed 2D SAR image corresponding to a 3D scene. Specifically, the well-known SAR phenomenon of layover is easily explained in terms of tomographic projections and is shown to be analogous to the projection effect in conventional optical imaging. PMID:18290021

  15. Spectrum of CHD7 Mutations in 110 Individuals with CHARGE Syndrome and Genotype-Phenotype Correlation

    PubMed Central

    Lalani, Seema R.; Safiullah, Arsalan M.; Fernbach, Susan D.; Harutyunyan, Karine G.; Thaller, Christina; Peterson, Leif E.; McPherson, John D.; Gibbs, Richard A.; White, Lisa D.; Hefner, Margaret; Davenport, Sandra L. H.; Graham, John M.; Bacino, Carlos A.; Glass, Nancy L.; Towbin, Jeffrey A.; Craigen, William J.; Neish, Steven R.; Lin, Angela E.; Belmont, John W.

    2006-01-01

    CHARGE syndrome is a well-established multiple-malformation syndrome with distinctive consensus diagnostic criteria. Characteristic associated anomalies include ocular coloboma, choanal atresia, cranial nerve defects, distinctive external and inner ear abnormalities, hearing loss, cardiovascular malformations, urogenital anomalies, and growth retardation. Recently, mutations of the chromodomain helicase DNA-binding protein gene CHD7 were reported to be a major cause of CHARGE syndrome. We sequenced the CHD7 gene in 110 individuals who had received the clinical diagnosis of CHARGE syndrome, and we detected mutations in 64 (58%). Mutations were distributed throughout the coding exons and conserved splice sites of CHD7. Of the 64 mutations, 47 (73%) predicted premature truncation of the protein. These included nonsense and frameshift mutations, which most likely lead to haploinsufficiency. Phenotypically, the mutation-positive group was more likely to exhibit cardiovascular malformations (54 of 59 in the mutation-positive group vs. 30 of 42 in the mutation-negative group; P=.014), coloboma of the eye (55 of 62 in the mutation-positive group vs. 30 of 43 in the mutation-negative group; P=.022), and facial asymmetry, often caused by seventh cranial nerve abnormalities (36 of 56 in the mutation-positive group vs. 13 of 39 in the mutation-negative group; P=.004). Mouse embryo whole-mount and section in situ hybridization showed the expression of Chd7 in the outflow tract of the heart, optic vesicle, facio-acoustic preganglion complex, brain, olfactory pit, and mandibular component of the first branchial arch. Microarray gene-expression analysis showed a signature pattern of gene-expression differences that distinguished the individuals with CHARGE syndrome with CHD7 mutation from the controls. We conclude that cardiovascular malformations, coloboma, and facial asymmetry are common findings in CHARGE syndrome caused by CHD7 mutation. PMID:16400610

  16. Biallelic Mutations in DNM1L are Associated with a Slowly Progressive Infantile Encephalopathy.

    PubMed

    Nasca, Alessia; Legati, Andrea; Baruffini, Enrico; Nolli, Cecilia; Moroni, Isabella; Ardissone, Anna; Goffrini, Paola; Ghezzi, Daniele

    2016-09-01

    Mitochondria are highly dynamic organelles, undergoing continuous fission and fusion, and mitochondrial dynamics is important for several cellular functions. DNM1L is the most important mediator of mitochondrial fission, with a role also in peroxisome division. Few reports of patients with genetic defects in DNM1L have been published, most of them describing de novo dominant mutations. We identified compound heterozygous DNM1L variants in two brothers presenting with an infantile slowly progressive neurological impairment. One variant was a frame-shift mutation, the other was a missense change, the pathogenicity of which was validated in a yeast model. Fluorescence microscopy revealed abnormally elongated mitochondria and aberrant peroxisomes in mutant fibroblasts, indicating impaired fission of these organelles. In conclusion, we described a recessive disease caused by DNM1L mutations, with a clinical phenotype resembling mitochondrial disorders but without any biochemical features typical of these syndromes (lactic acidosis, respiratory chain complex deficiency) or indicating a peroxisomal disorder. PMID:27328748

  17. A novel EDA gene mutation in a Spanish family with X-linked hypohidrotic ectodermal dysplasia.

    PubMed

    Cañueto, J; Zafra-Cobo, M I; Ciria, S; Unamuno, P; González-Sarmiento, R

    2011-11-01

    X-linked hypohidrotic ectodermal dysplasia (XLHED) is characterized by abnormal development of the hair, teeth, and sweat glands. It is caused by mutations in the EDA gene, which maps to the X chromosome and encodes a protein called ectodysplasin-A, a member of the tumor necrosis factor-related ligand family. Affected males typically exhibit all the typical features of HED, but heterozygous carriers may show mild to moderate clinical manifestations. We describe the case of a Spanish family in which a novel heterozygous c.733_734insGA mutation at the EDA gene was identified. It was located in exon 5 and consisted of a frame-shift mutation at codon 245, which gave rise to an abnormal protein with a premature stop codon after 35 residues. Genetic analyses in families with XLHED are useful for checking carrier status, but they also provide information for genetic counseling and prenatal diagnosis. PMID:21696697

  18. Familial cortical dysplasia caused by mutation in the mammalian target of rapamycin regulator NPRL3.

    PubMed

    Sim, Joe C; Scerri, Thomas; Fanjul-Fernández, Miriam; Riseley, Jessica R; Gillies, Greta; Pope, Kate; van Roozendaal, Hanna; Heng, Julian I; Mandelstam, Simone A; McGillivray, George; MacGregor, Duncan; Kannan, Lakshminarayanan; Maixner, Wirginia; Harvey, A Simon; Amor, David J; Delatycki, Martin B; Crino, Peter B; Bahlo, Melanie; Lockhart, Paul J; Leventer, Richard J

    2016-01-01

    We describe first cousin sibling pairs with focal epilepsy, one of each pair having focal cortical dysplasia (FCD) IIa. Linkage analysis and whole-exome sequencing identified a heterozygous germline frameshift mutation in the gene encoding nitrogen permease regulator-like 3 (NPRL3). NPRL3 is a component of GAP Activity Towards Rags 1, a negative regulator of the mammalian target of rapamycin complex 1 signaling pathway. Immunostaining of resected brain tissue demonstrated mammalian target of rapamycin activation. Screening of 52 unrelated individuals with FCD identified 2 additional patients with FCDIIa and germline NPRL3 mutations. Similar to DEPDC5, NPRL3 mutations may be considered as causal variants in patients with FCD or magnetic resonance imaging-negative focal epilepsy. PMID:26285051

  19. A novel mutation in the EDAR gene causes severe autosomal recessive hypohidrotic ectodermal dysplasia.

    PubMed

    Henningsen, Emil; Svendsen, Mathias Tiedemann; Lildballe, Dorte Launholt; Jensen, Peter Kjestrup Axel

    2014-08-01

    We report on a 2-year-old girl presenting with a severe form of hypohidrotic ectodermal dysplasia (HED). The patient presented with hypotrichosis, anodontia, hypohidrosis, frontal bossing, prominent lips and ears, dry, pale skin, and dermatitis. The patient had chronic rhinitis with malodorous nasal discharge. The girl was the second born child of first-cousin immigrants from Northern Iraq. A novel homozygous mutation (c.84delC) in the EDAR gene was identified. This mutation most likely causes a frameshift in the protein product (p.S29fs*74). This results in abolition of all ectodysplasin-mediated NF-kB signalling. This complete loss-of-function mutation likely accounts for the severe clinical abnormalities in ectodermal structures in the described patient. PMID:24764207

  20. Novel LMNA Gene Mutation in a Patient With Atypical Werner's Syndrome

    PubMed Central

    Doh, Yun Jeong; Kim, Hee Kyoung; Jung, Eui Dal; Choi, Seung Hee; Kim, Jung Guk; Kim, Bo Wan

    2009-01-01

    Hutchinson-Gilford progeria syndrome (HGPS) and Werner's syndrome are representative types of progeroid syndrome. LMNA (Lamin A/C) gene mutation with atypical Werner's syndrome have recently been reported. Atypical Werner's syndrome with the severe metabolic complications, the extent of the lipodystrophy is associated with A133L mutation in the LMNA gene and these patients present with phenotypically heterogeneous disorders. We experienced a 15-yr-old Korean female with progeroid features, generalized lipodystrophy, hypertriglyceridemia, fatty liver, steatohepatitis, and type 2 diabetes mellitus. Skin fibroblasts from the patient showed marked abnormal nuclear morphology, compared with that from normal persons. Gene analysis revealed that this patient had T506del of exon 2 in the LMNA gene. We report here the first case of atypical Werner's syndrome with frameshift mutation that was caused by T506del. PMID:19270485

  1. A cis-acting element in retroviral genomic RNA links Gag-Pol ribosomal frameshifting to selective viral RNA encapsidation

    PubMed Central

    Chamanian, Mastooreh; Purzycka, Katarzyna J.; Wille, Paul T.; Ha, Janice S.; McDonald, David; Gao, Yong; Le Grice, Stuart F.J.; Arts, Eric J.

    2013-01-01

    SUMMARY During retroviral RNA encapsidation two full length genomic (g) RNAs are selectively incorporated into assembling virions. Packaging involves a cis-acting packaging element (ψ) within the 5'-untranslated region of unspliced HIV-1 RNA genome. However, the mechanism(s) that selects and limits gRNAs for packaging remains uncertain. Using a dual complementation system involving bipartite HIV-1 gRNA, we observed that gRNA packaging is additionally dependent on a cis-acting RNA element, the Genomic RNA Packaging Enhancer (GRPE), found within the gag p1–p6 domain and overlapping the Gag-Pol ribosomal frameshift signal. Deleting or disrupting the two conserved GRPE stem-loops diminished gRNA packaging and infectivity >50-fold, while deleting gag sequences between ψ and GRPE had no effect. Downregulating the translation termination factor eRF1 produces defective virus particles containing 20-times more gRNA. Thus, only the HIV-1 RNAs employed for Gag-Pol translation may be specifically selected for encapsidation, possibly explaining the limitation of two gRNAs per virion. PMID:23414758

  2. Ribosomal frameshifting in the CCR5 mRNA is regulated by miRNAs and the NMD pathway

    PubMed Central

    Belew, Ashton Trey; Meskauskas, Arturas; Musalgaonkar, Sharmishtha; Advani, Vivek M.; Sulima, Sergey O.; Kasprzak, Wojciech K.; Shapiro, Bruce A.; Dinman, Jonathan D.

    2015-01-01

    Programmed –1 ribosomal frameshift (–1 PRF) signals redirect translating ribosomes to slip back one base on messenger RNAs. Although well characterized in viruses, how these elements may regulate cellular gene expression is not understood. Here we describe a –1 PRF signal in the human mRNA encoding CCR5, the HIV-1 co-receptor. CCR5 mRNA-mediated –1 PRF is directed by an mRNA pseudoknot, and is stimulated by at least two microRNAs. Mapping the mRNA–miRNA interaction suggests that formation of a triplex RNA structure stimulates –1 PRF. A –1 PRF event on the CCR5 mRNA directs translating ribosomes to a premature termination codon, destabilizing it through the nonsense-mediated mRNA decay pathway. At least one additional mRNA decay pathway is also involved. Functional –1 PRF signals that seem to be regulated by miRNAs are also demonstrated in mRNAs encoding six other cytokine receptors, suggesting a novel mode through which immune responses may be fine-tuned in mammalian cells. PMID:25043019

  3. Alaska: Improving Referrals of Victims of Maltreatment to the IDEA Part C Program. State Spotlight: Data Sharing

    ERIC Educational Resources Information Center

    Derrington, Taletha; Peters, Mary Louise; Mauzy, Denise; Ruggiero, Robert

    2015-01-01

    This 2015 state spotlight document describes how Alaska Part C improved the referral of children from Child Welfare to the Individuals with Disabilities Education Act (IDEA) Part C Program by an automated transfer of data from Child Welfare to Part C for substantiated cases of child maltreatment (i.e., child abuse and/or neglect).

  4. Scientist Spotlight Homework Assignments Shift Students’ Stereotypes of Scientists and Enhance Science Identity in a Diverse Introductory Science Class

    PubMed Central

    Schinske, Jeffrey N.; Perkins, Heather; Snyder, Amanda; Wyer, Mary

    2016-01-01

    Research into science identity, stereotype threat, and possible selves suggests a lack of diverse representations of scientists could impede traditionally underserved students from persisting and succeeding in science. We evaluated a series of metacognitive homework assignments (“Scientist Spotlights”) that featured counterstereotypical examples of scientists in an introductory biology class at a diverse community college. Scientist Spotlights additionally served as tools for content coverage, as scientists were selected to match topics covered each week. We analyzed beginning- and end-of-course essays completed by students during each of five courses with Scientist Spotlights and two courses with equivalent homework assignments that lacked connections to the stories of diverse scientists. Students completing Scientist Spotlights shifted toward counterstereotypical descriptions of scientists and conveyed an enhanced ability to personally relate to scientists following the intervention. Longitudinal data suggested these shifts were maintained 6 months after the completion of the course. Analyses further uncovered correlations between these shifts, interest in science, and course grades. As Scientist Spotlights require very little class time and complement existing curricula, they represent a promising tool for enhancing science identity, shifting stereotypes, and connecting content to issues of equity and diversity in a broad range of STEM classrooms. PMID:27587856

  5. Frameshift events associated with the lysyl-tRNA and the rare arginine codon, AGA, in Escherichia coli: a case study involving the human Relaxin 2 protein.

    PubMed

    Kerrigan, John J; McNulty, Dean E; Burns, Matthew; Allen, Kimberly E; Tang, Xiaoyan; Lu, Quinn; Trulli, Janice M; Johanson, Kyung O; Kane, James F

    2008-08-01

    Human Relaxin 2 is an insulin-related peptide hormone with a mass of 19,084 Da. The mRNA contains a number of arginine codons that are rarely used by Escherichia coli to produce highly expressed proteins. As a result, expressing this recombinant protein in E. coli is problematic. When human Relaxin 2 was expressed in E. coli BL21 (DE3), several forms of the protein were made. One species had the expected molecular weight (19,084 Da). A second species observed had a molecular weight of 21,244 Da. A third minor species had a molecular weight of 17,118 Da. These aberrant molecular weights can be explained as follows. First, a sequence CGA-AAA-AAG-AGA, containing the rare arginine codons CGA and AGA was the site of the +1 frameshift that generated the 21,244 Da species. Since there was a limited supply of this arginyl-tRNA, the peptidyl-tRNA moved +1 nucleotide to occupy the codon and resumed protein synthesis. Second, a -1 frameshift associated with 'slippery A' sequence XXA-AAA-AAG accounted for 10% of the product with a mass of 17,118 Da. Presumably, the shift to -1 also occurred because there was a paucity of the arginyl-tRNAArgucu. Introduction of a plasmid coding for the cognate tRNA for AGA and site directed mutagenesis prevented the formation of both frameshift species. PMID:18474430

  6. Normosmic Congenital Hypogonadotropic Hypogonadism Due to TAC3/TACR3 Mutations: Characterization of Neuroendocrine Phenotypes and Novel Mutations

    PubMed Central

    Voican, Adela; Amazit, Larbi; Trabado, Séverine; Fagart, Jérôme; Meduri, Geri; Brailly-Tabard, Sylvie; Chanson, Philippe; Lecomte, Pierre; Guiochon-Mantel, Anne; Young, Jacques

    2011-01-01

    Context TAC3/TACR3 mutations have been reported in normosmic congenital hypogonadotropic hypogonadism (nCHH) (OMIM #146110). In the absence of animal models, studies of human neuroendocrine phenotypes associated with neurokinin B and NK3R receptor dysfunction can help to decipher the pathophysiology of this signaling pathway. Objective To evaluate the prevalence of TAC3/TACR3 mutations, characterize novel TACR3 mutations and to analyze neuroendocrine profiles in nCHH caused by deleterious TAC3/TACR3 biallelic mutations. Results From a cohort of 352 CHH, we selected 173 nCHH patients and identified nine patients carrying TAC3 or TACR3 variants (5.2%). We describe here 7 of these TACR3 variants (1 frameshift and 2 nonsense deleterious mutations and 4 missense variants) found in 5 subjects. Modeling and functional studies of the latter demonstrated the deleterious consequence of one missense mutation (Tyr267Asn) probably caused by the misfolding of the mutated NK3R protein. We found a statistically significant (p<0.0001) higher mean FSH/LH ratio in 11 nCHH patients with TAC3/TACR3 biallelic mutations than in 47 nCHH patients with either biallelic mutations in KISS1R, GNRHR, or with no identified mutations and than in 50 Kallmann patients with mutations in KAL1, FGFR1 or PROK2/PROKR2. Three patients with TAC3/TACR3 biallelic mutations had an apulsatile LH profile but low-frequency alpha-subunit pulses. Pulsatile GnRH administration increased alpha-subunit pulsatile frequency and reduced the FSH/LH ratio. Conclusion The gonadotropin axis dysfunction associated with nCHH due to TAC3/TACR3 mutations is related to a low GnRH pulsatile frequency leading to a low frequency of alpha-subunit pulses and to an elevated FSH/LH ratio. This ratio might be useful for pre-screening nCHH patients for TAC3/TACR3 mutations. PMID:22031817

  7. Variegate Porphyria in Western Europe: Identification of PPOX Gene Mutations in 104 Families, Extent of Allelic Heterogeneity, and Absence of Correlation between Phenotype and Type of Mutation

    PubMed Central

    Whatley, Sharon D.; Puy, Hervé; Morgan, Rhian R.; Robreau, Anne-Marie; Roberts, Andrew G.; Nordmann, Yves; Elder, George H.; Deybach, Jean-Charles

    1999-01-01

    Summary Variegate porphyria (VP) is a low-penetrance, autosomal dominant disorder characterized clinically by skin lesions and acute neurovisceral attacks that occur separately or together. It results from partial deficiency of protoporphyrinogen oxidase encoded by the PPOX gene. VP is relatively common in South Africa, where most patients have inherited the same mutation in the PPOX gene from a common ancestor, but few families from elsewhere have been studied. Here we describe the molecular basis and clinical features of 108 unrelated patients from France and the United Kingdom. Mutations in the PPOX gene were identified by a combination of screening (denaturing gradient gel electrophoresis, heteroduplex analysis, or denaturing high-performance liquid chromatography) and direct automated sequencing of amplified genomic DNA. A total of 60 novel and 6 previously reported mutations (25 missense, 24 frameshift, 10 splice site, and 7 nonsense) were identified in 104 (96%) of these unrelated patients, together with 3 previously unrecognized single-nucleotide polymorphisms. VP is less heterogeneous than other acute porphyrias; 5 mutations were present in 28 (26%) of the families, whereas 47 mutations were restricted to 1 family; only 2 mutations were found in both countries. The pattern of clinical presentation was identical to that reported from South Africa and was not influenced by type of mutation. Our results define the molecular genetics of VP in western Europe, demonstrate its allelic heterogeneity outside South Africa, and show that genotype is not a significant determinant of mode of presentation. PMID:10486317

  8. Excess of De Novo Deleterious Mutations in Genes Associated with Glutamatergic Systems in Nonsyndromic Intellectual Disability

    PubMed Central

    Hamdan, Fadi F.; Gauthier, Julie; Araki, Yoichi; Lin, Da-Ting; Yoshizawa, Yuhki; Higashi, Kyohei; Park, A-Reum; Spiegelman, Dan; Dobrzeniecka, Sylvia; Piton, Amélie; Tomitori, Hideyuki; Daoud, Hussein; Massicotte, Christine; Henrion, Edouard; Diallo, Ousmane; Shekarabi, Masoud; Marineau, Claude; Shevell, Michael; Maranda, Bruno; Mitchell, Grant; Nadeau, Amélie; D'Anjou, Guy; Vanasse, Michel; Srour, Myriam; Lafrenière, Ronald G.; Drapeau, Pierre; Lacaille, Jean Claude; Kim, Eunjoon; Lee, Jae-Ran; Igarashi, Kazuei; Huganir, Richard L.; Rouleau, Guy A.; Michaud, Jacques L.

    2011-01-01

    Little is known about the genetics of nonsyndromic intellectual disability (NSID). We hypothesized that de novo mutations (DNMs) in synaptic genes explain an important fraction of sporadic NSID cases. In order to investigate this possibility, we sequenced 197 genes encoding glutamate receptors and a large subset of their known interacting proteins in 95 sporadic cases of NSID. We found 11 DNMs, including ten potentially deleterious mutations (three nonsense, two splicing, one frameshift, four missense) and one neutral mutation (silent) in eight different genes. Calculation of point-substitution DNM rates per functional and neutral site showed significant excess of functional DNMs compared to neutral ones. De novo truncating and/or splicing mutations in SYNGAP1, STXBP1, and SHANK3 were found in six patients and are likely to be pathogenic. De novo missense mutations were found in KIF1A, GRIN1, CACNG2, and EPB41L1. Functional studies showed that all these missense mutations affect protein function in cell culture systems, suggesting that they may be pathogenic. Sequencing these four genes in 50 additional sporadic cases of NSID identified a second DNM in GRIN1 (c.1679_1681dup/p.Ser560dup). This mutation also affects protein function, consistent with structural predictions. None of these mutations or any other DNMs were identified in these genes in 285 healthy controls. This study highlights the importance of the glutamate receptor complexes in NSID and further supports the role of DNMs in this disorder. PMID:21376300

  9. Excess of de novo deleterious mutations in genes associated with glutamatergic systems in nonsyndromic intellectual disability.

    PubMed

    Hamdan, Fadi F; Gauthier, Julie; Araki, Yoichi; Lin, Da-Ting; Yoshizawa, Yuhki; Higashi, Kyohei; Park, A-Reum; Spiegelman, Dan; Dobrzeniecka, Sylvia; Piton, Amélie; Tomitori, Hideyuki; Daoud, Hussein; Massicotte, Christine; Henrion, Edouard; Diallo, Ousmane; Shekarabi, Masoud; Marineau, Claude; Shevell, Michael; Maranda, Bruno; Mitchell, Grant; Nadeau, Amélie; D'Anjou, Guy; Vanasse, Michel; Srour, Myriam; Lafrenière, Ronald G; Drapeau, Pierre; Lacaille, Jean Claude; Kim, Eunjoon; Lee, Jae-Ran; Igarashi, Kazuei; Huganir, Richard L; Rouleau, Guy A; Michaud, Jacques L

    2011-03-11

    Little is known about the genetics of nonsyndromic intellectual disability (NSID). We hypothesized that de novo mutations (DNMs) in synaptic genes explain an important fraction of sporadic NSID cases. In order to investigate this possibility, we sequenced 197 genes encoding glutamate receptors and a large subset of their known interacting proteins in 95 sporadic cases of NSID. We found 11 DNMs, including ten potentially deleterious mutations (three nonsense, two splicing, one frameshift, four missense) and one neutral mutation (silent) in eight different genes. Calculation of point-substitution DNM rates per functional and neutral site showed significant excess of functional DNMs compared to neutral ones. De novo truncating and/or splicing mutations in SYNGAP1, STXBP1, and SHANK3 were found in six patients and are likely to be pathogenic. De novo missense mutations were found in KIF1A, GRIN1, CACNG2, and EPB41L1. Functional studies showed that all these missense mutations affect protein function in cell culture systems, suggesting that they may be pathogenic. Sequencing these four genes in 50 additional sporadic cases of NSID identified a second DNM in GRIN1 (c.1679_1681dup/p.Ser560dup). This mutation also affects protein function, consistent with structural predictions. None of these mutations or any other DNMs were identified in these genes in 285 healthy controls. This study highlights the importance of the glutamate receptor complexes in NSID and further supports the role of DNMs in this disorder. PMID:21376300

  10. Mutations in the CHD7 Gene: The Experience of a Commercial Laboratory

    PubMed Central

    Bartels, Cynthia F.; Scacheri, Cheryl; White, Lashonda

    2010-01-01

    CHARGE syndrome is an autosomal dominant multisystem disorder caused by mutation in the CHD7 gene, encoding chromodomain helicase DNA-binding protein 7. Molecular diagnostic testing for CHD7 mutation has been available in a clinical setting since 2005. We report here the results from the first 642 unrelated proband samples submitted for testing. Thirty-two percent (n = 203) of patient samples had a heterozygous pathogenic variant identified. The lower mutation rate than that published for well-characterized clinical samples is likely due to referral bias, as samples submitted for clinical testing may be for “rule-out” diagnoses, rather than solely to confirm clinical suspicion. We identified 159 unique pathogenic mutations, and of these, 134 mutations were each seen in a single individual and 25 mutations were found in two to five individuals (n = 69). Of the 203 mutations, only 9 were missense, with 107 nonsense, 69 frameshift, and 15 splice-site mutations likely leading to haploinsufficiency at the cellular level. An additional 72 variations identified in the 642 tested samples (11%) were considered to have unknown clinical significance. Copy number changes (deletion/duplication of the entire gene or one/several exons) were found to account for a very small number of cases (n = 3). This cohort represents the largest CHARGE syndrome sample size to date and is intended to serve as a resource for clinicians, genetic counselors, researchers, and other diagnostic laboratories. PMID:21158681

  11. Interplay between DMD point mutations and splicing signals in Dystrophinopathy phenotypes.

    PubMed

    Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

    2013-01-01

    DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

  12. Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

    PubMed Central

    Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

    2013-01-01

    DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

  13. Parental age affects somatic mutation rates in the progeny of flowering plants.

    PubMed

    Singh, Amit Kumar; Bashir, Tufail; Sailer, Christian; Gurumoorthy, Viswanathan; Ramakrishnan, Anantha Maharasi; Dhanapal, Shanmuhapreya; Grossniklaus, Ueli; Baskar, Ramamurthy

    2015-05-01

    In humans, it is well known that the parental reproductive age has a strong influence on mutations transmitted to their progeny. Meiotic nondisjunction is known to increase in older mothers, and base substitutions tend to go up with paternal reproductive age. Hence, it is clear that the germinal mutation rates are a function of both maternal and paternal ages in humans. In contrast, it is unknown whether the parental reproductive age has an effect on somatic mutation rates in the progeny, because these are rare and difficult to detect. To address this question, we took advantage of the plant model system Arabidopsis (Arabidopsis thaliana), where mutation detector lines allow for an easy quantitation of somatic mutations, to test the effect of parental age on somatic mutation rates in the progeny. Although we found no significant effect of parental age on base substitutions, we found that frameshift mutations and transposition events increased in the progeny of older parents, an effect that is stronger through the maternal line. In contrast, intrachromosomal recombination events in the progeny decrease with the age of the parents in a parent-of-origin-dependent manner. Our results clearly show that parental reproductive age affects somatic mutation rates in the progeny and, thus, that some form of age-dependent information, which affects the frequency of double-strand breaks and possibly other processes involved in maintaining genome integrity, is transmitted through the gametes. PMID:25810093

  14. Identification of novel type VII collagen gene mutations resulting in severe recessive dystrophic epidermolysis bullosa.

    PubMed

    Massé, M; Cserhalmi-Friedman, P B; Falanga, V; Celebi, J T; Martinez-Mir, A; Christiano, A M

    2005-05-01

    In this work, we studied the proband in a small nuclear family of Chinese and Dutch/German descent and identified two novel mutations in the type VII collagen gene leading to recessive dystrophic epidermolysis bullosa, Hallopeau-Siemens variant (HS-RDEB). The maternal mutation is a single base pair deletion of a cytosine nucleotide in exon 26, designated 3472delC, resulting in a frameshift and a premature termination codon (PTC) within the same exon, 7 bp downstream of the site of the mutation. The paternal mutation is a G-->A transition located at the 5' donor splice site within intron 51, designated IVS51 + 1G-->A. This mutation leads to the activation of a cryptic splice site, 32 bp downstream of the mutation site and to subsequent aberrant out-of-frame splicing, resulting in two alternative mRNA transcripts and a downstream PTC. To our knowledge, these two mutations have not been previously reported. These findings extend the body of evidence for compound heterozygous mutations leading to HS-RDEB and provide the basis for prenatal diagnosis in this family. PMID:15807692

  15. Parental Age Affects Somatic Mutation Rates in the Progeny of Flowering Plants1

    PubMed Central

    Singh, Amit Kumar; Bashir, Tufail; Sailer, Christian; Gurumoorthy, Viswanathan; Ramakrishnan, Anantha Maharasi; Dhanapal, Shanmuhapreya; Grossniklaus, Ueli; Baskar, Ramamurthy

    2015-01-01

    In humans, it is well known that the parental reproductive age has a strong influence on mutations transmitted to their progeny. Meiotic nondisjunction is known to increase in older mothers, and base substitutions tend to go up with paternal reproductive age. Hence, it is clear that the germinal mutation rates are a function of both maternal and paternal ages in humans. In contrast, it is unknown whether the parental reproductive age has an effect on somatic mutation rates in the progeny, because these are rare and difficult to detect. To address this question, we took advantage of the plant model system Arabidopsis (Arabidopsis thaliana), where mutation detector lines allow for an easy quantitation of somatic mutations, to test the effect of parental age on somatic mutation rates in the progeny. Although we found no significant effect of parental age on base substitutions, we found that frameshift mutations and transposition events increased in the progeny of older parents, an effect that is stronger through the maternal line. In contrast, intrachromosomal recombination events in the progeny decrease with the age of the parents in a parent-of-origin-dependent manner. Our results clearly show that parental reproductive age affects somatic mutation rates in the progeny and, thus, that some form of age-dependent information, which affects the frequency of double-strand breaks and possibly other processes involved in maintaining genome integrity, is transmitted through the gametes. PMID:25810093

  16. The first de novo mutation of the connexin 32 gene associated with X linked Charcot-Marie-Tooth disease.

    PubMed Central

    Meggouh, F; Benomar, A; Rouger, H; Tardieu, S; Birouk, N; Tassin, J; Barhoumi, C; Yahyaoui, M; Chkili, T; Brice, A; LeGuern, E

    1998-01-01

    X linked Charcot-Marie-Tooth disease (CMTX) is a hereditary motor and sensory neuropathy caused by mutations in the connexin 32 gene (Cx32). Using the SSCP technique and direct sequencing of PCR amplified genomic DNA fragments of the Cx32 gene from a Moroccan patient and her relatives, we identified the first de novo mutation of the Cx32 gene, consisting of a deletion of a G residue at position 499 in the Cx32 open reading frame. This previously unreported mutation produces a frameshift at position 147 in the protein and introduces a premature stop codon (TAG) at nucleotide 643, which results in the production of a truncated Cx32 molecule. This mutation illustrates the risk of an erroneous diagnosis of autosomal recessive CMT, especially in populations where consanguineous unions are frequent, and its consequences for genetic counselling, which can be avoided by molecular analysis. Images PMID:9541114

  17. Identification of novel mutations in STAR gene in patients with lipoid congenital adrenal hyperplasia: a first report from India.

    PubMed

    Vasudevan, Lakshmi; Joshi, Rajesh; Das, Dhanjit Kumar; Rao, Sudha; Sanghavi, Daksha; Babu, Shiny; Tamhankar, Parag M

    2013-01-01

    Lipoid congenital adrenal hyperplasia (LCAH), a rare disorder of steroid biosynthesis, is the most severe form of CAH. We report novel molecular findings of three unrelated infants with LCAH diagnosed at our center. A known missense mutation c.653C>T (p.A218V) and two novel mutations [premature termination c.441G>A (or p.W147X) and frameshift deletion c.del815G (or p.R272PfsX35)] were identified after complete sequencing of the STAR gene. Prenatal diagnosis was carried out for the family with mutation c.815delG by molecular testing wherein the fetus was found to be homozygous for the mutation. This is the first report of molecular diagnosis and prenatal testing for LCAH from India. PMID:23748066

  18. Loss-of-function mutations in the RNA biogenesis factor NAF1 predispose to pulmonary fibrosis-emphysema.

    PubMed

    Stanley, Susan E; Gable, Dustin L; Wagner, Christa L; Carlile, Thomas M; Hanumanthu, Vidya Sagar; Podlevsky, Joshua D; Khalil, Sara E; DeZern, Amy E; Rojas-Duran, Maria F; Applegate, Carolyn D; Alder, Jonathan K; Parry, Erin M; Gilbert, Wendy V; Armanios, Mary

    2016-08-10

    Chronic obstructive pulmonary disease and pulmonary fibrosis have been hypothesized to represent premature aging phenotypes. At times, they cluster in families, but the genetic basis is not understood. We identified rare, frameshift mutations in the gene for nuclear assembly factor 1, NAF1, a box H/ACA RNA biogenesis factor, in pulmonary fibrosis-emphysema patients. The mutations segregated with short telomere length, low telomerase RNA levels, and extrapulmonary manifestations including myelodysplastic syndrome and liver disease. A truncated NAF1 was detected in cells derived from patients, and, in cells in which the frameshift mutation was introduced by genome editing, telomerase RNA levels were reduced. The mutant NAF1 lacked a conserved carboxyl-terminal motif, which we show is required for nuclear localization. To understand the disease mechanism, we used CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein-9 nuclease) to generate Naf1(+/-) mice and found that they had half the levels of telomerase RNA. Other box H/ACA RNA levels were also decreased, but rRNA pseudouridylation, which is guided by snoRNAs, was intact. Moreover, first-generation Naf1(+/-) mice showed no evidence of ribosomal pathology. Our data indicate that disease in NAF1 mutation carriers is telomere-mediated; they show that NAF1 haploinsufficiency selectively disturbs telomere length homeostasis by decreasing the levels of telomerase RNA while sparing rRNA pseudouridylation. PMID:27510903

  19. Mutation spectrum of homogentisic acid oxidase (HGD) in alkaptonuria

    PubMed Central

    Vilboux, Thierry; Kayser, Michael; Introne, Wendy; Suwannarat, Pim; Bernardini, Isa; Fischer, Roxanne; O’Brien, Kevin; Kleta, Robert; Huizing, Marjan; Gahl, William A.

    2009-01-01

    Alkaptonuria (AKU) is a rare autosomal recessive metabolic disorder, characterized by accumulation of homogentisic acid, leading to darkened urine, pigmentation of connective tissue (ochronosis), joint and spine arthritis, and destruction of cardiac valves. AKU is due to mutations in the homogentisate dioxygenase gene, HGD, that converts homogentisic acid to maleylacetoacetic acid in the tyrosine catabolic pathway. Here we report a comprehensive mutation analysis of 93 patients enrolled in our study, as well as an extensive update of all previously published HGD mutations associated with AKU. Within our patient cohort, we identified 52 HGD variants, of which 22 were novel. This yields a total of 91 identified HGD variations associated with AKU to date, including 62 missense, 13 splice site, 10 frameshift, 5 nonsense and 1 no-stop mutation. Most HGD variants reside in exons 3, 6, 8 and 13. We assessed the potential effect of all missense variations on protein function, using 5 bioinformatic tools specifically designed for interpretation of missense variants (SIFT, POLYPHEN, PANTHER, PMUT and SNAP). We also analyzed the potential effect of splice site variants using two different tools (BDGP and NetGene2). This study provides valuable resources for molecular analysis of alkaptonuria and expands our knowledge of the molecular basis of this disease. PMID:19862842

  20. A novel MED12 mutation: Evidence for a fourth phenotype.

    PubMed

    Prontera, Paolo; Ottaviani, Valentina; Rogaia, Daniela; Isidori, Ilenia; Mencarelli, Amedea; Malerba, Natascia; Cocciadiferro, Dario; Rolph, Pfundt; Stangoni, Gabriela; Vulto-van Silfhout, Anneke; Merla, Giuseppe

    2016-09-01

    Mutations of the MED12 gene have been reported mainly in males with FG (Opitz-Kaveggia), Lujan-Fryns, or X-linked Ohdo syndromes. Recently, a different phenotype characterized by minor anomalies, severe intellectual disability (ID), and absent language was reported in female and male patients belonging to the same family and carrying a frameshift MED12 mutation (c.5898dupC). Here, we report on two brothers and their niece affected by severe and mild ID, respectively, where whole exome sequencing combined with variant analysis within a panel of ID-related genes, disclosed a novel c.2312T>C (p.Ile771Thr) MED12 mutation. This variant, which has not been reported as a polymorphism, was not present in a third unaffected brother, and was predicted to be deleterious by five bioinformatic databases. This finding together with the phenotypic analogies shared with the carriers of c.5898dupC mutation suggests the existence of a fourth MED12-related disorder, characterized by severe ID, absent or deficient language and, milder, clinical manifestation in heterozygotes. We have reviewed the literature on MED12 heterozygotes, their clinical manifestations, and discuss the possible biological causes of this condition. © 2016 Wiley Periodicals, Inc. PMID:27312080

  1. Heterogeneous AVPR2 gene mutations in congenital nephrogenic diabetes insipidus

    SciTech Connect

    Wildin, R.S.; Antush, M.J.; Bennett, R.L.; Schoof, J.M.; Scott, C.R. )

    1994-08-01

    Mutations in the AVPR2 gene encoding the receptor for arginine vasopressin in the kidney (V2 ADHR) have been reported in patients with congenital nephrogenic diabetes insipidus, a predominantly X-linked disorder of water homeostasis. The authors have used restriction-enzyme analysis and direct DNA sequencing of genomic PCR product to evaluate the AVPR2 gene in 11 unrelated affected males. Each patient has a different DNA sequence variation, and only one matches a previously reported mutation. Cosegregation of the variations with nephrogenic diabetes insipidus was demonstrated for two families, and a de novo mutation was accomplished in one family. All the variations predict frameshifts, truncations, or nonconservative amino acid substitutions in evolutionarily conserved positions in the V2 ADHR and related receptors. Of interest, a 28-bp deletion is found in one patient, while another, unrelated patient has a tandem duplication of the same 28-bp segment, suggesting that both resulted from the same unusual unequal crossing-over mechanism facilitated by 9-mer direct sequence repeats. Since the V2 ADHR is a member of the seven-transmembrane-domain, G-protein-coupled receptor superfamily, the loss-of-function mutations from this study and others provide important clues to the structure-function relationship of this and related receptors. 55 refs., 4 figs., 2 tabs.

  2. Ribosomal frameshifting during translation of measles virus P protein mRNA is capable of directing synthesis of a unique protein.

    PubMed Central

    Liston, P; Briedis, D J

    1995-01-01

    Members of the Paramyxoviridae family utilize a variety of different strategies to increase coding capacity within their P cistrons. Translation initiation at alternative 5'-proximal AUG codons is used by measles virus (MV) to express the virus-specific P and C proteins from overlapping reading frames on their mRNAs. Additional species of mRNAs are transcribed from the MV P cistron by the insertion of extra nontemplated G residues at a specific site within the P transcript. Addition of only a single nontemplated G residue results in the expression of the V protein, which contains a unique carboxyl terminus. We have used an Escherichia coli system to express MV P cistron-related mRNAs and proteins. We have found that ribosomal frameshifting on the MV P protein mRNA is capable of generating a previously unrecognized P cistron-encoded protein that we have designated R. Some ribosomes which have initiated translation of the P protein mRNA use the sequence TCC CCG AG (24 nucleotides upstream of the V protein stop codon) to slip into the -1 reading frame, thus translating the sequence as TC CCC GAG. The resulting R protein terminates five codons downstream of the frameshift site at the V protein stop codon. We have gone on to use a chloramphenicol acetyltransferase reporter system to demonstrate that this MV-specific sequence is capable of directing frameshifting during in vivo translation in eukaryotic cells. Analysis of immunoprecipitated proteins from MV-infected cells by two-dimensional gel electrophoresis allowed detection of a protein species consistent with R protein in MV-infected cells. Quantitation of this protein species allowed a rough estimation of frameshift frequency of approximately 1.8%. Significant stimulation of ribosomal frameshift frequency at this locus of the MV P mRNA was mediated by a downstream stimulator element which, although not yet fully defined, appeared to be neither a conventional stem-loop nor an RNA pseudoknot structure. PMID:7474085

  3. Danon disease: case report and detection of new mutation.

    PubMed

    Regelsberger, G; Höftberger, R; Pickl, W F; Zlabinger, G J; Körmöczi, U; Salzer-Muhar, U; Luckner, D; Bodamer, O A; Mayr, J A; Muss, W H; Budka, H; Bernheimer, H

    2009-12-01

    Danon disease is an X-linked disorder resulting from mutations in the lysosome-associated membrane protein-2 (LAMP2) gene. We report a male patient with skeletal myopathy, mental retardation, and massive hypertrophic obstructive cardiomyopathy necessitating heart transplantation. Immunohistochemistry of skeletal muscle and leukocytes, western blot analysis of leukocytes and cardiac muscle, flow cytometry, and DNA sequencing were performed. Muscle biopsy revealed autophagic vacuolar myopathy and lack of immunohistochemically detectable LAMP-2. Diagnosis of Danon disease was confirmed by western blot analysis of myocardial tissue and peripheral blood sample of the patient showing deficiency of LAMP-2 in myocardium and leukocytes. Moreover, absence of LAMP-2 in lymphocytes, monocytes and granulocytes was shown by flow cytometric analysis. Genetic analysis of the LAMP2 gene revealed a novel 1-bp deletion at position 179 (c.179delC) at the 3' end of exon 2, resulting in a frameshift with a premature stop codon. PMID:19588270

  4. Spectrum of mutations in the COL4A5 collagen gene in X-linked Alport syndrome.

    PubMed Central

    Knebelmann, B.; Breillat, C.; Forestier, L.; Arrondel, C.; Jacassier, D.; Giatras, I.; Drouot, L.; Deschênes, G.; Grünfeld, J. P.; Broyer, M.; Gubler, M. C.; Antignac, C.

    1996-01-01

    Alport syndrome is a mainly X-linked hereditary disease of basement membranes that is characterized by progressive renal failure, deafness, and ocular lesions. It is associated with mutations of the COL4A5 gene located at Xq22 and encoding the alpha5 chain of type IV collagen. We have screened 48 of the 51 exons of the COL4A5 gene by SSCP analysis and have identified 64 mutations and 10 sequence variants among 131 unrelated Alport syndrome patients. This represents a mutation-detection rate of 50%. There were no hot-spot mutations and no recurrent mutations in our population. The identified mutations were 6 nonsense mutations, 12 frameshift mutations, 17 splice-site mutations, and 29 missense mutations, 27 of the latter being glycine substitutions in the collagenous domain. Two of these occurred on the same allele in one patient and segregated with the disease in the family. We showed that some of the glycine substitutions could be associated with the lack of immunological expression of the alpha3(IV)-alpha5(IV) collagen chains in the glomerular basement membrane. Images Figure 1 Figure 2 PMID:8940267

  5. Common mutations in the phosphofructokinase-M gene in Ashkenazi Jewish patients with glycogenesis VII - and their population frequency

    SciTech Connect

    Sherman, J.B.; Raben, N.; Nicastri, C.; Adams, E.M.; Plotz, P.H. ); Argov, Z. ); Nakajima, Hiromu ); Eng, C.M.; Cowan, T.M. )

    1994-08-01

    Phosphofructokinase (PFK) catalyzes the rate-limiting step of glycolysis. Deficiency of the muscle enzyme is manifested by exercise intolerance and a compensated hemolytic anemia. Case reports of this autosomal recessive disease suggest a predominance in Ashkenazi Jews in the United States. The authors have explored the genetic basis for this illness in nine affected families and surveyed the normal Ashkenazi population for the mutations found. Genomic DNA was amplified using PCR, and denaturing gradient-gel electrophoresis. The polymorphic exons were sequenced or digested with restriction enzymes. A previously described splicing mutation, [Delta]5, accounted for 11 (61%) of 18 abnormal alleles in the nine families. A single base deletion leading to a frameshift mutation in exon 22 ([Delta]C-22) was found in six of seven alleles. A third mutation, resulting in a nonconservative amino acid substitution in exon 4, accounted for the remaining allele. Thus, three mutations could account for an illness in this group, and two mutations could account for 17 of 18 alleles. In screening 250 normal Ashkenazi individuals for all three mutations, they found only one [Delta]5 allele. Clinical data revealed no correlation between the particular mutations and symptoms, but male patients were more symptomatic than females, and only males had frank hemolysis and hyperuricemia. Because PFK deficiency in Ashkenazi Jews is caused by a limited number of mutations, screening genomic DNA from peripheral blood for the described mutations in this population should enable rapid diagnosis without muscle biopsy. 41 refs., 4 figs., 2 tabs.

  6. A new monoclonal antibody (CAL2) detects CALRETICULIN mutations in formalin-fixed and paraffin-embedded bone marrow biopsies

    PubMed Central

    Stein, H; Bob, R; Dürkop, H; Erck, C; Kämpfe, D; Kvasnicka, H-M; Martens, H; Roth, A; Streubel, A

    2016-01-01

    Recent advances in the diagnostic of myeloproliferative neoplasms (MPNs) discovered CALRETICULIN (CALR) mutations as a major driver in these disorders. In contrast to JAK2 mutations being mainly associated with polycythaemia vera, CALR mutations are only associated with primary myelofibrosis (PMF) and essential thrombocythaemia (ET). CALR mutations are present in the majority of PMF and ET patients lacking JAK2 and MPL mutations. As these CALR mutations are absent from reactive bone marrow (BM) lesions their presence indicates ET or PMF. So far these mutations are detectable only by molecular assays. Their molecular detection is cumbersome because of the great CALR mutation heterogeneity. Therefore, the availability of a simple assay would be of great help. All CALR mutations reported lead to a frameshift generating a new 36 amino-acid C-terminus. We generated a monoclonal antibody (CAL2) to this C-neoterminus by immunizing mice with a representative peptide and compared its performance with Sanger sequencing data in 173 MPNs and other BM diseases. There was a 100% correlation between the molecular and the CAL2 immunohistochemical (IHC) assays. Thus, the detection of CALR mutations by the CAL2 IHC is a specific, sensitive, rapid, simple and low-cost method. PMID:26202929

  7. PAX2 mutations in fetal renal hypodysplasia.

    PubMed

    Martinovic-Bouriel, Jelena; Benachi, Alexandra; Bonnière, Maryse; Brahimi, Nora; Esculpavit, Chantal; Morichon, Nicole; Vekemans, Michel; Antignac, Corinne; Salomon, Rémi; Encha-Razavi, Féréchté; Attié-Bitach, Tania; Gubler, Marie-Claire

    2010-04-01

    Papillorenal syndrome also known as renal-coloboma syndrome (OMIM 120330) is an autosomal dominant condition comprising optic nerve anomaly and renal oligomeganephronic hypoplasia. This reduced number of nephron generations with compensatory glomerular hypertrophy leads towards chronic insufficiency with renal failure. We report on two fetuses with PAX2 mutations presenting at 24 and 18 weeks' gestation, respectively, born into two different sibships. In our first patient, termination of pregnancy was elected for anhydramnios and suspicion of renal agenesis in the healthy couple with an unremarkable previous clinical history. This fetus had bilateral asymmetric kidney anomalies including a small multicystic left kidney, and an extremely hypoplastic right kidney. Histology showed dysplastic lesions in the left kidney, contrasting with rather normal organization in the hypoplastic right kidney. Ocular examination disclosed bilateral optic nerve coloboma. The association of these anomalies, highly suggestive of the papillorenal syndrome, led us to perform the molecular study of the PAX2 gene. Direct sequencing of the PAX2 coding sequence identified a de novo single G deletion of nucleotide 935 in exon 3 of the PAX2 resulting in a frameshift mutation (c.392delG, p.Ser131Thrfs*28). In the second family, the presence of a maternally inherited PAX2 mutation led to a decision for termination of pregnancy. The 18-week gestation fetus presented the papillorenal syndrome including hypoplastic kidneys and optic nerve coloboma. In order to address the PAX2 involvement in isolated renal "disease," 18 fetuses fulfilling criteria were screened: 10/18 had uni- or bilateral agenesis, 6/18 had bilateral multicystic dysplasia with enlarged kidneys, and 2/18 presented bilateral severe hypodysplasia confirmed on fetopathological examination. To the best of our knowledge, our first patient represents an unreported fetal diagnosis of papillorenal syndrome, and another example of the

  8. Geolocation with error analysis using imagery from an experimental spotlight SAR

    NASA Astrophysics Data System (ADS)

    Wonnacott, William Mark

    This dissertation covers the development of a geometry-based sensor model for a specific monostatic spotlight synthetic aperture radar (SAR) system---referred to as the ExSAR (for experimental SAR). This sensor model facilitates single- and multiple-image geopositioning with error analysis. It allows for the use of known ground control points in refining the collection geometry parameters (a process called image resection) and for the subsequent geopositioning of other points using the resected image. Theoretically, the model also allows for the potential recovery of bias-like, persistent errors common across multiple images. The model also includes multi-image correspondence equations to aid in the cross-image identification of conjugate points. The sensor model development begins with a generic, theoretical approach to the modeling of spotlight SAR. A closed-form solution to the range and range-rate condition equations and the corresponding error propagation equation are presented. (The SAR condition equations have traditionally been solved iteratively.) The application of the closed-form solution in the image-to-ground and ground-to-image transformations is documented. The theoretical work also includes a preliminary error sensitivity analysis and a treatment of the spotlight SAR resection process. The ExSAR-specific model is established and assessed with an extensive set of images collected using the experimental radar over arrays of ground control points. Using this set, the imagery metadata elements are assessed, and the optimal element set for geopositioning is determined. The ExSAR imagery is shown to be transformed to the ground plane in only one dimension. The eventual ExSAR sensor model is used with known elevations and single-image geopositioning to show a horizontal accuracy of 8.23 m (rms). With resection using five ground-surveyed control points per image, the horizontal accuracy of reserved check points is 0.45 m (rms). Resections using the same

  9. 2-Amino-N6-hydroxyadenine induces gene/point mutations and multiple-locus mutations, but not multilocus deletion mutations, in the ad-3 region of a two-component heterokaryon of Neurospora crassa.

    PubMed

    de Serres, F J; Brockman, H E; Overton, L K

    1991-08-01

    The mutagenicity of 2-amino-N6-hydroxyadenine (AHA) has been studied in Neurospora crassa by treating a two-component heterokaryon (H-12) and recovering specific-locus mutations induced in the ad-3 region. This assay system permits the identification of ad-3A and/or ad-3B mutants resulting from gene/point mutations, multilocus deletion mutations, and multiple-locus mutations of various genotypes, involving one or both loci. Genetic characterization of the ad-3 mutants recovered from experiments with AHA in H-12 shows that 98.9% (270/273) of the ad-3 mutants are gene/point mutations (ad-3R), 1.1% (3/270) are unknowns, and none is a multilocus deletion mutation (ad-3IR). Among the gene/point mutations, 3.3% (9/273) are multiple-locus mutations (gene/point mutations with a closely-linked recessive lethal mutation [ad-3R + RLCL]). Another 25.3% (69/273) are multiple-locus mutations with a recessive lethal mutation located elsewhere in the genome [ad-3R + RL]. Heterokaryon tests for allelic complementation among the ad-3BR mutants showed that 90.8% (139/153) of the mutants were complementing, and 20.3% (31/153) were leaky. In addition, 32.5% (38/117) of the ad-3AR mutants were leaky. These data are consistent with the hypothesis that AHA produces specific-locus mutations in the ad-3 region of N. crassa by base-pair substitution. The data from the present experiments are compared with the data for 2-aminopurine (2AP)-induced ad-3 mutants in H-12 (de Serres and Brockman, 1991). Whereas, 2AP is a weak mutagen in H-12, AHA is extremely potent (Brockman et al., 1987). In contrast with 2AP, AHA induces ad-3 mutants exclusively by gene/point mutation in H-12. We conclude that whereas AHA induces ad-3 mutants predominantly by AT to GC base-pair transitions, 2AP induces ad-3 mutants by a wide variety of mechanisms including: (1) AT to GC and GC to AT base-pair transitions, (2) frameshift mutations, (3) other, as yet unidentified, intragenic alterations, (4) small multilocus

  10. Identification of 14 novel mutations in the long isoform of USH2A in Spanish patients with Usher syndrome type II

    PubMed Central

    Aller, E; Jaijo, T; Beneyto, M; Nájera, C; Oltra, S; Ayuso, C; Baiget, M; Carballo, M; Antiñolo, G; Valverde, D; Moreno, F; Vilela, C; Collado, D; Pérez‐Garrigues, H; Navea, A; Millán, J M

    2006-01-01

    Mutations in USH2A gene have been shown to be responsible for Usher syndrome type II, an autosomal recessive disorder characterised by hearing loss and retinitis pigmentosa. USH2A was firstly described as consisting of 21 exons, but 52 novel exons at the 3' end of the gene were recently identified. In this report, a mutation analysis of the new 52 exons of USH2A gene was carried out in 32 unrelated patients in which both disease‐causing mutations could not be found after the screening of the first 21 exons of the USH2A gene. On analysing the new 52 exons, fourteen novel mutations were identified in 14 out of the 32 cases studied, including 7 missense, 5 frameshift, 1 duplication and a putative splice-site mutation. PMID:17085681

  11. Adjustable under-expression of yeast mating pathway proteins in Saccharomyces cerevisiae using a programmed ribosomal frameshift.

    PubMed

    Choi, Min-Yeon; Park, Sang-Hyun

    2016-06-01

    Experimental research in molecular biology frequently relies on the promotion or suppression of gene expression, an important tool in the study of its functions. Although yeast is among the most studied model systems with the ease of maintenance and manipulation, current experimental methods are mostly limited to gene deletion, suppression or overexpression of genes. Therefore, the ability to reduce protein expressions and then observing the effects would promote a better understanding of the exact functions and their interactions. Reducing protein expression is mainly limited by the difficulties associated with controlling the reduction level, and in some cases, the initial endogenous abundance is too low. For the under-expression to be useful as an experimental tool, repeatability and stability of reduced expression is important. We found that cis-elements in programmed -1 ribosomal frameshifting (-1RFS) of beet western yellow virus (BWYV) could be utilized to reduced protein expression in Saccharomyces cerevisiae. The two main advantages of using -1RFS are adjustable reduction rates and ease of use. To demonstrate the utility of this under-expression system, examples of reduced protein abundance were shown using yeast mating pathway components. The abundance of MAP kinase Fus3 was reduced to approximately 28-75 % of the wild-type value. Other MAP kinase mating pathway components, including Ste5, Ste11, and Ste7, were also under-expressed to verify that the -1RFS system works with different proteins. Furthermore, reduced Fus3 abundance altered the overall signal transduction outcome of the mating pathway, demonstrating the potential for further studies of signal transduction adjustment via under-expression. PMID:26837218

  12. Yeast telomere maintenance is globally controlled by programmed ribosomal frameshifting and the nonsense-mediated mRNA decay pathway

    PubMed Central

    Advani, Vivek M.; Belew, Ashton T.; Dinman, Jonathan D.

    2013-01-01

    We have previously shown that ~10% of all eukaryotic mRNAs contain potential programmed -1 ribosomal frameshifting (-1 PRF) signals and that some function as mRNA destabilizing elements through the Nonsense-Mediated mRNA Decay (NMD) pathway by directing translating ribosomes to premature termination codons. Here, the connection between -1 PRF, NMD and telomere end maintenance are explored. Functional -1 PRF signals were identified in the mRNAs encoding two components of yeast telomerase, EST1 and EST2, and in mRNAs encoding proteins involved in recruiting telomerase to chromosome ends, STN1 and CDC13. All of these elements responded to mutants and drugs previously known to stimulate or inhibit -1 PRF, further supporting the hypothesis that they promote -1 PRF through the canonical mechanism. All affected the steady-state abundance of a reporter mRNA and the wide range of -1 PRF efficiencies promoted by these elements enabled the determination of an inverse logarithmic relationship between -1 PRF efficiency and mRNA accumulation. Steady-state abundances of the endogenous EST1, EST2, STN1 and CDC13 mRNAs were similarly inversely proportional to changes in -1 PRF efficiency promoted by mutants and drugs, supporting the hypothesis that expression of these genes is post-transcriptionally controlled by -1 PRF under native conditions. Overexpression of EST2 by ablation of -1 PRF signals or inhibition of NMD promoted formation of shorter telomeres and accumulation of large budded cells at the G2/M boundary. A model  is presented describing how limitation and maintenance of correct stoichiometries of telomerase components by -1 PRF is used to maintain yeast telomere length. PMID:24563826

  13. Nucleotide sequence of Zygosaccharomyces bailii virus Z: Evidence for +1 programmed ribosomal frameshifting and for assignment to family Amalgaviridae.

    PubMed

    Depierreux, Delphine; Vong, Minh; Nibert, Max L

    2016-06-01

    Zygosaccharomyces bailii virus Z (ZbV-Z) is a monosegmented dsRNA virus that infects the yeast Zygosaccharomyces bailii and remains unclassified to date despite its discovery >20years ago. The previously reported nucleotide sequence of ZbV-Z (GenBank AF224490) encompasses two nonoverlapping long ORFs: upstream ORF1 encoding the putative coat protein and downstream ORF2 encoding the RNA-dependent RNA polymerase (RdRp). The lack of overlap between these ORFs raises the question of how the downstream ORF is translated. After examining the previous sequence of ZbV-Z, we predicted that it contains at least one sequencing error to explain the nonoverlapping ORFs, and hence we redetermined the nucleotide sequence of ZbV-Z, derived from the same isolate of Z. bailii as previously studied, to address this prediction. The key finding from our new sequence, which includes several insertions, deletions, and substitutions relative to the previous one, is that ORF2 in fact overlaps ORF1 in the +1 frame. Moreover, a proposed sequence motif for +1 programmed ribosomal frameshifting, previously noted in influenza A viruses, plant amalgaviruses, and others, is also present in the newly identified ORF1-ORF2 overlap region of ZbV-Z. Phylogenetic analyses provided evidence that ZbV-Z represents a distinct taxon most closely related to plant amalgaviruses (genus Amalgavirus, family Amalgaviridae). We conclude that ZbV-Z is the prototype of a new species, which we propose to assign as type species of a new genus of monosegmented dsRNA mycoviruses in family Amalgaviridae. Comparisons involving other unclassified mycoviruses with RdRps apparently related to those of plant amalgaviruses, and having either mono- or bisegmented dsRNA genomes, are also discussed. PMID:26951859

  14. Overexpression of p53 protein in squamous cell carcinomas of head and neck without apparent gene mutations.

    PubMed

    Xu, L; Chen, Y T; Huvos, A G; Zlotolow, I M; Rettig, W J; Old, L J; Garin-Chesa, P

    1994-06-01

    Structural alterations of p53 and overexpression of the p53 protein are found in a large proportion of human cancers. In this study, we examined the frequency of p53 mutations and p53 overexpression in squamous cell carcinomas (SQCC) of head and neck. Expression of p53 was detected by immunochemistry (IHC) with monoclonal antibodies defining three distinct epitopes: PAb421 (species cross-reactive epitope on normal and mutated p53), PAb1801 (epitope on normal and mutated human p53), and PAb240 (conformational epitope of mutated p53 and denatured normal p53). Genetic alterations of p53 were identified by single-strand conformational polymorphism (SSCP) analysis and DNA sequencing in selected cases. IHC assays revealed nuclear p53 immunostaining in 53% of cases (32 of 60) with PAb1801, 38% (23 of 60) with PAb421, and 32% (19 of 60) with PAb240. Cases positive with PAb421 or PAb240 were also positive with PAb1801, whereas PAb421 and PAb240 identified overlapping but distinct tumor subsets. Areas of carcinoma in situ present in the tumor specimens showed nuclear p53 immunostaining in 11 of 26 cases. SSCP analysis for exons 5-9, the most common sites of p53 abnormalities, revealed mutations in 26% (15 of 58) of the evaluable cases. Comparison of the SSCP results with the IHC results for PAb1801 identified 11 cases that were positive by both methods, 4 cases with p53 mutations that were negative by IHC, 20 cases positive by IHC but without detectable p53 mutations, and 23 cases negative by both methods. IHC with PAb240, which is thought to be specific for mutated p53, was positive in 9 cases with demonstrable p53 mutations and in 9 cases with no detectable mutations. DNA sequence analysis of nine tumors identified point mutations, nonsense mutations, and frame-shift mutations. In conclusion, our study shows that p53 overexpression in SQCC of head and neck as detected by IHC is a frequent finding, and that overexpression is associated with common types of p53 mutations in

  15. Signature predictions of surface targets undergoing turning maneuvers in spotlight synthetic aperture radar imagery

    NASA Astrophysics Data System (ADS)

    Garren, David A.

    2015-05-01

    This paper investigates methodologies for predicting the smear signatures in broadside spotlight synthetic aperture radar imagery collections due to surface targets that are undergoing turning maneuvers. This analysis examines the case of broadside geometry wherein the radar moves with constant speed and heading on a level flight path. This investigation concentrates moving target smear issues that yield some defocus in the range direction, although much smaller in magnitude than the motion induced smearing in the radar cross-range direction. This paper focuses on the case of a target that executes a turning maneuver during the SAR collection interval. The SAR simulations are shown to give excellent agreement between the moving target signatures and the predicted shapes of the central contours.

  16. Lake Urmia Bridge Stability Assessment: Results from Terrasar-X Spotlight Mode Images

    NASA Astrophysics Data System (ADS)

    Hosseini, F.; Motagh, M.; Vajedian, S.; Sharifi, M. A.

    2015-12-01

    In this study we investigate stability of Lake Urmia bridge, locally also known as Shahid Kalantari's highway bridge, in northwest of Iran using high-resolution satellite radar imagery. The radar dataset includes 22 SAR images acquired in SpotLight mode from 2014 to 2015 in an ascending orbit by TerraSAR-X satellite. A high-resolution Digital Elevation Model (DEM) of the area was constructed from a pair of TanDEM-X bi-static data on June 2012 to remove the effect of topography from interferometry observations. The analysis of X-band interferograms shows high number of displacement fringes, which are interpreted as being caused by thermal dilation due to temperature differences in the imaged area between two SAR acquisitions. This effect, which can often be observed in single interferograms, have important impact on time-series products and should be considered for deformation analysis of bridge structures.

  17. Type of mutation in the neurofibromatosis type 2 gene (NF2) frequently determines severity of disease.

    PubMed Central

    Ruttledge, M. H.; Andermann, A. A.; Phelan, C. M.; Claudio, J. O.; Han, F. Y.; Chretien, N.; Rangaratnam, S.; MacCollin, M.; Short, P.; Parry, D.; Michels, V.; Riccardi, V. M.; Weksberg, R.; Kitamura, K.; Bradburn, J. M.; Hall, B. D.; Propping, P.; Rouleau, G. A.

    1996-01-01

    The gene predisposing to neurofibromatosis type 2 (NF2) on human chromosome 22 has revealed a wide variety of different mutations in NF2 individuals. These patients display a marked variability in clinical presentation, ranging from very severe disease with numerous tumors at a young age to a relatively mild condition much later in life. To investigate whether this phenotypic heterogeneity is determined by the type of mutation in NF2, we have collected clinical information on 111 NF2 cases from 73 different families on whom we have performed mutation screening in this gene. Sixty-seven individuals (56.2%) from 41 of these kindreds revealed 36 different putative disease-causing mutations. These include 26 proposed protein-truncating alterations (frameshift deletions/insertions and nonsense mutations), 6 splice-site mutations, 2 missense mutations, 1 base substitution in the 3' UTR of the NF2 cDNA, and a single 3-bp in-frame insertion. Seventeen of these mutations are novel, whereas the remaining 19 have been described previously in other NF2 individuals or sporadic tumors. When individuals harboring protein-truncating mutations are compared with cases with single codon alterations, a significant correlation (P < .001) with clinical outcome is observed. Twenty-four of 28 patients with mutations that cause premature truncation of the NF2 protein, schwannomin, present with severe phenotypes. In contrast, all 16 cases from three families with mutations that affect only a single amino acid have mild NF2. These data provide conclusive evidence that a phenotype/genotype correlation exists for certain NF2 mutations. PMID:8755919

  18. Mutation screening of PALB2 in clinically ascertained families from the Breast Cancer Family Registry.

    PubMed

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Tsimiklis, Helen; Teo, Zhi L; Li, Roger; Pope, Bernard J; Terry, Mary Beth; Buys, Saundra S; Daly, Mary; Hopper, John L; Winship, Ingrid; Goldgar, David E; Park, Daniel J; Southey, Melissa C

    2015-01-01

    Loss-of-function mutations in PALB2 are associated with an increased risk of breast cancer, with recent data showing that female breast cancer risks for PALB2 mutation carriers are comparable in magnitude to those for BRCA2 mutation carriers. This study applied targeted massively parallel sequencing to characterize the mutation spectrum of PALB2 in probands attending breast cancer genetics clinics in the USA. The coding regions and proximal intron-exon junctions of PALB2 were screened in probands not known to carry a mutation in BRCA1 or BCRA2 from 1,250 families enrolled through familial cancer clinics by the Breast Cancer Family Registry. Mutation screening was performed using Hi-Plex, an amplicon-based targeted massively parallel sequencing platform. Screening of PALB2 was successful in 1,240/1,250 probands and identified nine women with protein-truncating mutations (three nonsense mutations and five frameshift mutations). Four of the 33 missense variants were predicted to be deleterious to protein function by in silico analysis using two different programs. Analysis of tumors from carriers of truncating mutations revealed that the majority were high histological grade, invasive ductal carcinomas. Young onset was apparent in most families, with 19 breast cancers under 50 years of age, including eight under the age of 40 years. Our data demonstrate the utility of Hi-Plex in the context of high-throughput testing for rare genetic mutations and provide additional timely information about the nature and prevalence of PALB2 mutations, to enhance risk assessment and risk management of women at high risk of cancer attending clinical genetic services. PMID:25575445

  19. Mutation screening of PALB2 in clinically ascertained families from the Breast Cancer Family Registry

    PubMed Central

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Tsimiklis, Helen; Teo, Zhi L.; Li, Roger; Pope, Bernard J.; Terry, Mary Beth; Buys, Saundra S.; Daly, Mary; Hopper, John L.; Winship, Ingrid; Goldgar, David E.; Park, Daniel J.; Southey, Melissa C.

    2015-01-01

    Loss-of-function mutations in PALB2 are associated with an increased risk of breast cancer, with recent data showing that female breast cancer risks for PALB2 mutation carriers are comparable in magnitude to those for BRCA2 mutation carriers. This study applied targeted massively parallel sequencing to characterize the mutation spectrum of PALB2 in probands attending breast cancer genetics clinics in the USA. The coding regions and proximal intron–exon junctions of PALB2 were screened in probands not known to carry a mutation in BRCA1 or BCRA2 from 1,250 families enrolled through familial cancer clinics by the Breast Cancer Family Registry. Mutation screening was performed using Hi-Plex, an amplicon-based targeted massively parallel sequencing platform. Screening of PALB2 was successful in 1,240/1,250 probands and identified nine women with protein-truncating mutations (three nonsense mutations and five frameshift mutations). Four of the 33 missense variants were predicted to be deleterious to protein function by in silico analysis using two different programs. Analysis of tumors from carriers of truncating mutations revealed that the majority were high histological grade, invasive ductal carcinomas. Young onset was apparent in most families, with 19 breast cancers under 50 years of age, including eight under the age of 40 years. Our data demonstrate the utility of Hi-Plex in the context of high-throughput testing for rare genetic mutations and provide additional timely information about the nature and prevalence of PALB2 mutations, to enhance risk assessment and risk management of women at high risk of cancer attending clinical genetic services. PMID:25575445

  20. Identification of 45 novel mutations in the nebulin gene associated with autosomal recessive nemaline myopathy.

    PubMed

    Lehtokari, Vilma-Lotta; Pelin, Katarina; Sandbacka, Maria; Ranta, Salla; Donner, Kati; Muntoni, Francesco; Sewry, Caroline; Angelini, Corrado; Bushby, Kate; Van den Bergh, Peter; Iannaccone, Susan; Laing, Nigel G; Wallgren-Pettersson, Carina

    2006-09-01

    Nemaline myopathy (NM) is a clinically and genetically heterogeneous disorder of skeletal muscle caused by mutations in at least five different genes encoding thin filament proteins of the striated muscle sarcomere. We have previously described 18 different mutations in the last 42 exons of the nebulin gene (NEB) in 18 families with NM. Here we report 45 novel NEB mutations detected by denaturing high-performance liquid chromatography (dHPLC) and sequence analysis of all 183 NEB exons in NM patients from 44 families. Altogether we have identified, including the deletion of exon 55 identified in the Ashkenazi Jewish population, 64 different mutations in NEB segregating with autosomal recessive NM in 55 families. The majority (55%) of the mutations in NEB are frameshift or nonsense mutations predicted to cause premature truncation of nebulin. Point mutations (25%) or deletions (3%) affecting conserved splice signals are predicted in the majority of cases to cause in-frame exon skipping, possibly leading to impaired nebulin-tropomyosin interaction along the thin filament. Patients in 18 families had one of nine missense mutations (14%) affecting conserved amino acids at or in the vicinity of actin or tropomyosin binding sites. In addition, we found the exon 55 deletion in four families. The majority of the patients (in 49/55 families) were shown to be compound heterozygous for two different mutations. The mutations were found in both constitutively and alternatively expressed exons throughout the NEB gene, and there were no obvious mutational hotspots. Patients with more severe clinical pictures tended to have mutations predicted to be more disruptive than patients with milder forms. PMID:16917880

  1. Founding BRCA1 mutations in hereditary breast and ovarian cancer in southern Sweden

    SciTech Connect

    Johannsson, O.; Hakansson, S.; Johannson, U.

    1996-03-01

    Nine different germ-line mutations in the BRCA1 breast and ovarian cancer susceptibility gene were identified in 15 of 47 kindreds from southern Sweden, by use of SSCP and heteroduplex analysis of all exons and flanking intron region and by a protein-truncation test for exon 11, followed by direct sequencing. All but one of the mutations are predicted to give rise to premature translation termination and include seven frameshift insertions or deletions, a nonsense mutation, and a splice acceptor site mutation. The remaining mutation is a missense mutation (Cys61Gly) in the zinc-binding motif. Four novel Swedish founding mutations were identified: the nucleotide 2595 deletion A was found in five families, the C 1806 T nonsense mutation in three families, the 3166 insertion TGAGA in three families, and the nucleotide 1201 deletion 11 in two families. Analysis of the intragenic polymorphism D17S855 supports common origins of the mutations. Eleven of the 15 kindreds manifesting BRCA1 mutations were breast-ovarian cancer families, several of them with a predominant ovarian cancer phenotype. The set of 32 families in which no BRCA1 alterations were detected included 1 breast-ovarian cancer kindred manifesting clear linkage to the BRCA1 region and loss of the wild-type chromosome in associated tumors. Other tumor types found in BRCA1 mutation/haplotype carriers included prostatic, pancreas, skin, and lung cancer, a malignant melanoma, an oligodendroglioma, and a carcinosarcoma. In all, 12 of 16 kindreds manifesting BRCA1 mutation or linkage contained ovarian cancer, as compared with only 6 of the remaining 31 families (P < .001). The present study confirms the involvement of BRCA1 in disease predisposition for a subset of hereditary breast cancer families often characterized by ovarian cancers. 28 refs., 3 figs., 4 tabs.

  2. Spotlight: Malaysia.

    PubMed

    Patriquin, W

    1988-03-01

    Focus is on Malaysia -- its population and land area, its total fertility rate and mortality rate, economic development, contraceptive usage, and population policy. In 1987 Malaysia's population was estimated to be 16.1 million with births 31/1000 population and deaths 7/1000 population. The rate of natural increase is 2.4%, the total fertility rate 3.9 children/woman, and the infant mortality rate 30/1000 live births. Ethnically, Malaysia is made up of several distinct groups. Indigenous Malays are the most numerous -- about 50% of the population. Their unique characteristics include that they are Moslem, rural, and usually of lower economic status. Chinese make up the 2nd largest group of Malaysians, nearly 1/3 of the population. This group is active in trade, business, and finance and possesses considerable economic power. About 10% of the population is of Indian descent. Malaysia has experienced much economic growth. Traditional exports grew in volume and value during the 1970; the petroleum sector expanded so rapidly it accounts for 1/4 of all exports. One reason for Malaysia's rapid economic growth is the government's promotion of industrialization and foreign investment. According to the 1982 contraceptive prevalence survey, 42% of currently married women 15-44 years were using contraception. The government considers the current rate of national increase to be satisfactory, but in 1984 it adopted a population policy to more than quadruple its population in 2100 to 70 million. It intends to accomplish this by instituting pronatalist incentives to help the fall in the national growth rate. The government's rationale for more population growth is that a larger domestic population could better support industrial growth that otherwise might be stymied by "protectionist policies practiced by developed countries." Incentives to encourage fertility include income-tax deductions and maternity benefits for women who have up to 5 children. PMID:12341834

  3. Spotlight: Ecuador.

    PubMed

    1998-04-01

    This article describes the vital statistics and population growth in Ecuador as of mid-1997. Mid-1997 population numbered about 12 million. Fertility was 3.6 births/woman; deaths were 6/1000 population; and births were 29/1000 population. Ecuador was primarily an agricultural country, until oil was discovered in the early 1970s. The country has worked to increase per capita income and confront environmental consequences. The capital city of Quito is situated in a valley between two mountains and has very high air pollution levels due to cars and factories. In contrast, indigenous populations live in the Andean mountains and farm small plots. Land shortages have pushed these farmers onto higher slopes and more marginal land that is becoming eroded. 22% of Ecuador's forests were cleared for farming during 1980-90. The city of Guayaquil, on the Pacific coast, has serious water pollution problems, sewage problems, and industrial pollution. Shrimp farming relies on high levels of fertilizer, which is damaging coastlines. Oil exploration in the interior of Ecuador, has resulted in disruption of indigenous population, loss of forests, and pollution of rivers. Texaco Oil is accused of spilling about 17 million gallons of crude oil, or 50 times more than the Exxon Valdez oil spill in Alaska. Texaco argues that it met government environmental standards and agreed to a cleanup, which only partially meets the standards of its critics. Oil resources have funded improvements in education and health. About 90% of Ecuador's adult population is literate. Fertility has declined, but the population is still largely young and will be entering their reproductive years by 2025. PMID:12293549

  4. Spotlight: Kuwait.

    PubMed

    Patriquin, W

    1988-02-01

    The population of Kuwait was estimated at 1.9 million in 1987, with a 3.2% rate of natural increase. The total fertility rate stood at 4.4, with 34 births/1000 population and 3 death/1000. The infant mortality rate is 19/1000, and life expectancy at birth is 72 years. The gross natural product per capita is US$14,270. As a result of the large number of resident foreign workers, native Kuwaitis comprise only 43% of the population. The majority of foreign workers are Arabs from neighboring states. During the last 3 decades, Kuwait's population has increased by 950%, largely through migration. Another consequence of migration is Kuwait's sex ratio of 132 males per 100 females. Kuwait's extremely low crude death rate, 3/1000, reflects a fertile, young population benefiting from sudden, large-scale health expenditures over the past 2 decades. Huge revenues from petroleum have enabled the government to establish a highly developed welfare system, with free education and no personal income taxes. Literacy currently stands at 71%. No family planning programs exist, although contraceptive supplies are available commercially. The government considers the current rate of population growth to be too slow to meet the requirements of an expanding economy and would like to be able to reduce the number of foreign workers in the country. PMID:12341735

  5. Spotlight: Azerbaijan.

    PubMed

    1999-02-01

    As of mid-1998, Azerbaijan had a population of 7.7 million people residing in a land area of 33,436 square miles. There were 17 births and 6 deaths per 1000 population, as well as 19 infant deaths for every 1000 live births, and a population growing in size at 1.1% annually. The average woman had 2.1 births during her reproductive lifetime and life expectancy was 67 years for men and 74 years for women. Azerbaijan is an oil-producing country, although the agricultural sector is responsible for 25% of gross domestic product and employs 31% of the work force. Despite its oil wealth and strong agricultural and mining sectors, Azerbaijan is struggling to improve its environmental conditions and support a large refugee population. The country's air, water, and soil are severely polluted. Air pollution stems from petrochemical plants, refineries, exhaust fumes, and the burning of untreated garbage; water pollution is the result of oil spills, leaky pipelines and tanks, runoff of fertilizers and pesticides, and improperly treated sewage; and land pollution is due to inadequate waste management. The high incidence of waterborne diseases, including cholera, in Azerbaijan is caused by the inadequate treatment of drinking water and sewage intrusion into leaky distribution pipes. Although over 90% of infants under age 1 year are immunized against diphtheria, whooping cough, tetanus, polio, and measles, babies in Azerbaijan are 3 times as likely to die before reaching age 1 year than are babies in the US. Azerbaijani children are 5 times more likely to die by age 5 than are US children. Living conditions are especially difficult for the 12% of the overall population which are refugees. PMID:12348921

  6. Spotlight: Bangladesh.

    PubMed

    Parikh, L

    1998-01-01

    This brief article highlights the progress made in Bangladesh in reducing fertility and improving women's status. The mid-1997 population was an estimated 122.2 million persons. The land area is 50,260 square miles. Population density was 2432 people per square mile. Births were 31 per 1000 persons. Deaths were 11 per 1000 persons. Infant deaths were 77 per 1000 live births. Natural increase was 2% per year. The total fertility rate was 3.3 births per woman. Life expectancy was 58 years for males and females. Bangladesh is one of the most densely populated countries in the world and has about 50% of US population situated on land the size of Wisconsin. Average annual income is about $240. Livelihoods from agriculture are affected by monsoons and natural disasters. Bangladesh has reduced its fertility by half since the mid-1970s. Almost 50% of married women relied on contraception during 1996-97, compared to only 8% of married women in 1975. Increases in contraceptive prevalence are attributed to the family planning program and parents' desire for smaller families. The government has made slowing population growth a priority since the 1970s. The 35,000 field workers provide door-to-door contraception and counseling. Mass media has promoted messages about the economic and health advantages of limiting or spacing births. Women continue to play a subordinate role to men, despite their improved control over fertility. Under 30% of women are literate compared to 50% of men. Islamic practices still confine women to the home. Programs are directed to improving women's financial status through credit programs. Women now hold many jobs in the new garment industry, which is the largest nonagricultural employer. PMID:12348209

  7. Spotlight: Mongolia.

    PubMed

    1998-11-01

    As of mid-1998, Mongolia had a population of 2.4 million people residing in a land area of 604,826 sq. miles. There were 24 births and 7 deaths per 1000 population, as well as 49 infant deaths for every 1000 live births, and a population growing in size at 1.6% annually. Mongolia has the highest birth rate in East Asia, and is one of the few developing countries which promotes population growth. A large number of young women will enter their childbearing years in the near future. The average Mongolian woman has 3.1 births during her reproductive lifetime and life expectancy is 57 years overall; no data are available for separate male and female rates. After Western Sahara, Mongolia has the world's lowest population density, at approximately 4 people per sq. mile. More than 25% of Mongolia's population lives in the capital city of Ulan Bator, of whom half live in tents, with minimal supplies of water and electricity. Live animals and animal products account for half of Mongolia's output and almost 90% of its exports. As Mongolia begins to exploit its rich supply of coal and oil reserves, mining and industrial pressures upon water resources and wilderness are beginning to be acknowledged. In addition, the country's grasslands are vulnerable to overgrazing by a growing number of livestock. The United Nations Development Program's Mongolia Biodiversity Project is a multifaceted approach to help Mongolia conserve its ecological wealth. The US is also helping Mongolia manage its resource problems through funding and the deployment of 58 US Peace Corps volunteers to important protected areas. PMID:12294354

  8. Spotlight: Egypt.

    PubMed

    1998-12-01

    Egypt is the most populous country in the Arab world and the second most populous country in Africa, with 65.5 million people living in a land area of 384,344 square miles as of mid-1998. There were 28 births and 6 deaths per 1000 population, as well as 63 infant deaths for every 1000 live births, and a population growing in size at 2.2% annually. The average Egyptian woman has 3.6 births during her reproductive lifetime and life expectancy is 65 years for men and 69 years for women. Egypt has major issues to address with regard to the management and use of its water resources, balancing the protection and use of rural lands, and expanding industry while protecting the air, water, and land. Much of Egypt's water is polluted and its soil damaged and depleted due to irrigation-related salinization. With Cairo and Alexandria already densely populated, the proportion of Egypt's population expected to live in urban areas should exceed 60% by 2025. Almost all of Egypt's population lives along the banks of the Nile and its delta, almost all of the country's agricultural production occurs on 5% of that land, and less than 1% of the land is protected. Population momentum will cause Egypt's population to grow a projected 51% by 2025 even though 47% of married women use some form of contraception. 51% of Egyptian adults are literate and tense relations with Israel influence Egypt's public expenditures and foreign assistance. PMID:12348893

  9. Iran: spotlight.

    PubMed

    Roudi, N

    1987-09-01

    Given its location between Asia and Asia Minor, Iran has been a country of strategic political importance throughout history. More than 98% of Iran's population is Moslem. During the early 20th century, as Iran gradually gained independence from the USSR and Turkey, a modernization process was begun. However, this modernization process was forced to yield to Islamic traditionalism after the 1979 Islamic Revolution. Women have been most affected by this change. The implementation of Islamic traditions has meant low job opportunity or motivation for continuing education among women. Although fertility remains high, the present government is satisfied with the current rate of population growth. Family planning is allowed if implemented within the framework of Islamic law, but abortion is illegal. Mortality fell substantially after World War II, but has not continued to decline. At present, both males and females have the same life expectancy at birth. Iran's population is growing at a rate of 4%/year, and can be expected to double in another 21 years. It has been projected that Iran, currently the 21st largest country in the world with a population of 50 million, will become the 15th largest with a population of 97 million by the year 2025. Tehran, the 20th largest city in 1985, is projected to be the 9th largest by the year 2000, with a population of 13.6 million. PMID:12268893

  10. Pakistan. Spotlight.

    PubMed

    Greene, M

    1985-01-01

    Focus in this discussion of Pakistan is on demographic factors, the issue of ethnic versus national solidarity, and economic and social development. The population was estimated at 99.2 million in 1985. The birthrate was 43/1000 in 1984 and the deaths were 15/1000. The infant mortality rate is 105 infant deaths/1000 live births, and life expectancy at birth is 51 years. In 1983 the gross national product per capita was US$390. The population of Pakistan is concentrated around Karachi on the Arabian Sea and in the crescent formed by Lahore, Rawalpindi, and Peshawar. Pakistan was a British colony, part of the Indian subcontinent until partition in 1947, when Britain gave Pakistan and India their freedom. Pakistan is not a theocracy, but the military government turns to traditional Islam for affirmation of its authority. Its martial law regime, established in 1977, is headed by President Ziaul Haq. The issue of ethnic versus national solidarity has been a problem since independence. Bengali-speaking East Pakistanis felt they did not have equal power in their country whose official language was Urdu and whose capital was in West Pakistan. East and West Pakistan ended up in armed conflict with the formation of Bangladesh in 1971 as the result. Regional and ethnic conflict is exacerbated by the low rate of literacy and the low status of certain ethnic groups in Pakistan. In addition, Pakistan suffers problems typical of many developing nations: a low per capita income, a large and growing population, and a highly stratified traditional society. In 1981 doctors, engineers, and craftsmen were in short supply, but there was a surplus of 300,000 agricultural workers. Agriculture makes up 30% of the GNP and employs 55% of the work force. In Pakistan's 6th Five Year Plan, initiated in July 1983, the government acknowledged for the 1st time the extremely poor conditions for women as indicated by literacy, health, and fertility. The total fertility rate is 6.4 average births/woman. Although the government is ostensibly trying to help women, funding for women's programs during the Five Year Plan was cut. Economic growth has been good in recent years, but agricultural growth is a result of increased acreage rather than yield per acre. PMID:12280214

  11. Spotlight: Zimbabwe.

    PubMed

    Patriquin, W

    1988-04-01

    In Zimbabwe, a reproductive health survey conducted in 1984 revealed the highest rate of contraceptive use in sub-Saharan Africa -- 38% of currently married women were using some form of family planning and 27% a modern contraceptive method. The majority of Zimbabwe's population, a country formerly known a Rhodesia, is African, but there also are about 100,000 whites, 20,000 persons of mixed race, and 10,000 Asians. Robert Mugabe formed the 1st government of Zimbabwe as a result of elections held in February 1980. Since independence, rifts have developed between the black nationalist leaders -- Robert Mugabe and Joshua Nkomo -- and continues. Some guerrilla activity has occurred in rural areas and antigovernment dissidence creating security and economic problems. Zimbabwe has a broad range of natural resources -- large mineral deposits including coal, asbestos, copper, nickel, gold, and iron ore. In addition to a well-developed electrical power network, there is a good infrastructure of paved roads and a vital railroad link with neighboring South Africa. Due to the trade sanctions imposed between 1965 and independence, the country has had to look inward for production. The manufacturing sector is well developed as is agriculture. The government identifies the country's most urgent problems as the resettlement of displaced persons and reconstruction of roads, health establishments, and schools destroyed during guerrilla activity. PMID:12315399

  12. Spotlight: Burundi.

    PubMed

    Lim, A

    1996-09-01

    This article summarizes demographic information on Burundi. Population in mid-1996 was 5.9 million. There were 46 births/1000 population and 16 deaths/1000 population. Infant mortality was 102/1000 live births. The rate of natural increase was 3% per year. The total fertility rate was 6.6 births/woman. 1% of married women used modern contraceptives. Life expectancy was 48 years for men and 52 years for women. In this country of 9900 sq. miles of land area most of the people live in the western region, which has fertile volcanic soil and a plateau area. Population density is 600 people/sq. mile. 6% live in urban areas. 85% of the population are Hutu (a Bantu ethnic group) and 14% are Tutsi (a Hamitic group); 1% are Twa or pygmies. About 3000 Europeans and 2000 South Asians live in Burundi. Government is dominated by the Tutsi minority. The country achieved independence from Belgium in 1962. The country has experienced civil strife between the Hutus and the Tutsis since the assassination by Tutsi troops in 1993 of the first democratically elected Hutu president. An estimated 100,000 refugees fled the country in 1996. 67% of the population are Christians, and 32% practice indigenous religions; 1% are Muslim. The economy is heavily dependent on coffee exports. About 50% of children aged under 5 are malnourished. Maternal mortality is an estimated 1300 deaths/100,000 live births. AIDS is expected to reduce total population by 4% by 2005. 85% of rural population and 55% of urban population are below the absolute poverty level. 50% of rural population have access to safe water and sanitation. PMID:12291558

  13. Spotlight: Oman.

    PubMed

    Roudi, F

    1997-05-01

    Halfway through 1997, Oman had a population of 2.3 million growing via natural increase at a rate of 3.4% annually. Birth and death rates in the country are 38 and 4 per 1000 population, respectively. Oman encompasses 82,030 sq. miles. 27 infants die in Oman per 1000 live births, the average woman bears 6.2 children, and life expectancy is 69 and 73 years for men and women, respectively. 97% of ever-married women know of at least one contraceptive method, and the rate of contraceptive prevalence among married women increased from 9% in 1987 to 28% in 1995, 21% of which is modern methods. The oil boom of the 1970s brought wealth to Oman, driving per capita gross national product from $370 in 1973 to $6200 in 1982. The economy is based largely upon the government-controlled petroleum industry, which accounts for 80% of revenues. Two-thirds of the world's crude petroleum shipped by sea passes by Oman through the Strait of Hormuz, giving Oman disproportionately large geopolitical importance. Foreigners largely from India, Pakistan, and the Philippines comprise more than half of the country's labor force. More than 80% of primary school-age children are enrolled in school, with increasing numbers of Omani women also attending school. PMID:12292419

  14. Burma. Spotlight.

    PubMed

    Perry, S

    1985-04-01

    Current demographic, economic, and political conditions in Burma are briefly described. In 1962 the military overthrew the democratic government of Burma, established a socialist state, and adopted isolationist policies. Recently the government sought to renew, on a limited basis, contact with the outside world. Information derived from a 1983 national census indicates that the population size, as estimated for 1985, is 37 million, and population density is 51 persons/square mile. 2/3 of the population lives in the central plateau and the delta region of the Irrawaddy River. The annual population growth rate is 2.2% (1983), and 24% of the population is urban. The birth rate is 37, the death rate is 15, and the infant mortality rate is 94. The gross national product is US$180 (1983). 68% of the population is Burmese, and the remainder is composed of numerous minorities. The 2 million Karen and Shan members of the population, as well as members of the outlawed Burmese Communist party, are engaged in armed resistance to the government. 63% of the labor force is engaged in agriculture. Farming is done primarily by traditional methods on small, individually owned landholdings, and the major crops are rice, sugar cane, jute, pulses, and groundnuts. Agricultural production was serious disrupted during World War II, and yields did not reach pre-war levels again until 1964. Current yields are still well below those achieved in most other Asian countries. Despite the availability of additional land suitable for cultivation, the proportion of land under cultivation (15%) did not increase in recent years. Due to population growth, the amount of cultivated land/person actually decreased from 1.39 acres to 0.77 acres between 1940-78. The country experienced only minimal industrial growth in recent years. Although urban growth is slow, the cities of Mandaly and Rangoon are surrounded by slums. The government is promoting the residtribution of the slum inhabitants to a number of small planned cities. Many individuals migrated from the remote mountain regions to the central agricultural plateau in recent years, partly to avoid being involved in the armed conflict between insurgents and the govenment. The government is satisfied with the country's current rate of population growth and does not provide the population with family planning services or supplies. PMID:12266917

  15. Spotlight: Lebanon.

    PubMed

    Fischbach, M R

    1998-01-01

    As of mid-1998, Lebanon had a population of 4.1 million people residing in a land area of 4015 sq. miles. There were 23 births and 7 deaths per 1000 population, as well as 34 infant deaths for every 1000 live births, and a population growing in size at 1.6% annually, one of the lowest population growth rates in the Arab world. The average woman had 2.3 births during her reproductive lifetime and life expectancy was 68 years for men and 73 years for women. Lebanon is the only Arab country without a desert. Moreover, unlike other countries in the region, Lebanon has all of the water resources it needs to sustain its population. 95% of Lebanese are Arab and speak Arabic. 356,000 Palestinian Arabs, refugees, and their descendants live in the country's 12 refugee camps. 65% of married women in 1996 reported using some form of contraception; 39% used a modern method. In 1995, 94.7% of men and 90.3% of women were literate, and the gross national product per capita in 1996 was US$2970. Active in the international trade of hashish and cocaine, Lebanon is still recovering from its 1975-90 civil war and the 1982 Israeli invasion. Environmental pollution and other environmental threats are of growing concern. PMID:12294108

  16. Nigeria. Spotlight.

    PubMed

    Lecky, M

    1984-12-01

    Nigeria, the most populous country in Africa, currently has no official population policy; however, recent news releases from the Federal Ministry of Information indicate that efforts to deal with rapid population growth may be forthcouming. Adequate census materials are lacking. In 1984 population size was estimated to be 88 million, and in 1983 the estimated crude birth rate was 48-51/1000, the estimated crude death rate was 16-18/1000, and the population growth rate was approximately 3.0%-3.5%. Other estimates for 1983 placed the infant mortality rate at 134 and life expectancy at 49 years. The total fertility rate observed in a 1981 World Fertility Study was 5.4, but this rate was questioned by investigators, who believe it is too low. World Bank projections, based on the assumption that fertility declines will begin soon, indicate that the population will reach 618 million before stabilizing toward the end of the 21st century. At the present time, only 6% of Nigeria's women of reproductive age use contraception, and most of these women contracept only for spacing purposes. Nigeria, which obtained independence in 1960, is plagued by internal strife between different ethnic groups. The northern region, populated by the Hausa is less developed economically than the southern region. The Ibo, who play a major role in the nation's commerical and government sectors, predominated in the the southeastern region, and the Yoruba are the most populous group in the southwestern region. 1/2 of the population if Muslim, 40% is Christian, and the remaining proportion practices traditional religions. During the 1960s, Nigeria derived 2/3 of it gross national product from agriculture, and especially from the export of cocoa, groundnuts, and palm oil. During the 1970s the economy changed markedly as the country began to exploit its oil reserves. By 1983, agriculture accounted for only 20% of the gross national product, and 98% of the country's total exports of US$11.3 billion were derived from oil. Oil reserves are expected to be exhausted in 15 years. To compensate for this expected loss, an effort was initiated in 1980 to revive the country's deteriorating agricultural sector. In addition, the government instituted educational programs aimed at increasing the supply of skilled labor for industrial development. PMID:12313400

  17. Libya: spotlight.

    PubMed

    1984-01-01

    Libya's population at 3.7 million is small but growing so rapidly that it should double by 2000. At this time 90% of the population live in less than 25% of the land area, and 40% live in 1 of the 2 major cities, Tripoli and Benghazi. Since oil was discovered in the 1950s, Libya's economy has been almost totally dependent upon petroleum exports. Prices have dropped sharply since 1980 because of the world oil glut, but oil still provides a rich income. The government has used the substantial oil revenues for ambitious construction projects, expansion of educational and health facilities, and creation of a modern defense establishment to foster economic development and political strength. Libya has enjoyed remarkable improvements in living standards and school enrollment over the past 30 years. Literacy increased from 23% for men and 2% for women to 73% for men and 40% for women since the 1950s. Prior to 1950, Libya's population grew at less than 2% annually, but since then declining mortality, high birthrates, and increasing immigration have caused growth rates to soar above 4%. Consistent with Arab tradition, Libyans favor large families. Women marry at around age 17 and bear an average of 7 children. The Moslem culture disapproves of women working outside the home, and only about 5% do so. The government encourages the high birthrates to increase the small native population. Importation of modern contraceptive is illegal, and family planning does not receive government support although maternal and child health projects do. The increases in education and labor force participation of women may lead to lower fertility in the future. The average Libyan's life expectancy was 43 during the 1950s and about 190 of every 1000 babies died before their 1st birthday. In the 1980s life expectancy is up to about 65, and infant mortality down to 90/1000 births. The mortality decline can be directly attributed to vaccination campaigns carried out during the late 1950s and the expansion of health care financed by petroleum exports. The decline in mortality coupled with the continuation of high birthrates have produced an annual rate of natural increase of 3.3%, but the most marked changes in the population are from international migration. Since 1965, hundreds of thousands of foreign laborers have been attracted to Libya by the promise of high wages and generous social services. Libya faces several problems in the near future. 47% of the population are under age 15, and the communities of aliens, viewed suspiciously by the native Libyans, appear to be permanent additions to the society. PMID:12279826

  18. Spotlight: Syria.

    PubMed

    Fischbach, M R

    1998-06-01

    As of mid-1998, Syria had a population of 15.6 million people residing in a land area of 70,958 sq. miles, of which only 28% is arable. There were 33 births and 6 deaths per 1000 population, as well as 35 infant deaths for every 1000 live births, and a population growing in size at 2.8% annually. The average woman had 4.6 births during her reproductive lifetime and life expectancy was 67 years for men and 68 years for women. About 9% of Syria's population is Arab. About half of the population lives in urban areas. While war has caused several population movements over the past 50 years, there is now only a small degree of external migration. Approximately 300,000 Palestinian Arabs, refugees, and their descendants reside in Syria. The government's liberalization of the country's state-dominated economy in the early 1990s led to a period of economic growth which has slowed since the mid-1990s. The current 9% unemployment rate is will rise in the future context of a stagnant economy and a growing body of work-age youths; 45% of the population is under age 15 years. Estimated per capita gross national product in 1996 was US$1160, with approximately 28% of gross domestic product derived from agriculture, 18% from industry, and 54% from services. Although Syria has enough water resources for its population, that supply is threatened by pollution. Basic health care is not always available in rural areas and the government has no initiative to reduce fertility, even though the country's population will double in 25 years at current growth rates. 40% of married women use some form of contraception and 28% use a modern method. Only 26 AIDS cases had been reported in the country up to 1993. PMID:12348559

  19. Spotlight: Ghana.

    PubMed

    De Sherbinin, A

    1993-01-01

    At independence in 1957, Ghana possessed one of the strongest economies in Africa. Ghana exemplifies the problems confronted by African countries with economics that are tied to the export of natural and agriculture products, large debts to foreign countries, and rapid population growth. Ghana's population of 16 million is the second largest in west Africa, behind Nigeria. 45% of Ghanaians are under age 15, providing a built-in momentum for population growth as these young people begin childbearing. The government first adopted a population policy in 1969, but only recently is much being done to implement it. Only 13% of married women of reproductive age use contraception, and only 5% use modern methods, according to a 1988 Demographic and Health Survey. The total fertility rate is 6.2 average lifetime births per woman. High fertility plus expensive school fees and economic pressures are raising the drop-out rate of girls. 2 recent studies found that many Ghanaian men opposed their wives' desire to use contraceptives to limit family size. Policymakers are encouraging a greater involvement for men in family planning with male-to-male outreach. The country faces a number of environmental problems. At the turn of the century, forests covered most of the country. At present they cover only about a third. Logging and land-clearing activities are also a threat to biodiversity. Laws do exist to protect wild species of plants and animals, but enforcement is understaffed. The underdeveloped water supply systems make water-borne diseases, such as diarrhea and bilharzia, serious health threats. Insect-borne onchocerciasis is also a problem. High unemployment rates have forced many Ghanaians to emigrate, and, in the mid-1980s, Ghanaians increasingly headed toward England and Canada. The net migration rate is -1/1000 population. Presidential elections held in late 1992 returned Jerry Rawlings to power. PMID:12286891

  20. Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.

    PubMed

    Olson, Heather E; Tambunan, Dimira; LaCoursiere, Christopher; Goldenberg, Marti; Pinsky, Rebecca; Martin, Emilie; Ho, Eugenia; Khwaja, Omar; Kaufmann, Walter E; Poduri, Annapurna

    2015-09-01

    Rett syndrome and neurodevelopmental disorders with features overlapping this syndrome frequently remain unexplained in patients without clinically identified MECP2 mutations. We recruited a cohort of 11 patients with features of Rett syndrome and negative initial clinical testing for mutations in MECP2. We analyzed their phenotypes to determine whether patients met formal criteria for Rett syndrome, reviewed repeat clinical genetic testing, and performed exome sequencing of the probands. Using 2010 diagnostic criteria, three patients had classical Rett syndrome, including two for whom repeat MECP2 gene testing had identified mutations. In a patient with neonatal onset epilepsy with atypical Rett syndrome, we identified a frameshift deletion in STXBP1. Among seven patients with features of Rett syndrome not fulfilling formal diagnostic criteria, four had suspected pathogenic mutations, one each in MECP2, FOXG1, SCN8A, and IQSEC2. MECP2 mutations are highly correlated with classical Rett syndrome. Genes associated with atypical Rett syndrome, epilepsy, or intellectual disability should be considered in patients with features overlapping with Rett syndrome and negative MECP2 testing. While most of the identified mutations were apparently de novo, the SCN8A variant was inherited from an unaffected parent mosaic for the mutation, which is important to note for counseling regarding recurrence risks. PMID:25914188

  1. Mutational analysis of patients with neurofibromatosis 2

    SciTech Connect

    MacCollin, M.; Ramesh, V.; Pulaski, K.; Trofatter, J.A.; Short, M.P.; Bove, C.; Jacoby, L.B.; Louis, D.N.; Rubio, M.P.; Eldridge, R.

    1994-08-01

    Neurofibromatosis 2 (NF2) is a genetic disorder characterized by the development of multiple nervous-system tumors in young adulthood. The NF2 gene has recently been isolated and found to encode a new member, merlin, of the protein 4.1 family of cytoskeleton-associated proteins. To define the molecular basis of NF2 in affected individuals, the authors have used SSCP analysis to scan the exons of the NF2 gene from 33 unrelated patients with NF2. Twenty unique SSCP variants were seen in 21 patients; 10 of these individuals were known to be the only affected person in their kindred, while 7 had at least one other known affected relative. In all cases in which family members were available, the SSCP variant segregated with the disease; comparison of sporadic cases with their parents confirmed the de novo variants. DNA sequence analysis revealed that 19 of the 20 variants observed are predicted to lead to a truncated protein due to frameshift, creation of a stop codon, or interference with normal RNA splicing. A single patient carried a 3-bp deletion removing a phenylalanine residue. The authors conclude that the majority of NF2 patients carry an inactivating mutation of the NF2 gene and that neutral polymorphism in the gene is rare. 18 refs., 3 figs., 2 tabs.

  2. Homozygous truncating PTPRF mutation causes athelia.

    PubMed

    Borck, Guntram; de Vries, Liat; Wu, Hsin-Jung; Smirin-Yosef, Pola; Nürnberg, Gudrun; Lagovsky, Irina; Ishida, Luis Henrique; Thierry, Patrick; Wieczorek, Dagmar; Nürnberg, Peter; Foley, John; Kubisch, Christian; Basel-Vanagaite, Lina

    2014-08-01

    Athelia is a very rare entity that is defined by the absence of the nipple-areola complex. It can affect either sex and is mostly part of syndromes including other congenital or ectodermal anomalies, such as limb-mammary syndrome, scalp-ear-nipple syndrome, or ectodermal dysplasias. Here, we report on three children from two branches of an extended consanguineous Israeli Arab family, a girl and two boys, who presented with a spectrum of nipple anomalies ranging from unilateral hypothelia to bilateral athelia but no other consistently associated anomalies except a characteristic eyebrow shape. Using homozygosity mapping after single nucleotide polymorphism (SNP) array genotyping and candidate gene sequencing we identified a homozygous frameshift mutation in PTPRF as the likely cause of nipple anomalies in this family. PTPRF encodes a receptor-type protein phosphatase that localizes to adherens junctions and may be involved in the regulation of epithelial cell-cell contacts, peptide growth factor signaling, and the canonical Wnt pathway. Together with previous reports on female mutant Ptprf mice, which have a lactation defect, and disruption of one allele of PTPRF by a balanced translocation in a woman with amastia, our results indicate a key role for PTPRF in the development of the nipple-areola region. PMID:24781087

  3. Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing

    PubMed Central

    Walsh, Tom; Lee, Ming K.; Casadei, Silvia; Thornton, Anne M.; Stray, Sunday M.; Pennil, Christopher; Nord, Alex S.; Mandell, Jessica B.; Swisher, Elizabeth M.; King, Mary-Claire

    2010-01-01

    Inherited loss-of-function mutations in the tumor suppressor genes BRCA1, BRCA2, and multiple other genes predispose to high risks of breast and/or ovarian cancer. Cancer-associated inherited mutations in these genes are collectively quite common, but individually rare or even private. Genetic testing for BRCA1 and BRCA2 mutations has become an integral part of clinical practice, but testing is generally limited to these two genes and to women with severe family histories of breast or ovarian cancer. To determine whether massively parallel, “next-generation” sequencing would enable accurate, thorough, and cost-effective identification of inherited mutations for breast and ovarian cancer, we developed a genomic assay to capture, sequence, and detect all mutations in 21 genes, including BRCA1 and BRCA2, with inherited mutations that predispose to breast or ovarian cancer. Constitutional genomic DNA from subjects with known inherited mutations, ranging in size from 1 to >100,000 bp, was hybridized to custom oligonucleotides and then sequenced using a genome analyzer. Analysis was carried out blind to the mutation in each sample. Average coverage was >1200 reads per base pair. After filtering sequences for quality and number of reads, all single-nucleotide substitutions, small insertion and deletion mutations, and large genomic duplications and deletions were detected. There were zero false-positive calls of nonsense mutations, frameshift mutations, or genomic rearrangements for any gene in any of the test samples. This approach enables widespread genetic testing and personalized risk assessment for breast and ovarian cancer. PMID:20616022

  4. High prevalence of germline STK11 mutations in Hungarian Peutz-Jeghers Syndrome patients

    PubMed Central

    2010-01-01

    Background Peutz-Jeghers syndrome (PJS) is a rare autosomal dominantly inherited disease characterized by gastrointestinal hamartomatous polyposis and mucocutaneous pigmentation. The genetic predisposition for PJS has been shown to be associated with germline mutations in the STK11/LKB1 tumor suppressor gene. The aim of the present study was to characterize Hungarian PJS patients with respect to germline mutation in STK11/LKB1 and their association to disease phenotype. Methods Mutation screening of 21 patients from 13 PJS families were performed using direct DNA sequencing and multiplex ligation-dependent probe amplification (MLPA). Comparative semi-quantitative sequencing was applied to investigate the mRNA-level effects of nonsense and splice-affecting mutations. Results Thirteen different pathogenic mutations in STK11, including a high frequency of large genomic deletions (38%, 5/13), were identified in the 13 unrelated families studied. One of these deletions also affects two neighboring genes (SBNO2 and GPX4), located upstream of STK11, with a possible modifier effect. The majority of the point mutations (88%, 7/8) can be considered novel. Quantification of the STK11 transcript at the mRNA-level revealed that the expression of alleles carrying a nonsense or frameshift mutation was reduced to 30-70% of that of the wild type allele. Mutations affecting splice-sites around exon 2 displayed an mRNA processing pattern indicative of co-regulated splicing of exons 2 and 3. Conclusions A combination of sensitive techniques may assure a high (100%) STK11 mutation detection frequency in PJS families. Characterization of mutations at mRNA level may give a deeper insight into the molecular consequences of the pathogenic mutations than predictions made solely at the genomic level. PMID:21118512

  5. Extracellular and intracellular anti-mutagenic effects of bile pigments in the Salmonella typhimurium reverse mutation assay

    PubMed Central

    Mölzer, C.; Huber, H.; Diem, K.; Wallner, M.; Bulmer, A.C.; Wagner, K.-H.

    2013-01-01

    In vitro anti-genotoxic properties of bile pigments have been explored and confirmed recently. Despite these reports mechanisms to explain DNA protection by endogenous bile pigments remain unclear. Surprisingly, the quantification of cellular pigment absorption which could represent a fundamental prerequisite for intracellular (e.g., anti-mutagenic) effects, has not been explored. Therefore, we aimed to measure the amounts of un-/conjugated bilirubin as well as biliverdin absorbed into colonies of Salmonella typhimurium, utilising HPLC analyses, and to observe whether intracellular compound concentrations could predict anti-genotoxic effects. HPLC analyses confirmed that bacterial bile pigment absorption was concentration-dependent. Plate bile pigment concentrations were inversely associated with genotoxicity of all tested mutagens, irrespective of strain and test conditions. However, protection against frame-shift mutation in strain TA98 most strongly depended on the bacterial absorption of bilirubin and biliverdin, which indicates that bile pigments can protect by intercepting mutations extracellularly and specifically inhibit frame-shift mutations intracellularly. PMID:22906569

  6. Gain- and Loss-of-Function Mutations in the Breast Cancer Gene GATA3 Result in Differential Drug Sensitivity.

    PubMed

    Mair, Barbara; Konopka, Tomasz; Kerzendorfer, Claudia; Sleiman, Katia; Salic, Sejla; Serra, Violeta; Muellner, Markus K; Theodorou, Vasiliki; Nijman, Sebastian M B

    2016-09-01

    Patterns of somatic mutations in cancer genes provide information about their functional role in tumourigenesis, and thus indicate their potential for therapeutic exploitation. Yet, the classical distinction between oncogene and tumour suppressor may not always apply. For instance, TP53 has been simultaneously associated with tumour suppressing and promoting activities. Here, we uncover a similar phenomenon for GATA3, a frequently mutated, yet poorly understood, breast cancer gene. We identify two functional classes of frameshift mutations that are associated with distinct expression profiles in tumours, differential disease-free patient survival and gain- and loss-of-function activities in a cell line model. Furthermore, we find an estrogen receptor-independent synthetic lethal interaction between a GATA3 frameshift mutant with an extended C-terminus and the histone methyltransferases G9A and GLP, indicating perturbed epigenetic regulation. Our findings reveal important insights into mutant GATA3 function and breast cancer, provide the first potential therapeutic strategy and suggest that dual tumour suppressive and oncogenic activities are more widespread than previously appreciated. PMID:27588951

  7. Two new severe mutations causing guanidinoacetate methyltransferase deficiency.

    PubMed

    Carducci, C; Leuzzi, V; Carducci, C; Prudente, S; Mercuri, L; Antonozzi, I

    2000-12-01

    Primary disorders of creatine metabolism have been only recently described. We report new molecular and biochemical findings obtained from a child affected by guanidinoacetate methyltransferase deficiency. This patient presented with neurological regression, epilepsy, and a movement disorder during the first year of life. HPLC analysis showed high concentrations of guanidinoacetic acid in urine, plasma, and CSF. Molecular analyses of cDNA and genomic DNA revealed two novel mutations, a G insertion following nucleotide 491 of the cDNA (c.491insG) in exon 5 and a transversion at nt -3 in intron 5 (IVS5-3C>G). The c.491insG mutation causes a frameshift and a premature stop codon at the end of the exon. The IVS5-3C>G mutation prevents the splicing of the last exon of the gene precluding the complete maturation of the transcript and, most likely, causes rapid degradation of the mRNA. PMID:11136556

  8. Late-onset epileptic spasms in a female patient with a CASK mutation.

    PubMed

    Nakajiri, Tomoshi; Kobayashi, Katsuhiro; Okamoto, Nobuhiko; Oka, Makio; Miya, Fuyuki; Kosaki, Kenjiro; Yoshinaga, Harumi

    2015-10-01

    We report a female patient with late-onset epileptic spasms (ESs) of a rare form, distinct from those seen in typical West syndrome, in association with a heterozygous frameshift CASK mutation (c.1896dupC (p.C633fs(∗)2)). She has a phenotype of microcephaly with pontine and cerebellar hypoplasia (MICPCH), and has had intractable ESs in clusters since 3 years 8 months of age with multifocal, particularly bifrontal, epileptic discharges in electroencephalogram. The available literature on patients with both ESs and CASK mutations has been reviewed, revealing that four of the five female children, including the present girl, had late-onset ESs, in contrast to the four males, who tended toward early-onset ESs. PMID:25765806

  9. Truncating mutation in the autophagy gene UVRAG confers oncogenic properties and chemosensitivity in colorectal cancers

    PubMed Central

    He, Shanshan; Zhao, Zhen; Yang, Yongfei; O'Connell, Douglas; Zhang, Xiaowei; Oh, Soohwan; Ma, Binyun; Lee, Joo-Hyung; Zhang, Tian; Varghese, Bino; Yip, Janae; Dolatshahi Pirooz, Sara; Li, Ming; Zhang, Yong; Li, Guo-Min; Ellen Martin, Sue; Machida, Keigo; Liang, Chengyu

    2015-01-01

    Autophagy-related factors are implicated in metabolic adaptation and cancer metastasis. However, the role of autophagy factors in cancer progression and their effect in treatment response remain largely elusive. Recent studies have shown that UVRAG, a key autophagic tumour suppressor, is mutated in common human cancers. Here we demonstrate that the cancer-related UVRAG frameshift (FS), which does not result in a null mutation, is expressed as a truncated UVRAGFS in colorectal cancer (CRC) with microsatellite instability (MSI), and promotes tumorigenesis. UVRAGFS abrogates the normal functions of UVRAG, including autophagy, in a dominant-negative manner. Furthermore, expression of UVRAGFS can trigger CRC metastatic spread through Rac1 activation and epithelial-to-mesenchymal transition, independently of autophagy. Interestingly, UVRAGFS expression renders cells more sensitive to standard chemotherapy regimen due to a DNA repair defect. These results identify UVRAG as a new MSI target gene and provide a mechanism for UVRAG participation in CRC pathogenesis and treatment response. PMID:26234763

  10. Estimating mutation rate: how to count mutations?

    PubMed Central

    Fu, Yun-Xin; Huai, Haying

    2003-01-01

    Mutation rate is an essential parameter in genetic research. Counting the number of mutant individuals provides information for a direct estimate of mutation rate. However, mutant individuals in the same family can share the same mutations due to premeiotic mutation events, so that the number of mutant individuals can be significantly larger than the number of mutation events observed. Since mutation rate is more closely related to the number of mutation events, whether one should count only independent mutation events or the number of mutants remains controversial. We show in this article that counting mutant individuals is a correct approach for estimating mutation rate, while counting only mutation events will result in underestimation. We also derived the variance of the mutation-rate estimate, which allows us to examine a number of important issues about the design of such experiments. The general strategy of such an experiment should be to sample as many families as possible and not to sample much more offspring per family than the reciprocal of the pairwise correlation coefficient within each family. To obtain a reasonably accurate estimate of mutation rate, the number of sampled families needs to be in the same or higher order of magnitude as the reciprocal of the mutation rate. PMID:12807798

  11. A syndrome of microcephaly, short stature, polysyndactyly, and dental anomalies caused by a homozygous KATNB1 mutation.

    PubMed

    Yigit, Gökhan; Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Möller-Hartmann, Claudia; Altmüller, Janine; Thiele, Holger; Nürnberg, Peter; Wollnik, Bernd

    2016-03-01

    Using whole-exome sequencing, we identified a homozygous acceptor splice-site mutation in intron 6 of the KATNB1 gene in a patient from a consanguineous Turkish family who presented with congenital microcephaly, lissencephaly, short stature, polysyndactyly, and dental abnormalities. cDNA analysis revealed complete loss of the natural acceptor splice-site resulting either in the usage of an alternative, exonic acceptor splice-site inducing a frame-shift and premature protein truncation or, to a minor extent, in complete skipping of exon 7. Both effects most likely lead to complete loss of KATNB1 function. Homozygous and compound heterozygous mutations in KATNB1 have very recently been described as a cause of microcephaly with brain malformations and seizures. We extend the KATNB1 associated phenotype by describing a syndrome characterized by primordial dwarfism, lissencephaly, polysyndactyly, and dental anomalies, which is caused by a homozygous truncating KATNB1 mutation. PMID:26640080

  12. The USH1C 216G-->A splice-site mutation results in a 35-base-pair deletion.

    PubMed

    Lentz, Jennifer; Savas, Sevtap; Ng, San-San; Athas, Grace; Deininger, Prescott; Keats, Bronya

    2005-02-01

    Usher syndrome is characterized by profound hearing loss and retinal degeneration. A splice-site mutation, 216G-->A, in exon 3 of USH1C is associated with Acadian Usher type IC. This mutation was reported to create an in-frame deletion of 39 base pairs (bp), resulting in an unstable transcript. By RT-PCR analysis of 216A and 216G constructs transfected into HeLa cells and also of patient cell lines, we have demonstrated a frame-shift deletion of 35 bp, not 39 bp. Thus, the instability of the USH1C mRNA is explained by the 216G-->A out-of-frame splice site mutation. PMID:15578223

  13. A novel SOX18 mutation uncovered in Jordanian patient with hypotrichosis-lymphedema-telangiectasia syndrome by Whole Exome Sequencing.

    PubMed

    Bastaki, Fatma; Mohamed, Madiha; Nair, Pratibha; Saif, Fatima; Tawfiq, Nafisa; Al-Ali, Mahmoud Taleb; Brandau, Oliver; Hamzeh, Abdul Rezzak

    2016-02-01

    The SOX18 gene encodes a transcription factor that plays a notable role in certain developmental contexts such as lymphangiogenesis, hair follicle development and vasculogenesis. SOX18 mutations are linked to recessive and dominant hypotrichosis-lymphedema-telangiectasia syndrome (HLTS). In this study we report on a novel heterozygous mutation in SOX18 in a Jordanian patient suffering from HLTS that was revealed by Whole Exome Sequencing. In this case, a frameshift caused by 14-nucleotide duplication in SOX18 appeared de novo resulting in a premature translational stop at the N-terminal region of the central trans-activation domain. Here we present the clinical manifestations of the above mentioned molecular lesion in the light of what is known from published SOX18 mutations. PMID:26631803

  14. Identification of eight mutations and three sequence variations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene

    SciTech Connect

    Ghanem, N.; Costes, B.; Girodon, E.; Martin, J.; Fanen, P.; Goossens, M. )

    1994-05-15

    To determine cystic fibrosis (CF) defects in a sample of 224 non-[Delta]F508 CF chromosomes, the authors used denaturing gradient gel multiplex analysis of CF transmembrane conductance regulator gene segments, a strategy based on blind exhaustive analysis rather than a search for known mutations. This process allowed detection of 11 novel variations comprising two nonsense mutations (Q890X and W1204X), a splice defect (405 + 4 A [yields] G), a frameshift (3293delA), four presumed missense mutations (S912L, H949Y, L1065P, Q1071P), and three sequence polymorphisms (R31C or 223 C/T, 3471 T/C, and T1220I or 3791 C/T). The authors describe these variations, together with the associated phenotype when defects on both CF chromosomes were identified. 8 refs., 1 fig., 1 tab.

  15. The mutation profile of JAK2 and CALR in Chinese Han patients with Philadelphia chromosome-negative myeloproliferative neoplasms

    PubMed Central

    2014-01-01

    Mutations in JAK2, MPL and CALR are highly relevant to the Philadelphia chromosome (Ph)-negative myeloproliferative neoplasms (MPNs). We performed high resolution melting analysis and Sanger sequencing together with T-A cloning to elucidate the unique mutation profile of these genes, in Chinese patients with MPNs. Peripheral blood DNA samples were obtained from 80 patients with polycythemia vera (PV), 80 patients with essential thrombocytosis (ET) and 50 patients with primary myelofibrosis (PMF). Ten PV patients were identified with diverse JAK2 exon 12 mutations. Five novel JAK2 Exon 12 mutation patterns (M532V/E543G, N533D, M535I/H538Y/K549I, E543G and D544N) were described. JAK2 V617F was detected in 140 samples (66 PV, 45 ET and 29 PMF). JAK2 Exon 12 mutations were prevalent (13%) and variable in the Chinese patients. Compared with PV patients with JAK2 V617F mutations, PV patients with JAK2 exon 12 mutations had an earlier median onset of disease (P = 0.0013). MPL W515L/K mutations were discerned in 4 ET and 3 PMF patients. Two kinds of CALR mutation, c. 1179_1230del and c. 1234_1235insTTGTC were detected in 20 ET and 16 PMF patients. A novel CALR mutation pattern (c. 1173_1223del/c. 1179_1230del) was identified in 2 PMF samples. In addition, 17 scattered point mutations in CALR c.1153 to c.1255 were also detected in 13 cases with CALR frame-shifting variations and 2 cases without CALR frame-shifting variations. Female patients showed a predisposition to CALR mutations (P = 0.0035). Chinese Ph-negative MPN patients have a unique mutation landscape in the common molecular markers of MPN diagnosis. Validation of the molecular diagnostic pipeline should be emphasized since there is a considerable ethnical diversity in the molecular profiles of Ph-negative MPNs. PMID:25023898

  16. Mutational specificities of environmental carcinogens in the lacl gene of Escherichia coli H. V: DNA sequence analysis of mutations in bacteria recovered from the liver of Swiss mice exposed to 1,2-dimethylhydrazine, azoxymethane, and methylazoxymethanolacetate

    SciTech Connect

    Zeilmaker, M.J.; Horsfall, M.J.; van Helten, J.B.; Glickman, B.W.; Mohn, G.R. )

    1991-01-01

    The host-mediated assay (HMA) was used to determine the spectra of mutations induced in the lacl gene of Escherichia coli cells recovered from the livers of Swiss mice exposed to the carcinogens 1,2-dimethylhydrazine (SDMH), azoxymethane (AOM), and methylazoxymethanolacetate (MAMA). These spectra were further compared with changes induced by dimethylnitrosamine (DMNA) in the HMA methodology. A total of 177 independent lacl mutations arising in the HMA following exposure to SDMH, AOM, and MAMA were analyzed. Single-base substitutions accounted for 97% of all mutations analyzed. The vast majority of the single-base substitutions consisted of G:C----A:T transitions (94% of all mutations). The remaining mutations consisted of A:T----G:C transitions (3% of all mutations) while non-base substitutions accounted for only 3% of the total mutagenesis. The latter mutations consisted of one frameshift mutation and four lacO deletions. The distribution of G:C----A:T transitions induced by the three chemicals in the first 200 bp of the lacl gene was not random, but rather clustered at sites where a target guanine was flanked at the 5{prime} site by a purine residue.

  17. Novel mutations in SKIV2L and TTC37 genes in Malaysian children with trichohepatoenteric syndrome.

    PubMed

    Lee, Way Seah; Teo, Kai Ming; Ng, Ruey Terng; Chong, Sze Yee; Kee, Boon Pin; Chua, Kek Heng

    2016-07-15

    Trichohepatoenteric syndrome (THES) is a rare autosomal recessive disorder that is classically associated with intractable diarrhea with an onset within the first few months of life. Herein, we investigated and reported novel mutations in two causal genes in 3 Malaysian cases. Genomic DNA was extracted from peripheral blood obtained from patients in two Malaysian Chinese families. The exons of SKIV2L and TTC37 genes were amplified and sequenced by bi-directional sequencing to identify the point mutations within the coding sequence. Three Chinese boys from two families with characteristic features and clinical course were diagnosed with THES. In family-1, two point mutations were identified in the SKIV2L gene (c.1891G>A and c.3187C>T). In family-2, a single-nucleotide duplication (c.3426dupA) was found in the TTC37 gene. These mutations cause the production of abnormal non-functional gene product leading to the clinical manifestations in the patients. We reported three point mutations, which have not been previously described in other patients with THES in SKIV2L and TTC37 genes, including one nonsense, one frameshift, and one missense mutations. PMID:27050310

  18. Polymorphisms and Mutations of Human TMPRSS6 in Iron Deficiency Anemia

    PubMed Central

    Beutler, E.; Van Geet, C.; te Loo, D.M.W.M.; Gelbart, T.; Crain, K.; Truksa, J; Lee, P.L

    2009-01-01

    Male subjects with iron deficiency from the general population were examined for polymorphisms or sporadic mutations in TMPRSS6 to identify genetic risk factors for iron deficiency anemia. Three uncommon non-synonymous polymorphisms were identified, G228D, R446W, and V795I (allele frequencies 0.0074, 0.023 and 0.0074 respectively), of which the R446W polymorphism appeared to be overrepresented in the anemic population. In addition, three children with iron refractory iron deficiency anemia, and one sibling with iron responsive iron deficiency anemia were also examined for polymorphisms or sporadic mutations in TMPRSS6. Two children (family 1) were compound heterozygotes for a L674F mutation and a previously described splicing defect predicted to cause skipping of exon 13 (IVS13+1 G>A). One child from the second family was homozygous for a deletion (497T) causing a frameshift (L166X+36) and premature termination. The sibling and mother from the second family were compound heterozygotes for the L166X mutation and the uncommon R446W polymorphism. Although in vitro expression studies demonstrated that the R446W isoform was biologically similar to wildtype Tmprss6, clinical data indicate that the R446W produces a milder disease when carried in trans with severe mutation in Tmprss6. The four children carrying mutations in TMPRSS6 all exhibited inappropriately high urinary hepcidin levels for the degree of iron deficiency. PMID:19818657

  19. Identification of eight point mutations in protein S deficiency type I--analysis of 15 pedigrees.

    PubMed

    Gómez, E; Poort, S R; Bertina, R M; Reitsma, P H

    1995-05-01

    We described molecular genetic studies of 15 patients with protein S deficiency type I (i.e. reduced total protein S antigen). All the exons of the PROS 1 gene were analyzed both by PCR and direct sequencing in all 15 probands. This analysis led to the identification of point mutations affecting eight individuals. One of these mutations (codon-25, insertion of T) has been described previously in a Dutch pedigree. The other mutations are novel and all are located in exons that code for the protein S domain that is homologous to the steroid hormone binding globulins. They include two amino acid replacements (one individual with 340 Gly--> Val, and two individuals with 467 Val --> Gly), and four frameshift mutations due to either one bp deletions (in codon 261 deletion of T and in codon 267 deletion of G) or insertions (in codon 565 insertion T and after codon 578 insertions of C). Studies performed in six families (totalling 43 subjects) showed cosegregation of the genetic abnormality with reduced plasma protein S levels, and provided genetic evidence for a heterozygous protein S deficiency in 25 of them. The yield of mutations in this study (53%) confirms that the percentage of protein S deficient cases in which a point mutation is found remains low. PMID:7482398

  20. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation.

    PubMed

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun

    2016-01-01

    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease. PMID:27570485

  1. Alterations of the IKBKG locus and diseases: an update and a report of 13 novel mutations.

    PubMed

    Fusco, Francesca; Pescatore, Alessandra; Bal, Elodie; Ghoul, Aida; Paciolla, Mariateresa; Lioi, Maria Brigida; D'Urso, Michele; Rabia, Smail Hadj; Bodemer, Christine; Bonnefont, Jean Paul; Munnich, Arnold; Miano, Maria Giuseppina; Smahi, Asma; Ursini, Matilde Valeria

    2008-05-01

    Mutations in the inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), also called nuclear factor-kappaB (NF-kB) essential modulator (NEMO), gene are the most common single cause of incontinentia pigmenti (IP) in females and anhydrotic ectodermal dysplasia with immunodeficiency (EDA-ID) in males. The IKBKG gene, located in the Xq28 chromosomal region, encodes for the regulatory subunit of the inhibitor of kappaB (IkB) kinase (IKK) complex required for the activation of the NF-kB pathway. Therefore, the remarkably heterogeneous and often severe clinical presentation reported in IP is due to the pleiotropic role of this signaling transcription pathway. A recurrent exon 4_10 genomic rearrangement in the IKBKG gene accounts for 60 to 80% of IP-causing mutations. Besides the IKBKG rearrangement found in IP females (which is lethal in males), a total of 69 different small mutations (missense, frameshift, nonsense, and splice-site mutations) have been reported, including 13 novel ones in this work. The updated distribution of all the IP- and EDA-ID-causing mutations along the IKBKG gene highlights a secondary hotspot mutation in exon 10, which contains only 11% of the protein. Furthermore, familial inheritance analysis revealed an unexpectedly high incidence of sporadic cases (>65%). The sum of the observations can aid both in determining the molecular basis of IP and EDA-ID allelic diseases, and in genetic counseling in affected families. PMID:18350553

  2. Different inactivating mutations of the mineralocorticoid receptor in fourteen families affected by type I pseudohypoaldosteronism.

    PubMed

    Sartorato, Paola; Lapeyraque, Anne-Laure; Armanini, Decio; Kuhnle, Ursula; Khaldi, Yasmina; Salomon, Rémi; Abadie, Véronique; Di Battista, Eliana; Naselli, Arturo; Racine, Alain; Bosio, Maurizio; Caprio, Massimiliano; Poulet-Young, Véronique; Chabrolle, Jean-Pierre; Niaudet, Patrick; De Gennes, Christiane; Lecornec, Marie-Hélène; Poisson, Elodie; Fusco, Anna Maria; Loli, Paola; Lombès, Marc; Zennaro, Maria-Christina

    2003-06-01

    We have analyzed the human mineralocorticoid receptor (hMR) gene in 14 families with autosomal dominant or sporadic pseudohypoaldosteronism (PHA1), a rare form of mineralocorticoid resistance characterized by neonatal renal salt wasting and failure to thrive. Six heterozygous mutations were detected. Two frameshift mutations in exon 2 (insT1354, del8bp537) and one nonsense mutation in exon 4 (C2157A, Cys645stop) generate truncated proteins due to premature stop codons. Three missense mutations (G633R, Q776R, L979P) differently affect hMR function. The DNA binding domain mutant R633 exhibits reduced maximal transactivation, although its binding characteristics and ED(50) of transactivation are comparable with wild-type hMR. Ligand binding domain mutants R776 and P979 present reduced or absent aldosterone binding, respectively, which is associated with reduced or absent ligand-dependent transactivation capacity. Finally, P979 possesses a transdominant negative effect on wild-type hMR activity, whereas mutations G633R and Q776R probably result in haploinsufficiency in PHA1 patients. We conclude that hMR mutations are a common feature of autosomal dominant PHA1, being found in 70% of our familial cases. Their absence in some families underscores the importance of an extensive investigation of the hMR gene and the role of precise diagnostic procedures to allow for identification of other genes potentially involved in the disease. PMID:12788847

  3. A novel mutation causing pseudohypoparathyroidism 1A with congenital hypothyroidism and osteoma cutis.

    PubMed

    Lubell, Tamar; Garzon, Maria; Anyane Yeboa, Kwame; Shah, Bina

    2009-01-01

    Various inactivating mutations in guanine nucleotide-binding protein, alpha-stimulating activity polypeptide1 (GNAS1) gene have been described with poor phenotype correlation. Pseudohypoparathyroidism type 1a (PHP1a) results from an inactivating mutation in the GNAS1 gene. Hormone resistance occurs not only to parathyroid hormone (PTH), but typically also to other hormones which signal via G protein coupled receptors including thyroid stimulating hormone (TSH), gonadotropins, and growth hormone releasing hormone. In addition, the phenotype of Albright hereditary osteodystrophy (AHO) is observed, which may include short stature, round facies, brachydactyly, obesity, ectopic soft tissue or dermal ossification (osteoma cutis) and psychomotor retardation with variable expression. We present a 2-year-old boy with PHP 1A who initially presented at age 3 weeks with congenital hypothyroidism. By 17 months of age, he manifested osteoma cutis, psychomotor retardation, obesity, brachydactyly and resistance to PTH with normocalcemia and mild hyperphosphatemia. Genetic analysis revealed a novel mutation in exon 13 of GNAS1 in our patient. This mutation, c.1100_1101insA, resulted in a frameshift and premature truncation of bases downstream. This mutation was also found in the mother of this patient who was also noted to have short stature, obesity, brachydactyly and non progressive osteoma cutis, but no hormone resistance.We report a novel heterozygous mutation causing PHP1A with PTH and TSH resistance and AHO which has not been described previously. PHP1A is also a rare presentation of congenital hypothyroidism. PMID:21274302

  4. Whole Exome Sequencing Identifies Mutations in Usher Syndrome Genes in Profoundly Deaf Tunisian Patients

    PubMed Central

    Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine

    2015-01-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss. PMID:25798947

  5. Expanded mutational spectrum in Cohen syndrome, tissue expression, and transcript variants of COH1.

    PubMed

    Seifert, Wenke; Holder-Espinasse, Muriel; Kühnisch, Jirko; Kahrizi, Kimia; Tzschach, Andreas; Garshasbi, Masoud; Najmabadi, Hossein; Walter Kuss, Andreas; Kress, Wolfram; Laureys, Geneviève; Loeys, Bart; Brilstra, Eva; Mancini, Grazia M S; Dollfus, Hélène; Dahan, Karin; Apse, Kira; Hennies, Hans Christian; Horn, Denise

    2009-02-01

    Cohen syndrome is characterised by mental retardation, postnatal microcephaly, facial dysmorphism, pigmentary retinopathy, myopia, and intermittent neutropenia. Mutations in COH1 (VPS13B) have been found in patients with Cohen syndrome from diverse ethnic origins. We have carried out mutation analysis in twelve novel patients with Cohen syndrome from nine families. In this series, we have identified 13 different mutations in COH1, twelve of these are novel including six frameshift mutations, four nonsense mutations, two splice site mutations, and a one-codon deletion. Since different transcripts of COH1 have been reported previously, we have analysed the expression patterns of COH1 splice variants. The transcript variant NM_152564 including exon 28b showed ubiquitous expression in all examined human tissues. In contrast, human brain and retina showed differential splicing of exon 28 (NM_017890). Moreover, analysis of mouse tissues revealed ubiquitous expression of Coh1 homologous to human NM_152564 in all examined tissues but no prevalent alternative splicing. PMID:19006247

  6. Molecular nature of 11 spontaneous de novo mutations in Drosophila melanogaster.

    PubMed

    Yang, H P; Tanikawa, A Y; Kondrashov, A S

    2001-03-01

    To investigate the molecular nature and rate of spontaneous mutation in Drosophila melanogaster, we screened 887,000 individuals for de novo recessive loss-of-function mutations at eight loci that affect eye color. In total, 28 mutants were found in 16 independent events (13 singletons and three clusters). The molecular nature of the 13 events was analyzed. Coding exons of the locus were affected by insertions or deletions >100 nucleotides long (6 events), short frameshift insertions or deletions (4 events), and replacement nucleotide substitutions (1 event). In the case of 2 mutant alleles, coding regions were not affected. Because approximately 70% of spontaneous de novo loss-of-function mutations in Homo sapiens are due to nucleotide substitutions within coding regions, insertions and deletions appear to play a much larger role in spontaneous mutation in D. melanogaster than in H. sapiens. If so, the per nucleotide mutation rate in D. melanogaster may be lower than in H. sapiens, even if their per locus mutation rates are similar. PMID:11238412

  7. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation

    PubMed Central

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun

    2016-01-01

    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease. PMID:27570485

  8. Identification of four novel PCDH19 Mutations and prediction of their functional impact.

    PubMed

    Leonardi, Emanuela; Sartori, Stefano; Vecchi, Marilena; Bettella, Elisa; Polli, Roberta; Palma, Luca De; Boniver, Clementina; Murgia, Alessandra

    2014-11-01

    The PCDH19 gene encodes protocadherin-19, a transmembrane protein with six cadherin (EC) domains, containing adhesive interfaces likely to be involved in neuronal connection. Over a hundred mostly private mutations have been identified in girls with epilepsy, with or without intellectual disability (ID). Furthermore, transmitting hemizygous males are devoid of seizures or ID, making it difficult to establish the pathogenic nature of newly identified variants. Here, we describe an integrated approach to evaluate the pathogenicity of four novel PCDH19 mutations. Segregation analysis has been complemented with an in silico analysis of mutation effects at the protein level. Using sequence information, we compared different computational prediction methods. We used homology modeling to build structural models of two PCDH19 EC-domains, and compared wild-type and mutant models to identify differences in residue interactions or biochemical properties of the model surfaces. Our analysis suggests different molecular effects of the novel mutations in exerting their pathogenic role. Two of them interfere with or alter functional residues predicted to mediate ligand or protein binding, one alters the EC-domain folding stability; the frame-shift mutation produces a truncated protein lacking the intracellular domain. Interestingly, the girl carrying the putative loss of function mutation presents the most severe phenotype. PMID:25227595

  9. Pseudolysogeny and sequential mutations build multiresistance to virulent bacteriophages in Pseudomonas aeruginosa.

    PubMed

    Latino, Libera; Midoux, Cédric; Hauck, Yolande; Vergnaud, Gilles; Pourcel, Christine

    2016-05-01

    Coevolution between bacteriophages (phages) and their prey is the result of mutualistic interactions. Here, we show that pseudolysogeny is a frequent outcome of infection by virulent phages of Pseudomonas aeruginosa and that selection of resistant bacterial mutants is favoured by continuous production of phages. We investigated the frequency and characteristics of P. aeruginosa strain PAO1 variants resisting infection by different combinations of virulent phages belonging to four genera. The frequency of resistant bacteria was 10- 5 for single phage infection and 10- 6 for infections with combinations of two or four phages. The genome of 27 variants was sequenced and the comparison with the genome of the parental PAO1 strain allowed the identification of point mutations or small indels. Four additional variants were characterized by a candidate gene approach. In total, 27 independent mutations were observed affecting 14 genes and a regulatory region. The mutations affected genes involved in biosynthesis of type IV pilus, alginate, LPS and O-antigen. Half of the variants possessed changes in homopolymer tracts responsible for frameshift mutations and these phase variation mutants were shown to be unstable. Eleven double mutants were detected. The presence of free phage DNA was observed in association with exclusion of superinfection in half of the variants and no chromosomal mutation could be found in three of them. Upon further growth of these pseudolysogens, some variants with new chromosomal mutations were recovered, presumably due to continuous evolutionary pressure. PMID:26921273

  10. Identification of 31 novel mutations in the F8 gene in Spanish hemophilia A patients: structural analysis of 20 missense mutations suggests new intermolecular binding sites.

    PubMed

    Venceslá, Adoración; Corral-Rodríguez, María Angeles; Baena, Manel; Cornet, Mónica; Domènech, Montserrat; Baiget, Montserrat; Fuentes-Prior, Pablo; Tizzano, Eduardo F

    2008-04-01

    Hemophilia A (HA) is an X-linked bleeding disorder caused by a wide variety of mutations in the factor 8 (F8) gene, leading to absent or deficient factor VIII (FVIII). We analyzed the F8 gene of 267 unrelated Spanish patients with HA. After excluding patients with the common intron-1 and intron-22 inversions and large deletions, we detected 137 individuals with small mutations, 31 of which had not been reported previously. Eleven of these were nonsense, frameshift, and splicing mutations, whereas 20 were missense changes. We assessed the impact of the 20 substitutions based on currently available information about FV and FVIII structure and function relationship, including previously reported results of replacements at these and topologically equivalent positions. Although most changes are likely to cause gross structural perturbations and concomitant cofactor instability, p.Ala375Ser is predicted to affect cofactor activation. Finally, 3 further mutations (p.Pro64Arg, p.Gly494Val, and p.Asp2267Gly) appear to affect cofactor interactions with its carrier protein, von Willebrand factor, with the scavenger receptor low-density lipoprotein receptor-related protein (LRP), and/or with the substrate of the FVIIIapi*FIXa (Xase) complex, factor X. Characterization of these novel mutations is important for adequate genetic counseling in HA families, but also contributes to a better understanding of FVIII structure-function relationship. PMID:18184865

  11. Identification of 31 novel mutations in the F8 gene in Spanish hemophilia A patients: structural analysis of 20 missense mutations suggests new intermolecular binding sites

    PubMed Central

    Venceslá, Adoración; Corral-Rodríguez, María Ángeles; Baena, Manel; Cornet, Mónica; Domènech, Montserrat; Baiget, Montserrat; Fuentes-Prior, Pablo

    2008-01-01

    Hemophilia A (HA) is an X-linked bleeding disorder caused by a wide variety of mutations in the factor 8 (F8) gene, leading to absent or deficient factor VIII (FVIII). We analyzed the F8 gene of 267 unrelated Spanish patients with HA. After excluding patients with the common intron-1 and intron-22 inversions and large deletions, we detected 137 individuals with small mutations, 31 of which had not been reported previously. Eleven of these were nonsense, frameshift, and splicing mutations, whereas 20 were missense changes. We assessed the impact of the 20 substitutions based on currently available information about FV and FVIII structure and function relationship, including previously reported results of replacements at these and topologically equivalent positions. Although most changes are likely to cause gross structural perturbations and concomitant cofactor instability, p.Ala375Ser is predicted to affect cofactor activation. Finally, 3 further mutations (p.Pro64Arg, p.Gly494Val, and p.Asp2267Gly) appear to affect cofactor interactions with its carrier protein, von Willebrand factor, with the scavenger receptor low-density lipoprotein receptor–related protein (LRP), and/or with the substrate of the FVIIIapi•FIXa (Xase) complex, factor X. Characterization of these novel mutations is important for adequate genetic counseling in HA families, but also contributes to a better understanding of FVIII structure-function relationship. PMID:18184865

  12. Matriptase-2 mutations in iron-refractory iron deficiency anemia patients provide new insights into protease activation mechanisms.

    PubMed

    Ramsay, Andrew J; Quesada, Victor; Sanchez, Mayka; Garabaya, Cecilia; Sardà, María P; Baiget, Montserrat; Remacha, Angel; Velasco, Gloria; López-Otín, Carlos

    2009-10-01

    Mutations leading to abrogation of matriptase-2 proteolytic activity in humans are associated with an iron-refractory iron deficiency anemia (IRIDA) due to elevated hepcidin levels. Here we describe two novel heterozygous mutations within the matriptase-2 (TMPRSS6) gene of monozygotic twin girls exhibiting an IRIDA phenotype. The first is the frameshift mutation (P686fs) caused by the insertion of the four nucleotides CCCC in exon 16 (2172_2173insCCCC) that is predicted to terminate translation before the catalytic serine. The second mutation is the di-nucleotide substitution c.467C>A and c.468C>T in exon 3 that causes the missense mutation A118D in the SEA domain of the extracellular stem region of matriptase-2. Functional analysis of both variant matriptase-2 proteases has revealed that they lead to ineffective suppression of hepcidin transcription. We also demonstrate that the A118D SEA domain mutation causes an intra-molecular structural imbalance that impairs matriptase-2 activation. Collectively, these results extend the pattern of TMPRSS6 mutations associated with IRIDA and functionally demonstrate that mutations affecting protease regions other than the catalytic domain may have a profound impact in the regulatory role of matriptase-2 during iron deficiency. PMID:19592582

  13. Mutations in the human GlyT2 gene define a presynaptic component of human startle disease

    PubMed Central

    Rees, Mark I.; Harvey, Kirsten; Pearce, Brian R.; Chung, Seo-Kyung; Duguid, Ian C.; Thomas, Philip; Beatty, Sarah; Graham, Gail E.; Armstrong, Linlea; Shiang, Rita; Abbott, Kim J.; Zuberi, Sameer M.; Stephenson, John B.P.; Owen, Michael J.; Tijssen, Marina A.J.; van den Maagdenberg, Arn M.J.M.; Smart, Trevor G.; Supplisson, Stéphane; Harvey, Robert J.

    2011-01-01

    Hyperekplexia is a human neurological disorder characterized by an excessive startle response and is typically caused by missense and nonsense mutations in the gene encoding the inhibitory glycine receptor (GlyR) α1 subunit (GLRA1)1-3. Genetic heterogeneity has been confirmed in isolated sporadic cases with mutations in other postsynaptic glycinergic proteins including the GlyR β subunit (GLRB)4, gephyrin (GPHN)5 and RhoGEF collybistin (ARHGEF9)6. However, many sporadic patients diagnosed with hyperekplexia do not carry mutations in these genes2-7. Here we reveal that missense, nonsense and frameshift mutations in the presynaptic glycine transporter 2 (GlyT2) gene (SLC6A5)8 also cause hyperekplexia. Patients harbouring mutations in SLC6A5 presented with hypertonia, an exaggerated startle response to tactile or acoustic stimuli, and life-threatening neonatal apnoea episodes. GlyT2 mutations result in defective subcellular localisation and/or decreased glycine uptake, with selected mutations affecting predicted glycine and Na+ binding sites. Our results demonstrate that SLC6A5 is a major gene for hyperekplexia and define the first neurological disorder linked to mutations in a Na+/Cl−-dependent transporter for a classical fast neurotransmitter. By analogy, we suggest that in other human disorders where defects in postsynaptic receptors have been identified, similar symptoms could result from defects in the cognate presynaptic neurotransmitter transporter. PMID:16751771

  14. Identification of the second common Jewish Gaucher disease mutation makes possible population-based screening for the heterozygous state

    SciTech Connect

    Beutler, E.; Gelbart, T.; Kuhl, W.; Sorge, J.; West, C. )

    1991-12-01

    Gaucher disease is an autosomal recessive glycolipid storage disease characterized by a deficiency of glucocerebrosidase. The disease is most common in persons of Ashkenazi Jewish ancestry and the most common mutation, accounting for about 75% of the mutant alleles in this population, is known to be an A {yields} G substitution at cDNA nucleotide (nt) 1,226. Screening for this disease has not been possible because nearly 25% of the mutant alleles had not been identified, but linkage analysis led to the suggestion that most of these could be accounted for by a single mutation. The authors now report the discovery of this mutation. The insertion of a single nucleotide, a second guanine at cDNA nt 84 (the 84GG mutation), has been detected in the 5{prime} coding region of the glucocerebrosidase gene. The amount mRNA produced is shown to be normal but since the frameshift produces early termination, no translation product is seen. This finding is consistent with the virtual absence of antigen found in patients carrying this mutation. The 84GG mutation accounts for most of the previously unidentified Gaucher disease mutations in Jewish patients. The common Jewish mutation at nt 1,448 accounted for 95% of all of the Gaucher disease-producing alleles in 71 Jewish patients. This now makes it possible to screen for heterozygotes on a DNA level with a relatively low risk of missing couples at risk for producing infants with Gaucher disease.

  15. Mutational spectrum of the oral-facial-digital type I syndrome: a study on a large collection of patients.

    PubMed

    Prattichizzo, Clelia; Macca, Marina; Novelli, Valeria; Giorgio, Giovanna; Barra, Adriano; Franco, Brunella

    2008-10-01

    Oral-facial-digital type I (OFDI) syndrome is a male-lethal X-linked dominant developmental disorder belonging to the heterogeneous group of oral-facial-digital syndromes (OFDS). OFDI is characterized by malformations of the face, oral cavity, and digits. Central nervous system (CNS) abnormalities and cystic kidney disease can also be part of this condition. This rare genetic disorder is due to mutations in the OFD1 gene that encodes a centrosome/basal body protein necessary for primary cilium assembly and for left-right axis determination, thus ascribing OFDI to the growing number of disorders associated to ciliary dysfunction. We now report a mutation analysis study in a cohort of 100 unrelated affected individuals collected worldwide. Putative disease-causing mutations were identified in 81 patients (81%). We describe 67 different mutations, 64 of which represent novel mutations, including 36 frameshift, nine missense, 11 splice-site, and 11 nonsense mutations. Most of them concentrate in exons 3, 8, 9, 12, 13, and 16, suggesting that these exons may represent mutational hotspots. Phenotypic characterization of the patients provided a better definition of the clinical features of OFDI syndrome. Our results indicate that renal cystic disease is present in 60% of cases >18 years of age. Genotype-phenotype correlation did not reveal significant associations apart for the high-arched/cleft palate most frequently associated to missense and splice-site mutations. Our results contribute to further expand our knowledge on the molecular basis of OFDI syndrome. PMID:18546297

  16. Mutations of GIPC3 cause nonsyndromic hearing loss DFNB72 but not DFNB81 that also maps to chromosome 19p

    PubMed Central

    Rehman, Atteeq U.; Gul, Khitab; Morell, Robert J.; Lee, Kwanghyuk; Ahmed, Zubair M.; Riazuddin, Saima; Ali, Rana A.; Shahzad, Mohsin; Jaleel, Ateeq-ul; Andrade, Paula B.; Khan, Shaheen N.; Khan, Saadullah; Brewer, Carmen C.; Ahmad, Wasim; Leal, Suzanne M.; Riazuddin, Sheikh

    2012-01-01

    A missense mutation of Gipc3 was previously reported to cause age-related hearing loss in mice. Point mutations of human GIPC3 were found in two small families, but association with hearing loss was not statistically significant. Here, we describe one frameshift and six missense mutations in GIPC3 cosegregating with DFNB72 hearing loss in six large families that support statistically significant evidence for genetic linkage. However, GIPC3 is not the only nonsyndromic hearing impairment gene in this region; no GIPC3 mutations were found in a family cosegregating hearing loss with markers of chromosome 19p. Haplotype analysis excluded GIPC3 from the obligate linkage interval in this family and defined a novel locus spanning 4.08 Mb and 104 genes. This closely linked but distinct nonsyndromic hearing loss locus was designated DFNB81. PMID:21660509

  17. Exome Sequencing Identification of EP300 Mutation in a Proband with Coloboma and Imperforate Anus: Possible Expansion of the Phenotypic Spectrum of Rubinstein-Taybi Syndrome.

    PubMed

    Masuda, Koji; Akiyama, Kazuhiro; Arakawa, Michiko; Nishi, Eriko; Kitazawa, Noritaka; Higuchi, Tsukasa; Katou, Yuki; Shirahige, Katsuhiko; Izumi, Kosuke

    2015-07-01

    Rubinstein-Taybi syndrome (RSTS) is a multisystem developmental disorder characterized by facial dysmorphisms, broad thumbs and halluces, growth retardation, and intellectual disability. In about 8% of RSTS cases, mutations are found in EP300. Previously, the EP300 mutation has been shown to cause the highly variable RSTS phenotype. Using exome sequencing, we identified a de novo EP300 frameshift mutation in a proband with coloboma, facial asymmetry and imperforate anus with minimal RSTS features. Previous molecular studies have demonstrated the importance of EP300 in oculogenesis, supporting the possibility that EP300 mutation may cause ocular coloboma. Since a wide phenotypic spectrum is well known in EP300-associated RSTS cases, the atypical phenotype identified in our proband may be an example of rare manifestations of RSTS. PMID:26279656

  18. Global Monitoring of Mountain Glaciers Using High-Resolution Spotlight Imaging from the International Space Station

    NASA Astrophysics Data System (ADS)

    Donnellan, A.; Green, J. J.; Bills, B. G.; Goguen, J.; Ansar, A.; Knight, R. L.; Hallet, B.; Scambos, T. A.; Thompson, L. G.; Morin, P. J.

    2013-12-01

    Mountain glaciers around the world are retreating rapidly, contributing about 20% to present-day sea level rise. Numerous studies have shown that mountain glaciers are sensitive to global environmental change. Temperate-latitude glaciers and snowpack provide water for over 1 billion people. Glaciers are a resource for irrigation and hydroelectric power, but also pose flood and avalanche hazards. Accurate mass balance assessments have been made for only 280 glaciers, yet there are over 130,000 in the World Glacier Inventory. The rate of glacier retreat or advance can be highly variable, is poorly sampled, and inadequately understood. Liquid water from ice front lakes, rain, melt, or sea water and debris from rocks, dust, or pollution interact with glacier ice often leading to an amplification of warming and further melting. Many mountain glaciers undergo rapid and episodic events that greatly change their mass balance or extent but are sparsely documented. Events include calving, outburst floods, opening of crevasses, or iceberg motion. Spaceborne high-resolution spotlight optical imaging provides a means of clarifying the relationship between the health of mountain glaciers and global environmental change. Digital elevation models (DEMs) can be constructed from a series of images from a range of perspectives collected by staring at a target during a satellite overpass. It is possible to collect imagery for 1800 targets per month in the ×56° latitude range, construct high-resolution DEMs, and monitor changes in high detail over time with a high-resolution optical telescope mounted on the International Space Station (ISS). Snow and ice type, age, and maturity can be inferred from different color bands as well as distribution of liquid water. Texture, roughness, albedo, and debris distribution can be estimated by measuring bidirectional reflectance distribution functions (BRDF) and reflectance intensity as a function of viewing angle. The non-sun-synchronous orbit

  19. Mutational analysis of Btk, the defective gene in X-linked agammaglobulinemia

    SciTech Connect

    Conley, M.E.; Fitch-Hilgenberg, M.E.; Rohrer, J.

    1994-09-01

    Recent studies have shown that X-linked agammaglobulinemia (XLA), a disorder of B cell development, is due to mutations in an scr-like cytoplasmic tyrosine kinase, Btk. Thus far, mutations in this gene have been identified by sequencing of cDNA. To permit the detection of mutations in genomic DNA, we determined the structure of Btk and identified 19 exons in 37 kb of DNA. PCR primers were designed to amplify each exon with its splice sites. Two overlapping PCR products were employed for exons longer than 230 base pairs. Single strand conformation polymorphism (SSCP) analysis was used to screen genomic DNA from 30 unrelated families presumed to carry a mutation in Btk. It was possible to amplify DNA in every reaction from every patient. None of the DNA samples demonstrated more than one aberrant SSCP pattern. Twenty three mutations were detected in 25 families. Seven point mutations resulting in amino acid substitutions were seen. An additional 7 base pair substitutions gave rise to premature stop codons. Two splice defects were noted. Small insertions or deletions, all resulting in frameshifts and premature stop codons were seen in eight patients. One patient had an A to G transition in the ATG start codon. Two mutations, both at CpG dinucleotides, were seen in more than one family. Haplotype analysis, using CA repeats closely linked to Btk, demonstrated that the mutations in these families arose independently. We conclude from these studies that the mutations in Btk in patients with XLA are highly variable. Large deletions are uncommon, although small 1 to 4 bp insertions or deletions constitute as many as one third of the mutations. Further analysis of patients with amino acid substitutions will permit structure/function correlations.

  20. Novel mutations in the USH1C gene in Usher syndrome patients

    PubMed Central

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

    2010-01-01

    Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

  1. Associations between Polycyclic Aromatic Hydrocarbon–Related Exposures and p53 Mutations in Breast Tumors

    PubMed Central

    Mordukhovich, Irina; Rossner, Pavel; Terry, Mary Beth; Santella, Regina; Zhang, Yu-Jing; Hibshoosh, Hanina; Memeo, Lorenzo; Mansukhani, Mahesh; Long, Chang-Min; Garbowski, Gail; Agrawal, Meenakshi; Gaudet, Mia M.; Steck, Susan E.; Sagiv, Sharon K.; Eng, Sybil M.; Teitelbaum, Susan L.; Neugut, Alfred I.; Conway-Dorsey, Kathleen; Gammon, Marilie D.

    2010-01-01

    Background Previous studies have suggested that polycyclic aromatic hydrocarbons (PAHs) may be associated with breast cancer. However, the carcinogenicity of PAHs on the human breast remains unclear. Certain carcinogens may be associated with specific mutation patterns in the p53 tumor suppressor gene, thereby contributing information about disease etiology. Objectives We hypothesized that associations of PAH-related exposures with breast cancer would differ according to tumor p53 mutation status, effect, type, and number. Methods We examined this possibility in a population-based case–control study using polytomous logistic regression. As previously reported, 151 p53 mutations among 859 tumors were identified using Surveyor nuclease and confirmed by sequencing. Results We found that participants with p53 mutations were less likely to be exposed to PAHs (assessed by smoking status in 859 cases and 1,556 controls, grilled/smoked meat intake in 822 cases and 1,475 controls, and PAH–DNA adducts in peripheral mononuclear cells in 487 cases and 941 controls) than participants without p53 mutations. For example, active and passive smoking was associated with p53 mutation–negative [odds ratio (OR) = 1.55; 95% confidence interval (CI), 1.11–2.15] but not p53 mutation–positive (OR = 0.77; 95% CI, 0.43–1.38) cancer (ratio of the ORs = 0.50, p < 0.05). However, frameshift mutations, mutation number, G:C→A:T transitions at CpG sites, and insertions/deletions were consistently elevated among exposed subjects. Conclusions These findings suggest that PAHs may be associated with specific breast tumor p53 mutation subgroups rather than with overall p53 mutations and may also be related to breast cancer through mechanisms other than p53 mutation. PMID:20064791

  2. DMD Mutations in 576 Dystrophinopathy Families: A Step Forward in Genotype-Phenotype Correlations

    PubMed Central

    Rodriguez, Maria Jose; Baena, Manel; Verdura, Edgard; Nascimento, Andres; Ortez, Carlos; Baiget, Montserrat; Gallano, Pia

    2015-01-01

    Recent advances in molecular therapies for Duchenne muscular dystrophy (DMD) require precise genetic diagnosis because most therapeutic strategies are mutation-specific. To understand more about the genotype-phenotype correlations of the DMD gene we performed a comprehensive analysis of the DMD mutational spectrum in a large series of families. Here we provide the clinical, pathological and genetic features of 576 dystrophinopathy patients. DMD gene analysis was performed using the MLPA technique and whole gene sequencing in blood DNA and muscle cDNA. The impact of the DNA variants on mRNA splicing and protein functionality was evaluated by in silico analysis using computational algorithms. DMD mutations were detected in 576 unrelated dystrophinopathy families by combining the analysis of exonic copies and the analysis of small mutations. We found that 471 of these mutations were large intragenic rearrangements. Of these, 406 (70.5%) were exonic deletions, 64 (11.1%) were exonic duplications, and one was a deletion/duplication complex rearrangement (0.2%). Small mutations were identified in 105 cases (18.2%), most being nonsense/frameshift types (75.2%). Mutations in splice sites, however, were relatively frequent (20%). In total, 276 mutations were identified, 85 of which have not been previously described. The diagnostic algorithm used proved to be accurate for the molecular diagnosis of dystrophinopathies. The reading frame rule was fulfilled in 90.4% of DMD patients and in 82.4% of Becker muscular dystrophy patients (BMD), with significant differences between the mutation types. We found that 58% of DMD patients would be included in single exon-exon skipping trials, 63% from strategies directed against multiexon-skipping exons 45 to 55, and 14% from PTC therapy. A detailed analysis of missense mutations provided valuable information about their impact on the protein structure. PMID:26284620

  3. DMD Mutations in 576 Dystrophinopathy Families: A Step Forward in Genotype-Phenotype Correlations.

    PubMed

    Juan-Mateu, Jonas; Gonzalez-Quereda, Lidia; Rodriguez, Maria Jose; Baena, Manel; Verdura, Edgard; Nascimento, Andres; Ortez, Carlos; Baiget, Montserrat; Gallano, Pia

    2015-01-01

    Recent advances in molecular therapies for Duchenne muscular dystrophy (DMD) require precise genetic diagnosis because most therapeutic strategies are mutation-specific. To understand more about the genotype-phenotype correlations of the DMD gene we performed a comprehensive analysis of the DMD mutational spectrum in a large series of families. Here we provide the clinical, pathological and genetic features of 576 dystrophinopathy patients. DMD gene analysis was performed using the MLPA technique and whole gene sequencing in blood DNA and muscle cDNA. The impact of the DNA variants on mRNA splicing and protein functionality was evaluated by in silico analysis using computational algorithms. DMD mutations were detected in 576 unrelated dystrophinopathy families by combining the analysis of exonic copies and the analysis of small mutations. We found that 471 of these mutations were large intragenic rearrangements. Of these, 406 (70.5%) were exonic deletions, 64 (11.1%) were exonic duplications, and one was a deletion/duplication complex rearrangement (0.2%). Small mutations were identified in 105 cases (18.2%), most being nonsense/frameshift types (75.2%). Mutations in splice sites, however, were relatively frequent (20%). In total, 276 mutations were identified, 85 of which have not been previously described. The diagnostic algorithm used proved to be accurate for the molecular diagnosis of dystrophinopathies. The reading frame rule was fulfilled in 90.4% of DMD patients and in 82.4% of Becker muscular dystrophy patients (BMD), with significant differences between the mutation types. We found that 58% of DMD patients would be included in single exon-exon skipping trials, 63% from strategies directed against multiexon-skipping exons 45 to 55, and 14% from PTC therapy. A detailed analysis of missense mutations provided valuable information about their impact on the protein structure. PMID:26284620

  4. Down-regulation of C12orf59 is associated with a poor prognosis and VHL mutations in renal cell carcinoma

    PubMed Central

    Wu, Jianting; Li, Cailing; Luo, Liya; Xia, Lingling; Li, Xianxin; Gui, Yaoting; Cai, Zhiming; Li, Zesong

    2016-01-01

    C12orf59 is newly identified gene in kidney. However, the relation of C12orf59 expression and clinic features is unknown. Here, our study showed that C12orf59 was broadly expressed in normal human tissues with high expression levels in kidney while its expression is beyond detectable in a panel of cancer cell lines. C12orf59 expression in RCC was significantly decreased compared with corresponding adjacent noncancerous tissues (P < 0.01). The decreased C12orf59 expression was correlated with lymph node status (P < 0.05), distant metastases (P < 0.05), poor survival (P < 0.001) (HR 3.00; 95% CI, 1.29–7.53), VHL non-sense mutations or frame-shift mutations (P < 0.01), and UMPP gene non-sense mutations or frame-shift mutations (P = 0.01). Thus, we propose that the decreased C12orf59 expression status is a prognostic biomarker of ccRCC and cooperates with the loss of VHL all the while promoting renal carcinogenesis. PMID:26758419

  5. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron). PMID:23806041

  6. A novel 10-base pair insertion mutation in exon 5 of the SOD1 gene in a Chinese family with amyotrophic lateral sclerosis.

    PubMed

    Chen, Siyu; Li, Mao; Zhu, Wenjia; Mao, Fengbiao; Wang, Jiesi; Sun, Zhongsheng; Huang, Xusheng

    2016-09-01

    Amyotrophic lateral sclerosis (ALS) is an adult-onset, progressive, fatal neurodegenerative disease. Several genes are associated with ALS. Copper-zinc superoxide dismutase 1 (SOD1) is one of the most commonly mutated genes in ALS, and more than 160 mutations in SOD1 have been reported. We reported a novel heterozygous insertion mutation that led to a frameshift and a premature termination at position 136 in exon 5 of the SOD1 gene (c.392_393insGCAAAGGTGG; p.N132Qfs*5) in a Chinese familial ALS pedigree. This mutation in the pedigree demonstrated an autosomal dominant pattern of inheritance and a phenotype characterized by an early onset (approximately 34 years old) with a relatively rapid course (approximately 2 years) and limb onset with respiratory involvement. The clinical feature of the p.N132Qfs*5 mutation was nearly identical to a previously reported mutation (Gly127insTGGG). Experiments in G127X mice demonstrated that the G127X mutation was pathogenic. SOD1 activity in the p.N132Qfs*5 mutation carriers in the family decreased significantly compared with normal family members. In conclusion, we identified a novel SOD1 mutation in an ALS family, which is an important addition to the catalog of SOD1 mutations in ALS. PMID:27297615

  7. Spotlight SAR interferometry for terrain elevation mapping and interferometric change detection

    SciTech Connect

    Eichel, P.H.; Ghiglia, D.C.; Jakowatz, C.V. Jr.

    1996-02-01

    In this report, we employ an approach quite different from any previous work; we show that a new methodology leads to a simpler and clearer understanding of the fundamental principles of SAR interferometry. This methodology also allows implementation of an important collection mode that has not been demonstrated to date. Specifically, we introduce the following six new concepts for the processing of interferometric SAR (INSAR) data: (1) processing using spotlight mode SAR imaging (allowing ultra-high resolution), as opposed to conventional strip-mapping techniques; (2) derivation of the collection geometry constraints required to avoid decorrelation effects in two-pass INSAR; (3) derivation of maximum likelihood estimators for phase difference and the change parameter employed in interferometric change detection (ICD); (4) processing for the two-pass case wherein the platform ground tracks make a large crossing angle; (5) a robust least-squares method for two-dimensional phase unwrapping formulated as a solution to Poisson`s equation, instead of using traditional path-following techniques; and (6) the existence of a simple linear scale factor that relates phase differences between two SAR images to terrain height. We show both theoretical analysis, as well as numerous examples that employ real SAR collections to demonstrate the innovations listed above.

  8. Considerations for autofocus of spotlight-mode SAR imagery created using a beamforming algorithm.

    SciTech Connect

    Wahl, Daniel Eugene; Jakowatz, Charles V., Jr.

    2008-10-01

    In recent papers the authors discussed the advantages of forming spotlight-mode SAR imagery from phase history data via a technique that is rooted in the principles of phased-array beamforming, which is closely related to back-projection. The application of a traditional autofocus algorithm, such as Phase Gradient Autofocus (PGA), requires some care in this situation. Specifically, a stated advantage of beamforming is that it easily allows for reconstruction of the SAR image onto an arbitrary imaging grid. One very useful grid, for example, is a Cartesian grid in the ground plane. Autofocus via PGA for such an image, however, cannot be performed in a straightforward manner, because in PGA a Fourier transform relationship is required between the image domain and the range-compressed phase history, and this is not the case for such an imaging grid. In this paper we propose a strategy for performing autofocus in this situation, and discuss its limitations. We demonstrate the algorithm on synthetic phase errors applied to real SAR imagery.

  9. Mutation and the environment

    SciTech Connect

    Mendelsohn, M.L. ); Albertini, R.J. )

    1990-01-01

    This book is organized under the following headings: Plenary lectures; Brook mutational mechanisms; Adduction and DNA damage; Recombination and gene conversion; Repair: Prokoyote mechanisms and induction; Repair: Lower eukaryote and plant mechanisms; Repair: Higher eukaryote mechanisms and selectivity; Repair: Human genes and mechanisms; Mutation: Spectra and mechanisms; Mutation: Shuttle vectors; Mutation: Transgenic animals; New methods: Polymerase chain reaction.

  10. Frameshift deletions of exons 3-7 and revertant fibers in Duchenne muscular dystrophy: mechanisms of dystrophin production.

    PubMed Central

    Winnard, A V; Mendell, J R; Prior, T W; Florence, J; Burghes, A H

    1995-01-01

    Duchenne muscular dystrophy (DMD) patients with mutations that disrupt the translational reading frame produce little or no dystrophin. Two exceptions are the deletion of exons 3-7 and the occurrence of rare dystrophin-positive fibers (revertant fibers) in muscle of DMD patients. Antibodies directed against the amino-terminus and the 5' end of exon 8 did not detect dystrophin in muscle from patients who have a deletion of exons 3-7. However, in all cases, dystrophin was detected with an antibody directed against the 3' end of exon 8. The most likely method of dystrophin production in these cases is initiation at a new start codon in exon 8. We also studied two patients who have revertant fibers: one had an inherited duplication of exons 5-7, which, on immunostaining, showed two types of revertant fibers; and the second patient had a 2-bp nonsense mutation in exon 51, which creates a cryptic splice site. An in-frame mRNA that uses this splice site in exon 51 was detected. Immunostaining demonstrated the presence of the 3' end of exon 51, which is in agreement with the use of this mRNA in revertant fibers. The most likely method of dystrophin production in these fibers is a second mutation that restores the reading frame. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7825572

  11. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    SciTech Connect

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  12. Mutations in the consensus helicase domains of the Werner syndrome gene

    SciTech Connect

    Yu, Chang-En; Oshima, Junko; Wijsman, E.M.

    1997-02-01

    Werner syndrome (WS) is an autosomal recessive disease with a complex phenotype that is suggestive of accelerated aging. WS is caused by mutations in a gene, WRN, that encodes a predicted 1,432-amino-acid protein with homology to DNA and RNA helicases. Previous work identified four WS mutations in the 3{prime} end of the gene, which resulted in predicted truncated protein products of 1,060-1,247 amino acids but did not disrupt the helicase domain region (amino acids 569-859). Here, additional WS subjects were screened for mutations, and the intron-exon structure of the gene was determined. A total of 35 exons were defined, with the coding sequences beginning in the second exon. Five new WS mutations were identified: two nonsense mutations at codons 369 and 889; a mutation at a splice-junction site, resulting in a predicted truncated protein of 760 amino acids; a 1-bp deletion causing a frameshift; and a predicted truncated protein of 391 amino acids. Another deletion is >15 kb of genomic DNA, including exons 19-23; the predicted protein is 1,186 amino acids long. Four of these new mutations either partially disrupt the helicase domain region or result in predicted protein products completely missing the helicase region. These results confirm that mutations in the WRN gene are responsible for WS. Also, the location of the mutations indicates that the presence or absence of the helicase domain does not influence the WS phenotype and suggests that WS is the result of complete loss of function of the WRN gene product. 63 refs., 1 fig., 5 tabs.

  13. Molecular and phenotypic spectrum of ASPM-related primary microcephaly: Identification of eight novel mutations.

    PubMed

    Abdel-Hamid, Mohamed S; Ismail, Manal F; Darwish, Hebatallh A; Effat, Laila K; Zaki, Maha S; Abdel-Salam, Ghada M H

    2016-08-01

    Autosomal recessive primary microcephaly (MCPH) is an abnormal proliferation of neurons during brain development that leads to a small brain size but architecturally normal in most instances. Mutations in the ASPM gene have been identified to be the most prevalent. Thirty-seven patients from 30 unrelated families with a clinical diagnosis of MCPH were enrolled in this study. Screening of ASPM gene mutations was performed by targeted linkage analysis followed by direct sequencing. Thirteen protein truncating mutations of the ASPM were identified in 15 families (50%), eight of which were novel mutations. The mutations detected were eight nonsense, four frameshift, and one splice site. Two of these mutations (p.R1327* and p.R3181*) were recurrent and shared similar haplotypes suggesting founder effect. Patients with ASPM mutations had mild to severe intellectual disability and variable degrees of simplified gyral pattern and small frontal lobe. In addition, hypoplasia of corpus callosum (18 patients), mildly small cerebellar vermis (10 patients), and relatively small pons (13 patients) were found in 85.7%, 47.6%, and 61.9%, respectively. Furthermore, one patient had porencephaly and another had a small midline cyst. Epilepsy was documented in two patients (9.5%). Non-neurologic abnormalities consisted of growth retardation (four patients), and co-incidental association of oculo-cutaneous albinism (one patient). Our study expands the mutation spectrum of ASPM. Moreover, the simplified gyral pattern and small frontal lobe together with hypoplastic corpus callosum, small cerebellum and pons enable ASPM mutated patients to be distinguished. © 2016 Wiley Periodicals, Inc. PMID:27250695

  14. Germline BAP1 Mutational Landscape of Asbestos-Exposed Malignant Mesothelioma Patients with Family History of Cancer.

    PubMed

    Ohar, Jill A; Cheung, Mitchell; Talarchek, Jacqueline; Howard, Suzanne E; Howard, Timothy D; Hesdorffer, Mary; Peng, Hongzhuang; Rauscher, Frank J; Testa, Joseph R

    2016-01-15

    Heritable mutations in the BAP1 tumor suppressor gene predispose individuals to mesothelioma and other cancers. However, a large-scale assessment of germline BAP1 mutation incidence and associated clinical features in mesothelioma patients with a family history of cancer has not been reported. Therefore, we examined the germline BAP1 mutation status of 150 mesothelioma patients with a family history of cancer, 50 asbestos-exposed control individuals with a family history of cancers other than mesothelioma, and 153 asbestos-exposed individuals without familial cancer. No BAP1 alterations were found in control cohorts, but were identified in nine of 150 mesothelioma cases (6%) with a family history of cancer. Alterations among these cases were characterized by both missense and frameshift mutations, and enzymatic activity of BAP1 missense mutants was decreased compared with wild-type BAP1. Furthermore, BAP1 mutation carriers developed mesothelioma at an earlier age that was more often peritoneal than pleural (five of nine) and exhibited improved long-term survival compared to mesothelioma patients without BAP1 mutations. Moreover, many tumors harboring BAP1 germline mutations were associated with BAP1 syndrome, including mesothelioma and ocular/cutaneous melanomas, as well as renal, breast, lung, gastric, and basal cell carcinomas. Collectively, these findings suggest that mesothelioma patients presenting with a family history of cancer should be considered for BAP1 genetic testing to identify those individuals who might benefit from further screening and routine monitoring for the purpose of early detection and intervention. PMID:26719535

  15. TEX11 is mutated in infertile men with azoospermia and regulates genome-wide recombination rates in mouse.

    PubMed

    Yang, Fang; Silber, Sherman; Leu, N Adrian; Oates, Robert D; Marszalek, Janet D; Skaletsky, Helen; Brown, Laura G; Rozen, Steve; Page, David C; Wang, P Jeremy

    2015-09-01

    Genome-wide recombination is essential for genome stability, evolution, and speciation. Mouse Tex11, an X-linked meiosis-specific gene, promotes meiotic recombination and chromosomal synapsis. Here, we report that TEX11 is mutated in infertile men with non-obstructive azoospermia and that an analogous mutation in the mouse impairs meiosis. Genetic screening of a large cohort of idiopathic infertile men reveals that TEX11 mutations, including frameshift and splicing acceptor site mutations, cause infertility in 1% of azoospermic men. Functional evaluation of three analogous human TEX11 missense mutations in transgenic mouse models identified one mutation (V748A) as a potential infertility allele and found two mutations non-causative. In the mouse model, an intronless autosomal Tex11 transgene functionally substitutes for the X-linked Tex11 gene, providing genetic evidence for the X-to-autosomal retrotransposition evolution phenomenon. Furthermore, we find that TEX11 protein levels modulate genome-wide recombination rates in both sexes. These studies indicate that TEX11 alleles affecting expression level or substituting single amino acids may contribute to variations in recombination rates between sexes and among individuals in humans. PMID:26136358

  16. Mutations in BRCA1 and BRCA2 in breast cancer families: Are there more breast cancer-susceptibility genes?

    SciTech Connect

    Serova, O.M.; Mazoyer, S.; Putet, N.

    1997-03-01

    To estimate the proportion of breast cancer families due to BRCA1 or BRCA2, we performed mutation screening of the entire coding regions of both genes supplemented with linkage analysis of 31 families, 8 containing male breast cancers and 23 site-specific female breast cancer. A combination of protein-truncation test and SSCP or heteroduplex analyses was used for mutation screening complemented, where possible, by the analysis of expression level of BRCA1 and BRCA2 alleles. Six of the eight families with male breast cancer revealed frameshift mutations, two in BRCA1 and four in BRCA2. Although most families with female site-specific breast cancers were thought to be due to mutations in either BRCA1 or BRCA2, we identified only eight mutations in our series of 23 site-specific female breast cancer families (34%), four in BRCA1 and four in BRCA2. According to the posterior probabilities calculated for mutation-negative families, based on linkage data and mutation screening results, we would expect 8-10 site-specific female breast cancer families of our series to be due to neither BRCA1 nor BRCA2. Thus, our results suggest the existence of at least one more major breast cancer-susceptibility gene. 24 refs., 1 fig., 3 tabs.

  17. Homozygosity Mapping and Whole Exome Sequencing Reveal a Novel Homozygous COL18A1 Mutation Causing Knobloch Syndrome

    PubMed Central

    Piri, Niloofar; Nürnberg, Gudrun; Saleh-Gohari, Nasrollah; Haghighi, Amirreza; Neidhardt, John; Nürnberg, Peter; Berger, Wolfgang

    2014-01-01

    The aim of this study was to identify the genetic basis of a chorioretinal dystrophy with high myopia of unknown origin in a child of a consanguineous marriage. The proband and ten family members of Iranian ancestry participated in this study. Linkage analysis was carried out with DNA samples of the proband and her parents by using the Human SNP Array 6.0. Whole exome sequencing (WES) was performed with the patients’ DNA. Specific sequence alterations within the homozygous regions identified by whole exome sequencing were verified by Sanger sequencing. Upon genetic analysis, a novel homozygous frameshift mutation was found in exon 42 of the COL18A1 gene in the patient. Both parents were heterozygous for this sequence variation. Mutations in COL18A1 are known to cause Knobloch syndrome (KS). Retrospective analysis of clinical records of the patient revealed surgical removal of a meningocele present at birth. The clinical features shown by our patient were typical of KS with the exception of chorioretinal degeneration which is a rare manifestation. This is the first case of KS reported in a family of Iranian ancestry. We identified a novel disease-causing (deletion) mutation in the COL18A1 gene leading to a frameshift and premature stop codon in the last exon. The mutation was not present in SNP databases and was also not found in 192 control individuals. Its localization within the endostatin domain implicates a functional relevance of endostatin in KS. A combined approach of linkage analysis and WES led to a rapid identification of the disease-causing mutation even though the clinical description was not completely clear at the beginning. PMID:25392994

  18. A novel MLL2 gene mutation in a Korean patient with Kabuki syndrome

    PubMed Central

    Kim, Soo Jin; Cho, Sung Yoon; Maeng, Se Hyun; Sohn, Young Bae; Kim, Su-Jin; Ki, Chang-Seok

    2013-01-01

    Kabuki syndrome (KS) is a rare genetic disease with a distinctive dysmorphic face, intellectual disability, and multiple congenital abnormalities. KS is inherited in an autosomal dominant manner. As the primary cause of KS, MLL2 mutations have been identified in 56-76% of affected individuals who have been tested, suggesting that there may be additional genes associated with KS. Recently, a few KS individuals have been found to have de novo partial or complete deletions of an X chromosome gene, KDM6A, which encodes a histone demethylase that interacts with MLL2. Nevertheless, mutations in MLL2 are the major cause of KS. Although there are a few reports of KS patients in Korea, none of these had been confirmed by genetic analysis. Here, we report a case of a Korean patient with clinical features of KS. Using direct sequencing, we identified a frameshift heterozygous mutation for MLL2: (c.5256_5257delGA;p.Lys1753Alafs*34). Clinically, the patient presented with typical facial features, and diagnosis of KS was based on the diagnostic criteria. While KS is a rare disease, other malformations that overlap with those found in individuals with KS are common. Hence, the diagnosis of KS by mutational analysis can be a valuable method for patients with KS-like syndromes. Furthermore, in the near future, other genes could be identified in patients with KS without a detectable MLL2 mutation. PMID:24019847

  19. Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations

    PubMed Central

    Chassaing, N; Martin, L; Calvas, P; Le Bert, M; Hovnanian, A

    2005-01-01

    Pseudoxanthoma elasticum (PXE) is an inherited systemic disease of connective tissue primarily affecting the skin, retina, and cardiovascular system. It is characterised pathologically by elastic fibre mineralisation and fragmentation (so called "elastorrhexia"), and clinically by high heterogeneity in age of onset and the extent and severity of organ system involvement. PXE was recently associated with mutations in the ABCC6 (ATP binding cassette subtype C number 6) gene. At least one ABCC6 mutation is found in about 80% of patients. These mutations are identifiable in most of the 31 ABCC6 exons and consist of missense, nonsense, frameshift mutations, or large deletions. No correlation between the nature or location of the mutations and phenotype severity has yet been established. Recent findings support exclusive recessive inheritance. The proposed prevalence of PXE is 1/25 000, but this is probably an underestimate. ABCC6 encodes the protein ABCC6 (also known as MRP6), a member of the large ATP dependent transmembrane transporter family that is expressed predominantly in the liver and kidneys, and only to a lesser extent in tissues affected by PXE. The physiological substrates of ABCC6 remain to be determined, but the current hypothesis is that PXE should be considered to be a metabolic disease with undetermined circulating molecules interacting with the synthesis, turnover, or maintenance of elastic fibres. PMID:15894595

  20. [Clinical features and DGUOK mutations of an infant with mitochondrial DNA depletion syndrome].

    PubMed

    Deng, Mei; Lin, Wei-Xia; Guo, Li; Zhang, Zhan-Hui; Song, Yuan-Zong

    2016-06-01

    The aim of this study was to investigate the clinical features and DGUOK gene mutations of an infant with mitochondrial DNA depletion syndrome (MDS). The patient (more than 7 months old) manifested as hepatosplenomegaly, abnormal liver function, nystagmus and psychomotor retardation. Genetic DNA was extracted from peripheral blood samples of the patient and her parents. Targeted Exome Sequencing was performed to explore the genetic causes. Sanger sequencing was carried out to confirm the detected mutations. The sequencing results showed that the patient was a compound heterozygote for c.679G>A and c.817delT in the DGUOK gene. The former was a reportedly pathogenic missense mutation of maternal origin, while the latter, a frameshift mutation from the father, has not been described yet. The findings in this study expand the mutation spectrum of DGUOK gene, and provide molecular evidence for the etiologic diagnosis of the patient as well as for the genetic counseling and prenatal diagnosis in the family. PMID:27324545

  1. Analbuminemia: three cases resulting from different point mutations in the albumin gene.

    PubMed Central

    Watkins, S; Madison, J; Galliano, M; Minchiotti, L; Putnam, F W

    1994-01-01

    Analbuminemia is a very rare recessive disorder in which subjects have little or no circulating albumin, although albumin is normally the most abundant plasma protein and has many functions. Analbuminemia is caused by a variety of mutations in the albumin gene and is exhibited only by subjects homozygous for the defect. Previously the mutation had been identified at the molecular level in only two human cases; in one case it resulted from an exon-splicing defect, and in the other case it was caused by a nucleotide insertion that caused a frameshift and premature stop codon. In this investigation we identified the mutations in three unrelated subjects from different countries. In each instance a single-nucleotide mutation produced a stop codon, but the mutations occurred at three different sites: (i) in an Italian male a C-->T transition at nt 2368 in the genomic sequence of albumin, (ii) a C-->T transition at nt 4446 for an American female, and (iii) a G-->A transition at nt 7708 in a Canadian male. The size of the albumin fragment that might have been produced for the three cases varied from 31- to 213-amino acid residues, but no evidence for a circulating albumin fragment was obtained. The paradox is that analbuminemia is extremely rare (frequency < 1 x 10(6)); yet the virtual absence of albumin is tolerable despite its multiple functions. Images PMID:7937781

  2. BRAT1 mutations are associated with infantile epileptic encephalopathy, mitochondrial dysfunction, and survival into childhood.

    PubMed

    Horn, Denise; Weschke, Bernhard; Knierim, Ellen; Fischer-Zirnsak, Björn; Stenzel, Werner; Schuelke, Markus; Zemojtel, Tomasz

    2016-09-01

    We describe two siblings who were affected with early onset focal seizures, severe progressive postnatal microcephaly, muscular hypertonia, feeding problems and bouts of apnea, only minimal psychomotor development, as well as death in infancy and childhood. We identified compound heterozygous mutations in BRAT1 exons 5 (c.638_639insA) and 8 (c.1134+1G>A) in one affected child via next-generation sequencing of the disease-associated genome followed by phenotype-driven bioinformatic analysis. Sanger sequencing confirmed the presence of these mutations in both patients and a heterozygote status of the parents. Whereas the frameshift mutation (c.638_639insA) has been described in one family, the splice-site mutation (c.1134+1G>A) is novel. In contrast to all cases published so far, one of our patients showed a considerably milder clinical course with survival into childhood. Investigation of a skeletal muscle biopsy showed a severely reduced COX enzyme histochemical staining, indicating mitochondrial dysfunction. Our data expand the clinical and mutational spectrum of the BRAT1-associated phenotype. © 2016 Wiley Periodicals, Inc. PMID:27282648

  3. Congenital erythropoietic porphyria: identification and expression of 10 mutations in the uroporphyrinogen III synthase gene.

    PubMed Central

    Xu, W; Warner, C A; Desnick, R J

    1995-01-01

    To investigate the molecular basis of the phenotypic heterogeneity in congenital erythropoietic porphyria, the mutations in the uroporphyrinogen III synthase gene from unrelated patients were determined. Six missense (L4F, Y19C, V82F, V99A, A104V, and G225S), a nonsense (Q249X), a frameshift (633insA), and two splicing mutations (IVS2+1 and IVS9 delta A + 4) were identified. When L4F, Y19C, V82F, V99A, A104V, 633insA, G225S, and Q249X were expressed in Escherichia coli, only the V82F, V99A, and A104V alleles expressed residual enzymatic activity. Of note, the V82F mutation, which occurs adjacent to the 5' donor site of intron 4, resulted in approximately 54% aberrantly spliced transcripts with exon 4 deleted. Thus, this novel exonic single-base substitution caused two lesions, a missense mutation and an aberrantly spliced transcript. Of the splicing mutations, the IVS2+1 allele produced a single transcript with exon 2 deleted, whereas the IVS9 delta A+4 allele was alternatively spliced, approximately 26% being normal transcripts and the remainder with exon 9 deleted. The amount of residual activity expressed by each allele provided a basis to correlate genotype with disease severity, thereby permitting genotype/phenotype predictions in this clinically heterogeneous disease. Images PMID:7860775

  4. An autosomal recessive mutation of DSG4 causes monilethrix through the ER stress response.

    PubMed

    Kato, Madoka; Shimizu, Akira; Yokoyama, Yoko; Kaira, Kyoichi; Shimomura, Yutaka; Ishida-Yamamoto, Akemi; Kamei, Kiyoko; Tokunaga, Fuminori; Ishikawa, Osamu

    2015-05-01

    Monilethrix is a hair shaft anomaly characterized by beaded hair with periodic changes in hair thickness. Mutations in the desmoglein 4 (DSG4) gene reportedly underlie the autosomal recessive form of the disease. However, the pathogenesis and cellular basis for the DSG4 mutation-induced monilethrix remained largely unknown. We report a Japanese female patient with monilethrix. Observation of her hair shaft by means of transmission electron microscopy showed fewer desmosomes and abnormal keratinization. Genetic analysis revealed a homozygous mutation, c.2119delG (p.Asp707Ilefs*109), in the DSG4 gene, which was predicted to cause a frameshift and premature termination in the intracellular region of the DSG4 protein. The mutation has not been reported previously. In the patient's hair shaft, we detected reduced but partial expression of the mutant DSG4 protein. Cellular analyses demonstrated that the mutant DSG4 lost its affinity to plakoglobin and accumulated in the endoplasmic reticulum (ER). The amounts of mutant DSG4 were increased by proteasome inhibitor treatment, and the expression of an ER chaperone, GRP78/BiP, was elevated in the patient's skin. Collectively, these results suggest that the dysfunctional mutated DSG4, tethered in the ER, undergoes ER-associated degradation, leading to unfolded protein response induction, and thus ER stress may have a role in the pathogenesis of monilethrix. PMID:25615553

  5. Mutations in the human UBR1 gene and the associated phenotypic spectrum.

    PubMed

    Sukalo, Maja; Fiedler, Ariane; Guzmán, Celina; Spranger, Stephanie; Addor, Marie-Claude; McHeik, Jiad N; Oltra Benavent, Manuel; Cobben, Jan M; Gillis, Lynette A; Shealy, Amy G; Deshpande, Charu; Bozorgmehr, Bita; Everman, David B; Stattin, Eva-Lena; Liebelt, Jan; Keller, Klaus-Michael; Bertola, Débora Romeo; van Karnebeek, Clara D M; Bergmann, Carsten; Liu, Zhifeng; Düker, Gesche; Rezaei, Nima; Alkuraya, Fowzan S; Oğur, Gönül; Alrajoudi, Abdullah; Venegas-Vega, Carlos A; Verbeek, Nienke E; Richmond, Erick J; Kirbiyik, Ozgür; Ranganath, Prajnya; Singh, Ankur; Godbole, Koumudi; Ali, Fouad A M; Alves, Crésio; Mayerle, Julia; Lerch, Markus M; Witt, Heiko; Zenker, Martin

    2014-05-01

    Johanson-Blizzard syndrome (JBS) is a rare, autosomal recessive disorder characterized by exocrine pancreatic insufficiency, typical facial features, dental anomalies, hypothyroidism, sensorineural hearing loss, scalp defects, urogenital and anorectal anomalies, short stature, and cognitive impairment of variable degree. This syndrome is caused by a defect of the E3 ubiquitin ligase UBR1, which is part of the proteolytic N-end rule pathway. Herein, we review previously reported (n = 29) and a total of 31 novel UBR1 mutations in relation to the associated phenotype in patients from 50 unrelated families. Mutation types include nonsense, frameshift, splice site, missense, and small in-frame deletions consistent with the hypothesis that loss of UBR1 protein function is the molecular basis of JBS. There is an association of missense mutations and small in-frame deletions with milder physical abnormalities and a normal intellectual capacity, thus suggesting that at least some of these may represent hypomorphic UBR1 alleles. The review of clinical data of a large number of molecularly confirmed JBS cases allows us to define minimal clinical criteria for the diagnosis of JBS. For all previously reported and novel UBR1 mutations together with their clinical data, a mutation database has been established at LOVD. PMID:24599544

  6. Novel mutations of APOB cause ApoB truncations undetectable in plasma and familial hypobetalipoproteinemia.

    PubMed

    Yue, Pin; Yuan, Bo; Gerhard, Daniela S; Neuman, Rosalind J; Isley, William L; Harris, William S; Schonfeld, Gustav

    2002-08-01

    Familial hypobetalipoproteinemia (FHBL) is a genetic disorder characterized by low levels of apoB-100 and LDL cholesterol. Truncation-producing mutations of apoB (chromosome 2) are among several potential causes of FHBL in patients. Ten new families with FHBL linked to chromosome 2 were identified. In Family 8, a 4432delT in exon 26 produces a frame-shift and a premature stop codon predicted to produce a truncated apoB-30.9. Even though this truncation is just 10 amino acid shorter than the well-documented apoB-31, which is readily detectable in plasma, apoB-30.9 is undetectable. Most truncations shorter than apoB-30 are not detectable in plasma. In Family 34, an acceptor splicing mutation at position -1 of exon 14 changes the acceptor splice site AG to AA. Two families (Family 50 and 52) had mutations (apoB-9 and apoB-29) reported previously. In Family 98, a novel point mutation in exon 26 (11163T>G) causes a premature stop codon, and produces a truncated apoB-80.5 readily detectable in plasma. Sequencing of the ApoB gene in families 1, 5, 18, 58, and 59 did not reveal mutations. PMID:12124991

  7. Molecular analysis of formaldehyde-induced mutations in human lymphoblasts and E. coli

    SciTech Connect

    Crosby, R.M.; Richardson, K.K.; Craft, T.R.; Benforado, K.B.; Liber, H.L.; Skopek, T.R.

    1988-01-01

    The molecular nature of formaldehyde (HCHO)-induced mutations was studied in both human lymphoblasts and E. coli. Thirty HPRT/sup -/ human lymphoblast colonies induced by eight repetitive 150 ..mu..M HCHO treatments were characterized by Southern blot analysis. Fourteen of these mutants (47%) had visible deletions of some or all of the X-linked HPRT bands, indicating that HCHO can induce large losses of DNA in human lymphoblasts. In E. coli., DNA alterations induced by HCHO were characterized with use of the xanthine guanine phosphoribosyl transferase (gpt) gene as the genetic target. Exposure of E. coli to 4 mM HCHO for 1 hr induced large insertions (41%), large deletions (18%), and point mutations (41%). Dideoxy DNA sequencing revealed that most of the point mutations were transversions at GC base pairs. In contrast, exposure of E. coli to 40 mM HCHO for 1 hr produced 92% point mutations, 62% of which were transitions at a single AT base pair in the gene. Therefore, HCHO is capable of producing different genetic alterations in E. coli at different concentrations, suggesting fundamental differences in the mutagenic mechanisms operating at the two concentrations used. Naked pSV2gpt plasmid DNA was exposed to 3.3 or 10 mM HCHO and transformed into E. coli. Most of the resulting mutations were frameshifts, again suggesting a different mutagenic mechanism.

  8. Functional correction by antisense therapy of a splicing mutation in the GALT gene.

    PubMed

    Coelho, Ana I; Lourenço, Sílvia; Trabuco, Matilde; Silva, Maria João; Oliveira, Anabela; Gaspar, Ana; Diogo, Luísa; Tavares de Almeida, Isabel; Vicente, João B; Rivera, Isabel

    2015-04-01

    In recent years, antisense therapy has emerged as an increasingly important therapeutic approach to tackle several genetic disorders, including inborn errors of metabolism. Intronic mutations activating cryptic splice sites are particularly amenable to antisense therapy, as the canonical splice sites remain intact, thus retaining the potential for restoring constitutive splicing. Mutational analysis of Portuguese galactosemic patients revealed the intronic variation c.820+13A>G as the second most prevalent mutation, strongly suggesting its pathogenicity. The aim of this study was to functionally characterize this intronic variation, to elucidate its pathogenic molecular mechanism(s) and, ultimately, to correct it by antisense therapy. Minigene splicing assays in two distinct cell lines and patients' transcript analyses showed that the mutation activates a cryptic donor splice site, inducing an aberrant splicing of the GALT pre-mRNA, which in turn leads to a frameshift with inclusion of a premature stop codon (p.D274Gfs*17). Functional-structural studies of the recombinant wild-type and truncated GALT showed that the latter is devoid of enzymatic activity and prone to aggregation. Finally, two locked nucleic acid oligonucleotides, designed to specifically recognize the mutation, successfully restored the constitutive splicing, thus establishing a proof of concept for the application of antisense therapy as an alternative strategy for the clearly insufficient dietary treatment in classic galactosemia. PMID:25052314

  9. Revealing the function of a novel splice-site mutation of CHD7 in CHARGE syndrome.

    PubMed

    Lee, Byeonghyeon; Duz, Mehmet Bugrahan; Sagong, Borum; Koparir, Asuman; Lee, Kyu-Yup; Choi, Jae Young; Seven, Mehmet; Yuksel, Adnan; Kim, Un-Kyung; Ozen, Mustafa

    2016-02-01

    Most cases of CHARGE syndrome are sporadic and autosomal dominant. CHD7 is a major causative gene of CHARGE syndrome. In this study, we screened CHD7 in two Turkish patients demonstrating symptoms of CHARGE syndrome such as coloboma, heart defect, choanal atresia, retarded growth, genital abnomalities and ear anomalies. Two mutations of CHD7 were identified including a novel splice-site mutation (c.2443-2A>G) and a previously known frameshift mutation (c.2504_2508delATCTT). We performed exon trapping analysis to determine the effect of the c.2443-2A>G mutation at the transcriptional level, and found that it caused a complete skip of exon 7 and splicing at a cryptic splice acceptor site. Our current study is the second study demonstrating an exon 7 deficit in CHD7. Results of previous studies suggest that the c.2443-2A>G mutation affects the formation of nasal tissues and the neural retina during early development, resulting in choanal atresia and coloboma, respectively. The findings of the present study will improve our understanding of the genetic causes of CHARGE syndrome. PMID:26551301

  10. De Novo Mutations in CHAMP1 Cause Intellectual Disability with Severe Speech Impairment

    PubMed Central

    Hempel, Maja; Cremer, Kirsten; Ockeloen, Charlotte W.; Lichtenbelt, Klaske D.; Herkert, Johanna C.; Denecke, Jonas; Haack, Tobias B.; Zink, Alexander M.; Becker, Jessica; Wohlleber, Eva; Johannsen, Jessika; Alhaddad, Bader; Pfundt, Rolph; Fuchs, Sigrid; Wieczorek, Dagmar; Strom, Tim M.; van Gassen, Koen L.I.; Kleefstra, Tjitske; Kubisch, Christian; Engels, Hartmut; Lessel, Davor

    2015-01-01

    CHAMP1 encodes a protein with a function in kinetochore-microtubule attachment and in the regulation of chromosome segregation, both of which are known to be important for neurodevelopment. By trio whole-exome sequencing, we have identified de novo deleterious mutations in CHAMP1 in five unrelated individuals affected by intellectual disability with severe speech impairment, motor developmental delay, muscular hypotonia, and similar dysmorphic features including short philtrum and a tented upper and everted lover lip. In addition to two frameshift and one nonsense mutations, we found an identical nonsense mutation, c.1192C>T (p.Arg398∗), in two affected individuals. All mutations, if resulting in a stable protein, are predicted to lead to the loss of the functionally important zinc-finger domains in the C terminus of the protein, which regulate CHAMP1 localization to chromosomes and the mitotic spindle, thereby providing a mechanistic understanding for their pathogenicity. We thus establish deleterious de novo mutations in CHAMP1 as a cause of intellectual disability. PMID:26340335

  11. Inherited biallelic CSF3R mutations in severe congenital neutropenia

    PubMed Central

    Triot, Alexa; Järvinen, Päivi M.; Arostegui, Juan I.; Murugan, Dhaarini; Kohistani, Naschla; Dapena Díaz, José Luis; Racek, Tomas; Puchałka, Jacek; Gertz, E. Michael; Schäffer, Alejandro A.; Kotlarz, Daniel; Pfeifer, Dietmar; Díaz de Heredia Rubio, Cristina; Ozdemir, Mehmet Akif; Patiroglu, Turkan; Karakukcu, Musa; Sánchez de Toledo Codina, José; Yagüe, Jordi; Touw, Ivo P.; Unal, Ekrem

    2014-01-01

    Severe congenital neutropenia (SCN) is characterized by low numbers of peripheral neutrophil granulocytes and a predisposition to life-threatening bacterial infections. We describe a novel genetic SCN type in 2 unrelated families associated with recessively inherited loss-of-function mutations in CSF3R, encoding the granulocyte colony-stimulating factor (G-CSF) receptor. Family A, with 3 affected children, carried a homozygous missense mutation (NM_000760.3:c.922C>T, NP_000751.1:p.Arg308Cys), which resulted in perturbed N-glycosylation and aberrant localization to the cell surface. Family B, with 1 affected infant, carried compound heterozygous deletions provoking frameshifts and premature stop codons (NM_000760.3:c.948_963del, NP_000751.1:p.Gly316fsTer322 and NM_000760.3:c.1245del, NP_000751.1:p.Gly415fsTer432). Despite peripheral SCN, all patients had morphologic evidence of full myeloid cell maturation in bone marrow. None of the patients responded to treatment with recombinant human G-CSF. Our study highlights the genetic and morphologic SCN variability and provides evidence both for functional importance and redundancy of G-CSF receptor-mediated signaling in human granulopoiesis. PMID:24753537

  12. Specific-mutational patterns of p53 gene in bladder transitional cell carcinoma among a group of Iraqi patients exposed to war environmental hazards

    PubMed Central

    2012-01-01

    Background To unfold specific-mutational patterns in TP53 gene due to exposures to war environmental hazards and to detect the association of TP53 gene alteration with the depth of bladder cancer. Methods Twenty-nine bladder carcinomas were analyzed for TP53 alterations. PCR-single strand conformational polymorphism analysis, DNA sequencing and immunohistochemical analysis using monoclonal mouse anti-human p53 antibody (Clone DO-7) were employed. Results TP53 gene mutations occurred in 37.9% of the cases while TP53 overexpression occurred in 58.6%. Both of them were associated with deep invasive-tumors. Single mutations were seen in 63.6%, whereas only 27.3% have shown double mutations. Four mutations were frameshifted (30.8%); two of them showed insertion A after codon 244. There was no significant association between TP53 mutations and protein overexpression (P>0.05), while a significant association was observed between TP53 alterations and tumors progression (P ≤ 0.01). Conclusion The infrequent TP53mutations, especially insertion A and 196 hotspot codon, may represent the specific-mutational patterns in bladder carcinoma among the Iraqi patients who were exposed to war environmental hazards. TP53 alteration associated with bladder cancer progression should be analyzed by both mutational and protein expression analysis. PMID:22929185

  13. Nonsyndromic hearing loss DFNA10 and a novel mutation of EYA4: evidence for correlation of normal cardiac phenotype with truncating mutations of the Eya domain.

    PubMed

    Makishima, Tomoko; Madeo, Anne C; Brewer, Carmen C; Zalewski, Christopher K; Butman, John A; Sachdev, Vandana; Arai, Andrew E; Holbrook, Brenda M; Rosing, Douglas R; Griffith, Andrew J

    2007-07-15

    Dominant, truncating mutations of eyes absent 4 (EYA4) on chromosome 6q23 can cause either nonsyndromic hearing loss DFNA10 or hearing loss with dilated cardiomyopathy (DCM). It has been proposed that truncations of the C-terminal Eya domain cause DFNA10 whereas upstream truncations of the N-terminal variable region cause hearing loss with DCM. Here we report an extended family co-segregating autosomal dominant, postlingual-onset, progressive, sensorineural hearing loss (SNHL) with a novel frameshift mutation, 1,490insAA, of EYA4. The 1,490insAA allele is predicted to encode a truncated protein with an intact N-terminal variable region, but lacking the entire C-terminal Eya domain. Clinical studies including electrocardiography, echocardiography, and magnetic resonance imaging (MRI) of the heart in nine affected family members revealed no DCM or associated abnormalities and confirmed their nonsyndromic phenotype. These are the first definitive cardiac evaluations of DFNA10 hearing loss to support a correlation of EYA4 mutation position with the presence or absence of DCM. These results will facilitate the counseling of patients with these phenotypes and EYA4 mutations. PMID:17567890

  14. ETHE1 mutations are specific to ethylmalonic encephalopathy

    PubMed Central

    Tiranti, V; Briem, E; Lamantea, E; Mineri, R; Papaleo, E; De Gioia, L; Forlani, F; Rinaldo, P; Dickson, P; Abu‐Libdeh, B; Cindro‐Heberle, L; Owaidha, M; Jack, R M; Christensen, E; Burlina, A; Zeviani, M

    2006-01-01

    Mutations in ETHE1, a gene located at chromosome 19q13, have recently been identified in patients affected by ethylmalonic encephalopathy (EE). EE is a devastating infantile metabolic disorder, characterised by widespread lesions in the brain, hyperlactic acidaemia, petechiae, orthostatic acrocyanosis, and high levels of ethylmalonic acid in body fluids. To investigate to what extent ETHE1 is responsible for EE, we analysed this gene in 29 patients with typical EE and in 11 patients presenting with early onset progressive encephalopathy with ethylmalonic aciduria (non‐EE EMA). Frameshift, stop, splice site, and missense mutations of ETHE1 were detected in all the typical EE patients analysed. Western blot analysis of the ETHE1 protein indicated that some of the missense mutations are associated with the presence of the protein, suggesting that the corresponding wild type amino acid residues have a catalytic function. No ETHE1 mutations were identified in non‐EE EMA patients. Experiments based on two dimensional blue native electrophoresis indicated that ETHE1 protein works as a supramolecular, presumably homodimeric, complex, and a three dimensional model of the protein suggests that it is likely to be a mitochondrial matrix thioesterase acting on a still unknown substrate. Finally, the 625G→A single nucleotide polymorphism in the gene encoding the short chain acyl‐coenzyme A dehydrogenase (SCAD) was previously proposed as a co‐factor in the aetiology of EE and other EMA syndromes. SNP analysis in our patients ruled out a pathogenic role of SCAD variants in EE, but did show a highly significant prevalence of the 625A alleles in non‐EE EMA patients. PMID:16183799

  15. Novel mutations in 3-phosphoglycerate dehydrogenase (PHGDH) are distributed throughout the protein and result in altered enzyme kinetics.

    PubMed

    Tabatabaie, L; de Koning, T J; Geboers, A J J M; van den Berg, I E T; Berger, R; Klomp, L W J

    2009-05-01

    Three-phosphoglycerate dehydrogenase (3-PGDH) deficiency is a rare recessive inborn error in the biosynthesis of the amino acid L-serine characterized clinically by congenital microcephaly, psychomotor retardation, and intractable seizures. The biochemical abnormalities associated with this disorder are low concentrations of L-serine, D-serine, and glycine in cerebrospinal fluid (CSF). Only two missense mutations (p.V425M and p.V490M) have been identified in PHGDH, the gene encoding 3-PGDH, but it is currently unclear how these mutations in the carboxy-terminal regulatory domain of the protein affect enzyme function. We now describe five novel mutations in five patients with 3-PGDH deficiency; one frameshift mutation (p.G238fsX), and four missense mutations (p.R135W, p.V261M, p.A373T, and p.G377S). The missense mutations were located in the nucleotide binding and regulatory domains of 3-PGDH and did not affect steady-state expression, protein stability, and protein degradation rates. Patients' fibroblasts displayed a significant, but incomplete, reduction in maximal enzyme activities associated with all missense mutations. In transient overexpression studies in HEK293T cells, the p.A373T, p.V425M, and p.V490M mutations resulted in almost undetectable enzyme activities. Molecular modeling of the p.R135W and p.V261M mutations onto the partial crystal structure of 3-PGDH predicted that these mutations affect substrate and cofactor binding. This prediction was confirmed by the results of kinetic measurements in fibroblasts and transiently transfected HEK293T cells, which revealed a markedly decreased V(max) and an increase in K(m) values, respectively. Taken together, these data suggest that missense mutations associated with 3-PGDH deficiency either primarily affect substrate binding or result in very low residual enzymatic activity. PMID:19235232

  16. Ankyrin Bugey: a de novo deletional frameshift variant in exon 6 of the ankyrin gene associated with spherocytosis.

    PubMed

    Morlé, L; Bozon, M; Alloisio, N; Vallier, A; Hayette, S; Pascal, O; Monier, D; Philippe, N; Forget, B G; Delaunay, J

    1997-03-01

    We describe a case of spherocytosis in a French child splenectomized at age 10 years. The parents were devoid of any clinical, hematological, or biochemical abnormalities. Following splenectomy, the proposita exhibited a reduction of red cell membrane ankyrin. The variable number of dinucleotide repeats associated with the erythroid ankyrin gene (ANK1) were studied at the genomic level. The father, the mother, and the proposita had the AC14/AC11, AC14/AC14, and AC14/AC11 genotypes, respectively, although the proposita exhibited a pattern consistent with an AC14,-combination at the cDNA level. We thought there could be a de novo mutation in the ANK1 allele of paternal origin (AC11). A false paternity seemed most unlikely. Based on PCR-amplification of exons, SSCP analysis, and, when appropriate, nucleotide sequencing, we found a one-nucleotide deletion in codon 146 (exon 6): 521delC, ACG-->AG. This placed in phase a TAG triplet normally overlapping codons 150 and 151. Early interruption of translation presumably accounted for the premature degradation of mutant mRNA. Restriction analysis confirmed the presence of the mutation in the proposita and its absence in the parents. The variant was designated ankyrin Bugey. PMID:9067504

  17. Bitterness of glucose/galactose: novel mutations in the SLC5A1 gene.

    PubMed

    Pode-Shakked, Ben; Reish, Orit; Aktuglu-Zeybek, Cigdem; Kesselman, Dafna; Dekel, Benjamin; Bujanover, Yoram; Anikster, Yair

    2014-01-01

    Glucose galactose malabsorption (GGM) is a rare autosomal recessive disorder characterized by life-threatening osmotic diarrhea at infancy. When the intake of the offending sugars (namely, glucose, galactose and lactose) is ceased, the diarrhea promptly stops. Mutations in the SLC5A1 gene, encoding the sodium-glucose co-transporter located in the brush border of enterocytes, have been shown to cause the disease. More than 300 subjects of diverse origin have been reported worldwide, most of whom are a result of a consanguineous union. We examined 6 patients from 4 families presenting with complaints consistent with GGM and responsive to the appropriate fructose-based diet. Genomic DNA of the patients was polymerase chain reaction amplified for each of the 15 exons of the SLC5A1 gene and analyzed by nucleotide sequencing. The analysis lead to the identification of 2 novel mutations: a 1915 del C mutation, a frameshift mutation leading to a premature stop at codon 645; and a substitution missense mutation of T to C on nucleotide 947 (exon 9) causing a L316P substitution. In addition, G426R and C255W mutations previously described were identified; in both cases, the patients were shown to be homozygous and their parents heterozygous for the mutation. Of note, additional patients who underwent a similar evaluation at our center for suspected GGM did not show mutations in the SLC5A1 gene. Because the latter did not previously undergo a diagnostic algorithm in full, for instance, one that may consist of a glucose breath hydrogen test and an empiric attempt of a dietary switch to galactomin, we suggest that molecular genotyping of such patients should only follow such appropriate clinical evaluation. PMID:24048166

  18. Novel Munc13–4 mutations in children and young adult patients with haemophagocytic lymphohistiocytosis

    PubMed Central

    Santoro, A; Cannella, S; Bossi, G; Gallo, F; Trizzino, A; Pende, D; Dieli, F; Bruno, G; Stinchcombe, J C; Micalizzi, C; De Fusco, C; Danesino, C; Moretta, L; Notarangelo, L D; Griffiths, G M; Aricò, M

    2006-01-01

    Familial haemophagocytic lymphohistiocytosis (FHL) is a genetically heterogeneous disorder characterised by constitutive defects in cellular cytotoxicity resulting in fever, hepatosplenomegaly and cytopenia, and the outcome is fatal unless treated by chemoimmunotherapy followed by haematopoietic stem‐cell transplantation. Since 1999, mutations in the perforin gene giving rise to this disease have been identified; however, these account only for 40% of cases. Lack of a genetic marker hampers the diagnosis, suitability for transplantation, selection of familial donors, identification of carriers, genetic counselling and prenatal diagnosis. Mutations in the Munc13–4 gene have recently been described in patients with FHL. We sequenced the Munc13–4 gene in all patients with haemophagocytic lymphohistiocytosis not due to PRF1 mutations. In 15 of the 30 families studied, 12 novel and 4 known Munc13–4 mutations were found, spread throughout the gene. Among novel mutations, 2650C→T introduced a stop codon; 441del A, 532del C, 3082del C and 3226ins G caused a frameshift, and seven were mis sense mutations. Median age of diagnosis was 4 months, but six patients developed the disease after 5 years of age and one as a young adult of 18 years. Involvement of central nervous system was present in 9 of 15 patients, activity of natural killer cells was markedly reduced or absent in 13 of 13 tested patients. Chemo‐immunotherapy was effective in all patients. Munc13–4 mutations were found in 15 of 30 patients with FHL without PRF1 mutations. Because these patients may develop the disease during adolescence or even later, haematologists should include FHL2 and FHL3 in the differential diagnosis of young adults with fever, cytopenia, splenomegaly and hypercytokinaemia. PMID:16825436

  19. Congenital hypothyroidism and thyroid dyshormonogenesis: a case report of siblings with a newly identified mutation in thyroperoxidase

    PubMed Central

    Sparling, David P.; Fabian, Kendra; Harik, Lara; Jobanputra, Vaidehi; Anyane-Yeboa, Kwame; Oberfield, Sharon E.; Fennoy, Ilene

    2016-01-01

    Background Thyroid dyshormonogenesis continues to be a significant cause of congenital hypothyroidism. Over time, forms of thyroid dyshormonogenesis can result in goiter, which can lead to difficult management decisions as the pathologic changes can both mimic or lead to thyroid cancer. Methods Herein we describe the cases of two brothers diagnosed with congenital hypothyroidism, with initial findings consistent with thyroid dyshormonogenesis. One brother eventually developed multinodular goiter with complex pathology on biopsy, resulting in thyroidectomy. Results Whole exome sequencing revealed the brothers carry a novel frameshift mutation in thyroperoxidase; the mutation, while not previously described, was likely both deleterious and pathogenic. Conlcusions These cases highlight the complex pathology that can occur within thyroid dyshormonogenesis, with similar appearance to possible thyroid cancer, leading to complex management decisions. They also highlight the role that a genetic diagnosis can play in interpreting the impact of dyshormonogenesis on nodular thyroid development, and the need for long-term follow-up in these patients. PMID:26894573

  20. Mutational analysis of ATP7B in Chinese Wilson disease patients.

    PubMed

    Hua, Rui; Hua, Fang; Jiao, Yonggeng; Pan, Yu; Yang, Xu; Peng, Shanshan; Niu, Junqi

    2016-01-01

    Wilson Disease (WD) is an inborn error of copper metabolism inherited in an autosomal recessive manner caused by the mutations in the P-type ATPase gene (ATP7B). In this study, we screen and detect the mutations of the ATP7B gene in unrelated Chinese WD patients. A total of 68 individuals from ten provinces of China with WD were recruited. Of them, 43 were males and 25 were females, and their onset ages were from 1 to 48 years with a median onset age of 22.2 years. All the exons and exon/intron boundaries of ATP7B gene of the patients were sequenced and aligned to the referred ATP7B gene sequence. The results suggested that 66 of the 68 patents carried with at least one mutation and 48 different mutations were identified including 34 missense, one synonymous, two nonsense, two splicing, and nine frameshift mutations (five insertion and four deletion). Among these mutations, c.2333G>T, c.2310C>G, c.2975C>T, and c.3443T>C were the most prevalent mutants and c.2310C>G always linked with c.2333G>T. The eighth, 11(th), and 18(th) exons carried more mutations (6/48, 5/48, and 5/48, respectively) than others. After comparing with the mutations reported previously, 22 out of the 48 mutations were identified as novel mutations. A popular algorithm, Polyphen-2, was used to predict the effects of the amino-acid substitution due to the mutations on the structure and function of ATP7B function and the predicted results indicated that all the missense mutations were unfavorable except c.121A>G and c.748G>A. Phenotype/genotype correlation analysis suggested that the patients with c.2975C>T or c.3809A>G often presented WD features before 12 years old while the patients with c.3443T>C almost presented WD after 12 years old. This is the first time to identify the common mutations contributing to early onset age in Chinese WD patients. Our study will broaden our knowledge about ATP7B mutations in WD patients. PMID:27398169

  1. Mutational analysis of ATP7B in Chinese Wilson disease patients

    PubMed Central

    Hua, Rui; Hua, Fang; Jiao, Yonggeng; Pan, Yu; Yang, Xu; Peng, Shanshan; Niu, Junqi

    2016-01-01

    Wilson Disease (WD) is an inborn error of copper metabolism inherited in an autosomal recessive manner caused by the mutations in the P-type ATPase gene (ATP7B). In this study, we screen and detect the mutations of the ATP7B gene in unrelated Chinese WD patients. A total of 68 individuals from ten provinces of China with WD were recruited. Of them, 43 were males and 25 were females, and their onset ages were from 1 to 48 years with a median onset age of 22.2 years. All the exons and exon/intron boundaries of ATP7B gene of the patients were sequenced and aligned to the referred ATP7B gene sequence. The results suggested that 66 of the 68 patents carried with at least one mutation and 48 different mutations were identified including 34 missense, one synonymous, two nonsense, two splicing, and nine frameshift mutations (five insertion and four deletion). Among these mutations, c.2333G>T, c.2310C>G, c.2975C>T, and c.3443T>C were the most prevalent mutants and c.2310C>G always linked with c.2333G>T. The eighth, 11th, and 18th exons carried more mutations (6/48, 5/48, and 5/48, respectively) than others. After comparing with the mutations reported previously, 22 out of the 48 mutations were identified as novel mutations. A popular algorithm, Polyphen-2, was used to predict the effects of the amino-acid substitution due to the mutations on the structure and function of ATP7B function and the predicted results indicated that all the missense mutations were unfavorable except c.121A>G and c.748G>A. Phenotype/genotype correlation analysis suggested that the patients with c.2975C>T or c.3809A>G often presented WD features before 12 years old while the patients with c.3443T>C almost presented WD after 12 years old. This is the first time to identify the common mutations contributing to early onset age in Chinese WD patients. Our study will broaden our knowledge about ATP7B mutations in WD patients. PMID:27398169

  2. Compound heterozygosity for COL7A1 mutations in twins with dystrophic epidermolysis bullosa: A recessive paternal deletion/insertion mutation and a dominant negative maternal glycine substitution result in a severe phenotype

    SciTech Connect

    Christiano, A.M.; Uitto, J.; Anton-Lamprecht, I.; Ebschner, U.; Amano, S.; Burgeson, R.E.

    1996-04-01

    We have previously demonstrated genetic linkage between the type VII collagen gene (COL7A1) and the dominant (DDEB) and recessive (RDEB) forms of dystrophic epidermolysis bullosa (DEB) and have subsequently identified pathogenetic mutations in several families. Mutations in DDEB identified thus far are glycine substitutions in the collagenous domain of COL7A1, while the most severe forms of RDEB result from premature termination codon (PTC) mutations on both alleles. In this study, we performed mutation analysis in the COL7A1 gene in twins who displayed a severe DEB phenotype. Mutational analysis revealed a paternal 2-bp deletion/1-bp insertion in exon 56, designated 5103CC{yields}G, which results in a frameshift and downstream PTC. Analysis of the maternal COL7A1 allele revealed a glycine-to-arginine substitution in exon 91 (G2351R). Careful questioning of the mother revealed that she and her father had a history of shedding of toenails and occasional poorly heating erosions, consistent with a mild form of DDEB. Immunoprecipitation of type VII collagen from fibroblasts of the twins revealed a marked reduction in intracellular protein production, consistent with the drastic reduction in mRNA transcript from the paternal mutant allele, while the majority of polypeptides bearing the glycine substitution appeared to be degraded intracellularly. Thus, the severe RDEB phenotype in the probands results from compound heterozygosity for one glycine substitution and one PTC mutation in COL7A1. 40 refs., 7 figs.

  3. CF Mutation Panel

    MedlinePlus

    ... page: Was this page helpful? Also known as: Cystic Fibrosis Genotyping; CF DNA Analysis; CF Gene Mutation Panel; CF Molecular Genetic Testing Formal name: Cystic Fibrosis Gene Mutation Panel Related tests: Sweat Test ; Trypsinogen ; ...

  4. Colorectal cancer prognosis: is it all mutation, mutation, mutation?

    PubMed Central

    Hassan, A B; Paraskeva, C

    2005-01-01

    For the 500 000 new cases of colorectal cancer in the world each year, identification of patients with a worse prognosis and those who are more likely to respond to treatment is a challenge. There is an increasing body of evidence correlating genetic mutations with outcome in tumours derived from human colorectal cancer cohorts. K-ras, but not p53 or APC, mutations appear to be associated with poorer overall survival in colorectal cancer patients. PMID:16099785

  5. Point mutations in the murine fumarylacetoacetate hydrolase gene: Animalmodels for the human genetic disorder hereditary tyrosinemia type 1

    SciTech Connect

    Aponte, Jennifer; Sega, Gary A; Hauser, Loren John; Dhar, Madhu; Withrow, Catherine; Carpenter, D A; Rinchik, Eugene M.; Culiat, Cymbeline T; Johnson, Dabney K

    2001-01-01

    Hereditary tyrosinemia type 1 (HT1) is a severe autosomal recessive metabolic disease associated with point mutations in the human fumarylacetoacetate hydrolase (FAH) gene that disrupt tyrosine catabolism. An acute form of HT1 results in death during the first months of life because of hepatic failure, whereas a chronic form leads to gradual development of liver disease often accompanied by renal dysfunction, childhood rickets, neurological crisis, and hepatocellular carcinoma. Mice homozygous for certain chromosome 7 deletions of the albino Tyr; c locus that also include Fah die perinatally as a result of liver dysfunction and exhibit a complex syndrome characterized by structural abnormalities and alterations in gene expression in the liver and kidney. Here we report that two independent, postnatally lethal mutations induced by N-ethyl-N-nitrosourea and mapped near Tyr are alleles of Fah. The Fah6287SB allele is a missense mutation in exon 6, and Fah5961SB is a splice mutation causing loss of exon 7, a subsequent frameshift in the resulting mRNA, and a severe reduction of Fah mRNA levels. Increased levels of the diagnostic metabolite succinylacetone in the urine of the Fah6287SB and Fah5961SB mutants indicate that these mutations cause a decrease in Fah enzymatic activity. Thus, the neonatal phenotype present in both mutants is due to a deficiency in Fah caused by a point mutation, and we propose Fah5961SB and Fah6287SB as mouse models for acute and chronic forms of human HT1, respectively.

  6. A novel splice site mutation in the GNPTAB gene in an Iranian patient with mucolipidosis II α/β.

    PubMed

    Hashemi-Gorji, Feyzollah; Ghafouri-Fard, Soudeh; Salehpour, Shadab; Yassaee, Vahid Reza; Miryounesi, Mohammad

    2016-08-01

    Mucolipidosis type II α/β (ML II α/β) and mucolipidosis type III α/β (ML III α/β) have been shown to be caused by an absence or reduced level of uridine diphosphate (UDP)-N-acetylglucosamine-1-phosphotransferase enzyme (EC 2.7.8.17) activity, respectively. Both disorders are caused by mutations in the GNPTAB gene and are inherited in an autosomal recessive manner. Here we report a 2-year-old female patient being diagnosed as a case of ML II α/β due to coarse face, severe developmental delay, multiple dysostosis, noticeable increase of multiple lysosomal enzymes activity in plasma and normal acid mucopolysaccharides in urine. Mutational analysis of the GNPTAB gene has revealed a novel homozygous mutation in the patient (c.3250-2A>G) with both parents being heterozygote. Transcript analyses showed that this novel splice site mutation leads to exon 17 skipping and a frameshift afterwards (p.P1084_R1112del F1113Vfs*1). Consequently, we confirmed the association of this mutation with ML II α/β. Our finding expands the number of reported cases of this rare metabolic disorder and adds to the GNPTAB mutation database. PMID:27180337

  7. TGFB2 mutations cause familial thoracic aortic aneurysms and dissections associated with mild systemic features of Marfan syndrome.

    PubMed

    Boileau, Catherine; Guo, Dong-Chuan; Hanna, Nadine; Regalado, Ellen S; Detaint, Delphine; Gong, Limin; Varret, Mathilde; Prakash, Siddharth K; Li, Alexander H; d'Indy, Hyacintha; Braverman, Alan C; Grandchamp, Bernard; Kwartler, Callie S; Gouya, Laurent; Santos-Cortez, Regie Lyn P; Abifadel, Marianne; Leal, Suzanne M; Muti, Christine; Shendure, Jay; Gross, Marie-Sylvie; Rieder, Mark J; Vahanian, Alec; Nickerson, Deborah A; Michel, Jean Baptiste; Jondeau, Guillaume; Milewicz, Dianna M

    2012-08-01

    A predisposition for thoracic aortic aneurysms leading to acute aortic dissections can be inherited in families in an autosomal dominant manner. Genome-wide linkage analysis of two large unrelated families with thoracic aortic disease followed by whole-exome sequencing of affected relatives identified causative mutations in TGFB2. These mutations-a frameshift mutation in exon 6 and a nonsense mutation in exon 4-segregated with disease with a combined logarithm of odds (LOD) score of 7.7. Sanger sequencing of 276 probands from families with inherited thoracic aortic disease identified 2 additional TGFB2 mutations. TGFB2 encodes transforming growth factor (TGF)-β2, and the mutations are predicted to cause haploinsufficiency for TGFB2; however, aortic tissue from cases paradoxically shows increased TGF-β2 expression and immunostaining. Thus, haploinsufficiency for TGFB2 predisposes to thoracic aortic disease, suggesting that the initial pathway driving disease is decreased cellular TGF-β2 levels leading to a secondary increase in TGF-β2 production in the diseased aorta. PMID:22772371

  8. Single-Side Two-Location Spotlight Imaging for Building Based on MIMO Through-Wall-Radar.

    PubMed

    Jia, Yong; Zhong, Xiaoling; Liu, Jiangang; Guo, Yong

    2016-01-01

    Through-wall-radar imaging is of interest for mapping the wall layout of buildings and for the detection of stationary targets within buildings. In this paper, we present an easy single-side two-location spotlight imaging method for both wall layout mapping and stationary target detection by utilizing multiple-input multiple-output (MIMO) through-wall-radar. Rather than imaging for building walls directly, the images of all building corners are generated to speculate wall layout indirectly by successively deploying the MIMO through-wall-radar at two appropriate locations on only one side of the building and then carrying out spotlight imaging with two different squint-views. In addition to the ease of implementation, the single-side two-location squint-view detection also has two other advantages for stationary target imaging. The first one is the fewer multi-path ghosts, and the second one is the smaller region of side-lobe interferences from the corner images in comparison to the wall images. Based on Computer Simulation Technology (CST) electromagnetic simulation software, we provide multiple sets of validation results where multiple binary panorama images with clear images of all corners and stationary targets are obtained by combining two single-location images with the use of incoherent additive fusion and two-dimensional cell-averaging constant-false-alarm-rate (2D CA-CFAR) detection. PMID:27618039

  9. Space-variant filtering for correction of wavefront curvature effects in spotlight-mode SAR imagery formed via polar formatting

    SciTech Connect

    Jakowatz, C.V. Jr.; Wahl, D.E.; Thompson, P.A.; Doren, N.E.

    1996-12-31

    Wavefront curvature defocus effects can occur in spotlight-mode SAR imagery when reconstructed via the well-known polar formatting algorithm (PFA) under certain scenarios that include imaging at close range, use of very low center frequency, and/or imaging of very large scenes. The range migration algorithm (RMA), also known as seismic migration, was developed to accommodate these wavefront curvature effects. However, the along-track upsampling of the phase history data required of the original version of range migration can in certain instances represent a major computational burden. A more recent version of migration processing, the Frequency Domain Replication and Downsampling (FReD) algorithm, obviates the need to upsample, and is accordingly more efficient. In this paper the authors demonstrate that the combination of traditional polar formatting with appropriate space-variant post-filtering for refocus can be as efficient or even more efficient than FReD under some imaging conditions, as demonstrated by the computer-simulated results in this paper. The post-filter can be pre-calculated from a theoretical derivation of the curvature effect. The conclusion is that the new polar formatting with post filtering algorithm (PF2) should be considered as a viable candidate for a spotlight-mode image formation processor when curvature effects are present.

  10. Loss of function mutations in RPL27 and RPS27 identified by whole-exome sequencing in Diamond-Blackfan anaemia.

    PubMed

    Wang, RuNan; Yoshida, Kenichi; Toki, Tsutomu; Sawada, Takafumi; Uechi, Tamayo; Okuno, Yusuke; Sato-Otsubo, Aiko; Kudo, Kazuko; Kamimaki, Isamu; Kanezaki, Rika; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Terui, Kiminori; Sato, Tomohiko; Iribe, Yuji; Ohga, Shouichi; Kuramitsu, Madoka; Hamaguchi, Isao; Ohara, Akira; Hara, Junichi; Goi, Kumiko; Matsubara, Kousaku; Koike, Kenichi; Ishiguro, Akira; Okamoto, Yasuhiro; Watanabe, Kenichiro; Kanno, Hitoshi; Kojima, Seiji; Miyano, Satoru; Kenmochi, Naoya; Ogawa, Seishi; Ito, Etsuro

    2015-03-01

    Diamond-Blackfan anaemia is a congenital bone marrow failure syndrome that is characterized by red blood cell aplasia. The disease has been associated with mutations or large deletions in 11 ribosomal protein genes including RPS7, RPS10, RPS17, RPS19, RPS24, RPS26, RPS29, RPL5, RPL11, RPL26 and RPL35A as well as GATA1 in more than 50% of patients. However, the molecular aetiology of many Diamond-Blackfan anaemia cases remains to be uncovered. To identify new mutations responsible for Diamond-Blackfan anaemia, we performed whole-exome sequencing analysis of 48 patients with no documented mutations/deletions involving known Diamond-Blackfan anaemia genes except for RPS7, RPL26, RPS29 and GATA1. Here, we identified a de novo splicing error mutation in RPL27 and frameshift deletion in RPS27 in sporadic patients with Diamond-Blackfan anaemia. In vitro knockdown of gene expression disturbed pre-ribosomal RNA processing. Zebrafish models of rpl27 and rps27 mutations showed impairments of erythrocyte production and tail and/or brain development. Additional novel mutations were found in eight patients, including RPL3L, RPL6, RPL7L1T, RPL8, RPL13, RPL14, RPL18A and RPL31. In conclusion, we identified novel germline mutations of two ribosomal protein genes responsible for Diamond-Blackfan anaemia, further confirming the concept that mutations in ribosomal protein genes lead to Diamond-Blackfan anaemia. PMID:25424902

  11. PTCH mutations and deletions in patients with typical nevoid basal cell carcinoma syndrome and in patients with a suspected genetic predisposition to basal cell carcinoma: a French study

    PubMed Central

    Soufir, N; Gerard, B; Portela, M; Brice, A; Liboutet, M; Saiag, P; Descamps, V; Kerob, D; Wolkenstein, P; Gorin, I; Lebbe, C; Dupin, N; Crickx, B; Basset-Seguin, N; Grandchamp, B

    2006-01-01

    The patched (PTCH) mutation rate in nevoid basal cell carcinoma syndrome (NBCCS) reported in various studies ranges from 40 to 80%. However, few studies have investigated the role of PTCH in clinical conditions suggesting an inherited predisposition to basal cell carcinoma (BCC), although it has been suggested that PTCH polymorphisms could predispose to multiple BCC (MBCC). In this study, we therefore performed an exhaustive analysis of PTCH (mutations detection and deletion analysis) in 17 patients with the full complement of criteria for NBCCS (14 sporadic and three familial cases), and in 48 patients suspected of having a genetic predisposition to BCC (MBCC and/or age at diagnosis ⩽40 years and/or familial BCC). Eleven new germline alterations of the PTCH gene were characterised in 12 out of 17 patients harbouring the full complement of criteria for the syndrome (70%). These were frameshift mutations in five patients, nonsense mutations in five patients, a small inframe deletion in one patient, and a large germline deletion in another patient. Only one missense mutation (G774R) was found, and this was in a patient affected with MBCC, but without any other NBCCS criterion. We therefore suggest that patients harbouring the full complement of NBCCS criteria should as a priority be screened for PTCH mutations by sequencing, followed by a deletion analysis if no mutation is detected. In other clinical situations that suggest genetic predisposition to BCC, germline mutations of PTCH are not common. PMID:16909134

  12. The NOD2 3020insC Mutation in Women with Breast Cancer from the Bydgoszcz Region in Poland. First Results

    PubMed Central

    2006-01-01

    The frameshift NOD2 gene mutation 3020insC is predominantly associated with Crohn's disease, but predisposes to many types of common cancers as well. We studied the frequency of this mutant NOD2 allele in 148 breast cancer women from the Bydgoszcz region in Poland. The NOD2 mutation was present in 8.8% of the patients. The mean age at breast cancer diagnosis of the mutation carriers was 43 years. We did not find any mutation in patients diagnosed with breast cancer after the age of 50 years. There was no association of the NOD2 mutation with a strong family history of breast cancer. On the contrary, the mutation frequency (11.4%) was two times higher in women from families with a single case of breast cancer and with aggregation of other common types of cancer, especially digestive tract cancers. Low risk of breast cancer in the mutation carriers seems to be confirmed by finding the 3020insC mutation in three healthy parents of probands aged 73, 74 and 83 years, from three separate families. PMID:20222998

  13. HMG CoA Lyase (HL): Mutation detection and development of a bacterial expression system for screening the activity of mutant alleles from HL-deficient patients

    SciTech Connect

    Robert, M.F.; Ashmarina, L.; Poitier, E.

    1994-09-01

    HL catalyzes the last step of ketogenesis, and autosomal recessive HL deficiency in humans can cause episodes of hypoglycemia and coma. Structurally, HL is a dimer of identical 325-residue peptides which requires a reducing environment to maintain activity. We cloned the human and mouse HL cDNAs and genes and have performed mutation analysis on cells from 30 HL-deficient probands. Using SSCP and also genomic Southern analysis we have identified putative mutations on 53/60 alleles of these patients (88%). To date, we have found 20 mutations: 3 large deletions, 4 termination mutations, 5 frameshift mutations, and 8 missense mutations which we suspect to be pathogenic based on evolutionary conservation and/or our previous studies on purified HL protein. We have also identified 3 polymorphic variants. In order to directly test the activity of the missense mutations, we established a pGEX-based system, using a glutathione S transferase (GST)-HL fusion protein. Expressed wild-type GST-HL was insoluble. We previously located a reactive Cys at the C-terminus of chicken HL which is conserved in human HL. We produced a mutant HL peptide, C323S, which replaced Cys323 with Ser. Purified C323S is soluble and has similar kinetics to wild-type HL. C323S-containing GST-HL is soluble and enzymatically active. We are cloning and expressing the 8 missense mutations.

  14. Six novel mutations in the myophosphorylase gene in patients with McArdle disease and a family with pseudo-dominant inheritance pattern.

    PubMed

    Wu, Y; Weber, J L; Vladutiu, G D; Tarnopolsky, M A

    2011-12-01

    McArdle disease is an autosomal recessive glycogenosis due to deficiency of the enzyme myophosphorylase. It results from homozygous or compound heterozygous mutations in the gene for this enzyme, PYGM. We report six novel mutations in the PYGM gene based upon sequencing data including three missense mutations (p.D51G, p.P398L, and p.N648Y), one nonsense mutation (p.Y75X), one frame-shift mutation (p.Y114SfsX181), and one amino acid deletion (p.Y53del) in six patients with McArdle disease. We also report on a Caucasian family that appeared to transmit McArdle disease in an autosomal dominant manner. In order to evaluate the potential pathogenicity of the sequence variants, we performed in silico analysis using PolyPhen-2 and SIFT BLink, along with species conservation analysis using UCSC Genome Browser. The above mutations were all predicted to be disease associated with high probability and with at least the same level of certainty as several confirmed mutations. The current data add to the list of pathogenic mutations in the PYGM gene associated with McArdle disease. PMID:21880526

  15. Clinical and molecular genetic analysis of a Chinese family with congenital X-linked adrenal hypoplasia caused by novel mutation 1268delA in the DAX-1 gene*

    PubMed Central

    ZHANG, Zhe; FENG, Ye; YE, Dan; LI, Cheng-jiang; DONG, Feng-qin; TONG, Ying

    2015-01-01

    Congenital X-linked adrenal hypoplasia (AHC) is a rare disease characterized by primary adrenal insufficiency before adolescence and by hypogonadotropic hypogonadism (HHG) during adolescence. In this paper, we present a Chinese family with AHC. Two brothers, misdiagnosed with adrenal insufficiency of unknown etiology at the age of 9, were correctly diagnosed with AHC when delayed puberty, HHG, and testicular defects were observed. We investigated the clinical features and identified the dosage-sensitive sex reversal AHC critical region of the X chromosome gene 1 (DAX-1) mutation in this kindred. Direct sequencing of the DAX-1 gene revealed that the two siblings have a novel mutation (1268delA) of which their mother is a heterozygous carrier. This mutation causes a frameshift and a premature stop codon at position 436, encoding a truncated protein. It is important to increase knowledge of the mutational spectrum in genes related to this disease, linking phenotype to genotype. PMID:26537215

  16. Detection of somatic BRCA1/2 mutations in ovarian cancer - next-generation sequencing analysis of 100 cases.

    PubMed

    Koczkowska, Magdalena; Zuk, Monika; Gorczynski, Adam; Ratajska, Magdalena; Lewandowska, Marzena; Biernat, Wojciech