Science.gov

Sample records for fyn regulatory mechanisms

  1. Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1.

    PubMed Central

    Sanguinetti, Amy R; Cao, Haiming; Corley Mastick, Cynthia

    2003-01-01

    Caveolin-1 is phosphorylated on Tyr(14) in response to both oxidative and hyperosmotic stress. In the present paper, we show that this phosphorylation requires activation of the Src family kinase Fyn. Stress-induced caveolin phosphorylation was abolished by three Src kinase inhibitors, SU6656, PP2 and PD180970, and was not observed in fibroblasts derived from a Src, Yes and Fyn triple-knockout mouse (SYF-/-). Using cell lines derived from single-kinase-knockout mice (Src-/-, Yes-/- and Fyn-/-), we show that expression of Fyn, but not Src or Yes, is required for stress-induced caveolin phosphorylation. Heterologous expression of Fyn in the SYF-/- and Fyn-/- cells was sufficient to reconstitute stress-induced caveolin phosphorylation, and overexpression of Fyn in wild-type cells induced hyperphosphorylation of caveolin. Fyn was autophosphorylated following oxidative stress, verifying activation of this kinase. Interestingly, there was a concomitant increase in the phosphorylation of Fyn on its Csk (C-terminal Src kinase) site, indicating feedback inhibition. Csk binds to phosphocaveolin [Cao, Courchesne and Mastick (2002) J. Biol. Chem. 277, 8771-8774] and should phosphorylate any co-localized Src-family kinases. Oxidative-stress-induced phosphorylation of caveolin-1 also requires expression of Abl [Sanguinetti and Mastick (2003) Cell Signal. 15, 289-298]. Using inhibitors and cells derived from knockout mice, we verified a requirement for both Abl and Fyn in stress-induced caveolin phosphorylation in a single cell type. Our data suggest a novel mechanism for attenuation of Src-kinase activity by Abl: stable tyrosine phosphorylation of a scaffolding protein, caveolin, and recruitment of Csk. Paxillin, a substrate of both Abl and Src, organizes a similar regulatory complex. PMID:12921535

  2. miR-106b inhibits tau phosphorylation at Tyr18 by targeting Fyn in a model of Alzheimer's disease.

    PubMed

    Liu, Wei; Zhao, Jingya; Lu, Guangxiu

    2016-09-16

    Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by β-amyloid deposits and neurofibrillary tangles consisting of hyperphosphorylated tau protein. Increasing evidence has revealed that microRNAs (miRNAs) are implicated in the pathogenesis of AD. However, the effect of miRNAs on abnormal tau phosphorylation remains largely unclear so far. In this study, we investigated the role of miR-106b in tau phosphorylation and identified a new molecular mechanism of the hyperphosphorylation of tau. The results of qRT-PCR showed that the expression level of miR-106b was decreased, but Fyn was increased in the temporal cortex of AD patients. Overexpression of miR-106b inhibited Aβ1-42-induced tau phosphorylation at Tyr18 in SH-SY5Y cells stably expressing tau (SH-SY5Y/tau), whereas no changes were observed in tau phosphorylation at Ser396/404. Dual-luciferase reporter gene assay validated that Fyn was a direct target gene of miR-106b. In addition, western blot analysis revealed that Fyn protein expression was suppressed when SH-SY5Y cells were transfected with miR-106b mimics. Endogenous Fyn expression was knockdown by transfection with a small interfering RNA specific for Fyn (si-Fyn). The phosphorylation level of tau at Tyr 18 was decreased in the si-Fyn group compared with the negative control group, but the inhibitory effect of si-Fyn on tau phosphorylation was attenuated when miR-106b expression was inhibited. Taken together, these data suggest that miR-106b inhibits Aβ1-42-induced tau phosphorylation at Tyr18 by targeting Fyn. Our findings extend the knowledge about the regulation of tau phosphorylation and the regulatory mechanism of Fyn gene expression. PMID:27520374

  3. Superantigen-induced CD4 Memory T Cell Anergy. I. Staphylococcal Enterotoxin B Induces Fyn-mediated Negative Signaling1

    PubMed Central

    Watson, Andrew R. O.; Janik, David K.; Lee, William T.

    2012-01-01

    Memory CD4 T cells must provide robust protection for an organism while still maintaining self-tolerance. Superantigens reveal a memory cell-specific regulatory pathway, by which signaling through the TCR can lead to clonal tolerance (anergy). Here we show that the src kinase Fyn is a critical regulator of anergy in murine memory CD4 T cells induced by the bacterial superantigen staphylococcal enterotoxin B (SEB). Exposure to SEB results in impaired TCR signaling due to failed CD3/ZAP-70 complex formation. Further, signal transduction through the TCR remains similarly blocked when anergic memory cells are subsequently exposed to agonist peptide antigen. Pharmacological inhibition or genetic elimination of Fyn kinase reverses memory cell anergy, resulting in SEB-induced cell proliferation. The mechanism underlying impaired TCR signaling and subsequent memory cell anergy must involve a Fyn signaling pathway given that the suppression of Fyn activity restores CD3/ZAP-70 complex formation and TCR proximal signaling. PMID:22386537

  4. FYN promotes breast cancer progression through epithelial-mesenchymal transition.

    PubMed

    Xie, Ye-Gong; Yu, Yue; Hou, Li-Kun; Wang, Xin; Zhang, Bin; Cao, Xu-Chen

    2016-08-01

    FYN, one of the members of the Src family of kinases (SFKs), has been reported to be overexpressed in various types of cancers and correlated with cell motility and proliferation. However, the mechanism is still unclear. In the present study, we found that FYN was overexpressed in breast cancer and overexpression of FYN promoted cell proliferation, migration and invasion in the MCF10A cells, whereas depletion of FYN suppressed cell proliferation, migration and invasion in the MDA-MB-231 cells. Moreover, FYN upregulated the expression of mesenchymal markers and epithelial-mesenchymal transition (EMT)-related transcription factors, and downregulated the expression of epithelial markers, suggesting that FYN induces EMT in breast cancer cells. Furthermore, FYN was transcriptionally regulated by FOXO1 and mediated FGF2-induced EMT through both the PI3K/AKT and ERK/MAPK pathways. PMID:27349276

  5. Chromium(VI) stimulates Fyn to initiate innate immune gene induction in human airway epithelial cells

    PubMed Central

    Nemec, Antonia A.; Zubritsky, Lindsey M.; Barchowsky, Aaron

    2009-01-01

    Mechanisms for pathogenic metal signaling in airway injury or disease promotion are poorly understood. It is widely believed that one mechanism for pathogenic and possible carcinogenic effects of inhaled chromium (Cr(VI)) is inhibition of inducible gene transactivation. However, we recently reported that Cr(VI) inhibition of Sp1-dependent transactivation required signal transducer and activator of transcription 1 (STAT1)-dependent expression of an inhibitory protein in airway epithelium. Thus, Cr(VI) exposures can induce genes and we hypothesized this induction resulted from Cr(VI) signaling through an innate immune-like STAT1-dependent pathway initiated by Fyn. Exposure of human airway epithelial (BEAS-2B) cells to Cr(VI) selectively transactivated STAT-responsive interferon-stimulated response element (ISRE) and induced ISRE-driven transactivation of interferon regulatory factor 7 (IRF7), without affecting the gamma interferon-activated site (GAS)-driven IRF1 expression. Cr(VI)-induced IRF7 was absent or greatly reduced in cells that lacked STAT1, were treated with the Src family kinase inhibitor, PP2, or lacked Fyn. Expressing Fyn, but not Src, in mouse embryonic fibroblasts cells null for Src, Yes, and Fyn restored Cr(VI)-stimulated STAT1 tyrosine phosphorylation and IRF7 expression. Finally, shRNA knockdown of Fyn in BEAS-2B cells prevented Cr(VI)-activated STAT1 transactivation of IRF7. These data support a novel mechanism through which Cr(VI) stimulates Fyn to initiate interferon-like signaling for STAT1-dependent gene transactivation. PMID:19994902

  6. Chemically Diverse Toxicants Converge on Fyn and c-Cbl to Disrupt Precursor Cell Function

    PubMed Central

    Li, Zaibo; Dong, Tiefei; Pröschel, Chris; Noble, Mark

    2007-01-01

    Identification of common mechanistic principles that shed light on the action of the many chemically diverse toxicants to which we are exposed is of central importance in understanding how toxicants disrupt normal cellular function and in developing more effective means of protecting against such effects. Of particular importance is identifying mechanisms operative at environmentally relevant toxicant exposure levels. Chemically diverse toxicants exhibit striking convergence, at environmentally relevant exposure levels, on pathway-specific disruption of receptor tyrosine kinase (RTK) signaling required for cell division in central nervous system (CNS) progenitor cells. Relatively small toxicant-induced increases in oxidative status are associated with Fyn kinase activation, leading to secondary activation of the c-Cbl ubiquitin ligase. Fyn/c-Cbl pathway activation by these pro-oxidative changes causes specific reductions, in vitro and in vivo, in levels of the c-Cbl target platelet-derived growth factor receptor-α and other c-Cbl targets, but not of the TrkC RTK (which is not a c-Cbl target). Sequential Fyn and c-Cbl activation, with consequent pathway-specific suppression of RTK signaling, is induced by levels of methylmercury and lead that affect large segments of the population, as well as by paraquat, an organic herbicide. Our results identify a novel regulatory pathway of oxidant-mediated Fyn/c-Cbl activation as a shared mechanism of action of chemically diverse toxicants at environmentally relevant levels, and as a means by which increased oxidative status may disrupt mitogenic signaling. These results provide one of a small number of general mechanistic principles in toxicology, and the only such principle integrating toxicology, precursor cell biology, redox biology, and signaling pathway analysis in a predictive framework of broad potential relevance to the understanding of pro-oxidant–mediated disruption of normal development. PMID:17298174

  7. Fyn is a redox sensor involved in solar ultraviolet light-induced signal transduction in skin carcinogenesis

    PubMed Central

    Kim, Jong-Eun; Roh, Eunmiri; Lee, Mee Hyun; Yu, Dong Hoon; Kim, Dong Joon; Lim, Tae-Gyu; Jung, Sung Keun; Peng, Cong; Cho, Yong-Yeon; Dickinson, Sally; Alberts, Dave; Bowden, G. Tim; Einspahr, Janine; Stratton, Steven P; Curiel, Clara; Bode, Ann M.; Lee, Ki Won; Dong, Zigang

    2015-01-01

    Solar ultraviolet (UV) light is a major etiological factor in skin carcinogenesis, with solar UV-stimulated signal transduction inducing pathological changes and skin damage. The primary sensor of solar UV-induced cellular signaling has not been identified. We use an experimental system of solar simulated light (SSL) to mimic solar UV and we demonstrate that Fyn is a primary redox sensor involved in SSL-induced signal transduction. Reactive oxygen species (ROS) generated by SSL exposure directly oxidize Cys488 of Fyn, resulting in increased Fyn kinase activity. Fyn oxidation was increased in mouse skin after SSL exposure, and Fyn knockout (Fyn−/−) mice formed larger and more tumors compared to Fyn wildtype mice when exposed to SSL for an extended period of time. Murine embryonic fibroblasts (MEFs) lacking Fyn as well as cells in which Fyn expression was knocked down were resistant to SSL-induced apoptosis. Furthermore, cells expressing mutant Fyn (C448A) were resistant to SSL-induced apoptosis. These findings suggest that Fyn acts as a regulatory nexus between solar UV, ROS and signal transduction during skin carcinogenesis. PMID:26686094

  8. Fyn is a redox sensor involved in solar ultraviolet light-induced signal transduction in skin carcinogenesis.

    PubMed

    Kim, J-E; Roh, E; Lee, M H; Yu, D H; Kim, D J; Lim, T-G; Jung, S K; Peng, C; Cho, Y-Y; Dickinson, S; Alberts, D; Bowden, G T; Einspahr, J; Stratton, S P; Curiel-Lewandrowski, C; Bode, A M; Lee, K W; Dong, Z

    2016-08-01

    Solar ultraviolet (UV) light is a major etiological factor in skin carcinogenesis, with solar UV-stimulated signal transduction inducing pathological changes and skin damage. The primary sensor of solar UV-induced cellular signaling has not been identified. We use an experimental system of solar simulated light (SSL) to mimic solar UV and we demonstrate that Fyn is a primary redox sensor involved in SSL-induced signal transduction. Reactive oxygen species (ROS) generated by SSL exposure directly oxidize Cys488 of Fyn, resulting in increased Fyn kinase activity. Fyn oxidation was increased in mouse skin after SSL exposure and Fyn-knockout mice formed larger and more tumors compared with Fyn wild-type mice when exposed to SSL for an extended period of time. Murine embryonic fibroblasts (MEFs) lacking Fyn and cells in which Fyn expression was knocked down were resistant to SSL-induced apoptosis. Furthermore, cells expressing mutant Fyn (C448A) were resistant to SSL-induced apoptosis. These findings suggest that Fyn acts as a regulatory nexus between solar UV, ROS and signal transduction during skin carcinogenesis. PMID:26686094

  9. Fyn Kinase Regulates Microglial Neuroinflammatory Responses in Cell Culture and Animal Models of Parkinson's Disease

    PubMed Central

    Panicker, Nikhil; Saminathan, Hariharan; Jin, Huajun; Neal, Matthew; Harischandra, Dilshan S.; Gordon, Richard; Kanthasamy, Kavin; Lawana, Vivek; Sarkar, Souvarish; Luo, Jie; Anantharam, Vellareddy; Kanthasamy, Anumantha G.

    2015-01-01

    Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present study, we examined the role of Fyn, a non-receptor tyrosine kinase, in microglial activation and neuroinflammatory mechanisms in cell culture and animal models of PD. The well-characterized inflammogens LPS and TNFα rapidly activated Fyn kinase in microglia. Immunocytochemical studies revealed that activated Fyn preferentially localized to the microglial plasma membrane periphery and the nucleus. Furthermore, activated Fyn phosphorylated PKCδ at tyrosine residue 311, contributing to an inflammogen-induced increase in its kinase activity. Notably, the Fyn-PKCδ signaling axis further activated the LPS- and TNFα-induced MAP kinase phosphorylation and activation of the NFκB pathway, implying that Fyn is a major upstream regulator of proinflammatory signaling. Functional studies in microglia isolated from wild-type (Fyn+/+) and Fyn knock-out (Fyn−/−) mice revealed that Fyn is required for proinflammatory responses, including cytokine release as well as iNOS activation. Interestingly, a prolonged inflammatory insult induced Fyn transcript and protein expression, indicating that Fyn is upregulated during chronic inflammatory conditions. Importantly, in vivo studies using MPTP, LPS, or 6-OHDA models revealed a greater attenuation of neuroinflammatory responses in Fyn−/− and PKCδ −/− mice compared with wild-type mice. Collectively, our data demonstrate that Fyn is a major upstream signaling mediator of microglial neuroinflammatory processes in PD. SIGNIFICANCE STATEMENT Parkinson's disease (PD) is a complex multifactorial disease characterized by the progressive loss of midbrain dopamine neurons. Sustained microglia-mediated neuroinflammation has

  10. Involvement of the Tyro3 receptor and its intracellular partner Fyn signaling in Schwann cell myelination.

    PubMed

    Miyamoto, Yuki; Torii, Tomohiro; Takada, Shuji; Ohno, Nobuhiko; Saitoh, Yurika; Nakamura, Kazuaki; Ito, Akihito; Ogata, Toru; Terada, Nobuo; Tanoue, Akito; Yamauchi, Junji

    2015-10-01

    During early development of the peripheral nervous system, Schwann cell precursors proliferate, migrate, and differentiate into premyelinating Schwann cells. After birth, Schwann cells envelop neuronal axons with myelin sheaths. Although some molecular mechanisms underlying myelination by Schwann cells have been identified, the whole picture remains unclear. Here we show that signaling through Tyro3 receptor tyrosine kinase and its binding partner, Fyn nonreceptor cytoplasmic tyrosine kinase, is involved in myelination by Schwann cells. Impaired formation of myelin segments is observed in Schwann cell neuronal cultures established from Tyro3-knockout mouse dorsal root ganglia (DRG). Indeed, Tyro3-knockout mice exhibit reduced myelin thickness. By affinity chromatography, Fyn was identified as the binding partner of the Tyro3 intracellular domain, and activity of Fyn is down-regulated in Tyro3-knockout mice, suggesting that Tyro3, acting through Fyn, regulates myelination. Ablating Fyn in mice results in reduced myelin thickness. Decreased myelin formation is observed in cultures established from Fyn-knockout mouse DRG. Furthermore, decreased kinase activity levels and altered expression of myelination-associated transcription factors are observed in these knockout mice. These results suggest the involvement of Tyro3 receptor and its binding partner Fyn in Schwann cell myelination. This constitutes a newly recognized receptor-linked signaling mechanism that can control Schwann cell myelination. PMID:26224309

  11. Fyn Is a Novel Target of (−)-Epigallocatechin Gallate in the Inhibition of JB6 Cl41 Cell Transformation

    PubMed Central

    He, Zhiwei; Tang, Faqing; Ermakova, Svetlana; Li, Ming; Zhao, Qing; Cho, Yong-Yeon; Ma, Wei-Ya; Choi, Hong-Seok; Bode, Ann M.; Yang, Chung S.; Dong, Zigang

    2010-01-01

    The cancer preventive action of (−)-epigallocatechin gallate (EGCG), found in green tea, is strongly supported by epidemiology and laboratory research data. However, the mechanism by which EGCG inhibits carcinogenesis and cell transformation is not clear. In this study, we report that EGCG suppressed epidermal growth factor (EGF)-induced cell transformation in JB6 cells. We also found that EGCG inhibited EGF-induced Fyn kinase activity and phosphorylation in vitro and in vivo. Fyn was implicated in the process because EGF-induced JB6 cell transformation was inhibited by small interfering RNA (siRNA)-Fyn-JB6 cells. With an in vitro protein-binding assay, we found that EGCG directly bound with the GST-Fyn-SH2 domain but not the GST-Fyn-SH3 domain. The Kd value for EGCG binding to the Fyn SH2 domain was 0.367 ± 0.122 µM and Bmax was 1.35 ± 0.128 nmol/mg. Compared with control JB6 Cl41 cells, EGF-induced phosphorylation of p38 MAP kinase (p38 MAPK) (Thr180/Tyr182), ATF-2 (Thr71) and signal transducer and activator of transcription 1 (STAT1) (Thr727) was decreased in siRNA-Fyn-JB6 cells. EGCG could inhibit the phosphorylation of p38 MAPK, ATF-2, and STAT1. The DNA binding ability of AP-1, STAT1, and ATF-2 was also decreased in siRNA-Fyn-JB6 cells. Overall, these results demonstrated that EGCG interacted with Fyn and inhibited Fyn kinase activity and thereby regulated EGF-induced cell transformation. Inhibition of Fyn kinase activity is a novel and important mechanism that may be involved in EGCG-induced inhibition of cell transformation. PMID:18095272

  12. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons

    PubMed Central

    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua

    2016-01-01

    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies. PMID:27420046

  13. Fyn kinase controls Fc{epsilon}RI receptor-operated calcium entry necessary for full degranulation in mast cells

    SciTech Connect

    Sanchez-Miranda, Elizabeth; Ibarra-Sanchez, Alfredo; Gonzalez-Espinosa, Claudia

    2010-01-22

    IgE-antigen-dependent crosslinking of the high affinity IgE receptor (Fc{epsilon}RI) on mast cells leads to degranulation, leukotriene synthesis and cytokine production. Calcium (Ca{sup 2+}) mobilization is a sine qua non requisite for degranulation, allowing the rapid secretion of stored pro-inflammatory mediators responsible for allergy symptoms. Fyn is a Src-family kinase that positively controls Fc{epsilon}RI-induced mast cell degranulation. However, our understanding of the mechanism connecting Fyn activation to secretion of pre-synthesized mediators is very limited. We analyzed Fc{epsilon}RI-dependent Ca{sup 2+} mobilization in bone marrow-derived mast cells (BMMCs) differentiated from WT and Fyn -/- knock out mice. Fyn -/- BMMCs showed a marked defect in extracellular Ca{sup 2+} influx after Fc{epsilon}RI crosslinking but not after thapsigargin addition. High concentrations of Gadolinium (Gd{sup 3+}) partially blocked Fc{epsilon}RI-induced Ca{sup 2+} influx in WT cells but, in contrast, completely inhibited Ca{sup 2+} mobilization in Fyn -/- cells. Low concentrations of an inhibitor of the canonical transient receptor potential (TRPC) Ca{sup 2+} channels (2-aminoethoxyphenyl-borane, 2-APB) blocked Fc{epsilon}RI-induced maximal Ca{sup 2+} rise in WT but not in Fyn -/- cells. Ca{sup 2+} entry through Fyn-controlled, 2-APB sensitive channels was found to be important for full degranulation and IL-2 mRNA accumulation in WT cells. Immunoprecipitation assays showed that Fyn kinase interacts with TRPC 3/6/7 channels after IgE-antigen stimulation, but its association is not related to protein tyrosine phosphorylation. Results indicate Fyn kinase mediates the receptor-dependent activation of TRPC channels that contribute to degranulation in Fc{epsilon}RI-stimulated mast cells.

  14. Comparative studies of gene regulatory mechanisms.

    PubMed

    Pai, Athma A; Gilad, Yoav

    2014-12-01

    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution. PMID:25215415

  15. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  16. Advances in Autophagy Regulatory Mechanisms.

    PubMed

    Gallagher, Laura E; Williamson, Leon E; Chan, Edmond Y W

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  17. Chromatin insulators: regulatory mechanisms and epigenetic inheritance

    PubMed Central

    Bushey, Ashley M.; Dorman, Elizabeth R.; Corces, Victor G.

    2008-01-01

    Enhancer-blocking insulators are DNA elements that disrupt the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter. Insulators participate in both transcriptional regulation and global nuclear organization, two features of chromatin that are thought to be maintained from one generation to the next through epigenetic mechanisms. Furthermore, there are many regulatory mechanisms in place that enhance or hinder insulator activity. These modes of regulation could be used to establish cell-type specific insulator activity that is epigenetically inherited along a cell and/or organismal lineage. This review will discuss the evidence for epigenetic inheritance and regulation of insulator function. PMID:18851828

  18. Gene regulatory mechanisms underpinning prostate cancer susceptibility.

    PubMed

    Whitington, Thomas; Gao, Ping; Song, Wei; Ross-Adams, Helen; Lamb, Alastair D; Yang, Yuehong; Svezia, Ilaria; Klevebring, Daniel; Mills, Ian G; Karlsson, Robert; Halim, Silvia; Dunning, Mark J; Egevad, Lars; Warren, Anne Y; Neal, David E; Grönberg, Henrik; Lindberg, Johan; Wei, Gong-Hong; Wiklund, Fredrik

    2016-04-01

    Molecular characterization of genome-wide association study (GWAS) loci can uncover key genes and biological mechanisms underpinning complex traits and diseases. Here we present deep, high-throughput characterization of gene regulatory mechanisms underlying prostate cancer risk loci. Our methodology integrates data from 295 prostate cancer chromatin immunoprecipitation and sequencing experiments with genotype and gene expression data from 602 prostate tumor samples. The analysis identifies new gene regulatory mechanisms affected by risk locus SNPs, including widespread disruption of ternary androgen receptor (AR)-FOXA1 and AR-HOXB13 complexes and competitive binding mechanisms. We identify 57 expression quantitative trait loci at 35 risk loci, which we validate through analysis of allele-specific expression. We further validate predicted regulatory SNPs and target genes in prostate cancer cell line models. Finally, our integrated analysis can be accessed through an interactive visualization tool. This analysis elucidates how genome sequence variation affects disease predisposition via gene regulatory mechanisms and identifies relevant genes for downstream biomarker and drug development. PMID:26950096

  19. Alzheimer's amyloid-β oligomers rescue cellular prion protein induced tau reduction via the Fyn pathway.

    PubMed

    Chen, Rong-Jie; Chang, Wei-Wei; Lin, Yu-Chun; Cheng, Pei-Lin; Chen, Yun-Ru

    2013-09-18

    Amyloid-β (Aβ) and tau are the pathogenic hallmarks in Alzheimer's disease (AD). Aβ oligomers are considered the actual toxic entities, and the toxicity relies on the presence of tau. Recently, Aβ oligomers have been shown to specifically interact with cellular prion protein (PrP(C)) where the role of PrP(C) in AD is still not fully understood. To investigate the downstream mechanism of PrP(C) and Aβ oligomer interaction and their possible relationships to tau, we examined tau expression in human neuroblastoma BE(2)-C cells transfected with murine PrP(C) and studied the effect under Aβ oligomer treatment. By Western blotting, we found that PrP(C) overexpression down-regulated tau protein and Aβ oligomer binding alleviated the tau reduction induced by wild type but not M128V PrP(C), the high AD risk polymorphic allele in human prion gene. PrP(C) lacking the Aβ oligomer binding site was incapable of rescuing the level of tau reduction. Quantitative RT-PCR showed the PrP(C) effect was attributed to tau reduction at the transcription level. Treatment with Fyn pathway inhibitors, Fyn kinase inhibitor PP2 and MEK inhibitor U0126, reversed the PrP(C)-induced tau reduction and Aβ oligomer treatment modulated Fyn kinase activity. The results suggested Fyn pathway regulated Aβ-PrP(C)-tau signaling. Overall, our results demonstrated that PrP(C) down-regulated tau via the Fyn pathway and the effect can be regulated by Aβ oligomers. Our study facilitated the understanding of molecular mechanisms among PrP(C), tau, and Aβ oligomers. PMID:23805846

  20. Regulatory mechanisms link phenotypic plasticity to evolvability.

    PubMed

    van Gestel, Jordi; Weissing, Franz J

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  1. Dopamine D2 receptors are involved in the regulation of Fyn and metabotropic glutamate receptor 5 phosphorylation in the rat striatum in vivo.

    PubMed

    Mao, Li-Min; Wang, John Q

    2016-04-01

    Fyn, a major Src family kinase (SFK) member that is densely expressed in striatal neurons, is actively involved in the regulation of cellular and synaptic activities in local neurons. This SFK member is likely regulated by dopamine signaling through a receptor mechanism involving dopamine D2 receptors (D2Rs). This study characterizes the D2R-dependent regulation of Fyn in the rat striatum in vivo. Moreover, we explore whether D2Rs regulate metabotropic glutamate receptor 5 (mGluR5) in its tyrosine phosphorylation and whether the D2R-SFK pathway modulates trafficking of mGluR5. We found that blockade of D2Rs by systemic administration of a D2R antagonist, eticlopride, substantially increased SFK phosphorylation in the striatum. This increase was a transient and reversible event. The eticlopride-induced SFK phosphorylation occurred predominantly in immunopurified Fyn but not in another SFK member, Src. Eticlopride also elevated tyrosine phosphorylation of mGluR5. In parallel, eticlopride enhanced synaptic delivery of active Fyn and mGluR5. Pretreatment with an SFK inhibitor blocked the eticlopride-induced tyrosine phosphorylation and synaptic trafficking of mGluR5. These results indicate that D2Rs inhibit SFK (mainly Fyn) phosphorylation in the striatum. D2Rs also inhibit tyrosine phosphorylation and synaptic recruitment of mGluR5 through a signaling mechanism likely involving Fyn. PMID:26777117

  2. Mechanotransduction in an extracted cell model: Fyn drives stretch- and flow-elicited PECAM-1 phosphorylation.

    PubMed

    Chiu, Yi-Jen; McBeath, Elena; Fujiwara, Keigi

    2008-08-25

    Mechanosensing followed by mechanoresponses by cells is well established, but the mechanisms by which mechanical force is converted into biochemical events are poorly understood. Vascular endothelial cells (ECs) exhibit flow- and stretch-dependent responses and are widely used as a model for studying mechanotransduction in mammalian cells. Platelet EC adhesion molecule 1 (PECAM-1) is tyrosine phosphorylated when ECs are exposed to flow or when PECAM-1 is directly pulled, suggesting that it is a mechanochemical converter. We show that PECAM-1 phosphorylation occurs when detergent-extracted EC monolayers are stretched, indicating that this phosphorylation is mechanically triggered and does not require the intact plasma membrane and soluble cytoplasmic components. Using kinase inhibitors and small interfering RNAs, we identify Fyn as the PECAM-1 kinase associated with the model. We further show that stretch- and flow-induced PECAM-1 phosphorylation in intact ECs is abolished when Fyn expression is down-regulated. We suggest that PECAM-1 and Fyn are essential components of a PECAM-1-based mechanosensory complex in ECs. PMID:18710921

  3. VEGF secretion during hypoxia depends on free radicals-induced Fyn kinase activity in mast cells

    SciTech Connect

    Garcia-Roman, Jonathan; Ibarra-Sanchez, Alfredo; Lamas, Monica; Gonzalez Espinosa, Claudia

    2010-10-15

    Research highlights: {yields} Bone marrow-derived mast cells (BMMCs) secrete functional VEGF but do not degranulate after Cobalt chloride-induced hypoxia. {yields} CoCl{sub 2}-induced VEGF secretion in mast cells occurs by a Ca{sup 2+}-insensitive but brefeldin A and Tetanus toxin-sensitive mechanism. {yields} Trolox and N-acetylcysteine inhibit hypoxia-induced VEGF secretion but only Trolox inhibits Fc{epsilon}RI-dependent anaphylactic degranulation in mast cells. {yields} Src family kinase Fyn activation after free radical production is necessary for hypoxia-induced VEGF secretion in mast cells. -- Abstract: Mast cells (MC) have an important role in pathologic conditions such as asthma and chronic obstructive pulmonary disease (COPD), where hypoxia conduce to deleterious inflammatory response. MC contribute to hypoxia-induced angiogenesis producing factors such as vascular endothelial growth factor (VEGF), but the mechanisms behind the control of hypoxia-induced VEGF secretion in this cell type is poorly understood. We used the hypoxia-mimicking agent cobalt chloride (CoCl{sub 2}) to analyze VEGF secretion in murine bone marrow-derived mast cells (BMMCs). We found that CoCl{sub 2} promotes a sustained production of functional VEGF, able to induce proliferation of endothelial cells in vitro. CoCl{sub 2}-induced VEGF secretion was independent of calcium rise but dependent on tetanus toxin-sensitive vesicle-associated membrane proteins (VAMPs). VEGF exocytosis required free radicals formation and the activation of Src family kinases. Interestingly, an important deficiency on CoCl{sub 2}-induced VEGF secretion was observed in Fyn kinase-deficient BMMCs. Moreover, Fyn kinase was activated by CoCl{sub 2} in WT cells and this activation was prevented by treatment with antioxidants such as Trolox and N-acetylcysteine. Our results show that BMMCs are able to release VEGF under hypoxic conditions through a tetanus toxin-sensitive mechanism, promoted by free radicals

  4. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  5. A novel homolog of protein tyrosine kinase Fyn identified in Lampetra japonica with roles in the immune response.

    PubMed

    Zhang, Qiong; Song, Xueying; Su, Peng; Li, Ranran; Liu, Chang; Gou, Meng; Wang, Hao; Liu, Xin; Li, Qingwei

    2016-04-01

    The non-receptor protein tyrosine kinase (nrPTK) Fyn, a member of the avian sarcoma virus transforming gene (Src) kinase family, plays a very significant role in cell growth, survival, apoptosis, tumor formation and immune response. In this study, a homolog of nrPTK Fyn was identified for the first time in the lamprey, Lampetra japonica and was named "Lja-Fyn". The cDNA fragment of lamprey lja-fyn contains a 1611-bp open reading frame, which encodes a protein of 537 amino acids. Multiple sequence alignment analysis showed that it shares four conserved domains (Src homology (SH) 4, SH3, SH2 and protein kinases catalytic domains) and a variable unique domain with vertebrates Fyn molecules. Though Lja-Fyn has high sequence similarity with typical Fyn and Yes molecules of jawed vertebrates, the identities among Lja-Fyn and typical Fyn molecules in unique domain are relatively higher than that among Lja-Fyn and typical Yes molecules. The result indicates that Lja-Fyn is a homolog of Fyn rather than Yes. The phylogenetic analysis showed that Fyn, Yes and Src molecules are grouped into three distinct phylogenetic clusters, and Lja-Fyn is grouped as a single branch in Fyn cluster. The real-time quantitative PCR assay revealed the wide distribution of the lja-fyn mRNA in lamprey immune related tissues. After stimulation with mixed antigens, the levels of lja-fyn mRNA were obviously up-regulated in the gill and lymphocyte-like cells, and the similar results were got by western blot analysis of Lja-Fyn protein expression. These results indicated that nrPTK Lja-Fyn was likely to be involved in immune response. Furthermore, our present findings also provide the necessary information for understanding the distinction between lamprey Lja-Fyn and other members of jawed vertebrates in Src family. PMID:26743129

  6. Neuroblastoma Tyrosine Kinase Signaling Networks Involve FYN and LYN in Endosomes and Lipid Rafts

    PubMed Central

    Guo, Ailan; Stokes, Matthew P.; Kuehn, Emily D.; George, Lynn; Comb, Michael; Grimes, Mark L.

    2015-01-01

    Protein phosphorylation plays a central role in creating a highly dynamic network of interacting proteins that reads and responds to signals from growth factors in the cellular microenvironment. Cells of the neural crest employ multiple signaling mechanisms to control migration and differentiation during development. It is known that defects in these mechanisms cause neuroblastoma, but how multiple signaling pathways interact to govern cell behavior is unknown. In a phosphoproteomic study of neuroblastoma cell lines and cell fractions, including endosomes and detergent-resistant membranes, 1622 phosphorylated proteins were detected, including more than half of the receptor tyrosine kinases in the human genome. Data were analyzed using a combination of graph theory and pattern recognition techniques that resolve data structure into networks that incorporate statistical relationships and protein-protein interaction data. Clusters of proteins in these networks are indicative of functional signaling pathways. The analysis indicates that receptor tyrosine kinases are functionally compartmentalized into distinct collaborative groups distinguished by activation and intracellular localization of SRC-family kinases, especially FYN and LYN. Changes in intracellular localization of activated FYN and LYN were observed in response to stimulation of the receptor tyrosine kinases, ALK and KIT. The results suggest a mechanism to distinguish signaling responses to activation of different receptors, or combinations of receptors, that govern the behavior of the neural crest, which gives rise to neuroblastoma. PMID:25884760

  7. Immune Regulatory Mechanisms in Allergic Conjunctivitis

    PubMed Central

    Niederkorn, Jerry Y.

    2008-01-01

    Purpose of review This review highlights recent findings regarding the immune regulation of allergic conjunctivitis (AC). Mouse models have facilitated prospective studies that have not been possible in patients. The availability of gene knockout mice and the wealth of monoclonal antibodies have permitted exquisite dissection of the pathophysiology and immune regulation of AC. Recent findings New insights have emerged in three areas: a) role of costimulatory molecules in the induction of Th2 immune responses; b) crucial role of interferon-γ (IFN-γ) in the expression of AC; and c) the function of T regulatory cells in shaping conjunctival inflammation once the immune response has been initiated. Summary Allergic conjunctivitis involves early phase and late phase reactions. The early phase reaction (EPR) is IgE antibody-dependent, while the late phase reaction (LPR) is IgE-independent and is mediated by inflammatory cells, especially eosinophils. Recent studies in mouse models of AC have provided important insights into the immune regulation of both the EPR and LPR of AC. Mounting evidence suggests that IFN-γ is crucial for optimum expression of AC. Costimulatory molecules influence the induction of Th2 immune responses and the EPR while regulatory T cells shape the expression of the LPR of AC. PMID:18769204

  8. FYN expression potentiates FLT3-ITD induced STAT5 signaling in acute myeloid leukemia

    PubMed Central

    Chougule, Rohit A.; Kazi, Julhash U.; Rönnstrand, Lars

    2016-01-01

    FYN is a non-receptor tyrosine kinase belonging to the SRC family of kinases, which are frequently over-expressed in human cancers, and play key roles in cancer biology. SRC has long been recognized as an important oncogene, but little attention has been given to its other family members. In this report, we have studied the role of FYN in FLT3 signaling in respect to acute myeloid leukemia (AML). We observed that FYN displays a strong association with wild-type FLT3 as well as oncogenic FLT3-ITD and is dependent on the kinase activity of FLT3 and the SH2 domain of FYN. We identified multiple FYN binding sites in FLT3, which partially overlapped with SRC binding sites. To understand the role of FYN in FLT3 signaling, we generated FYN overexpressing cells. We observed that expression of FYN resulted in slightly enhanced phosphorylation of AKT, ERK1/2 and p38 in response to ligand stimulation. Furthermore, FYN expression led to a slight increase in FLT3-ITD-dependent cell proliferation, but potent enhancement of STAT5 phosphorylation as well as colony formation. We also observed that FYN expression is deregulated in AML patient samples and that higher expression of FYN, in combination with FLT3-ITD mutation, resulted in enrichment of the STAT5 signaling pathway and correlated with poor prognosis in AML. Taken together our data suggest that FYN cooperates with oncogenic FLT3-ITD in cellular transformation by selective activation of the STAT5 pathway. Therefore, inhibition of FYN, in combination with FLT3 inhibition, will most likely be beneficial for this group of AML patients. PMID:26848862

  9. FYN expression potentiates FLT3-ITD induced STAT5 signaling in acute myeloid leukemia.

    PubMed

    Chougule, Rohit A; Kazi, Julhash U; Rönnstrand, Lars

    2016-03-01

    FYN is a non-receptor tyrosine kinase belonging to the SRC family of kinases, which are frequently over-expressed in human cancers, and play key roles in cancer biology. SRC has long been recognized as an important oncogene, but little attention has been given to its other family members. In this report, we have studied the role of FYN in FLT3 signaling in respect to acute myeloid leukemia (AML). We observed that FYN displays a strong association with wild-type FLT3 as well as oncogenic FLT3-ITD and is dependent on the kinase activity of FLT3 and the SH2 domain of FYN. We identified multiple FYN binding sites in FLT3, which partially overlapped with SRC binding sites. To understand the role of FYN in FLT3 signaling, we generated FYN overexpressing cells. We observed that expression of FYN resulted in slightly enhanced phosphorylation of AKT, ERK1/2 and p38 in response to ligand stimulation. Furthermore, FYN expression led to a slight increase in FLT3-ITD-dependent cell proliferation, but potent enhancement of STAT5 phosphorylation as well as colony formation. We also observed that FYN expression is deregulated in AML patient samples and that higher expression of FYN, in combination with FLT3-ITD mutation, resulted in enrichment of the STAT5 signaling pathway and correlated with poor prognosis in AML. Taken together our data suggest that FYN cooperates with oncogenic FLT3-ITD in cellular transformation by selective activation of the STAT5 pathway. Therefore, inhibition of FYN, in combination with FLT3 inhibition, will most likely be beneficial for this group of AML patients. PMID:26848862

  10. Premature lethality, hyperactivity, and aberrant phosphorylation in transgenic mice expressing a constitutively active form of Fyn

    PubMed Central

    Xia, Di; Götz, Jürgen

    2014-01-01

    The kinase Fyn, the microtubule-associated protein tau and the peptide amyloid-β (Aβ) constitute a toxic triad in Alzheimer's disease (AD). Tau's subcellular localization is mainly regulated by phosphorylation whereas Fyn's localization is dictated by palmitoylation targeting it to the plasma membrane in a reversible manner. We have previously shown that tau is required for Fyn to be targeted to the dendritic spine. We had also shown that a truncated form of tau (Δtau) that accumulates in the cell soma is capable of trapping Fyn and preventing it from entering the spine. Here we determined that palmitoylation is required for Fyn's membrane and spine localization. We further evaluated the functional consequences of neuronal over-expression of the constitutively active Y531F mutant form of Fyn (FynCA) in transgenic mice. We found that the FynCA transgenic mice displayed a reduced weight, a massively reduced lifespan and a high level of hyperactivity. The lifespan of the FynCA mice was only slightly extended by crossing them with Δtau transgenic mice, possibly reflecting differences in expression patterns of the transgenes and high levels of transgenic FynCA compared to endogenous Fyn. Analysis of synaptosomes revealed that FynCA accumulated at high levels in the spine, resulting in increased levels of the NMDA receptor subunit NR2b phosphorylated at residue Y1472. Tau was strongly phosphorylated at the AT8 epitope S202/T205 as shown by Western blot and immunohistochemistry indicating that an increased tyrosine kinase activity of Fyn has down-stream consequences for serine/threonine-directed phosphorylation. PMID:24860422

  11. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  12. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  13. Nitrogen fixation: key genetic regulatory mechanisms.

    PubMed

    Martinez-Argudo, I; Little, R; Shearer, N; Johnson, P; Dixon, R

    2005-02-01

    The necessity to respond to the level of fixed nitrogen and external oxygen concentrations and to provide sufficient energy for nitrogen fixation imposes common regulatory principles amongst diazotrophs. The NifL-NifA system in Azotobacter vinelandii integrates the signals of redox, fixed-nitrogen and carbon status to regulate nif transcription. Multidomain signalling interactions between NifL and NifA are modulated by redox changes, ligand binding and interaction with the signal-transduction protein GlnK. Under adverse redox conditions (excess oxygen) or when fixed nitrogen is in excess, NifL forms a complex with NifA in which transcriptional activation is prevented. Oxidized NifL forms a binary complex with NifA to inhibit NifA activity. When fixed nitrogen is in excess, the non-covalently modified form of GlnK interacts with NifL to promote the formation of a GlnK-NifL-NifA ternary complex. When the cell re-encounters favourable conditions for nitrogen fixation, it is necessary to deactivate the signals to ensure that the NifL-NifA complex is dissociated so that NifA is free to activate transcription. This is achieved through interactions with 2-oxoglutarate, a key metabolic signal of the carbon status, which binds to the N-terminal GAF (cGMP-specific and stimulated phosphodiesterases, Anabaena adenylate cyclases and Escherichia coli FhlA) domain of NifA. PMID:15667291

  14. Molecular regulatory mechanism of tooth root development

    PubMed Central

    Huang, Xiao-Feng; Chai, Yang

    2012-01-01

    The root is crucial for the physiological function of the tooth, and a healthy root allows an artificial crown to function as required clinically. Tooth crown development has been studied intensively during the last few decades, but root development remains not well understood. Here we review the root development processes, including cell fate determination, induction of odontoblast and cementoblast differentiation, interaction of root epithelium and mesenchyme, and other molecular mechanisms. This review summarizes our current understanding of the signaling cascades and mechanisms involved in root development. It also sets the stage for de novo tooth regeneration. PMID:23222990

  15. The SH2 domain is crucial for function of Fyn in neuronal migration and cortical lamination

    PubMed Central

    Lu, Xi; Hu, Xinde; Song, Lingzhen; An, Lei; Duan, Minghui; Chen, Shulin; Zhao, Shanting

    2015-01-01

    Neurons in the developing brain form the cortical plate (CP) in an inside-out manner, in which the late-born neurons are located more superficially than the early-born neurons. Fyn, a member of the Src family kinases, plays an important role in neuronal migration by binding to many substrates. However, the role of the Src-homology 2 (SH2) domain in function of Fyn in neuronal migration remains poorly understood. Here, we demonstrate that the SH2 domain is essential for the action of Fyn in neuronal migration and cortical lamination. A point mutation in the Fyn SH2 domain (FynR176A) impaired neuronal migration and their final location in the cerebral cortex, by inducing neuronal aggregation and branching. Thus, we provide the first evidence of the Fyn SH2 domain contributing to neuronal migration and neuronal morphogenesis. [BMB Reports 2015; 48(2): 97-102] PMID:24912779

  16. Regulation of Multicellular Spheroids by MAPK and FYN Kinase.

    PubMed

    Lee, Casey; Ramos, Daniel M

    2016-08-01

    Understanding of the biology of oral squamous cell carcinoma (SCC) has not progressed significantly in the past 60 years, with 5-year survival remaining at approximately 50%. The epidemic of Human Papilloma Virus and its associated SCC warrants a renewed emphasis on fully understanding this disease. We previously used the 3-dimensional multicellular spheroid (MCS) model system to evaluate SCC behavior more accurately. In this study, we determined that SCC growth in MCS approximates epithelial to mesenchymal transition. Organization of an MCS requires the full-length β6 integrin subunit and its maintenance requires mitogen-activated protein kinase (MAPK). Limiting FYN kinase activation results in the down-regulation of E-cadherin, β-catenin and an increase in expression of N-cadherin and SNAIL. These results indicate that the microenvironment and growth patterns in an MCS are complex and require MAPK and FYN kinase. PMID:27466485

  17. [Regulatory mechanism of circulating inorganic phosphate].

    PubMed

    Michigami, Toshimi

    2016-02-01

    Circulating level of phosphate is altered by age and diet, and is also controlled by several hormones such as parathyroid hormone(PTH), 1,25-dihydroxyvitamin D[1,25(OH)2D]and fibroblast growth factor 23(FGF23). The main function of PTH and 1,25(OH)2D is maintaining calcium homeostasis, while FGF23 plays a central role in phosphate metabolism. PTH suppresses phosphate reabsorption in the proximal tubules to increase the renal phosphate wasting, while 1,25(OH)2D facilitates the intestinal phosphate absorption. FGF23 increases the renal phosphate wasting and reduces the production of 1,25(OH)2D. Of note, these hormones mutually regulate one another. The production of FGF23 is also regulated by various local factors. The mechanism for sensing the phosphate availability still remains unknown, and further investigation is required. PMID:26813498

  18. Phytochemical regulation of Fyn and AMPK signaling circuitry.

    PubMed

    Lee, Chan Gyu; Koo, Ja Hyun; Kim, Sang Geon

    2015-12-01

    During the past decades, phytochemical terpenoids, polyphenols, lignans, flavonoids, and alkaloids have been identified as antioxidative and cytoprotective agents. Adenosine monophosphate-activated protein kinase (AMPK) is a kinase that controls redox-state and oxidative stress in the cell, and serves as a key molecule regulating energy metabolism. Many phytochemicals directly or indirectly alter the AMPK pathway in distinct manners, exerting catabolic metabolism. Some of them are considered promising in the treatment of metabolic diseases such as type II diabetes, obesity, and hyperlipidemia. Another important kinase that regulates energy metabolism is Fyn kinase, a member of the Src family kinases that plays a role in various cellular responses such as insulin signaling, cell growth, oxidative stress and apoptosis. Phytochemical inhibition of Fyn leads to AMPK-mediated protection of the cell in association with increased antioxidative capacity and mitochondrial biogenesis. The kinases may work together to form a signaling circuitry for the homeostasis of energy conservation and expenditure, and may serve as targets of phytochemicals. This review is intended as a compilation of recent advancements in the pharmacological research of phytochemicals targeting Fyn and AMPK circuitry, providing information for the prevention and treatment of metabolic diseases and the accompanying tissue injuries. PMID:25951818

  19. Subversion of cell cycle regulatory mechanisms by HIV

    PubMed Central

    Rice, Andrew P.; Kimata, Jason T.

    2015-01-01

    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular process towards viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein utilizes Cyclin T1 to activated proviral transcription, and regulation of Cyclin T1 levels in CD4+ T cells has important consequences for viral replication and latency. This review will summarize this emerging evidence that primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to enhance replication. PMID:26067601

  20. SRC family kinase FYN promotes the neuroendocrine phenotype and visceral metastasis in advanced prostate cancer

    PubMed Central

    Sievert, Margarit; Duan, Peng; Lichterman, Jake; Huang, Jen-Ming; Smith, Bethany; You, Sungyong; Nandana, Srinivas; Chu, Gina Chia-Yi; Mink, Sheldon; Josson, Sajni; Liu, Chunyan; Morello, Matteo; Jones, Lawrence W. M.; Kim, Jayoung; Freeman, Michael R.; Bhowmick, Neil; Zhau, Haiyen E.; Chung, Leland W.K.; Posadas, Edwin M.

    2015-01-01

    FYN is a SRC family kinase (SFK) that has been shown to be up-regulated in human prostate cancer (PCa) tissues and cell lines. In this study, we observed that FYN is strongly up-regulated in human neuroendocrine PCa (NEPC) tissues and xenografts, as well as cells derived from a NEPC transgenic mouse model. In silico analysis of FYN expression in prostate cancer cell line databases revealed an association with the expression of neuroendocrine (NE) markers such as CHGA, CD44, CD56, and SYP. The loss of FYN abrogated the invasion of PC3 and ARCaPM cells in response to MET receptor ligand HGF. FYN also contributed to the metastatic potential of NEPC cells in two mouse models of visceral metastasis with two different cell lines (PC3 and TRAMPC2-RANKL). The activation of MET appeared to regulate neuroendocrine (NE) features as evidenced by increased expression of NE markers in PC3 cells with HGF. Importantly, the overexpression of FYN protein in DU145 cells was directly correlated with the increase of CHGA. Thus, our data demonstrated that the neuroendocrine differentiation that occurs in PCa cells is, at least in part, regulated by FYN kinase. Understanding the role of FYN in the regulation of NE markers will provide further support for ongoing clinical trials of SFK and MET inhibitors in castration-resistant PCa patients. PMID:26624980

  1. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  2. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  3. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes.

    PubMed

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-08-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  4. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  5. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  6. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.

    2012-01-01

    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  7. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  8. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  9. Data supporting the role of Fyn in initiating myelination in the peripheral nervous system.

    PubMed

    Miyamoto, Yuki; Tamano, Moe; Torii, Tomohiro; Kawahara, Kazuko; Nakamura, Kazuaki; Tanoue, Akito; Takada, Shuji; Yamauchi, Junji

    2016-06-01

    Transgenic mice, which express active Fyn tyrosine kinase under the control of a glial fibrillary acidic protein promoter, have been produced. This promoter induces protein expression in the initiation stage of myelination in the peripheral nervous system (PNS) "Phosphorylation of cytohesin-1 by Fyn is required for initiation of myelination and the extent of myelination during development (Yamauchi et al., 2015 [1])". Herein we provide the data regarding myelination-related protein markers and myelin ultrastructure in transgenic mice. PMID:27115022

  10. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  11. The prion hypothesis: from biological anomaly to basic regulatory mechanism

    PubMed Central

    Tuite, Mick F; Serio, Tricia R

    2010-01-01

    Preface Prions are unusual proteinaceous infectious agents that are typically associated with a class of fatal degenerative diseases of the mammalian brain. However, the discovery of fungal prions, which are not associated with disease, suggests that we must now consider the impact of these factors on basic cellular physiology in a different light. Fungal prions are epigenetic determinants that can alter a range of cellular processes, including metabolism and gene expression pathways, and these changes can lead to a range of prion-associated phenotypes. The mechanistic similarities between prion propagation in mammals and fungi suggest that prions are not a biological anomaly but instead are a new appreciated and perhaps ubiquitous regulatory mechanism. PMID:21081963

  12. Emerging regulatory mechanisms in ubiquitin-dependent cell cycle control

    PubMed Central

    Mocciaro, Annamaria; Rape, Michael

    2012-01-01

    The covalent modification of proteins with ubiquitin is required for accurate cell division in all eukaryotes. Ubiquitylation depends on an enzymatic cascade, in which E3 enzymes recruit specific substrates for modification. Among ~600 human E3s, the SCF (Skp1–cullin1–F-box) and the APC/C (anaphase-promoting complex/cyclosome) are known for driving the degradation of cell cycle regulators to accomplish irreversible cell cycle transitions. The cell cycle machinery reciprocally regulates the SCF and APC/C through various mechanisms, including the modification of these E3s or the binding of specific inhibitors. Recent studies have provided new insight into the intricate relationship between ubiquitylation and the cell division apparatus as they revealed roles for atypical ubiquitin chains, new mechanisms of substrate and E3 regulation, as well as extensive crosstalk between ubiquitylation enzymes. Here, we review these emerging regulatory mechanisms of ubiquitin-dependent cell cycle control and discuss how their manipulation might provide therapeutic benefits in the future. PMID:22357967

  13. Mechanisms of regulatory volume increase in collecting duct cells.

    PubMed

    Fu, W J; Kuwahara, M; Cragoe, E J; Marumo, F

    1993-01-01

    To examine the mechanisms of cell volume regulation in response to hyperosmolality, segments of the inner stripe of rabbit outer medullary collecting duct (OMCDi) were perfused in vitro. The cross-sectional area of the tubule was monitored as an index of the relative cell volume. When luminal and basolateral osmolalities were increased from 290 to 390 mOsm simultaneously, the tubule cell shrank instantaneously and reswelled gradually, showing the so-called regulatory volume increase (RVI). Basolateral Na+ removal and addition of basolateral ethyl isopropyl amiloride (EIPA) decreased the RVI response by 76 and 66%, respectively. By contrast, apical Na+ removal had no effect on this response. RVI response was also inhibited by basolateral, but not luminal, Cl- removal (-63%), by total HCO3- removal (-74%), and by adding basolateral 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) (-62%). Intracellular pH did not change significantly during RVI. Vasopressin increased RVI response by 56%. However, this increase was abolished in the absence of basolateral Na+ and Cl-, and in the presence of basolateral EIPA and DIDS. These results suggest that major mechanisms responsible for RVI are Na(+)-H+ and Cl(-)-HCO3- exchange systems in the basolateral membrane, and that these systems are stimulated by vasopressin in rabbit OMCDi. PMID:8007444

  14. The Src kinase Fyn is protective in acute chemical-induced colitis and promotes recovery from disease.

    PubMed

    Lopes, Fernando; Wang, Arthur; Smyth, David; Reyes, Jose-Luis; Doering, Axinia; Schenck, L Patrick; Beck, Paul; Waterhouse, Christopher; McKay, Derek M

    2015-06-01

    Despite progress in understanding enteric inflammation, current therapies, although effective in many patients with inflammatory bowel disease (IBD), have significant side-effects, and, in many patients, it is refractory to treatment. The Src kinase Fyn mediated IFN-γ-induced increased permeability in model epithelia, and so we hypothesized that inhibition of Fyn kinase would be anti-colitic. Mice [B6.129SF2/J wild-type (WT), Fyn KO, or chimeras] received 2.5% dextran sodium sulfate (DSS) or normal water for 10 d and were necropsied immediately or 3 d later. Gut permeability was assessed by FITC-dextran flux, colitis by macroscopic and histologic parameters, and immune cell status by cytokine production and CD4(+) T cell Foxp3 expression. Fyn KO mice consistently displayed significantly worse DSS-induced disease than WT, correlating with decreased IL-10 and increased IL-17 in splenocytes and the gut; Fyn KO mice failed to thrive after removal of the DSS water. Analysis of chimeric mice indicated that the increased sensitivity to DSS was due to the lack of Fyn kinase in hematopoietic, but not stromal, cells, in accordance with Fyn(+) T cell increases in WT mice exposed to DSS and Fyn KO mice having a reduced number of CD4(+)Foxp3(+) cells in baseline or colitic conditions and a reduced capacity to induce Foxp3 expression in vitro. Other experiments suggest that the colonic microbiota in Fyn KO mice is not preferentially colitogenic. Contrary to our expectation, the absence of Fyn kinase resulted in greater DSS-induced disease, and analysis of chimeric mice indicated that leukocyte Fyn kinase is beneficial in limiting colitis. PMID:25877924

  15. T-cell regulatory mechanisms in specific immunotherapy.

    PubMed

    Jutel, Marek; Akdis, Cezmi A

    2008-01-01

    Allergen-specific immunotherapy (SIT) is the only treatment which leads to a lifelong tolerance against previously disease-causing allergens due to restoration of normal immunity against allergens. The description of T-regulatory (Treg) cells being involved in prevention of sensitization to allergens has led to great interest whether they represent a major target for allergen-SIT and whether it would be possible to manipulate Treg cells to increase its efficacy. Activationinduced cell death, anergy and/or immune response modulation by Treg cells are essential mechanisms of peripheral T-cell tolerance. There is growing evidence that anergy, tolerance and active suppression are not entirely distinct, but rather represent linked mechanisms possibly involving the same cells and multiple suppressor mechanisms. Skewing of allergen-specific effector T cells to Treg cells appears as a crucial event in the control of healthy immune response to allergens and successful allergen-SIT. The Treg cell response is characterized by abolished allergen- induced specific T-cell proliferation and suppressed Thelper (Th)1- and Th2-type cytokine secretion. In addition, mediators of allergic inflammation that trigger cAMP-associated G-protein-coupled receptors, such as histamine receptor-2, may contribute to peripheral tolerance mechanisms. The increased levels of interleukin-10 and transforming growth factor-Beta that are produced by Treg cells potently suppress IgE production, while simultaneously increasing production of non-inflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress effector cells of allergic inflammation such as mast cells, basophils and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms. It is associated with regulation of antibody isotypes and effector cells to the direction of a healthy immune response. By the application of the recent knowledge in Treg

  16. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  17. Role of Fyn-mediated NMDA receptor function in prediabetic neuropathy in mice.

    PubMed

    Suo, Meng; Wang, Ping; Zhang, Mengyuan

    2016-08-01

    Diabetic neuropathy is a common complication of diabetes. This study evaluated the role of Fyn kinase and N-methyl-d-aspartate receptors (NMDARs) in the spinal cord in diabetic neuropathy using an animal model of high-fat diet-induced prediabetes. We found that prediabetic wild-type mice exhibited tactile allodynia and thermal hypoalgesia after a 16-wk high-fat diet, relative to normal diet-fed wild-type mice. Furthermore, prediabetic wild-type mice exhibited increased tactile allodynia and thermal hypoalgesia at 24 wk relative to 16 wk. Such phenomena were correlated with increased expression and activation of NR2B subunit of NMDARs, as well as Fyn-NR2B interaction in the spinal cord. Fyn(-/-) mice developed prediabetes after 16-wk high-fat diet treatment and exhibited thermal hypoalgesia, without showing tactile allodynia or altered expression and activation of NR2B subunit, relative to normal diet-fed Fyn(-/-) mice. Finally, intrathecal administrations of Ro 25-6981 (selective NR2B subunit-containing NMDAR antagonist) dose-dependently alleviated tactile allodynia, but not thermal hypoalgesia, at 16 and 24 wk in prediabetic wild-type mice. Our results suggested that Fyn-mediated NR2B signaling plays a critical role in regulation of prediabetic neuropathy and that the increased expression/function of NR2B subunit-containing NMDARs may contribute to the progression of neuropathy in type 2 diabetes. PMID:27146985

  18. Fyn Mediates High Glucose-Induced Actin Cytoskeleton Reorganization of Podocytes via Promoting ROCK Activation In Vitro.

    PubMed

    Lv, Zhimei; Hu, Mengsi; Ren, Xiaoxu; Fan, Minghua; Zhen, Junhui; Chen, Liqun; Lin, Jiangong; Ding, Nannan; Wang, Qun; Wang, Rong

    2016-01-01

    Fyn, a member of the Src family of tyrosine kinases, is a key regulator in cytoskeletal remodeling in a variety of cell types. Recent studies have demonstrated that Fyn is responsible for nephrin tyrosine phosphorylation, which will result in polymerization of actin filaments and podocyte damage. Thus detailed involvement of Fyn in podocytes is to be elucidated. In this study, we investigated the potential role of Fyn/ROCK signaling and its interactions with paxillin. Our results presented that high glucose led to filamentous actin (F-actin) rearrangement in podocytes, accompanied by paxillin phosphorylation and increased cell motility, during which Fyn and ROCK were markedly activated. Gene knockdown of Fyn by siRNA showed a reversal effect on high glucose-induced podocyte damage and ROCK activation; however, inhibition of ROCK had no significant effects on Fyn phosphorylation. These observations demonstrate that in vitro Fyn mediates high glucose-induced actin cytoskeleton remodeling of podocytes via promoting ROCK activation and paxillin phosphorylation. PMID:26881253

  19. Fyn Mediates High Glucose-Induced Actin Cytoskeleton Reorganization of Podocytes via Promoting ROCK Activation In Vitro

    PubMed Central

    Lv, Zhimei; Hu, Mengsi; Ren, Xiaoxu; Fan, Minghua; Zhen, Junhui; Chen, Liqun; Lin, Jiangong; Ding, Nannan; Wang, Qun; Wang, Rong

    2016-01-01

    Fyn, a member of the Src family of tyrosine kinases, is a key regulator in cytoskeletal remodeling in a variety of cell types. Recent studies have demonstrated that Fyn is responsible for nephrin tyrosine phosphorylation, which will result in polymerization of actin filaments and podocyte damage. Thus detailed involvement of Fyn in podocytes is to be elucidated. In this study, we investigated the potential role of Fyn/ROCK signaling and its interactions with paxillin. Our results presented that high glucose led to filamentous actin (F-actin) rearrangement in podocytes, accompanied by paxillin phosphorylation and increased cell motility, during which Fyn and ROCK were markedly activated. Gene knockdown of Fyn by siRNA showed a reversal effect on high glucose-induced podocyte damage and ROCK activation; however, inhibition of ROCK had no significant effects on Fyn phosphorylation. These observations demonstrate that in vitro Fyn mediates high glucose-induced actin cytoskeleton remodeling of podocytes via promoting ROCK activation and paxillin phosphorylation. PMID:26881253

  20. Fyn kinase genetic ablation causes structural abnormalities in mature retina and defective Müller cell function.

    PubMed

    Chavez-Solano, Marbella; Ibarra-Sanchez, Alfredo; Treviño, Mario; Gonzalez-Espinosa, Claudia; Lamas, Monica

    2016-04-01

    Fyn kinase is widely expressed in neuronal and glial cells of the brain, where it exerts multiple functional roles that affect fundamental physiological processes. The aim of our study was to investigate the, so far unknown, functional role of Fyn in the retina. We report that Fyn is expressed, in vivo, in a subpopulation of Müller glia. We used a mouse model of Fyn genetic ablation and Müller-enriched primary cultures to demonstrate that Fyn deficiency induces morphological alterations in the mature retina, a reduction in the thickness of the outer and inner nuclear layers and alterations in postnatal Müller cell physiology. These include shortening of Müller cell processes, a decrease in cell proliferation, inactivation of the Akt signal transduction pathway, a reduced number of focal adhesions points and decreased adhesion of these cells to the ECM. As abnormalities in Müller cell physiology have been previously associated to a compromised retinal function we evaluated behavioral responses to visual stimulation. Our results associate Fyn deficiency with impaired visual optokinetic responses under scotopic and photopic light conditions. Our study reveals novel roles for Fyn kinase in retinal morphology and Müller cell physiology and suggests that Fyn is required for optimal visual processing. PMID:26808221

  1. Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas.

    PubMed

    Palomero, Teresa; Couronné, Lucile; Khiabanian, Hossein; Kim, Mi-Yeon; Ambesi-Impiombato, Alberto; Perez-Garcia, Arianne; Carpenter, Zachary; Abate, Francesco; Allegretta, Maddalena; Haydu, J Erika; Jiang, Xiaoyu; Lossos, Izidore S; Nicolas, Concha; Balbin, Milagros; Bastard, Christian; Bhagat, Govind; Piris, Miguel A; Campo, Elias; Bernard, Olivier A; Rabadan, Raul; Ferrando, Adolfo A

    2014-02-01

    Peripheral T cell lymphomas (PTCLs) are a heterogeneous and poorly understood group of non-Hodgkin lymphomas. Here we combined whole-exome sequencing of 12 tumor-normal DNA pairs, RNA sequencing analysis and targeted deep sequencing to identify new genetic alterations in PTCL transformation. These analyses identified highly recurrent epigenetic factor mutations in TET2, DNMT3A and IDH2 as well as a new highly prevalent RHOA mutation encoding a p.Gly17Val alteration present in 22 of 35 (67%) angioimmunoblastic T cell lymphoma (AITL) samples and in 8 of 44 (18%) PTCL, not otherwise specified (PTCL-NOS) samples. Mechanistically, the RHOA Gly17Val protein interferes with RHOA signaling in biochemical and cellular assays, an effect potentially mediated by the sequestration of activated guanine-exchange factor (GEF) proteins. In addition, we describe new and recurrent, albeit less frequent, genetic defects including mutations in FYN, ATM, B2M and CD58 implicating SRC signaling, impaired DNA damage response and escape from immune surveillance mechanisms in the pathogenesis of PTCL. PMID:24413734

  2. Alteration of de novo glucose production contributes to fasting hypoglycaemia in Fyn deficient mice.

    PubMed

    Yang, Yingjuan; Tarabra, Elena; Yang, Gong-She; Vaitheesvaran, Bhavapriya; Palacios, Gustavo; Kurland, Irwin J; Pessin, Jeffrey E; Bastie, Claire C

    2013-01-01

    Previous studies have demonstrated that glucose disposal is increased in the Fyn knockout (FynKO) mice due to increased insulin sensitivity. FynKO mice also display fasting hypoglycaemia despite decreased insulin levels, which suggested that hepatic glucose production was unable to compensate for the increased basal glucose utilization. The present study investigates the basis for the reduction in plasma glucose levels and the reduced ability for the liver to produce glucose in response to gluconeogenic substrates. FynKO mice had a 5-fold reduction in phosphoenolpyruvate carboxykinase (PEPCK) gene and protein expression and a marked reduction in pyruvate, pyruvate/lactate-stimulated glucose output. Remarkably, de novo glucose production was also blunted using gluconeogenic substrates that bypass the PEPCK step. Impaired conversion of glycerol to glucose was observed in both glycerol tolerance test and determination of the conversion of (13)C-glycerol to glucose in the fasted state. α-glycerol phosphate levels were reduced but glycerol kinase protein expression levels were not changed. Fructose-driven glucose production was also diminished without alteration of fructokinase expression levels. The normal levels of dihydroxyacetone phosphate and glyceraldehyde-3-phosphate observed in the FynKO liver extracts suggested normal triose kinase function. Fructose-bisphosphate aldolase (aldolase) mRNA or protein levels were normal in the Fyn-deficient livers, however, there was a large reduction in liver fructose-6-phosphate (30-fold) and fructose-1,6-bisphosphate (7-fold) levels as well as a reduction in glucose-6-phosphate (2-fold) levels. These data suggest a mechanistic defect in the allosteric regulation of aldolase activity. PMID:24312371

  3. Data supporting the role of Fyn in initiating myelination in the peripheral nervous system

    PubMed Central

    Miyamoto, Yuki; Tamano, Moe; Torii, Tomohiro; Kawahara, Kazuko; Nakamura, Kazuaki; Tanoue, Akito; Takada, Shuji; Yamauchi, Junji

    2016-01-01

    Transgenic mice, which express active Fyn tyrosine kinase under the control of a glial fibrillary acidic protein promoter, have been produced. This promoter induces protein expression in the initiation stage of myelination in the peripheral nervous system (PNS) “Phosphorylation of cytohesin-1 by Fyn is required for initiation of myelination and the extent of myelination during development (Yamauchi et al., 2015 [1])”. Herein we provide the data regarding myelination-related protein markers and myelin ultrastructure in transgenic mice. PMID:27115022

  4. Fyn Activation of mTORC1 Stimulates the IRE1α-JNK Pathway, Leading to Cell Death.

    PubMed

    Wang, Yichen; Yamada, Eijiro; Zong, Haihong; Pessin, Jeffrey E

    2015-10-01

    We previously reported that the skeletal muscle-specific overexpression of Fyn in mice resulted in a severe muscle wasting phenotype despite the activation of mTORC1 signaling. To investigate the bases for the loss of muscle fiber mass, we examined the relationship between Fyn activation of mTORC1, JNK, and endoplasmic reticulum stress. Overexpression of Fyn in skeletal muscle in vivo and in HEK293T cells in culture resulted in the activation of IRE1α and JNK, leading to increased cell death. Fyn synergized with the general endoplasmic reticulum stress inducer thapsigargin, resulting in the activation of IRE1α and further accelerated cell death. Moreover, inhibition of mTORC1 with rapamycin suppressed IRE1α activation and JNK phosphorylation, resulting in protecting cells against Fyn- and thapsigargin-induced cell death. Moreover, rapamycin treatment in vivo reduced the skeletal muscle IRE1α activation in the Fyn-overexpressing transgenic mice. Together, these data demonstrate the presence of a Fyn-induced endoplasmic reticulum stress that occurred, at least in part, through the activation of mTORC1, as well as subsequent activation of the IRE1α-JNK pathway driving cell death. PMID:26306048

  5. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  6. Arrestin-3 is essential for the activation of Fyn by the luteinizing hormone receptor (LHR) in MA-10 cells*

    PubMed Central

    Galet, Colette; Ascoli, Mario

    2008-01-01

    Recent studies showed that Fyn is a mediator of the LHR-induced activation of the ERK1/2 cascade in MA-10 cells. Since the LHR is a G protein-coupled receptor and the Src family of kinases can be activated by some Gα subunits and by the non-visual arrestins we investigated the role of these signaling molecules in the LHR-provoked activation of Fyn. Small interfering RNAs (siRNAs) that target two Gα subunits that participate in LHR signaling (Gαs and Gα11) and one that targets arrestin-3 were co-transfected with the hLHR in MA-10 cells. We then determined the effects of these siRNAs on the LHR-provoked activation of Fyn, the phosphorylation of FAK (a prominent Fyn substrate) and the release of EGF-like growth factors (a Fyn-mediated process). Expression of the siRNA against Gαs decreased the level of Gαs and LHR-stimulated cAMP production by ~50% but did not affect LHR-stimulated Fyn activation or FAK phosphorylation. Likewise, expression of the siRNA against Gα11 decreased the level of Gα11 and LHR-stimulated inositol phosphate production by ~50% but did not affect LHR-stimulated Fyn activation or FAK phosphorylation. Expression of the siRNA against arrestin-3 decreased the level of arrestin-3 and the rate of internalization of hCG by ~50% and it also inhibited the LHR-provoked stimulation of Fyn, the phosphorylation of FAK and the release of EGF-like growth factors. These results show that, in MA-10 cells, the hLHR activates Fyn through and arrestin-3-dependent pathway and that this pathway is a mediator of the hLHR-provoked release of EGF-like growth factors. PMID:18647647

  7. Regulation of natural cytotoxicity by the adaptor SAP and the Src-related kinase Fyn

    PubMed Central

    Bloch-Queyrat, Coralie; Fondanèche, Marie-Claude; Chen, Riyan; Yin, Luo; Relouzat, Francis; Veillette, André; Fischer, Alain; Latour, Sylvain

    2005-01-01

    SAP is an adaptor protein that is expressed in NK and T cells. It is mutated in humans who have X-linked lymphoproliferative (XLP) disease. By interacting with SLAM family receptors, SAP enables tyrosine phosphorylation signaling of these receptors by its ability to recruit the Src-related kinase, Fyn. Here, we analyzed the role of SAP in NK cell functions using the SAP-deficient mouse model. Our results showed that SAP was required for the ability of NK cells to eliminate tumor cells in vitro and in vivo. This effect strongly correlated with expression of CD48 on tumor cells, the ligand of 2B4, a SLAM-related receptor expressed in NK cells. In keeping with earlier reports that studied human NK cells, we showed that SAP was necessary for the ability of 2B4 to trigger cytotoxicity and IFN-γ secretion. In the absence of SAP, 2B4 function was shifted toward inhibition of NK cell–mediated cytotoxicity. By analyzing mice lacking Fyn, we showed that similarly to SAP, Fyn was strictly required for 2B4 function. Taken together, these results provide evidence that the 2B4-SAP-Fyn cascade defines a potent activating pathway of natural cytotoxicity. They also could help to explain the high propensity of patients who have XLP disease to develop lymphoproliferative disorders. PMID:15998796

  8. Brain-derived neurotrophic factor rapidly increases NMDA receptor channel activity through Fyn-mediated phosphorylation.

    PubMed

    Xu, Fei; Plummer, Mark R; Len, Guo-Wei; Nakazawa, Takanobu; Yamamoto, Tadashi; Black, Ira B; Wu, Kuo

    2006-11-22

    Brain-derived neurotrophic factor (BDNF) is a potent modulator of hippocampal synaptic plasticity. Previously, we found that one of the targets of BDNF modulation is NR2B-containing NMDA receptors. Furthermore, exposure to the trophin rapidly increases NMDA receptor activity and enhances tyrosine phosphorylation of NR2B in cortical and hippocampal postsynaptic densities (PSDs), potentially linking receptor phosphorylation to synaptic plasticity. To define the specific NR2B residue(s) regulated by BDNF, we focused on tyrosine 1472, phosphorylation of which increases after LTP. BDNF rapidly increased phosphorylation in cortical PSDs. The tyrosine kinase Fyn is critical since BDNF-dependent phosphorylation was abolished in Fyn knockout mice. Single-channel patch clamp recordings showed that Fyn is required for the increase in NMDA receptor activity elicited by BDNF. Collectively, our results suggest that BDNF enhances phosphorylation of NR2B tyrosine 1472 through activation of Fyn, leading to alteration of NMDA receptor activity and increased synaptic transmission. PMID:17045972

  9. Arsenic interferes with the signaling transduction pathway of T cell receptor activation by increasing basal and induced phosphorylation of Lck and Fyn in spleen cells

    SciTech Connect

    Soto-Pena, Gerson A.; Vega, Libia

    2008-07-15

    Arsenic is known to produce inhibition as well as induction of immune cells proliferative responses depending on the doses as one of its mechanisms of immunotoxicity. Here we evaluate the effect of arsenic exposure on the activation of splenic mononuclear cells (SMC) in male CD57BL6N mice. Intra-gastric exposure to arsenic (as sodium arsenite) for 30 days (1, 0.1, or 0.01 mg/kg/day), reduced the proportion of CD4+ cells and the CD4+/CD8+ ratio in the spleen, increasing the proportion of CD11b+ cells. Arsenic exposure did not modify the proportion of B cells. SMC showed an increased level of phosphorylation of lck and fyn kinases (first kinases associated to TCR complex when activated). Although normal levels of apoptosis were observed on freshly isolated SMC, an increase in apoptotic cells related with the increase in phosphorylation of lck and fyn was observed when SMC were activated with Concanavalin-A (Con-A). Arsenic exposure reduced the proliferative response of SMC to Con-A, and also reduced secretion of IL-2, IL-6, IL-12 and IFN{gamma}. No effect was observed on IL-4, and IL-10 secretion. The same effects were observed when SMC of exposed animals were activated with anti-CD3/CD28 antibodies for 24 h, but these effects were transitory since a recovery, up to control levels or even higher, were observed after 72 h of stimulation. This study demonstrates that repeated and prolonged exposure to arsenic alters cell populations and produces functional changes depending on the specific activation pathway, and could be related with the phosphorylation status of lck and fyn kinases.

  10. Role of Fyn kinase in signaling associated with epiboly during zebrafish development.

    PubMed

    Sharma, Dipika; Holets, Lesya; Zhang, Xiaoming; Kinsey, William H

    2005-09-15

    The function of Fyn kinase during zebrafish development through the blastula stage was investigated through the use of dominant-negative constructs designed to suppress the function of zebrafish c-Fyn. Microinjection of SH2 domain-containing fusion protein or mRNA encoding the mutated, catalytically inactive Fyn at 45 min post-insemination had no significant effect during cleavage and did not inhibit formation of the yolk syncitial layer. Smoothing of the enveloping cell layer at the midblastula transition occurred normally and expression of bon/mixer and mezzo, zygotic transcription factors indicated that activation of the zygotic genome did occur. Signaling pathways involved with axis determination such as beta-catenin, activin, and nodal appeared to function normally as evidenced by expression of boz, goosecoid, and mezzo. However, while formation of the yolk syncitial layer was normal, the marginal blastomeres failed to migrate toward the vegetal pole and epiboly did not occur, a phenotype similar but distinct from that resulting from suppression of c-Yes kinase. The block to development was prevented by co-injection of c-Fyn mRNA with the dominant-negative construct indicating that it was a specific effect. Injection of the dominant-negative mRNA into individual blastomeres indicated that the effect was exerted on the intrinsic ability of the individual blastomeres to respond to signals directing epiboly and not on the signals themselves. Analysis of the pattern of calcium signaling in experimental and control embryos demonstrated that the elevated [Ca2+]i characteristic of the marginal blastomeres was suppressed. Together, these observations indicate that Fyn kinase plays an important role in epiboly, possibly through its effects in calcium signaling. PMID:16112104

  11. DMBA induces tyrosine phosphorylation of PLC-[gamma]1 and activates the tyrosine kinases lck and fyn in the HPB-ALL human T-cell line

    SciTech Connect

    Archuleta, M.M.; Schieven, G.L.; Ledbetter, J.A.; Burchiel, S.W. . Coll. of Pharmacy)

    1993-01-01

    Previous studies in this laboratory have demonstrated that DMBA alters biochemical events associated with lymphocyte activation including formation of the second messenger IP[sub 3] and the release of intracellular Ca[sup 2+]. The purpose of the present studies was to evaluate the mechanisms by which DMBA induces IP[sub 3] formation and Ca[sup 2+] release by examining phosphorylation of membrane associated proteins and activation of protein tyrosine kinases lck and fyn. These studies demonstrated that exposure of HPB-ALL cells to 10[mu]M DMBA resulted in a time- and dose-dependent increase in tyrosine phosphorylation of PLC-[gamma]1 that correlated with our earlier findings of IP[sub 3] formation and Ca[sup 2+] release. These results indicate that the effects of DMBA on the PI-PLC signaling pathway are in part, the result of DMBA-induced tyrosine phosphorylation of the PLC-[gamma]1 enzyme. The mechanism of DMBA- induced tyrosine phosphorylation of PLC-[gamma]1 may be due to activation of fyn or lck kinase activity, since it was found that DMBA increased the activity of these PTKs by more than 2-fold. Therefore, these studies demonstrate that DMBA may disrupt T cell activation by stimulating PTK activation with concomitant tyrosine phosphorylation of PLC-[gamma]1, release of IP[sub 3], and mobilization of intracellular Ca[sup 2+].

  12. DMBA induces tyrosine phosphorylation of PLC-{gamma}1 and activates the tyrosine kinases lck and fyn in the HPB-ALL human T-cell line

    SciTech Connect

    Archuleta, M.M.; Schieven, G.L.; Ledbetter, J.A.; Burchiel, S.W.

    1993-02-01

    Previous studies in this laboratory have demonstrated that DMBA alters biochemical events associated with lymphocyte activation including formation of the second messenger IP{sub 3} and the release of intracellular Ca{sup 2+}. The purpose of the present studies was to evaluate the mechanisms by which DMBA induces IP{sub 3} formation and Ca{sup 2+} release by examining phosphorylation of membrane associated proteins and activation of protein tyrosine kinases lck and fyn. These studies demonstrated that exposure of HPB-ALL cells to 10{mu}M DMBA resulted in a time- and dose-dependent increase in tyrosine phosphorylation of PLC-{gamma}1 that correlated with our earlier findings of IP{sub 3} formation and Ca{sup 2+} release. These results indicate that the effects of DMBA on the PI-PLC signaling pathway are in part, the result of DMBA-induced tyrosine phosphorylation of the PLC-{gamma}1 enzyme. The mechanism of DMBA- induced tyrosine phosphorylation of PLC-{gamma}1 may be due to activation of fyn or lck kinase activity, since it was found that DMBA increased the activity of these PTKs by more than 2-fold. Therefore, these studies demonstrate that DMBA may disrupt T cell activation by stimulating PTK activation with concomitant tyrosine phosphorylation of PLC-{gamma}1, release of IP{sub 3}, and mobilization of intracellular Ca{sup 2+}.

  13. Fyn Deficiency Promotes a Preferential Increase in Subcutaneous Adipose Tissue Mass and Decreased Visceral Adipose Tissue Inflammation

    PubMed Central

    Lee, Ting-Wen A.; Kwon, Hyokjoon; Zong, Haihong; Yamada, Eijiro; Vatish, Manu; Pessin, Jeffrey E.; Bastie, Claire C.

    2013-01-01

    Previous studies have demonstrated that Fyn knockout (FynKO) mice on a standard chow diet display increased glucose clearance and whole-body insulin sensitivity associated with decreased adiposity resulting from increased fatty acid use and energy expenditure. Surprisingly, however, despite a similar extent of adipose tissue (AT) mass accumulation on a high-fat diet, the FynKO mice remained fully glucose tolerant and insulin sensitive. Physiologic analyses demonstrated that the FynKO mice had a combination of skewed AT expansion into the subcutaneous compartment rather than to the visceral depot, reduced AT inflammation associated with reduced T-cell and macrophage infiltration, and increased proportion of anti-inflammatory M2 macrophages. These data demonstrate that Fyn is an important regulator of whole-body integrative metabolism that coordinates AT expansion, inflammation, and insulin sensitivity in states of nutrient excess. These data further suggest that inhibition of Fyn function may provide a novel target to prevent AT inflammation, insulin resistance, and the dyslipidemia components of the metabolic syndrome. PMID:23321073

  14. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  15. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  16. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  17. Transcription factor-microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome

    PubMed Central

    LIU, HAI-YING; HUANG, YU-LING; LIU, JIAN-QIAO; HUANG, QING

    2016-01-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5–11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF-microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS-associated TF-microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir-355-5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF-microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  18. Transcription factor‑microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome.

    PubMed

    Liu, Hai-Ying; Huang, Yu-Ling; Liu, Jian-Qiao; Huang, Qing

    2016-05-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5‑11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF‑microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS‑associated TF‑microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir‑355‑5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF‑microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  19. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  20. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  1. Ly-6A is required for T cell receptor expression and protein tyrosine kinase fyn activity.

    PubMed Central

    Lee, S K; Su, B; Maher, S E; Bothwell, A L

    1994-01-01

    To characterize the function of the Ly-6A antigen in T cell activation, antisense Ly-6 RNA was expressed in a stably transfected antigen-specific T cell clone. Reduced Ly-6A expression results in inhibition of responses to antigen, anti-TCR (anti-T cell receptor) crosslinking and concanavalin A plus recombinant interleukin 1 and causes impairment of in vitro fyn tyrosine kinase activity. More substantial reduction of Ly-6A results in reduction of TCR expression. Analysis of mRNA species indicates that the reduction is specific for the TCR beta chain. These data demonstrate that Ly-6A may regulate TCR expression and may be involved in early events of T cell activation via regulation of fyn tyrosine kinase activity. Images PMID:8187770

  2. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  3. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  4. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  5. Ser/Thr phosphorylation as a regulatory mechanism in bacteria

    PubMed Central

    Dworkin, Jonathan

    2015-01-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggests that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases. PMID:25625314

  6. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  7. Essential role of PH domain and leucine-rich repeat protein phosphatase 2 in Nrf2 suppression via modulation of Akt/GSK3β/Fyn kinase axis during oxidative hepatocellular toxicity.

    PubMed

    Rizvi, F; Shukla, S; Kakkar, P

    2014-01-01

    Instances of sustained oxidative activity have been shown to involve dysregulation of Nrf2-mediated transcriptional induction; however, mechanisms warranting Nrf2-repression remain unclear. In this study, using primary rat hepatocytes, we have attempted to identify factors that may negatively influence Nrf2 survival pathway. Though studies indicate a conspicuous association between Akt and Nrf2, a confirmatory link between the two is unaddressed. On inhibiting PI3K/Akt pathway, we observed compromised activities of antioxidant and detoxification enzymes culminating in oxidative cytotoxicity. This was accompanied by reduced nuclear retention of Nrf2 and its ARE binding affinity, increased Nrf2 ubiquitination and concurrent decline in its downstream targets. Moreover, Akt inhibition enhanced nuclear translocation as well as phosphorylation of Fyn kinase, an enzyme linked to Nrf2 degradation, by relieving GSK3β from phosphorylation-mediated repression. The involvement of Akt and Fyn kinase in influencing Nrf2 signaling was further confirmed in oxidatively stressed hepatocytes by using tert-butyl hydroperoxide (tBHP). tBHP-induced decrease in Nrf2 levels was associated with enhanced Fyn kinase phosphorylation, Fyn kinase nuclear translocation and decreased levels of phosphorylated GSK3β(Ser9) in a time-dependent manner. Interestingly, tBHP induced site-specific deactivation of Akt as only Akt(Ser473) phosphorylation was observed to be affected. Further, protein expression as well as nuclear localization of PHLPP2, a phosphatase specific for Akt(Ser473), was found to be significantly enhanced in tBHP-stressed hepatocytes. Silencing of PHLPP2 not only resulted in considerable restoration of Nrf2 signaling, enhanced Nrf2-ARE binding and reduced Nrf2 ubiquitination but also significantly suppressed tBHP-induced ROS generation and alterations in mitochondrial permeability. We infer that cellular PHLPP2 levels may aggravate oxidative toxicity by suppressing Nrf2/ARE

  8. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  9. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  10. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  11. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  12. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  13. Alzheimer Amyloid-β Oligomer Bound to Post-Synaptic Prion Protein Activates Fyn to Impair Neurons

    PubMed Central

    Um, Ji Won; Nygaard, Haakon B.; Heiss, Jacqueline K.; Kostylev, Mikhail A.; Stagi, Massimiliano; Vortmeyer, Alexander; Wisniewski, Thomas; Gunther, Erik C.; Strittmatter, Stephen M.

    2012-01-01

    SUMMARY Amyloid-beta (Aβ) oligomers are thought to trigger Alzheimer’s disease (AD) pathophysiology. Cellular Prion Protein (PrPC) selectively binds oligomeric Aβ and can mediate AD-related phenotypes. Here, we examined the specificity, distribution and signaling from Aβ/PrP complexes, seeking to explain how they might alter the function of NMDA receptors in neurons. PrPC is enriched in post-synaptic densities, and Aβ/PrPC interaction leads to Fyn kinase activation. Soluble Aβ assemblies derived from human AD brain interact with PrPC to activate Fyn. Aβ engagement of PrPC/Fyn signaling yields phosphorylation of the NR2B subunit of NMDA-receptors, which is coupled to an initial increase and then loss of surface NMDA-receptors. Aβ-induced LDH release and dendritic spine loss require both PrPC and Fyn, and human familial AD transgene-induced convulsive seizures do not occur in mice lacking PrPC. These results delineate an Aβ oligomer signal transduction pathway requiring PrPC and Fyn to alter synaptic function with relevance to AD. PMID:22820466

  14. A Central Nervous System-Dependent Intron-Embedded Gene Encodes a Novel Murine Fyn Binding Protein

    PubMed Central

    Ben Khalaf, Noureddine; Taha, Safa; Bakhiet, Moiz; Fathallah, M. Dahmani

    2016-01-01

    The interplay between the nervous and immune systems is gradually being unraveled. We previously reported in the mouse the novel soluble immune system factor ISRAA, whose activation in the spleen is central nervous system-dependent. We also showed that ISRAA plays a role in modulating anti-infection immunity. Herein, we report the genomic description of the israa locus, along with some insights into the structure-function relationship of the protein. Our findings revealed that israa is nested within intron 6 of the mouse zmiz1 gene. Protein sequence analysis revealed a typical SH2 binding motif (Y102TEV), with Fyn being the most likely binding partner. Docking simulation showed a favorable conformation for the ISRAA-Fyn complex, with a specific binding mode for the binding of the YTEV motif to the SH2 domain. Experimental studies showed that in vitro, recombinant ISRAA is phosphorylated by Fyn at tyrosine 102. Cell transfection and pull-down experiments revealed Fyn as a binding partner of ISRAA in the EL4 mouse T-cell line. Indeed, we demonstrated that ISRAA downregulates T-cell activation and the phosphorylation of an activation tyrosine (Y416) of Src-family kinases in mouse splenocytes. Our observations highlight ISRAA as a novel Fyn binding protein that is likely to be involved in a signaling pathway driven by the nervous system. PMID:26901312

  15. Oligodendroglial p130Cas is a target of Fyn kinase involved in process formation, cell migration and survival.

    PubMed

    Gonsior, Constantin; Binamé, Fabien; Frühbeis, Carsten; Bauer, Nina M; Hoch-Kraft, Peter; Luhmann, Heiko J; Trotter, Jacqueline; White, Robin

    2014-01-01

    Oligodendrocytes are the myelinating glial cells of the central nervous system. In the course of brain development, oligodendrocyte precursor cells migrate, scan the environment and differentiate into mature oligodendrocytes with multiple cellular processes which recognize and ensheath neuronal axons. During differentiation, oligodendrocytes undergo dramatic morphological changes requiring cytoskeletal rearrangements which need to be tightly regulated. The non-receptor tyrosine kinase Fyn plays a central role in oligodendrocyte differentiation and myelination. In order to improve our understanding of the role of oligodendroglial Fyn kinase, we have identified Fyn targets in these cells. Purification and mass-spectrometric analysis of tyrosine-phosphorylated proteins in response to overexpressed active Fyn in the oligodendrocyte precursor cell line Oli-neu, yielded the adaptor molecule p130Cas. We analyzed the function of this Fyn target in oligodendroglial cells and observed that reduction of p130Cas levels by siRNA affects process outgrowth, the thickness of cellular processes and migration behavior of Oli-neu cells. Furthermore, long term p130Cas reduction results in decreased cell numbers as a result of increased apoptosis in cultured primary oligodendrocytes. Our data contribute to understanding the molecular events taking place during oligodendrocyte migration and morphological differentiation and have implications for myelin formation. PMID:24586768

  16. Oligodendroglial p130Cas Is a Target of Fyn Kinase Involved in Process Formation, Cell Migration and Survival

    PubMed Central

    Gonsior, Constantin; Binamé, Fabien; Frühbeis, Carsten; Bauer, Nina M.; Hoch-Kraft, Peter; Luhmann, Heiko J.; Trotter, Jacqueline; White, Robin

    2014-01-01

    Oligodendrocytes are the myelinating glial cells of the central nervous system. In the course of brain development, oligodendrocyte precursor cells migrate, scan the environment and differentiate into mature oligodendrocytes with multiple cellular processes which recognize and ensheath neuronal axons. During differentiation, oligodendrocytes undergo dramatic morphological changes requiring cytoskeletal rearrangements which need to be tightly regulated. The non-receptor tyrosine kinase Fyn plays a central role in oligodendrocyte differentiation and myelination. In order to improve our understanding of the role of oligodendroglial Fyn kinase, we have identified Fyn targets in these cells. Purification and mass-spectrometric analysis of tyrosine-phosphorylated proteins in response to overexpressed active Fyn in the oligodendrocyte precursor cell line Oli-neu, yielded the adaptor molecule p130Cas. We analyzed the function of this Fyn target in oligodendroglial cells and observed that reduction of p130Cas levels by siRNA affects process outgrowth, the thickness of cellular processes and migration behavior of Oli-neu cells. Furthermore, long term p130Cas reduction results in decreased cell numbers as a result of increased apoptosis in cultured primary oligodendrocytes. Our data contribute to understanding the molecular events taking place during oligodendrocyte migration and morphological differentiation and have implications for myelin formation. PMID:24586768

  17. AlphaScreen HTS and Live Cell Bioluminescence Resonance Energy Transfer (BRET) Assays for Identification of Tau–Fyn SH3 Interaction Inhibitors for Alzheimer’s Disease

    PubMed Central

    Cochran, J. Nicholas; Diggs, Pauleatha V.; Nebane, N. Miranda; Rasmussen, Lynn; White, E. Lucile; Bostwick, Robert; Maddry, Joseph A.; Suto, Mark J.; Roberson, Erik D.

    2014-01-01

    Alzheimer’s Disease (AD) is the most common neurodegenerative disease and with Americans’ increasing longevity it is becoming an epidemic. There are currently no effective treatments for this disorder. Abnormalities of Tau track more closely with cognitive decline than the most studied therapeutic target in AD, amyloid-beta, but the optimal strategy for targeting Tau has not yet been identified. Based on considerable preclinical data from AD models, we hypothesize that interactions between Tau and the Src-family tyrosine kinase, Fyn, are pathogenic in AD. Genetically reducing either Tau or Fyn is protective in AD mouse models, and a dominant negative fragment of Tau that alters Fyn localization is also protective. Here, we describe a new AlphaScreen assay and a live-cell BRET assay using a novel BRET pair for quantifying the Tau–Fyn interaction. We used these assays to map the binding site on Tau for Fyn to the 5th and 6th PXXP motifs, to show that AD-associated phosphorylation at MARK sites increase the affinity of the Tau–Fyn interaction, and to identify Tau–Fyn interaction inhibitors by HTS. This screen has identified a variety of chemically tractable hits, suggesting that the Tau–Fyn interaction may represent a good drug target for AD. PMID:25156556

  18. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  19. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  20. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  1. An indoxyl compound 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, suppresses activation of Fyn kinase in mast cells and IgE-mediated allergic responses in mice

    SciTech Connect

    Lee, Jun Ho; Kim, Tae Hyung; Kim, Hyuk Soon; Kim, A-Ram; Kim, Do-Kyun; Nam, Seung Taek; Kim, Hyun Woo; Park, Young Hwan; Her, Erk; Park, Yeong Min; Kim, Hyung Sik; Kim, Young Mi; Choi, Wahn Soo

    2015-06-15

    Mast cells, constituents of virtually all organs and tissues, are critical cells in IgE-mediated allergic responses. The aim of this study was to investigate the effect and mechanism of an indoxyl chromogenic compound, 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, on IgE-mediated mast cell activation and allergic responses in mice. CAC-0982 reversibly suppressed antigen-stimulated degranulation in murine mast cells (IC{sub 50}, ~ 3.8 μM) and human mast cells (IC{sub 50}, ~ 3.0 μM). CAC-0982 also inhibited the expression and secretion of IL-4 and TNF-α in mast cells. Furthermore, CAC-0982 suppressed the mast cell-mediated allergic responses in mice in a dose-dependent manner (ED{sub 50} 27.9 mg/kg). As for the mechanism, CAC-0982 largely suppressed the phosphorylation of Syk and its downstream signaling molecules, including LAT, Akt, Erk1/2, p38, and JNK. Notably, the tyrosine kinase assay of antigen-stimulated mast cells showed that CAC-0982 inhibited Fyn kinase, one of the upstream tyrosine kinases for Syk activation in mast cells. Taken together, these results suggest that CAC-0982 may be used as a new treatment for regulating IgE-mediated allergic diseases through the inhibition of the Fyn/Syk pathway in mast cells. - Highlights: • The anti-allergic effect of 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, was measured. • CAC-0982 reversibly suppressed the activation of mast cells by IgE and antigen. • CAC-0982 inhibited passive cutaneous anaphylaxis in mice. • CAC-0982 suppresses mast cells through inhibition of Fyn activation in mast cells.

  2. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  3. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells. PMID:26051475

  4. MOBP levels are regulated by Fyn kinase and affect the morphological differentiation of oligodendrocytes.

    PubMed

    Schäfer, Isabelle; Müller, Christina; Luhmann, Heiko J; White, Robin

    2016-03-01

    Oligodendrocytes are the myelinating glial cells of the central nervous system (CNS). Myelin is formed by extensive wrapping of oligodendroglial processes around axonal segments, which ultimately allows a rapid saltatory conduction of action potentials within the CNS and sustains neuronal health. The non-receptor tyrosine kinase Fyn is an important signaling molecule in oligodendrocytes. It controls the morphological differentiation of oligodendrocytes and is an integrator of axon-glial signaling cascades leading to localized synthesis of myelin basic protein (MBP), which is essential for myelin formation. The abundant myelin-associated oligodendrocytic basic protein (MOBP) resembles MBP in several aspects and has also been reported to be localized as mRNA and translated in the peripheral myelin compartment. The signals initiating local MOBP synthesis are so far unknown and the cellular function of MOBP remains elusive. Here, we show, by several approaches in cultured primary oligodendrocytes, that MOBP synthesis is stimulated by Fyn activity. Moreover, we reveal a new function for MOBP in oligodendroglial morphological differentiation. PMID:26801084

  5. Metabolic and transcriptional regulatory mechanisms underlying the anoxic adaptation of rice coleoptile.

    PubMed

    Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup

    2014-01-01

    The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389

  6. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen

    2014-01-01

    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  7. Novel Regulatory Mechanisms of Pathogenicity and Virulence to Combat MDR in Candida albicans

    PubMed Central

    Hameed, Saif; Fatima, Zeeshan

    2013-01-01

    Continuous deployment of antifungals in treating infections caused by dimorphic opportunistic pathogen Candida albicans has led to the emergence of drug resistance resulting in cross-resistance to many unrelated drugs, a phenomenon termed multidrug resistance (MDR). Despite the current understanding of major factors which contribute to MDR mechanisms, there are many lines of evidence suggesting that it is a complex interplay of multiple factors which may be contributed by still unknown mechanisms. Coincidentally with the increased usage of antifungal drugs, the number of reports for antifungal drug resistance has also increased which further highlights the need for understanding novel molecular mechanisms which can be explored to combat MDR, namely, ROS, iron, hypoxia, lipids, morphogenesis, and transcriptional and signaling networks. Considering the worrying evolution of MDR and significance of C. albicans being the most prevalent human fungal pathogen, this review summarizes these new regulatory mechanisms which could be exploited to prevent MDR development in C. albicans as established from recent studies. PMID:24163696

  8. Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis

    PubMed Central

    Fox, Kristina A.; Ramesh, Arati; Stearns, Jennifer E.; Bourgogne, Agathe; Reyes-Jara, Angelica; Winkler, Wade C.; Garsin, Danielle A.

    2009-01-01

    Ethanolamine, a product of the breakdown of phosphatidylethanolamine from cell membranes, is abundant in the human intestinal tract and in processed foods. Effective utilization of ethanolamine as a carbon and nitrogen source may provide a survival advantage to bacteria that inhabit the gastrointestinal tract and may influence the virulence of pathogens. In this work, we describe a unique series of posttranscriptional regulatory strategies that influence expression of ethanolamine utilization genes (eut) in Enterococcus, Clostridium, and Listeria species. One of these mechanisms requires an unusual 2-component regulatory system. Regulation involves specific sensing of ethanolamine by a sensor histidine kinase (EutW), resulting in autophosphorylation and subsequent phosphoryl transfer to a response regulator (EutV) containing a RNA-binding domain. Our data suggests that EutV is likely to affect downstream gene expression by interacting with conserved transcription termination signals located within the eut locus. Breakdown of ethanolamine requires adenosylcobalamin (AdoCbl) as a cofactor, and, intriguingly, we also identify an intercistronic AdoCbl riboswitch that has a predicted structure different from previously established AdoCbl riboswitches. We demonstrate that association of AdoCbl to this riboswitch prevents formation of an intrinsic transcription terminator element located within the intercistronic region. Together, these results suggest an intricate and carefully coordinated interplay of multiple regulatory strategies for control of ethanolamine utilization genes. Gene expression appears to be directed by overlapping posttranscriptional regulatory mechanisms, each responding to a particular metabolic signal, conceptually akin to regulation by multiple DNA-binding transcription factors. PMID:19246383

  9. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN.

    PubMed

    Pei, Changan; Qin, Shiyong; Wang, Minghai; Zhang, Shuguang

    2015-11-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN‑overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN‑VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV‑NELIN‑siRNA‑VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN‑VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α‑actin and total Ras homolog gene family member A (RhoA) protein expression. The intra‑nuclear translocation of SMα‑actin‑serum response factor (SMα‑actin‑SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y‑27632, SRF and SMα‑actin expression decreased. However, cells in the LV‑NELIN‑siRNA‑VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα‑actin protein and total RhoA protein was decreased. The occurrence of SRF extra‑nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα‑actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN‑induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling

  10. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation. PMID:25222226

  11. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  12. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  13. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  14. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  15. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  16. The human sperm acrosome reaction: physiology and regulatory mechanisms. An update.

    PubMed

    Brucker, C; Lipford, G B

    1995-01-01

    The acrosome reaction is a crucial step during gamete interaction in all species, including man. It allows spermatozoa to penetrate the zona pellucida and fuse with the oocyte membrane. Spermatozoa unable to undergo the acrosome reaction will not fertilize intact oocytes. This article concentrates on the characteristics and regulatory mechanisms of the acrosome reaction in human spermatozoa. During recent years, various entities found in the vicinity of the ovulated oocyte have been identified as stimulators of the acrosome reaction, of which zona protein is considered the prime physiological inducer in vivo. The steroid hormone progesterone has been shown to evoke critical responses in sperm cells leading to the acrosome reaction. Calcium has also been shown to play a central role during the acrosome reaction. Calcium flux is induced specifically by progesterone in capacitated and uncapacitated sperm cells, whereas only capacitated spermatozoa are able to subsequently complete the acrosome reaction. Progesterone as well as zona protein has been shown to evoke crucial responses within human spermatozoa, shedding light on the cascade of intracellular signalling events leading to the completion of the acrosome reaction. Furthermore, chemical agents which bring about the reaction in vitro, such as the ionophores ionomycin or A23187, have been used to shed light on its regulatory mechanisms. A number of molecules have been postulated to regulate the acrosome reaction in mammals, for example a galactosyl-transferase and a sperm protein tyrosine kinase. In addition, a novel protein, termed SAA-1, that was first detected on human spermatozoa is discussed with respect to its potential role as a regulatory protein closely involved in the initiation of the acrosome reaction. PMID:9080206

  17. p120 Catenin-Associated Fer and Fyn Tyrosine Kinases Regulate β-Catenin Tyr-142 Phosphorylation and β-Catenin-α-Catenin Interaction

    PubMed Central

    Piedra, Jose; Miravet, Susana; Castaño, Julio; Pálmer, Héctor G.; Heisterkamp, Nora; García de Herreros, Antonio; Duñach, Mireia

    2003-01-01

    β-Catenin has a key role in the formation of adherens junction through its interactions with E-cadherin and α-catenin. We show here that interaction of β-catenin with α-catenin is regulated by the phosphorylation of β-catenin Tyr-142. This residue can be phosphorylated in vitro by Fer or Fyn tyrosine kinases. Transfection of these kinases to epithelial cells disrupted the association between both catenins. We have also examined whether these kinases are involved in the regulation of this interaction by K-ras. Stable transfectants of the K-ras oncogene in intestinal epithelial IEC18 cells were generated which show little α-catenin-β-catenin association with respect to control clones; this effect is accompanied by increased Tyr-142 phosphorylation and activation of Fer and Fyn kinases. As reported for Fer, Fyn kinase is constitutively bound to p120 catenin; expression of K-ras induces the phosphorylation of p120 catenin on tyrosine residues increasing its affinity for E-cadherin and, consequently, promotes the association of Fyn with the adherens junction complex. Yes tyrosine kinase also binds to p120 catenin but only upon activation, and stimulates Fer and Fyn tyrosine kinases. These results indicate that p120 catenin acts as a docking protein facilitating the activation of Fer/Fyn tyrosine kinases by Yes and demonstrate the role of these p120 catenin-associated kinases in the regulation of β-catenin-α-catenin interaction. PMID:12640114

  18. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells. PMID:26200095

  19. Mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis.

    PubMed

    Xu, Wen; Fazekas, Gyorgy; Hara, Hideo; Tabira, Takeshi

    2005-06-01

    The mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis (EAE) was studied in SJL/J mice. In vivo experiments showed that NK cell depletion by anti-NK1.1 monoclonal antibody treatment enhanced EAE in mice. To investigate the mechanism, we cultured proteolipid protein (PLP)136-150 peptide-specific, encephalitogenic T cell lines, which were used as the NK cell target. Our results show that NK cells exert a direct cytotoxic effect on autoantigen-specific, encephalitogenic T cells. Furthermore, cytotoxicity to PLP-specific, encephalitogenic T line cells was enhanced by using enriched NK cells as effector cells. However, the cytotoxic effect of NK cells to ovalbumin-specific T line cells and ConA-stimulated T cells could also be detected with a lesser efficiency. Our studies indicate that NK cells play a regulatory role in EAE through killing of syngeneic T cells which include myelin antigen-specific, encephalitogenic T cells, and thus ameliorate EAE. PMID:15885305

  20. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Zeng, Shaohua; Xiao, Gong; Wei, Guoyan; Liao, Sihong; Chen, Jianjun; Sun, Wei; Lv, Haiyan; Wang, Ying

    2015-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs). However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated 12 structural genes and two putative transcription factors (TFs) in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C, and icariin) decreased slightly or dramatically in two lines of Epimedium sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1), together with a bHLH TF (EsGL3) and WD40 protein (EsTTG1), were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase) in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering, and molecular breeding studies of Epimedium species. PMID:26388888

  1. Gene expression in maturing neurons: regulatory mechanisms and related neurodevelopmental disorders.

    PubMed

    Ding, Baojin

    2015-04-25

    During the central nervous system (CNS) development, the interactions between intrinsic genes and extrinsic environment ensure that each neuronal developmental stage (eg. neuronal proliferation, differentiation, migration, axon extension, dendritogenesis and formation of functional synapses) occurs in the proper timing and sequence. The successful coordination requires that numerous groups of genes are exquisitely regulated in a spatiotemporal manner by various regulatory mechanisms, including sequence-specific DNA-binding proteins, histone modifications, DNA methylation, chromatin remodeling, and microRNAs (miRNAs). By targeting chromatin structure, transcription and translation processes, these mechanisms form a regulatory network to accomplish the fine regulation of gene expression in response to environmental stimuli at different developmental stages. Dysregulation of the gene expression during neuronal development has been shown to be implicated in a number of neurodevelopmental disorders, such as autism spectrum disorders (ASD), Rett syndrome (RTT), Fragile-X syndrome (FXS) and other genetic diseases. The further understanding of the regulation of gene expression during neuronal development may provide new approaches for the diagnosis and treatment of these disorders. PMID:25896042

  2. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  3. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean.

    PubMed

    Liu, Yunfeng; Zhang, Dajian; Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  4. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  5. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  6. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi

    2015-01-01

    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  7. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  8. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  9. Transcriptional Control of Photosynthesis Genes: The Evolutionarily Conserved Regulatory Mechanism in Plastid Genome Function

    PubMed Central

    Puthiyaveetil, Sujith; Ibrahim, Iskander M.; Jeličić, Branka; Tomašić, Ana; Fulgosi, Hrvoje; Allen, John F.

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts—photosynthetic plastids—in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  10. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  11. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  12. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  13. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  14. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  15. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  16. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus.

    PubMed

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3'-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  17. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  18. Atomistic Insights into Regulatory Mechanisms of the HER2 Tyrosine Kinase Domain: A Molecular Dynamics Study

    PubMed Central

    Telesco, Shannon E.; Radhakrishnan, Ravi

    2009-01-01

    HER2 (ErbB2/Neu) is a receptor tyrosine kinase belonging to the epidermal growth factor receptor (EGFR)/ErbB family and is overexpressed in 20–30% of human breast cancers. Although several crystal structures of ErbB kinases have been solved, the precise mechanism of HER2 activation remains unknown, and it has been suggested that HER2 is unique in its requirement for phosphorylation of Y877, a key tyrosine residue located in the activation loop. To elucidate mechanistic details of kinase domain regulation, we performed molecular dynamics simulations of a homology-modeled HER2 kinase structure in active and inactive conformations. Principal component analysis of the atomistic fluctuations reveals a tight coupling between the activation loop and catalytic loop that may contribute to alignment of residues required for catalysis in the active kinase. The free energy perturbation method is also employed to predict a role for phosphorylated Y877 in stabilizing the kinase conformations. Finally, simulation results are presented for a HER2/EGFR heterodimer and reveal that the dimeric interface induces a rearrangement of the αC helix toward the active conformation. Elucidation of the molecular regulatory mechanisms in HER2 will help establish structure-function relationships in the wild-type kinase, as well as predict mutations with a propensity for constitutive activation in HER2-mediated cancers. PMID:19289058

  19. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  20. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  1. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  2. Postsynaptic density protein 95-regulated NR2B tyrosine phosphorylation and interactions of Fyn with NR2B in levodopa-induced dyskinesia rat models

    PubMed Central

    Ba, Maowen; Kong, Min; Ma, Guozhao

    2015-01-01

    Context Abnormality in interactions between N-methyl-d-aspartate (NMDA) receptor and its signaling molecules occurs in the lesioned striatum in Parkinson’s disease (PD) and levodopa-induced dyskinesia (LID). It was reported that Fyn-mediated NR2B tyrosine phosphorylation, can enhance NMDA receptor function. Postsynaptic density protein 95 (PSD-95), one of the synapse-associated proteins, regulates interactions between receptor and downstream-signaling molecules. In light of the relationship between PSD-95, NR2B, and Fyn kinases, does PSD-95 contribute to the overactivity of NMDA receptor function induced by dopaminergic treatment? To further prove the possibility, the effects of regulating the PSD-95 expression on the augmented NR2B tyrosine phosphorylation and on the interactions of Fyn and NR2B in LID rat models were evaluated. Methods In the present study, parkinsonian rat models were established by injecting 6-hydroxydopamine. Subsequently, valid PD rats were treated with levodopa (50 mg/kg/day with benserazide 12.5 mg/kg/day, twice daily) intraperitoneally for 22 days to create LID rat models. Then, the effect of pretreatment with an intrastriatal injection of the PSD-95mRNA antisense oligonucleotides (PSD-95 ASO) on the rotational response to levodopa challenge was assessed. The effects of pretreatment with an intrastriatal injection of PSD-95 ASO on the augmented NR2B tyrosine phosphorylation and interactions of Fyn with NR2B in the LID rat models were detected by immunoblotting and immunoprecipitation. Results Levodopa administration twice daily for 22 days to parkinsonian rats shortened the rotational duration and increased the peak turning responses. The altered rotational responses were attenuated by PSD-95 ASO pretreatment. Meanwhile, PSD-95 ASO pretreatment decreased the level of PSD-95 protein expression and reduced both the augmented NR2B tyrosine phosphorylation and interactions of Fyn with NR2B triggered during the levodopa administration in the

  3. Understanding the cellular roles of Fyn-related kinase (FRK): implications in cancer biology.

    PubMed

    Goel, Raghuveera Kumar; Lukong, Kiven Erique

    2016-06-01

    The non-receptor tyrosine kinase Fyn-related kinase (FRK) is a member of the BRK family kinases (BFKs) and is distantly related to the Src family kinases (SFKs). FRK was first discovered in 1993, and studies pursued thereafter attributed a potential tumour-suppressive function to the enzyme. In recent years, however, further functional characterization of the tyrosine kinase in diverse cancer types suggests that FRK may potentially play an oncogenic role as well. Specifically, while ectopic expression of FRK suppresses cell proliferation and migration in breast and brain cancers, knockdown or catalytic inhibition of FRK suppresses these cellular processes in pancreatic and liver cancer. Such functional paradox is therefore evidently exhibited in a tissue-specific context. This review sheds light on the recent developments emerged from investigations on FRK which include: (a) a review of the expression pattern of the protein in mammalian cells/tissues, (b) underlying genomic perturbations and (c) a mechanistic function of the enzyme across different cellular environments. Given its functional heterogeneity observed across different cancers, we also discuss the therapeutic significance of FRK. PMID:27067725

  4. Mechanisms of allergen-specific immunotherapy: T-regulatory cells and more.

    PubMed

    Verhagen, Johan; Blaser, Kurt; Akdis, Cezmi A; Akdis, Mübeccel

    2006-05-01

    Activation-induced cell death, anergy, or immune response modulation by regulatory T cells (Treg cells) are essential mechanisms of peripheral T-cell tolerance. Genetic predisposition and environmental instructions tune thresholds for the activation of T cells, other inflammatory cells, and resident tissue cells in allergic diseases. Skewing allergen-specific effector T cells to a Treg-cell phenotype seems to be crucial in maintaining a healthy immune response to allergens and successful allergen-specific immunotherapy. The Treg-cell response is characterized by an abolished allergen-specific T-cell proliferation and the suppressed secretion of T-helper 1- and T-helper 2-type cytokines. Suppressed proliferative and cytokine responses against allergens are induced by multiple suppressor factors, including cytokines such as interleukin-10 (IL-10) and transforming growth factor beta (TGF-beta), and cell surface molecules such as cytotoxic T-lymphocyte antigen-4, programmed death-1, and histamine receptor 2. The increased levels of IL-10 and TGF-beta produced by Treg cells potently suppress IgE production while simultaneously increasing the production of noninflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress the activity of effector cells of allergic inflammation, such as mast cells, basophils, and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms on T cells, regulation of antibody isotypes, and suppression of effector cells. The application of current knowledge of Treg cells and related mechanisms of peripheral tolerance may soon lead to more rational and safer approaches to the prevention and cure of allergic disease. PMID:16701141

  5. Regulatory mechanism of the flavoprotein Tah18-dependent nitric oxide synthesis and cell death in yeast.

    PubMed

    Yoshikawa, Yuki; Nasuno, Ryo; Kawahara, Nobuhiro; Nishimura, Akira; Watanabe, Daisuke; Takagi, Hiroshi

    2016-07-01

    Nitric oxide (NO) is a ubiquitous signaling molecule involved in the regulation of a large number of cellular functions. The regulatory mechanism of NO generation in unicellular eukaryotic yeast cells is poorly understood due to the lack of mammalian and bacterial NO synthase (NOS) orthologues, even though yeast produces NO under oxidative stress conditions. Recently, we reported that the flavoprotein Tah18, which was previously shown to transfer electrons to the iron-sulfur cluster protein Dre2, is involved in NOS-like activity in the yeast Saccharomyces cerevisiae. On the other hand, Tah18 was reported to promote apoptotic cell death after exposure to hydrogen peroxide (H2O2). Here, we showed that NOS-like activity requiring Tah18 induced cell death upon treatment with H2O2. Our experimental results also indicate that Tah18-dependent NO production and cell death are suppressed by enhancement of the interaction between Tah18 and its molecular partner Dre2. Our findings indicate that the Tah18-Dre2 complex regulates cell death as a molecular switch via Tah18-dependent NOS-like activity in response to environmental changes. PMID:27178802

  6. Identification of regulatory mechanisms of intestinal folate transport in condition of folate deficiency.

    PubMed

    Thakur, Shilpa; Rahat, Beenish; Hamid, Abid; Najar, Rauf Ahmad; Kaur, Jyotdeep

    2015-10-01

    Folic acid is an essential micronutrient, deficiency of which can lead to disturbance in various metabolic processes of cell. Folate transport across intestine occurs via the involvement of specialized folate transporters viz. proton coupled folate transporter (PCFT) and reduced folate carrier (RFC), which express at the membrane surfaces. The current study was designed to identify the regulatory mechanisms underlying the effects of folate deficiency (FD) on folate transport in human intestinal cell line as well as in rats and to check the reversibility of such effects. Caco-2 cells were grown for five generations in control and FD medium. Following treatment, one subgroup of cells was shifted on folate sufficient medium and grown for three more generations. Similarly, rats were fed an FD diet for 3 and 5 months, and after 3 months of FD treatment, one group of rats were shifted on normal folate-containing diet. Increase in folate transport and expression of folate transporters were observed on FD treatment. However, when cells and rats were shifted to control conditions after treatment, transport and expression of these genes restored to the control level. FD was found to have no impact on promoter methylation of PCFT and RFC; however, messenger RNA stability of transporters was found to be decreased, suggesting some adaptive response. Overall, increased expression of transporters under FD conditions can be attributed to enhanced rate of transcription of folate transporters and also to the increased binding of specificity protein 1 transcription factor to the RFC promoter only. PMID:26168702

  7. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  8. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  9. Protein Tyrosine Kinase Fyn Regulates TLR4-Elicited Responses on Mast Cells Controlling the Function of a PP2A-PKCα/β Signaling Node Leading to TNF Secretion.

    PubMed

    Martín-Ávila, Alejandro; Medina-Tamayo, Jaciel; Ibarra-Sánchez, Alfredo; Vázquez-Victorio, Genaro; Castillo-Arellano, Jorge Iván; Hernández-Mondragón, Alma Cristal; Rivera, Juan; Madera-Salcedo, Iris K; Blank, Ulrich; Macías-Silva, Marina; González-Espinosa, Claudia

    2016-06-15

    Mast cells produce proinflammatory cytokines in response to TLR4 ligands, but the signaling pathways involved are not fully described. In this study, the participation of the Src family kinase Fyn in the production of TNF after stimulation with LPS was evaluated using bone marrow-derived mast cells from wild-type and Fyn-deficient mice. Fyn(-/-) cells showed higher LPS-induced secretion of preformed and de novo-synthesized TNF. In both cell types, TNF colocalized with vesicle-associated membrane protein (VAMP)3-positive compartments. Addition of LPS provoked coalescence of VAMP3 and its interaction with synaptosomal-associated protein 23; those events were increased in the absence of Fyn. Higher TNF mRNA levels were also observed in Fyn-deficient cells as a result of increased transcription and greater mRNA stability after LPS treatment. Fyn(-/-) cells also showed higher LPS-induced activation of TAK-1 and ERK1/2, whereas IκB kinase and IκB were phosphorylated, even in basal conditions. Increased responsiveness in Fyn(-/-) cells was associated with a lower activity of protein phosphatase 2A (PP2A) and augmented activity of protein kinase C (PKC)α/β, which was dissociated from PP2A and increased its association with the adapter protein neuroblast differentiation-associated protein (AHNAK, desmoyokin). LPS-induced PKCα/β activity was associated with VAMP3 coalescence in WT and Fyn-deficient cells. Reconstitution of MC-deficient Wsh mice with Fyn(-/-) MCs produced greater LPS-dependent production of TNF in the peritoneal cavity. Our data show that Fyn kinase is activated after TLR4 triggering and exerts an important negative control on LPS-dependent TNF production in MCs controlling the inactivation of PP2Ac and activation of PKCα/β necessary for the secretion of TNF by VAMP3(+) carriers. PMID:27183589

  10. A mechanism for expansion of regulatory T cell repertoire and its role in self tolerance

    PubMed Central

    Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-01-01

    SUMMARY T cell receptor (TCR) signaling plays a key role in T cell fate determination. Precursor cells expressing TCRs within a certain low affinity range for self peptide-MHC complexes undergo positive selection and differentiate into naïve T cells expressing a highly diverse self-MHC restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for “self” are either eliminated through TCR agonist induced apoptosis (negative selection)1 or restrained by regulatory CD4+ T (Treg) cells, whose differentiation and function are controlled by the X-chromosome encoded transcription factor Foxp3 (review2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist driven TCR signals combined with interleukin-2 (IL-2) receptor signaling. In addition to Treg cells, TCR agonist-driven selection results in the generation of several other specialized T cell lineages like NKT and MAIT cells3. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs4-6, Here we explored whether a specialized mechanism enables agonist driven selection of Treg cells with a diverse TCR repertoire and its significance for self-tolerance. We found that intronic Foxp3 enhancer CNS3 acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to effectively control self-reactive T cells, especially when thymic negative selection was genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  11. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  12. Oligodendroglial Argonaute protein Ago2 associates with molecules of the Mbp mRNA localization machinery and is a downstream target of Fyn kinase

    PubMed Central

    Müller, Christina; Schäfer, Isabelle; Luhmann, Heiko J.; White, Robin

    2015-01-01

    Oligodendrocytes myelinate neuronal axons in the central nervous system (CNS) facilitating rapid transmission of action potentials by saltatory conduction. Myelin basic protein (MBP) is an essential component of myelin and its absence results in severe hypomyelination in the CNS of rodents. Mbp mRNA is not translated immediately after exit from the nucleus in the cytoplasm, but is transported to the plasma membrane in RNA transport granules in a translationally silenced state. We have previously identified the small non-coding RNA 715 (sncRNA715) as an inhibitor of Mbp translation associated with RNA granules. Argonaute (Ago) proteins and small RNAs form the minimal core of the RNA induced silencing complex and together recognize target mRNAs to be translationally inhibited or degraded. Recently, tyrosine phosphorylation of Ago2 was reported to be a regulator of small RNA binding. The oligodendroglial non-receptor tyrosine kinase Fyn is activated by neuronal signals and stimulates the translation of Mbp mRNA at the axon-glial contact site. Here we analyzed the expression of Ago proteins in oligodendrocytes, if they associate with Mbp mRNA transport granules and are tyrosine phosphorylated by Fyn. We show that all Ago proteins (Ago1-4) are expressed by oligodendrocytes and that Ago2 colocalizes with hnRNP A2 in granular cytoplasmic structures. Ago2 associates with hnRNP A2, Mbp mRNA, sncRNA715 and Fyn kinase and is tyrosine phosphorylated in response to Fyn activity. Our findings suggest an involvement of Ago2 in the translational regulation of Mbp. The identification of Ago proteins as Fyn targets will foster further research to understand in more molecular detail how Fyn activity regulates Mbp translation. PMID:26379499

  13. Oligodendroglial Argonaute protein Ago2 associates with molecules of the Mbp mRNA localization machinery and is a downstream target of Fyn kinase.

    PubMed

    Müller, Christina; Schäfer, Isabelle; Luhmann, Heiko J; White, Robin

    2015-01-01

    Oligodendrocytes myelinate neuronal axons in the central nervous system (CNS) facilitating rapid transmission of action potentials by saltatory conduction. Myelin basic protein (MBP) is an essential component of myelin and its absence results in severe hypomyelination in the CNS of rodents. Mbp mRNA is not translated immediately after exit from the nucleus in the cytoplasm, but is transported to the plasma membrane in RNA transport granules in a translationally silenced state. We have previously identified the small non-coding RNA 715 (sncRNA715) as an inhibitor of Mbp translation associated with RNA granules. Argonaute (Ago) proteins and small RNAs form the minimal core of the RNA induced silencing complex and together recognize target mRNAs to be translationally inhibited or degraded. Recently, tyrosine phosphorylation of Ago2 was reported to be a regulator of small RNA binding. The oligodendroglial non-receptor tyrosine kinase Fyn is activated by neuronal signals and stimulates the translation of Mbp mRNA at the axon-glial contact site. Here we analyzed the expression of Ago proteins in oligodendrocytes, if they associate with Mbp mRNA transport granules and are tyrosine phosphorylated by Fyn. We show that all Ago proteins (Ago1-4) are expressed by oligodendrocytes and that Ago2 colocalizes with hnRNP A2 in granular cytoplasmic structures. Ago2 associates with hnRNP A2, Mbp mRNA, sncRNA715 and Fyn kinase and is tyrosine phosphorylated in response to Fyn activity. Our findings suggest an involvement of Ago2 in the translational regulation of Mbp. The identification of Ago proteins as Fyn targets will foster further research to understand in more molecular detail how Fyn activity regulates Mbp translation. PMID:26379499

  14. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings. PMID:25582339

  15. A 'danse macabre': tau and Fyn in STEP with amyloid beta to facilitate induction of synaptic depression and excitotoxicity.

    PubMed

    Boehm, Jannic

    2013-06-01

    Alzheimer's disease, with its two most prominent pathological factors amyloid beta and tau protein, can be described as a disease of the synapse. It therefore comes as little surprise that NMDA receptor-related synaptic dysfunction had been thought for several years to underlie the synaptic pathophysiology seen in Alzheimer's disease. In this review I will summarise recent evidence showing that the NMDA receptor links the effects of extracellular amyloid beta with intracellular tau protein. Furthermore, the antagonistic roles of Fyn and STEP in NMDA receptor regulation, synaptic plasticity and induction of synaptic depression will be discussed. PMID:23773061

  16. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  17. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  18. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  19. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  20. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  1. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.

    PubMed

    Chen, C L; Zhao, J W

    2016-01-01

    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function. PMID:27323039

  2. Sleep-wake states and their regulatory mechanisms throughout early human development.

    PubMed

    Peirano, Patricio; Algarín, Cecilia; Uauy, Ricardo

    2003-10-01

    The emergence of sleep states is one of the most significant aspects of development. Descriptions of both neonatal and late fetal behavior and studies on the organization of sleep have shown that fetus and newborns exhibit spontaneously discrete and cyclic patterns of active sleep (AS) and quiet sleep (QS). Human fetuses and neonates sleep most of their life, and AS is the prevailing state even during the first postnatal months. Several hypotheses to explain central nervous system development consider that AS is the expression of a basic activation program for the central nervous system that increases the functional competence of neurons, circuits, and complex patterns before the organism is called on to use them. Current results indicate the maturation of QS not only coincides with the formation of thalamocortical and intracortical patterns of innervation and periods of heightened synaptogenesis, since this sleep state is also associated with important processes in synaptic remodeling. In fact, several studies suggest that the information acquired during wakefulness is further processed during AS and QS. This article reviews the processes involved in the timing of both AS/QS and sleep/wake alternating patterns throughout early human development. A growing body of evidence indicates that the duration of unmodulated parental care and noncircadian environmental conditions may be detrimental for the establishment of these basic rhythmicities. As a consequence, alterations in parental/environmental entraining factors may well contribute to disturb sleep and feeding commonly experienced by preterm infants. Further knowledge on the early establishment of sleep-wake states regulatory mechanisms is needed to improve modalities for appropriate stimulation in the developing human being. PMID:14597916

  3. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  4. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  5. [Progress of research in osteoarthritis. Gene expression and its regulatory mechanisms in the degenerative cartilage in osteoarthritis].

    PubMed

    Okazaki, Ken; Iwamoto, Yukihide

    2009-11-01

    Spatiotemporal variations of pathological changes were observed in the osteoarthritis joints. Gene expressions vary depending on the zones in the cartilage. For example, the expressions of degradative enzymes such as matrix metalloproteinases were enhanced in the superficial zone whereas the expression of matrix proteins enhanced at the deep zone. Many factors such as mechanical stress, aging, genetic background, inflammation and phenotypic changes of chondrocytes influence the pathogenesis of osteoarthritis, suggesting the involvement of many regulatory mechanisms in the gene expression. However, discoveries of regulatory factors that provide common pathways for the various phenomenon observed in the osteoarthritis cartilage suggest the interaction and co-operation of these important factors to conduct the pathology of degenerative cartilage. PMID:19880989

  6. The N-terminal SH4 region of the Src family kinase Fyn is modified by methylation and heterogeneous fatty acylation: role in membrane targeting, cell adhesion, and spreading.

    PubMed

    Liang, Xiquan; Lu, Yun; Wilkes, Meredith; Neubert, Thomas A; Resh, Marilyn D

    2004-02-27

    The N-terminal SH4 domain of Src family kinases is responsible for promoting membrane binding and plasma membrane targeting. Most Src family kinases contain an N-terminal Met-Gly-Cys consensus sequence that undergoes dual acylation with myristate and palmitate after removal of methionine. Previous studies of Src family kinase fatty acylation have relied on radiolabeling of cells with radioactive fatty acids. Although this method is useful for verifying that a given fatty acid is attached to a protein, it does not reveal whether other fatty acids or other modifying groups are attached to the protein. Here we use matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry to identify fatty acylated species of the Src family kinase Fyn. Our results reveal that Fyn is efficiently myristoylated and that some of the myristoylated proteins are also heterogeneously S-acylated with palmitate, palmitoleate, stearate, or oleate. Furthermore, we show for the first time that Fyn is trimethylated at lysine residues 7 and/or 9 within its N-terminal region. Both myristoylation and palmitoylation were required for methylation of Fyn. However, a general methylation inhibitor had no inhibitory effect on myristoylation and palmitoylation of Fyn, suggesting that methylation occurs after myristoylation and palmitoylation. Lysine mutants of Fyn that could not be methylated failed to promote cell adhesion and spreading, suggesting that methylation is important for Fyn function. PMID:14660555

  7. Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence

    PubMed Central

    Kinney, Justin B.; Murugan, Anand; Callan, Curtis G.; Cox, Edward C.

    2010-01-01

    Cells use protein-DNA and protein-protein interactions to regulate transcription. A biophysical understanding of this process has, however, been limited by the lack of methods for quantitatively characterizing the interactions that occur at specific promoters and enhancers in living cells. Here we show how such biophysical information can be revealed by a simple experiment in which a library of partially mutated regulatory sequences are partitioned according to their in vivo transcriptional activities and then sequenced en masse. Computational analysis of the sequence data produced by this experiment can provide precise quantitative information about how the regulatory proteins at a specific arrangement of binding sites work together to regulate transcription. This ability to reliably extract precise information about regulatory biophysics in the face of experimental noise is made possible by a recently identified relationship between likelihood and mutual information. Applying our experimental and computational techniques to the Escherichia coli lac promoter, we demonstrate the ability to identify regulatory protein binding sites de novo, determine the sequence-dependent binding energy of the proteins that bind these sites, and, importantly, measure the in vivo interaction energy between RNA polymerase and a DNA-bound transcription factor. Our approach provides a generally applicable method for characterizing the biophysical basis of transcriptional regulation by a specified regulatory sequence. The principles of our method can also be applied to a wide range of other problems in molecular biology. PMID:20439748

  8. Redox biology in normal cells and cancer: restoring function of the redox/Fyn/c-Cbl pathway in cancer cells offers new approaches to cancer treatment.

    PubMed

    Noble, Mark; Mayer-Pröschel, Margot; Li, Zaibo; Dong, Tiefei; Cui, Wanchang; Pröschel, Christoph; Ambeskovic, Ibro; Dietrich, Joerg; Han, Ruolan; Yang, Yin Miranda; Folts, Christopher; Stripay, Jennifer; Chen, Hsing-Yu; Stevens, Brett M

    2015-02-01

    This review discusses a unique discovery path starting with novel findings on redox regulation of precursor cell and signaling pathway function and identification of a new mechanism by which relatively small changes in redox status can control entire signaling networks that regulate self-renewal, differentiation, and survival. The pathway central to this work, the redox/Fyn/c-Cbl (RFC) pathway, converts small increases in oxidative status to pan-activation of the c-Cbl ubiquitin ligase, which controls multiple receptors and other proteins of central importance in precursor cell and cancer cell function. Integration of work on the RFC pathway with attempts to understand how treatment with systemic chemotherapy causes neurological problems led to the discovery that glioblastomas (GBMs) and basal-like breast cancers (BLBCs) inhibit c-Cbl function through altered utilization of the cytoskeletal regulators Cool-1/βpix and Cdc42, respectively. Inhibition of these proteins to restore normal c-Cbl function suppresses cancer cell division, increases sensitivity to chemotherapy, disrupts tumor-initiating cell (TIC) activity in GBMs and BLBCs, controls multiple critical TIC regulators, and also allows targeting of non-TICs. Moreover, these manipulations do not increase chemosensitivity or suppress division of nontransformed cells. Restoration of normal c-Cbl function also allows more effective harnessing of estrogen receptor-α (ERα)-independent activities of tamoxifen to activate the RFC pathway and target ERα-negative cancer cells. Our work thus provides a discovery strategy that reveals mechanisms and therapeutic targets that cannot be deduced by standard genetics analyses, which fail to reveal the metabolic information, isoform shifts, protein activation, protein complexes, and protein degradation critical to our discoveries. PMID:25481740

  9. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis.

    PubMed

    Yang, Yang; Xing, Yiqiao; Liang, Chaoqun; Hu, Liya; Xu, Fei; Mei, Qi

    2016-06-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin‑dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  10. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation.

    PubMed

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  11. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  12. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  13. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  14. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  15. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  16. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands

    PubMed Central

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  17. Regulatory Role of Collagen V in Establishing Mechanical Properties of Tendons and Ligaments is Tissue-Dependent

    PubMed Central

    Connizzo, Brianne K.; Freedman, Benjamin R.; Fried, Joanna H.; Sun, Mei; Birk, David E.; Soslowsky, Louis J.

    2015-01-01

    Patients with classic (type I) Ehlers-Danlos Syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue-dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus tendon (FDL), Achilles tendon (ACH), the anterior cruciate ligament (ACL) and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1ΔTen/ΔTen group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1ΔTen/ΔTen group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue-dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  18. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction. PMID:26482052

  19. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  20. Compartmentalized signaling by GPI-anchored ephrin-A5 requires the Fyn tyrosine kinase to regulate cellular adhesion

    PubMed Central

    Davy, Alice; Gale, Nicholas W.; Murray, Elizabeth W.; Klinghoffer, Richard A.; Soriano, Philippe; Feuerstein, Claude; Robbins, Stephen M.

    1999-01-01

    Eph receptor tyrosine kinases and their corresponding surface-bound ligands, the ephrins, provide cues to the migration of cells and growth cones during embryonic development. Here we show that ephrin-A5, which is attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidylinositol-anchor, induces compartmentalized signaling within a caveolae-like membrane microdomain when bound to the extracellular domain of its cognate Eph receptor. The physiological response induced by this signaling event is concomitant with a change in the cellular architecture and adhesion of the ephrin-A5-expressing cells and requires the activity of the Fyn protein tyrosine kinase. This study stresses the relevance of bidirectional signaling involving the ephrins and Eph receptors during brain development. PMID:10601038

  1. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  2. Mechanisms and treatment of allergic disease in the big picture of regulatory T cells.

    PubMed

    Akdis, Cezmi A; Akdis, Mübeccel

    2009-04-01

    Various populations of regulatory T (Treg) cells have been shown to play a central role in the maintenance of peripheral homeostasis and the establishment of controlled immune responses. Their identification as key regulators of immunologic processes in peripheral tolerance to allergens has opened an important era in the prevention and treatment of allergic diseases. Both naturally occurring CD4+CD25+ Treg cells and inducible populations of allergen-specific, IL-10-secreting Treg type 1 (T(R)1) cells inhibit allergen-specific effector cells in experimental models. Skewing of allergen-specific effector T cells to a regulatory phenotype appears to be a key event in the development of healthy immune response to allergens and successful outcome in allergen-specific immunotherapy. Forkhead box protein 3-positive CD4+CD25+ Treg cells and T(R)1 cells contribute to the control of allergen-specific immune responses in several major ways, which can be summarized as suppression of dendritic cells that support the generation of effector T cells; suppression of effector T(H)1, T(H)2, and T(H)17 cells; suppression of allergen-specific IgE and induction of IgG4; suppression of mast cells, basophils, and eosinophils; interaction with resident tissue cells and remodeling; and suppression of effector T-cell migration to tissues. Current strategies for drug development and allergen-specific immunotherapy exploit these observations, with the potential for preventive therapies and cure for allergic diseases. PMID:19348912

  3. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  4. Analysis of the dual regulatory mechanisms controlling expression of the vegetative catalase gene of Bacillus subtilis.

    PubMed Central

    Bol, D K; Yasbin, R E

    1994-01-01

    The expression of a vegetative catalase gene, katA (formerly the kat-19 gene), is necessary to protect Bacillus subtilis from H2O2, presumably by removing the oxidant from the environment. Genetic analysis of katA revealed that this gene is under two distinct forms of regulation, temporal and H2O2 inducible. The results reported here demonstrate that (i) the H2O2-inducible regulation of katA gene is not a component of the SOS regulon, (ii) the regulatory genes spo0A and abrB are involved in the temporal regulation but not the H2O2-specific induction of katA gene expression, and (iii) transcription initiation for the katA gene occurs at the same site under both forms of regulation. Images PMID:7961428

  5. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  6. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  7. Sphingosine 1-phosphate induces platelet/endothelial cell adhesion molecule-1 phosphorylation in human endothelial cells through cSrc and Fyn.

    PubMed

    Huang, Yu-Ting; Chen, Shee-Uan; Chou, Chia-Hong; Lee, Hsinyu

    2008-08-01

    Sphingosine 1-phosphate (S1P) is a multifunctional phospholipid which acts through a specific family of G protein-coupled receptors. Platelet/endothelial cell adhesion molecule-1 (PECAM-1) form trans-homophilic binding at lateral cell border. Upon stimulation, its cytoplasmic tyrosine residues could be phosphorylated and interact with various downstream signaling molecules. In this study, we demonstrated that S1P induced PECAM-1 tyrosine phosphorylation in human umbilical cord vein cells (HUVECs). By pharmacological inhibitors, it was suggested that G(i) and Src family kinases were involved in PECAM-1 phosphorylation. Moreover, cSrc and Fyn siRNA significantly suppressed S1P-induced PECAM-1 phosphorylation. These results suggested that S1P-induced PECAM-1 phosphorylation through G(i) and subsequent cSrc and Fyn. Our findings provide further understanding of S1P and PECAM-1 signaling as well as their functions in endothelial cells. PMID:18502612

  8. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  9. Overexpression of Heat Shock Protein 72 Attenuates NF-κB Activation Using a Combination of Regulatory Mechanisms in Microglia

    PubMed Central

    Khammash, Mustafa; Giffard, Rona G.

    2014-01-01

    Overexpression of the inducible heat shock protein 70, Hsp72, has broadly cytoprotective effects and improves outcome following stroke. A full understanding of how Hsp72 protects cells against injury is elusive, though several distinct mechanisms are implicated. One mechanism is its anti-inflammatory effects. We study the effects of Hsp72 overexpression on activation of the transcription factor NF-κB in microglia combining experimentation and mathematical modeling, using TNFα to stimulate a microglial cell line stably overexpressing Hsp72. We find that Hsp72 overexpression reduces the amount of NF-κB DNA binding activity, activity of the upstream kinase IKK, and amount of IκBα inhibitor phosphorylated following TNFα application. Simulations evaluating several proposed mechanisms suggest that inhibition of IKK activation is an essential component of its regulatory activities. Unexpectedly we find that Hsp72 overexpression reduces the initial amount of the RelA/p65 NF-κB subunit in cells, contributing to the attenuated response. Neither mechanism in isolation, however, is sufficient to attenuate the response, providing evidence that Hsp72 relies upon multiple mechanisms to attenuate NF-κB activation. An additional observation from our study is that the induced expression of IκBα is altered significantly in Hsp72 expressing cells. While the mechanism responsible for this observation is not known, it points to yet another means by which Hsp72 may alter the NF-κB response. This study illustrates the multi-faceted nature of Hsp72 regulation of NF-κB activation in microglia and offers further clues to a novel mechanism by which Hsp72 may protect cells against injury. PMID:24516376

  10. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium.

    PubMed

    Mazin, Pavel V; Fisunov, Gleb Y; Gorbachev, Alexey Y; Kapitskaya, Kristina Y; Altukhov, Ilya A; Semashko, Tatiana A; Alexeev, Dmitry G; Govorun, Vadim M

    2014-12-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3'-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  11. The Hematopoietic Stem and Progenitor Cell Cistrome: GATA Factor-Dependent cis-Regulatory Mechanisms.

    PubMed

    Hewitt, K J; Johnson, K D; Gao, X; Keles, S; Bresnick, E H

    2016-01-01

    Transcriptional regulators mediate the genesis and function of the hematopoietic system by binding complex ensembles of cis-regulatory elements to establish genetic networks. While thousands to millions of any given cis-element resides in a genome, how transcriptional regulators select these sites and how site attributes dictate functional output is not well understood. An instructive system to address this problem involves the GATA family of transcription factors that control vital developmental and physiological processes and are linked to multiple human pathologies. Although GATA factors bind DNA motifs harboring the sequence GATA, only a very small subset of these abundant motifs are occupied in genomes. Mechanistic studies revealed a unique configuration of a GATA factor-regulated cis-element consisting of an E-box and a downstream GATA motif separated by a short DNA spacer. GATA-1- or GATA-2-containing multiprotein complexes at these composite elements control transcription of genes critical for hematopoietic stem cell emergence in the mammalian embryo, hematopoietic progenitor cell regulation, and erythroid cell maturation. Other constituents of the complex include the basic helix-loop-loop transcription factor Scl/TAL1, its heterodimeric partner E2A, and the Lim domain proteins LMO2 and LDB1. This chapter reviews the structure/function of E-box-GATA composite cis-elements, which collectively constitute an important sector of the hematopoietic stem and progenitor cell cistrome. PMID:27137654

  12. Site-specific silencing of regulatory elements as a mechanism of X inactivation.

    PubMed

    Calabrese, J Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E; Magnuson, Terry

    2012-11-21

    The inactive X chromosome's (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequences is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to nontranscribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X inactivation occurred within, and X inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  13. Site-specific silencing of regulatory elements as a mechanism of X-inactivation

    PubMed Central

    Calabrese, J. Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W.; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E.; Magnuson, Terry

    2012-01-01

    The inactive X chromosome’s (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequence is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to non-transcribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X-inactivation occurred within, and X-inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X-inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  14. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  15. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  16. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  17. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  18. The regulatory role of cell mechanics for migration of differentiating myeloid cells.

    PubMed

    Lautenschläger, Franziska; Paschke, Stephan; Schinkinger, Stefan; Bruel, Arlette; Beil, Michael; Guck, Jochen

    2009-09-15

    Migration of cells is important for tissue maintenance, immune response, and often altered in disease. While biochemical aspects, including cell adhesion, have been studied in detail, much less is known about the role of the mechanical properties of cells. Previous measurement methods rely on contact with artificial surfaces, which can convolute the results. Here, we used a non-contact, microfluidic optical stretcher to study cell mechanics, isolated from other parameters, in the context of tissue infiltration by acute promyelocytic leukemia (APL) cells, which occurs during differentiation therapy with retinoic acid. Compliance measurements of APL cells reveal a significant softening during differentiation, with the mechanical properties of differentiated cells resembling those of normal neutrophils. To interfere with the migratory ability acquired with the softening, differentiated APL cells were exposed to paclitaxel, which stabilizes microtubules. This treatment does not alter compliance but reduces cell relaxation after cessation of mechanical stress six-fold, congruent with a significant reduction of motility. Our observations imply that the dynamical remodeling of cell shape required for tissue infiltration can be frustrated by stiffening the microtubular system. This link between the cytoskeleton, cell mechanics, and motility suggests treatment options for pathologies relying on migration of cells, notably cancer metastasis. PMID:19717452

  19. Understanding gene regulatory mechanisms by integrating ChIP-seq and RNA-seq data: statistical solutions to biological problems

    PubMed Central

    Angelini, Claudia; Costa, Valerio

    2014-01-01

    The availability of omic data produced from international consortia, as well as from worldwide laboratories, is offering the possibility both to answer long-standing questions in biomedicine/molecular biology and to formulate novel hypotheses to test. However, the impact of such data is not fully exploited due to a limited availability of multi-omic data integration tools and methods. In this paper, we discuss the interplay between gene expression and epigenetic markers/transcription factors. We show how integrating ChIP-seq and RNA-seq data can help to elucidate gene regulatory mechanisms. In particular, we discuss the two following questions: (i) Can transcription factor occupancies or histone modification data predict gene expression? (ii) Can ChIP-seq and RNA-seq data be used to infer gene regulatory networks? We propose potential directions for statistical data integration. We discuss the importance of incorporating underestimated aspects (such as alternative splicing and long-range chromatin interactions). We also highlight the lack of data benchmarks and the need to develop tools for data integration from a statistical viewpoint, designed in the spirit of reproducible research. PMID:25364758

  20. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  1. [VEGETATIVE REGULATORY MECHANISMS IN DIFFERENT GEOMAGNETIC CONDITIONS DEPENDING ON A DEGREE OF PHYSICAL CONDITIONING].

    PubMed

    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G

    2016-04-01

    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  2. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  3. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  4. The Potential Regulatory Mechanisms of miR-196a in Huntington’s Disease through Bioinformatic Analyses

    PubMed Central

    Tsai, Shaw-Jeng; Lai, Yen-Yu; Chang, Yu-Fan; Cheng, Pei-Hsun; Chen, Chuan-Mu; Yang, Shang-Hsun

    2015-01-01

    High throughput screening is a powerful tool to identify the potential candidate molecules involved during disease progression. However, analysis of complicated data is one of the most challenging steps on the way to obtaining useful results from this approach. Previously, we showed that a specific miRNA, miR-196a, could ameliorate the pathological phenotypes of Huntington’s disease (HD) in different models, and performed high throughput screening by using the striatum of transgenic mice. In this study, we further tried to identify the potential regulatory mechanisms using different bioinformatic tools, including Database for Annotation, Visualization and Integrated Discovery (DAVID), Molecular Signatures Database (MSigDB), TargetScan and MetaCore. The results showed that miR-196a dominantly altered “ABC transporters”, “RIG-I-like receptor signaling pathway”, immune system”, “adaptive immune system”,“tissue remodeling and wound repair” and “cytoskeleton remodeling”. In addition, miR-196a also changed the expression of several well-defined pathways of HD, such as apoptosis and cell adhesion. Since these analyses showed the regulatory pathways are highly related to the modification of the cytoskeleton, we further confirmed that miR-196a could enhance the neurite outgrowth in neuroblastoma cells, suggesting miR-196a might provide beneficial functions through the alteration of cytoskeleton structures. Since impairment of the cytoskeleton has been reported in several neuronal diseases, this study will provide not only the potential working mechanisms of miR-196a but also insights for therapeutic strategies for use with different neuronal diseases. PMID:26376480

  5. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  6. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.

    PubMed

    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin

    2016-06-01

    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter. PMID:26711125

  7. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  8. Identification of Novel Pretranslational Regulatory Mechanisms for NF-κB Activation*

    PubMed Central

    Huang, Xiao; Gong, Ren; Li, Xinyuan; Virtue, Anthony; Yang, Fan; Yang, Irene H.; Tran, Anh H.; Yang, Xiao-Feng; Wang, Hong

    2013-01-01

    NF-κB-controlled transcriptional regulation plays a central role in inflammatory and immune responses. Currently, understanding about NF-κB activation mechanism emphasizes IκB-tethered complex inactivation in the cytoplasm. In the case of NF-κB activation, IκB phosphorylation leads to its degradation, followed by NF-κB relocation to the nucleus and trans-activation of NF-κB-targeted genes. Pretranslational mechanism mediated NF-κB activation remains poorly understood. In this study, we investigated NF-κB pretranslational regulation by performing a series of database mining analyses and using six large national experimental databases (National Center of Biotechnology Information UniGene expressed sequence tag profile database, Gene Expression Omnibus database, Transcription Element Search System database, AceView database, and Epigenomics database) and TargetScan software. We reported the following findings: 1) NF-κB-signaling genes are differentially expressed in human and mouse tissues; 2) heart and vessels are the inflammation-privileged tissues and less easy to be inflamed because lacking in key NF-κB-signaling molecular expression; 3) NF-κB-signaling genes are induced by cardiovascular disease risk factors oxidized phospholipids and proinflammatory cytokines in endothelial cells; 4) transcription factors CCAAT/enhancer-binding proteins and NF-κB have higher binding site frequencies in the promoters of proinflammatory cytokine-induced NF-κB genes; 5) most NF-κB-signaling genes have multiple alternative promoters and alternatively spliced isoforms; 6) NF-κB family genes can be regulated by DNA methylation; and 7) 27 of 38 NF-κB-signaling genes can be regulated by microRNAs. Our findings provide important insight into the mechanism of NF-κB activation, which may contribute to cardiovascular disease, inflammatory diseases, and immunological disorders. PMID:23515310

  9. Regulatory mechanisms of betacellulin in CXCL8 production from lung cancer cells

    PubMed Central

    2014-01-01

    Background Betacellulin (BTC), a member of the epidermal growth factor (EGF) family, binds and activates ErbB1 and ErbB4 homodimers. BTC was expressed in tumors and involved in tumor growth progression. CXCL8 (interleukin-8) was involved in tumor cell proliferation via the transactivation of the epidermal growth factor receptor (EGFR). Materials and methods The present study was designed to investigate the possible interrelation between BTC and CXCL8 in human lung cancer cells (A549) and demonstrated the mechanisms of intracellular signals in the regulation of both functions. Bio-behaviors of A549 were assessed using Cell-IQ Alive Image Monitoring System. Results We found that BTC significantly increased the production of CXCL8 through the activation of the EGFR-PI3K/Akt-Erk signal pathway. BTC induced the resistance of human lung cancer cells to TNF-α/CHX-induced apoptosis. Treatments with PI3K inhibitors, Erk1/2 inhibitor, or Erlotinib significantly inhibited BTC-induced CXCL8 production and cell proliferation and movement. Conclusion Our data indicated that CXCL8 production from lung cancer cells could be initiated by an autocrine mechanism or external sources of BTC through the EGFR–PI3K–Akt–Erk pathway to the formation of inflammatory microenvironment. BTC may act as a potential target to monitor and improve the development of lung cancer inflammation. PMID:24629040

  10. Dss1 Interaction with Brh2 as a Regulatory Mechanism for Recombinational Repair▿

    PubMed Central

    Zhou, Qingwen; Kojic, Milorad; Cao, Zhimin; Lisby, Michael; Mazloum, Nayef A.; Holloman, William K.

    2007-01-01

    Brh2, the BRCA2 ortholog in Ustilago maydis, enables recombinational repair of DNA by controlling Rad51 and is in turn regulated by Dss1. Interplay with Rad51 is conducted via the BRC element located in the N-terminal region of the protein and through an unrelated domain, CRE, at the C terminus. Mutation in either BRC or CRE severely reduces functional activity, but repair deficiency of the brh2 mutant can be complemented by expressing BRC and CRE on different molecules. This intermolecular complementation is dependent upon the presence of Dss1. Brh2 molecules associate through the region overlapping with the Dss1-interacting domain to form at least dimer-sized complexes, which in turn, can be dissociated by Dss1 to monomer. We propose that cooperation between BRC and CRE domains and the Dss1-provoked dissociation of Brh2 complexes are requisite features of Brh2's molecular mechanism. PMID:17261595

  11. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  12. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  13. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  14. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  15. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  16. Regulatory mechanisms, expression levels and proliferation effects of the FUS-DDIT3 fusion oncogene in liposarcoma.

    PubMed

    Åman, Pierre; Dolatabadi, Soheila; Svec, David; Jonasson, Emma; Safavi, Setareh; Andersson, Daniel; Grundevik, Pernilla; Thomsen, Christer; Ståhlberg, Anders

    2016-04-01

    Fusion oncogenes are among the most common types of oncogene in human cancers. The gene rearrangements result in new combinations of regulatory elements and functional protein domains. Here we studied a subgroup of sarcomas and leukaemias characterized by the FET (FUS, EWSR1, TAF15) family of fusion oncogenes, including FUS-DDIT3 in myxoid liposarcoma (MLS). We investigated the regulatory mechanisms, expression levels and effects of FUS-DDIT3 in detail. FUS-DDIT3 showed a lower expression than normal FUS at both the mRNA and protein levels, and single-cell analysis revealed a lack of correlation between FUS-DDIT3 and FUS expression. FUS-DDIT3 transcription was regulated by the FUS promotor, while its mRNA stability depended on the DDIT3 sequence. FUS-DDIT3 protein stability was regulated by protein interactions through the FUS part, rather than the leucine zipper containing DDIT3 part. In addition, in vitro as well as in vivo FUS-DDIT3 protein expression data displayed highly variable expression levels between individual MLS cells. Combined mRNA and protein analyses at the single-cell level showed that FUS-DDIT3 protein expression was inversely correlated to the expression of cell proliferation-associated genes. We concluded that FUS-DDIT3 is uniquely regulated at the transcriptional as well as the post-translational level and that its expression level is important for MLS tumour development. The FET fusion oncogenes are potentially powerful drug targets and detailed knowledge about their regulation and functions may help in the development of novel treatments. PMID:26865464

  17. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  18. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  19. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  20. Stimulation of rat hepatic low density lipoprotein receptors by glucagon. Evidence of a novel regulatory mechanism in vivo.

    PubMed Central

    Rudling, M; Angelin, B

    1993-01-01

    We studied the influence of glucagon on hepatic LDL receptors and plasma lipoproteins in rats. A dose-dependent (maximum, threefold) increase in LDL-receptor binding was evident already at a dose of 2 x 4 micrograms, and detectable 3 h after injection; concomitantly, cholesterol and apolipoprotein (apo) B and apoE within LDL and large HDL decreased in plasma. LDL receptor mRNA levels were however unaltered or reduced. Hepatic microsomal cholesterol was increased and the enzymatic activities of 3-hydroxy-3-methylglutaryl coenzyme A reductase and cholesterol 7 alpha-hydroxylase in hepatic microsomes were reduced. Insulin alone increased receptor binding and receptor mRNA levels twofold, but plasma cholesterol was unchanged and plasma apoE and apoB increased. Administration of insulin to glucagon-treated animals reduced the LDL-receptor binding to control levels and apoB appeared in LDL particles. Estrogen treatment increased LDL-receptor binding and mRNA levels five- and eightfold, respectively. Combined treatment with glucagon and estrogen reduced the stimulation of LDL-receptor mRNA levels by 80% although LDL-receptor binding was unchanged. Immunoblot analysis showed that glucagon increased the number of hepatic LDL receptors. We conclude that glucagon induces the number of hepatic LDL receptors by a mechanism not related to increased mRNA levels, suggesting the presence of a posttranscriptional regulatory mechanism present in the liver in vivo. Images PMID:8514887

  1. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  2. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  3. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria. PMID:26967471

  4. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis. PMID:25266651

  5. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  6. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  7. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  8. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans. PMID:27030597

  9. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach. PMID:22289456

  10. A Regulatory Mechanism for RSK2 NH2-Terminal Kinase Activity

    PubMed Central

    Cho, Yong-Yeon; Yao, Ke; Pugliese, Angelo; Malakhova, Margarita L.; Bode, Ann M.; Dong, Zigang

    2010-01-01

    Our previous findings indicated that RSK2 plays a critical role in proliferation and cell transformation induced by tumor promoters, such as epidermal growth factor or 12-O-tetradecanoylphorbol-13-acetate, and that kaempferol, a natural compound found in edible plants, selectively inhibits RSK2 activity. However, the molecular mechanism for RSK2 activation is unclear. Herein, we provide evidence showing that NH2-terminal kinase domain (NTD) activation of RSK2 is required for the activation of the extracellular signal-regulated kinase–mediated COOH-terminal kinase domain (CTD). We also found that the NTD plays a key role in substrate phosphorylation and that kaempferol binds with the NTD but not the CTD in both the active and inactive forms. Homology modeling of the RSK2 NH2-terminal domain and small-molecule docking, validated by mutagenesis experiments, clearly showed that Val82 and Lys100 are critical amino acids for kaempferol binding and RSK2 activity. Furthermore, immunohistofluorescence and Western blot results indicated that the RSK2 protein level is markedly higher in cancer cell lines as well as cancer tissues compared with nonmalignant cell lines or normal tissues. In addition, kaempferol inhibited proliferation of malignant human cancer cell lines, including A431, SK-MEL-5 and SK-MEL-28, and HCT-116. These results indicate that targeting RSK2 with natural compounds, such as kaempferol, might be a good strategy for chemopreventive or chemotherapeutic application. PMID:19435896

  11. Regulatory mechanism of ZNF139 in multi-drug resistance of gastric cancer cells.

    PubMed

    Li, Yong; Tan, Bi-bo; Zhao, Qun; Fan, Li-qiao; Liu, Yü; Wang, Dong

    2014-06-01

    Our previous study found increased zinc finger protein 139 (ZNF139) expression in gastric cancer (GC) cells. Purpose of the study is to further clarify the role and mechanism of ZNF139 in multi-drug resistance (MDR) of GC cells. MTT assay, RT-PCR, Western blotting were employed to detect susceptibility of GC cells to chemotherapeutic agents (5-FU, L-OHP) in vitro, and expressions of ZNF139 and MDR associated genes MDR1/P-gp, MRP1, Bcl-2, Bax were also detected. siRNA specific to ZNF139 was transfected into MKN28 cells, then chemosensitivity of GC cells as well as changes of ZNF139 and MDR associated genes were detected. It's found the inhibition rate of 5-FU, L-OHP to well-differentiated GC tissues and cell line was lower than that in the poorly differentiated tissues and cell line; expressions of ZNF139 and MDR1/P-gp, MRP1 and Bcl-2 in well-differentiated GC tissues and cell line MKN28 were higher, while Bax expression was lower. After ZNF139-siRNA was transfected into MKN28, ZNF139 expression in GC cells was inhibited by 90%; inhibition rate of 5-FU, L-OHP to tumor cells increased, and expressions of MDR1/P-gp, MRP1 and Bcl-2 were down-regulated, while Bax was up-regulated. ZNF139 was involved in GC MDR by promoting expressions of MDR1/P-gp, MRP1 and Bcl-2 and inhibiting Bax simultaneously. PMID:24515389

  12. Extracellular Superoxide Dismutase Regulates the Expression of Small GTPase Regulatory Proteins GEFs, GAPs, and GDI

    PubMed Central

    Laukkanen, Mikko O.; Cammarota, Francesca; Esposito, Tiziana; Salvatore, Marco; Castellone, Maria D.

    2015-01-01

    Extracellular superoxide dismutase (SOD3), which catalyzes the dismutation of superoxide anions to hydrogen peroxide at the cell membranes, regulates the cellular growth in a dose-dependent manner. This enzyme induces primary cell proliferation and immortalization at low expression levels whereas it activates cancer barrier signaling through the p53-p21 pathway at high expression levels, causing growth arrest, senescence, and apoptosis. Because previous reports suggested that the SOD3–induced reduction in the rates of cellular growth and migration also occurred in the absence of functional p53 signaling, in the current study we investigated the SOD3-induced growth-suppressive mechanisms in anaplastic thyroid cancer cells. Based on our data, the robust over-expression of SOD3 increased the level of phosphorylation of the EGFR, ERBB2, RYK, ALK, FLT3, and EPHA10 receptor tyrosine kinases with the consequent downstream activation of the SRC, FYN, YES, HCK, and LYN kinases. However, pull-down experiments focusing on the small GTPase RAS, RAC, CDC42, and RHO revealed a reduced level of growth and migration signal transduction, such as the lack of stimulation of the mitogen pathway, in the SOD3 over-expressing cells, which was confirmed by MEK1/2 and ERK1/2 Western blotting analysis. Interestingly, the mRNA expression analyses indicated that SOD3 regulated the expression of guanine nucleotide-exchange factors (RHO GEF16, RAL GEF RGL1), GTPase-activating proteins (ARFGAP ADAP2, RAS GAP RASAL1, RGS4), and a Rho guanine nucleotide-disassociation inhibitor (RHO GDI 2) in a dose dependent manner, thus controlling signaling through the small G protein GTPases. Therefore, our current data may suggest the occurrence of dose-dependent SOD3–driven control of the GTP loading of small G proteins indicating a novel growth regulatory mechanism of this enzyme. PMID:25751262

  13. Extracellular superoxide dismutase regulates the expression of small gtpase regulatory proteins GEFs, GAPs, and GDI.

    PubMed

    Laukkanen, Mikko O; Cammarota, Francesca; Esposito, Tiziana; Salvatore, Marco; Castellone, Maria D

    2015-01-01

    Extracellular superoxide dismutase (SOD3), which catalyzes the dismutation of superoxide anions to hydrogen peroxide at the cell membranes, regulates the cellular growth in a dose-dependent manner. This enzyme induces primary cell proliferation and immortalization at low expression levels whereas it activates cancer barrier signaling through the p53-p21 pathway at high expression levels, causing growth arrest, senescence, and apoptosis. Because previous reports suggested that the SOD3-induced reduction in the rates of cellular growth and migration also occurred in the absence of functional p53 signaling, in the current study we investigated the SOD3-induced growth-suppressive mechanisms in anaplastic thyroid cancer cells. Based on our data, the robust over-expression of SOD3 increased the level of phosphorylation of the EGFR, ERBB2, RYK, ALK, FLT3, and EPHA10 receptor tyrosine kinases with the consequent downstream activation of the SRC, FYN, YES, HCK, and LYN kinases. However, pull-down experiments focusing on the small GTPase RAS, RAC, CDC42, and RHO revealed a reduced level of growth and migration signal transduction, such as the lack of stimulation of the mitogen pathway, in the SOD3 over-expressing cells, which was confirmed by MEK1/2 and ERK1/2 Western blotting analysis. Interestingly, the mRNA expression analyses indicated that SOD3 regulated the expression of guanine nucleotide-exchange factors (RHO GEF16, RAL GEF RGL1), GTPase-activating proteins (ARFGAP ADAP2, RAS GAP RASAL1, RGS4), and a Rho guanine nucleotide-disassociation inhibitor (RHO GDI 2) in a dose dependent manner, thus controlling signaling through the small G protein GTPases. Therefore, our current data may suggest the occurrence of dose-dependent SOD3-driven control of the GTP loading of small G proteins indicating a novel growth regulatory mechanism of this enzyme. PMID:25751262

  14. Regulatory effect and mechanism of gastrin and its antagonists on colorectal carcinoma

    PubMed Central

    He, Shuang-Wu; Shen, Kang-Qiang; He, Yu-Jun; Xie, Bin; Zhao, Yan-Ming

    1999-01-01

    AIM: To explore the effect and mechanism of gastrin and its an tagonists proglumide and somatostatin on colorectal carcinoma and their clinical significance. METHODS: A model of transplanted human colonic carcinoma was established from SW480 cell line in gymnomouse body. The volume and weight of transplanted carcinoma was observed under the effect of pentagatrin (PG), proglumide (PGL) and octapeptide somotostatin (SMS201-995, SMS). The cAMP content of carcinoma cell was determined by radioimmunoassay and the DNA, protein content and cell cycle were determined by flow-cytometry. The amount of viable cells was determined by MTT colorimetric analysis, IP3 content was determined by radioimmuno assay, Ca2+ concentration in cell by fluorometry and PKC activity by isotopic enzymolysis. The expression of gastrin, c-myc, c-fos and rasP21 in 48 case s of colorectal carcinoma tissue was detected by the immuno-cytochemistry SP method. Argyrophilia nucleolar organizer regions was determined with argyrophilia stain. RESULTS: The volume, weight, cAMP, DNA and protein content in carcinoma cell, cell amount and proliferation index of S and G2M phase in PG group were all significantly higher than those of control group. When PG was at the concentration of 25 mg/L, the amount of viable cells, IP3 content and Ca2+ concentration in cell and membrane PKC activity in PG group were significantly higher than those in control group; when PGL was at a concentration of 32 mg/L, they dropped to the lowest level in PG (25 mg/L) + PGL group, but without significant difference from the control group. The positive expression rate of gastrin, c-myc, c-fos and rasP21 in carcinoma tissue was 39.6%, 54.2%, 47.9% and 54.2% respectively and significantly higher than that in mucosa 3 cm and 6 cm adjacent to carcinoma tissue and normal colorectal mucosa. The positive expression rate of gastrin of highly-differentiated adenocarcinoma group was significantly higher than that of poorly-differentiated and

  15. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  16. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.

    PubMed

    Ehrlich, Marcelo

    2016-02-01

    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. PMID:26776724

  17. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  18. Aspects of the regulatory mechanisms of PPAR functions: analysis of a bidirectional response element and regulation by sumoylation.

    PubMed

    Shimizu, Makoto; Yamashita, Daisuke; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi

    2006-06-01

    Peroxisome proliferator-activated receptors (PPARs) constitute a subfamily of nuclear receptor superfamily. A wide variety of compounds including hypolipidemic agents, antidiabetic drugs, and long-chain fatty acids are the potential ligands of PPARs. To approach the regulatory mechanisms of PPARs, we studied on two subjects in this work. First, we identified a functional PPAR-binding site in the spacer region between the PEX11alpha and perilipin genes, which are arranged in tandem on the mouse genome. By gene reporter assays and in vivo as well as in vitro binding assays, we show that these genes are regulated tissue-selectively through this common binding site: The PEX11alpha gene is activated by PPARalpha in the liver, whereas the perilipin gene by PPARgamma in the adipose tissue. As the second subject, we found that PPARgamma2 is conjugated with small ubiquitin-related modifier (SUMO) at a specific lysine residue in the amino-terminal region. By site-directed mutagenesis combined with gene reporter assays and sumoylation analyses, we show that sumoylation represses the ligand-independent transactivating function carried by this region, and hence negatively regulates the whole transactivating competence of PPARgamma2. In addition, phosphorylation at a specific site in the amino-terminal region represses the transactivation by PPARgamma2 possibly through enhancing sumoylation. PMID:16534556

  19. Myosin Light Chain Kinase (MLCK) Regulates Cell Migration in a Myosin Regulatory Light Chain Phosphorylation-independent Mechanism*

    PubMed Central

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-01-01

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration. PMID:25122766

  20. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  1. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  2. Comparative Study between Transcriptionally- and Translationally-Acting Adenine Riboswitches Reveals Key Differences in Riboswitch Regulatory Mechanisms

    PubMed Central

    Blouin, Simon; Heppell, Benoit; Bastet, Laurène; St-Pierre, Patrick; Massé, Eric; Lafontaine, Daniel A.

    2011-01-01

    Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic). While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms. PMID:21283784

  3. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  4. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM. PMID:22170036

  5. A mechanism for expansion of regulatory T-cell repertoire and its role in self-tolerance.

    PubMed

    Feng, Yongqiang; van der Veeken, Joris; Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-12-01

    T-cell receptor (TCR) signalling has a key role in determining T-cell fate. Precursor cells expressing TCRs within a certain low-affinity range for complexes of self-peptide and major histocompatibility complex (MHC) undergo positive selection and differentiate into naive T cells expressing a highly diverse self-MHC-restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for 'self' are either eliminated through TCR-agonist-induced apoptosis (negative selection) or restrained by regulatory T (Treg) cells, whose differentiation and function are controlled by the X-chromosome-encoded transcription factor Foxp3 (reviewed in ref. 2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist-driven TCR signals combined with interleukin 2 (IL-2) receptor signalling. In addition to Treg cells, TCR-agonist-driven selection results in the generation of several other specialized T-cell lineages such as natural killer T cells and innate mucosal-associated invariant T cells. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs. Here we explore in mice whether a specialized mechanism enables agonist-driven selection of Treg cells with a diverse TCR repertoire, and the importance this holds for self-tolerance. We show that the intronic Foxp3 enhancer conserved noncoding sequence 3 (CNS3) acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to control self-reactive T cells effectively, especially when thymic negative selection is genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  6. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-beta: the role of T regulatory cells.

    PubMed

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-04-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-beta (TGF-beta) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-beta secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  7. Effect and Regulatory Mechanism of Clock Gene Per1 on Biological Behaviors of Human Oral Squamous Carcinoma Cell.

    PubMed

    Han-Xue, L I; Kai, Yang; Xiao-Juan, F U; Qin, Zhao

    2016-04-10

    Objective To investigate the effect and regulatory mechanism of clock gene Per1 on the proliferation,apoptosis,migration,and invasion of human oral squamous carcinoma SCC15 cells. Methods RNA interference was used to knock down Per1 gene in human oral squamous cell carcinoma SCC15 cell line. Changes of cell proliferation and apoptosis were analyzed by flow cytometry. Transwell assay was carried out to assess cell migration and invasion. Real-time polymerase chain reaction was used to detect the mRNA expressions of Ki-67,murine double minute 2(MDM2),c-Myc,p53,Bax,Bcl-2,metalloproteinase (MMP)2,MMP9,and vascular endothelial growth factor (VEGF). Results shRNA-mediated knockdown of Per1 promoted the proliferation,migration and invasion capacity,and inhibited cell apoptosis capacity of SCC15 cells (all P<0.05). Additionally,Per1 knockdown also increased the mRNA expressions of Ki-67,MDM2,Bcl-2,MMP2,and MMP9 and decreased the mRNA expressions of c-Myc,p53,and Bax (all P<0.05);however,the VEGF mRNA expression did not differ significantly after Per1 knockdown (P>0.05). Conclusions Clock gene Perl can regulate important tumor-related genes downstream such as Ki-67,MDM2,c-Myc,p53,Bax,Bcl-2,MMP2,and MMP9,and the aberrant expression of Per1 can affect tumor cell proliferation,apoptosis,migration and invasion. An in-depth study of Per1 may further clarify the mechanism of tumorigenesis and tumor development and thus provides new effective molecular targets for cancer treatment. PMID:27181891

  8. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGESBeta

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  9. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  10. Purification, crystallization and preliminary X-ray diffraction analysis of the Fyn SH2 domain and its complex with a phosphotyrosine peptide

    PubMed Central

    Huculeci, Radu; Buts, Lieven; Lenaerts, Tom; van Nuland, Nico A. J.; Garcia-Pino, Abel

    2012-01-01

    SH2 domains are widespread protein-binding modules that recognize phosphotyrosines and play central roles in intracellular signalling pathways. The SH2 domain of the human protein tyrosine kinase Fyn has been expressed, purified and crystallized in the unbound state and in complex with a high-affinity phosphotyrosine peptide. X-ray data were collected to a resolution of 2.00 Å for the unbound form and 1.40 Å for the protein in complex with the phosphotyrosine peptide. PMID:22442244