Sample records for fyn regulatory mechanisms

  1. Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1.

    PubMed Central

    Sanguinetti, Amy R; Cao, Haiming; Corley Mastick, Cynthia


    Caveolin-1 is phosphorylated on Tyr(14) in response to both oxidative and hyperosmotic stress. In the present paper, we show that this phosphorylation requires activation of the Src family kinase Fyn. Stress-induced caveolin phosphorylation was abolished by three Src kinase inhibitors, SU6656, PP2 and PD180970, and was not observed in fibroblasts derived from a Src, Yes and Fyn triple-knockout mouse (SYF-/-). Using cell lines derived from single-kinase-knockout mice (Src-/-, Yes-/- and Fyn-/-), we show that expression of Fyn, but not Src or Yes, is required for stress-induced caveolin phosphorylation. Heterologous expression of Fyn in the SYF-/- and Fyn-/- cells was sufficient to reconstitute stress-induced caveolin phosphorylation, and overexpression of Fyn in wild-type cells induced hyperphosphorylation of caveolin. Fyn was autophosphorylated following oxidative stress, verifying activation of this kinase. Interestingly, there was a concomitant increase in the phosphorylation of Fyn on its Csk (C-terminal Src kinase) site, indicating feedback inhibition. Csk binds to phosphocaveolin [Cao, Courchesne and Mastick (2002) J. Biol. Chem. 277, 8771-8774] and should phosphorylate any co-localized Src-family kinases. Oxidative-stress-induced phosphorylation of caveolin-1 also requires expression of Abl [Sanguinetti and Mastick (2003) Cell Signal. 15, 289-298]. Using inhibitors and cells derived from knockout mice, we verified a requirement for both Abl and Fyn in stress-induced caveolin phosphorylation in a single cell type. Our data suggest a novel mechanism for attenuation of Src-kinase activity by Abl: stable tyrosine phosphorylation of a scaffolding protein, caveolin, and recruitment of Csk. Paxillin, a substrate of both Abl and Src, organizes a similar regulatory complex. PMID:12921535

  2. miR-106b inhibits tau phosphorylation at Tyr18 by targeting Fyn in a model of Alzheimer's disease.


    Liu, Wei; Zhao, Jingya; Lu, Guangxiu


    Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by β-amyloid deposits and neurofibrillary tangles consisting of hyperphosphorylated tau protein. Increasing evidence has revealed that microRNAs (miRNAs) are implicated in the pathogenesis of AD. However, the effect of miRNAs on abnormal tau phosphorylation remains largely unclear so far. In this study, we investigated the role of miR-106b in tau phosphorylation and identified a new molecular mechanism of the hyperphosphorylation of tau. The results of qRT-PCR showed that the expression level of miR-106b was decreased, but Fyn was increased in the temporal cortex of AD patients. Overexpression of miR-106b inhibited Aβ1-42-induced tau phosphorylation at Tyr18 in SH-SY5Y cells stably expressing tau (SH-SY5Y/tau), whereas no changes were observed in tau phosphorylation at Ser396/404. Dual-luciferase reporter gene assay validated that Fyn was a direct target gene of miR-106b. In addition, western blot analysis revealed that Fyn protein expression was suppressed when SH-SY5Y cells were transfected with miR-106b mimics. Endogenous Fyn expression was knockdown by transfection with a small interfering RNA specific for Fyn (si-Fyn). The phosphorylation level of tau at Tyr 18 was decreased in the si-Fyn group compared with the negative control group, but the inhibitory effect of si-Fyn on tau phosphorylation was attenuated when miR-106b expression was inhibited. Taken together, these data suggest that miR-106b inhibits Aβ1-42-induced tau phosphorylation at Tyr18 by targeting Fyn. Our findings extend the knowledge about the regulation of tau phosphorylation and the regulatory mechanism of Fyn gene expression. PMID:27520374

  3. Superantigen-induced CD4 Memory T Cell Anergy. I. Staphylococcal Enterotoxin B Induces Fyn-mediated Negative Signaling1

    PubMed Central

    Watson, Andrew R. O.; Janik, David K.; Lee, William T.


    Memory CD4 T cells must provide robust protection for an organism while still maintaining self-tolerance. Superantigens reveal a memory cell-specific regulatory pathway, by which signaling through the TCR can lead to clonal tolerance (anergy). Here we show that the src kinase Fyn is a critical regulator of anergy in murine memory CD4 T cells induced by the bacterial superantigen staphylococcal enterotoxin B (SEB). Exposure to SEB results in impaired TCR signaling due to failed CD3/ZAP-70 complex formation. Further, signal transduction through the TCR remains similarly blocked when anergic memory cells are subsequently exposed to agonist peptide antigen. Pharmacological inhibition or genetic elimination of Fyn kinase reverses memory cell anergy, resulting in SEB-induced cell proliferation. The mechanism underlying impaired TCR signaling and subsequent memory cell anergy must involve a Fyn signaling pathway given that the suppression of Fyn activity restores CD3/ZAP-70 complex formation and TCR proximal signaling. PMID:22386537

  4. FYN promotes breast cancer progression through epithelial-mesenchymal transition.


    Xie, Ye-Gong; Yu, Yue; Hou, Li-Kun; Wang, Xin; Zhang, Bin; Cao, Xu-Chen


    FYN, one of the members of the Src family of kinases (SFKs), has been reported to be overexpressed in various types of cancers and correlated with cell motility and proliferation. However, the mechanism is still unclear. In the present study, we found that FYN was overexpressed in breast cancer and overexpression of FYN promoted cell proliferation, migration and invasion in the MCF10A cells, whereas depletion of FYN suppressed cell proliferation, migration and invasion in the MDA-MB-231 cells. Moreover, FYN upregulated the expression of mesenchymal markers and epithelial-mesenchymal transition (EMT)-related transcription factors, and downregulated the expression of epithelial markers, suggesting that FYN induces EMT in breast cancer cells. Furthermore, FYN was transcriptionally regulated by FOXO1 and mediated FGF2-induced EMT through both the PI3K/AKT and ERK/MAPK pathways. PMID:27349276

  5. Chromium(VI) stimulates Fyn to initiate innate immune gene induction in human airway epithelial cells

    PubMed Central

    Nemec, Antonia A.; Zubritsky, Lindsey M.; Barchowsky, Aaron


    Mechanisms for pathogenic metal signaling in airway injury or disease promotion are poorly understood. It is widely believed that one mechanism for pathogenic and possible carcinogenic effects of inhaled chromium (Cr(VI)) is inhibition of inducible gene transactivation. However, we recently reported that Cr(VI) inhibition of Sp1-dependent transactivation required signal transducer and activator of transcription 1 (STAT1)-dependent expression of an inhibitory protein in airway epithelium. Thus, Cr(VI) exposures can induce genes and we hypothesized this induction resulted from Cr(VI) signaling through an innate immune-like STAT1-dependent pathway initiated by Fyn. Exposure of human airway epithelial (BEAS-2B) cells to Cr(VI) selectively transactivated STAT-responsive interferon-stimulated response element (ISRE) and induced ISRE-driven transactivation of interferon regulatory factor 7 (IRF7), without affecting the gamma interferon-activated site (GAS)-driven IRF1 expression. Cr(VI)-induced IRF7 was absent or greatly reduced in cells that lacked STAT1, were treated with the Src family kinase inhibitor, PP2, or lacked Fyn. Expressing Fyn, but not Src, in mouse embryonic fibroblasts cells null for Src, Yes, and Fyn restored Cr(VI)-stimulated STAT1 tyrosine phosphorylation and IRF7 expression. Finally, shRNA knockdown of Fyn in BEAS-2B cells prevented Cr(VI)-activated STAT1 transactivation of IRF7. These data support a novel mechanism through which Cr(VI) stimulates Fyn to initiate interferon-like signaling for STAT1-dependent gene transactivation. PMID:19994902

  6. Chemically Diverse Toxicants Converge on Fyn and c-Cbl to Disrupt Precursor Cell Function

    PubMed Central

    Li, Zaibo; Dong, Tiefei; Pröschel, Chris; Noble, Mark


    Identification of common mechanistic principles that shed light on the action of the many chemically diverse toxicants to which we are exposed is of central importance in understanding how toxicants disrupt normal cellular function and in developing more effective means of protecting against such effects. Of particular importance is identifying mechanisms operative at environmentally relevant toxicant exposure levels. Chemically diverse toxicants exhibit striking convergence, at environmentally relevant exposure levels, on pathway-specific disruption of receptor tyrosine kinase (RTK) signaling required for cell division in central nervous system (CNS) progenitor cells. Relatively small toxicant-induced increases in oxidative status are associated with Fyn kinase activation, leading to secondary activation of the c-Cbl ubiquitin ligase. Fyn/c-Cbl pathway activation by these pro-oxidative changes causes specific reductions, in vitro and in vivo, in levels of the c-Cbl target platelet-derived growth factor receptor-α and other c-Cbl targets, but not of the TrkC RTK (which is not a c-Cbl target). Sequential Fyn and c-Cbl activation, with consequent pathway-specific suppression of RTK signaling, is induced by levels of methylmercury and lead that affect large segments of the population, as well as by paraquat, an organic herbicide. Our results identify a novel regulatory pathway of oxidant-mediated Fyn/c-Cbl activation as a shared mechanism of action of chemically diverse toxicants at environmentally relevant levels, and as a means by which increased oxidative status may disrupt mitogenic signaling. These results provide one of a small number of general mechanistic principles in toxicology, and the only such principle integrating toxicology, precursor cell biology, redox biology, and signaling pathway analysis in a predictive framework of broad potential relevance to the understanding of pro-oxidant–mediated disruption of normal development. PMID:17298174

  7. Fyn is a redox sensor involved in solar ultraviolet light-induced signal transduction in skin carcinogenesis.


    Kim, J-E; Roh, E; Lee, M H; Yu, D H; Kim, D J; Lim, T-G; Jung, S K; Peng, C; Cho, Y-Y; Dickinson, S; Alberts, D; Bowden, G T; Einspahr, J; Stratton, S P; Curiel-Lewandrowski, C; Bode, A M; Lee, K W; Dong, Z


    Solar ultraviolet (UV) light is a major etiological factor in skin carcinogenesis, with solar UV-stimulated signal transduction inducing pathological changes and skin damage. The primary sensor of solar UV-induced cellular signaling has not been identified. We use an experimental system of solar simulated light (SSL) to mimic solar UV and we demonstrate that Fyn is a primary redox sensor involved in SSL-induced signal transduction. Reactive oxygen species (ROS) generated by SSL exposure directly oxidize Cys488 of Fyn, resulting in increased Fyn kinase activity. Fyn oxidation was increased in mouse skin after SSL exposure and Fyn-knockout mice formed larger and more tumors compared with Fyn wild-type mice when exposed to SSL for an extended period of time. Murine embryonic fibroblasts (MEFs) lacking Fyn and cells in which Fyn expression was knocked down were resistant to SSL-induced apoptosis. Furthermore, cells expressing mutant Fyn (C448A) were resistant to SSL-induced apoptosis. These findings suggest that Fyn acts as a regulatory nexus between solar UV, ROS and signal transduction during skin carcinogenesis. PMID:26686094

  8. Fyn is a redox sensor involved in solar ultraviolet light-induced signal transduction in skin carcinogenesis

    PubMed Central

    Kim, Jong-Eun; Roh, Eunmiri; Lee, Mee Hyun; Yu, Dong Hoon; Kim, Dong Joon; Lim, Tae-Gyu; Jung, Sung Keun; Peng, Cong; Cho, Yong-Yeon; Dickinson, Sally; Alberts, Dave; Bowden, G. Tim; Einspahr, Janine; Stratton, Steven P; Curiel, Clara; Bode, Ann M.; Lee, Ki Won; Dong, Zigang


    Solar ultraviolet (UV) light is a major etiological factor in skin carcinogenesis, with solar UV-stimulated signal transduction inducing pathological changes and skin damage. The primary sensor of solar UV-induced cellular signaling has not been identified. We use an experimental system of solar simulated light (SSL) to mimic solar UV and we demonstrate that Fyn is a primary redox sensor involved in SSL-induced signal transduction. Reactive oxygen species (ROS) generated by SSL exposure directly oxidize Cys488 of Fyn, resulting in increased Fyn kinase activity. Fyn oxidation was increased in mouse skin after SSL exposure, and Fyn knockout (Fyn−/−) mice formed larger and more tumors compared to Fyn wildtype mice when exposed to SSL for an extended period of time. Murine embryonic fibroblasts (MEFs) lacking Fyn as well as cells in which Fyn expression was knocked down were resistant to SSL-induced apoptosis. Furthermore, cells expressing mutant Fyn (C448A) were resistant to SSL-induced apoptosis. These findings suggest that Fyn acts as a regulatory nexus between solar UV, ROS and signal transduction during skin carcinogenesis. PMID:26686094

  9. Fyn Kinase Regulates Microglial Neuroinflammatory Responses in Cell Culture and Animal Models of Parkinson's Disease

    PubMed Central

    Panicker, Nikhil; Saminathan, Hariharan; Jin, Huajun; Neal, Matthew; Harischandra, Dilshan S.; Gordon, Richard; Kanthasamy, Kavin; Lawana, Vivek; Sarkar, Souvarish; Luo, Jie; Anantharam, Vellareddy; Kanthasamy, Anumantha G.


    Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present study, we examined the role of Fyn, a non-receptor tyrosine kinase, in microglial activation and neuroinflammatory mechanisms in cell culture and animal models of PD. The well-characterized inflammogens LPS and TNFα rapidly activated Fyn kinase in microglia. Immunocytochemical studies revealed that activated Fyn preferentially localized to the microglial plasma membrane periphery and the nucleus. Furthermore, activated Fyn phosphorylated PKCδ at tyrosine residue 311, contributing to an inflammogen-induced increase in its kinase activity. Notably, the Fyn-PKCδ signaling axis further activated the LPS- and TNFα-induced MAP kinase phosphorylation and activation of the NFκB pathway, implying that Fyn is a major upstream regulator of proinflammatory signaling. Functional studies in microglia isolated from wild-type (Fyn+/+) and Fyn knock-out (Fyn−/−) mice revealed that Fyn is required for proinflammatory responses, including cytokine release as well as iNOS activation. Interestingly, a prolonged inflammatory insult induced Fyn transcript and protein expression, indicating that Fyn is upregulated during chronic inflammatory conditions. Importantly, in vivo studies using MPTP, LPS, or 6-OHDA models revealed a greater attenuation of neuroinflammatory responses in Fyn−/− and PKCδ −/− mice compared with wild-type mice. Collectively, our data demonstrate that Fyn is a major upstream signaling mediator of microglial neuroinflammatory processes in PD. SIGNIFICANCE STATEMENT Parkinson's disease (PD) is a complex multifactorial disease characterized by the progressive loss of midbrain dopamine neurons. Sustained microglia-mediated neuroinflammation has

  10. Involvement of the Tyro3 receptor and its intracellular partner Fyn signaling in Schwann cell myelination.


    Miyamoto, Yuki; Torii, Tomohiro; Takada, Shuji; Ohno, Nobuhiko; Saitoh, Yurika; Nakamura, Kazuaki; Ito, Akihito; Ogata, Toru; Terada, Nobuo; Tanoue, Akito; Yamauchi, Junji


    During early development of the peripheral nervous system, Schwann cell precursors proliferate, migrate, and differentiate into premyelinating Schwann cells. After birth, Schwann cells envelop neuronal axons with myelin sheaths. Although some molecular mechanisms underlying myelination by Schwann cells have been identified, the whole picture remains unclear. Here we show that signaling through Tyro3 receptor tyrosine kinase and its binding partner, Fyn nonreceptor cytoplasmic tyrosine kinase, is involved in myelination by Schwann cells. Impaired formation of myelin segments is observed in Schwann cell neuronal cultures established from Tyro3-knockout mouse dorsal root ganglia (DRG). Indeed, Tyro3-knockout mice exhibit reduced myelin thickness. By affinity chromatography, Fyn was identified as the binding partner of the Tyro3 intracellular domain, and activity of Fyn is down-regulated in Tyro3-knockout mice, suggesting that Tyro3, acting through Fyn, regulates myelination. Ablating Fyn in mice results in reduced myelin thickness. Decreased myelin formation is observed in cultures established from Fyn-knockout mouse DRG. Furthermore, decreased kinase activity levels and altered expression of myelination-associated transcription factors are observed in these knockout mice. These results suggest the involvement of Tyro3 receptor and its binding partner Fyn in Schwann cell myelination. This constitutes a newly recognized receptor-linked signaling mechanism that can control Schwann cell myelination. PMID:26224309

  11. Fyn Is a Novel Target of (−)-Epigallocatechin Gallate in the Inhibition of JB6 Cl41 Cell Transformation

    PubMed Central

    He, Zhiwei; Tang, Faqing; Ermakova, Svetlana; Li, Ming; Zhao, Qing; Cho, Yong-Yeon; Ma, Wei-Ya; Choi, Hong-Seok; Bode, Ann M.; Yang, Chung S.; Dong, Zigang


    The cancer preventive action of (−)-epigallocatechin gallate (EGCG), found in green tea, is strongly supported by epidemiology and laboratory research data. However, the mechanism by which EGCG inhibits carcinogenesis and cell transformation is not clear. In this study, we report that EGCG suppressed epidermal growth factor (EGF)-induced cell transformation in JB6 cells. We also found that EGCG inhibited EGF-induced Fyn kinase activity and phosphorylation in vitro and in vivo. Fyn was implicated in the process because EGF-induced JB6 cell transformation was inhibited by small interfering RNA (siRNA)-Fyn-JB6 cells. With an in vitro protein-binding assay, we found that EGCG directly bound with the GST-Fyn-SH2 domain but not the GST-Fyn-SH3 domain. The Kd value for EGCG binding to the Fyn SH2 domain was 0.367 ± 0.122 µM and Bmax was 1.35 ± 0.128 nmol/mg. Compared with control JB6 Cl41 cells, EGF-induced phosphorylation of p38 MAP kinase (p38 MAPK) (Thr180/Tyr182), ATF-2 (Thr71) and signal transducer and activator of transcription 1 (STAT1) (Thr727) was decreased in siRNA-Fyn-JB6 cells. EGCG could inhibit the phosphorylation of p38 MAPK, ATF-2, and STAT1. The DNA binding ability of AP-1, STAT1, and ATF-2 was also decreased in siRNA-Fyn-JB6 cells. Overall, these results demonstrated that EGCG interacted with Fyn and inhibited Fyn kinase activity and thereby regulated EGF-induced cell transformation. Inhibition of Fyn kinase activity is a novel and important mechanism that may be involved in EGCG-induced inhibition of cell transformation. PMID:18095272

  12. Neuroprotective Effects of Inhibiting Fyn S-Nitrosylation on Cerebral Ischemia/Reperfusion-Induced Damage to CA1 Hippocampal Neurons

    PubMed Central

    Hao, Lingyun; Wei, Xuewen; Guo, Peng; Zhang, Guangyi; Qi, Suhua


    Nitric oxide (NO) can regulate signaling pathways via S-nitrosylation. Fyn can be post-translationally modified in many biological processes. In the present study, using a rat four-vessel-occlusion ischemic model, we aimed to assess whether Fyn could be S-nitrosylated and to evaluate the effects of Fyn S-nitrosylation on brain damage. In vitro, Fyn could be S-nitrosylated by S-nitrosoglutathione (GSNO, an exogenous NO donor), and in vivo, endogenous NO synthesized by NO synthases (NOS) could enhance Fyn S-nitrosylation. Application of GSNO, 7-nitroindazole (7-NI, an inhibitor of neuronal NOS) and hydrogen maleate (MK-801, the N-methyl-d-aspartate receptor (NMDAR) antagonist) could decrease the S-nitrosylation and phosphorylation of Fyn induced by cerebral ischemia/reperfusion (I/R). Cresyl violet staining validated that these compounds exerted neuroprotective effects against the cerebral I/R-induced damage to hippocampal CA1 neurons. Taken together, in this study, we demonstrated that Fyn can be S-nitrosylated both in vitro and in vivo and that inhibiting S-nitrosylation can exert neuroprotective effects against cerebral I/R injury, potentially via NMDAR-mediated mechanisms. These findings may lead to a new field of inquiry to investigate the underlying pathogenesis of stroke and the development of novel treatment strategies. PMID:27420046

  13. Fyn kinase controls Fc{epsilon}RI receptor-operated calcium entry necessary for full degranulation in mast cells

    SciTech Connect

    Sanchez-Miranda, Elizabeth; Ibarra-Sanchez, Alfredo; Gonzalez-Espinosa, Claudia


    IgE-antigen-dependent crosslinking of the high affinity IgE receptor (Fc{epsilon}RI) on mast cells leads to degranulation, leukotriene synthesis and cytokine production. Calcium (Ca{sup 2+}) mobilization is a sine qua non requisite for degranulation, allowing the rapid secretion of stored pro-inflammatory mediators responsible for allergy symptoms. Fyn is a Src-family kinase that positively controls Fc{epsilon}RI-induced mast cell degranulation. However, our understanding of the mechanism connecting Fyn activation to secretion of pre-synthesized mediators is very limited. We analyzed Fc{epsilon}RI-dependent Ca{sup 2+} mobilization in bone marrow-derived mast cells (BMMCs) differentiated from WT and Fyn -/- knock out mice. Fyn -/- BMMCs showed a marked defect in extracellular Ca{sup 2+} influx after Fc{epsilon}RI crosslinking but not after thapsigargin addition. High concentrations of Gadolinium (Gd{sup 3+}) partially blocked Fc{epsilon}RI-induced Ca{sup 2+} influx in WT cells but, in contrast, completely inhibited Ca{sup 2+} mobilization in Fyn -/- cells. Low concentrations of an inhibitor of the canonical transient receptor potential (TRPC) Ca{sup 2+} channels (2-aminoethoxyphenyl-borane, 2-APB) blocked Fc{epsilon}RI-induced maximal Ca{sup 2+} rise in WT but not in Fyn -/- cells. Ca{sup 2+} entry through Fyn-controlled, 2-APB sensitive channels was found to be important for full degranulation and IL-2 mRNA accumulation in WT cells. Immunoprecipitation assays showed that Fyn kinase interacts with TRPC 3/6/7 channels after IgE-antigen stimulation, but its association is not related to protein tyrosine phosphorylation. Results indicate Fyn kinase mediates the receptor-dependent activation of TRPC channels that contribute to degranulation in Fc{epsilon}RI-stimulated mast cells.

  14. Comparative studies of gene regulatory mechanisms.


    Pai, Athma A; Gilad, Yoav


    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution. PMID:25215415

  15. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.


    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  16. Advances in Autophagy Regulatory Mechanisms.


    Gallagher, Laura E; Williamson, Leon E; Chan, Edmond Y W


    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  17. Chromatin insulators: regulatory mechanisms and epigenetic inheritance

    PubMed Central

    Bushey, Ashley M.; Dorman, Elizabeth R.; Corces, Victor G.


    Enhancer-blocking insulators are DNA elements that disrupt the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter. Insulators participate in both transcriptional regulation and global nuclear organization, two features of chromatin that are thought to be maintained from one generation to the next through epigenetic mechanisms. Furthermore, there are many regulatory mechanisms in place that enhance or hinder insulator activity. These modes of regulation could be used to establish cell-type specific insulator activity that is epigenetically inherited along a cell and/or organismal lineage. This review will discuss the evidence for epigenetic inheritance and regulation of insulator function. PMID:18851828

  18. Gene regulatory mechanisms underpinning prostate cancer susceptibility.


    Whitington, Thomas; Gao, Ping; Song, Wei; Ross-Adams, Helen; Lamb, Alastair D; Yang, Yuehong; Svezia, Ilaria; Klevebring, Daniel; Mills, Ian G; Karlsson, Robert; Halim, Silvia; Dunning, Mark J; Egevad, Lars; Warren, Anne Y; Neal, David E; Grönberg, Henrik; Lindberg, Johan; Wei, Gong-Hong; Wiklund, Fredrik


    Molecular characterization of genome-wide association study (GWAS) loci can uncover key genes and biological mechanisms underpinning complex traits and diseases. Here we present deep, high-throughput characterization of gene regulatory mechanisms underlying prostate cancer risk loci. Our methodology integrates data from 295 prostate cancer chromatin immunoprecipitation and sequencing experiments with genotype and gene expression data from 602 prostate tumor samples. The analysis identifies new gene regulatory mechanisms affected by risk locus SNPs, including widespread disruption of ternary androgen receptor (AR)-FOXA1 and AR-HOXB13 complexes and competitive binding mechanisms. We identify 57 expression quantitative trait loci at 35 risk loci, which we validate through analysis of allele-specific expression. We further validate predicted regulatory SNPs and target genes in prostate cancer cell line models. Finally, our integrated analysis can be accessed through an interactive visualization tool. This analysis elucidates how genome sequence variation affects disease predisposition via gene regulatory mechanisms and identifies relevant genes for downstream biomarker and drug development. PMID:26950096

  19. Alzheimer's amyloid-β oligomers rescue cellular prion protein induced tau reduction via the Fyn pathway.


    Chen, Rong-Jie; Chang, Wei-Wei; Lin, Yu-Chun; Cheng, Pei-Lin; Chen, Yun-Ru


    Amyloid-β (Aβ) and tau are the pathogenic hallmarks in Alzheimer's disease (AD). Aβ oligomers are considered the actual toxic entities, and the toxicity relies on the presence of tau. Recently, Aβ oligomers have been shown to specifically interact with cellular prion protein (PrP(C)) where the role of PrP(C) in AD is still not fully understood. To investigate the downstream mechanism of PrP(C) and Aβ oligomer interaction and their possible relationships to tau, we examined tau expression in human neuroblastoma BE(2)-C cells transfected with murine PrP(C) and studied the effect under Aβ oligomer treatment. By Western blotting, we found that PrP(C) overexpression down-regulated tau protein and Aβ oligomer binding alleviated the tau reduction induced by wild type but not M128V PrP(C), the high AD risk polymorphic allele in human prion gene. PrP(C) lacking the Aβ oligomer binding site was incapable of rescuing the level of tau reduction. Quantitative RT-PCR showed the PrP(C) effect was attributed to tau reduction at the transcription level. Treatment with Fyn pathway inhibitors, Fyn kinase inhibitor PP2 and MEK inhibitor U0126, reversed the PrP(C)-induced tau reduction and Aβ oligomer treatment modulated Fyn kinase activity. The results suggested Fyn pathway regulated Aβ-PrP(C)-tau signaling. Overall, our results demonstrated that PrP(C) down-regulated tau via the Fyn pathway and the effect can be regulated by Aβ oligomers. Our study facilitated the understanding of molecular mechanisms among PrP(C), tau, and Aβ oligomers. PMID:23805846

  20. Regulatory mechanisms link phenotypic plasticity to evolvability.


    van Gestel, Jordi; Weissing, Franz J


    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  1. Dopamine D2 receptors are involved in the regulation of Fyn and metabotropic glutamate receptor 5 phosphorylation in the rat striatum in vivo.


    Mao, Li-Min; Wang, John Q


    Fyn, a major Src family kinase (SFK) member that is densely expressed in striatal neurons, is actively involved in the regulation of cellular and synaptic activities in local neurons. This SFK member is likely regulated by dopamine signaling through a receptor mechanism involving dopamine D2 receptors (D2Rs). This study characterizes the D2R-dependent regulation of Fyn in the rat striatum in vivo. Moreover, we explore whether D2Rs regulate metabotropic glutamate receptor 5 (mGluR5) in its tyrosine phosphorylation and whether the D2R-SFK pathway modulates trafficking of mGluR5. We found that blockade of D2Rs by systemic administration of a D2R antagonist, eticlopride, substantially increased SFK phosphorylation in the striatum. This increase was a transient and reversible event. The eticlopride-induced SFK phosphorylation occurred predominantly in immunopurified Fyn but not in another SFK member, Src. Eticlopride also elevated tyrosine phosphorylation of mGluR5. In parallel, eticlopride enhanced synaptic delivery of active Fyn and mGluR5. Pretreatment with an SFK inhibitor blocked the eticlopride-induced tyrosine phosphorylation and synaptic trafficking of mGluR5. These results indicate that D2Rs inhibit SFK (mainly Fyn) phosphorylation in the striatum. D2Rs also inhibit tyrosine phosphorylation and synaptic recruitment of mGluR5 through a signaling mechanism likely involving Fyn. PMID:26777117

  2. Mechanotransduction in an extracted cell model: Fyn drives stretch- and flow-elicited PECAM-1 phosphorylation.


    Chiu, Yi-Jen; McBeath, Elena; Fujiwara, Keigi


    Mechanosensing followed by mechanoresponses by cells is well established, but the mechanisms by which mechanical force is converted into biochemical events are poorly understood. Vascular endothelial cells (ECs) exhibit flow- and stretch-dependent responses and are widely used as a model for studying mechanotransduction in mammalian cells. Platelet EC adhesion molecule 1 (PECAM-1) is tyrosine phosphorylated when ECs are exposed to flow or when PECAM-1 is directly pulled, suggesting that it is a mechanochemical converter. We show that PECAM-1 phosphorylation occurs when detergent-extracted EC monolayers are stretched, indicating that this phosphorylation is mechanically triggered and does not require the intact plasma membrane and soluble cytoplasmic components. Using kinase inhibitors and small interfering RNAs, we identify Fyn as the PECAM-1 kinase associated with the model. We further show that stretch- and flow-induced PECAM-1 phosphorylation in intact ECs is abolished when Fyn expression is down-regulated. We suggest that PECAM-1 and Fyn are essential components of a PECAM-1-based mechanosensory complex in ECs. PMID:18710921

  3. VEGF secretion during hypoxia depends on free radicals-induced Fyn kinase activity in mast cells

    SciTech Connect

    Garcia-Roman, Jonathan; Ibarra-Sanchez, Alfredo; Lamas, Monica; Gonzalez Espinosa, Claudia


    Research highlights: {yields} Bone marrow-derived mast cells (BMMCs) secrete functional VEGF but do not degranulate after Cobalt chloride-induced hypoxia. {yields} CoCl{sub 2}-induced VEGF secretion in mast cells occurs by a Ca{sup 2+}-insensitive but brefeldin A and Tetanus toxin-sensitive mechanism. {yields} Trolox and N-acetylcysteine inhibit hypoxia-induced VEGF secretion but only Trolox inhibits Fc{epsilon}RI-dependent anaphylactic degranulation in mast cells. {yields} Src family kinase Fyn activation after free radical production is necessary for hypoxia-induced VEGF secretion in mast cells. -- Abstract: Mast cells (MC) have an important role in pathologic conditions such as asthma and chronic obstructive pulmonary disease (COPD), where hypoxia conduce to deleterious inflammatory response. MC contribute to hypoxia-induced angiogenesis producing factors such as vascular endothelial growth factor (VEGF), but the mechanisms behind the control of hypoxia-induced VEGF secretion in this cell type is poorly understood. We used the hypoxia-mimicking agent cobalt chloride (CoCl{sub 2}) to analyze VEGF secretion in murine bone marrow-derived mast cells (BMMCs). We found that CoCl{sub 2} promotes a sustained production of functional VEGF, able to induce proliferation of endothelial cells in vitro. CoCl{sub 2}-induced VEGF secretion was independent of calcium rise but dependent on tetanus toxin-sensitive vesicle-associated membrane proteins (VAMPs). VEGF exocytosis required free radicals formation and the activation of Src family kinases. Interestingly, an important deficiency on CoCl{sub 2}-induced VEGF secretion was observed in Fyn kinase-deficient BMMCs. Moreover, Fyn kinase was activated by CoCl{sub 2} in WT cells and this activation was prevented by treatment with antioxidants such as Trolox and N-acetylcysteine. Our results show that BMMCs are able to release VEGF under hypoxic conditions through a tetanus toxin-sensitive mechanism, promoted by free radicals

  4. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.


    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  5. A novel homolog of protein tyrosine kinase Fyn identified in Lampetra japonica with roles in the immune response.


    Zhang, Qiong; Song, Xueying; Su, Peng; Li, Ranran; Liu, Chang; Gou, Meng; Wang, Hao; Liu, Xin; Li, Qingwei


    The non-receptor protein tyrosine kinase (nrPTK) Fyn, a member of the avian sarcoma virus transforming gene (Src) kinase family, plays a very significant role in cell growth, survival, apoptosis, tumor formation and immune response. In this study, a homolog of nrPTK Fyn was identified for the first time in the lamprey, Lampetra japonica and was named "Lja-Fyn". The cDNA fragment of lamprey lja-fyn contains a 1611-bp open reading frame, which encodes a protein of 537 amino acids. Multiple sequence alignment analysis showed that it shares four conserved domains (Src homology (SH) 4, SH3, SH2 and protein kinases catalytic domains) and a variable unique domain with vertebrates Fyn molecules. Though Lja-Fyn has high sequence similarity with typical Fyn and Yes molecules of jawed vertebrates, the identities among Lja-Fyn and typical Fyn molecules in unique domain are relatively higher than that among Lja-Fyn and typical Yes molecules. The result indicates that Lja-Fyn is a homolog of Fyn rather than Yes. The phylogenetic analysis showed that Fyn, Yes and Src molecules are grouped into three distinct phylogenetic clusters, and Lja-Fyn is grouped as a single branch in Fyn cluster. The real-time quantitative PCR assay revealed the wide distribution of the lja-fyn mRNA in lamprey immune related tissues. After stimulation with mixed antigens, the levels of lja-fyn mRNA were obviously up-regulated in the gill and lymphocyte-like cells, and the similar results were got by western blot analysis of Lja-Fyn protein expression. These results indicated that nrPTK Lja-Fyn was likely to be involved in immune response. Furthermore, our present findings also provide the necessary information for understanding the distinction between lamprey Lja-Fyn and other members of jawed vertebrates in Src family. PMID:26743129

  6. Neuroblastoma Tyrosine Kinase Signaling Networks Involve FYN and LYN in Endosomes and Lipid Rafts

    PubMed Central

    Guo, Ailan; Stokes, Matthew P.; Kuehn, Emily D.; George, Lynn; Comb, Michael; Grimes, Mark L.


    Protein phosphorylation plays a central role in creating a highly dynamic network of interacting proteins that reads and responds to signals from growth factors in the cellular microenvironment. Cells of the neural crest employ multiple signaling mechanisms to control migration and differentiation during development. It is known that defects in these mechanisms cause neuroblastoma, but how multiple signaling pathways interact to govern cell behavior is unknown. In a phosphoproteomic study of neuroblastoma cell lines and cell fractions, including endosomes and detergent-resistant membranes, 1622 phosphorylated proteins were detected, including more than half of the receptor tyrosine kinases in the human genome. Data were analyzed using a combination of graph theory and pattern recognition techniques that resolve data structure into networks that incorporate statistical relationships and protein-protein interaction data. Clusters of proteins in these networks are indicative of functional signaling pathways. The analysis indicates that receptor tyrosine kinases are functionally compartmentalized into distinct collaborative groups distinguished by activation and intracellular localization of SRC-family kinases, especially FYN and LYN. Changes in intracellular localization of activated FYN and LYN were observed in response to stimulation of the receptor tyrosine kinases, ALK and KIT. The results suggest a mechanism to distinguish signaling responses to activation of different receptors, or combinations of receptors, that govern the behavior of the neural crest, which gives rise to neuroblastoma. PMID:25884760

  7. Immune Regulatory Mechanisms in Allergic Conjunctivitis

    PubMed Central

    Niederkorn, Jerry Y.


    Purpose of review This review highlights recent findings regarding the immune regulation of allergic conjunctivitis (AC). Mouse models have facilitated prospective studies that have not been possible in patients. The availability of gene knockout mice and the wealth of monoclonal antibodies have permitted exquisite dissection of the pathophysiology and immune regulation of AC. Recent findings New insights have emerged in three areas: a) role of costimulatory molecules in the induction of Th2 immune responses; b) crucial role of interferon-γ (IFN-γ) in the expression of AC; and c) the function of T regulatory cells in shaping conjunctival inflammation once the immune response has been initiated. Summary Allergic conjunctivitis involves early phase and late phase reactions. The early phase reaction (EPR) is IgE antibody-dependent, while the late phase reaction (LPR) is IgE-independent and is mediated by inflammatory cells, especially eosinophils. Recent studies in mouse models of AC have provided important insights into the immune regulation of both the EPR and LPR of AC. Mounting evidence suggests that IFN-γ is crucial for optimum expression of AC. Costimulatory molecules influence the induction of Th2 immune responses and the EPR while regulatory T cells shape the expression of the LPR of AC. PMID:18769204

  8. FYN expression potentiates FLT3-ITD induced STAT5 signaling in acute myeloid leukemia

    PubMed Central

    Chougule, Rohit A.; Kazi, Julhash U.; Rönnstrand, Lars


    FYN is a non-receptor tyrosine kinase belonging to the SRC family of kinases, which are frequently over-expressed in human cancers, and play key roles in cancer biology. SRC has long been recognized as an important oncogene, but little attention has been given to its other family members. In this report, we have studied the role of FYN in FLT3 signaling in respect to acute myeloid leukemia (AML). We observed that FYN displays a strong association with wild-type FLT3 as well as oncogenic FLT3-ITD and is dependent on the kinase activity of FLT3 and the SH2 domain of FYN. We identified multiple FYN binding sites in FLT3, which partially overlapped with SRC binding sites. To understand the role of FYN in FLT3 signaling, we generated FYN overexpressing cells. We observed that expression of FYN resulted in slightly enhanced phosphorylation of AKT, ERK1/2 and p38 in response to ligand stimulation. Furthermore, FYN expression led to a slight increase in FLT3-ITD-dependent cell proliferation, but potent enhancement of STAT5 phosphorylation as well as colony formation. We also observed that FYN expression is deregulated in AML patient samples and that higher expression of FYN, in combination with FLT3-ITD mutation, resulted in enrichment of the STAT5 signaling pathway and correlated with poor prognosis in AML. Taken together our data suggest that FYN cooperates with oncogenic FLT3-ITD in cellular transformation by selective activation of the STAT5 pathway. Therefore, inhibition of FYN, in combination with FLT3 inhibition, will most likely be beneficial for this group of AML patients. PMID:26848862

  9. FYN expression potentiates FLT3-ITD induced STAT5 signaling in acute myeloid leukemia.


    Chougule, Rohit A; Kazi, Julhash U; Rönnstrand, Lars


    FYN is a non-receptor tyrosine kinase belonging to the SRC family of kinases, which are frequently over-expressed in human cancers, and play key roles in cancer biology. SRC has long been recognized as an important oncogene, but little attention has been given to its other family members. In this report, we have studied the role of FYN in FLT3 signaling in respect to acute myeloid leukemia (AML). We observed that FYN displays a strong association with wild-type FLT3 as well as oncogenic FLT3-ITD and is dependent on the kinase activity of FLT3 and the SH2 domain of FYN. We identified multiple FYN binding sites in FLT3, which partially overlapped with SRC binding sites. To understand the role of FYN in FLT3 signaling, we generated FYN overexpressing cells. We observed that expression of FYN resulted in slightly enhanced phosphorylation of AKT, ERK1/2 and p38 in response to ligand stimulation. Furthermore, FYN expression led to a slight increase in FLT3-ITD-dependent cell proliferation, but potent enhancement of STAT5 phosphorylation as well as colony formation. We also observed that FYN expression is deregulated in AML patient samples and that higher expression of FYN, in combination with FLT3-ITD mutation, resulted in enrichment of the STAT5 signaling pathway and correlated with poor prognosis in AML. Taken together our data suggest that FYN cooperates with oncogenic FLT3-ITD in cellular transformation by selective activation of the STAT5 pathway. Therefore, inhibition of FYN, in combination with FLT3 inhibition, will most likely be beneficial for this group of AML patients. PMID:26848862

  10. Premature lethality, hyperactivity, and aberrant phosphorylation in transgenic mice expressing a constitutively active form of Fyn

    PubMed Central

    Xia, Di; Götz, Jürgen


    The kinase Fyn, the microtubule-associated protein tau and the peptide amyloid-β (Aβ) constitute a toxic triad in Alzheimer's disease (AD). Tau's subcellular localization is mainly regulated by phosphorylation whereas Fyn's localization is dictated by palmitoylation targeting it to the plasma membrane in a reversible manner. We have previously shown that tau is required for Fyn to be targeted to the dendritic spine. We had also shown that a truncated form of tau (Δtau) that accumulates in the cell soma is capable of trapping Fyn and preventing it from entering the spine. Here we determined that palmitoylation is required for Fyn's membrane and spine localization. We further evaluated the functional consequences of neuronal over-expression of the constitutively active Y531F mutant form of Fyn (FynCA) in transgenic mice. We found that the FynCA transgenic mice displayed a reduced weight, a massively reduced lifespan and a high level of hyperactivity. The lifespan of the FynCA mice was only slightly extended by crossing them with Δtau transgenic mice, possibly reflecting differences in expression patterns of the transgenes and high levels of transgenic FynCA compared to endogenous Fyn. Analysis of synaptosomes revealed that FynCA accumulated at high levels in the spine, resulting in increased levels of the NMDA receptor subunit NR2b phosphorylated at residue Y1472. Tau was strongly phosphorylated at the AT8 epitope S202/T205 as shown by Western blot and immunohistochemistry indicating that an increased tyrosine kinase activity of Fyn has down-stream consequences for serine/threonine-directed phosphorylation. PMID:24860422

  11. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine


    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  12. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine


    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  13. Nitrogen fixation: key genetic regulatory mechanisms.


    Martinez-Argudo, I; Little, R; Shearer, N; Johnson, P; Dixon, R


    The necessity to respond to the level of fixed nitrogen and external oxygen concentrations and to provide sufficient energy for nitrogen fixation imposes common regulatory principles amongst diazotrophs. The NifL-NifA system in Azotobacter vinelandii integrates the signals of redox, fixed-nitrogen and carbon status to regulate nif transcription. Multidomain signalling interactions between NifL and NifA are modulated by redox changes, ligand binding and interaction with the signal-transduction protein GlnK. Under adverse redox conditions (excess oxygen) or when fixed nitrogen is in excess, NifL forms a complex with NifA in which transcriptional activation is prevented. Oxidized NifL forms a binary complex with NifA to inhibit NifA activity. When fixed nitrogen is in excess, the non-covalently modified form of GlnK interacts with NifL to promote the formation of a GlnK-NifL-NifA ternary complex. When the cell re-encounters favourable conditions for nitrogen fixation, it is necessary to deactivate the signals to ensure that the NifL-NifA complex is dissociated so that NifA is free to activate transcription. This is achieved through interactions with 2-oxoglutarate, a key metabolic signal of the carbon status, which binds to the N-terminal GAF (cGMP-specific and stimulated phosphodiesterases, Anabaena adenylate cyclases and Escherichia coli FhlA) domain of NifA. PMID:15667291

  14. Molecular regulatory mechanism of tooth root development

    PubMed Central

    Huang, Xiao-Feng; Chai, Yang


    The root is crucial for the physiological function of the tooth, and a healthy root allows an artificial crown to function as required clinically. Tooth crown development has been studied intensively during the last few decades, but root development remains not well understood. Here we review the root development processes, including cell fate determination, induction of odontoblast and cementoblast differentiation, interaction of root epithelium and mesenchyme, and other molecular mechanisms. This review summarizes our current understanding of the signaling cascades and mechanisms involved in root development. It also sets the stage for de novo tooth regeneration. PMID:23222990

  15. The SH2 domain is crucial for function of Fyn in neuronal migration and cortical lamination

    PubMed Central

    Lu, Xi; Hu, Xinde; Song, Lingzhen; An, Lei; Duan, Minghui; Chen, Shulin; Zhao, Shanting


    Neurons in the developing brain form the cortical plate (CP) in an inside-out manner, in which the late-born neurons are located more superficially than the early-born neurons. Fyn, a member of the Src family kinases, plays an important role in neuronal migration by binding to many substrates. However, the role of the Src-homology 2 (SH2) domain in function of Fyn in neuronal migration remains poorly understood. Here, we demonstrate that the SH2 domain is essential for the action of Fyn in neuronal migration and cortical lamination. A point mutation in the Fyn SH2 domain (FynR176A) impaired neuronal migration and their final location in the cerebral cortex, by inducing neuronal aggregation and branching. Thus, we provide the first evidence of the Fyn SH2 domain contributing to neuronal migration and neuronal morphogenesis. [BMB Reports 2015; 48(2): 97-102] PMID:24912779

  16. Regulation of Multicellular Spheroids by MAPK and FYN Kinase.


    Lee, Casey; Ramos, Daniel M


    Understanding of the biology of oral squamous cell carcinoma (SCC) has not progressed significantly in the past 60 years, with 5-year survival remaining at approximately 50%. The epidemic of Human Papilloma Virus and its associated SCC warrants a renewed emphasis on fully understanding this disease. We previously used the 3-dimensional multicellular spheroid (MCS) model system to evaluate SCC behavior more accurately. In this study, we determined that SCC growth in MCS approximates epithelial to mesenchymal transition. Organization of an MCS requires the full-length β6 integrin subunit and its maintenance requires mitogen-activated protein kinase (MAPK). Limiting FYN kinase activation results in the down-regulation of E-cadherin, β-catenin and an increase in expression of N-cadherin and SNAIL. These results indicate that the microenvironment and growth patterns in an MCS are complex and require MAPK and FYN kinase. PMID:27466485

  17. [Regulatory mechanism of circulating inorganic phosphate].


    Michigami, Toshimi


    Circulating level of phosphate is altered by age and diet, and is also controlled by several hormones such as parathyroid hormone(PTH), 1,25-dihydroxyvitamin D[1,25(OH)2D]and fibroblast growth factor 23(FGF23). The main function of PTH and 1,25(OH)2D is maintaining calcium homeostasis, while FGF23 plays a central role in phosphate metabolism. PTH suppresses phosphate reabsorption in the proximal tubules to increase the renal phosphate wasting, while 1,25(OH)2D facilitates the intestinal phosphate absorption. FGF23 increases the renal phosphate wasting and reduces the production of 1,25(OH)2D. Of note, these hormones mutually regulate one another. The production of FGF23 is also regulated by various local factors. The mechanism for sensing the phosphate availability still remains unknown, and further investigation is required. PMID:26813498

  18. Phytochemical regulation of Fyn and AMPK signaling circuitry.


    Lee, Chan Gyu; Koo, Ja Hyun; Kim, Sang Geon


    During the past decades, phytochemical terpenoids, polyphenols, lignans, flavonoids, and alkaloids have been identified as antioxidative and cytoprotective agents. Adenosine monophosphate-activated protein kinase (AMPK) is a kinase that controls redox-state and oxidative stress in the cell, and serves as a key molecule regulating energy metabolism. Many phytochemicals directly or indirectly alter the AMPK pathway in distinct manners, exerting catabolic metabolism. Some of them are considered promising in the treatment of metabolic diseases such as type II diabetes, obesity, and hyperlipidemia. Another important kinase that regulates energy metabolism is Fyn kinase, a member of the Src family kinases that plays a role in various cellular responses such as insulin signaling, cell growth, oxidative stress and apoptosis. Phytochemical inhibition of Fyn leads to AMPK-mediated protection of the cell in association with increased antioxidative capacity and mitochondrial biogenesis. The kinases may work together to form a signaling circuitry for the homeostasis of energy conservation and expenditure, and may serve as targets of phytochemicals. This review is intended as a compilation of recent advancements in the pharmacological research of phytochemicals targeting Fyn and AMPK circuitry, providing information for the prevention and treatment of metabolic diseases and the accompanying tissue injuries. PMID:25951818

  19. Subversion of cell cycle regulatory mechanisms by HIV

    PubMed Central

    Rice, Andrew P.; Kimata, Jason T.


    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular process towards viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein utilizes Cyclin T1 to activated proviral transcription, and regulation of Cyclin T1 levels in CD4+ T cells has important consequences for viral replication and latency. This review will summarize this emerging evidence that primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to enhance replication. PMID:26067601

  20. SRC family kinase FYN promotes the neuroendocrine phenotype and visceral metastasis in advanced prostate cancer

    PubMed Central

    Sievert, Margarit; Duan, Peng; Lichterman, Jake; Huang, Jen-Ming; Smith, Bethany; You, Sungyong; Nandana, Srinivas; Chu, Gina Chia-Yi; Mink, Sheldon; Josson, Sajni; Liu, Chunyan; Morello, Matteo; Jones, Lawrence W. M.; Kim, Jayoung; Freeman, Michael R.; Bhowmick, Neil; Zhau, Haiyen E.; Chung, Leland W.K.; Posadas, Edwin M.


    FYN is a SRC family kinase (SFK) that has been shown to be up-regulated in human prostate cancer (PCa) tissues and cell lines. In this study, we observed that FYN is strongly up-regulated in human neuroendocrine PCa (NEPC) tissues and xenografts, as well as cells derived from a NEPC transgenic mouse model. In silico analysis of FYN expression in prostate cancer cell line databases revealed an association with the expression of neuroendocrine (NE) markers such as CHGA, CD44, CD56, and SYP. The loss of FYN abrogated the invasion of PC3 and ARCaPM cells in response to MET receptor ligand HGF. FYN also contributed to the metastatic potential of NEPC cells in two mouse models of visceral metastasis with two different cell lines (PC3 and TRAMPC2-RANKL). The activation of MET appeared to regulate neuroendocrine (NE) features as evidenced by increased expression of NE markers in PC3 cells with HGF. Importantly, the overexpression of FYN protein in DU145 cells was directly correlated with the increase of CHGA. Thus, our data demonstrated that the neuroendocrine differentiation that occurs in PCa cells is, at least in part, regulated by FYN kinase. Understanding the role of FYN in the regulation of NE markers will provide further support for ongoing clinical trials of SFK and MET inhibitors in castration-resistant PCa patients. PMID:26624980

  1. Regulatory mechanisms related to biofuel tolerance in producing microbes.


    Fu, Y; Chen, L; Zhang, W


    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  2. Secretory pattern and regulatory mechanism of growth hormone in cattle.


    Kasuya, Etsuko


    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  3. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki


    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  4. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes.


    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki


    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  5. Regulatory mechanisms of EGFR signalling during Drosophila eye development.


    Malartre, Marianne


    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  6. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.


    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  7. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.


    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang


    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  8. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang


    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  9. Data supporting the role of Fyn in initiating myelination in the peripheral nervous system.


    Miyamoto, Yuki; Tamano, Moe; Torii, Tomohiro; Kawahara, Kazuko; Nakamura, Kazuaki; Tanoue, Akito; Takada, Shuji; Yamauchi, Junji


    Transgenic mice, which express active Fyn tyrosine kinase under the control of a glial fibrillary acidic protein promoter, have been produced. This promoter induces protein expression in the initiation stage of myelination in the peripheral nervous system (PNS) "Phosphorylation of cytohesin-1 by Fyn is required for initiation of myelination and the extent of myelination during development (Yamauchi et al., 2015 [1])". Herein we provide the data regarding myelination-related protein markers and myelin ultrastructure in transgenic mice. PMID:27115022

  10. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.


    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  11. The prion hypothesis: from biological anomaly to basic regulatory mechanism

    PubMed Central

    Tuite, Mick F; Serio, Tricia R


    Preface Prions are unusual proteinaceous infectious agents that are typically associated with a class of fatal degenerative diseases of the mammalian brain. However, the discovery of fungal prions, which are not associated with disease, suggests that we must now consider the impact of these factors on basic cellular physiology in a different light. Fungal prions are epigenetic determinants that can alter a range of cellular processes, including metabolism and gene expression pathways, and these changes can lead to a range of prion-associated phenotypes. The mechanistic similarities between prion propagation in mammals and fungi suggest that prions are not a biological anomaly but instead are a new appreciated and perhaps ubiquitous regulatory mechanism. PMID:21081963

  12. Emerging regulatory mechanisms in ubiquitin-dependent cell cycle control

    PubMed Central

    Mocciaro, Annamaria; Rape, Michael


    The covalent modification of proteins with ubiquitin is required for accurate cell division in all eukaryotes. Ubiquitylation depends on an enzymatic cascade, in which E3 enzymes recruit specific substrates for modification. Among ~600 human E3s, the SCF (Skp1–cullin1–F-box) and the APC/C (anaphase-promoting complex/cyclosome) are known for driving the degradation of cell cycle regulators to accomplish irreversible cell cycle transitions. The cell cycle machinery reciprocally regulates the SCF and APC/C through various mechanisms, including the modification of these E3s or the binding of specific inhibitors. Recent studies have provided new insight into the intricate relationship between ubiquitylation and the cell division apparatus as they revealed roles for atypical ubiquitin chains, new mechanisms of substrate and E3 regulation, as well as extensive crosstalk between ubiquitylation enzymes. Here, we review these emerging regulatory mechanisms of ubiquitin-dependent cell cycle control and discuss how their manipulation might provide therapeutic benefits in the future. PMID:22357967

  13. Mechanisms of regulatory volume increase in collecting duct cells.


    Fu, W J; Kuwahara, M; Cragoe, E J; Marumo, F


    To examine the mechanisms of cell volume regulation in response to hyperosmolality, segments of the inner stripe of rabbit outer medullary collecting duct (OMCDi) were perfused in vitro. The cross-sectional area of the tubule was monitored as an index of the relative cell volume. When luminal and basolateral osmolalities were increased from 290 to 390 mOsm simultaneously, the tubule cell shrank instantaneously and reswelled gradually, showing the so-called regulatory volume increase (RVI). Basolateral Na+ removal and addition of basolateral ethyl isopropyl amiloride (EIPA) decreased the RVI response by 76 and 66%, respectively. By contrast, apical Na+ removal had no effect on this response. RVI response was also inhibited by basolateral, but not luminal, Cl- removal (-63%), by total HCO3- removal (-74%), and by adding basolateral 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) (-62%). Intracellular pH did not change significantly during RVI. Vasopressin increased RVI response by 56%. However, this increase was abolished in the absence of basolateral Na+ and Cl-, and in the presence of basolateral EIPA and DIDS. These results suggest that major mechanisms responsible for RVI are Na(+)-H+ and Cl(-)-HCO3- exchange systems in the basolateral membrane, and that these systems are stimulated by vasopressin in rabbit OMCDi. PMID:8007444

  14. The Src kinase Fyn is protective in acute chemical-induced colitis and promotes recovery from disease.


    Lopes, Fernando; Wang, Arthur; Smyth, David; Reyes, Jose-Luis; Doering, Axinia; Schenck, L Patrick; Beck, Paul; Waterhouse, Christopher; McKay, Derek M


    Despite progress in understanding enteric inflammation, current therapies, although effective in many patients with inflammatory bowel disease (IBD), have significant side-effects, and, in many patients, it is refractory to treatment. The Src kinase Fyn mediated IFN-γ-induced increased permeability in model epithelia, and so we hypothesized that inhibition of Fyn kinase would be anti-colitic. Mice [B6.129SF2/J wild-type (WT), Fyn KO, or chimeras] received 2.5% dextran sodium sulfate (DSS) or normal water for 10 d and were necropsied immediately or 3 d later. Gut permeability was assessed by FITC-dextran flux, colitis by macroscopic and histologic parameters, and immune cell status by cytokine production and CD4(+) T cell Foxp3 expression. Fyn KO mice consistently displayed significantly worse DSS-induced disease than WT, correlating with decreased IL-10 and increased IL-17 in splenocytes and the gut; Fyn KO mice failed to thrive after removal of the DSS water. Analysis of chimeric mice indicated that the increased sensitivity to DSS was due to the lack of Fyn kinase in hematopoietic, but not stromal, cells, in accordance with Fyn(+) T cell increases in WT mice exposed to DSS and Fyn KO mice having a reduced number of CD4(+)Foxp3(+) cells in baseline or colitic conditions and a reduced capacity to induce Foxp3 expression in vitro. Other experiments suggest that the colonic microbiota in Fyn KO mice is not preferentially colitogenic. Contrary to our expectation, the absence of Fyn kinase resulted in greater DSS-induced disease, and analysis of chimeric mice indicated that leukocyte Fyn kinase is beneficial in limiting colitis. PMID:25877924

  15. T-cell regulatory mechanisms in specific immunotherapy.


    Jutel, Marek; Akdis, Cezmi A


    Allergen-specific immunotherapy (SIT) is the only treatment which leads to a lifelong tolerance against previously disease-causing allergens due to restoration of normal immunity against allergens. The description of T-regulatory (Treg) cells being involved in prevention of sensitization to allergens has led to great interest whether they represent a major target for allergen-SIT and whether it would be possible to manipulate Treg cells to increase its efficacy. Activationinduced cell death, anergy and/or immune response modulation by Treg cells are essential mechanisms of peripheral T-cell tolerance. There is growing evidence that anergy, tolerance and active suppression are not entirely distinct, but rather represent linked mechanisms possibly involving the same cells and multiple suppressor mechanisms. Skewing of allergen-specific effector T cells to Treg cells appears as a crucial event in the control of healthy immune response to allergens and successful allergen-SIT. The Treg cell response is characterized by abolished allergen- induced specific T-cell proliferation and suppressed Thelper (Th)1- and Th2-type cytokine secretion. In addition, mediators of allergic inflammation that trigger cAMP-associated G-protein-coupled receptors, such as histamine receptor-2, may contribute to peripheral tolerance mechanisms. The increased levels of interleukin-10 and transforming growth factor-Beta that are produced by Treg cells potently suppress IgE production, while simultaneously increasing production of non-inflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress effector cells of allergic inflammation such as mast cells, basophils and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms. It is associated with regulation of antibody isotypes and effector cells to the direction of a healthy immune response. By the application of the recent knowledge in Treg

  16. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin


    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  17. Role of Fyn-mediated NMDA receptor function in prediabetic neuropathy in mice.


    Suo, Meng; Wang, Ping; Zhang, Mengyuan


    Diabetic neuropathy is a common complication of diabetes. This study evaluated the role of Fyn kinase and N-methyl-d-aspartate receptors (NMDARs) in the spinal cord in diabetic neuropathy using an animal model of high-fat diet-induced prediabetes. We found that prediabetic wild-type mice exhibited tactile allodynia and thermal hypoalgesia after a 16-wk high-fat diet, relative to normal diet-fed wild-type mice. Furthermore, prediabetic wild-type mice exhibited increased tactile allodynia and thermal hypoalgesia at 24 wk relative to 16 wk. Such phenomena were correlated with increased expression and activation of NR2B subunit of NMDARs, as well as Fyn-NR2B interaction in the spinal cord. Fyn(-/-) mice developed prediabetes after 16-wk high-fat diet treatment and exhibited thermal hypoalgesia, without showing tactile allodynia or altered expression and activation of NR2B subunit, relative to normal diet-fed Fyn(-/-) mice. Finally, intrathecal administrations of Ro 25-6981 (selective NR2B subunit-containing NMDAR antagonist) dose-dependently alleviated tactile allodynia, but not thermal hypoalgesia, at 16 and 24 wk in prediabetic wild-type mice. Our results suggested that Fyn-mediated NR2B signaling plays a critical role in regulation of prediabetic neuropathy and that the increased expression/function of NR2B subunit-containing NMDARs may contribute to the progression of neuropathy in type 2 diabetes. PMID:27146985

  18. Fyn Mediates High Glucose-Induced Actin Cytoskeleton Reorganization of Podocytes via Promoting ROCK Activation In Vitro.


    Lv, Zhimei; Hu, Mengsi; Ren, Xiaoxu; Fan, Minghua; Zhen, Junhui; Chen, Liqun; Lin, Jiangong; Ding, Nannan; Wang, Qun; Wang, Rong


    Fyn, a member of the Src family of tyrosine kinases, is a key regulator in cytoskeletal remodeling in a variety of cell types. Recent studies have demonstrated that Fyn is responsible for nephrin tyrosine phosphorylation, which will result in polymerization of actin filaments and podocyte damage. Thus detailed involvement of Fyn in podocytes is to be elucidated. In this study, we investigated the potential role of Fyn/ROCK signaling and its interactions with paxillin. Our results presented that high glucose led to filamentous actin (F-actin) rearrangement in podocytes, accompanied by paxillin phosphorylation and increased cell motility, during which Fyn and ROCK were markedly activated. Gene knockdown of Fyn by siRNA showed a reversal effect on high glucose-induced podocyte damage and ROCK activation; however, inhibition of ROCK had no significant effects on Fyn phosphorylation. These observations demonstrate that in vitro Fyn mediates high glucose-induced actin cytoskeleton remodeling of podocytes via promoting ROCK activation and paxillin phosphorylation. PMID:26881253

  19. Fyn Mediates High Glucose-Induced Actin Cytoskeleton Reorganization of Podocytes via Promoting ROCK Activation In Vitro

    PubMed Central

    Lv, Zhimei; Hu, Mengsi; Ren, Xiaoxu; Fan, Minghua; Zhen, Junhui; Chen, Liqun; Lin, Jiangong; Ding, Nannan; Wang, Qun; Wang, Rong


    Fyn, a member of the Src family of tyrosine kinases, is a key regulator in cytoskeletal remodeling in a variety of cell types. Recent studies have demonstrated that Fyn is responsible for nephrin tyrosine phosphorylation, which will result in polymerization of actin filaments and podocyte damage. Thus detailed involvement of Fyn in podocytes is to be elucidated. In this study, we investigated the potential role of Fyn/ROCK signaling and its interactions with paxillin. Our results presented that high glucose led to filamentous actin (F-actin) rearrangement in podocytes, accompanied by paxillin phosphorylation and increased cell motility, during which Fyn and ROCK were markedly activated. Gene knockdown of Fyn by siRNA showed a reversal effect on high glucose-induced podocyte damage and ROCK activation; however, inhibition of ROCK had no significant effects on Fyn phosphorylation. These observations demonstrate that in vitro Fyn mediates high glucose-induced actin cytoskeleton remodeling of podocytes via promoting ROCK activation and paxillin phosphorylation. PMID:26881253

  20. Fyn kinase genetic ablation causes structural abnormalities in mature retina and defective Müller cell function.


    Chavez-Solano, Marbella; Ibarra-Sanchez, Alfredo; Treviño, Mario; Gonzalez-Espinosa, Claudia; Lamas, Monica


    Fyn kinase is widely expressed in neuronal and glial cells of the brain, where it exerts multiple functional roles that affect fundamental physiological processes. The aim of our study was to investigate the, so far unknown, functional role of Fyn in the retina. We report that Fyn is expressed, in vivo, in a subpopulation of Müller glia. We used a mouse model of Fyn genetic ablation and Müller-enriched primary cultures to demonstrate that Fyn deficiency induces morphological alterations in the mature retina, a reduction in the thickness of the outer and inner nuclear layers and alterations in postnatal Müller cell physiology. These include shortening of Müller cell processes, a decrease in cell proliferation, inactivation of the Akt signal transduction pathway, a reduced number of focal adhesions points and decreased adhesion of these cells to the ECM. As abnormalities in Müller cell physiology have been previously associated to a compromised retinal function we evaluated behavioral responses to visual stimulation. Our results associate Fyn deficiency with impaired visual optokinetic responses under scotopic and photopic light conditions. Our study reveals novel roles for Fyn kinase in retinal morphology and Müller cell physiology and suggests that Fyn is required for optimal visual processing. PMID:26808221

  1. Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas.


    Palomero, Teresa; Couronné, Lucile; Khiabanian, Hossein; Kim, Mi-Yeon; Ambesi-Impiombato, Alberto; Perez-Garcia, Arianne; Carpenter, Zachary; Abate, Francesco; Allegretta, Maddalena; Haydu, J Erika; Jiang, Xiaoyu; Lossos, Izidore S; Nicolas, Concha; Balbin, Milagros; Bastard, Christian; Bhagat, Govind; Piris, Miguel A; Campo, Elias; Bernard, Olivier A; Rabadan, Raul; Ferrando, Adolfo A


    Peripheral T cell lymphomas (PTCLs) are a heterogeneous and poorly understood group of non-Hodgkin lymphomas. Here we combined whole-exome sequencing of 12 tumor-normal DNA pairs, RNA sequencing analysis and targeted deep sequencing to identify new genetic alterations in PTCL transformation. These analyses identified highly recurrent epigenetic factor mutations in TET2, DNMT3A and IDH2 as well as a new highly prevalent RHOA mutation encoding a p.Gly17Val alteration present in 22 of 35 (67%) angioimmunoblastic T cell lymphoma (AITL) samples and in 8 of 44 (18%) PTCL, not otherwise specified (PTCL-NOS) samples. Mechanistically, the RHOA Gly17Val protein interferes with RHOA signaling in biochemical and cellular assays, an effect potentially mediated by the sequestration of activated guanine-exchange factor (GEF) proteins. In addition, we describe new and recurrent, albeit less frequent, genetic defects including mutations in FYN, ATM, B2M and CD58 implicating SRC signaling, impaired DNA damage response and escape from immune surveillance mechanisms in the pathogenesis of PTCL. PMID:24413734

  2. Alteration of de novo glucose production contributes to fasting hypoglycaemia in Fyn deficient mice.


    Yang, Yingjuan; Tarabra, Elena; Yang, Gong-She; Vaitheesvaran, Bhavapriya; Palacios, Gustavo; Kurland, Irwin J; Pessin, Jeffrey E; Bastie, Claire C


    Previous studies have demonstrated that glucose disposal is increased in the Fyn knockout (FynKO) mice due to increased insulin sensitivity. FynKO mice also display fasting hypoglycaemia despite decreased insulin levels, which suggested that hepatic glucose production was unable to compensate for the increased basal glucose utilization. The present study investigates the basis for the reduction in plasma glucose levels and the reduced ability for the liver to produce glucose in response to gluconeogenic substrates. FynKO mice had a 5-fold reduction in phosphoenolpyruvate carboxykinase (PEPCK) gene and protein expression and a marked reduction in pyruvate, pyruvate/lactate-stimulated glucose output. Remarkably, de novo glucose production was also blunted using gluconeogenic substrates that bypass the PEPCK step. Impaired conversion of glycerol to glucose was observed in both glycerol tolerance test and determination of the conversion of (13)C-glycerol to glucose in the fasted state. α-glycerol phosphate levels were reduced but glycerol kinase protein expression levels were not changed. Fructose-driven glucose production was also diminished without alteration of fructokinase expression levels. The normal levels of dihydroxyacetone phosphate and glyceraldehyde-3-phosphate observed in the FynKO liver extracts suggested normal triose kinase function. Fructose-bisphosphate aldolase (aldolase) mRNA or protein levels were normal in the Fyn-deficient livers, however, there was a large reduction in liver fructose-6-phosphate (30-fold) and fructose-1,6-bisphosphate (7-fold) levels as well as a reduction in glucose-6-phosphate (2-fold) levels. These data suggest a mechanistic defect in the allosteric regulation of aldolase activity. PMID:24312371

  3. Data supporting the role of Fyn in initiating myelination in the peripheral nervous system

    PubMed Central

    Miyamoto, Yuki; Tamano, Moe; Torii, Tomohiro; Kawahara, Kazuko; Nakamura, Kazuaki; Tanoue, Akito; Takada, Shuji; Yamauchi, Junji


    Transgenic mice, which express active Fyn tyrosine kinase under the control of a glial fibrillary acidic protein promoter, have been produced. This promoter induces protein expression in the initiation stage of myelination in the peripheral nervous system (PNS) “Phosphorylation of cytohesin-1 by Fyn is required for initiation of myelination and the extent of myelination during development (Yamauchi et al., 2015 [1])”. Herein we provide the data regarding myelination-related protein markers and myelin ultrastructure in transgenic mice. PMID:27115022

  4. Fyn Activation of mTORC1 Stimulates the IRE1α-JNK Pathway, Leading to Cell Death.


    Wang, Yichen; Yamada, Eijiro; Zong, Haihong; Pessin, Jeffrey E


    We previously reported that the skeletal muscle-specific overexpression of Fyn in mice resulted in a severe muscle wasting phenotype despite the activation of mTORC1 signaling. To investigate the bases for the loss of muscle fiber mass, we examined the relationship between Fyn activation of mTORC1, JNK, and endoplasmic reticulum stress. Overexpression of Fyn in skeletal muscle in vivo and in HEK293T cells in culture resulted in the activation of IRE1α and JNK, leading to increased cell death. Fyn synergized with the general endoplasmic reticulum stress inducer thapsigargin, resulting in the activation of IRE1α and further accelerated cell death. Moreover, inhibition of mTORC1 with rapamycin suppressed IRE1α activation and JNK phosphorylation, resulting in protecting cells against Fyn- and thapsigargin-induced cell death. Moreover, rapamycin treatment in vivo reduced the skeletal muscle IRE1α activation in the Fyn-overexpressing transgenic mice. Together, these data demonstrate the presence of a Fyn-induced endoplasmic reticulum stress that occurred, at least in part, through the activation of mTORC1, as well as subsequent activation of the IRE1α-JNK pathway driving cell death. PMID:26306048

  5. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia


    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  6. Arrestin-3 is essential for the activation of Fyn by the luteinizing hormone receptor (LHR) in MA-10 cells*

    PubMed Central

    Galet, Colette; Ascoli, Mario


    Recent studies showed that Fyn is a mediator of the LHR-induced activation of the ERK1/2 cascade in MA-10 cells. Since the LHR is a G protein-coupled receptor and the Src family of kinases can be activated by some Gα subunits and by the non-visual arrestins we investigated the role of these signaling molecules in the LHR-provoked activation of Fyn. Small interfering RNAs (siRNAs) that target two Gα subunits that participate in LHR signaling (Gαs and Gα11) and one that targets arrestin-3 were co-transfected with the hLHR in MA-10 cells. We then determined the effects of these siRNAs on the LHR-provoked activation of Fyn, the phosphorylation of FAK (a prominent Fyn substrate) and the release of EGF-like growth factors (a Fyn-mediated process). Expression of the siRNA against Gαs decreased the level of Gαs and LHR-stimulated cAMP production by ~50% but did not affect LHR-stimulated Fyn activation or FAK phosphorylation. Likewise, expression of the siRNA against Gα11 decreased the level of Gα11 and LHR-stimulated inositol phosphate production by ~50% but did not affect LHR-stimulated Fyn activation or FAK phosphorylation. Expression of the siRNA against arrestin-3 decreased the level of arrestin-3 and the rate of internalization of hCG by ~50% and it also inhibited the LHR-provoked stimulation of Fyn, the phosphorylation of FAK and the release of EGF-like growth factors. These results show that, in MA-10 cells, the hLHR activates Fyn through and arrestin-3-dependent pathway and that this pathway is a mediator of the hLHR-provoked release of EGF-like growth factors. PMID:18647647

  7. Regulation of natural cytotoxicity by the adaptor SAP and the Src-related kinase Fyn

    PubMed Central

    Bloch-Queyrat, Coralie; Fondanèche, Marie-Claude; Chen, Riyan; Yin, Luo; Relouzat, Francis; Veillette, André; Fischer, Alain; Latour, Sylvain


    SAP is an adaptor protein that is expressed in NK and T cells. It is mutated in humans who have X-linked lymphoproliferative (XLP) disease. By interacting with SLAM family receptors, SAP enables tyrosine phosphorylation signaling of these receptors by its ability to recruit the Src-related kinase, Fyn. Here, we analyzed the role of SAP in NK cell functions using the SAP-deficient mouse model. Our results showed that SAP was required for the ability of NK cells to eliminate tumor cells in vitro and in vivo. This effect strongly correlated with expression of CD48 on tumor cells, the ligand of 2B4, a SLAM-related receptor expressed in NK cells. In keeping with earlier reports that studied human NK cells, we showed that SAP was necessary for the ability of 2B4 to trigger cytotoxicity and IFN-γ secretion. In the absence of SAP, 2B4 function was shifted toward inhibition of NK cell–mediated cytotoxicity. By analyzing mice lacking Fyn, we showed that similarly to SAP, Fyn was strictly required for 2B4 function. Taken together, these results provide evidence that the 2B4-SAP-Fyn cascade defines a potent activating pathway of natural cytotoxicity. They also could help to explain the high propensity of patients who have XLP disease to develop lymphoproliferative disorders. PMID:15998796

  8. Brain-derived neurotrophic factor rapidly increases NMDA receptor channel activity through Fyn-mediated phosphorylation.


    Xu, Fei; Plummer, Mark R; Len, Guo-Wei; Nakazawa, Takanobu; Yamamoto, Tadashi; Black, Ira B; Wu, Kuo


    Brain-derived neurotrophic factor (BDNF) is a potent modulator of hippocampal synaptic plasticity. Previously, we found that one of the targets of BDNF modulation is NR2B-containing NMDA receptors. Furthermore, exposure to the trophin rapidly increases NMDA receptor activity and enhances tyrosine phosphorylation of NR2B in cortical and hippocampal postsynaptic densities (PSDs), potentially linking receptor phosphorylation to synaptic plasticity. To define the specific NR2B residue(s) regulated by BDNF, we focused on tyrosine 1472, phosphorylation of which increases after LTP. BDNF rapidly increased phosphorylation in cortical PSDs. The tyrosine kinase Fyn is critical since BDNF-dependent phosphorylation was abolished in Fyn knockout mice. Single-channel patch clamp recordings showed that Fyn is required for the increase in NMDA receptor activity elicited by BDNF. Collectively, our results suggest that BDNF enhances phosphorylation of NR2B tyrosine 1472 through activation of Fyn, leading to alteration of NMDA receptor activity and increased synaptic transmission. PMID:17045972

  9. Arsenic interferes with the signaling transduction pathway of T cell receptor activation by increasing basal and induced phosphorylation of Lck and Fyn in spleen cells

    SciTech Connect

    Soto-Pena, Gerson A.; Vega, Libia


    Arsenic is known to produce inhibition as well as induction of immune cells proliferative responses depending on the doses as one of its mechanisms of immunotoxicity. Here we evaluate the effect of arsenic exposure on the activation of splenic mononuclear cells (SMC) in male CD57BL6N mice. Intra-gastric exposure to arsenic (as sodium arsenite) for 30 days (1, 0.1, or 0.01 mg/kg/day), reduced the proportion of CD4+ cells and the CD4+/CD8+ ratio in the spleen, increasing the proportion of CD11b+ cells. Arsenic exposure did not modify the proportion of B cells. SMC showed an increased level of phosphorylation of lck and fyn kinases (first kinases associated to TCR complex when activated). Although normal levels of apoptosis were observed on freshly isolated SMC, an increase in apoptotic cells related with the increase in phosphorylation of lck and fyn was observed when SMC were activated with Concanavalin-A (Con-A). Arsenic exposure reduced the proliferative response of SMC to Con-A, and also reduced secretion of IL-2, IL-6, IL-12 and IFN{gamma}. No effect was observed on IL-4, and IL-10 secretion. The same effects were observed when SMC of exposed animals were activated with anti-CD3/CD28 antibodies for 24 h, but these effects were transitory since a recovery, up to control levels or even higher, were observed after 72 h of stimulation. This study demonstrates that repeated and prolonged exposure to arsenic alters cell populations and produces functional changes depending on the specific activation pathway, and could be related with the phosphorylation status of lck and fyn kinases.

  10. Role of Fyn kinase in signaling associated with epiboly during zebrafish development.


    Sharma, Dipika; Holets, Lesya; Zhang, Xiaoming; Kinsey, William H


    The function of Fyn kinase during zebrafish development through the blastula stage was investigated through the use of dominant-negative constructs designed to suppress the function of zebrafish c-Fyn. Microinjection of SH2 domain-containing fusion protein or mRNA encoding the mutated, catalytically inactive Fyn at 45 min post-insemination had no significant effect during cleavage and did not inhibit formation of the yolk syncitial layer. Smoothing of the enveloping cell layer at the midblastula transition occurred normally and expression of bon/mixer and mezzo, zygotic transcription factors indicated that activation of the zygotic genome did occur. Signaling pathways involved with axis determination such as beta-catenin, activin, and nodal appeared to function normally as evidenced by expression of boz, goosecoid, and mezzo. However, while formation of the yolk syncitial layer was normal, the marginal blastomeres failed to migrate toward the vegetal pole and epiboly did not occur, a phenotype similar but distinct from that resulting from suppression of c-Yes kinase. The block to development was prevented by co-injection of c-Fyn mRNA with the dominant-negative construct indicating that it was a specific effect. Injection of the dominant-negative mRNA into individual blastomeres indicated that the effect was exerted on the intrinsic ability of the individual blastomeres to respond to signals directing epiboly and not on the signals themselves. Analysis of the pattern of calcium signaling in experimental and control embryos demonstrated that the elevated [Ca2+]i characteristic of the marginal blastomeres was suppressed. Together, these observations indicate that Fyn kinase plays an important role in epiboly, possibly through its effects in calcium signaling. PMID:16112104

  11. DMBA induces tyrosine phosphorylation of PLC-[gamma]1 and activates the tyrosine kinases lck and fyn in the HPB-ALL human T-cell line

    SciTech Connect

    Archuleta, M.M.; Schieven, G.L.; Ledbetter, J.A.; Burchiel, S.W. . Coll. of Pharmacy)


    Previous studies in this laboratory have demonstrated that DMBA alters biochemical events associated with lymphocyte activation including formation of the second messenger IP[sub 3] and the release of intracellular Ca[sup 2+]. The purpose of the present studies was to evaluate the mechanisms by which DMBA induces IP[sub 3] formation and Ca[sup 2+] release by examining phosphorylation of membrane associated proteins and activation of protein tyrosine kinases lck and fyn. These studies demonstrated that exposure of HPB-ALL cells to 10[mu]M DMBA resulted in a time- and dose-dependent increase in tyrosine phosphorylation of PLC-[gamma]1 that correlated with our earlier findings of IP[sub 3] formation and Ca[sup 2+] release. These results indicate that the effects of DMBA on the PI-PLC signaling pathway are in part, the result of DMBA-induced tyrosine phosphorylation of the PLC-[gamma]1 enzyme. The mechanism of DMBA- induced tyrosine phosphorylation of PLC-[gamma]1 may be due to activation of fyn or lck kinase activity, since it was found that DMBA increased the activity of these PTKs by more than 2-fold. Therefore, these studies demonstrate that DMBA may disrupt T cell activation by stimulating PTK activation with concomitant tyrosine phosphorylation of PLC-[gamma]1, release of IP[sub 3], and mobilization of intracellular Ca[sup 2+].

  12. DMBA induces tyrosine phosphorylation of PLC-{gamma}1 and activates the tyrosine kinases lck and fyn in the HPB-ALL human T-cell line

    SciTech Connect

    Archuleta, M.M.; Schieven, G.L.; Ledbetter, J.A.; Burchiel, S.W.


    Previous studies in this laboratory have demonstrated that DMBA alters biochemical events associated with lymphocyte activation including formation of the second messenger IP{sub 3} and the release of intracellular Ca{sup 2+}. The purpose of the present studies was to evaluate the mechanisms by which DMBA induces IP{sub 3} formation and Ca{sup 2+} release by examining phosphorylation of membrane associated proteins and activation of protein tyrosine kinases lck and fyn. These studies demonstrated that exposure of HPB-ALL cells to 10{mu}M DMBA resulted in a time- and dose-dependent increase in tyrosine phosphorylation of PLC-{gamma}1 that correlated with our earlier findings of IP{sub 3} formation and Ca{sup 2+} release. These results indicate that the effects of DMBA on the PI-PLC signaling pathway are in part, the result of DMBA-induced tyrosine phosphorylation of the PLC-{gamma}1 enzyme. The mechanism of DMBA- induced tyrosine phosphorylation of PLC-{gamma}1 may be due to activation of fyn or lck kinase activity, since it was found that DMBA increased the activity of these PTKs by more than 2-fold. Therefore, these studies demonstrate that DMBA may disrupt T cell activation by stimulating PTK activation with concomitant tyrosine phosphorylation of PLC-{gamma}1, release of IP{sub 3}, and mobilization of intracellular Ca{sup 2+}.

  13. Fyn Deficiency Promotes a Preferential Increase in Subcutaneous Adipose Tissue Mass and Decreased Visceral Adipose Tissue Inflammation

    PubMed Central

    Lee, Ting-Wen A.; Kwon, Hyokjoon; Zong, Haihong; Yamada, Eijiro; Vatish, Manu; Pessin, Jeffrey E.; Bastie, Claire C.


    Previous studies have demonstrated that Fyn knockout (FynKO) mice on a standard chow diet display increased glucose clearance and whole-body insulin sensitivity associated with decreased adiposity resulting from increased fatty acid use and energy expenditure. Surprisingly, however, despite a similar extent of adipose tissue (AT) mass accumulation on a high-fat diet, the FynKO mice remained fully glucose tolerant and insulin sensitive. Physiologic analyses demonstrated that the FynKO mice had a combination of skewed AT expansion into the subcutaneous compartment rather than to the visceral depot, reduced AT inflammation associated with reduced T-cell and macrophage infiltration, and increased proportion of anti-inflammatory M2 macrophages. These data demonstrate that Fyn is an important regulator of whole-body integrative metabolism that coordinates AT expansion, inflammation, and insulin sensitivity in states of nutrient excess. These data further suggest that inhibition of Fyn function may provide a novel target to prevent AT inflammation, insulin resistance, and the dyslipidemia components of the metabolic syndrome. PMID:23321073

  14. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.


    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  15. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.


    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  16. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.


    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  17. Transcription factor-microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome

    PubMed Central



    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5–11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF-microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS-associated TF-microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir-355-5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF-microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  18. Transcription factor‑microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome.


    Liu, Hai-Ying; Huang, Yu-Ling; Liu, Jian-Qiao; Huang, Qing


    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5‑11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF‑microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS‑associated TF‑microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir‑355‑5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF‑microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  19. Translational regulatory mechanisms in persistent forms of synaptic plasticity.


    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu


    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  20. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela


    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  1. Ly-6A is required for T cell receptor expression and protein tyrosine kinase fyn activity.

    PubMed Central

    Lee, S K; Su, B; Maher, S E; Bothwell, A L


    To characterize the function of the Ly-6A antigen in T cell activation, antisense Ly-6 RNA was expressed in a stably transfected antigen-specific T cell clone. Reduced Ly-6A expression results in inhibition of responses to antigen, anti-TCR (anti-T cell receptor) crosslinking and concanavalin A plus recombinant interleukin 1 and causes impairment of in vitro fyn tyrosine kinase activity. More substantial reduction of Ly-6A results in reduction of TCR expression. Analysis of mRNA species indicates that the reduction is specific for the TCR beta chain. These data demonstrate that Ly-6A may regulate TCR expression and may be involved in early events of T cell activation via regulation of fyn tyrosine kinase activity. Images PMID:8187770

  2. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas


    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  3. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.


    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong


    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  4. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David


    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  5. Ser/Thr phosphorylation as a regulatory mechanism in bacteria

    PubMed Central

    Dworkin, Jonathan


    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggests that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases. PMID:25625314

  6. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.


    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  7. Essential role of PH domain and leucine-rich repeat protein phosphatase 2 in Nrf2 suppression via modulation of Akt/GSK3β/Fyn kinase axis during oxidative hepatocellular toxicity.


    Rizvi, F; Shukla, S; Kakkar, P


    Instances of sustained oxidative activity have been shown to involve dysregulation of Nrf2-mediated transcriptional induction; however, mechanisms warranting Nrf2-repression remain unclear. In this study, using primary rat hepatocytes, we have attempted to identify factors that may negatively influence Nrf2 survival pathway. Though studies indicate a conspicuous association between Akt and Nrf2, a confirmatory link between the two is unaddressed. On inhibiting PI3K/Akt pathway, we observed compromised activities of antioxidant and detoxification enzymes culminating in oxidative cytotoxicity. This was accompanied by reduced nuclear retention of Nrf2 and its ARE binding affinity, increased Nrf2 ubiquitination and concurrent decline in its downstream targets. Moreover, Akt inhibition enhanced nuclear translocation as well as phosphorylation of Fyn kinase, an enzyme linked to Nrf2 degradation, by relieving GSK3β from phosphorylation-mediated repression. The involvement of Akt and Fyn kinase in influencing Nrf2 signaling was further confirmed in oxidatively stressed hepatocytes by using tert-butyl hydroperoxide (tBHP). tBHP-induced decrease in Nrf2 levels was associated with enhanced Fyn kinase phosphorylation, Fyn kinase nuclear translocation and decreased levels of phosphorylated GSK3β(Ser9) in a time-dependent manner. Interestingly, tBHP induced site-specific deactivation of Akt as only Akt(Ser473) phosphorylation was observed to be affected. Further, protein expression as well as nuclear localization of PHLPP2, a phosphatase specific for Akt(Ser473), was found to be significantly enhanced in tBHP-stressed hepatocytes. Silencing of PHLPP2 not only resulted in considerable restoration of Nrf2 signaling, enhanced Nrf2-ARE binding and reduced Nrf2 ubiquitination but also significantly suppressed tBHP-induced ROS generation and alterations in mitochondrial permeability. We infer that cellular PHLPP2 levels may aggravate oxidative toxicity by suppressing Nrf2/ARE

  8. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi


    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  9. Novel RNA regulatory mechanisms revealed in the epitranscriptome.


    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E


    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  10. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.


    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi


    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  11. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.


    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  12. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  13. A Central Nervous System-Dependent Intron-Embedded Gene Encodes a Novel Murine Fyn Binding Protein

    PubMed Central

    Ben Khalaf, Noureddine; Taha, Safa; Bakhiet, Moiz; Fathallah, M. Dahmani


    The interplay between the nervous and immune systems is gradually being unraveled. We previously reported in the mouse the novel soluble immune system factor ISRAA, whose activation in the spleen is central nervous system-dependent. We also showed that ISRAA plays a role in modulating anti-infection immunity. Herein, we report the genomic description of the israa locus, along with some insights into the structure-function relationship of the protein. Our findings revealed that israa is nested within intron 6 of the mouse zmiz1 gene. Protein sequence analysis revealed a typical SH2 binding motif (Y102TEV), with Fyn being the most likely binding partner. Docking simulation showed a favorable conformation for the ISRAA-Fyn complex, with a specific binding mode for the binding of the YTEV motif to the SH2 domain. Experimental studies showed that in vitro, recombinant ISRAA is phosphorylated by Fyn at tyrosine 102. Cell transfection and pull-down experiments revealed Fyn as a binding partner of ISRAA in the EL4 mouse T-cell line. Indeed, we demonstrated that ISRAA downregulates T-cell activation and the phosphorylation of an activation tyrosine (Y416) of Src-family kinases in mouse splenocytes. Our observations highlight ISRAA as a novel Fyn binding protein that is likely to be involved in a signaling pathway driven by the nervous system. PMID:26901312

  14. Oligodendroglial p130Cas is a target of Fyn kinase involved in process formation, cell migration and survival.


    Gonsior, Constantin; Binamé, Fabien; Frühbeis, Carsten; Bauer, Nina M; Hoch-Kraft, Peter; Luhmann, Heiko J; Trotter, Jacqueline; White, Robin


    Oligodendrocytes are the myelinating glial cells of the central nervous system. In the course of brain development, oligodendrocyte precursor cells migrate, scan the environment and differentiate into mature oligodendrocytes with multiple cellular processes which recognize and ensheath neuronal axons. During differentiation, oligodendrocytes undergo dramatic morphological changes requiring cytoskeletal rearrangements which need to be tightly regulated. The non-receptor tyrosine kinase Fyn plays a central role in oligodendrocyte differentiation and myelination. In order to improve our understanding of the role of oligodendroglial Fyn kinase, we have identified Fyn targets in these cells. Purification and mass-spectrometric analysis of tyrosine-phosphorylated proteins in response to overexpressed active Fyn in the oligodendrocyte precursor cell line Oli-neu, yielded the adaptor molecule p130Cas. We analyzed the function of this Fyn target in oligodendroglial cells and observed that reduction of p130Cas levels by siRNA affects process outgrowth, the thickness of cellular processes and migration behavior of Oli-neu cells. Furthermore, long term p130Cas reduction results in decreased cell numbers as a result of increased apoptosis in cultured primary oligodendrocytes. Our data contribute to understanding the molecular events taking place during oligodendrocyte migration and morphological differentiation and have implications for myelin formation. PMID:24586768

  15. Alzheimer Amyloid-β Oligomer Bound to Post-Synaptic Prion Protein Activates Fyn to Impair Neurons

    PubMed Central

    Um, Ji Won; Nygaard, Haakon B.; Heiss, Jacqueline K.; Kostylev, Mikhail A.; Stagi, Massimiliano; Vortmeyer, Alexander; Wisniewski, Thomas; Gunther, Erik C.; Strittmatter, Stephen M.


    SUMMARY Amyloid-beta (Aβ) oligomers are thought to trigger Alzheimer’s disease (AD) pathophysiology. Cellular Prion Protein (PrPC) selectively binds oligomeric Aβ and can mediate AD-related phenotypes. Here, we examined the specificity, distribution and signaling from Aβ/PrP complexes, seeking to explain how they might alter the function of NMDA receptors in neurons. PrPC is enriched in post-synaptic densities, and Aβ/PrPC interaction leads to Fyn kinase activation. Soluble Aβ assemblies derived from human AD brain interact with PrPC to activate Fyn. Aβ engagement of PrPC/Fyn signaling yields phosphorylation of the NR2B subunit of NMDA-receptors, which is coupled to an initial increase and then loss of surface NMDA-receptors. Aβ-induced LDH release and dendritic spine loss require both PrPC and Fyn, and human familial AD transgene-induced convulsive seizures do not occur in mice lacking PrPC. These results delineate an Aβ oligomer signal transduction pathway requiring PrPC and Fyn to alter synaptic function with relevance to AD. PMID:22820466

  16. Oligodendroglial p130Cas Is a Target of Fyn Kinase Involved in Process Formation, Cell Migration and Survival

    PubMed Central

    Gonsior, Constantin; Binamé, Fabien; Frühbeis, Carsten; Bauer, Nina M.; Hoch-Kraft, Peter; Luhmann, Heiko J.; Trotter, Jacqueline; White, Robin


    Oligodendrocytes are the myelinating glial cells of the central nervous system. In the course of brain development, oligodendrocyte precursor cells migrate, scan the environment and differentiate into mature oligodendrocytes with multiple cellular processes which recognize and ensheath neuronal axons. During differentiation, oligodendrocytes undergo dramatic morphological changes requiring cytoskeletal rearrangements which need to be tightly regulated. The non-receptor tyrosine kinase Fyn plays a central role in oligodendrocyte differentiation and myelination. In order to improve our understanding of the role of oligodendroglial Fyn kinase, we have identified Fyn targets in these cells. Purification and mass-spectrometric analysis of tyrosine-phosphorylated proteins in response to overexpressed active Fyn in the oligodendrocyte precursor cell line Oli-neu, yielded the adaptor molecule p130Cas. We analyzed the function of this Fyn target in oligodendroglial cells and observed that reduction of p130Cas levels by siRNA affects process outgrowth, the thickness of cellular processes and migration behavior of Oli-neu cells. Furthermore, long term p130Cas reduction results in decreased cell numbers as a result of increased apoptosis in cultured primary oligodendrocytes. Our data contribute to understanding the molecular events taking place during oligodendrocyte migration and morphological differentiation and have implications for myelin formation. PMID:24586768

  17. AlphaScreen HTS and Live Cell Bioluminescence Resonance Energy Transfer (BRET) Assays for Identification of Tau–Fyn SH3 Interaction Inhibitors for Alzheimer’s Disease

    PubMed Central

    Cochran, J. Nicholas; Diggs, Pauleatha V.; Nebane, N. Miranda; Rasmussen, Lynn; White, E. Lucile; Bostwick, Robert; Maddry, Joseph A.; Suto, Mark J.; Roberson, Erik D.


    Alzheimer’s Disease (AD) is the most common neurodegenerative disease and with Americans’ increasing longevity it is becoming an epidemic. There are currently no effective treatments for this disorder. Abnormalities of Tau track more closely with cognitive decline than the most studied therapeutic target in AD, amyloid-beta, but the optimal strategy for targeting Tau has not yet been identified. Based on considerable preclinical data from AD models, we hypothesize that interactions between Tau and the Src-family tyrosine kinase, Fyn, are pathogenic in AD. Genetically reducing either Tau or Fyn is protective in AD mouse models, and a dominant negative fragment of Tau that alters Fyn localization is also protective. Here, we describe a new AlphaScreen assay and a live-cell BRET assay using a novel BRET pair for quantifying the Tau–Fyn interaction. We used these assays to map the binding site on Tau for Fyn to the 5th and 6th PXXP motifs, to show that AD-associated phosphorylation at MARK sites increase the affinity of the Tau–Fyn interaction, and to identify Tau–Fyn interaction inhibitors by HTS. This screen has identified a variety of chemically tractable hits, suggesting that the Tau–Fyn interaction may represent a good drug target for AD. PMID:25156556

  18. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.


    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa


    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  19. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.


    Loli, Denise; Bicudo, José Eduardo P W


    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  20. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.


    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne


    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  1. An indoxyl compound 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, suppresses activation of Fyn kinase in mast cells and IgE-mediated allergic responses in mice

    SciTech Connect

    Lee, Jun Ho; Kim, Tae Hyung; Kim, Hyuk Soon; Kim, A-Ram; Kim, Do-Kyun; Nam, Seung Taek; Kim, Hyun Woo; Park, Young Hwan; Her, Erk; Park, Yeong Min; Kim, Hyung Sik; Kim, Young Mi; Choi, Wahn Soo


    Mast cells, constituents of virtually all organs and tissues, are critical cells in IgE-mediated allergic responses. The aim of this study was to investigate the effect and mechanism of an indoxyl chromogenic compound, 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, on IgE-mediated mast cell activation and allergic responses in mice. CAC-0982 reversibly suppressed antigen-stimulated degranulation in murine mast cells (IC{sub 50}, ~ 3.8 μM) and human mast cells (IC{sub 50}, ~ 3.0 μM). CAC-0982 also inhibited the expression and secretion of IL-4 and TNF-α in mast cells. Furthermore, CAC-0982 suppressed the mast cell-mediated allergic responses in mice in a dose-dependent manner (ED{sub 50} 27.9 mg/kg). As for the mechanism, CAC-0982 largely suppressed the phosphorylation of Syk and its downstream signaling molecules, including LAT, Akt, Erk1/2, p38, and JNK. Notably, the tyrosine kinase assay of antigen-stimulated mast cells showed that CAC-0982 inhibited Fyn kinase, one of the upstream tyrosine kinases for Syk activation in mast cells. Taken together, these results suggest that CAC-0982 may be used as a new treatment for regulating IgE-mediated allergic diseases through the inhibition of the Fyn/Syk pathway in mast cells. - Highlights: • The anti-allergic effect of 5-bromo-4-chloro-3-indolyl 1,3-diacetate, CAC-0982, was measured. • CAC-0982 reversibly suppressed the activation of mast cells by IgE and antigen. • CAC-0982 inhibited passive cutaneous anaphylaxis in mice. • CAC-0982 suppresses mast cells through inhibition of Fyn activation in mast cells.

  2. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel


    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  3. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.


    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua


    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells. PMID:26051475

  4. MOBP levels are regulated by Fyn kinase and affect the morphological differentiation of oligodendrocytes.


    Schäfer, Isabelle; Müller, Christina; Luhmann, Heiko J; White, Robin


    Oligodendrocytes are the myelinating glial cells of the central nervous system (CNS). Myelin is formed by extensive wrapping of oligodendroglial processes around axonal segments, which ultimately allows a rapid saltatory conduction of action potentials within the CNS and sustains neuronal health. The non-receptor tyrosine kinase Fyn is an important signaling molecule in oligodendrocytes. It controls the morphological differentiation of oligodendrocytes and is an integrator of axon-glial signaling cascades leading to localized synthesis of myelin basic protein (MBP), which is essential for myelin formation. The abundant myelin-associated oligodendrocytic basic protein (MOBP) resembles MBP in several aspects and has also been reported to be localized as mRNA and translated in the peripheral myelin compartment. The signals initiating local MOBP synthesis are so far unknown and the cellular function of MOBP remains elusive. Here, we show, by several approaches in cultured primary oligodendrocytes, that MOBP synthesis is stimulated by Fyn activity. Moreover, we reveal a new function for MOBP in oligodendroglial morphological differentiation. PMID:26801084

  5. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen


    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  6. Metabolic and transcriptional regulatory mechanisms underlying the anoxic adaptation of rice coleoptile.


    Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup


    The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389

  7. Novel Regulatory Mechanisms of Pathogenicity and Virulence to Combat MDR in Candida albicans

    PubMed Central

    Hameed, Saif; Fatima, Zeeshan


    Continuous deployment of antifungals in treating infections caused by dimorphic opportunistic pathogen Candida albicans has led to the emergence of drug resistance resulting in cross-resistance to many unrelated drugs, a phenomenon termed multidrug resistance (MDR). Despite the current understanding of major factors which contribute to MDR mechanisms, there are many lines of evidence suggesting that it is a complex interplay of multiple factors which may be contributed by still unknown mechanisms. Coincidentally with the increased usage of antifungal drugs, the number of reports for antifungal drug resistance has also increased which further highlights the need for understanding novel molecular mechanisms which can be explored to combat MDR, namely, ROS, iron, hypoxia, lipids, morphogenesis, and transcriptional and signaling networks. Considering the worrying evolution of MDR and significance of C. albicans being the most prevalent human fungal pathogen, this review summarizes these new regulatory mechanisms which could be exploited to prevent MDR development in C. albicans as established from recent studies. PMID:24163696

  8. Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis

    PubMed Central

    Fox, Kristina A.; Ramesh, Arati; Stearns, Jennifer E.; Bourgogne, Agathe; Reyes-Jara, Angelica; Winkler, Wade C.; Garsin, Danielle A.


    Ethanolamine, a product of the breakdown of phosphatidylethanolamine from cell membranes, is abundant in the human intestinal tract and in processed foods. Effective utilization of ethanolamine as a carbon and nitrogen source may provide a survival advantage to bacteria that inhabit the gastrointestinal tract and may influence the virulence of pathogens. In this work, we describe a unique series of posttranscriptional regulatory strategies that influence expression of ethanolamine utilization genes (eut) in Enterococcus, Clostridium, and Listeria species. One of these mechanisms requires an unusual 2-component regulatory system. Regulation involves specific sensing of ethanolamine by a sensor histidine kinase (EutW), resulting in autophosphorylation and subsequent phosphoryl transfer to a response regulator (EutV) containing a RNA-binding domain. Our data suggests that EutV is likely to affect downstream gene expression by interacting with conserved transcription termination signals located within the eut locus. Breakdown of ethanolamine requires adenosylcobalamin (AdoCbl) as a cofactor, and, intriguingly, we also identify an intercistronic AdoCbl riboswitch that has a predicted structure different from previously established AdoCbl riboswitches. We demonstrate that association of AdoCbl to this riboswitch prevents formation of an intrinsic transcription terminator element located within the intercistronic region. Together, these results suggest an intricate and carefully coordinated interplay of multiple regulatory strategies for control of ethanolamine utilization genes. Gene expression appears to be directed by overlapping posttranscriptional regulatory mechanisms, each responding to a particular metabolic signal, conceptually akin to regulation by multiple DNA-binding transcription factors. PMID:19246383

  9. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN.


    Pei, Changan; Qin, Shiyong; Wang, Minghai; Zhang, Shuguang


    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN‑overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN‑VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV‑NELIN‑siRNA‑VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN‑VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α‑actin and total Ras homolog gene family member A (RhoA) protein expression. The intra‑nuclear translocation of SMα‑actin‑serum response factor (SMα‑actin‑SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y‑27632, SRF and SMα‑actin expression decreased. However, cells in the LV‑NELIN‑siRNA‑VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα‑actin protein and total RhoA protein was decreased. The occurrence of SRF extra‑nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα‑actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN‑induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling

  10. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.


    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A


    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation. PMID:25222226

  11. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central


    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  12. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.


    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J


    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  13. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.


    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas


    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  14. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas


    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  15. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana


    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  16. The human sperm acrosome reaction: physiology and regulatory mechanisms. An update.


    Brucker, C; Lipford, G B


    The acrosome reaction is a crucial step during gamete interaction in all species, including man. It allows spermatozoa to penetrate the zona pellucida and fuse with the oocyte membrane. Spermatozoa unable to undergo the acrosome reaction will not fertilize intact oocytes. This article concentrates on the characteristics and regulatory mechanisms of the acrosome reaction in human spermatozoa. During recent years, various entities found in the vicinity of the ovulated oocyte have been identified as stimulators of the acrosome reaction, of which zona protein is considered the prime physiological inducer in vivo. The steroid hormone progesterone has been shown to evoke critical responses in sperm cells leading to the acrosome reaction. Calcium has also been shown to play a central role during the acrosome reaction. Calcium flux is induced specifically by progesterone in capacitated and uncapacitated sperm cells, whereas only capacitated spermatozoa are able to subsequently complete the acrosome reaction. Progesterone as well as zona protein has been shown to evoke crucial responses within human spermatozoa, shedding light on the cascade of intracellular signalling events leading to the completion of the acrosome reaction. Furthermore, chemical agents which bring about the reaction in vitro, such as the ionophores ionomycin or A23187, have been used to shed light on its regulatory mechanisms. A number of molecules have been postulated to regulate the acrosome reaction in mammals, for example a galactosyl-transferase and a sperm protein tyrosine kinase. In addition, a novel protein, termed SAA-1, that was first detected on human spermatozoa is discussed with respect to its potential role as a regulatory protein closely involved in the initiation of the acrosome reaction. PMID:9080206

  17. p120 Catenin-Associated Fer and Fyn Tyrosine Kinases Regulate β-Catenin Tyr-142 Phosphorylation and β-Catenin-α-Catenin Interaction

    PubMed Central

    Piedra, Jose; Miravet, Susana; Castaño, Julio; Pálmer, Héctor G.; Heisterkamp, Nora; García de Herreros, Antonio; Duñach, Mireia


    β-Catenin has a key role in the formation of adherens junction through its interactions with E-cadherin and α-catenin. We show here that interaction of β-catenin with α-catenin is regulated by the phosphorylation of β-catenin Tyr-142. This residue can be phosphorylated in vitro by Fer or Fyn tyrosine kinases. Transfection of these kinases to epithelial cells disrupted the association between both catenins. We have also examined whether these kinases are involved in the regulation of this interaction by K-ras. Stable transfectants of the K-ras oncogene in intestinal epithelial IEC18 cells were generated which show little α-catenin-β-catenin association with respect to control clones; this effect is accompanied by increased Tyr-142 phosphorylation and activation of Fer and Fyn kinases. As reported for Fer, Fyn kinase is constitutively bound to p120 catenin; expression of K-ras induces the phosphorylation of p120 catenin on tyrosine residues increasing its affinity for E-cadherin and, consequently, promotes the association of Fyn with the adherens junction complex. Yes tyrosine kinase also binds to p120 catenin but only upon activation, and stimulates Fer and Fyn tyrosine kinases. These results indicate that p120 catenin acts as a docking protein facilitating the activation of Fer/Fyn tyrosine kinases by Yes and demonstrate the role of these p120 catenin-associated kinases in the regulation of β-catenin-α-catenin interaction. PMID:12640114

  18. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.


    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas


    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells. PMID:26200095

  19. Mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis.


    Xu, Wen; Fazekas, Gyorgy; Hara, Hideo; Tabira, Takeshi


    The mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis (EAE) was studied in SJL/J mice. In vivo experiments showed that NK cell depletion by anti-NK1.1 monoclonal antibody treatment enhanced EAE in mice. To investigate the mechanism, we cultured proteolipid protein (PLP)136-150 peptide-specific, encephalitogenic T cell lines, which were used as the NK cell target. Our results show that NK cells exert a direct cytotoxic effect on autoantigen-specific, encephalitogenic T cells. Furthermore, cytotoxicity to PLP-specific, encephalitogenic T line cells was enhanced by using enriched NK cells as effector cells. However, the cytotoxic effect of NK cells to ovalbumin-specific T line cells and ConA-stimulated T cells could also be detected with a lesser efficiency. Our studies indicate that NK cells play a regulatory role in EAE through killing of syngeneic T cells which include myelin antigen-specific, encephalitogenic T cells, and thus ameliorate EAE. PMID:15885305

  20. Gene expression in maturing neurons: regulatory mechanisms and related neurodevelopmental disorders.


    Ding, Baojin


    During the central nervous system (CNS) development, the interactions between intrinsic genes and extrinsic environment ensure that each neuronal developmental stage (eg. neuronal proliferation, differentiation, migration, axon extension, dendritogenesis and formation of functional synapses) occurs in the proper timing and sequence. The successful coordination requires that numerous groups of genes are exquisitely regulated in a spatiotemporal manner by various regulatory mechanisms, including sequence-specific DNA-binding proteins, histone modifications, DNA methylation, chromatin remodeling, and microRNAs (miRNAs). By targeting chromatin structure, transcription and translation processes, these mechanisms form a regulatory network to accomplish the fine regulation of gene expression in response to environmental stimuli at different developmental stages. Dysregulation of the gene expression during neuronal development has been shown to be implicated in a number of neurodevelopmental disorders, such as autism spectrum disorders (ASD), Rett syndrome (RTT), Fragile-X syndrome (FXS) and other genetic diseases. The further understanding of the regulation of gene expression during neuronal development may provide new approaches for the diagnosis and treatment of these disorders. PMID:25896042

  1. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Zeng, Shaohua; Xiao, Gong; Wei, Guoyan; Liao, Sihong; Chen, Jianjun; Sun, Wei; Lv, Haiyan; Wang, Ying


    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs). However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated 12 structural genes and two putative transcription factors (TFs) in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C, and icariin) decreased slightly or dramatically in two lines of Epimedium sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1), together with a bHLH TF (EsGL3) and WD40 protein (EsTTG1), were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase) in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering, and molecular breeding studies of Epimedium species. PMID:26388888

  2. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean.


    Liu, Yunfeng; Zhang, Dajian; Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin


    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  3. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin


    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  4. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi


    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  5. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M


    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: PMID:24867637

  6. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.


    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  7. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.


    Kianianmomeni, Arash


    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  8. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf


    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  9. Transcriptional Control of Photosynthesis Genes: The Evolutionarily Conserved Regulatory Mechanism in Plastid Genome Function

    PubMed Central

    Puthiyaveetil, Sujith; Ibrahim, Iskander M.; Jeličić, Branka; Tomašić, Ana; Fulgosi, Hrvoje; Allen, John F.


    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts—photosynthetic plastids—in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  10. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin


    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  11. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.


    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H


    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  12. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank


    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  13. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.


    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao


    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  14. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central


    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  15. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.


    Li, Junlin; Zhao, Guifang; Gao, Xiaocai


    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  16. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.


    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian


    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  17. Atomistic Insights into Regulatory Mechanisms of the HER2 Tyrosine Kinase Domain: A Molecular Dynamics Study

    PubMed Central

    Telesco, Shannon E.; Radhakrishnan, Ravi


    HER2 (ErbB2/Neu) is a receptor tyrosine kinase belonging to the epidermal growth factor receptor (EGFR)/ErbB family and is overexpressed in 20–30% of human breast cancers. Although several crystal structures of ErbB kinases have been solved, the precise mechanism of HER2 activation remains unknown, and it has been suggested that HER2 is unique in its requirement for phosphorylation of Y877, a key tyrosine residue located in the activation loop. To elucidate mechanistic details of kinase domain regulation, we performed molecular dynamics simulations of a homology-modeled HER2 kinase structure in active and inactive conformations. Principal component analysis of the atomistic fluctuations reveals a tight coupling between the activation loop and catalytic loop that may contribute to alignment of residues required for catalysis in the active kinase. The free energy perturbation method is also employed to predict a role for phosphorylated Y877 in stabilizing the kinase conformations. Finally, simulation results are presented for a HER2/EGFR heterodimer and reveal that the dimeric interface induces a rearrangement of the αC helix toward the active conformation. Elucidation of the molecular regulatory mechanisms in HER2 will help establish structure-function relationships in the wild-type kinase, as well as predict mutations with a propensity for constitutive activation in HER2-mediated cancers. PMID:19289058

  18. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus.


    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei


    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3'-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  19. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei


    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  20. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José


    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  1. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.


    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen


    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  2. Postsynaptic density protein 95-regulated NR2B tyrosine phosphorylation and interactions of Fyn with NR2B in levodopa-induced dyskinesia rat models

    PubMed Central

    Ba, Maowen; Kong, Min; Ma, Guozhao


    Context Abnormality in interactions between N-methyl-d-aspartate (NMDA) receptor and its signaling molecules occurs in the lesioned striatum in Parkinson’s disease (PD) and levodopa-induced dyskinesia (LID). It was reported that Fyn-mediated NR2B tyrosine phosphorylation, can enhance NMDA receptor function. Postsynaptic density protein 95 (PSD-95), one of the synapse-associated proteins, regulates interactions between receptor and downstream-signaling molecules. In light of the relationship between PSD-95, NR2B, and Fyn kinases, does PSD-95 contribute to the overactivity of NMDA receptor function induced by dopaminergic treatment? To further prove the possibility, the effects of regulating the PSD-95 expression on the augmented NR2B tyrosine phosphorylation and on the interactions of Fyn and NR2B in LID rat models were evaluated. Methods In the present study, parkinsonian rat models were established by injecting 6-hydroxydopamine. Subsequently, valid PD rats were treated with levodopa (50 mg/kg/day with benserazide 12.5 mg/kg/day, twice daily) intraperitoneally for 22 days to create LID rat models. Then, the effect of pretreatment with an intrastriatal injection of the PSD-95mRNA antisense oligonucleotides (PSD-95 ASO) on the rotational response to levodopa challenge was assessed. The effects of pretreatment with an intrastriatal injection of PSD-95 ASO on the augmented NR2B tyrosine phosphorylation and interactions of Fyn with NR2B in the LID rat models were detected by immunoblotting and immunoprecipitation. Results Levodopa administration twice daily for 22 days to parkinsonian rats shortened the rotational duration and increased the peak turning responses. The altered rotational responses were attenuated by PSD-95 ASO pretreatment. Meanwhile, PSD-95 ASO pretreatment decreased the level of PSD-95 protein expression and reduced both the augmented NR2B tyrosine phosphorylation and interactions of Fyn with NR2B triggered during the levodopa administration in the

  3. Understanding the cellular roles of Fyn-related kinase (FRK): implications in cancer biology.


    Goel, Raghuveera Kumar; Lukong, Kiven Erique


    The non-receptor tyrosine kinase Fyn-related kinase (FRK) is a member of the BRK family kinases (BFKs) and is distantly related to the Src family kinases (SFKs). FRK was first discovered in 1993, and studies pursued thereafter attributed a potential tumour-suppressive function to the enzyme. In recent years, however, further functional characterization of the tyrosine kinase in diverse cancer types suggests that FRK may potentially play an oncogenic role as well. Specifically, while ectopic expression of FRK suppresses cell proliferation and migration in breast and brain cancers, knockdown or catalytic inhibition of FRK suppresses these cellular processes in pancreatic and liver cancer. Such functional paradox is therefore evidently exhibited in a tissue-specific context. This review sheds light on the recent developments emerged from investigations on FRK which include: (a) a review of the expression pattern of the protein in mammalian cells/tissues, (b) underlying genomic perturbations and (c) a mechanistic function of the enzyme across different cellular environments. Given its functional heterogeneity observed across different cancers, we also discuss the therapeutic significance of FRK. PMID:27067725

  4. Mechanisms of allergen-specific immunotherapy: T-regulatory cells and more.


    Verhagen, Johan; Blaser, Kurt; Akdis, Cezmi A; Akdis, Mübeccel


    Activation-induced cell death, anergy, or immune response modulation by regulatory T cells (Treg cells) are essential mechanisms of peripheral T-cell tolerance. Genetic predisposition and environmental instructions tune thresholds for the activation of T cells, other inflammatory cells, and resident tissue cells in allergic diseases. Skewing allergen-specific effector T cells to a Treg-cell phenotype seems to be crucial in maintaining a healthy immune response to allergens and successful allergen-specific immunotherapy. The Treg-cell response is characterized by an abolished allergen-specific T-cell proliferation and the suppressed secretion of T-helper 1- and T-helper 2-type cytokines. Suppressed proliferative and cytokine responses against allergens are induced by multiple suppressor factors, including cytokines such as interleukin-10 (IL-10) and transforming growth factor beta (TGF-beta), and cell surface molecules such as cytotoxic T-lymphocyte antigen-4, programmed death-1, and histamine receptor 2. The increased levels of IL-10 and TGF-beta produced by Treg cells potently suppress IgE production while simultaneously increasing the production of noninflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress the activity of effector cells of allergic inflammation, such as mast cells, basophils, and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms on T cells, regulation of antibody isotypes, and suppression of effector cells. The application of current knowledge of Treg cells and related mechanisms of peripheral tolerance may soon lead to more rational and safer approaches to the prevention and cure of allergic disease. PMID:16701141

  5. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K


    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  6. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma


    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  7. Regulatory mechanism of the flavoprotein Tah18-dependent nitric oxide synthesis and cell death in yeast.


    Yoshikawa, Yuki; Nasuno, Ryo; Kawahara, Nobuhiro; Nishimura, Akira; Watanabe, Daisuke; Takagi, Hiroshi


    Nitric oxide (NO) is a ubiquitous signaling molecule involved in the regulation of a large number of cellular functions. The regulatory mechanism of NO generation in unicellular eukaryotic yeast cells is poorly understood due to the lack of mammalian and bacterial NO synthase (NOS) orthologues, even though yeast produces NO under oxidative stress conditions. Recently, we reported that the flavoprotein Tah18, which was previously shown to transfer electrons to the iron-sulfur cluster protein Dre2, is involved in NOS-like activity in the yeast Saccharomyces cerevisiae. On the other hand, Tah18 was reported to promote apoptotic cell death after exposure to hydrogen peroxide (H2O2). Here, we showed that NOS-like activity requiring Tah18 induced cell death upon treatment with H2O2. Our experimental results also indicate that Tah18-dependent NO production and cell death are suppressed by enhancement of the interaction between Tah18 and its molecular partner Dre2. Our findings indicate that the Tah18-Dre2 complex regulates cell death as a molecular switch via Tah18-dependent NOS-like activity in response to environmental changes. PMID:27178802

  8. Identification of regulatory mechanisms of intestinal folate transport in condition of folate deficiency.


    Thakur, Shilpa; Rahat, Beenish; Hamid, Abid; Najar, Rauf Ahmad; Kaur, Jyotdeep


    Folic acid is an essential micronutrient, deficiency of which can lead to disturbance in various metabolic processes of cell. Folate transport across intestine occurs via the involvement of specialized folate transporters viz. proton coupled folate transporter (PCFT) and reduced folate carrier (RFC), which express at the membrane surfaces. The current study was designed to identify the regulatory mechanisms underlying the effects of folate deficiency (FD) on folate transport in human intestinal cell line as well as in rats and to check the reversibility of such effects. Caco-2 cells were grown for five generations in control and FD medium. Following treatment, one subgroup of cells was shifted on folate sufficient medium and grown for three more generations. Similarly, rats were fed an FD diet for 3 and 5 months, and after 3 months of FD treatment, one group of rats were shifted on normal folate-containing diet. Increase in folate transport and expression of folate transporters were observed on FD treatment. However, when cells and rats were shifted to control conditions after treatment, transport and expression of these genes restored to the control level. FD was found to have no impact on promoter methylation of PCFT and RFC; however, messenger RNA stability of transporters was found to be decreased, suggesting some adaptive response. Overall, increased expression of transporters under FD conditions can be attributed to enhanced rate of transcription of folate transporters and also to the increased binding of specificity protein 1 transcription factor to the RFC promoter only. PMID:26168702

  9. Protein Tyrosine Kinase Fyn Regulates TLR4-Elicited Responses on Mast Cells Controlling the Function of a PP2A-PKCα/β Signaling Node Leading to TNF Secretion.


    Martín-Ávila, Alejandro; Medina-Tamayo, Jaciel; Ibarra-Sánchez, Alfredo; Vázquez-Victorio, Genaro; Castillo-Arellano, Jorge Iván; Hernández-Mondragón, Alma Cristal; Rivera, Juan; Madera-Salcedo, Iris K; Blank, Ulrich; Macías-Silva, Marina; González-Espinosa, Claudia


    Mast cells produce proinflammatory cytokines in response to TLR4 ligands, but the signaling pathways involved are not fully described. In this study, the participation of the Src family kinase Fyn in the production of TNF after stimulation with LPS was evaluated using bone marrow-derived mast cells from wild-type and Fyn-deficient mice. Fyn(-/-) cells showed higher LPS-induced secretion of preformed and de novo-synthesized TNF. In both cell types, TNF colocalized with vesicle-associated membrane protein (VAMP)3-positive compartments. Addition of LPS provoked coalescence of VAMP3 and its interaction with synaptosomal-associated protein 23; those events were increased in the absence of Fyn. Higher TNF mRNA levels were also observed in Fyn-deficient cells as a result of increased transcription and greater mRNA stability after LPS treatment. Fyn(-/-) cells also showed higher LPS-induced activation of TAK-1 and ERK1/2, whereas IκB kinase and IκB were phosphorylated, even in basal conditions. Increased responsiveness in Fyn(-/-) cells was associated with a lower activity of protein phosphatase 2A (PP2A) and augmented activity of protein kinase C (PKC)α/β, which was dissociated from PP2A and increased its association with the adapter protein neuroblast differentiation-associated protein (AHNAK, desmoyokin). LPS-induced PKCα/β activity was associated with VAMP3 coalescence in WT and Fyn-deficient cells. Reconstitution of MC-deficient Wsh mice with Fyn(-/-) MCs produced greater LPS-dependent production of TNF in the peritoneal cavity. Our data show that Fyn kinase is activated after TLR4 triggering and exerts an important negative control on LPS-dependent TNF production in MCs controlling the inactivation of PP2Ac and activation of PKCα/β necessary for the secretion of TNF by VAMP3(+) carriers. PMID:27183589

  10. A mechanism for expansion of regulatory T cell repertoire and its role in self tolerance

    PubMed Central

    Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y


    SUMMARY T cell receptor (TCR) signaling plays a key role in T cell fate determination. Precursor cells expressing TCRs within a certain low affinity range for self peptide-MHC complexes undergo positive selection and differentiate into naïve T cells expressing a highly diverse self-MHC restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for “self” are either eliminated through TCR agonist induced apoptosis (negative selection)1 or restrained by regulatory CD4+ T (Treg) cells, whose differentiation and function are controlled by the X-chromosome encoded transcription factor Foxp3 (review2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist driven TCR signals combined with interleukin-2 (IL-2) receptor signaling. In addition to Treg cells, TCR agonist-driven selection results in the generation of several other specialized T cell lineages like NKT and MAIT cells3. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs4-6, Here we explored whether a specialized mechanism enables agonist driven selection of Treg cells with a diverse TCR repertoire and its significance for self-tolerance. We found that intronic Foxp3 enhancer CNS3 acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to effectively control self-reactive T cells, especially when thymic negative selection was genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  11. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.


    Kowalewski, Mariusz P


    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  12. Oligodendroglial Argonaute protein Ago2 associates with molecules of the Mbp mRNA localization machinery and is a downstream target of Fyn kinase

    PubMed Central

    Müller, Christina; Schäfer, Isabelle; Luhmann, Heiko J.; White, Robin


    Oligodendrocytes myelinate neuronal axons in the central nervous system (CNS) facilitating rapid transmission of action potentials by saltatory conduction. Myelin basic protein (MBP) is an essential component of myelin and its absence results in severe hypomyelination in the CNS of rodents. Mbp mRNA is not translated immediately after exit from the nucleus in the cytoplasm, but is transported to the plasma membrane in RNA transport granules in a translationally silenced state. We have previously identified the small non-coding RNA 715 (sncRNA715) as an inhibitor of Mbp translation associated with RNA granules. Argonaute (Ago) proteins and small RNAs form the minimal core of the RNA induced silencing complex and together recognize target mRNAs to be translationally inhibited or degraded. Recently, tyrosine phosphorylation of Ago2 was reported to be a regulator of small RNA binding. The oligodendroglial non-receptor tyrosine kinase Fyn is activated by neuronal signals and stimulates the translation of Mbp mRNA at the axon-glial contact site. Here we analyzed the expression of Ago proteins in oligodendrocytes, if they associate with Mbp mRNA transport granules and are tyrosine phosphorylated by Fyn. We show that all Ago proteins (Ago1-4) are expressed by oligodendrocytes and that Ago2 colocalizes with hnRNP A2 in granular cytoplasmic structures. Ago2 associates with hnRNP A2, Mbp mRNA, sncRNA715 and Fyn kinase and is tyrosine phosphorylated in response to Fyn activity. Our findings suggest an involvement of Ago2 in the translational regulation of Mbp. The identification of Ago proteins as Fyn targets will foster further research to understand in more molecular detail how Fyn activity regulates Mbp translation. PMID:26379499

  13. Oligodendroglial Argonaute protein Ago2 associates with molecules of the Mbp mRNA localization machinery and is a downstream target of Fyn kinase.


    Müller, Christina; Schäfer, Isabelle; Luhmann, Heiko J; White, Robin


    Oligodendrocytes myelinate neuronal axons in the central nervous system (CNS) facilitating rapid transmission of action potentials by saltatory conduction. Myelin basic protein (MBP) is an essential component of myelin and its absence results in severe hypomyelination in the CNS of rodents. Mbp mRNA is not translated immediately after exit from the nucleus in the cytoplasm, but is transported to the plasma membrane in RNA transport granules in a translationally silenced state. We have previously identified the small non-coding RNA 715 (sncRNA715) as an inhibitor of Mbp translation associated with RNA granules. Argonaute (Ago) proteins and small RNAs form the minimal core of the RNA induced silencing complex and together recognize target mRNAs to be translationally inhibited or degraded. Recently, tyrosine phosphorylation of Ago2 was reported to be a regulator of small RNA binding. The oligodendroglial non-receptor tyrosine kinase Fyn is activated by neuronal signals and stimulates the translation of Mbp mRNA at the axon-glial contact site. Here we analyzed the expression of Ago proteins in oligodendrocytes, if they associate with Mbp mRNA transport granules and are tyrosine phosphorylated by Fyn. We show that all Ago proteins (Ago1-4) are expressed by oligodendrocytes and that Ago2 colocalizes with hnRNP A2 in granular cytoplasmic structures. Ago2 associates with hnRNP A2, Mbp mRNA, sncRNA715 and Fyn kinase and is tyrosine phosphorylated in response to Fyn activity. Our findings suggest an involvement of Ago2 in the translational regulation of Mbp. The identification of Ago proteins as Fyn targets will foster further research to understand in more molecular detail how Fyn activity regulates Mbp translation. PMID:26379499

  14. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.


    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J


    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings. PMID:25582339

  15. A 'danse macabre': tau and Fyn in STEP with amyloid beta to facilitate induction of synaptic depression and excitotoxicity.


    Boehm, Jannic


    Alzheimer's disease, with its two most prominent pathological factors amyloid beta and tau protein, can be described as a disease of the synapse. It therefore comes as little surprise that NMDA receptor-related synaptic dysfunction had been thought for several years to underlie the synaptic pathophysiology seen in Alzheimer's disease. In this review I will summarise recent evidence showing that the NMDA receptor links the effects of extracellular amyloid beta with intracellular tau protein. Furthermore, the antagonistic roles of Fyn and STEP in NMDA receptor regulation, synaptic plasticity and induction of synaptic depression will be discussed. PMID:23773061

  16. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred


    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  17. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei


    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  18. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer


    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  19. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central



    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  20. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central



    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  1. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.


    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J


    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  2. Sleep-wake states and their regulatory mechanisms throughout early human development.


    Peirano, Patricio; Algarín, Cecilia; Uauy, Ricardo


    The emergence of sleep states is one of the most significant aspects of development. Descriptions of both neonatal and late fetal behavior and studies on the organization of sleep have shown that fetus and newborns exhibit spontaneously discrete and cyclic patterns of active sleep (AS) and quiet sleep (QS). Human fetuses and neonates sleep most of their life, and AS is the prevailing state even during the first postnatal months. Several hypotheses to explain central nervous system development consider that AS is the expression of a basic activation program for the central nervous system that increases the functional competence of neurons, circuits, and complex patterns before the organism is called on to use them. Current results indicate the maturation of QS not only coincides with the formation of thalamocortical and intracortical patterns of innervation and periods of heightened synaptogenesis, since this sleep state is also associated with important processes in synaptic remodeling. In fact, several studies suggest that the information acquired during wakefulness is further processed during AS and QS. This article reviews the processes involved in the timing of both AS/QS and sleep/wake alternating patterns throughout early human development. A growing body of evidence indicates that the duration of unmodulated parental care and noncircadian environmental conditions may be detrimental for the establishment of these basic rhythmicities. As a consequence, alterations in parental/environmental entraining factors may well contribute to disturb sleep and feeding commonly experienced by preterm infants. Further knowledge on the early establishment of sleep-wake states regulatory mechanisms is needed to improve modalities for appropriate stimulation in the developing human being. PMID:14597916

  3. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.


    Chen, C L; Zhao, J W


    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function. PMID:27323039

  4. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana


    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  5. [Progress of research in osteoarthritis. Gene expression and its regulatory mechanisms in the degenerative cartilage in osteoarthritis].


    Okazaki, Ken; Iwamoto, Yukihide


    Spatiotemporal variations of pathological changes were observed in the osteoarthritis joints. Gene expressions vary depending on the zones in the cartilage. For example, the expressions of degradative enzymes such as matrix metalloproteinases were enhanced in the superficial zone whereas the expression of matrix proteins enhanced at the deep zone. Many factors such as mechanical stress, aging, genetic background, inflammation and phenotypic changes of chondrocytes influence the pathogenesis of osteoarthritis, suggesting the involvement of many regulatory mechanisms in the gene expression. However, discoveries of regulatory factors that provide common pathways for the various phenomenon observed in the osteoarthritis cartilage suggest the interaction and co-operation of these important factors to conduct the pathology of degenerative cartilage. PMID:19880989

  6. The N-terminal SH4 region of the Src family kinase Fyn is modified by methylation and heterogeneous fatty acylation: role in membrane targeting, cell adhesion, and spreading.


    Liang, Xiquan; Lu, Yun; Wilkes, Meredith; Neubert, Thomas A; Resh, Marilyn D


    The N-terminal SH4 domain of Src family kinases is responsible for promoting membrane binding and plasma membrane targeting. Most Src family kinases contain an N-terminal Met-Gly-Cys consensus sequence that undergoes dual acylation with myristate and palmitate after removal of methionine. Previous studies of Src family kinase fatty acylation have relied on radiolabeling of cells with radioactive fatty acids. Although this method is useful for verifying that a given fatty acid is attached to a protein, it does not reveal whether other fatty acids or other modifying groups are attached to the protein. Here we use matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry to identify fatty acylated species of the Src family kinase Fyn. Our results reveal that Fyn is efficiently myristoylated and that some of the myristoylated proteins are also heterogeneously S-acylated with palmitate, palmitoleate, stearate, or oleate. Furthermore, we show for the first time that Fyn is trimethylated at lysine residues 7 and/or 9 within its N-terminal region. Both myristoylation and palmitoylation were required for methylation of Fyn. However, a general methylation inhibitor had no inhibitory effect on myristoylation and palmitoylation of Fyn, suggesting that methylation occurs after myristoylation and palmitoylation. Lysine mutants of Fyn that could not be methylated failed to promote cell adhesion and spreading, suggesting that methylation is important for Fyn function. PMID:14660555

  7. Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence

    PubMed Central

    Kinney, Justin B.; Murugan, Anand; Callan, Curtis G.; Cox, Edward C.


    Cells use protein-DNA and protein-protein interactions to regulate transcription. A biophysical understanding of this process has, however, been limited by the lack of methods for quantitatively characterizing the interactions that occur at specific promoters and enhancers in living cells. Here we show how such biophysical information can be revealed by a simple experiment in which a library of partially mutated regulatory sequences are partitioned according to their in vivo transcriptional activities and then sequenced en masse. Computational analysis of the sequence data produced by this experiment can provide precise quantitative information about how the regulatory proteins at a specific arrangement of binding sites work together to regulate transcription. This ability to reliably extract precise information about regulatory biophysics in the face of experimental noise is made possible by a recently identified relationship between likelihood and mutual information. Applying our experimental and computational techniques to the Escherichia coli lac promoter, we demonstrate the ability to identify regulatory protein binding sites de novo, determine the sequence-dependent binding energy of the proteins that bind these sites, and, importantly, measure the in vivo interaction energy between RNA polymerase and a DNA-bound transcription factor. Our approach provides a generally applicable method for characterizing the biophysical basis of transcriptional regulation by a specified regulatory sequence. The principles of our method can also be applied to a wide range of other problems in molecular biology. PMID:20439748

  8. Redox biology in normal cells and cancer: restoring function of the redox/Fyn/c-Cbl pathway in cancer cells offers new approaches to cancer treatment.


    Noble, Mark; Mayer-Pröschel, Margot; Li, Zaibo; Dong, Tiefei; Cui, Wanchang; Pröschel, Christoph; Ambeskovic, Ibro; Dietrich, Joerg; Han, Ruolan; Yang, Yin Miranda; Folts, Christopher; Stripay, Jennifer; Chen, Hsing-Yu; Stevens, Brett M


    This review discusses a unique discovery path starting with novel findings on redox regulation of precursor cell and signaling pathway function and identification of a new mechanism by which relatively small changes in redox status can control entire signaling networks that regulate self-renewal, differentiation, and survival. The pathway central to this work, the redox/Fyn/c-Cbl (RFC) pathway, converts small increases in oxidative status to pan-activation of the c-Cbl ubiquitin ligase, which controls multiple receptors and other proteins of central importance in precursor cell and cancer cell function. Integration of work on the RFC pathway with attempts to understand how treatment with systemic chemotherapy causes neurological problems led to the discovery that glioblastomas (GBMs) and basal-like breast cancers (BLBCs) inhibit c-Cbl function through altered utilization of the cytoskeletal regulators Cool-1/βpix and Cdc42, respectively. Inhibition of these proteins to restore normal c-Cbl function suppresses cancer cell division, increases sensitivity to chemotherapy, disrupts tumor-initiating cell (TIC) activity in GBMs and BLBCs, controls multiple critical TIC regulators, and also allows targeting of non-TICs. Moreover, these manipulations do not increase chemosensitivity or suppress division of nontransformed cells. Restoration of normal c-Cbl function also allows more effective harnessing of estrogen receptor-α (ERα)-independent activities of tamoxifen to activate the RFC pathway and target ERα-negative cancer cells. Our work thus provides a discovery strategy that reveals mechanisms and therapeutic targets that cannot be deduced by standard genetics analyses, which fail to reveal the metabolic information, isoform shifts, protein activation, protein complexes, and protein degradation critical to our discoveries. PMID:25481740

  9. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis.


    Yang, Yang; Xing, Yiqiao; Liang, Chaoqun; Hu, Liya; Xu, Fei; Mei, Qi


    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin‑dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  10. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation.


    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q


    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476


    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  12. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.


    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R


    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  13. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R


    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  14. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.


    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  15. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands

    PubMed Central

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo


    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  16. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.


    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo


    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  17. Regulatory Role of Collagen V in Establishing Mechanical Properties of Tendons and Ligaments is Tissue-Dependent

    PubMed Central

    Connizzo, Brianne K.; Freedman, Benjamin R.; Fried, Joanna H.; Sun, Mei; Birk, David E.; Soslowsky, Louis J.


    Patients with classic (type I) Ehlers-Danlos Syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue-dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus tendon (FDL), Achilles tendon (ACH), the anterior cruciate ligament (ACL) and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1ΔTen/ΔTen group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1ΔTen/ΔTen group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue-dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  18. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?


    Askenasy, Nadir


    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction. PMID:26482052

  19. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo


    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  20. Compartmentalized signaling by GPI-anchored ephrin-A5 requires the Fyn tyrosine kinase to regulate cellular adhesion

    PubMed Central

    Davy, Alice; Gale, Nicholas W.; Murray, Elizabeth W.; Klinghoffer, Richard A.; Soriano, Philippe; Feuerstein, Claude; Robbins, Stephen M.


    Eph receptor tyrosine kinases and their corresponding surface-bound ligands, the ephrins, provide cues to the migration of cells and growth cones during embryonic development. Here we show that ephrin-A5, which is attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidylinositol-anchor, induces compartmentalized signaling within a caveolae-like membrane microdomain when bound to the extracellular domain of its cognate Eph receptor. The physiological response induced by this signaling event is concomitant with a change in the cellular architecture and adhesion of the ephrin-A5-expressing cells and requires the activity of the Fyn protein tyrosine kinase. This study stresses the relevance of bidirectional signaling involving the ephrins and Eph receptors during brain development. PMID:10601038

  1. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.


    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A


    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  2. Mechanisms and treatment of allergic disease in the big picture of regulatory T cells.


    Akdis, Cezmi A; Akdis, Mübeccel


    Various populations of regulatory T (Treg) cells have been shown to play a central role in the maintenance of peripheral homeostasis and the establishment of controlled immune responses. Their identification as key regulators of immunologic processes in peripheral tolerance to allergens has opened an important era in the prevention and treatment of allergic diseases. Both naturally occurring CD4+CD25+ Treg cells and inducible populations of allergen-specific, IL-10-secreting Treg type 1 (T(R)1) cells inhibit allergen-specific effector cells in experimental models. Skewing of allergen-specific effector T cells to a regulatory phenotype appears to be a key event in the development of healthy immune response to allergens and successful outcome in allergen-specific immunotherapy. Forkhead box protein 3-positive CD4+CD25+ Treg cells and T(R)1 cells contribute to the control of allergen-specific immune responses in several major ways, which can be summarized as suppression of dendritic cells that support the generation of effector T cells; suppression of effector T(H)1, T(H)2, and T(H)17 cells; suppression of allergen-specific IgE and induction of IgG4; suppression of mast cells, basophils, and eosinophils; interaction with resident tissue cells and remodeling; and suppression of effector T-cell migration to tissues. Current strategies for drug development and allergen-specific immunotherapy exploit these observations, with the potential for preventive therapies and cure for allergic diseases. PMID:19348912

  3. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.


    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  4. Analysis of the dual regulatory mechanisms controlling expression of the vegetative catalase gene of Bacillus subtilis.

    PubMed Central

    Bol, D K; Yasbin, R E


    The expression of a vegetative catalase gene, katA (formerly the kat-19 gene), is necessary to protect Bacillus subtilis from H2O2, presumably by removing the oxidant from the environment. Genetic analysis of katA revealed that this gene is under two distinct forms of regulation, temporal and H2O2 inducible. The results reported here demonstrate that (i) the H2O2-inducible regulation of katA gene is not a component of the SOS regulon, (ii) the regulatory genes spo0A and abrB are involved in the temporal regulation but not the H2O2-specific induction of katA gene expression, and (iii) transcription initiation for the katA gene occurs at the same site under both forms of regulation. Images PMID:7961428

  5. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.


    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  6. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.


    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S


    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  7. Sphingosine 1-phosphate induces platelet/endothelial cell adhesion molecule-1 phosphorylation in human endothelial cells through cSrc and Fyn.


    Huang, Yu-Ting; Chen, Shee-Uan; Chou, Chia-Hong; Lee, Hsinyu


    Sphingosine 1-phosphate (S1P) is a multifunctional phospholipid which acts through a specific family of G protein-coupled receptors. Platelet/endothelial cell adhesion molecule-1 (PECAM-1) form trans-homophilic binding at lateral cell border. Upon stimulation, its cytoplasmic tyrosine residues could be phosphorylated and interact with various downstream signaling molecules. In this study, we demonstrated that S1P induced PECAM-1 tyrosine phosphorylation in human umbilical cord vein cells (HUVECs). By pharmacological inhibitors, it was suggested that G(i) and Src family kinases were involved in PECAM-1 phosphorylation. Moreover, cSrc and Fyn siRNA significantly suppressed S1P-induced PECAM-1 phosphorylation. These results suggested that S1P-induced PECAM-1 phosphorylation through G(i) and subsequent cSrc and Fyn. Our findings provide further understanding of S1P and PECAM-1 signaling as well as their functions in endothelial cells. PMID:18502612

  8. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).


    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A


    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  9. Overexpression of Heat Shock Protein 72 Attenuates NF-κB Activation Using a Combination of Regulatory Mechanisms in Microglia

    PubMed Central

    Khammash, Mustafa; Giffard, Rona G.


    Overexpression of the inducible heat shock protein 70, Hsp72, has broadly cytoprotective effects and improves outcome following stroke. A full understanding of how Hsp72 protects cells against injury is elusive, though several distinct mechanisms are implicated. One mechanism is its anti-inflammatory effects. We study the effects of Hsp72 overexpression on activation of the transcription factor NF-κB in microglia combining experimentation and mathematical modeling, using TNFα to stimulate a microglial cell line stably overexpressing Hsp72. We find that Hsp72 overexpression reduces the amount of NF-κB DNA binding activity, activity of the upstream kinase IKK, and amount of IκBα inhibitor phosphorylated following TNFα application. Simulations evaluating several proposed mechanisms suggest that inhibition of IKK activation is an essential component of its regulatory activities. Unexpectedly we find that Hsp72 overexpression reduces the initial amount of the RelA/p65 NF-κB subunit in cells, contributing to the attenuated response. Neither mechanism in isolation, however, is sufficient to attenuate the response, providing evidence that Hsp72 relies upon multiple mechanisms to attenuate NF-κB activation. An additional observation from our study is that the induced expression of IκBα is altered significantly in Hsp72 expressing cells. While the mechanism responsible for this observation is not known, it points to yet another means by which Hsp72 may alter the NF-κB response. This study illustrates the multi-faceted nature of Hsp72 regulation of NF-κB activation in microglia and offers further clues to a novel mechanism by which Hsp72 may protect cells against injury. PMID:24516376

  10. Site-specific silencing of regulatory elements as a mechanism of X inactivation.


    Calabrese, J Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E; Magnuson, Terry


    The inactive X chromosome's (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequences is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to nontranscribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X inactivation occurred within, and X inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  11. Site-specific silencing of regulatory elements as a mechanism of X-inactivation

    PubMed Central

    Calabrese, J. Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W.; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E.; Magnuson, Terry


    The inactive X chromosome’s (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequence is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to non-transcribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X-inactivation occurred within, and X-inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X-inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  12. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.


    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  13. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium.


    Mazin, Pavel V; Fisunov, Gleb Y; Gorbachev, Alexey Y; Kapitskaya, Kristina Y; Altukhov, Ilya A; Semashko, Tatiana A; Alexeev, Dmitry G; Govorun, Vadim M


    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3'-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  14. The Hematopoietic Stem and Progenitor Cell Cistrome: GATA Factor-Dependent cis-Regulatory Mechanisms.


    Hewitt, K J; Johnson, K D; Gao, X; Keles, S; Bresnick, E H


    Transcriptional regulators mediate the genesis and function of the hematopoietic system by binding complex ensembles of cis-regulatory elements to establish genetic networks. While thousands to millions of any given cis-element resides in a genome, how transcriptional regulators select these sites and how site attributes dictate functional output is not well understood. An instructive system to address this problem involves the GATA family of transcription factors that control vital developmental and physiological processes and are linked to multiple human pathologies. Although GATA factors bind DNA motifs harboring the sequence GATA, only a very small subset of these abundant motifs are occupied in genomes. Mechanistic studies revealed a unique configuration of a GATA factor-regulated cis-element consisting of an E-box and a downstream GATA motif separated by a short DNA spacer. GATA-1- or GATA-2-containing multiprotein complexes at these composite elements control transcription of genes critical for hematopoietic stem cell emergence in the mammalian embryo, hematopoietic progenitor cell regulation, and erythroid cell maturation. Other constituents of the complex include the basic helix-loop-loop transcription factor Scl/TAL1, its heterodimeric partner E2A, and the Lim domain proteins LMO2 and LDB1. This chapter reviews the structure/function of E-box-GATA composite cis-elements, which collectively constitute an important sector of the hematopoietic stem and progenitor cell cistrome. PMID:27137654

  15. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.


    Suzuki, Takashi; Swift, Larry L


    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  16. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.


    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  17. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.


    Nguyen, Lan K; Kulasiri, Don


    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  18. The regulatory role of cell mechanics for migration of differentiating myeloid cells.


    Lautenschläger, Franziska; Paschke, Stephan; Schinkinger, Stefan; Bruel, Arlette; Beil, Michael; Guck, Jochen


    Migration of cells is important for tissue maintenance, immune response, and often altered in disease. While biochemical aspects, including cell adhesion, have been studied in detail, much less is known about the role of the mechanical properties of cells. Previous measurement methods rely on contact with artificial surfaces, which can convolute the results. Here, we used a non-contact, microfluidic optical stretcher to study cell mechanics, isolated from other parameters, in the context of tissue infiltration by acute promyelocytic leukemia (APL) cells, which occurs during differentiation therapy with retinoic acid. Compliance measurements of APL cells reveal a significant softening during differentiation, with the mechanical properties of differentiated cells resembling those of normal neutrophils. To interfere with the migratory ability acquired with the softening, differentiated APL cells were exposed to paclitaxel, which stabilizes microtubules. This treatment does not alter compliance but reduces cell relaxation after cessation of mechanical stress six-fold, congruent with a significant reduction of motility. Our observations imply that the dynamical remodeling of cell shape required for tissue infiltration can be frustrated by stiffening the microtubular system. This link between the cytoskeleton, cell mechanics, and motility suggests treatment options for pathologies relying on migration of cells, notably cancer metastasis. PMID:19717452

  19. Understanding gene regulatory mechanisms by integrating ChIP-seq and RNA-seq data: statistical solutions to biological problems

    PubMed Central

    Angelini, Claudia; Costa, Valerio


    The availability of omic data produced from international consortia, as well as from worldwide laboratories, is offering the possibility both to answer long-standing questions in biomedicine/molecular biology and to formulate novel hypotheses to test. However, the impact of such data is not fully exploited due to a limited availability of multi-omic data integration tools and methods. In this paper, we discuss the interplay between gene expression and epigenetic markers/transcription factors. We show how integrating ChIP-seq and RNA-seq data can help to elucidate gene regulatory mechanisms. In particular, we discuss the two following questions: (i) Can transcription factor occupancies or histone modification data predict gene expression? (ii) Can ChIP-seq and RNA-seq data be used to infer gene regulatory networks? We propose potential directions for statistical data integration. We discuss the importance of incorporating underestimated aspects (such as alternative splicing and long-range chromatin interactions). We also highlight the lack of data benchmarks and the need to develop tools for data integration from a statistical viewpoint, designed in the spirit of reproducible research. PMID:25364758

  20. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.


    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo


    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954



    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G


    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  2. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.


    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  3. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan


    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  4. The Potential Regulatory Mechanisms of miR-196a in Huntington’s Disease through Bioinformatic Analyses

    PubMed Central

    Tsai, Shaw-Jeng; Lai, Yen-Yu; Chang, Yu-Fan; Cheng, Pei-Hsun; Chen, Chuan-Mu; Yang, Shang-Hsun


    High throughput screening is a powerful tool to identify the potential candidate molecules involved during disease progression. However, analysis of complicated data is one of the most challenging steps on the way to obtaining useful results from this approach. Previously, we showed that a specific miRNA, miR-196a, could ameliorate the pathological phenotypes of Huntington’s disease (HD) in different models, and performed high throughput screening by using the striatum of transgenic mice. In this study, we further tried to identify the potential regulatory mechanisms using different bioinformatic tools, including Database for Annotation, Visualization and Integrated Discovery (DAVID), Molecular Signatures Database (MSigDB), TargetScan and MetaCore. The results showed that miR-196a dominantly altered “ABC transporters”, “RIG-I-like receptor signaling pathway”, immune system”, “adaptive immune system”,“tissue remodeling and wound repair” and “cytoskeleton remodeling”. In addition, miR-196a also changed the expression of several well-defined pathways of HD, such as apoptosis and cell adhesion. Since these analyses showed the regulatory pathways are highly related to the modification of the cytoskeleton, we further confirmed that miR-196a could enhance the neurite outgrowth in neuroblastoma cells, suggesting miR-196a might provide beneficial functions through the alteration of cytoskeleton structures. Since impairment of the cytoskeleton has been reported in several neuronal diseases, this study will provide not only the potential working mechanisms of miR-196a but also insights for therapeutic strategies for use with different neuronal diseases. PMID:26376480

  5. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].


    Sun, Ting; Chi, Qingjia; Wang, Guixue


    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  6. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.


    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin


    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter. PMID:26711125

  7. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay


    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  8. Identification of Novel Pretranslational Regulatory Mechanisms for NF-κB Activation*

    PubMed Central

    Huang, Xiao; Gong, Ren; Li, Xinyuan; Virtue, Anthony; Yang, Fan; Yang, Irene H.; Tran, Anh H.; Yang, Xiao-Feng; Wang, Hong


    NF-κB-controlled transcriptional regulation plays a central role in inflammatory and immune responses. Currently, understanding about NF-κB activation mechanism emphasizes IκB-tethered complex inactivation in the cytoplasm. In the case of NF-κB activation, IκB phosphorylation leads to its degradation, followed by NF-κB relocation to the nucleus and trans-activation of NF-κB-targeted genes. Pretranslational mechanism mediated NF-κB activation remains poorly understood. In this study, we investigated NF-κB pretranslational regulation by performing a series of database mining analyses and using six large national experimental databases (National Center of Biotechnology Information UniGene expressed sequence tag profile database, Gene Expression Omnibus database, Transcription Element Search System database, AceView database, and Epigenomics database) and TargetScan software. We reported the following findings: 1) NF-κB-signaling genes are differentially expressed in human and mouse tissues; 2) heart and vessels are the inflammation-privileged tissues and less easy to be inflamed because lacking in key NF-κB-signaling molecular expression; 3) NF-κB-signaling genes are induced by cardiovascular disease risk factors oxidized phospholipids and proinflammatory cytokines in endothelial cells; 4) transcription factors CCAAT/enhancer-binding proteins and NF-κB have higher binding site frequencies in the promoters of proinflammatory cytokine-induced NF-κB genes; 5) most NF-κB-signaling genes have multiple alternative promoters and alternatively spliced isoforms; 6) NF-κB family genes can be regulated by DNA methylation; and 7) 27 of 38 NF-κB-signaling genes can be regulated by microRNAs. Our findings provide important insight into the mechanism of NF-κB activation, which may contribute to cardiovascular disease, inflammatory diseases, and immunological disorders. PMID:23515310

  9. Regulatory mechanisms of betacellulin in CXCL8 production from lung cancer cells

    PubMed Central


    Background Betacellulin (BTC), a member of the epidermal growth factor (EGF) family, binds and activates ErbB1 and ErbB4 homodimers. BTC was expressed in tumors and involved in tumor growth progression. CXCL8 (interleukin-8) was involved in tumor cell proliferation via the transactivation of the epidermal growth factor receptor (EGFR). Materials and methods The present study was designed to investigate the possible interrelation between BTC and CXCL8 in human lung cancer cells (A549) and demonstrated the mechanisms of intracellular signals in the regulation of both functions. Bio-behaviors of A549 were assessed using Cell-IQ Alive Image Monitoring System. Results We found that BTC significantly increased the production of CXCL8 through the activation of the EGFR-PI3K/Akt-Erk signal pathway. BTC induced the resistance of human lung cancer cells to TNF-α/CHX-induced apoptosis. Treatments with PI3K inhibitors, Erk1/2 inhibitor, or Erlotinib significantly inhibited BTC-induced CXCL8 production and cell proliferation and movement. Conclusion Our data indicated that CXCL8 production from lung cancer cells could be initiated by an autocrine mechanism or external sources of BTC through the EGFR–PI3K–Akt–Erk pathway to the formation of inflammatory microenvironment. BTC may act as a potential target to monitor and improve the development of lung cancer inflammation. PMID:24629040

  10. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.


    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  11. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.


    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  12. Dss1 Interaction with Brh2 as a Regulatory Mechanism for Recombinational Repair▿

    PubMed Central

    Zhou, Qingwen; Kojic, Milorad; Cao, Zhimin; Lisby, Michael; Mazloum, Nayef A.; Holloman, William K.


    Brh2, the BRCA2 ortholog in Ustilago maydis, enables recombinational repair of DNA by controlling Rad51 and is in turn regulated by Dss1. Interplay with Rad51 is conducted via the BRC element located in the N-terminal region of the protein and through an unrelated domain, CRE, at the C terminus. Mutation in either BRC or CRE severely reduces functional activity, but repair deficiency of the brh2 mutant can be complemented by expressing BRC and CRE on different molecules. This intermolecular complementation is dependent upon the presence of Dss1. Brh2 molecules associate through the region overlapping with the Dss1-interacting domain to form at least dimer-sized complexes, which in turn, can be dissociated by Dss1 to monomer. We propose that cooperation between BRC and CRE domains and the Dss1-provoked dissociation of Brh2 complexes are requisite features of Brh2's molecular mechanism. PMID:17261595

  13. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].


    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G


    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  14. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto


    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  15. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.


    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  16. Regulatory mechanisms, expression levels and proliferation effects of the FUS-DDIT3 fusion oncogene in liposarcoma.


    Åman, Pierre; Dolatabadi, Soheila; Svec, David; Jonasson, Emma; Safavi, Setareh; Andersson, Daniel; Grundevik, Pernilla; Thomsen, Christer; Ståhlberg, Anders


    Fusion oncogenes are among the most common types of oncogene in human cancers. The gene rearrangements result in new combinations of regulatory elements and functional protein domains. Here we studied a subgroup of sarcomas and leukaemias characterized by the FET (FUS, EWSR1, TAF15) family of fusion oncogenes, including FUS-DDIT3 in myxoid liposarcoma (MLS). We investigated the regulatory mechanisms, expression levels and effects of FUS-DDIT3 in detail. FUS-DDIT3 showed a lower expression than normal FUS at both the mRNA and protein levels, and single-cell analysis revealed a lack of correlation between FUS-DDIT3 and FUS expression. FUS-DDIT3 transcription was regulated by the FUS promotor, while its mRNA stability depended on the DDIT3 sequence. FUS-DDIT3 protein stability was regulated by protein interactions through the FUS part, rather than the leucine zipper containing DDIT3 part. In addition, in vitro as well as in vivo FUS-DDIT3 protein expression data displayed highly variable expression levels between individual MLS cells. Combined mRNA and protein analyses at the single-cell level showed that FUS-DDIT3 protein expression was inversely correlated to the expression of cell proliferation-associated genes. We concluded that FUS-DDIT3 is uniquely regulated at the transcriptional as well as the post-translational level and that its expression level is important for MLS tumour development. The FET fusion oncogenes are potentially powerful drug targets and detailed knowledge about their regulation and functions may help in the development of novel treatments. PMID:26865464

  17. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J


    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  18. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).


    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O


    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  19. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.


    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P


    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  20. Stimulation of rat hepatic low density lipoprotein receptors by glucagon. Evidence of a novel regulatory mechanism in vivo.

    PubMed Central

    Rudling, M; Angelin, B


    We studied the influence of glucagon on hepatic LDL receptors and plasma lipoproteins in rats. A dose-dependent (maximum, threefold) increase in LDL-receptor binding was evident already at a dose of 2 x 4 micrograms, and detectable 3 h after injection; concomitantly, cholesterol and apolipoprotein (apo) B and apoE within LDL and large HDL decreased in plasma. LDL receptor mRNA levels were however unaltered or reduced. Hepatic microsomal cholesterol was increased and the enzymatic activities of 3-hydroxy-3-methylglutaryl coenzyme A reductase and cholesterol 7 alpha-hydroxylase in hepatic microsomes were reduced. Insulin alone increased receptor binding and receptor mRNA levels twofold, but plasma cholesterol was unchanged and plasma apoE and apoB increased. Administration of insulin to glucagon-treated animals reduced the LDL-receptor binding to control levels and apoB appeared in LDL particles. Estrogen treatment increased LDL-receptor binding and mRNA levels five- and eightfold, respectively. Combined treatment with glucagon and estrogen reduced the stimulation of LDL-receptor mRNA levels by 80% although LDL-receptor binding was unchanged. Immunoblot analysis showed that glucagon increased the number of hepatic LDL receptors. We conclude that glucagon induces the number of hepatic LDL receptors by a mechanism not related to increased mRNA levels, suggesting the presence of a posttranscriptional regulatory mechanism present in the liver in vivo. Images PMID:8514887

  1. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.


    McNamara, J P


    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  2. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan


    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  3. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.


    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian


    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans. PMID:27030597

  4. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef


    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  5. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.


    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B


    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  6. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.


    Takano, Hideaki


    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria. PMID:26967471

  7. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.


    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro


    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis. PMID:25266651

  8. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.


    Watanabe, Naoki


    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach. PMID:22289456

  9. A Regulatory Mechanism for RSK2 NH2-Terminal Kinase Activity

    PubMed Central

    Cho, Yong-Yeon; Yao, Ke; Pugliese, Angelo; Malakhova, Margarita L.; Bode, Ann M.; Dong, Zigang


    Our previous findings indicated that RSK2 plays a critical role in proliferation and cell transformation induced by tumor promoters, such as epidermal growth factor or 12-O-tetradecanoylphorbol-13-acetate, and that kaempferol, a natural compound found in edible plants, selectively inhibits RSK2 activity. However, the molecular mechanism for RSK2 activation is unclear. Herein, we provide evidence showing that NH2-terminal kinase domain (NTD) activation of RSK2 is required for the activation of the extracellular signal-regulated kinase–mediated COOH-terminal kinase domain (CTD). We also found that the NTD plays a key role in substrate phosphorylation and that kaempferol binds with the NTD but not the CTD in both the active and inactive forms. Homology modeling of the RSK2 NH2-terminal domain and small-molecule docking, validated by mutagenesis experiments, clearly showed that Val82 and Lys100 are critical amino acids for kaempferol binding and RSK2 activity. Furthermore, immunohistofluorescence and Western blot results indicated that the RSK2 protein level is markedly higher in cancer cell lines as well as cancer tissues compared with nonmalignant cell lines or normal tissues. In addition, kaempferol inhibited proliferation of malignant human cancer cell lines, including A431, SK-MEL-5 and SK-MEL-28, and HCT-116. These results indicate that targeting RSK2 with natural compounds, such as kaempferol, might be a good strategy for chemopreventive or chemotherapeutic application. PMID:19435896

  10. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.


    Hossain, M Sazzad; Dietz, Karl-Josef


    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  11. Regulatory mechanism of ZNF139 in multi-drug resistance of gastric cancer cells.


    Li, Yong; Tan, Bi-bo; Zhao, Qun; Fan, Li-qiao; Liu, Yü; Wang, Dong


    Our previous study found increased zinc finger protein 139 (ZNF139) expression in gastric cancer (GC) cells. Purpose of the study is to further clarify the role and mechanism of ZNF139 in multi-drug resistance (MDR) of GC cells. MTT assay, RT-PCR, Western blotting were employed to detect susceptibility of GC cells to chemotherapeutic agents (5-FU, L-OHP) in vitro, and expressions of ZNF139 and MDR associated genes MDR1/P-gp, MRP1, Bcl-2, Bax were also detected. siRNA specific to ZNF139 was transfected into MKN28 cells, then chemosensitivity of GC cells as well as changes of ZNF139 and MDR associated genes were detected. It's found the inhibition rate of 5-FU, L-OHP to well-differentiated GC tissues and cell line was lower than that in the poorly differentiated tissues and cell line; expressions of ZNF139 and MDR1/P-gp, MRP1 and Bcl-2 in well-differentiated GC tissues and cell line MKN28 were higher, while Bax expression was lower. After ZNF139-siRNA was transfected into MKN28, ZNF139 expression in GC cells was inhibited by 90%; inhibition rate of 5-FU, L-OHP to tumor cells increased, and expressions of MDR1/P-gp, MRP1 and Bcl-2 were down-regulated, while Bax was up-regulated. ZNF139 was involved in GC MDR by promoting expressions of MDR1/P-gp, MRP1 and Bcl-2 and inhibiting Bax simultaneously. PMID:24515389

  12. Extracellular Superoxide Dismutase Regulates the Expression of Small GTPase Regulatory Proteins GEFs, GAPs, and GDI

    PubMed Central

    Laukkanen, Mikko O.; Cammarota, Francesca; Esposito, Tiziana; Salvatore, Marco; Castellone, Maria D.


    Extracellular superoxide dismutase (SOD3), which catalyzes the dismutation of superoxide anions to hydrogen peroxide at the cell membranes, regulates the cellular growth in a dose-dependent manner. This enzyme induces primary cell proliferation and immortalization at low expression levels whereas it activates cancer barrier signaling through the p53-p21 pathway at high expression levels, causing growth arrest, senescence, and apoptosis. Because previous reports suggested that the SOD3–induced reduction in the rates of cellular growth and migration also occurred in the absence of functional p53 signaling, in the current study we investigated the SOD3-induced growth-suppressive mechanisms in anaplastic thyroid cancer cells. Based on our data, the robust over-expression of SOD3 increased the level of phosphorylation of the EGFR, ERBB2, RYK, ALK, FLT3, and EPHA10 receptor tyrosine kinases with the consequent downstream activation of the SRC, FYN, YES, HCK, and LYN kinases. However, pull-down experiments focusing on the small GTPase RAS, RAC, CDC42, and RHO revealed a reduced level of growth and migration signal transduction, such as the lack of stimulation of the mitogen pathway, in the SOD3 over-expressing cells, which was confirmed by MEK1/2 and ERK1/2 Western blotting analysis. Interestingly, the mRNA expression analyses indicated that SOD3 regulated the expression of guanine nucleotide-exchange factors (RHO GEF16, RAL GEF RGL1), GTPase-activating proteins (ARFGAP ADAP2, RAS GAP RASAL1, RGS4), and a Rho guanine nucleotide-disassociation inhibitor (RHO GDI 2) in a dose dependent manner, thus controlling signaling through the small G protein GTPases. Therefore, our current data may suggest the occurrence of dose-dependent SOD3–driven control of the GTP loading of small G proteins indicating a novel growth regulatory mechanism of this enzyme. PMID:25751262

  13. Extracellular superoxide dismutase regulates the expression of small gtpase regulatory proteins GEFs, GAPs, and GDI.


    Laukkanen, Mikko O; Cammarota, Francesca; Esposito, Tiziana; Salvatore, Marco; Castellone, Maria D


    Extracellular superoxide dismutase (SOD3), which catalyzes the dismutation of superoxide anions to hydrogen peroxide at the cell membranes, regulates the cellular growth in a dose-dependent manner. This enzyme induces primary cell proliferation and immortalization at low expression levels whereas it activates cancer barrier signaling through the p53-p21 pathway at high expression levels, causing growth arrest, senescence, and apoptosis. Because previous reports suggested that the SOD3-induced reduction in the rates of cellular growth and migration also occurred in the absence of functional p53 signaling, in the current study we investigated the SOD3-induced growth-suppressive mechanisms in anaplastic thyroid cancer cells. Based on our data, the robust over-expression of SOD3 increased the level of phosphorylation of the EGFR, ERBB2, RYK, ALK, FLT3, and EPHA10 receptor tyrosine kinases with the consequent downstream activation of the SRC, FYN, YES, HCK, and LYN kinases. However, pull-down experiments focusing on the small GTPase RAS, RAC, CDC42, and RHO revealed a reduced level of growth and migration signal transduction, such as the lack of stimulation of the mitogen pathway, in the SOD3 over-expressing cells, which was confirmed by MEK1/2 and ERK1/2 Western blotting analysis. Interestingly, the mRNA expression analyses indicated that SOD3 regulated the expression of guanine nucleotide-exchange factors (RHO GEF16, RAL GEF RGL1), GTPase-activating proteins (ARFGAP ADAP2, RAS GAP RASAL1, RGS4), and a Rho guanine nucleotide-disassociation inhibitor (RHO GDI 2) in a dose dependent manner, thus controlling signaling through the small G protein GTPases. Therefore, our current data may suggest the occurrence of dose-dependent SOD3-driven control of the GTP loading of small G proteins indicating a novel growth regulatory mechanism of this enzyme. PMID:25751262

  14. Regulatory effect and mechanism of gastrin and its antagonists on colorectal carcinoma

    PubMed Central

    He, Shuang-Wu; Shen, Kang-Qiang; He, Yu-Jun; Xie, Bin; Zhao, Yan-Ming


    AIM: To explore the effect and mechanism of gastrin and its an tagonists proglumide and somatostatin on colorectal carcinoma and their clinical significance. METHODS: A model of transplanted human colonic carcinoma was established from SW480 cell line in gymnomouse body. The volume and weight of transplanted carcinoma was observed under the effect of pentagatrin (PG), proglumide (PGL) and octapeptide somotostatin (SMS201-995, SMS). The cAMP content of carcinoma cell was determined by radioimmunoassay and the DNA, protein content and cell cycle were determined by flow-cytometry. The amount of viable cells was determined by MTT colorimetric analysis, IP3 content was determined by radioimmuno assay, Ca2+ concentration in cell by fluorometry and PKC activity by isotopic enzymolysis. The expression of gastrin, c-myc, c-fos and rasP21 in 48 case s of colorectal carcinoma tissue was detected by the immuno-cytochemistry SP method. Argyrophilia nucleolar organizer regions was determined with argyrophilia stain. RESULTS: The volume, weight, cAMP, DNA and protein content in carcinoma cell, cell amount and proliferation index of S and G2M phase in PG group were all significantly higher than those of control group. When PG was at the concentration of 25 mg/L, the amount of viable cells, IP3 content and Ca2+ concentration in cell and membrane PKC activity in PG group were significantly higher than those in control group; when PGL was at a concentration of 32 mg/L, they dropped to the lowest level in PG (25 mg/L) + PGL group, but without significant difference from the control group. The positive expression rate of gastrin, c-myc, c-fos and rasP21 in carcinoma tissue was 39.6%, 54.2%, 47.9% and 54.2% respectively and significantly higher than that in mucosa 3 cm and 6 cm adjacent to carcinoma tissue and normal colorectal mucosa. The positive expression rate of gastrin of highly-differentiated adenocarcinoma group was significantly higher than that of poorly-differentiated and

  15. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  16. Myosin Light Chain Kinase (MLCK) Regulates Cell Migration in a Myosin Regulatory Light Chain Phosphorylation-independent Mechanism*

    PubMed Central

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng


    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration. PMID:25122766

  17. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.


    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed


    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  18. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo


    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  19. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.


    Ehrlich, Marcelo


    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. PMID:26776724

  20. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed


    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  1. Aspects of the regulatory mechanisms of PPAR functions: analysis of a bidirectional response element and regulation by sumoylation.


    Shimizu, Makoto; Yamashita, Daisuke; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi


    Peroxisome proliferator-activated receptors (PPARs) constitute a subfamily of nuclear receptor superfamily. A wide variety of compounds including hypolipidemic agents, antidiabetic drugs, and long-chain fatty acids are the potential ligands of PPARs. To approach the regulatory mechanisms of PPARs, we studied on two subjects in this work. First, we identified a functional PPAR-binding site in the spacer region between the PEX11alpha and perilipin genes, which are arranged in tandem on the mouse genome. By gene reporter assays and in vivo as well as in vitro binding assays, we show that these genes are regulated tissue-selectively through this common binding site: The PEX11alpha gene is activated by PPARalpha in the liver, whereas the perilipin gene by PPARgamma in the adipose tissue. As the second subject, we found that PPARgamma2 is conjugated with small ubiquitin-related modifier (SUMO) at a specific lysine residue in the amino-terminal region. By site-directed mutagenesis combined with gene reporter assays and sumoylation analyses, we show that sumoylation represses the ligand-independent transactivating function carried by this region, and hence negatively regulates the whole transactivating competence of PPARgamma2. In addition, phosphorylation at a specific site in the amino-terminal region represses the transactivation by PPARgamma2 possibly through enhancing sumoylation. PMID:16534556

  2. Comparative Study between Transcriptionally- and Translationally-Acting Adenine Riboswitches Reveals Key Differences in Riboswitch Regulatory Mechanisms

    PubMed Central

    Blouin, Simon; Heppell, Benoit; Bastet, Laurène; St-Pierre, Patrick; Massé, Eric; Lafontaine, Daniel A.


    Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic). While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms. PMID:21283784

  3. Effect and Regulatory Mechanism of Clock Gene Per1 on Biological Behaviors of Human Oral Squamous Carcinoma Cell.


    Han-Xue, L I; Kai, Yang; Xiao-Juan, F U; Qin, Zhao


    Objective To investigate the effect and regulatory mechanism of clock gene Per1 on the proliferation,apoptosis,migration,and invasion of human oral squamous carcinoma SCC15 cells. Methods RNA interference was used to knock down Per1 gene in human oral squamous cell carcinoma SCC15 cell line. Changes of cell proliferation and apoptosis were analyzed by flow cytometry. Transwell assay was carried out to assess cell migration and invasion. Real-time polymerase chain reaction was used to detect the mRNA expressions of Ki-67,murine double minute 2(MDM2),c-Myc,p53,Bax,Bcl-2,metalloproteinase (MMP)2,MMP9,and vascular endothelial growth factor (VEGF). Results shRNA-mediated knockdown of Per1 promoted the proliferation,migration and invasion capacity,and inhibited cell apoptosis capacity of SCC15 cells (all P<0.05). Additionally,Per1 knockdown also increased the mRNA expressions of Ki-67,MDM2,Bcl-2,MMP2,and MMP9 and decreased the mRNA expressions of c-Myc,p53,and Bax (all P<0.05);however,the VEGF mRNA expression did not differ significantly after Per1 knockdown (P>0.05). Conclusions Clock gene Perl can regulate important tumor-related genes downstream such as Ki-67,MDM2,c-Myc,p53,Bax,Bcl-2,MMP2,and MMP9,and the aberrant expression of Per1 can affect tumor cell proliferation,apoptosis,migration and invasion. An in-depth study of Per1 may further clarify the mechanism of tumorigenesis and tumor development and thus provides new effective molecular targets for cancer treatment. PMID:27181891

  4. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose


    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.


    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  5. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.


    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline


    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM. PMID:22170036

  6. A mechanism for expansion of regulatory T-cell repertoire and its role in self-tolerance.


    Feng, Yongqiang; van der Veeken, Joris; Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y


    T-cell receptor (TCR) signalling has a key role in determining T-cell fate. Precursor cells expressing TCRs within a certain low-affinity range for complexes of self-peptide and major histocompatibility complex (MHC) undergo positive selection and differentiate into naive T cells expressing a highly diverse self-MHC-restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for 'self' are either eliminated through TCR-agonist-induced apoptosis (negative selection) or restrained by regulatory T (Treg) cells, whose differentiation and function are controlled by the X-chromosome-encoded transcription factor Foxp3 (reviewed in ref. 2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist-driven TCR signals combined with interleukin 2 (IL-2) receptor signalling. In addition to Treg cells, TCR-agonist-driven selection results in the generation of several other specialized T-cell lineages such as natural killer T cells and innate mucosal-associated invariant T cells. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs. Here we explore in mice whether a specialized mechanism enables agonist-driven selection of Treg cells with a diverse TCR repertoire, and the importance this holds for self-tolerance. We show that the intronic Foxp3 enhancer conserved noncoding sequence 3 (CNS3) acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to control self-reactive T cells effectively, especially when thymic negative selection is genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  7. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-beta: the role of T regulatory cells.


    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A


    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-beta (TGF-beta) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-beta secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  8. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.


    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  9. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.


    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  10. Purification, crystallization and preliminary X-ray diffraction analysis of the Fyn SH2 domain and its complex with a phosphotyrosine peptide

    PubMed Central

    Huculeci, Radu; Buts, Lieven; Lenaerts, Tom; van Nuland, Nico A. J.; Garcia-Pino, Abel


    SH2 domains are widespread protein-binding modules that recognize phosphotyrosines and play central roles in intracellular signalling pathways. The SH2 domain of the human protein tyrosine kinase Fyn has been expressed, purified and crystallized in the unbound state and in complex with a high-affinity phosphotyrosine peptide. X-ray data were collected to a resolution of 2.00 Å for the unbound form and 1.40 Å for the protein in complex with the phosphotyrosine peptide. PMID:22442244

  11. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.


    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna


    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  12. The Inhibition Mechanism of Non-phosphorylated Ser768 in the Regulatory Domain of Cystic Fibrosis Transmembrane Conductance Regulator*

    PubMed Central

    Wang, Guangyu


    The cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette transporters but serves as a chloride channel dysfunctional in cystic fibrosis. The activity of CFTR is tightly controlled not only by ATP-driven dimerization of its nucleotide-binding domains but also by phosphorylation of a unique regulatory (R) domain by protein kinase A (PKA). The R domain has multiple excitatory phosphorylation sites, but Ser737 and Ser768 are inhibitory. The underlying mechanism is unclear. Here, sulfhydryl-specific cross-linking strategy was employed to demonstrate that Ser768 or Ser737 could interact with outwardly facing hydrophilic residues of cytoplasmic loop 3 regulating channel gating. Furthermore, mutation of these residues to alanines promoted channel opening by curcumin in an ATP-dependent manner even in the absence of PKA. However, mutation of Ser768 and His950 with different hydrogen bond donors or acceptors clearly changed ATP- and PKA-dependent channel activity no matter whether curcumin was present or not. More importantly, significant activation of a double mutant H950R/S768R needed only ATP. Finally, in vitro and in vivo single channel recordings suggest that Ser768 may form a putative hydrogen bond with His950 of cytoplasmic loop 3 to prevent channel opening by ATP in the non-phosphorylated state and by subsequent cAMP-dependent phosphorylation. These observations support an electron cryomicroscopy-based structural model on which the R domain is closed to cytoplasmic loops regulating channel gating. PMID:21059651

  13. Accumulation Mechanisms of CD4(+)CD25(+)FOXP3(+) Regulatory T Cells in EBV-associated Gastric Carcinoma.


    Zhang, Na-na; Chen, Jian-ning; Xiao, Lin; Tang, Fang; Zhang, Zhi-gang; Zhang, Yi-wang; Feng, Zhi-ying; Jiang, Ye; Shao, Chun-kui


    Approximately 10% of gastric carcinomas are associated with Epstein-Barr virus (EBV) and are defined as EBV-associated gastric carcinomas (EBVaGCs). EBVaGCs are known to be accompanied by massive CD8(+) cytotoxic T cell (CTL) infiltration; however, adoptive cellular immunotherapy based on EBV-specific CD8(+) CTLs has been explored with limited success. Because regulatory T cells (Tregs) are regarded as a critical hurdle in anti-tumour immunity, we assessed the distribution of Tregs in 45 cases of EBVaGC and 45 cases of EBV-negative gastric carcinoma (EBVnGC) with matched clinicopathological parameters by immunohistochemistry. We showed that Tregs were significantly increased in EBVaGC compared to EBVnGC (15.92 ± 11.45/HPF vs. 8.45 ± 6.16/HPF, p = 0.001). In addition, we explored the accumulation mechanisms of Tregs in EBVaGC by using EBV (+) gastric carcinoma cell lines SNU719 and GT39 as ex vivo models. When peripheral blood mononuclear cells (PBMCs) were co-cultured with EBV (+) gastric carcinoma cell lines, the Treg frequency increased, and they underwent phenotypic and functional changes. The enhanced recruitment by CCL22 produced by EBVaGC cells, the decreased emigration due to CCR7 downregulation on the Treg surface, the higher proliferation rate, and the lower apoptosis rate of Tregs at tumour sites may promote the accumulation of Tregs in EBVaGC. PMID:26673957

  14. Fyn Kinase regulates GluN2B subunit-dominant NMDA receptors in human induced pluripotent stem cell-derived neurons

    PubMed Central

    Zhang, Wen-Bo; Ross, P. Joel; Tu, YuShan; Wang, Yongqian; Beggs, Simon; Sengar, Ameet S.; Ellis, James; Salter, Michael W.


    NMDA receptor (NMDAR)-mediated fast excitatory neurotransmission is implicated in a broad range of physiological and pathological processes in the mammalian central nervous system. The function and regulation of NMDARs have been extensively studied in neurons from rodents and other non-human species, and in recombinant expression systems. Here, we investigated human NMDARs in situ by using neurons produced by directed differentiation of human induced pluripotent stem cells (iPSCs). The resultant cells showed electrophysiological characteristics demonstrating that they are bona fide neurons. In particular, human iPSC-derived neurons expressed functional ligand-gated ion channels, including NMDARs, AMPA receptors, GABAA receptors, as well as glycine receptors. Pharmacological and electrophysiological properties of NMDAR-mediated currents indicated that these were dominated by receptors containing GluN2B subunits. The NMDAR currents were suppressed by genistein, a broad-spectrum tyrosine kinase inhibitor. The NMDAR currents were also inhibited by a Fyn-interfering peptide, Fyn(39–57), but not a Src-interfering peptide, Src(40–58). Together, these findings are the first evidence that tyrosine phosphorylation regulates the function of NMDARs in human iPSC-derived neurons. Our findings provide a basis for utilizing human iPSC-derived neurons in screening for drugs targeting NMDARs in neurological disorders. PMID:27040756

  15. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug


    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  16. Conformational coupling of integrin and Thy-1 regulates Fyn priming and fibroblast mechanotransduction

    PubMed Central

    Fiore, Vincent F.; Strane, Patrick W.; Bryksin, Anton V.; White, Eric S.; Hagood, James S.


    Progressive fibrosis is characterized by excessive deposition of extracellular matrix (ECM), resulting in gross alterations in tissue mechanics. Changes in tissue mechanics can further augment scar deposition through fibroblast mechanotransduction. In idiopathic pulmonary fibrosis, a fatal form of progressive lung fibrosis, previous work has shown that loss of Thy-1 (CD90) expression in fibroblasts correlates with regions of active fibrogenesis, thus representing a pathologically relevant fibroblast subpopulation. We now show that Thy-1 is a regulator of fibroblast rigidity sensing. Thy-1 physically couples to inactive αvβ3 integrins via its RGD-like motif, altering baseline integrin avidity to ECM ligands and also facilitating preadhesion clustering of integrin and membrane rafts via Thy-1’s glycophosphatidylinositol tether. Disruption of Thy-1–αvβ3 coupling altered recruitment of Src family kinases to adhesion complexes and impaired mechanosensitive, force-induced Rho signaling, and rigidity sensing. Loss of Thy-1 was sufficient to induce myofibroblast differentiation in soft ECMs and may represent a physiological mechanism important in wound healing and fibrosis. PMID:26459603

  17. Identification of Src, Fyn, and Lyn SH3-binding proteins: implications for a function of SH3 domains.

    PubMed Central

    Weng, Z; Thomas, S M; Rickles, R J; Taylor, J A; Brauer, A W; Seidel-Dugan, C; Michael, W M; Dreyfuss, G; Brugge, J S


    Src homology 3 (SH3) domains mediate protein-protein interactions necessary for the coupling of cellular proteins involved in intracellular signal transduction. We previously established solution-binding conditions that allow affinity isolation of Src SH3-binding proteins from cellular extracts (Z. Weng, J. A. Taylor, C. E. Turner, J. S. Brugge, and C. Seidel-Dugan, J. Biol. Chem. 268:14956-14963, 1993). In this report, we identified three of these proteins: Shc, a signaling protein that couples membrane tyrosine kinases with Ras; p62, a protein which can bind to p21rasGAP; and heterogeneous nuclear ribonucleoprotein K, a pre-mRNA-binding protein. All of these proteins contain proline-rich peptide motifs that could serve as SH3 domain ligands, and the binding of these proteins to the Src SH3 domain was inhibited with a proline-rich Src SH3 peptide ligand. These three proteins, as well as most of the other Src SH3 ligands, also bound to the SH3 domains of the closely related protein tyrosine kinases Fyn and Lyn. However, Src- and Lyn-specific SH3-binding proteins were also detected, suggesting subtle differences in the binding specificity of the SH3 domains from these related proteins. Several Src SH3-binding proteins were phosphorylated in Src-transformed cells. The phosphorylation of these proteins was not detected in cells transformed by a mutant variant of Src lacking the SH3 domain, while there was little change in tyrosine phosphorylation of other Src-induced phosphoproteins. In addition, the coprecipitation of v-Src with two tyrosyl-phosphorylated proteins with M(r)s of 62,000 and 130,000 was inhibited by incubation with a Src SH3 peptide ligand, suggesting that the binding of these substrate proteins is dependent on interactions with the SH3 domain. These results strongly suggest a role for the Src SH3 domain in the recruitment of substrates to this protein tyrosine kinase, either through direct interaction with the SH3 domain or indirectly through

  18. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.


    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  19. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.


    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne


    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  20. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki


    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  1. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio


    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  2. Genome-Wide Analysis of Wilms' Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms.


    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L; Lenz, Maximilian O; Taglienti, Mary E; Park, Peter J; Schermer, Bernhard; Benzing, Thomas; Kreidberg, Jordan A


    The transcription factor Wilms' tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  3. Cannabinoid receptor 1 induces a biphasic ERK activation via multiprotein signaling complex formation of proximal kinases PKCε, Src, and Fyn in primary neurons.


    Asimaki, Olga; Mangoura, Dimitra


    Cannabinoid receptors 1 (CB1Rs) play important roles in the regulation of dendritic branching, synapse density, and synaptic transmission through multiple G-protein-coupled signaling systems, including the activation of the extracellular signal-regulated kinases ERK1/2. The proximal signaling interactions leading to ERK1/2 activation by CB1R in CNS remain, however, unclear. Here, we present evidence that the CB1R agonist methanandamide induced a biphasic and sustained activation of ERK1/2 in primary neurons derived from E7 telencephalon. We show that E7 neurons natively express high levels of CB1R message and protein, the majority of which associates with PKCɛ at basal conditions. We now demonstrate that the first peak of ERK activation by CB1R was mediated by the sequential activation of G(q), PLC, and PKCɛ, selectively, and that the CB1R-activated PKCɛ acutely formed transient signaling modules containing activated Src and Fyn. A second pool of CB1Rs, coupled to PTX-sensitive activation of G(i/o), utilized as effectors additional Src and Fyn molecules to generate a second, additional wave of ERK activation at 15 min. Concurrently to these intermolecular signaling interactions, cytoskeleton-associated proteins MARCKS and p120catenin were drastically modified by phosphorylation of PKC and Src, respectively. These receptor-proximal signaling events correlated well with induction of neuritic outgrowth in the long term. Our data provide evidence for multiprotein signaling complex formation in the coupling of CB1R to activation of ERK in CNS neurons, and may elucidate several of the less understood acute effects of cannabinoid drugs. PMID:21074588

  4. IL-1β induces hypomyelination in the periventricular white matter through inhibition of oligodendrocyte progenitor cell maturation via FYN/MEK/ERK signaling pathway in septic neonatal rats.


    Xie, Di; Shen, Fengcai; He, Shaoru; Chen, Mengmeng; Han, Qianpeng; Fang, Ming; Zeng, Hongke; Chen, Chunbo; Deng, Yiyu


    Neuroinflammation elicited by microglia plays a key role in periventricular white matter (PWM) damage (PWMD) induced by infectious exposure. This study aimed to determine if microglia-derived interleukin-1β (IL-1β) would induce hypomyelination through suppression of maturation of oligodendrocyte progenitor cells (OPCs) in the developing PWM. Sprague-Dawley rats (1-day old) were injected with lipopolysaccharide (LPS) (1 mg/kg) intraperitoneally, following which upregulated expression of IL-1β and IL-1 receptor 1 (IL-1R1 ) was observed. This was coupled with enhanced apoptosis and suppressed proliferation of OPCs in the PWM. The number of PDGFR-α and NG2-positive OPCs was significantly decreased in the PWM at 24 h and 3 days after injection of LPS, whereas it was increased at 14 days and 28 days. The protein expression of Olig1, Olig2, and Nkx2.2 was significantly reduced, and mRNA expression of Tcf4 and Axin2 was upregulated in the developing PWM after LPS injection. The expression of myelin basic protein (MBP) and 2',3'-cyclic-nucleotide 3"-phosphodiesterase (CNPase) was downregulated in the PWM at 14 days and 28 days after LPS injection; this was linked to reduction of the proportion of myelinated axons and thinner myelin sheath as revealed by electron microscopy. Primary cultured OPCs treated with IL-1β showed the failure of maturation and proliferation. Furthermore, FYN/MEK/ERK signaling pathway was involved in suppression of maturation of primary OPCs induced by IL-1β administration. Our results suggest that following LPS injection, microglia are activated and produce IL-1β in the PWM in the neonatal rats. Excess IL-1β inhibits the maturation of OPCs via suppression of FYN/MEK/ERK phosphorylation thereby leading to axonal hypomyelination. PMID:26678483

  5. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.


    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  6. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine


    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  7. Posttranslational Modification of Maize Chloroplast Pyruvate Orthophosphate Dikinase Reveals the Precise Regulatory Mechanism of Its Enzymatic Activity.


    Chen, Yi-Bo; Lu, Tian-Cong; Wang, Hong-Xia; Shen, Jie; Bu, Tian-Tian; Chao, Qing; Gao, Zhi-Fang; Zhu, Xin-Guang; Wang, Yue-Feng; Wang, Bai-Chen


    In C4 plants, pyruvate orthophosphate dikinase (PPDK) activity is tightly dark/light regulated by reversible phosphorylation of an active-site threonine (Thr) residue; this process is catalyzed by PPDK regulatory protein (PDRP). Phosphorylation and dephosphorylation of PPDK lead to its inactivation and activation, respectively. Here, we show that light intensity rather than the light/dark transition regulates PPDK activity by modulating the reversible phosphorylation at Thr-527 (previously termed Thr-456) of PPDK in maize (Zea mays). The amount of PPDK (unphosphorylated) involved in C4 photosynthesis is indeed strictly controlled by light intensity, despite the high levels of PPDK protein that accumulate in mesophyll chloroplasts. In addition, we identified a transit peptide cleavage site, uncovered partial amino-terminal acetylation, and detected phosphorylation at four serine (Ser)/Thr residues, two of which were previously unknown in maize. In vitro experiments indicated that Thr-527 and Ser-528, but not Thr-309 and Ser-506, are targets of PDRP. Modeling suggests that the two hydrogen bonds between the highly conserved residues Ser-528 and glycine-525 are required for PDRP-mediated phosphorylation of the active-site Thr-527 of PPDK. Taken together, our results suggest that the regulation of maize plastid PPDK isoform (C4PPDK) activity is much more complex than previously reported. These diverse regulatory pathways may work alone or in combination to fine-tune C4PPDK activity in response to changes in lighting. PMID:24710069

  8. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M


    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  9. Mechanisms of impaired regulation by CD4+CD25+FOXP3+ regulatory T cells in human autoimmune diseases

    PubMed Central

    Buckner, Jane Hoyt


    A lack of regulatory T (TReg) cells that express CD4, CD25 and forkhead box P3 (FOXP3) results in severe autoimmunity in both mice and humans. Since the discovery of TReg cells, there has been intense investigation aimed at determining how they protect an organism from autoimmunity and whether defects in their number or function contribute to the development of autoimmunity in model systems. The next phase of investigation — that is, to define the role that defects in TReg cells have in human autoimmunity — is now underway. This Review summarizes our progress so far towards understanding the role of CD4+CD25+FOXP3+ TReg cells in human autoimmune diseases and the impact that this knowledge might have on the diagnosis and treatment of these diseases. PMID:21107346

  10. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.


    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M


    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  11. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.


    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke


    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  12. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central


    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  13. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.


    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina


    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells. PMID:23112133

  14. Mechanisms of andrographolide-induced platelet apoptosis in human platelets: regulatory roles of the extrinsic apoptotic pathway.


    Lien, Li-Ming; Su, Cheng-Chen; Hsu, Wen-Hsien; Lu, Wan-Jung; Chung, Chi-Li; Yen, Ting-Lin; Chiu, Hou-Chang; Sheu, Joen-Rong; Lin, Kuan-Hung


    Andrographolide, a novel nuclear factor-κB (NF-κB) inhibitor, is isolated from the leaves of Andrographis paniculata. Platelet activation is relevant to a variety of coronary heart diseases. Our recent studies revealed that andrographolide possesses potent antiplatelet activity by inhibition of the p38 MAPK/(●) HO-NF-κB-ERK2 cascade. Although platelets are anucleated cells, apoptotic machinery apparatus recently has been found to regulate platelet activation and limit platelet lifespan. Therefore, we further investigated the regulatory effects of andrographolide on platelet apoptotic events. In this study, apoptotic signaling events for caspase-3, -8, and Bid were time (10-60 min)- and dose (25-100 μΜ)-dependently activated by andrographolide in human platelets. Andrographolide could also disrupt mitrochondrial membrane potential. In addition, caspase-8 inhibitor (z-IETD-fmk, 50 μΜ) was found to reverse andrographolide-induced caspase-8 activation, whereas the antagonistic anti-Fas receptor (ZB4, 500 ng/mL) and anti-tumor necrosis factor-R1 (H398, 10 µg/mL) monoclonal antibodies did not. In conclusion, this study for the first time demonstrated that andrographolide might limit platelet lifespan by initiating the caspase-8-dependent extrinsic apoptotic pathway, in spite of no direct evidence that death receptors are involved in this process proved. Overall, the various medicinal properties of andrographolide suggest its potential value in treating patients with thromboembolic disorders. PMID:23292890

  15. Simultaneous coexpression of Borrelia burgdorferi Erp proteins occurs through a specific, erp locus-directed regulatory mechanism.


    El-Hage, Nazira; Stevenson, Brian


    An individual Borrelia burgdorferi bacterium can encode as many as 13 different Erp (OspE/F-related) proteins from mono-and bicistronic loci that are carried on up to 10 separate plasmids. We demonstrate through multilabel immunofluorescence analyses that individual bacteria simultaneously coexpress their entire Erp protein repertoire. While it has been proposed that B. burgdorferi controls expression of Erp and other plasmid-encoded proteins through changes in DNA topology, we observed regulated Erp expression in the absence of detectable differences in DNA supercoiling. Likewise, inhibition of DNA gyrase had no detectable effect on Erp expression. Furthermore, expression of loci physically adjacent to erp loci was observed to be independently regulated. It is concluded that Erp expression is regulated by a mechanism(s) directed at erp loci and not by a global, plasmid-wide mechanism. PMID:12142424

  16. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.


    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  17. Reovirus μ2 Protein Inhibits Interferon Signaling through a Novel Mechanism Involving Nuclear Accumulation of Interferon Regulatory Factor 9▿

    PubMed Central

    Zurney, Jennifer; Kobayashi, Takeshi; Holm, Geoffrey H.; Dermody, Terence S.; Sherry, Barbara


    The secreted cytokine alpha/beta interferon (IFN-α/β) binds its receptor to activate the Jak-STAT signal transduction pathway, leading to formation of the heterotrimeric IFN-stimulated gene factor 3 (ISGF3) transcription complex for induction of IFN-stimulated genes (ISGs) and establishment of an antiviral state. Many viruses have evolved countermeasures to inhibit the IFN pathway, thereby subverting the innate antiviral response. Here, we demonstrate that the mildly myocarditic reovirus type 1 Lang (T1L), but not the nonmyocarditic reovirus type 3 Dearing, represses IFN induction of a subset of ISGs and that this repressor function segregates with the T1L M1 gene. Concordantly, the T1L M1 gene product, μ2, dramatically inhibits IFN-β-induced reporter gene expression. Surprisingly, T1L infection does not degrade components of the ISGF3 complex or interfere with STAT1 or STAT2 nuclear translocation as has been observed for other viruses. Instead, infection with T1L or reassortant or recombinant viruses containing the T1L M1 gene results in accumulation of interferon regulatory factor 9 (IRF9) in the nucleus. This effect has not been previously described for any virus and suggests that μ2 modulates IRF9 interactions with STATs for both ISGF3 function and nuclear export. The M1 gene is a determinant of virus strain-specific differences in the IFN response, which are linked to virus strain-specific differences in induction of murine myocarditis. We find that virus-induced myocarditis is associated with repression of IFN function, providing new insights into the pathophysiology of this disease. Together, these data provide the first report of an increase in IRF9 nuclear accumulation associated with viral subversion of the IFN response and couple virus strain-specific differences in IFN antagonism to the pathogenesis of viral myocarditis. PMID:19109390

  18. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.


    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  19. Autophagy Regulatory Network — A systems-level bioinformatics resource for studying the mechanism and regulation of autophagy

    PubMed Central

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás


    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN;, to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  20. FGF23-Associated Tumor-Induced Osteomalacia in a Patient With Small Cell Carcinoma: A Case Report and Regulatory Mechanism Study.


    Sauder, Adrienne; Wiernek, Szymon; Dai, Xumin; Pereira, Renata; Yudd, Michael; Patel, Charvi; Golden, Andrew; Ahmed, Shahida; Choe, Jin; Chang, Victor; Sender, Slawomir; Cai, Donghong


    Tumor-induced osteomalacia (TIO) is typically caused by phosphaturic mesenchymal tumor (PMT) that secretes the phosphaturic hormone, fibroblast growth factor-23 (FGF23), resulting in decreased phosphate reabsorption in kidneys, hypophosphatemia, and finally osteomalacia. Rare cases of malignant tumor manifesting with TIO other than PMT had been reported, although in most of these reports, except one, circulating FGF23 levels were not evaluated and tissue expressing of FGF23 was not confirmed. In this article, we report a case of TIO in a patient with pulmonary small cell carcinoma with liver metastasis. The patient manifested with hypophosphatemia. His circulating level of FGF23 was markedly increased. The expression of FGF23 in tumor cells was confirmed. Furthermore, the regulatory mechanism of FGF23 in this patient was also investigated. PMID:26612848

  1. Stimulation of beta(1----3)glucan synthetase of various fungi by nucleoside triphosphates: generalized regulatory mechanism for cell wall biosynthesis.

    PubMed Central

    Szaniszlo, P J; Kang, M S; Cabib, E


    Particulate fractions from the taxonomically diverse fungi Achlya ambisexualis, Hansenula anomala, Neurospora crassa, Cryptococcus laurentii, Schizophyllum commune, and Wangiella dermatitidis were found to catalyze the time-dependent incorporation of glucose from UDP-[14C]glucose into a water-insoluble material. The reaction was stimulated by bovine serum albumin. The product was characterized as beta(1----3)glucan on the basis of its resistance to alpha- and beta-amylase and susceptibility to beta(1----3)glucanase. With the exception of the preparation from A. ambisexualis, all others were stimulated by nucleoside triphosphates and their analogs. The best activators were GTP and guanosine 5'-(gamma-thio)triphosphate. It is concluded that the stimulation by nucleotides, previously found with the glucan synthetase of Saccharomyces cerevisiae, is a regulatory mechanism that was well conserved during fungal evolution, presumably because of its importance in controlling cell wall biosynthesis and cell growth. PMID:3156122

  2. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle.


    Manimaran, A; Kumaresan, A; Jeyakumar, S; Mohanty, T K; Sejian, V; Kumar, Narender; Sreela, L; Prakash, M Arul; Mooventhan, P; Anantharaj, A; Das, D N


    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  3. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.


    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  4. Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid.


    Yao, D W; Luo, J; He, Q Y; Li, J; Wang, H; Shi, H B; Xu, H F; Wang, M; Loor, J J


    Stearoyl-coenzyme A desaturase 1 (SCD1) is a key enzyme in the biosynthesis of palmitoleic and oleic acid. Although the transcriptional regulatory mechanism of SCD1 via polyunsaturated fatty acids (PUFA) has been extensively explored in nonruminants, the existence of such mechanism in ruminant mammary gland remains unknown. In this study, we used goat genomic DNA to clone and sequence a 1,713-bp fragment of the SCD1 5' flanking region. Deletion assays revealed a core region of the promoter located between -415 and -109 bp upstream of the transcription start site, and contained the highly conserved PUFA response region. An intact PUFA response region was required for the basal transcriptional activity of SCD1. Linoleic acid reduced endogenous expression of SCD1 and sterol regulatory element binding factor-1 (SREBF1) in goat mammary epithelial cells. Further analysis indicated that both the sterol response element (SRE) and the nuclear factor Y (NF-Y) binding site in the SCD1 promoter were responsible for the inhibition effect by linoleic acid, whereas the effect was abrogated once NF-Y was deleted. In addition, SRE and NF-Y were partly responsible for the transcriptional activation induced via the liver X receptor agonist T 4506585 (Sigma-Aldrich, St. Louis, MO). When goat mammary epithelial cells were cultured with linoleic acid, addition of T 4506585 markedly increased SCD1 transcription in controls, but had no effect on cells with a deleted SRE promoter. These results demonstrated that linoleic acid can regulate SCD1 expression at the transcriptional level through SRE and NF-Y in a liver X receptor-dependent fashion in the goat mammary gland. PMID:26947306

  5. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.


    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J


    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis. PMID:26476413

  6. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.


    Peón, Alberto N; Terrazas, Luis I


    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS. PMID:26947777

  7. To gate, or not to gate: regulatory mechanisms for intercellular protein transport and virus movement in plants.


    Ueki, Shoko; Citovsky, Vitaly


    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein-protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  8. The Allosteric Regulatory Mechanism of the Escherichia coli MetNI Methionine ATP Binding Cassette (ABC) Transporter*

    PubMed Central

    Yang, Janet G.; Rees, Douglas C.


    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of d- and l-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by l-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. PMID:25678706

  9. The role of water molecules in the binding of class I and II peptides to the SH3 domain of the Fyn tyrosine kinase.


    Camara-Artigas, Ana; Ortiz-Salmeron, Emilia; Andujar-Sánchez, Montserrrat; Bacarizo, Julio; Martin-Garcia, Jose Manuel


    Interactions of proline-rich motifs with SH3 domains are present in signal transduction and other important cell processes. Analysis of structural and thermodynamic data suggest a relevant role of water molecules in these protein-protein interactions. To determine whether or not the SH3 domain of the Fyn tyrosine kinase shows the same behaviour, the crystal structures of its complexes with two high-affinity synthetic peptides, VSL12 and APP12, which are class I and II peptides, respectively, have been solved. In the class I complexes two water molecules were found at the binding interface that were not present in the class II complexes. The structures suggest a role of these water molecules in facilitating conformational changes in the SH3 domain to allow the binding of the class I or II peptides. In the third binding pocket these changes modify the cation-π and salt-bridge interactions that determine the affinity of the binding. Comparison of the water molecules involved in the binding of the peptides with previous reported hydration spots suggests a different pattern for the SH3 domains of the Src tyrosine kinase family. PMID:27599862

  10. Mechanism of Regulatory Effect of MicroRNA-206 on Connexin 43 in Distant Metastasis of Breast Cancer

    PubMed Central

    Lin, Zi-Jing; Ming, Jia; Yang, Lu; Du, Jun-Ze; Wang, Ning; Luo, Hao-Jun


    Background: MicroRNA-206 (miR-206) and connexin 43 (Cx43) are related with the distant metastasis of breast cancer. It remains unclear whether the regulatory effect of miR-206 on Cx43 is involved in metastasis of breast cancer. Methods: Using quantitative real-time polymerase chain reaction and Western blot, the expressions of miR-206 and Cx43 were determined in breast cancer tissues, hepatic and pulmonary metastasis (PM), and cell lines (MCF-10A, MCF-7, and MDA-MB-231). MCF-7/MDA-M-231 cells were transfected with lentivirus-shRNA vectors to enhance/inhibit miR-206, and then Cx43 expression was observed. Cell counting kit-8 assay and Transwell method were used to detect their changes in proliferation, migration, and invasion activity. The mutant plasmids of Cx43-3’ untranslated region (3’UTR) at position 478–484 and position 1609–1615 were constructed. Luciferase reporter assay was performed to observe the effects of miR-206 on luciferase expression of different mutant plasmids and to confirm the potential binding sites of Cx43. Results: Cx43 protein expression in hepatic and PM was significantly higher than that in the primary tumor, while no significant difference was showed in messenger RNA (mRNA) expression. MiR-206 mRNA expression in hepatic and PM was significantly lower than that in the primary tumor. Cx43 mRNA and protein levels, as well as cell proliferation, migration, and invasion capabilities, were all significantly improved in MDA-MB-231 cells after reducing miR-206 expression but decreased in MCF-7 cells after elevating miR-206 expression, which demonstrated a significantly negative correlation between miR-206 and Cx43 expression (P = 0.03). MiR-206 can drastically decrease Cx43 expression of MCF-7 cells but exerts no effects on Cx43 expression in 293 cells transfected with the Cx43 coding region but the lack of Cx43-3’UTR, suggesting that Cx43-3’UTR may be the key in Cx43 regulated by miR-206. Luciferase expression showed that the

  11. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing


    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  12. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog.


    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing


    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  13. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.


    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  14. The Hog1 SAPK controls the Rtg1/Rtg3 transcriptional complex activity by multiple regulatory mechanisms

    PubMed Central

    Ruiz-Roig, Clàudia; Noriega, Núria; Duch, Alba; Posas, Francesc; de Nadal, Eulàlia


    Cells modulate expression of nuclear genes in response to alterations in mitochondrial function, a response termed retrograde (RTG) regulation. In budding yeast, the RTG pathway relies on Rtg1 and Rtg3 basic helix-loop-helix leucine Zipper transcription factors. Exposure of yeast to external hyperosmolarity activates the Hog1 stress-activated protein kinase (SAPK), which is a key player in the regulation of gene expression upon stress. Several transcription factors, including Sko1, Hot1, the redundant Msn2 and Msn4, and Smp1, have been shown to be directly controlled by the Hog1 SAPK. The mechanisms by which Hog1 regulates their activity differ from one to another. In this paper, we show that Rtg1 and Rtg3 transcription factors are new targets of the Hog1 SAPK. In response to osmostress, RTG-dependent genes are induced in a Hog1-dependent manner, and Hog1 is required for Rtg1/3 complex nuclear accumulation. In addition, Hog1 activity regulates Rtg1/3 binding to chromatin and transcriptional activity. Therefore Hog1 modulates Rtg1/3 complex activity by multiple mechanisms in response to stress. Overall our data suggest that Hog1, through activation of the RTG pathway, contributes to ensure mitochondrial function as part of the Hog1-mediated osmoadaptive response. PMID:22956768

  15. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.


    Xie, L; Smith, J A; Gross, S S


    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP. PMID:9694862

  16. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira


    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  17. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.


    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa


    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  18. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.


    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming


    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  19. Comparative transcriptomic analysis reveals novel genes and regulatory mechanisms of Tetragenococcus halophilus in response to salt stress.


    Liu, Licui; Si, Lifang; Meng, Xin; Luo, Lixin


    Tetragenococcus halophilus, a moderately halophilic Gram-positive bacterium, was isolated from Chinese style soy sauce. This species is a valuable resource for investigating salt tolerance mechanisms and improving salinity resistance in microorganisms. RNA-seq was used to sequence T. halophilus samples treated with 0 M (T1), 1 M (T2), and 3.5 M NaCl (T3). Comparative transcriptomic analyses of the different treatments were performed using gene ontology and Kyoto encyclopedia of genes and genome. The comparison of T1 and T2 by RNA-seq revealed that genes involved in transcription, translation, membrane system, and division were highly up-regulated under optimum salt condition. The comparison of T2 and T3 showed that genes related to heat shock proteins or the ATP-binding cassette transport systems were significantly up-regulated under maximum-salt condition. In addition, a considerable proportion of the significantly differently expressed genes identified in this study are novel. These data provide a crucial resource that may determine specific responses to salt stress in T. halophilus. PMID:25563971

  20. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa


    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  1. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming


    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  2. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.


    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin


    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL. PMID:26297122

  3. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.


    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen


    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  4. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32.


    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria


    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  5. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.


    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  6. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.


    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A


    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. PMID:26549245

  7. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan


    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  8. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria


    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  9. Network-based integration of molecular and physiological data elucidates regulatory mechanisms underlying adaptation to high-fat diet.


    Derous, Davina; Kelder, Thomas; van Schothorst, Evert M; van Erk, Marjan; Voigt, Anja; Klaus, Susanne; Keijer, Jaap; Radonjic, Marijana


    Health is influenced by interplay of molecular, physiological and environmental factors. To effectively maintain health and prevent disease, health-relevant relations need to be understood at multiple levels of biological complexity. Network-based methods provide a powerful platform for integration and mining of data and knowledge characterizing different aspects of health. Previously, we have reported physiological and gene expression changes associated with adaptation of murine epididymal white adipose tissue (eWAT) to 5 days and 12 weeks of high-fat diet (HFD) and low-fat diet feeding (Voigt et al. in Mol Nutr Food Res 57:1423-1434, 2013. doi: 10.1002/mnfr.201200671 ). In the current study, we apply network analysis on this dataset to comprehensively characterize mechanisms driving the short- and long-term adaptation of eWAT to HFD across multiple levels of complexity. We built a three-layered interaction network comprising enriched biological processes, their transcriptional regulators and associated changes in physiological parameters. The multi-layered network model reveals that early eWAT adaptation to HFD feeding involves major changes at a molecular level, including activation of TGF-β signalling pathway, immune and stress response and downregulation of mitochondrial functioning. Upon prolonged HFD intake, initial transcriptional response tails off, mitochondrial functioning is even further diminished, and in turn the relation between eWAT gene expression and physiological changes becomes more prominent. In particular, eWAT weight and total energy intake negatively correlate with cellular respiration process, revealing mitochondrial dysfunction as a hallmark of late eWAT adaptation to HFD. Apart from global understanding of the time-resolved adaptation to HFD, the multi-layered network model allows several novel mechanistic hypotheses to emerge: (1) early activation of TGF-β signalling as a trigger for structural and morphological changes in

  10. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.


    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  11. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.


    Verdin, Hannah; D'haene, Barbara; Beysen, Diane; Novikova, Yana; Menten, Björn; Sante, Tom; Lapunzina, Pablo; Nevado, Julian; Carvalho, Claudia M B; Lupski, James R; De Baere, Elfride


    Genomic disorders are often caused by recurrent copy number variations (CNVs), with nonallelic homologous recombination (NAHR) as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ), fork stalling and template switching (FoSTeS), microhomology-mediated break-induced replication (MMBIR), serial replication slippage (SRS), and break-induced SRS (BISRS)--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32) or its regulatory domain (10), serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES), a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH), quantitative PCR (qPCR), long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  12. Microbial infection-induced expansion of effector T cells overcomes the suppressive effects of regulatory T cells via an IL-2 deprivation mechanism.


    Benson, Alicia; Murray, Sean; Divakar, Prashanthi; Burnaevskiy, Nikolay; Pifer, Reed; Forman, James; Yarovinsky, Felix


    Foxp3(+) regulatory T (Treg) cells are a critical cell population that suppresses T cell activation in response to microbial and viral pathogens. We identify a cell-intrinsic mechanism by which effector CD4(+) T cells overcome the suppressive effects of Treg cells in the context of three distinct infections: Toxoplasma gondii, Listeria monocytogenes, and vaccinia virus. The acute responses to the parasitic, bacterial, and viral pathogens resulted in a transient reduction in frequency and absolute number of Treg cells. The infection-induced partial loss of Treg cells was essential for the initiation of potent Th1 responses and host protection against the pathogens. The observed disappearance of Treg cells was a result of insufficiency in IL-2 caused by the expansion of pathogen-specific CD4(+) T cells with a limited capacity of IL-2 production. Exogenous IL-2 treatment during the parasitic, bacterial, and viral infections completely prevented the loss of Treg cells, but restoration of Treg cells resulted in a greatly enhanced susceptibility to the pathogens. These results demonstrate that the transient reduction in Treg cells induced by pathogens via IL-2 deprivation is essential for optimal T cell responses and host resistance to microbial and viral pathogens. PMID:22147768

  13. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.


    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong


    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation. PMID:27558751

  14. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism.


    Yang, Nianlan; Baban, Babak; Isales, Carlos M; Shi, Xing-Ming


    Bone marrow is a reservoir for regulatory T (T(reg)) cells, but how T(reg) cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of T(reg) cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors T(reg) cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and T(reg) in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions. PMID:26038125

  15. The mechanism of potent GTP cyclohydrolase I inhibition by 2,4-diamino-6-hydroxypyrimidine: requirement of the GTP cyclohydrolase I feedback regulatory protein.


    Kolinsky, Monica A; Gross, Steven S


    Inhibition of GTP cyclohydrolase I (GTPCH) has been used as a selective tool to assess the role of de novo synthesis of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) in a biological system. Toward this end, 2,4-diamino-6-hydroxypyrimidine (DAHP) has been used as the prototypical GTPCH inhibitor. Using a novel real-time kinetic microplate assay for GTPCH activity and purified prokaryote-expressed recombinant proteins, we show that potent inhibition by DAHP is not the result of a direct interaction with GTPCH. Rather, inhibition by DAHP in phosphate buffer occurs via an indirect mechanism that requires the presence of GTPCH feedback regulatory protein (GFRP). Notably, GFRP was previously discovered as the essential factor that reconstitutes inhibition of pure recombinant GTPCH by the pathway end product BH4. Thus, DAHP inhibits GTPCH by engaging the endogenous feedback inhibitory system. We further demonstrate that L-Phe fully reverses the inhibition of GTPCH by DAHP/GFRP, which is also a feature in common with inhibition by BH4/GFRP. These findings suggest that DAHP is not an indiscriminate inhibitor of GTPCH in biological systems; instead, it is predicted to preferentially attenuate GTPCH activity in cells that most abundantly express GFRP and/or contain the lowest levels of L-Phe. PMID:15292175

  16. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.


    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B


    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  17. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.


    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  18. BosR (BB0647) Controls the RpoN-RpoS Regulatory Pathway and Virulence Expression in Borrelia burgdorferi by a Novel DNA-Binding Mechanism

    PubMed Central

    Ouyang, Zhiming; Deka, Ranjit K.; Norgard, Michael V.


    In Borrelia burgdorferi (Bb), the Lyme disease spirochete, the alternative σ factor σ54 (RpoN) directly activates transcription of another alternative σ factor, σS (RpoS) which, in turn, controls the expression of virulence-associated membrane lipoproteins. As is customary in σ54-dependent gene control, a putative NtrC-like enhancer-binding protein, Rrp2, is required to activate the RpoN-RpoS pathway. However, recently it was found that rpoS transcription in Bb also requires another regulator, BosR, which was previously designated as a Fur or PerR homolog. Given this unexpected requirement for a second activator to promote σ54-dependent gene transcription, and the fact that regulatory mechanisms among similar species of pathogenic bacteria can be strain-specific, we sought to confirm the regulatory role of BosR in a second virulent strain (strain 297) of Bb. Indeed, BosR displayed the same influence over lipoprotein expression and mammalian infectivity for strain Bb 297 that were previously noted for Bb strain B31. We subsequently found that recombinant BosR (rBosR) bound to the rpoS gene at three distinct sites, and that binding occurred despite the absence of consensus Fur or Per boxes. This led to the identification of a novel direct repeat sequence (TAAATTAAAT) critical for rBosR binding in vitro. Mutations in the repeat sequence markedly inhibited or abolished rBosR binding. Taken together, our studies provide new mechanistic insights into how BosR likely acts directly on rpoS as a positive transcriptional activator. Additional novelty is engendered by the facts that, although BosR is a Fur or PerR homolog and it contains zinc (like Fur and PerR), it has other unique features that clearly set it apart from these other regulators. Our findings also have broader implications regarding a previously unappreciated layer of control that can be involved in σ54–dependent gene regulation in bacteria. PMID:21347346

  19. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses

    PubMed Central

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa


    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  20. Cloning, biochemical characterisation, tissue localisation and possible post-translational regulatory mechanism of the cytosolic phosphoglucose isomerase from developing sunflower seeds.


    Troncoso-Ponce, M A; Rivoal, J; Cejudo, F J; Dorion, S; Garcés, R; Martínez-Force, E


    Lipid biosynthesis in developing sunflower (Helianthus annuus L.) seeds requires reducing power. One of the main sources of cellular NADPH is the oxidative pentose phosphate pathway (OPPP), generated from the oxidation of glucose-6-phosphate. This glycolytic intermediate, which can be imported to the plastid and enter in the OPPP, is the substrate and product of cytosolic phosphoglucose isomerase (cPGI, EC In this report, we describe the cloning of a full-length cDNA encoding cPGI from developing sunflower seeds. The sequence was predicted to code for a protein of 566 residues characterised by the presence of two sugar isomerase domains. This cDNA was heterologously expressed in Escherichia coli as a His-tagged protein. The recombinant protein was purified using immobilised metal ion affinity chromatography and biochemically characterised. The enzyme had a specific activity of 1,436 micromol min(-1) mg(-1) and 1,011 micromol min(-1) mg(-1) protein when the reaction was initiated with glucose-6-phosphate and fructose-6-phosphate, respectively. Activity was not affected by erythrose-4-phosphate, but was inhibited by 6-P gluconate and glyceraldehyde-3-phosphate. A polyclonal immune serum was raised against the purified enzyme, allowing the study of protein levels during the period of active lipid synthesis in seeds. These results were compared with PGI activity profiles and mRNA expression levels obtained from Q-PCR studies. Our results point to the existence of a possible post-translational regulatory mechanism during seed development. Immunolocalisation of the protein in seed tissues further indicated that cPGI is highly expressed in the procambial ring. PMID:20628759

  1. Mathematical model of a telomerase transcriptional regulatory network developed by cell-based screening: analysis of inhibitor effects and telomerase expression mechanisms.


    Bilsland, Alan E; Stevenson, Katrina; Liu, Yu; Hoare, Stacey; Cairney, Claire J; Roffey, Jon; Keith, W Nicol


    Cancer cells depend on transcription of telomerase reverse transcriptase (TERT). Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3'-oxime (BIO) predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several aspects of TERT

  2. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.


    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa


    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  3. Unfolding-resistant translocase targeting: a novel mechanism for outer mitochondrial membrane localization exemplified by the Bbeta2 regulatory subunit of protein phosphatase 2A.


    Dagda, Ruben K; Barwacz, Chris A; Cribbs, J Thomas; Strack, Stefan


    Heterotrimeric serine/threonine protein phosphatase 2A (PP2A) consists of scaffolding (A), catalytic (C), and variable (B, B', and B'') subunits. Variable subunits dictate subcellular localization and substrate specificity of the PP2A holoenzyme. The Bbeta regulatory subunit gene is mutated in spinocerebellar ataxia type 12, and one of its splice variants, Bbeta2, targets PP2A to mitochondria to promote apoptosis in PC12 cells (Dagda, R. K., Zaucha, J. A., Wadzinski, B. E., and Strack, S. (2003) J. Biol. Chem. 278, 24976-24985). Here, we report that Bbeta2 is localized to the outer mitochondrial membrane by a novel mechanism, combining a cryptic mitochondrial import signal with a structural arrest domain. Scanning mutagenesis demonstrates that basic and hydrophobic residues mediate mitochondrial association and the proapoptotic activity of Bbeta2. When fused to green fluorescent protein, the N terminus of Bbeta2 acts as a cleavable mitochondrial import signal. Surprisingly, full-length Bbeta2 is not detectably cleaved and is retained at the outer mitochondrial membrane, even though it interacts with the TOM22 import receptor, as shown by luciferase complementation in intact cells. Mutations that open the C-terminal beta-propeller of Bbeta2 facilitate mitochondrial import, indicating that this rigid fold acts as a stop-transfer domain by resisting the partial unfolding step prerequisite for matrix translocation. Because hybrids of prototypical import and beta-propeller domains recapitulate this behavior, we predict the existence of other similarly localized proteins and a selection against highly stable protein folds in the mitochondrial matrix. This unfolding-resistant targeting to the mitochondrial translocase is necessary but not sufficient for the proapoptotic activity of Bbeta2, which also requires association with the rest of the PP2A holoenzyme. PMID:15923182

  4. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail:; Kaur, Simarna


    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  5. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.


    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A


    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA. PMID:23042418

  6. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].


    Arnautov, O V


    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  7. Study on the Regulatory Mechanism of the Lipid Metabolism Pathways during Chicken Male Germ Cell Differentiation Based on RNA-Seq

    PubMed Central

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun


    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation. PMID:25658587

  8. Proline Substitutions and Threonine Pseudophosphorylation of the SH3 Ligand of 18.5-kDa Myelin Basic Protein Decrease Its Affinity for the Fyn-SH3 Domain and Alter Process Development and Protein Localization in Oligodendrocytes

    PubMed Central

    Smith, Graham S.T.; De Avila, Miguel; Paez, Pablo M.; Spreuer, Vilma; Wills, Melanie K.B.; Jones, Nina; Boggs, Joan M.; Harauz, George


    The developmentally regulated myelin basic proteins (MBPs), which arise from the golli (gene of oligodendrocyte lineage) complex, are highly positively charged, intrinsically disordered, multifunctional proteins having several alternatively spliced isoforms and posttranslational modifications, and they play key roles in myelin compaction. The classic 18.5-kDa MBP isoform has a proline-rich region comprising amino acids 92–99 (murine sequence –T92PRTPPPS99–) that contains a minimal SH3 ligand domain. We have previously shown that 18.5-kDa MBP binds to several SH3 domains, including that of Fyn, a member of the Src family of tyrosine kinases involved in a number of signaling pathways during CNS development. To determine the physiological role of this binding as well as the role of phosphorylation of Thr92 and Thr95, in the current study we have produced several MBP variants specifically targeting phosphorylation sites and key structural regions of MBP’s SH3 ligand domain. Using isothermal titration calorimetry, we have demonstrated that, compared with the wild-type protein, these variants have lower affinity for the SH3 domain of Fyn. Moreover, overexpression of N-terminal-tagged GFP versions in immortalized oligodendroglial N19 and N20.1 cell cultures results in aberrant elongation of membrane processes and increased branching complexity and inhibits the ability of MBP to decrease Ca2+ influx. Phosphorylation of Thr92 can also cause MBP to traffic to the nucleus, where it may participate in additional protein–protein interactions. Coexpression of MBP with a constitutively active form of Fyn kinase resulted in membrane process elaboration, a phenomenon that was abolished by point amino acid substitutions in MBP’s SH3 ligand domain. These results suggest that MBP’s SH3 ligand domain plays a key role in intracellular protein interactions in vivo and may be required for proper membrane elaboration of developing oligodendrocytes and, further, that

  9. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne


    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  10. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis


    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  11. Regulatory Anatomy

    PubMed Central


    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  12. An SH3 binding motif within the nucleocapsid protein of porcine reproductive and respiratory syndrome virus interacts with the host cellular signaling proteins STAMI, TXK, Fyn, Hck, and cortactin.


    Kenney, Scott P; Meng, Xiang-Jin


    Porcine reproductive and respiratory syndrome virus (PRRSV) causes an economically important global swine disease, and has a complicated virus-host immunomodulation that often leads to a weak Th2 immune response and viral persistence. In this study, we identified a Src homology 3 (SH3) binding motif, PxxPxxP, that is conserved within the N protein of PRRSV strains. Subsequently, we identified five host cellular proteins [signal transducing adaptor molecule (STAM)I, TXK tyrosine kinase (TXK), protein tyrosine kinase fyn (Fyn), hematopoietic cell kinase (Hck), and cortactin] that interact with this SH3 motif. We demonstrated that binding of SH3 proteins with PRRSV N protein depends on at least one intact PxxP motif as disruption of P53 within the motif significantly reduced interaction of each of the 5 proteins. The first PxxP motif appears to be more important for STAMI-N protein interactions whereas the second PxxP motif was more important for Hck interaction. Both STAMI and Hck interactions with PRRSV N protein required an unhindered C-terminal domain as the interaction was only observed with STAMI and Hck proteins with N-terminal but not C-terminal fluorescent tags. We showed that the P56 residue within the SH3 motif is critical for virus lifecycle as mutation resulted in a loss of virus infectivity, however the P50 and P53 mutations did not abolish virus infectivity suggesting that these highly conserved proline residues within the SH3 motif may provide a selective growth advantage through interactions with the host rather than a vital functional element. These results have important implications in understanding PRRSV-host interactions. PMID:25882913

  13. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.


    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C


    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  14. Noncoding Regulatory RNAs in Hematopoiesis.


    Jeong, M; Goodell, M A


    Hematopoiesis is a dynamic process in which blood cells are continuously generated from hematopoietic stem cells (HSCs). The regulatory mechanisms controlling HSC fate have been studied extensively over the past several decades. Although many protein-coding genes have been shown to regulate hematopoietic differentiation, additional levels of HSC regulation are not well studied. Advances in deep sequencing have revealed many new classes of regulatory noncoding RNAs (ncRNAs), such as enhancer RNAs and antisense ncRNAs. Functional analysis of some of these ncRNAs has provided insights into the molecular mechanisms that regulate hematopoietic development and disease. In this review, we summarize recent advances in our understanding of functional regulatory ncRNAs associated with hematopoietic self-renewal and differentiation, as well as those dysregulated ncRNAs involved in hematologic malignancies. PMID:27137659

  15. T Regulatory Type 1 Cells in Squamous Cell Carcinoma of the Head and Neck: Mechanisms of Suppression and Expansion in Advanced Disease

    PubMed Central

    Bergmann, Christoph; Strauss, Laura; Wang, Yun; Szczepanski, Miroslaw J.; Lang, Stephan; Johnson, Jonas T.; Whiteside, Theresa L.


    Purpose Regulatory T cells play a major role in tumor escape from immunosurveillance. T regulatory cells type 1 (Tr1), a subset of regulatory T cells present in the tumor and peripheral circulation of patients with head and neck squamous cell carcinoma (HNSCC), mediate immune suppression and might contribute to tumor progression. Experimental Design CD4+CD25− T cells were isolated from peripheral blood mononuclear cells (PBMC) or tumor-infiltrating lymphocytes (TIL) of 26 HNSCC patients and 10 normal controls. The Tr1 cell phenotype was determined before and after culture in the presence of interleukin (IL)-2, IL-10, and IL-15, each at 10 to 20 IU/mL. Suppression was measured in carboxyfluorescein diacetate succinimidyl ester – based proliferation assays with or without neutralizing anti-IL-10 or anti – transforming growth factor-β1 (TGF-β1) monoclonal antibodies in Transwell systems. ELISA was used to define the Tr1 cytokine profile. Results Tr1 cells originate from CD4+CD25− precursors present in TIL and PBMC of HNSCC patients. Cytokine-driven ex vivo expansion of Tr1 precursors yielded CD4+CD25−Foxp3lowCD132+IL-10+TGF-β1 + populations that mediated higher suppression than Tr1 cells of normal controls (P < 0.0001). Tr1 cells suppressed proliferation of autologous responders via IL-10 and TGF-β1 secretion. Expression of these cytokines was higher in TIL-derived than PBMC-derived Tr1 cells (P < 0.0001). The Tr1 cell frequency and suppressor function were significantly higher in patients presenting with advanced than early disease stages and in patients “cured” by oncologic therapies than in those with active disease. Conclusions In HNSCC, Tr1 cell generation is promoted at the tumor site. Tr1 cells use TGF-β and IL-10 to mediate suppression. They expand during disease progression and also following cancer therapy in patients with no evident disease. PMID:18559587

  16. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn's disease and leprosy.


    Sun, Yonghu; Irwanto, Astrid; Toyo-Oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun


    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn's disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r(2) = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  17. A systematic computational analysis of the rRNA-3' UTR sequence complementarity suggests a regulatory mechanism influencing post-termination events in metazoan translation.


    Pánek, Josef; Kolář, Michal; Herrmannová, Anna; Valášek, Leoš Shivaya


    Nucleic acid sequence complementarity underlies many fundamental biological processes. Although first noticed a long time ago, sequence complementarity between mRNAs and ribosomal RNAs still lacks a meaningful biological interpretation. Here we used statistical analysis of large-scale sequence data sets and high-throughput computing to explore complementarity between 18S and 28S rRNAs and mRNA 3' UTR sequences. By the analysis of 27,646 full-length 3' UTR sequences from 14 species covering both protozoans and metazoans, we show that the computed 18S rRNA complementarity creates an evolutionarily conserved localization pattern centered around the ribosomal mRNA entry channel, suggesting its biological relevance and functionality. Based on this specific pattern and earlier data showing that post-termination 80S ribosomes are not stably anchored at the stop codon and can migrate in both directions to codons that are cognate to the P-site deacylated tRNA, we propose that the 18S rRNA-mRNA complementarity selectively stabilizes post-termination ribosomal complexes to facilitate ribosome recycling. We thus demonstrate that the complementarity between 18S rRNA and 3' UTRs has a non-random nature and very likely carries information with a regulatory potential for translational control. PMID:27190231

  18. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn’s disease and leprosy

    PubMed Central

    Sun, Yonghu; Irwanto, Astrid; Toyo-oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun


    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn’s disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r2 = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  19. Combinatorial readout of unmodified H3R2 and acetylated H3K14 by the tandem PHD finger of MOZ reveals a regulatory mechanism for HOXA9 transcription.


    Qiu, Yu; Liu, Lei; Zhao, Chen; Han, Chuanchun; Li, Fudong; Zhang, Jiahai; Wang, Yan; Li, Guohong; Mei, Yide; Wu, Mian; Wu, Jihui; Shi, Yunyu


    Histone acetylation is a hallmark for gene transcription. As a histone acetyltransferase, MOZ (monocytic leukemia zinc finger protein) is important for HOX gene expression as well as embryo and postnatal development. In vivo, MOZ forms a tetrameric complex with other subunits, including several chromatin-binding modules with regulatory functions. Here we report the solution structure of the tandem PHD (plant homeodomain) finger (PHD12) of human MOZ in a free state and the 1.47 Å crystal structure in complex with H3K14ac peptide, which reveals the structural basis for the recognition of unmodified R2 and acetylated K14 on histone H3. Moreover, the results of chromatin immunoprecipitation (ChIP) and RT-PCR assays indicate that PHD12 facilitates the localization of MOZ onto the promoter locus of the HOXA9 gene, thereby promoting the H3 acetylation around the promoter region and further up-regulating the HOXA9 mRNA level. Taken together, our findings suggest that the combinatorial readout of the H3R2/K14ac by PHD12 might represent an important epigenetic regulatory mechanism that governs transcription and also provide a clue of cross-talk between the MOZ complex and histone H3 modifications. PMID:22713874

  20. Regulatory T Cell-Dependent and -Independent Mechanisms of Immune Suppression by CD28/B7 and CD40/CD40L Costimulation Blockade.


    Vogel, Isabel; Verbinnen, Bert; Van Gool, Stefaan; Ceuppens, Jan L


    Blocking of costimulatory CD28/B7 and CD40/CD40L interactions is an experimental approach to immune suppression and tolerance induction. We previously reported that administration of a combination of CTLA-4Ig and MR1 (anti-CD40L mAb) for blockade of these interactions induces tolerance in a fully mismatched allogeneic splenocyte transfer model in mice. We now used this model to study whether regulatory T cells (Tregs) contribute to immune suppression and why both pathways have to be blocked simultaneously. Mice were injected with allogeneic splenocytes, CD4(+) T cells, or CD8(+) T cells and treated with MR1 mAb and different doses of CTLA-4Ig. The graft-versus-host reaction of CD4(+) T cells, but not of CD8(+) T cells, was inhibited by MR1. CTLA-4Ig was needed to cover CD8(+) T cells but had only a weak effect on CD4(+) T cells. Consequently, only the combination provided full protection when splenocytes were transferred. Importantly, MR1 and low-dose CTLA-4Ig treatment resulted in a relative increase in Tregs, and immune suppressive efficacy was abolished in the absence of Tregs. High-dose CTLA-4Ig treatment, in contrast, prevented Treg expansion and activity, and in combination with MR1 completely inhibited CD4(+) and CD8(+) T cell activation in a Treg-independent manner. In conclusion, MR1 and CTLA-4Ig act synergistically as they target different T cell populations. The contribution of Tregs to immune suppression by costimulation blockade depends on the concentration of CTLA-4Ig and thus on the degree of available CD28 costimulation. PMID:27288533

  1. Identification of in vivo DNA-binding mechanisms of Pax6 and reconstruction of Pax6-dependent gene regulatory networks during forebrain and lens development

    PubMed Central

    Sun, Jian; Rockowitz, Shira; Xie, Qing; Ashery-Padan, Ruth; Zheng, Deyou; Cvekl, Ales


    The transcription factor Pax6 is comprised of the paired domain (PD) and homeodomain (HD). In the developing forebrain, Pax6 is expressed in ventricular zone precursor cells and in specific subpopulations of neurons; absence of Pax6 results in disrupted cell proliferation and cell fate specification. Pax6 also regulates the entire lens developmental program. To reconstruct Pax6-dependent gene regulatory networks (GRNs), ChIP-seq studies were performed using forebrain and lens chromatin from mice. A total of 3514 (forebrain) and 3723 (lens) Pax6-containing peaks were identified, with ∼70% of them found in both tissues and thereafter called ‘common’ peaks. Analysis of Pax6-bound peaks identified motifs that closely resemble Pax6-PD, Pax6-PD/HD and Pax6-HD established binding sequences. Mapping of H3K4me1, H3K4me3, H3K27ac, H3K27me3 and RNA polymerase II revealed distinct types of tissue-specific enhancers bound by Pax6. Pax6 directly regulates cortical neurogenesis through activation (e.g. Dmrta1 and Ngn2) and repression (e.g. Ascl1, Fezf2, and Gsx2) of transcription factors. In lens, Pax6 directly regulates cell cycle exit via components of FGF (Fgfr2, Prox1 and Ccnd1) and Wnt (Dkk3, Wnt7a, Lrp6, Bcl9l, and Ccnd1) signaling pathways. Collectively, these studies provide genome-wide analysis of Pax6-dependent GRNs in lens and forebrain and establish novel roles of Pax6 in organogenesis. PMID:26138486

  2. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)


    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  3. Dual mechanisms of action of the RNA-binding protein human antigen R explains its regulatory effect on melanoma cell migration.


    Moradi, Farnaz; Berglund, Pontus; Linnskog, Rickard; Leandersson, Karin; Andersson, Tommy; Prasad, Chandra Prakash


    Overexpression of wingless-type MMTV integration site family 5A (WNT5A) plays a significant role in melanoma cancer progression; however, the mechanism(s) involved remains unknown. In breast cancer, the human antigen R (HuR) has been implicated in the regulation of WNT5A expression. Here, we demonstrate that endogenous expression of WNT5A correlates with levels of active HuR in HTB63 and WM852 melanoma cells and that HuR binds to WNT5A messenger RNA in both cell lines. Although the HuR inhibitor MS-444 significantly impaired migration in both melanoma cell lines, it reduced WNT5A expression only in HTB63 cells, as did small interfering RNA knockdown of HuR. Consistent with this finding, MS-444-induced inhibition of HTB63 cell migration was restored by the addition of recombinant WNT5A, whereas MS-444-induced inhibition of WM852 cell migration was restored by the addition of recombinant matrix metalloproteinase-9, another HuR-regulated protein. Clearly, HuR positively regulates melanoma cell migration via at least 2 distinct mechanisms making HuR an attractive therapeutic target for halting melanoma dissemination. PMID:26970271

  4. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development[OPEN

    PubMed Central

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin


    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays) HDAC HDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed in hda101 mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalian HDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  5. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development.


    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Rossi, Vincenzo; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin


    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays)HDACHDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed inhda101mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalianHDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  6. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.


    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S


    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities. PMID:26702834

  7. Deep Sequencing-Based Transcriptome Analysis Reveals the Regulatory Mechanism of Bemisia tabaci (Hemiptera: Aleyrodidae) Nymph Parasitized by Encarsia sophia (Hymenoptera: Aphelinidae)

    PubMed Central

    Wang, Ran; Li, Fei; Zhang, Fan; Wang, Su


    The whitefly Bemisia tabaci is a genetically diverse complex with multiple cryptic species, and some are the most destructive invasive pests of many ornamentals and crops worldwide. Encarsia sophia is an autoparasitoid wasp that demonstrated high efficiency as bio-control agent of whiteflies. However, the immune mechanism of B. tabaci parasitization by E. sophia is unknown. In order to investigate immune response of B. tabaci to E. Sophia parasitization, the transcriptome of E. sophia parasitized B. tabaci nymph was sequenced by Illumina sequencing. De novo assembly generated 393,063 unigenes with average length of 616 bp, in which 46,406 unigenes (15.8% of all unigenes) were successfully mapped. Parasitization by E. sophia had significant effects on the transcriptome profile of B. tabaci nymph. A total of 1482 genes were significantly differentially expressed, of which 852 genes were up-regulated and 630 genes were down-regulated. These genes were mainly involved in immune response, development, metabolism and host signaling pathways. At least 52 genes were found to be involved in the host immune response, 33 genes were involved in the development process, and 29 genes were involved in host metabolism. Taken together, the assembled and annotated transcriptome sequences provided a valuable genomic resource for further understanding the molecular mechanism of immune response of B. tabaci parasitization by E. sophia. PMID:27332546

  8. 3 CFR - Regulatory Review

    Code of Federal Regulations, 2010 CFR


    ... 3 The President 1 2010-01-01 2010-01-01 false Regulatory Review Presidential Documents Other Presidential Documents Memorandum of January 30, 2009 Regulatory Review Memorandum for the Heads of Executive Departments and Agencies For well over two decades, the Office of Information and Regulatory Affairs (OIRA) at the Office of Management...

  9. A novel regulatory mechanism for trimeric GTP-binding proteins in the membrane and secretory granule fractions of human and rodent beta cells.

    PubMed Central

    Kowluru, A; Seavey, S E; Rhodes, C J; Metz, S A


    Recently we described roles for heterotrimeric and low-molecular-mass GTP-binding proteins in insulin release from normal rat islets. During these studies, we observed that a protein with an apparent molecular mass (37 kDa) similar to that of the beta subunit of trimeric GTP-binding proteins underwent phosphorylation in each of five classes of insulin-secreting cells. Incubation of the beta cell total membrane fraction or the isolated secretory granule fraction (but not the cytosolic fraction) with [gamma-32P]ATP or [gamma-32P]GTP resulted in the phosphorylation of this protein, which was selectively immunoprecipitated by an anti-serum directed against the common beta subunit of trimeric G-proteins. Disruption of the alpha beta gamma trimer (by pretreatment with either fluoroaluminate or guanosine 5'(-)[gamma-thio]triphosphate) prevented beta subunit phosphorylation. Based on differential sensitivities to pH, heat and the histidine-selective reagent diethyl pyrocarbonate (and reversal of the latter by hydroxylamine), the phosphorylated amino acid was presumptively identified as histidine. Incubation of pure beta subunit alone or in combination with the exogenous purified alpha subunit of transducin did not result in the phosphorylation of the beta subunit, but addition of the islet cell membrane fraction did support this event, suggesting that membrane localization (or a membrane-associated factor) is required for beta subunit phosphorylation. Incubation of phosphorylated beta subunit with G alpha.GDP accelerated the dephosphorylation of the beta subunit, accompanied by the formation of G alpha-GTP. Immunoblotting detected multiple alpha subunits (of Gi, G(o) and Gq) and at least one beta subunit in the secretory granule fraction of normal rat islets and insulinoma cells. These data describe a potential alternative mechanism for the activation of GTP-binding proteins in beta cells which contrasts with the classical receptor-agonist mechanism: G beta undergoes

  10. Regulatory affairs administration as regulatory policy determinant

    SciTech Connect

    Forcier, J.R.


    It is the thesis of this article that the processing of a utility company's regulation-related work, the supporting tasks and the manner in which they are completed, can and does have a significant impact on the final results or work product of the regulatory affairs function, including even, potentially, the action of the regulatory agency. The article is therefore full of practical pointers on how the interface with the regulatory authority can best be organized, managed, and carried through to the attainment of optimum results for the utility. 2 references.

  11. Characterization of the functional role of allosteric site residue Asp102 in the regulatory mechanism of human mitochondrial NAD(P)+-dependent malate dehydrogenase (malic enzyme)

    PubMed Central


    Human mitochondrial NAD(P)+-dependent malate dehydrogenase (decarboxylating) (malic enzyme) can be specifically and allosterically activated by fumarate. X-ray crystal structures have revealed conformational changes in the enzyme in the absence and in the presence of fumarate. Previous studies have indicated that fumarate is bound to the allosteric pocket via Arg67 and Arg91. Mutation of these residues almost abolishes the activating effect of fumarate. However, these amino acid residues are conserved in some enzymes that are not activated by fumarate, suggesting that there may be additional factors controlling the activation mechanism. In the present study, we tried to delineate the detailed molecular mechanism of activation of the enzyme by fumarate. Site-directed mutagenesis was used to replace Asp102, which is one of the charged amino acids in the fumarate binding pocket and is not conserved in other decarboxylating malate dehydrogenases. In order to explore the charge effect of this residue, Asp102 was replaced by alanine, glutamate or lysine. Our experimental data clearly indicate the importance of Asp102 for activation by fumarate. Mutation of Asp102 to Ala or Lys significantly attenuated the activating effect of fumarate on the enzyme. Kinetic parameters indicate that the effect of fumarate was mainly to decrease the Km values for malate, Mg2+ and NAD+, but it did not notably elevate kcat. The apparent substrate Km values were reduced by increasing concentrations of fumarate. Furthermore, the greatest effect of fumarate activation was apparent at low malate, Mg2+ or NAD+ concentrations. The Kact values were reduced with increasing concentrations of malate, Mg2+ and NAD+. The Asp102 mutants, however, are much less sensitive to regulation by fumarate. Mutation of Asp102 leads to the desensitization of the co-operative effect between fumarate and substrates of the enzyme. PMID:15989682

  12. Underlying mechanism of regulatory actions of diclofenac, a nonsteroidal anti-inflammatory agent, on neuronal potassium channels and firing: an experimental and theoretical study.


    Huang, C W; Hung, T Y; Liao, Y K; Hsu, M C; Wu, S N


    Diclofenac (DIC), a nonsteroidal anti-inflammatory drug, is known to exert anti-nociceptive and anti-convulsant actions; however, its effects on ion currents, in neurons remain debatable. We aimed to investigate (1) potential effects of diclofenac on membrane potential and potassium currents in differentiated NSC-34 neuronal cells and dorsal root ganglion (DRG) neurons with whole-cell patch-clamp technology, and (2) firing of action potentials (APs), using a simulation model from hippocampal CA1 pyramidal neurons based on diclofenac's effects on potassium currents. In the NSC-34 cells, diclofenac exerted an inhibitory effect on delayed-rectifier K⁺ current (I(KDR)) with an IC₅₀ value of 73 μM. Diclofenac not merely inhibited the I(KDR) amplitude in response to membrane depolarization, but also accelerated the process of current inactivation. The inhibition by diclofenac of IK(DR) was not reversed by subsequent application of either naloxone. Importantly, diclofenac (300 μM) increased the amplitude of M-type K⁺ current (I)(KM)), while flupirtine (10 μM) or meclofenamic acid (10 μM) enhanced it effectively. Consistently, diclofenac (100 μM) increased the amplitude of I(KM) and diminished the I(KDR) amplitude, with a shortening of inactivation time constant in DRG neurons. Furthermore, by using the simulation modeling, we demonstrated the potential electrophysiological mechanisms underlying changes in AP firing caused by diclofenac. During the exposure to diclofenac, the actions on both I(KM) and I(KDR) could be potential mechanism through which it influences the excitability of fast-spiking neurons. Caution needs to be made in attributing the effects of diclofenac primarily to those produced by the activation of I(KM). PMID:23959723

  13. Tick-borne encephalitis (TBE) and hepatitis B nonresponders feature different immunologic mechanisms in response to TBE and influenza vaccination with involvement of regulatory T and B cells and IL-10.


    Garner-Spitzer, Erika; Wagner, Angelika; Paulke-Korinek, Maria; Kollaritsch, Herwig; Heinz, Franz X; Redlberger-Fritz, Monika; Stiasny, Karin; Fischer, Gottfried F; Kundi, Michael; Wiedermann, Ursula


    Low responsiveness/nonresponsiveness is characterized by an insufficient immune response upon primary and/or booster vaccination and affects 1-10% of vaccinees. In the current study, we aimed to investigate whether nonresponsiveness is an Ag/vaccine-specific phenomenon and to clarify underlying immunological mechanisms. Nonresponders to tick-borne encephalitis (TBE) or hepatitis B Ag with a history of previous TBE vaccinations were booster vaccinated with TBE and influenza vaccine and compared with TBE high responders in terms of humoral and cellular immune response. Postboosters in TBE high responder existing TBE titers increased, and solid humoral responses to influenza vaccine were induced. In TBE nonresponders, low to undetectable prevaccination TBE titers remained low, whereas sufficient influenza Abs were induced. In both TBE groups, a positive correlation of humoral and cellular immune response was seen as high/low TBE titers were associated with sufficient/lack of Ag-specific T cell proliferation. Furthermore, responses to influenza were robust in terms of Abs and cytokine production. In contrast, in hepatitis B nonresponders, sufficient humoral responses to TBE and influenza Ags were induced despite lacking specific IL-2 and IFN-γ production. Importantly, these patients showed high IL-10 baseline levels in vitro. HLA-DR subtypes associated with hepatitis B nonresponsiveness were overrepresented in this group, and high IL-10 levels were linked to these subtypes. Whereas TBE and hepatitis B nonresponders had increased IL-10-producing FOXP3(+) T regulatory cells upon vaccination, only in hepatitis B nonresponders, showing elevated prevaccination IL-10 levels, a prominent population of B regulatory cells was detected. We conclude that immunological pathways of nonresponsiveness follow different patterns depending both on vaccine Ag and genetic predisposition of the vaccinee. PMID:23872054

  14. Regulatory mechanisms of ecdysone-inducible Blimp-1 encoding a transcriptional repressor that is important for the prepupal development in Drosophila.


    Akagi, Kazutaka; Ueda, Hitoshi


    Blimp-1 is an ecdysone-inducible transcription factor that is expressed in the early stage of the prepupal period. The timing of its disappearance determines expression timing of the FTZ-F1 gene, whose temporally restricted expression is essential for the prepupal development. To elucidate the termination mechanism of Blimp-1 gene expression, we examined the regulation of the Blimp-1 gene using an organ culture system. The results showed that the Blimp-1 gene is transcribed in cultured organs taken from a low ecdysteroid period even after extended exposure to 20-hydroxyecdysone, while well-known early genes such as E75A are repressed under the same conditions. Similar selective transcription was observed in the cultured organs obtained from a high ecdysteroid period. We further showed that Blimp-1 transcripts quickly disappeared in the presence of actinomycin D. From these results, we concluded that the Blimp-1 gene is transcribed when the ecdysteroid titer is high, but the expressed mRNA degrades rapidly; these unique regulations limit its expression to the high ecdysteroid stage. PMID:21671917

  15. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons.


    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio


    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  16. Whirlin interacts with espin and modulates its actin-regulatory function: an insight into the mechanism of Usher syndrome type II.


    Wang, Le; Zou, Junhuang; Shen, Zuolian; Song, E; Yang, Jun


    Whirlin mutations cause retinal degeneration and hearing loss in Usher syndrome type II (USH2) and non-syndromic deafness, DFNB31. Its protein recruits other USH2 causative proteins to form a complex at the periciliary membrane complex in photoreceptors and the ankle link of the stereocilia in hair cells. However, the biological function of this USH2 protein complex is largely unknown. Using a yeast two-hybrid screen, we identified espin, an actin-binding/bundling protein involved in human deafness when defective, as a whirlin-interacting protein. The interaction between these two proteins was confirmed by their coimmunoprecipitation and colocalization in cultured cells. This interaction involves multiple domains of both proteins and only occurs when espin does not bind to actin. Espin was partially colocalized with whirlin in the retina and the inner ear. In whirlin knockout mice, espin expression changed significantly in these two tissues. Further studies found that whirlin increased the mobility of espin and actin at the actin bundles cross-linked by espin and, eventually, affected the dimension of these actin bundles. In whirlin knockout mice, the stereocilia were thickened in inner hair cells. We conclude that the interaction between whirlin and espin and the balance between their expressions are required to maintain the actin bundle network in photoreceptors and hair cells. Disruption of this actin bundle network contributes to the pathogenic mechanism of hearing loss and retinal degeneration caused by whirlin and espin mutations. Espin is a component of the USH2 protein complex and could be a candidate gene for Usher syndrome. PMID:22048959

  17. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons

    PubMed Central

    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio


    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  18. The analysis of estrogen receptor-α positive breast cancer stem-like cells unveils a high expression of the serpin proteinase inhibitor PI-9: Possible regulatory mechanisms.


    Lauricella, Marianna; Carlisi, Daniela; Giuliano, Michela; Calvaruso, Giuseppe; Cernigliaro, Cesare; Vento, Renza; D'Anneo, Antonella


    Breast cancer stem cells seem to play important roles in breast tumor recurrence and endocrine therapy resistance, although the underlying mechanisms have not been well established. Moreover, in some tumor systems the immunosurveillance failure against cancer cells has been related to the presence of the granzyme B inhibitor PI-9. This study explored the status of PI-9 in tumorspheres isolated from estrogen receptor-α positive (ERα+) breast cancer MCF7 cells. Studies were performed in tertiary tumorspheres which possess high levels of stemness markers (Nanog, Oct3/4 and Sox2) and self-renewal ability. The exposure to estrogens (17-β estradiol and genistein) increased the number and sizes of tumorspheres, promoting cell proliferation as demonstrated by the increase in the proliferating cell nuclear antigen (PCNA). The study of the three isoforms (66, 46 and 36 kDa) of ERα disclosed that tertiary tumorspheres exhibit a marked increase in ERα36, while the level of ERα66, which is highly expressed in MCF7 cells, declines. Although it is known that PI-9 is a transcriptional target of ERα66, surprisingly in tertiary tumorspheres, despite the reduced level of ERα66, the protein and mRNA content of PI-9 is higher than in MCF7 cells. Treatment with estrogens further increased PI-9 level while decreased that of ERα66 isoform thus excluding the involvement of this receptor isoform in the event. Moreover, our studies also provided evidence that tertiary tumorspheres express elevated levels of CXCR4 and phospho-p38, suggesting that the high PI-9 content might be ascribed to the activation of the proliferative CXCR4/phospho-p38 axis. Taken together, these events could supply a selective advantage to breast cancer stem cells by interfering with immunosurveillance systems and open up the avenue to new possible targets for breast cancer treatment. PMID:27121069

  19. Genomics in the land of regulatory science.


    Tong, Weida; Ostroff, Stephen; Blais, Burton; Silva, Primal; Dubuc, Martine; Healy, Marion; Slikker, William


    Genomics science has played a major role in the generation of new knowledge in the basic research arena, and currently question arises as to its potential to support regulatory processes. However, the integration of genomics in the regulatory decision-making process requires rigorous assessment and would benefit from consensus amongst international partners and research communities. To that end, the Global Coalition for Regulatory Science Research (GCRSR) hosted the fourth Global Summit on Regulatory Science (GSRS2014) to discuss the role of genomics in regulatory decision making, with a specific emphasis on applications in food safety and medical product development. Challenges and issues were discussed in the context of developing an international consensus for objective criteria in the analysis, interpretation and reporting of genomics data with an emphasis on transparency, traceability and "fitness for purpose" for the intended application. It was recognized that there is a need for a global path in the establishment of a regulatory bioinformatics framework for the development of transparent, reliable, reproducible and auditable processes in the management of food and medical product safety risks. It was also recognized that training is an important mechanism in achieving internationally consistent outcomes. GSRS2014 provided an effective venue for regulators andresearchers to meet, discuss common issues, and develop collaborations to address the challenges posed by the application of genomics to regulatory science, with the ultimate goal of wisely integrating novel technical innovations into regulatory decision-making. PMID:25796433

  20. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc


    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  1. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.


    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc


    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  2. Beta-adrenergic stimulation of cFOS via protein kinase A is mediated by cAMP regulatory element binding protein (CREB)-dependent and tissue-specific CREB-independent mechanisms in corticotrope cells.


    Boutillier, A L; Barthel, F; Roberts, J L; Loeffler, J P


    Catecholamines stimulate proopiomelanocortin (POMC) gene expression in corticotrope cells, but the molecular mechanisms of these effects are not known. While beta-adrenergic receptors stimulate the protein kinase A (PKA) system, the POMC promoter does not have classical cAMP-response elements (CREs). Therefore, we investigated the induction of the c-fos protooncogen, previously shown to increase POMC transcription in AtT20 cells. In this corticotrope-derived cell line, we show that activation of beta-receptors with isoprenaline (Iso) induces a transient rise in c-fos mRNA levels. Gel mobility shift assays with a labeled AP1 consensus sequence (TGACTCA) showed induction of specific binding activity after Iso treatment. Cotransfection experiments with dominant inhibitory PKA mutants and reporter genes containing c-fos promoter sequences showed that c-fos induction by Iso is entirely dependent on a functional PKA activity. Furthermore, we show that beta-receptor induction of c-fos in corticotrophs is mediated by at least two distinct cAMP-responsive sequences. cAMP regulatory element binding (CREB)-dependent induction is observed on the CRE located at -60 bp on the c-fos promoter. A region located in the vicinity of the dyad symetry element (-290) is also found to mediate tissue-specific cAMP induction. Transcriptional activation by this site, although sensitive to PKA antagonism, is not blocked by CREB mutants. PMID:1331087

  3. Gene Regulatory Networks Elucidating Huanglongbing Disease Mechanisms

    PubMed Central

    Martinelli, Federico; Reagan, Russell L.; Uratsu, Sandra L.; Phu, My L.; Albrecht, Ute; Zhao, Weixiang; Davis, Cristina E.; Bowman, Kim D.; Dandekar, Abhaya M.


    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein – protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes) would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation), sucrose metabolism (upregulation), and starch biosynthesis (upregulation). In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70) was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur. PMID:24086326

  4. Gene regulatory networks elucidating Huanglongbing disease mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional...

  5. Self-Regulatory Mechanisms Governing Gender Development.

    ERIC Educational Resources Information Center

    Bussey, Kay; Bandura, Albert


    Groups of younger and older children in a sample of two to five year olds were assessed for gender knowledge, gender standards, and gender-linked behavior. All children exhibited more same- than cross-sex typed behavior. Older children expressed self-approval for same-sex behavior and self-criticism for cross-sex behavior. (BC)

  6. Nuclear Regulatory Commission Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...) 2010, less the amounts appropriated from the Nuclear Waste Fund, amounts appropriated for Waste... agenda on April 26, 2010 (75 FR 21960). For this edition of the NRC's regulatory agenda, the most... publication of the last NRC semiannual agenda on April 26, 2010 (75 FR 21960). Within each group, the...

  7. NRC regulatory agenda

    SciTech Connect

    Not Available


    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  8. NRC regulatory agenda

    SciTech Connect

    Not Available


    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  9. NRC Regulatory Agenda

    SciTech Connect

    Not Available


    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  10. NRC Regulatory Agenda

    SciTech Connect

    Not Available


    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and all petitions for rulemaking which have been received by the commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  11. NRC regulatory agenda

    SciTech Connect

    Not Available


    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  12. NRC regulatory agenda

    SciTech Connect

    Not Available


    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has proposed or is considering action and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  13. Plant Regulatory Organizations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The chapter on Plant Regulatory Organizations is part of a book titled Pest Management and Phytosanitary Trade Barriers authored by Neil Heather (Australia) and Guy Hallman. It covers the role of plant regulatory organizations from the international to state level in protecting plant health. At on...

  14. Modeling of hysteresis in gene regulatory networks.


    Hu, J; Qin, K R; Xiang, C; Lee, T H


    Hysteresis, observed in many gene regulatory networks, has a pivotal impact on biological systems, which enhances the robustness of cell functions. In this paper, a general model is proposed to describe the hysteretic gene regulatory network by combining the hysteresis component and the transient dynamics. The Bouc-Wen hysteresis model is modified to describe the hysteresis component in the mammalian gene regulatory networks. Rigorous mathematical analysis on the dynamical properties of the model is presented to ensure the bounded-input-bounded-output (BIBO) stability and demonstrates that the original Bouc-Wen model can only generate a clockwise hysteresis loop while the modified model can describe both clockwise and counter clockwise hysteresis loops. Simulation studies have shown that the hysteresis loops from our model are consistent with the experimental observations in three mammalian gene regulatory networks and two E.coli gene regulatory networks, which demonstrate the ability and accuracy of the mathematical model to emulate natural gene expression behavior with hysteresis. A comparison study has also been conducted to show that this model fits the experiment data significantly better than previous ones in the literature. The successful modeling of the hysteresis in all the five hysteretic gene regulatory networks suggests that the new model has the potential to be a unified framework for modeling hysteresis in gene regulatory networks and provide better understanding of the general mechanism that drives the hysteretic function. PMID:22588784


    PubMed Central

    Davidson, Eric H.


    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, so causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network. PMID:21320483

  16. Regulatory guidance document

    SciTech Connect


    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  17. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.


    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi


    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  18. Structure-Based Network Analysis of Activation Mechanisms in the ErbB Family of Receptor Tyrosine Kinases: The Regulatory Spine Residues Are Global Mediators of Structural Stability and Allosteric Interactions

    PubMed Central

    James, Kevin A.; Verkhivker, Gennady M.


    The ErbB protein tyrosine kinases are among the most important cell signaling families and mutation-induced modulation of their activity is associated with diverse functions in biological networks and human disease. We have combined molecular dynamics simulations of the ErbB kinases with the protein structure network modeling to characterize the reorganization of the residue interaction networks during conformational equilibrium changes in the normal and oncogenic forms. Structural stability and network analyses have identified local communities integrated around high centrality sites that correspond to the regulatory spine residues. This analysis has provided a quantitative insight to the mechanism of mutation-induced “superacceptor” activity in oncogenic EGFR dimers. We have found that kinase activation may be determined by allosteric interactions between modules of structurally stable residues that synchronize the dynamics in the nucleotide binding site and the αC-helix with the collective motions of the integrating αF-helix and the substrate binding site. The results of this study have pointed to a central role of the conserved His-Arg-Asp (HRD) motif in the catalytic loop and the Asp-Phe-Gly (DFG) motif as key mediators of structural stability and allosteric communications in the ErbB kinases. We have determined that residues that are indispensable for kinase regulation and catalysis often corresponded to the high centrality nodes within the protein structure network and could be distinguished by their unique network signatures. The optimal communication pathways are also controlled by these nodes and may ensure efficient allosteric signaling in the functional kinase state. Structure-based network analysis has quantified subtle effects of ATP binding on conformational dynamics and stability of the EGFR structures. Consistent with the NMR studies, we have found that nucleotide-induced modulation of the residue interaction networks is not limited to the

  19. 78 FR 44279 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...The Department of Justice is publishing its spring 2013 regulatory agenda pursuant to Executive Order 12866, ``Regulatory Planning and Review,'' 58 FR 51735, and the Regulatory Flexibility Act, 5 U.S.C. sections 601 to 612...

  20. Bacteriophage therapy: a regulatory perspective.


    Pelfrene, Eric; Willebrand, Elsa; Cavaleiro Sanches, Ana; Sebris, Zigmars; Cavaleri, Marco


    Despite the recognized problem of antibiotic multidrug resistance, very few antibacterial agents with new mechanisms of action are under development. Bacteriophage therapy could offer one alternative strategy to mitigate this challenge. Although widely used throughout the 20th century in Eastern Europe and the former Soviet Union, this potential therapy has not yet been investigated according to rigorous scientific standards. This paper reports on a multistakeholder meeting held at the EMA, which outlined the existing regulatory framework to which such therapy should adhere and reviewed the current obstacles and shortcomings in scientific development for bacteriophage therapy. PMID:27068400

  1. Influence of simulated microgravity on clock genes expression rhythmicity and underlying blood circulating miRNAs-mRNA co-expression regulatory mechanism in C57BL/6J mice

    NASA Astrophysics Data System (ADS)

    Lv, Ke; Qu, Lina

    Purpose: It is vital for astronauts to maintain the optimal alertness and neurobehavioral function. Among various factors that exist in the space flight and long-duration mission environment, gravity changes may probably an essential environmental factor to interfere with internal circadian rhythms homeostasis and sleep quality, but the underlying mechanism is unclear. Mammals' biological clock is controlled by the suprachiasmatic nucleus (SCN), and peripheral organs adjust their own rhythmicity with the central signals. Nevertheless,the mechanism underlying this synchronizition process is still unknown. microRNAs (miRNAs) are about 19~22nt long regulatory RNAs that serve as critical modulators of post-transcriptional gene regulation. Recently, circulating miRNAs were found to have the regulatory role between cells and peripheral tissues, besides its function inside the cells. This study aims to investigate the regulatory signal transduction role of miRNAs between SCN and peripheral biological clock effecter tissues and to further decipher the mechanism of circadian disturbance under microgravity. Method: Firstly, based on the assumption that severe alterations in the expression of genes known to be involved in circadian rhythms may affect the expression of other genes, the labeled cDNA from liver and suprachiasmatic nucleus (SCN) of clock-knockout mice and control mice in different time points were cohybridized to microarrays. The fold change exceeding 2 (FC>2) was used to identify genes with altered expression levels in the knockout mice compared with control mice. Secondly, male C57BL/6J mice at 8 weeks of age were individually caged and acclimatized to the laboratory conditions (12h light/dark cycle) before being used for continuous core body temperature and activity monitoring. The mice were individually caged and tail suspended using a strip of adhesive surgical tape attached to a chain hanging from a pulley. Peripheral blood and liver tissues collection

  2. The ensembl regulatory build.


    Zerbino, Daniel R; Wilder, Steven P; Johnson, Nathan; Juettemann, Thomas; Flicek, Paul R


    Most genomic variants associated with phenotypic traits or disease do not fall within gene coding regions, but in regulatory regions, rendering their interpretation difficult. We collected public data on epigenetic marks and transcription factor binding in human cell types and used it to construct an intuitive summary of regulatory regions in the human genome. We verified it against independent assays for sensitivity. The Ensembl Regulatory Build will be progressively enriched when more data is made available. It is freely available on the Ensembl browser, from the Ensembl Regulation MySQL database server and in a dedicated track hub. PMID:25887522

  3. NRC regulatory agenda

    SciTech Connect

    Not Available


    The Regulatory Agenda is a quarterly compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and of all petitions for rulemaking that the NRC has received that are pending disposition.

  4. NRC Regulatory Agenda

    SciTech Connect

    Not Available


    The Regulatory Agenda is a quarterly compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and of all petitions for rulemaking that the NRC has received that are pending disposition.

  5. NRC regulatory agenda

    SciTech Connect

    Not Available


    The Regulatory Agenda is a quarterly compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and of all petitions for rulemaking that the NRC has received that are pending disposition.

  6. Canadian drug regulatory framework.


    Kelly, L; Lazzaro, M; Petersen, C


    The role of regulatory drug submission evaluators in Canada is to critically assess both the data submitted and the sponsor's interpretation of the data in order to reach an evidence-, and context-based recommendation as to the potential benefits and potential harms (i.e., risks) associated with taking the drug under the proposed conditions of use. The purpose of this document is to outline the regulatory framework in which this assessment occurs, including: defining what "authorization to market a drug in Canada" means, in terms of the role of the sponsor, the responsibility of Health Canada in applying the Food and Drugs Act prior to and after marketing authorization, and the distinction between regulatory authorization versus physician authorization; highlighting organizational, process and legal factors within Health Canada related to authorization of clinical trials and authorization to market a drug; considerations during the review process, such as regulatory and scientific issues related to the drug, patient populations and trial designs; application of international guidelines, and decisions from other jurisdictions; regulatory realities regarding drug authorization, including the requirement for wording in the Product Monograph to accurately reflect the information currently available on the safe and effective use of a drug, and that hypothesis-confirming studies are essential to regulatory endorsement; current issues related to the review of therapies for dementia, such as assessing preventative treatments, and therapies that have symptomatic versus disease-modifying effects, statistical issues regarding missing data, and trial design issues. PMID:17469674

  7. Influence of simulated microgravity on clock genes expression rhythmicity and underlying blood circulating miRNAs-mRNA co-expression regulatory mechanism in C57BL/6J mice

    NASA Astrophysics Data System (ADS)

    Lv, Ke; Qu, Lina

    Purpose: It is vital for astronauts to maintain the optimal alertness and neurobehavioral function. Among various factors that exist in the space flight and long-duration mission environment, gravity changes may probably an essential environmental factor to interfere with internal circadian rhythms homeostasis and sleep quality, but the underlying mechanism is unclear. Mammals' biological clock is controlled by the suprachiasmatic nucleus (SCN), and peripheral organs adjust their own rhythmicity with the central signals. Nevertheless,the mechanism underlying this synchronizition process is still unknown. microRNAs (miRNAs) are about 19~22nt long regulatory RNAs that serve as critical modulators of post-transcriptional gene regulation. Recently, circulating miRNAs were found to have the regulatory role between cells and peripheral tissues, besides its function inside the cells. This study aims to investigate the regulatory signal transduction role of miRNAs between SCN and peripheral biological clock effecter tissues and to further decipher the mechanism of circadian disturbance under microgravity. Method: Firstly, based on the assumption that severe alterations in the expression of genes known to be involved in circadian rhythms may affect the expression of other genes, the labeled cDNA from liver and suprachiasmatic nucleus (SCN) of clock-knockout mice and control mice in different time points were cohybridized to microarrays. The fold change exceeding 2 (FC>2) was used to identify genes with altered expression levels in the knockout mice compared with control mice. Secondly, male C57BL/6J mice at 8 weeks of age were individually caged and acclimatized to the laboratory conditions (12h light/dark cycle) before being used for continuous core body temperature and activity monitoring. The mice were individually caged and tail suspended using a strip of adhesive surgical tape attached to a chain hanging from a pulley. Peripheral blood and liver tissues collection

  8. RMOD: a tool for regulatory motif detection in signaling network.


    Kim, Jinki; Yi, Gwan-Su


    Regulatory motifs are patterns of activation and inhibition that appear repeatedly in various signaling networks and that show specific regulatory properties. However, the network structures of regulatory motifs are highly diverse and complex, rendering their identification difficult. Here, we present a RMOD, a web-based system for the identification of regulatory motifs and their properties in signaling networks. RMOD finds various network structures of regulatory motifs by compressing the signaling network and detecting the compressed forms of regulatory motifs. To apply it into a large-scale signaling network, it adopts a new subgraph search algorithm using a novel data structure called path-tree, which is a tree structure composed of isomorphic graphs of query regulatory motifs. This algorithm was evaluated using various sizes of signaling networks generated from the integration of various human signaling pathways and it showed that the speed and scalability of this algorithm outperforms those of other algorithms. RMOD includes interactive analysis and auxiliary tools that make it possible to manipulate the whole processes from building signaling network and query regulatory motifs to analyzing regulatory motifs with graphical illustration and summarized descriptions. As a result, RMOD provides an integrated view of the regulatory motifs and mechanism underlying their regulatory motif activities within the signaling network. RMOD is freely accessible online at the following URL: PMID:23874612

  9. Antibodies: Protective, destructive and regulatory role

    SciTech Connect

    Milgrom, F.; Abeyounis, C.J.; Albini, B.


    This book contains papers under 10 subject headings. The headings are: Production and Function of Antibodies, Protective Role of Antibodies, Antibodies to Foreign and Neoplastic Cells, Autoantibodies, Regulatory Mechanisms, Allergy, Immune Complexes, Antibodies in Pregnancy and Aging, Administration of Antibodies for Prevention and Therapy, and Abstracts of Poster Presentations.

  10. Rationales for regulatory activity

    SciTech Connect

    Perhac, R.M.


    The author provides an outline which touches on the types of concerns about risk evaluation which are addressed in the process of establishing regulatory guides. Broadly he says regulatory activity serves three broad constituents: (1) Paternalism (private risk); (2) Promotion of social welfare (public risks); (3) Protection of individual rights (public risks). He then discusses some of the major issues encountered in reaching a decision on what is an acceptable level of risk within each of these areas, and how one establishes such a level.

  11. Mapping of sites on the Src family protein tyrosine kinases p55blk, p59fyn, and p56lyn which interact with the effector molecules phospholipase C-gamma 2, microtubule-associated protein kinase, GTPase-activating protein, and phosphatidylinositol 3-kinase.

    PubMed Central

    Pleiman, C M; Clark, M R; Gauen, L K; Winitz, S; Coggeshall, K M; Johnson, G L; Shaw, A S; Cambier, J C


    Engagement of the B-cell antigen receptor complex induces immediate activation of receptor-associated Src family tyrosine kinases including p55blk, p59fyn, p53/56lyn, and perhaps p56lck, and this response is accompanied by tyrosine phosphorylation of distinct cellular substrates. These kinases act directly or indirectly to phosphorylate and/or activate effector proteins including p42 (microtubule-associated protein kinase) (MAPK), phospholipases C-gamma 1 (PLC gamma 1) and C-gamma 2 (PLC gamma 2), phosphatidylinositol 3-kinase (PI 3-K), and p21ras-GTPase-activating protein (GAP). Although coimmunoprecipitation results indicate that the Src family protein tyrosine kinases interact physically with some of these effector molecules, the molecular basis of this interaction has not been established. Here, we show that three distinct sites mediate the interaction of these kinases with effectors. The amino-terminal 27 residues of the unique domain of p56lyn mediate association with PLC gamma 2, MAPK, and GAP. Binding to PI 3-K is mediated through the Src homology 3 (SH3) domains of the Src family kinases. Relatively small proportions of cellular PI 3-K, PLC gamma 2, MAPK, and GAP, presumably those which are tyrosine phosphorylated, bind to the SH2 domains of these kinases. Comparative analysis of binding activities of Blk, Lyn, and Fyn shows that these kinases differ in their abilities to associate with MAPK and PI 3-K, suggesting that they may preferentially bind and subsequently phosphorylate distinct sets of downstream effector molecules in vivo. Fast protein liquid chromatography Mono Q column-fractionated MAPK maintains the ability to bind bacterially expressed Lyn, suggesting that the two kinases may interact directly. Images PMID:8395016

  12. Transcriptional Regulatory Elements in Fungal Secondary Metabolism

    PubMed Central

    Yin, Wenbing; Keller, Nancy P.


    Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

  13. Toxicogenomics in Regulatory Ecotoxicology

    EPA Science Inventory

    The potential utility of toxicogenomics in toxicological research and regulatory activities has been the subject of scientific discussions, and as with any new technology, there is a wide range of opinion. The purpose of this feature article is to consider roles of toxicogenomic...

  14. The regulatory horizon

    NASA Technical Reports Server (NTRS)

    Cook, ED


    The author briefly discusses the FAA's position as it relates to cockpit resource management. For example, if Cockpit Resource Management (CRM) is a positive concept, why isn't everyone required to implement it? The regulatory practice of the FAA is discussed and questions and answers are presented.

  15. EPAct Transportation Regulatory Activities

    SciTech Connect


    The U.S. Department of Energy's (DOE) Vehicle Technologies Program manages several transportation regulatory activities established by the Energy Policy Act of 1992 (EPAct), as amended by the Energy Conservation Reauthorization Act of 1998, EPAct 2005, and the Energy Independence and Security Act of 2007 (EISA).


    EPA Science Inventory

    The Tribes will work toward refining a regulatory program by taking a draft wetland conservation code with permitting incorporated to TEB for review. Progress will then proceed in developing a permit tracking system that will track both Tribal and fee land sites within reservati...


    EPA Science Inventory

    Appendix W to 40CFR Part 51 (Guideline on Air Quality Models) specifies the models to be used for purposes of permitting, PSD, and SIPs. Through a formal regulatory process this modeling guidance is periodically updated to reflect current science. In the most recent action, thr...

  18. NRC regulatory agenda

    SciTech Connect

    Not Available


    This document is a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considered action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  19. NRC regulatory agenda

    SciTech Connect

    Not Available


    This document provides a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  20. NRC Regulatory Agenda

    SciTech Connect

    Not Available


    This document compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rule making which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  1. Regulatory principles governing Salmonella and Yersinia virulence

    PubMed Central

    Erhardt, Marc; Dersch, Petra


    Enteric pathogens such as Salmonella and Yersinia evolved numerous strategies to survive and proliferate in different environmental reservoirs and mammalian hosts. Deciphering common and pathogen-specific principles for how these bacteria adjust and coordinate spatiotemporal expression of virulence determinants, stress adaptation, and metabolic functions is fundamental to understand microbial pathogenesis. In order to manage sudden environmental changes, attacks by the host immune systems and microbial competition, the pathogens employ a plethora of transcriptional and post-transcriptional control elements, including transcription factors, sensory and regulatory RNAs, RNAses, and proteases, to fine-tune and control complex gene regulatory networks. Many of the contributing global regulators and the molecular mechanisms of regulation are frequently conserved between Yersinia and Salmonella. However, the interplay, arrangement, and composition of the control elements vary between these closely related enteric pathogens, which generate phenotypic differences leading to distinct pathogenic properties. In this overview we present common and different regulatory networks used by Salmonella and Yersinia to coordinate the expression of crucial motility, cell adhesion and invasion determinants, immune defense strategies, and metabolic adaptation processes. We highlight evolutionary changes of the gene regulatory circuits that result in different properties of the regulatory elements and how this influences the overall outcome of the infection process. PMID:26441883

  2. Understanding the molecular mechanism of transcriptional regulation of banana Sucrose phosphate synthase (SPS) gene during fruit ripening: an insight into the functions of various cis-acting regulatory elements.


    Choudhury, Swarup Roy; Roy, Sujit; Singh, Sanjay Kumar; Sengupta, Dibyendu N


    Recently, we have reported the characterization of promoter region of Sucrose phosphate synthase (SPS) gene in banana and investigated the role of some cis-elements/motifs, present in the promoter of SPS, in the transcriptional regulation of the gene. DNA-protein interaction studies have demonstrated the presence of specific trans-acting factors which showed specific interactions with ethylene, auxin, low temperature and light responsive elements in regulating SPS transcription. Transient expression analyses have demonstrated the functional significance of the various cis-acting regulatory elements present in banana SPS promoter in regulating SPS expression during ripening. (1) Here, we have further discussed the possible role of these regulatory sequences in the regulation of transcriptional network and comment on their function in relation to sucrose metabolism during banana fruit ripening. PMID:20139735

  3. Toxicogenomics and the Regulatory Framework

    EPA Science Inventory

    Toxicogenomics presents regulatory agencies with the opportunity to revolutionize their analyses by enabling the collection of information on a broader range of responses than currently considered in traditional regulatory decision making. Analyses of genomic responses are expec...

  4. Nuclear Regulatory Commission information digest

    SciTech Connect



    The Nuclear Regulatory Commission information digest provides summary information regarding the US Nuclear Regulatory Commission, its regulatory responsibilities, and areas licensed by the commission. This is an annual publication for the general use of the NRC Staff and is available to the public. The digest is divided into two parts: the first presents an overview of the US Nuclear Regulatory Commission and the second provides data on NRC commercial nuclear reactor licensees and commercial nuclear power reactors worldwide.

  5. The Michigan regulatory incentives study for electric utilities

    SciTech Connect

    Reid, M.W.; Weaver, E.M. )


    This is the final report of Phase I of the Michigan Regulatory Incentives Study for Electric Utilities, a three-phase review of Michigan's regulatory system and its effects on resource selection by electric utilities. The goal of Phase I is to identify and analyze financial incentive mechanisms that encourage selection of resources in accord with the principles of integrated resource planning (IRP) or least-cost planning (LCP). Subsequent study phases will involve further analysis of options and possibly a collaborative formal effort to propose regulatory changes. The Phase I analysis proceeded in three steps: (1) identification and review of existing regulatory practices that affect utilities; selection of resources, particularly DSM; (2) preliminary analysis of ten financial mechanisms, and selection of three for further study; (3) detailed analysis of the three mechanisms, including consideration of how they could be implemented in Michigan and financial modeling of their likely impacts on utilities and ratepayers.

  6. Regulatory aspects on nanomedicines.


    Sainz, Vanessa; Conniot, João; Matos, Ana I; Peres, Carina; Zupancic, Eva; Moura, Liane; Silva, Liana C; Florindo, Helena F; Gaspar, Rogério S


    Nanomedicines have been in the forefront of pharmaceutical research in the last decades, creating new challenges for research community, industry, and regulators. There is a strong demand for the fast development of scientific and technological tools to address unmet medical needs, thus improving human health care and life quality. Tremendous advances in the biomaterials and nanotechnology fields have prompted their use as promising tools to overcome important drawbacks, mostly associated to the non-specific effects of conventional therapeutic approaches. However, the wide range of application of nanomedicines demands a profound knowledge and characterization of these complex products. Their properties need to be extensively understood to avoid unpredicted effects on patients, such as potential immune reactivity. Research policy and alliances have been bringing together scientists, regulators, industry, and, more frequently in recent years, patient representatives and patient advocacy institutions. In order to successfully enhance the development of new technologies, improved strategies for research-based corporate organizations, more integrated research tools dealing with appropriate translational requirements aiming at clinical development, and proactive regulatory policies are essential in the near future. This review focuses on the most important aspects currently recognized as key factors for the regulation of nanomedicines, discussing the efforts under development by industry and regulatory agencies to promote their translation into the market. Regulatory Science aspects driving a faster and safer development of nanomedicines will be a central issue for the next years. PMID:26260323

  7. Role of dendritic cells in the induction of regulatory T cells

    PubMed Central


    Dendritic cells (DCs) play a key role in initiating immune responses and maintaining immune tolerance. In addition to playing a role in thymic selection, DCs play an active role in tolerance under steady state conditions through several mechanisms which are dependent on IL-10, TGF-β, retinoic acid, indoleamine-2,3,-dioxygenase along with vitamin D. Several of these mechanisms are employed by DCs in induction of regulatory T cells which are comprised of Tr1 regulatory T cells, natural and inducible foxp3+ regulatory T cells, Th3 regulatory T cells and double negative regulatory T cells. It appears that certain DC subsets are highly specialized in inducing regulatory T cell differentiation and in some tissues the local microenvironment plays a role in driving DCs towards a tolerogenic response. In this review we discuss the recent advances in our understanding of the mechanisms underlying DC driven regulatory T cell induction. PMID:21711933

  8. Natural regulatory T cells in autoimmunity

    PubMed Central

    Lourenço, Elaine V.; La Cava, Antonio


    The suppressive/immunomodulatory function of CD4+CD25+Foxp+ regulatory T (Treg) cells is crucial for the maintenance of immune homeostasis, which helps to prevent autoimmunity and reduce the inflammation induced by pathogens and environmental insults. This review summarizes the current knowledge on the types and mechanisms of action of Treg cells and their role in the immune tolerance to self antigens, with a particular focus on naturally occurring Treg cells. PMID:21091291

  9. Securities and Exchange Commission Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... [Securities and Exchange Commission Semiannual Regulatory Agenda ] Part XXIII Securities and Exchange Commission Semiannual Regulatory Agenda ] SECURITIES AND EXCHANGE COMMISSION (SEC) SECURITIES AND EXCHANGE COMMISSION 17 CFR Ch. II Regulatory Flexibility Agenda AGENCY: Securities and Exchange Commission. ACTION: Semiannual regulatory...

  10. T regulatory cells in allergy.


    Braga, M; Quecchia, C; Cavallucci, E; Di Giampaolo, L; Schiavone, C; Petrarca, C; Di Gioacchino, M


    The progressive understanding of the nature and mechanisms of T regulatory (Treg) cells in the last decade has changed the concept of immune tolerance, that is no longer considered as a mere lack of immune reactivity but as a finely regulated process that requires specific activity of cells, adhesion and secreted molecules. Tregs play a key role in maintenance of self-tolerance and induction of tolerance against ubiquitous innocuous non-self antigens, so preventing the onset of autoimmune diseases and allergies. This review will focus on the Treg response in allergy that is characterized by a down-regulation of allergen specific T cell proliferation and inhibition of both Th1 and Th2 cytokines production. Hence, Treg cells suppress allergen-specific Th1 and Th2 cell responses playing an important role in the physiological immune response to allergens. Further, Treg cells are able to suppress IgE production by B lymphocytes and directly or indirectly inhibit the activity of allergic inflammation effector cells, namely eosinophils, basophils and mastcells. Finally, increasing evidence suggests that Treg cells are also implicated in chronicity development of inflammatory diseases. This appears to happen through a fine interaction they entertain with resident tissue cells and has been particularly highlighted in the study of airways remodeling in asthma. The understanding of the mechanisms underlying allergen tolerance has brought new interest in the development of new allergy treatment, able to target Treg cells, both in allergy prevention and in the therapy of established allergy. PMID:21329567

  11. YTRP: a repository for yeast transcriptional regulatory pathways

    PubMed Central

    Yang, Tzu-Hsien; Wang, Chung-Ching; Wang, Yu-Chao; Wu, Wei-Sheng


    Regulatory targets of transcription factors (TFs) can be identified by the TF perturbation experiments, which reveal the expression changes owing to the perturbation (deletion or overexpression) of TFs. But the identified targets of a given TF consist of both direct and indirect regulatory targets. It has been shown that most of the TFPE-identified regulatory targets are indirect, indicating that TF-gene regulation is mainly through transcriptional regulatory pathways (TRPs) consisting of intermediate TFs. Without identification of these TRPs, it is not easy to understand how a TF regulates its indirect targets. Because there is no such database depositing the potential TRPs for Saccharomyces cerevisiae now, this motivates us to construct the YTRP (Yeast Transcriptional Regulatory Pathway) database. For each TF-gene regulatory pair under different experimental conditions, all possible TRPs in two underlying networks (constructed using experimentally verified TF-gene binding pairs and TF-gene regulatory pairs from the literature) for the specified experimental conditions were automatically enumerated by TRP mining procedures developed from the graph theory. The enumerated TRPs of a TF-gene regulatory pair provide experimentally testable hypotheses for the molecular mechanisms behind a TF and its regulatory target. YTRP is available online at We believe that the TRPs deposited in this database will greatly improve the usefulness of TFPE data for yeast biologists to study the regulatory mechanisms between a TF and its knocked-out targets. Database URL: PMID:24608172

  12. Regulatory network rewiring for secondary metabolism in Arabidopsis thaliana under various conditions

    PubMed Central


    Background Plant secondary metabolites are critical to various biological processes. However, the regulations of these metabolites are complex because of regulatory rewiring or crosstalk. To unveil how regulatory behaviors on secondary metabolism reshape biological processes, we constructed and analyzed a dynamic regulatory network of secondary metabolic pathways in Arabidopsis. Results The dynamic regulatory network was constructed through integrating co-expressed gene pairs and regulatory interactions. Regulatory interactions were either predicted by conserved transcription factor binding sites (TFBSs) or proved by experiments. We found that integrating two data (co-expression and predicted regulatory interactions) enhanced the number of highly confident regulatory interactions by over 10% compared with using single data. The dynamic changes of regulatory network systematically manifested regulatory rewiring to explain the mechanism of regulation, such as in terpenoids metabolism, the regulatory crosstalk of RAV1 (AT1G13260) and ATHB1 (AT3G01470) on HMG1 (hydroxymethylglutaryl-CoA reductase, AT1G76490); and regulation of RAV1 on epoxysqualene biosynthesis and sterol biosynthesis. Besides, we investigated regulatory rewiring with expression, network topology and upstream signaling pathways. Regulatory rewiring was revealed by the variability of genes’ expression: pathway genes and transcription factors (TFs) were significantly differentially expressed under different conditions (such as terpenoids biosynthetic genes in tissue experiments and E2F/DP family members in genotype experiments). Both network topology and signaling pathways supported regulatory rewiring. For example, we discovered correlation among the numbers of pathway genes, TFs and network topology: one-gene pathways (such as δ-carotene biosynthesis) were regulated by a fewer TFs, and were not critical to metabolic network because of their low degrees in topology. Upstream signaling pathways of 50

  13. The core to regulatory reform

    SciTech Connect

    Partridge, J.W. Jr.


    Federal Energy Regulatory Commission (FERC) Orders 436, 500, and 636, the Clean Air Act Amendments of 1990, Public Utility Holding Company Act reform, and the 1992 Energy Policy Act all can have significant effects on an LDC's operations. Such changes in an LDC's environments must be balanced by changes within the utility, its marketplace, and its state regulatory environment. The question is where to start. For Columbia Gas Distribution Cos., based in Columbus, OH, the new operating foundation begins with each employee. Internal strength is critical in designing initiatives that meet the needs of the marketplace and are well-received by regulators. Employees must understand not only the regulatory environment in which the LDC operates, but also how their work contributes to a positive regulatory relationship. To achieve this, Columbia initiated the COntinuing Regulatory Education program, or CORE, in 1991. CORE is a regulatory-focused, information-initiative program coordinated by Columbia's Regulatory Policy, Planning, and Government Affairs Department. The CORE programs can take many forms, such as emerging issue discussions, dialogues with regulators and key parties, updates on regulatory fillings, regulatory policy meetings, and formal training classes. The speakers and discussion facilitators can range from human resource department trainers to senior officers, from regulatory department staff members to external experts, or from state commissioners to executives from other LDCs. The goals of CORE initiatives are to: Support a professional level of regulatory expertise through employee participation in well-developed regulatory programs presented by credible experts. Encourage a constructive state regulatory environment founded on communication and cooperation. CORE achieves these goals via five program levels: introductory basics, advanced learning, professional expertise, crossfunctional dialogues, and external idea exchanges.

  14. Genetic Regulatory Networks in Embryogenesis and Evolution

    NASA Technical Reports Server (NTRS)


    The article introduces a series of papers that were originally presented at a workshop titled Genetic Regulatory Network in Embryogenesis and Evaluation. Contents include the following: evolution of cleavage programs in relationship to axial specification and body plan evolution, changes in cell lineage specification elucidate evolutionary relations in spiralia, axial patterning in the leech: developmental mechanisms and evolutionary implications, hox genes in arthropod development and evolution, heterochronic genes in development and evolution, a common theme for LIM homeobox gene function across phylogeny, and mechanisms of specification in ascidian embryos.

  15. Toxicogenomics in regulatory ecotoxicology

    USGS Publications Warehouse

    Ankley, Gerald T.; Daston, George P.; Degitz, Sigmund J.; Denslow, Nancy D.; Hoke, Robert A.; Kennedy, Sean W.; Miracle, Ann L.; Perkins, Edward J.; Snape, Jason; Tillitt, Donald E.; Tyler, Charles R.; Versteeg, Donald


    Recently, we have witnessed an explosion of different genomic approaches that, through a combination of advanced biological, instrumental, and bioinformatic techniques, can yield a previously unparalleled amount of data concerning the molecular and biochemical status of organisms. Fueled partially by large, well-publicized efforts such as the Human Genome Project, genomic research has become a rapidly growing topical area in multiple biological disciplines. Since 1999, when the term “toxicogenomics” was coined to describe the application of genomics to toxicology (1), a rapid increase in publications on the topic has occurred (Figure 1). The potential utility of toxicogenomics in toxicological research and regulatory activities has been the subject of scientific discussions and, as with any new technology, has evoked a wide range of opinion (2–6). VIEWPOINT © 2006 american chemical Society july 1, 2006 / EnvironmEntal SciEncE & tEchnology n 4055 The purpose of this feature article is to consider the roles of toxicogenomics in the field of regulatory ecotoxicology, explore current limitations in the science and practice of genomics, and propose possible avenues to approach and resolve some of the major challenges. A significant amount of input to our analysis came from a workshop sponsored by the Society of Environmental Toxicology and Chemistry (SETAC) in Pellston, Mich., in September 2005. A complete list of names and affiliations of the experts participating in that workshop is provided online in Table 1 of the Supporting Information for this paper.

  16. Multiple mechanisms contribute to osmotic inducibility of proU operon expression in Escherichia coli: demonstration of two osmoresponsive promoters and of a negative regulatory element within the first structural gene.

    PubMed Central

    Dattananda, C S; Rajkumari, K; Gowrishankar, J


    Transcription of the proU operon in Escherichia coli is induced several hundredfold upon growth of cells in media of elevated osmolarity. A low-copy-number promoter-cloning plasmid vector, with lacZ as the reporter gene, was used for assaying the osmoresponsive promoter activity of each of various lengths of proU DNA, generated by cloning of discrete restriction fragments and by an exonuclease III-mediated deletion approach. The results indicate that expression of proU in E. coli is directed from two promoters, one (P2) characterized earlier by other workers with the start site of transcription 60 nucleotides upstream of the initiation codon of the first structural gene (proV), and the other (P1) situated 250 nucleotides upstream of proV. Furthermore, a region of DNA within proV was shown to be involved in negative regulation of proU transcription; phage Mu dII1681-generated lac fusions in the early region of proV also exhibited partial derepression of proU regulation, in comparison with fusions further downstream in the operon. Sequences around promoter P1, sequences around P2, and the promoter-downstream negative regulatory element, respectively, conferred approximately 5-, 8-, and 25-fold osmoresponsivity on proU expression. Within the region genetically defined to encode the negative regulatory element, there is a 116-nucleotide stretch that is absolutely conserved between the proU operons of E. coli and Salmonella typhimurium and has the capability of exhibiting alternative secondary structure. Insertion of this region of DNA into each of two different plasmid vectors was associated with a marked reduction in the mean topological linking number in plasmid molecules isolated from cultures grown in high-osmolarity medium. We propose that this region of DNA undergoes reversible transition to an underwound DNA conformation under high-osmolarity growth conditions and that this transition mediates its regulatory effect on proU expression. Images FIG. 2 FIG. 3 PMID

  17. Japanese pharmaceutical and regulatory environment.


    Nagata, Ryoichi; Rafizadeh-Kabe, Jean-David


    Drastic regulatory changes in Japan since 1997 have had a considerable impact on the way new medicines are developed. The regulatory authority itself has been transformed. Clinical trials are now performed according to international guidelines. Clinical data generated in one area are acceptable in the rest of the world in some cases through a bridging process that is viewed as only temporary. The future of drug development lies in multinational clinical trials and simultaneous submission to the major regulatory authorities. PMID:22034129

  18. Regulatory Streamlining and Improvement

    SciTech Connect

    Mark A. Carl


    The Interstate Oil and Gas Compact Commission (IOGCC) engaged in numerous projects outlined under the scope of work discussed in the United States Department of Energy (DOE) grant number DE-FC26-04NT15456 awarded to the IOGCC. Numerous projects were completed that were extremely valuable to state oil and gas agencies as a result of work performed utilizing resources provided by the grant. There are numerous areas in which state agencies still need assistance. This additional assistance will need to be addressed under future scopes of work submitted annually to DOE's Project Officer for this grant. This report discusses the progress of the projects outlined under the grant scope of work for the 2005-2006 areas of interest, which are as follows: Area of Interest No. 1--Regulatory Streamlining and Improvement: This area of interest continues to support IOGCC's regulatory streamlining efforts that include the identification and elimination of unnecessary duplications of efforts between and among state and federal programs dealing with exploration and production on public lands. Area of Interest No. 2--Technology: This area of interest seeks to improve efficiency in states through the identification of technologies that can reduce costs. Area of Interest No. 3--Training and Education: This area of interest is vital to upgrading the skills of regulators and industry alike. Within the National Energy Policy, there are many appropriate training and education opportunities. Education was strongly endorsed by the President's National Energy Policy Development group. Acting through the governors offices, states are very effective conduits for the dissemination of energy education information. While the IOGCC favors the development of a comprehensive, long-term energy education plan, states are also supportive of immediate action on important concerns, such as energy prices, availability and conservation. Area of Interest No. 4--Resource Assessment and Development: This area

  19. Emerging regulatory paradigms in glutathione metabolism.


    Liu, Yilin; Hyde, Annastasia S; Simpson, Melanie A; Barycki, Joseph J


    One of the hallmarks of cancer is the ability to generate and withstand unusual levels of oxidative stress. In part, this property of tumor cells is conferred by elevation of the cellular redox buffer glutathione. Though enzymes of the glutathione synthesis and salvage pathways have been characterized for several decades, we still lack a comprehensive understanding of their independent and coordinate regulatory mechanisms. Recent studies have further revealed that overall central metabolic pathways are frequently altered in various tumor types, resulting in significant increases in biosynthetic capacity and feeding into glutathione synthesis. In this review, we will discuss the enzymes and pathways affecting glutathione flux in cancer and summarize current models for regulating cellular glutathione through both de novo synthesis and efficient salvage. In addition, we examine the integration of glutathione metabolism with other altered fates of intermediary metabolites and highlight remaining questions about molecular details of the accepted regulatory modes. PMID:24974179

  20. Autonomous Boolean modeling of gene regulatory networks

    NASA Astrophysics Data System (ADS)

    Socolar, Joshua; Sun, Mengyang; Cheng, Xianrui


    In cases where the dynamical properties of gene regulatory networks are important, a faithful model must include three key features: a network topology; a functional response of each element to its inputs; and timing information about the transmission of signals across network links. Autonomous Boolean network (ABN) models are efficient representations of these elements and are amenable to analysis. We present an ABN model of the gene regulatory network governing cell fate specification in the early sea urchin embryo, which must generate three bands of distinct tissue types after several cell divisions, beginning from an initial condition with only two distinct cell types. Analysis of the spatial patterning problem and the dynamics of a network constructed from available experimental results reveals that a simple mechanism is at work in this case. Supported by NSF Grant DMS-10-68602

  1. Emerging regulatory paradigms in glutathione metabolism

    PubMed Central

    Liu, Yilin; Hyde, Annastasia S.; Simpson, Melanie A.; Barycki, Joseph J.


    One of the hallmarks of cancer is the ability to generate and withstand unusual levels of oxidative stress. In part, this property of tumor cells is conferred by elevation of the cellular redox buffer glutathione. Though enzymes of the glutathione synthesis and salvage pathways have been characterized for several decades, we still lack a comprehensive understanding of their independent and coordinate regulatory mechanisms. Recent studies have further revealed that overall central metabolic pathways are frequently altered in various tumor types, resulting in significant increases in biosynthetic capacity, and feeding into glutathione synthesis. In this review, we will discuss the enzymes and pathways affecting glutathione flux in cancer, and summarize current models for regulating cellular glutathione through both de novo synthesis and efficient salvage. In addition, we examine the integration of glutathione metabolism with other altered fates of intermediary metabolites, and highlight remaining questions about molecular details of the accepted regulatory modes. PMID:24974179

  2. Regulatory T cells in allergy and asthma.


    Larché, Mark


    Allergic diseases including asthma have risen considerably in prevalence in the last 50 years. A concomitant rise in autoimmune disease suggests a defect in immunoregulation, rather than a reduction in T-helper type 1 immunity. Immune responses to innocuous environmental antigens in health are characterized by dominant regulation through the production of interleukin-10 and transforming growth factor-beta. Recent studies suggest that diverse populations of regulatory T cells (Treg) play an important role in regulating T-helper type 2 (Th2) responses to allergens, maintaining functional tolerance. Regulatory responses appear to be compromised in allergic individuals but may be reconstituted to some extent with specific allergen immunotherapy. In experimental models, Treg can suppress Th2 responses to allergen, airway eosinophilia, mucous hypersecretion, and airway hyperresponsiveness. Further studies are required to precisely define the mechanisms of development and action of these cells, and to identify and evaluate novel targets for the treatment of allergic diseases. PMID:17873195

  3. Regulatory polymorphisms underlying complex disease traits.


    Knight, Julian C


    There is growing evidence that genetic variation plays an important role in the determination of individual susceptibility to complex disease traits. In contrast to coding sequence polymorphisms, where the consequences of non-synonymous variation may be resolved at the level of the protein phenotype, defining specific functional regulatory polymorphisms has proved problematic. This has arisen for a number of reasons, including difficulties with fine mapping due to linkage disequilibrium, together with a paucity of experimental tools to resolve the effects of non-coding sequence variation on gene expression. Recent studies have shown that variation in gene expression is heritable and can be mapped as a quantitative trait. Allele-specific effects on gene expression appear relatively common, typically of modest magnitude and context specific. The role of regulatory polymorphisms in determining susceptibility to a number of complex disease traits is discussed, including variation at the VNTR of INS, encoding insulin, in type 1 diabetes and polymorphism of CTLA4, encoding cytotoxic T lymphocyte antigen, in autoimmune disease. Examples where regulatory polymorphisms have been found to play a role in mongenic traits such as factor VII deficiency are discussed, and contrasted with those polymorphisms associated with ischaemic heart disease at the same gene locus. Molecular mechanisms operating in an allele-specific manner at the level of transcription are illustrated, with examples including the role of Duffy binding protein in malaria. The difficulty of resolving specific functional regulatory variants arising from linkage disequilibrium is demonstrated using a number of examples including polymorphism of CCR5, encoding CC chemokine receptor 5, and HIV-1 infection. The importance of understanding haplotypic structure to the design and interpretation of functional assays of putative regulatory variation is highlighted, together with discussion of the strategic use of

  4. Metabolic Constraint-Based Refinement of Transcriptional Regulatory Networks

    PubMed Central

    Chandrasekaran, Sriram; Price, Nathan D.


    There is a strong need for computational frameworks that integrate different biological processes and data-types to unravel cellular regulation. Current efforts to reconstruct transcriptional regulatory networks (TRNs) focus primarily on proximal data such as gene co-expression and transcription factor (TF) binding. While such approaches enable rapid reconstruction of TRNs, the overwhelming combinatorics of possible networks limits identification of mechanistic regulatory interactions. Utilizing growth phenotypes and systems-level constraints to inform regulatory network reconstruction is an unmet challenge. We present our approach Gene Expression and Metabolism Integrated for Network Inference (GEMINI) that links a compendium of candidate regulatory interactions with the metabolic network to predict their systems-level effect on growth phenotypes. We then compare predictions with experimental phenotype data to select phenotype-consistent regulatory interactions. GEMINI makes use of the observation that only a small fraction of regulatory network states are compatible with a viable metabolic network, and outputs a regulatory network that is simultaneously consistent with the input genome-scale metabolic network model, gene expression data, and TF knockout phenotypes. GEMINI preferentially recalls gold-standard interactions (p-value = 10−172), significantly better than using gene expression alone. We applied GEMINI to create an integrated metabolic-regulatory network model for Saccharomyces cerevisiae involving 25,000 regulatory interactions controlling 1597 metabolic reactions. The model quantitatively predicts TF knockout phenotypes in new conditions (p-value = 10−14) and revealed potential condition-specific regulatory mechanisms. Our results suggest that a metabolic constraint-based approach can be successfully used to help reconstruct TRNs from high-throughput data, and highlights the potential of using a biochemically-detailed mechanistic framework

  5. Metabolic constraint-based refinement of transcriptional regulatory networks.


    Chandrasekaran, Sriram; Price, Nathan D


    There is a strong need for computational frameworks that integrate different biological processes and data-types to unravel cellular regulation. Current efforts to reconstruct transcriptional regulatory networks (TRNs) focus primarily on proximal data such as gene co-expression and transcription factor (TF) binding. While such approaches enable rapid reconstruction of TRNs, the overwhelming combinatorics of possible networks limits identification of mechanistic regulatory interactions. Utilizing growth phenotypes and systems-level constraints to inform regulatory network reconstruction is an unmet challenge. We present our approach Gene Expression and Metabolism Integrated for Network Inference (GEMINI) that links a compendium of candidate regulatory interactions with the metabolic network to predict their systems-level effect on growth phenotypes. We then compare predictions with experimental phenotype data to select phenotype-consistent regulatory interactions. GEMINI makes use of the observation that only a small fraction of regulatory network states are compatible with a viable metabolic network, and outputs a regulatory network that is simultaneously consistent with the input genome-scale metabolic network model, gene expression data, and TF knockout phenotypes. GEMINI preferentially recalls gold-standard interactions (p-value = 10(-172)), significantly better than using gene expression alone. We applied GEMINI to create an integrated metabolic-regulatory network model for Saccharomyces cerevisiae involving 25,000 regulatory interactions controlling 1597 metabolic reactions. The model quantitatively predicts TF knockout phenotypes in new conditions (p-value = 10(-14)) and revealed potential condition-specific regulatory mechanisms. Our results suggest that a metabolic constraint-based approach can be successfully used to help reconstruct TRNs from high-throughput data, and highlights the potential of using a biochemically-detailed mechanistic framework to

  6. Anergy in CD4 Memory T Lymphocytes: II. Abrogation of TCR-induced Formation of Membrane Signaling Complexes1

    PubMed Central

    Lee, William T.; Prasad, Aparna; Watson, Andrew R. O.


    Memory and naive CD4 T cells have unique regulatory pathways for self/non-self discrimination. A memory cell specific regulatory pathway was revealed using superantigens to trigger the TCR. Upon stimulation by bacterial superantigens, like staphylococcal enterotoxin B (SEB), TCR proximal signaling is impaired leading to clonal tolerance (anergy). In the present report, we show that memory cell anergy results from the sequestration of the protein tyrosine kinase ZAP-70 away from the TCR/CD3ζ chain. During SEB-induced signaling, ZAP-70 is excluded from both detergent-resistant membrane microdomains and the immunological synapse, thus blocking downstream signaling. We also show that the mechanism underlying memory cell anergy must involve Fyn kinase, given that the suppression of Fyn activity restores the movement of ZAP-70 to the immunological synapse, TCR proximal signaling, and cell proliferation. Thus, toleragens, including microbial toxins, may modulate memory responses by targeting the organizational structure of memory cell signaling complexes. PMID:22663768

  7. Building Developmental Gene Regulatory Networks

    PubMed Central

    Li, Enhu; Davidson, Eric H.


    Animal development is an elaborate process programmed by genomic regulatory instructions. Regulatory genes encode transcription factors and signal molecules, and their expression is under the control of cis-regulatory modules that define the logic of transcriptional responses to the inputs of other regulatory genes. The functional linkages amongst regulatory genes constitute the gene regulatory networks (GRNs) that govern cell specification and patterning in development. Constructing such networks requires identification of the regulatory genes involved and characterization of their temporal and spatial expression patterns. Interactions (activation/repression) among transcription factors or signals can be investigated by large-scale perturbation analysis, in which the function of each gene is specifically blocked. Resultant expression changes are then integrated to identify direct linkages, and to reveal the structure of the GRN. Predicted GRN linkages can be tested and verified by cis-regulatory analysis. The explanatory power of the GRN was shown in the lineage specification of sea urchin endomesoderm. Acquiring such networks is essential for a systematic and mechanistic understanding of the developmental process. PMID:19530131

  8. 75 FR 79759 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... use throughout the rulemaking process. Timetable: Action Date FR Cite Notice: Public Meeting Framework... heating equipment. This is the second review for water heaters. Completed: Reason Date FR Cite Final... ``Regulatory Planning and Review,'' 58 FR 51735, and the Regulatory Flexibility Act, 5 U.S.C. 601 et...

  9. 76 FR 3825 - Regulatory Compliance

    Federal Register 2010, 2011, 2012, 2013, 2014


    ..., Washington, January 18, 2011 [FR Doc. 2011-1386 Filed 1-20-11; 8:45 am] Billing code 3110-01-P ... Documents#0;#0; ] Memorandum of January 18, 2011 Regulatory Compliance Memorandum for the Heads of Executive... accessible to the public, information concerning their regulatory compliance and enforcement activities,...

  10. Citizen participation on regulatory boards.


    Chesney, J D


    This article examines the relationship between regulatory board function and citizen participation. The research indicates that public members generally prefer advisory boards, while provider members prefer quasi-judicial bodies. Implications of these findings for structuring citizen participation in the regulatory process are examined. PMID:6736596

  11. 78 FR 1574 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... and stability to receive opioid addiction treatment medication. Timetable: Action Date FR Cite NPRM 06/19/09 74 FR 29153 NPRM Comment Period End 08/18/09 Final Action 12/06/12 77 FR 72752 Regulatory... FR Cite NPRM 03/00/13 Regulatory Flexibility Analysis Required: Yes. Agency Contact: Charles...

  12. Regulatory Foci and Organizational Commitment

    ERIC Educational Resources Information Center

    Markovits, Yannis; Ullrich, Johannes; van Dick, Rolf; Davis, Ann J.


    We use regulatory focus theory to derive specific predictions regarding the differential relationships between regulatory focus and commitment. We estimated a structural equation model using a sample of 520 private and public sector employees and found in line with our hypotheses that (a) promotion focus related more strongly to affective…

  13. 77 FR 7972 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... agenda pursuant to Executive Order 12866, ``Regulatory Planning and Review,'' 58 FR 51735, and the... Identifier No. 396 National Standards to 1105-AB34 Prevent, Detect, and Respond to Prison Rape (Reg Plan Seq... Prevent, Detect, and Respond to Prison Rape Regulatory Plan: This entry is Seq. No. 85 in part II of...

  14. Dephosphorylation activates the purified plant plasma membrane H+-ATPase--possible function of phosphothreonine residues in a mechanism not involving the regulatory C-terminal domain of the enzyme.


    Desbrosses, G; Stelling, J; Renaudin, J P


    The plasma membrane H+-ATPase was purified from tobacco cells (line BY-2). After solubilization by lysophosphatidylcholine followed by separation on a glycerol gradient, a fraction with a high specific activity of 9 micromol ATP x min(-1) x mg protein(-1) was obtained, in which the H+-ATPase polypeptide represented at least 80% of the protein. The incubation of this fraction in the presence of alkaline phosphatase increased H+-ATPase activity by 40%, in a manner consistent with dephosphorylation of the enzyme itself. The hydrolytic activity of the solubilized enzyme and its proton translocating activity, after reconstitution into proteoliposomes, were stimulated to the same extent. Alkaline phosphatase treatment was also accompanied by a 92% decrease in the H+-ATPase phosphothreonine content, whereas the phosphoserine residues were almost unaffected. The dephosphorylation induced a slight decrease of the affinity of the enzyme towards ATP. The purified enzyme was not activated by lysophosphatidylcholine addition nor by trypsin-mediated proteolysis, two treatments reported to release the inhibitory control by the C-terminal domain of the H+-ATPase and to increase the affinity of the enzyme towards ATP. Based on these results, the regulatory phosphorylation evoked by alkaline phosphatase most likely differs from the autoinhibitory control of the H+-ATPase by its C-terminal domain. PMID:9492323

  15. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling.


    Corral-Jara, Karla F; Trujillo-Ochoa, Jorge L; Realpe, Mauricio; Panduro, Arturo; Gómez-Leyva, Juan F; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia; Fierro, Nora A


    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  16. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling

    PubMed Central

    Corral-Jara, Karla F.; Gómez-Leyva, Juan F.; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia


    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  17. IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT-dependent mechanism and induces the expansion of these cells in vivo.


    Zorn, Emmanuel; Nelson, Erik A; Mohseni, Mehrdad; Porcheray, Fabrice; Kim, Haesook; Litsa, Despina; Bellucci, Roberto; Raderschall, Elke; Canning, Christine; Soiffer, Robert J; Frank, David A; Ritz, Jerome


    IL-2 plays a critical role in the maintenance of CD4+CD25+ FOXP3(+) regulatory T cells (Tregs) in vivo. We examined the effects of IL-2 signaling in human Tregs. In vitro, IL-2 selectively up-regulated the expression of FOXP3 in purified CD4+CD25+ T cells but not in CD4+CD25- cells. This regulation involved the binding of STAT3 and STAT5 proteins to a highly conserved STAT-binding site located in the first intron of the FOXP3 gene. We also examined the effects of low-dose IL-2 treatment in 12 patients with metastatic cancer and 9 patients with chronic myelogenous leukemia after allogeneic hematopoietic stem cell transplantation. Overall, IL-2 treatment resulted in a 1.9 median fold increase in the frequency of CD4+CD25+ cells in peripheral blood as well as a 9.7 median fold increase in FOXP3 expression in CD3+ T cells. CD56+CD3- natural killer (NK) cells also expanded during IL-2 therapy but did not express FOXP3. In vitro treatment of NK cells with 5-aza-2'-deoxycytidine restored the IL-2 signaling pathway leading to FOXP3 expression, suggesting that this gene was constitutively repressed by DNA methylation in these cells. Our findings support the clinical evaluation of low-dose IL-2 to selectively modulate CD4+CD25+ Tregs and increase expression of FOXP3 in vivo. PMID:16645171

  18. Understanding genetic regulatory networks

    NASA Astrophysics Data System (ADS)

    Kauffman, Stuart


    Random Boolean networks (RBM) were introduced about 35 years ago as first crude models of genetic regulatory networks. RBNs are comprised of N on-off genes, connected by a randomly assigned regulatory wiring diagram where each gene has K inputs, and each gene is controlled by a randomly assigned Boolean function. This procedure samples at random from the ensemble of all possible NK Boolean networks. The central ideas are to study the typical, or generic properties of this ensemble, and see 1) whether characteristic differences appear as K and biases in Boolean functions are introducted, and 2) whether a subclass of this ensemble has properties matching real cells. Such networks behave in an ordered or a chaotic regime, with a phase transition, "the edge of chaos" between the two regimes. Networks with continuous variables exhibit the same two regimes. Substantial evidence suggests that real cells are in the ordered regime. A key concept is that of an attractor. This is a reentrant trajectory of states of the network, called a state cycle. The central biological interpretation is that cell types are attractors. A number of properties differentiate the ordered and chaotic regimes. These include the size and number of attractors, the existence in the ordered regime of a percolating "sea" of genes frozen in the on or off state, with a remainder of isolated twinkling islands of genes, a power law distribution of avalanches of gene activity changes following perturbation to a single gene in the ordered regime versus a similar power law distribution plus a spike of enormous avalanches of gene changes in the chaotic regime, and the existence of branching pathway of "differentiation" between attractors induced by perturbations in the ordered regime. Noise is serious issue, since noise disrupts attractors. But numerical evidence suggests that attractors can be made very stable to noise, and meanwhile, metaplasias may be a biological manifestation of noise. As we learn more

  19. 78 FR 1636 - Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...This Regulatory Agenda is a semiannual summary of all current and projected rulemakings, existing regulations, and completed actions of the Small Business Administration (SBA). For this fall edition of the SBA's Regulatory Agenda, a Regulatory Plan that contains a list of the Agency's most important and significant regulatory actions and a Statement of Regulatory Priorities is also included.......

  20. Department of Justice Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... [The Regulatory Plan and Unified Agenda of Federal Regulatory and Deregulatory Actions] Part XI Department of Justice Semiannual Regulatory Agenda ] DEPARTMENT OF JUSTICE (DOJ) DEPARTMENT OF JUSTICE 8 CFR Ch. V 21 CFR Ch. I 27 CFR Ch. II 28 CFR Ch. I, V Regulatory Agenda AGENCY: Department of Justice. ACTION: Semiannual regulatory agenda....

  1. The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro

    PubMed Central

    De Avila, Miguel; Vassall, Kenrick A.; Smith, Graham S. T.; Bamm, Vladimir V.; Harauz, George


    The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92–R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP–Fyn–SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62–L68), and demonstrate further that residues (V83–P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn–SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex. PMID:25343306

  2. The Solution Structure of the Regulatory Domain of Tyrosine Hydroxylase

    PubMed Central

    Zhang, Shengnan; Huang, Tao; Ilangovan, Udayar; Hinck, Andrew P.; Fitzpatrick, Paul F.


    Tyrosine hydroxylase (TyrH) catalyzes the hydroxylation of tyrosine to form 3,4-dihydroxyphenylalanine in the biosynthesis of the catecholamine neurotransmitters. The activity of the enzyme is regulated by phosphorylation of serine residues in a regulatory domain and by binding of catecholamines to the active site. Available structures of TyrH lack the regulatory domain, limiting the understanding of the effect of regulation on structure. We report the use of NMR spectroscopy to analyze the solution structure of the isolated regulatory domain of rat TyrH. The protein is composed of a largely unstructured N-terminal region (residues 1-71) and a well-folded C-terminal portion (residues 72-159). The structure of a truncated version of the regulatory domain containing residues 65-159 has been determined and establishes that it is an ACT domain. The isolated domain is a homodimer in solution, with the structure of each monomer very similar to that of the core of the regulatory domain of phenylalanine hydroxylase. Two TyrH regulatory domain monomers form an ACT domain dimer composed of a sheet of eight strands with four α-helices on one side of the sheet. Backbone dynamic analyses were carried out to characterize the conformational flexibility of TyrH65-159. The results provide molecular details critical for understanding the regulatory mechanism of TyrH. PMID:24361276

  3. Re-evaluation of Non-regulatory Asbestos Group Minerals for Regulatory Agencies

    NASA Astrophysics Data System (ADS)

    Dogan, M.; Dogan, A.


    There are established rules and regulations for some asbestos group minerals - amphibole group minerals of actinolite, amosite, anthophyllite, crocidolite, tremolite; and serpentine group minerals of chrysotile- called "regulatory". There are also "non-regulatory" naturally occurring asbestos (NOA) group minerals as constituent of rocks and soil, including richterite, winchite, fluoro-edenite, balangeroite, carlosturanite, gageite, arfvedsonite, and magnesio-arfvedsonite. Strong evidences for carcinogenicity of these NOA minerals in later cohorts of cancer patients demonstrated the risks associated with these minerals. In addition, although the chrysotile asbestos regulated by some organizations such as WHO, World Trade Organization, United Nations, US EPA, International Labour Organization, and EU Countries; however, controversies still continue surrounding the use of chrysotile. Determinations of polymineralic fibrous veins, mixed particles, amphibole cleavage fragments, and genetic predisposition are also important issues (i.e. Dogan et al., 2006).Therefore, accurate characterizations of chemical composition, morphology, structure, and defects are necessary in order to find out mechanism(s) of carcinogenicity of all asbestos group minerals. Calculation methods of chemical composition are still under debate because of assumption of no vacancies at any sites and intergrowth of minerals. Substitution(s) may cause deviations from the ideal chemical formula and wide variations in chemical compositions. Detail morphological and chemical quantification of individual asbestos group minerals in micro- and nano-scale may help to evaluate its true carcinogenetic mechanism(s), and consequently prevention and possibly treatment of related diseases. we propose that nonregulatory asbestos minerals and the chrysotile should be re-evaluated. The amount of fibers inhaled, in terms of weight percent and number, need also be re-evaluated by mineralogists. Finally, Regulatory

  4. T follicular regulatory cells.


    Sage, Peter T; Sharpe, Arlene H


    Pathogen exposure elicits production of high-affinity antibodies stimulated by T follicular helper (Tfh) cells in the germinal center reaction. Tfh cells provide both costimulation and stimulatory cytokines to B cells to facilitate affinity maturation, class switch recombination, and plasma cell differentiation within the germinal center. Under normal circumstances, the germinal center reaction results in antibodies that precisely target foreign pathogens while limiting autoimmunity and excessive inflammation. In order to have this degree of control, the immune system ensures Tfh-mediated B-cell help is regulated locally in the germinal center. The recently identified T follicular regulatory (Tfr) cell subset can migrate to the germinal center and inhibit Tfh-mediated B-cell activation and antibody production. Although many aspects of Tfr cell biology are still unclear, recent data have begun to delineate the specialized roles of Tfr cells in controlling the germinal center reaction. Here we discuss the current understanding of Tfr-cell differentiation and function and how this knowledge is providing new insights into the dynamic regulation of germinal centers, and suggesting more efficacious vaccine strategies and ways to treat antibody-mediated diseases. PMID:27088919

  5. [The regulatory role of autophagy in tumor process].


    Liu, Hong; Shao, Rong-guang


    Autophagy is a classical regulatory mechanism of energy metabolism and self-update system in the maintenance of the intracellular homeostasis and cell development. Autophagy has been recently found to play a role in tumor development. Autophagy regulates tumor formation, proliferation, metastasis, and metabolism. At the same time, the anticancer drugs formed with autophagic mediators have been used in the treatment, which suggested that improving autophagy activity to inhibit tumor has become a new way for cancer treatment of cancer patients. This article gives an overview of the regulatory mechanism of autophagy, the relationship between autophagy and tumor, and tumor therapy by targeting autophagy. PMID:27405157

  6. Regulatory treatment of allowances and compliance costs

    SciTech Connect

    Rose, K.


    The Clean Air Act Amendments of 1990 (CAAA) established a national emission allowance trading system, a market-based form of environmental regulation designed to reduce and limit sulfur dioxide emissions. However, the allowance trading system is being applied primarily to an economically regulated electric utility industry. The combining of the new form of environmental regulation and economic regulation of electric utilities has raised a number of questions including what the role should be of the federal and state utility regulating commissions and how those actions will affect the decision making process of the utilities and the allowance market. There are several dimensions to the regulatory problems that commissions face. Allowances and utility compliance expenditures have implications for least-cost/IPR (integrated resource planning), prudence review procedures, holding company and multistate utility regulation and ratemaking treatment. The focus of this paper is on the ratemaking treatment. The following topics are covered: ratemaking treatment of allowances and compliance costs; Traditional cost-recovery mechanisms; limitations to the traditional approach; traditional approach and the allowance trading market; market-based cost recovery mechanisms; methods of determining the benchmark; determining the split between ratepayers and the utility; other regulatory approaches; limitations of incentive mechanisms.

  7. Regulatory T-lymphocytes in asthma.


    van Oosterhout, A J M; Bloksma, N


    T-helper cell type (Th)2 lymphocytes play an important role in the initiation, progression and persistence of allergic diseases, including asthma. However, little is known about immunoregulatory mechanisms that determine susceptibility to, severity of, or persistence of asthma. The concept of a disturbed Th1/Th2 balance, although having furthered the present understanding of immunoregulation in asthma, has recently been named a "procrustean paradigm", because of its failure to adequately explain many (pre)clinical observations. In recent years, the general knowledge regarding the regulation of infectious, autoimmune diseases, asthma and allergen immunotherapy by T-regulatory (Treg) cells, has rapidly increased. Many different Treg subsets have been described, including CD8+ Treg cells, natural killer (NK) cells and several different CD4+ Treg cell subsets. In this review, the authors will focus on two major and well-described CD4+ Treg cell subsets. These consist of naturally occurring CD25+ Treg cells and adaptive Treg cells that are postulated to prevent immune responses against self-antigens and adaptive immune responses, respectively. The adaptive T-regulatory cells are further subdivided into T-regulatory cells type 1 and T-helper cell type 3 that mediate suppression exclusively via the cytokines interleukin-10 and transforming growth factor-beta, respectively. PMID:16264056

  8. T regulatory cells in childhood asthma.


    Strickland, Deborah H; Holt, Patrick G


    Asthma is a chronic disease of the airways, most commonly driven by immuno-inflammatory responses to ubiquitous airborne antigens. Epidemiological studies have shown that disease is initiated early in life when the immune and respiratory systems are functionally immature and less able to maintain homeostasis in the face of continuous antigen challenge. Here, we examine the cellular and molecular mechanisms that underlie initial aeroallergen sensitization and the ensuing regulation of secondary responses to inhaled allergens in the airway mucosa. In particular, we focus on how T-regulatory (Treg) cells influence early asthma initiation and the potential of Treg cells as therapeutic targets for drug development in asthma. PMID:21798806

  9. Stabilizing gene regulatory networks through feedforward loops

    NASA Astrophysics Data System (ADS)

    Kadelka, C.; Murrugarra, D.; Laubenbacher, R.


    The global dynamics of gene regulatory networks are known to show robustness to perturbations in the form of intrinsic and extrinsic noise, as well as mutations of individual genes. One molecular mechanism underlying this robustness has been identified as the action of so-called microRNAs that operate via feedforward loops. We present results of a computational study, using the modeling framework of stochastic Boolean networks, which explores the role that such network motifs play in stabilizing global dynamics. The paper introduces a new measure for the stability of stochastic networks. The results show that certain types of feedforward loops do indeed buffer the network against stochastic effects.

  10. [Regional differences in the level of ERK1/2 phosphorylation and expression of the myogenic regulatory factors following electrostimulation with different mechanic and metabolic action on the gastrocnemius muscle].


    Borzykh, A A; Kuz'min, I V; Lysenko, E A; Vinogradova, O L


    Effect of high-frequency electrical stimulation of the sciatic nerve on ERK1/2 kinase phosphorylation and mRNA expression in MyoD (myogenic regulation factor) and myogenin in the red (RGM) and white (WGM) parts of the medial head in rat's m. gastrocnemius was studied. Two stimulation regimes were equalized both lengthwise and in total effort but differed in duration and number of contractions and, therefore, in mechanic and metabolic effects on the muscle. It was shown that growth of the number of phosphorylated ERK1/2 was particularly high in WCM due to application of the protocol for multiple short-time contractions. Whatever the stimulation regime, MyoD mRNA expression in RGM and WGM increases to the same extent, whereas myogenin mRNA expression does not change. Consequently, the regime with the predominantly mechanic effect is favorable to activation of the ERK signaling pathway in glycolytic myofibers. PMID:25087411

  11. Morin mitigates acetaminophen-induced liver injury by potentiating Nrf2 regulated survival mechanism through molecular intervention in PHLPP2-Akt-Gsk3β axis.


    Rizvi, Fatima; Mathur, Alpana; Kakkar, Poonam


    Acetaminophen (APAP) is frequently taken to relieve pain. Staggered APAP overdoses have been reported to cause acetaminophen-induced liver injury (AILI). Identification of efficacious therapeutic modalities to address complications imposed by accidental/intentional long-term APAP ingestion is needed. Morin, a plant-derived phytochemical, possesses a multitude of pharmacological properties including hepatoprotective action; however, the underlying mechanisms have been inadequately explored. Our present report demonstrates significant attenuation of APAP-mediated liver injury by morin supplementation in vivo as indicated by reduction in histological and serum markers of hepatotoxicity. Morin not only limited necroinflammation as revealed by reduced HMGB1 release, NALP3 and caspase-1 maturation, but also suppressed oxidative stress and mitochondrial dysfunction. This suggests that morin may have exerted its cytoprotective role by way of early intervention in the pathway leading to perpetuation of AILI. Morin reinforced cellular defenses by suppressing Nrf2 ubiquitination and promoting nuclear Nrf2 retention as well as ARE-Nrf2 binding affinity. The effects were observed to be a result of molecular intervention in the activity of PHLPP2, a phosphatase previously reported by us to subdue cellular Nrf2 responses via Fyn kinase activation. Morin was observed to inhibit APAP-induced increase in PHLPP2 activity ex vivo as well as its association with cellular target Akt1. As a result, morin prevented oxidative stress induced deactivation of Akt (Ser473) leading to suppression in GSK3β and Fyn kinase activation. The study supports the inhibitory action of morin against PHLPP2-regulated Nrf2-suppression and hence indentifies Nrf2-potentiating property of morin that may be exploited in developing novel therapeutic strategy to address AILI. PMID:26286854

  12. Population Dynamics of Genetic Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Braun, Erez


    Unlike common objects in physics, a biological cell processes information. The cell interprets its genome and transforms the genomic information content, through the action of genetic regulatory networks, into proteins which in turn dictate its metabolism, functionality and morphology. Understanding the dynamics of a population of biological cells presents a unique challenge. It requires to link the intracellular dynamics of gene regulation, through the mechanism of cell division, to the level of the population. We present experiments studying adaptive dynamics of populations of genetically homogeneous microorganisms (yeast), grown for long durations under steady conditions. We focus on population dynamics that do not involve random genetic mutations. Our experiments follow the long-term dynamics of the population distributions and allow to quantify the correlations among generations. We focus on three interconnected issues: adaptation of genetically homogeneous populations following environmental changes, selection processes on the population and population variability and expression distributions. We show that while the population exhibits specific short-term responses to environmental inputs, it eventually adapts to a robust steady-state, largely independent of external conditions. Cycles of medium-switch show that the adapted state is imprinted in the population and that this memory is maintained for many generations. To further study population adaptation, we utilize the process of gene recruitment whereby a gene naturally regulated by a specific promoter is placed under a different regulatory system. This naturally occurring process has been recognized as a major driving force in evolution. We have recruited an essential gene to a foreign regulatory network and followed the population long-term dynamics. Rewiring of the regulatory network allows us to expose their complex dynamics and phase space structure.

  13. Homotypic Regulatory Clusters in Drosophila

    PubMed Central

    Lifanov, Alexander P.; Makeev, Vsevolod J.; Nazina, Anna G.; Papatsenko, Dmitri A.


    Cis-regulatory modules (CRMs) are transcription regulatory DNA segments (∼1 Kb range) that control the expression of developmental genes in higher eukaryotes. We analyzed clustering of known binding motifs for transcription factors (TFs) in over 60 known CRMs from 20 Drosophila developmental genes, and we present evidence that each type of recognition motif forms significant clusters within the regulatory regions regulated by the corresponding TF. We demonstrate how a search with a single binding motif can be applied to explore gene regulatory networks and to discover coregulated genes in the genome. We also discuss the potential of the clustering method in interpreting the differential response of genes to various levels of transcriptional regulators. PMID:12670999

  14. Regulatory facility guide for Ohio

    SciTech Connect

    Anderson, S.S.; Bock, R.E.; Francis, M.W.; Gove, R.M.; Johnson, P.E.; Kovac, F.M.; Mynatt, J.O.; Rymer, A.C.


    The Regulatory Facility Guide (RFG) has been developed for the DOE and contractor facilities located in the state of Ohio. It provides detailed compilations of international, federal, and state transportation-related regulations applicable to shipments originating at destined to Ohio facilities. This RFG was developed as an additional resource tool for use both by traffic managers who must ensure that transportation operations are in full compliance with all applicable regulatory requirements and by oversight personnel who must verify compliance activities.

  15. The limits of regulatory toxicology

    SciTech Connect

    Carrington, Clark D.; Bolger, P. Michael


    The Acceptable Daily Intake (ADI) has been used by regulatory and public health organizations (e.g., the U.S. Food and Drug and Administration, and the World Health Organization) for chemicals for more than 50 years. The ADI concept was also initially employed at the U.S. Environmental Protection Agency at its inception in 1971, although with the adoption of newer terminology, it later became known as the Reference Dose (RfD). It is clear from the literature that both were first devised as instruments of regulatory policy. In the intervening years, it has become common to use language that implies that these standards are statements of scientific fact. Similarly, some of the discretionary or default values that are used to derive regulatory standards are represented as scientific assumptions when in fact they also represent regulatory policy. This confusion impedes both the best use of the available science and informed public participation in policy making. In addition, the misconception of the ADI or the RfD as statements of scientific fact may impede the consideration of alternative means to reduce exposure to chemicals that may be harmful, including regulatory measures that do not involve prescribing a regulatory concentration limit.

  16. Regulatory T cells: regulators of life.


    Schumacher, Anne; Zenclussen, Ana Claudia


    Pregnancy still represents one of the most fascinating paradoxical phenomena in science. Immediately after conception, the maternal immune system is challenged by the presence of foreign paternal antigens in the semen. This triggers mechanisms of recognition and tolerance that all together allow the embryo to implant and later the fetus to develop. Tolerance mechanisms to maintain pregnancy are of special interest as they defy the classical immunology rules. Several cell types, soluble factors, and immune regulatory molecules have been proposed to contribute to fetal tolerance. Within these, regulatory T cells (Treg) are one of the most studied immune cell populations lately. They are reportedly involved in fetal acceptance. Here, we summarize several aspects of Treg biology in normal and pathologic pregnancies focusing on Treg frequencies, subtypes, antigen specificity, and activity as well as on factors influencing Treg generation, recruitment, and function. This review also highlights the contribution of fetal Treg in tolerance induction and addresses the role of Treg in autoimmune diseases and infections during gestation. Finally, the potential of Treg as a predictive marker for the success of assisted reproductive techniques and for therapeutic interventions is discussed. PMID:24661545

  17. Regulatory T Cells and Their Role in Animal Disease.


    Veiga-Parga, T


    In humans and mouse models, Foxp3(+) regulatory T cells are known to control all aspects of immune responses. However, only limited information exists on these cells' role in diseases of other animals. In this review, we cover the most important features and different types of regulatory T cells, which include those that are thymus-derived and peripherally induced, the mechanisms by which they control immune responses by targeting effector T cells and antigen-presenting cells, and most important, their role in animal health and diseases including cancer, infections, and other conditions such as hypersensitivities and autoimmunity. Although the literature regarding regulatory T cells in domestic animal species is still limited, multiple articles have recently emerged and are discussed. Moreover, we also discuss the evidence suggesting that regulatory T cells might limit the magnitude of effector responses, which can have either a positive or negative result, depending on the context of animal and human disease. In addition, the issue of plasticity is discussed because plasticity in regulatory T cells can result in the loss of their protective function in some microenvironments during disease. Lastly, the manipulation of regulatory T cells is discussed in assessing the possibility of their use as a treatment in the future. PMID:26945003

  18. Steam Generator tube integrity -- US Nuclear Regulatory Commission perspective

    SciTech Connect

    Murphy, E.L.; Sullivan, E.J.


    In the US, the current regulatory framework was developed in the 1970s when general wall thinning was the dominant degradation mechanism; and, as a result of changes in the forms of degradation being observed and improvements in inspection and tube repair technology, the regulatory framework needs to be updated. Operating experience indicates that the current U.S. requirements should be more stringent in some areas, while in other areas they are overly conservative. To date, this situation has been dealt with on a plant-specific basis in the US. However, the NRC staff is now developing a proposed steam generator rule as a generic framework for ensuring that the steam generator tubes are capable of performing their intended safety functions. This paper discusses the current U.S. regulatory framework for assuring steam generator (SG) tube integrity, the need to update this regulatory framework, the objectives of the new proposed rule, the US Nuclear Regulatory Commission (NRC) regulatory guide (RG) that will accompany the rule, how risk considerations affect the development of the new rule, and some outstanding issues relating to the rule that the NRC is still dealing with.

  19. Natural product derived immune-regulatory agents.


    Talmadge, James E


    We can now declare that the clinical goal of immune intervention as a therapeutic strategy for neoplastic, infectious, autoimmune and inflammatory diseases, has been achieved and in many instances obtained regulatory approval. Although, interest in and optimism for this approach has fluctuated, in the last 20years, immunotherapy has progressed from trials with crude microbial mixtures and extracts to the sophisticated use of pure cultured bacterial, synthetized active moieties identified from crude extracts, analogues therefrom and agonists and antagonists identified during screening resulting in reproducible pharmacologically active compounds with multiple mechanisms of action. Our current understanding of the mechanism of action for immunoregulatory agents contributes to the future discovery of improved strategies to use these and future immunotherapies. In this review we have identified and discussed, those drugs that have been approved and or are in clinical development as immunoregulatory agents, emphasizing those derived from or associated with natural product. PMID:26968760

  20. Regulatory T cells in allergic diseases.


    Noval Rivas, Magali; Chatila, Talal A


    The pathogenesis of allergic diseases entails an ineffective tolerogenic immune response to allergens. Regulatory T (Treg) cells play a key role in sustaining immune tolerance to allergens, yet mechanisms by which Treg cells fail to maintain tolerance in patients with allergic diseases are not well understood. We review current concepts and established mechanisms regarding how Treg cells regulate different components of allergen-triggered immune responses to promote and maintain tolerance. We will also discuss more recent advances that emphasize the "dual" functionality of Treg cells in patients with allergic diseases: how Treg cells are essential in promoting tolerance to allergens but also how a proallergic inflammatory environment can skew Treg cells toward a pathogenic phenotype that aggravates and perpetuates disease. These advances highlight opportunities for novel therapeutic strategies that aim to re-establish tolerance in patients with chronic allergic diseases by promoting Treg cell stability and function. PMID:27596705

  1. Targeting regulatory T cells in tumors.


    Liu, Chang; Workman, Creg J; Vignali, Dario A A


    Regulatory T (Treg ) cells play a crucial role in maintaining peripheral tolerance and preventing autoimmunity. However, they also represent a major barrier to effective antitumor immunity and immunotherapy. Consequently, there has been considerable interest in developing approaches that can selectively or preferentially target Treg cells in tumors, while not impacting their capacity to maintain peripheral immune homeostasis. In this review, we describe our current understanding of the mechanisms underlying the recruitment, expansion, and suppressive activity of tumor-associated Treg cells, and discuss the approaches used and the challenges encountered in the immunotherapeutic targeting of Treg cells. In addition, we summarize the primary clinical targets and some emerging data on exciting new potential Treg cell-restricted targets. We propose that discovering and understanding mechanisms that are preferentially used by Treg cells within the tumor microenvironment will lead to strategies that selectively target Treg cell-mediated suppression of antitumor immunity while maintaining peripheral immune tolerance. PMID:26787424

  2. Steam generators regulatory practices and issues in Spain

    SciTech Connect

    Mendoza, C.; Castelao, C.; Ruiz-Colino, J.; Figueras, J.M.


    This paper presents the actual status of Spanish Steam Generator tubes, actions developed by PWR plant owners and submitted to CSN, and regulatory activities related to tube degradation mechanisms analysis; NDT tube inspection techniques; tube, tubesheet and TSPs integrity studies; tube plugging/repair criteria; preventive and corrective measures including whole SGs replacement; tube leak measurement methods and other operational aspects.

  3. Regulatory RNAs in Bacteria

    PubMed Central

    Waters, Lauren S.; Storz, Gisela


    RNA regulators in bacteria are a heterogenous group of molecules that act by various mechanisms to modulate a wide range of physiological responses. One class comprises riboswitches, which are parts of the mRNAs they regulate. These leader sequences fold into structures amenable to conformational changes upon the binding of small molecules. Riboswitches thus sense and respond to the availability of various nutrients in the cell. Other small transcripts bind to proteins, among them global regulators, and antagonize their functions. The largest and most extensively studied set of small RNA regulators act through base pairing with RNAs, usually modulating the translation and stability of mRNAs. The majority of these small RNAs regulate responses to changes in environmental conditions. Finally, a recently discovered group of RNA regulators, known as the CRISPR RNAs, contain short regions of homology to bacteriophage and plasmid sequences. CRISPR RNAs interfere with bacteriophage infection and plasmid conjugation by targeting the homologous foreign DNA through an unknown mechanism. Here we discuss what is known about these RNA regulators, as well as the many intriguing questions that remain to be addressed. PMID:19239884

  4. Regulatory Monitoring of Fortified Foods: Identifying Barriers and Good Practices

    PubMed Central

    Rowe, Laura A; Vossenaar, Marieke; Garrett, Greg S


    While fortification of staple foods and condiments has gained enormous global traction, poor performance persists throughout many aspects of implementation, most notably around the critical element of regulatory monitoring, which is essential for ensuring foods meet national fortification standards. Where coverage of fortified foods is high, limited nutritional impact of fortification programs largely exists due to regulatory monitoring that insufficiently identifies and holds producers accountable for underfortified products. Based on quality assurance data from 20 national fortification programs in 12 countries, we estimate that less than half of the samples are adequately fortified against relevant national standards. In this paper, we outline key findings from a literature review, key informant interviews with 11 fortification experts, and semi-quantitative surveys with 39 individuals from regulatory agencies and the food fortification industry in 17 countries on the perceived effectiveness of regulatory monitoring systems and barriers to compliance against national fortification standards. Findings highlight that regulatory agencies and industry disagree on the value that enforcement mechanisms have in ensuring compliance against standards. Perceived political risk of enforcement and poorly resourced inspectorate capacity appear to adversely reinforce each other within an environment of unclear legislation to create a major hurdle for improving overall compliance of fortification programs against national standards. Budget constraints affect the ability of regulatory agencies to create a well-trained inspector cadre and improve the detection and enforcement of non-compliant and underfortified products. Recommendations to improve fortification compliance include improving technical capacity; ensuring sustained leadership, accountability, and funding in both the private and the public sectors; and removing political barriers to ensure consistent detection of

  5. Regulatory Monitoring of Fortified Foods: Identifying Barriers and Good Practices.


    Luthringer, Corey L; Rowe, Laura A; Vossenaar, Marieke; Garrett, Greg S


    While fortification of staple foods and condiments has gained enormous global traction, poor performance persists throughout many aspects of implementation, most notably around the critical element of regulatory monitoring, which is essential for ensuring foods meet national fortification standards. Where coverage of fortified foods is high, limited nutritional impact of fortification programs largely exists due to regulatory monitoring that insufficiently identifies and holds producers accountable for underfortified products. Based on quality assurance data from 20 national fortification programs in 12 countries, we estimate that less than half of the samples are adequately fortified against relevant national standards. In this paper, we outline key findings from a literature review, key informant interviews with 11 fortification experts, and semi-quantitative surveys with 39 individuals from regulatory agencies and the food fortification industry in 17 countries on the perceived effectiveness of regulatory monitoring systems and barriers to compliance against national fortification standards. Findings highlight that regulatory agencies and industry disagree on the value that enforcement mechanisms have in ensuring compliance against standards. Perceived political risk of enforcement and poorly resourced inspectorate capacity appear to adversely reinforce each other within an environment of unclear legislation to create a major hurdle for improving overall compliance of fortification programs against national standards. Budget constraints affect the ability of regulatory agencies to create a well-trained inspector cadre and improve the detection and enforcement of non-compliant and underfortified products. Recommendations to improve fortification compliance include improving technical capacity; ensuring sustained leadership, accountability, and funding in both the private and the public sectors; and removing political barriers to ensure consistent detection of

  6. Securities and Exchange Commission Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... [The Regulatory Plan and Unified Agenda of Federal Regulatory and Deregulatory Actions] Part XXIV Securities and Exchange Commission Semiannual Regulatory Agenda ] SECURITIES AND EXCHANGE COMMISSION (SEC) SECURITIES AND EXCHANGE COMMISSION 17 CFR Ch. II Regulatory Flexibility Agenda AGENCY: Securities and Exchange Commission. ACTION:...

  7. 7 CFR 1773.40 - Regulatory assets.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Regulatory assets. 1773.40 Section 1773.40... § 1773.40 Regulatory assets. The CPA's workpapers must document whether all regulatory assets comply with... whether all regulatory assets have received RUS approval....

  8. Crystal Structure of the N-Acetyltransferase Domain of Human N-Acetyl-L-Glutamate Synthase in Complex with N-Acetyl-L-Glutamate Provides Insights into Its Catalytic and Regulatory Mechanisms

    PubMed Central

    Zhao, Gengxiang; Jin, Zhongmin; Allewell, Norma M.; Tuchman, Mendel; Shi, Dashuang


    N-acetylglutamate synthase (NAGS) catalyzes the conversion of AcCoA and L-glutamate to CoA and N-acetyl-L-glutamate (NAG), an obligate cofactor for carbamyl phosphate synthetase I (CPSI) in the urea cycle. NAGS deficiency results in elevated levels of plasma ammonia which is neurotoxic. We report herein the first crystal structure of human NAGS, that of the catalytic N-acetyltransferase (hNAT) domain with N-acetyl-L-glutamate bound at 2.1 Å resolution. Functional studies indicate that the hNAT domain retains catalytic activity in the absence of the amino acid kinase (AAK) domain. Instead, the major functions of the AAK domain appear to be providing a binding site for the allosteric activator, L-arginine, and an N-terminal proline-rich motif that is likely to function in signal transduction to CPS1. Crystalline hNAT forms a dimer similar to the NAT-NAT dimers that form in crystals of bifunctional N-acetylglutamate synthase/kinase (NAGS/K) from Maricaulis maris and also exists as a dimer in solution. The structure of the NAG binding site, in combination with mutagenesis studies, provide insights into the catalytic mechanism. We also show that native NAGS from human and mouse exists in tetrameric form, similar to those of bifunctional NAGS/K. PMID:23894642

  9. Crystal structure of the N-acetyltransferase domain of human N-acetyl-L-glutamate synthase in complex with N-acetyl-L-glutamate provides insights into its catalytic and regulatory mechanisms.


    Zhao, Gengxiang; Jin, Zhongmin; Allewell, Norma M; Tuchman, Mendel; Shi, Dashuang


    N-acetylglutamate synthase (NAGS) catalyzes the conversion of AcCoA and L-glutamate to CoA and N-acetyl-L-glutamate (NAG), an obligate cofactor for carbamyl phosphate synthetase I (CPSI) in the urea cycle. NAGS deficiency results in elevated levels of plasma ammonia which is neurotoxic. We report herein the first crystal structure of human NAGS, that of the catalytic N-acetyltransferase (hNAT) domain with N-acetyl-L-glutamate bound at 2.1 Å resolution. Functional studies indicate that the hNAT domain retains catalytic activity in the absence of the amino acid kinase (AAK) domain. Instead, the major functions of the AAK domain appear to be providing a binding site for the allosteric activator, L-arginine, and an N-terminal proline-rich motif that is likely to function in signal transduction to CPS1. Crystalline hNAT forms a dimer similar to the NAT-NAT dimers that form in crystals of bifunctional N-acetylglutamate synthase/kinase (NAGS/K) from Maricaulis maris and also exists as a dimer in solution. The structure of the NAG binding site, in combination with mutagenesis studies, provide insights into the catalytic mechanism. We also show that native NAGS from human and mouse exists in tetrameric form, similar to those of bifunctional NAGS/K. PMID:23894642

  10. Regulatory T cells vs Th17: differentiation of Th17 versus Treg, are the mutually exclusive?

    PubMed Central

    Zheng, Song Guo


    Naive CD4+ cells differentiate into T helper (Th1, Th2, Th9, Th17) and regulatory T (Treg) cells to execute their immunologic function. Whereas TGF-β suppresses Th1 and Th2 cell differentiation, this cytokine promotes Th9, Th17 and Foxp3+ regulatory T cells depending upon the presence of other cytokines. IL-6 promotes Th17, but suppresses regulatory T cell differentiation. Moreover, natural but not TGF-β-induced regulatory T cells convert into Th17 cells in the inflammatory milieu. Here an update of T cell differentiation and conversion, as well as underlying mechanisms are given. PMID:23885327

  11. Is there a feudal hierarchy amongst regulatory immune cells? More than just Tregs

    PubMed Central

    Mauri, Claudia; Carter, Natalie


    Nature has provided the developing immune system with several checkpoints important for the maintenance of tolerance and the prevention of autoimmunity. The regulatory mechanisms operating in the periphery of the system are mediated by subsets of regulatory cells, now considered principal contributors to peripheral tolerance. Regulatory T cells (Tregs) have received titanic interest in the past decade, placing them at the centre of immuno-suppressive reactions. However, it has become clearer that other immune suppressive cells inhibit auto-reactivity as effectively as Tregs. The function of Tregs and other regulatory cells in rheumatoid arthritis will be discussed in this review. PMID:19664198

  12. 75 FR 11166 - Joint Meeting of the Nuclear Regulatory Commission and the Federal Energy Regulatory Commission...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Joint Meeting of the Nuclear Regulatory Commission and the Federal Energy Regulatory Commission; Notice of Joint Meeting of the Nuclear Regulatory Commission and the Federal Energy Regulatory Commission March 2,...

  13. Negative cooperativity in regulatory enzymes.


    Levitzki, A; Koshland, D E


    Negative cooperativity has been observed in CTP synthetase, an allosteric enzyme which contains a regulatory site. Thus, the same enzyme exhibits negative cooperativity for GTP (an effector) and glutamine (a substrate) and positive cooperativity for ATP and UTP (both substrates). In the process of the delineation of these phenomena, diagnostic procedures for negative cooperativity were developed. Application of these procedures to other enzymes indicates that negative cooperativity is a characteristic of many of them. These findings add strong support for the sequential model of subunit interactions which postulates that ligand-induced conformational changes are responsible for regulatory and cooperative phenomena in enzymes. PMID:5256410

  14. The rise of regulatory RNA

    PubMed Central

    Morris, K.V.; Mattick, J.S.


    Discoveries over the last decade portend a paradigm shift in molecular biology. Evidence suggests that RNA is not only functional as a messenger between DNA and protein but also in the regulation of genome organization and gene expression, which is increasingly elaborated in complex organisms. Regulatory RNAs appear to operate at many levels, but in particular to play an important role in the epigenetic processes that control differentiation and development. These discoveries suggest a central role for RNA in human evolution and ontogeny. Here we survey the emergence of the previously unsuspected world of regulatory RNAs from an historical perspective. PMID:24776770

  15. DOE regulatory reform initiative vitrified mixed waste

    SciTech Connect

    Carroll, S.J.; Holtzscheiter, E.W.; Flaherty, J.E.


    The US Department of Energy (DOE) is charged with responsibly managing the largest volume of mixed waste in the United States. This responsibility includes managing waste in compliance with all applicable Federal and State laws and regulations, and in a cost-effective, environmentally responsible manner. Managing certain treated mixed wastes in Resource Conservation and Recovery Act (RCRA) permitted storage and disposal units (specifically those mixed wastes that pose low risks from the hazardous component) is unlikely to provide additional protection to human health and the environment beyond that afforded by managing these wastes in storage and disposal units subject to requirements for radiological control. In October, 1995, the DOE submitted a regulatory reform proposal to the Environmental Protection Agency (EPA) relating to vitrified mixed waste forms. The technical proposal supports a regulatory strategy that would allow vitrified mixed waste forms treated through a permit or other environmental compliance mechanism to be granted an exemption from RCRA hazardous waste regulation, after treatment, based upon the inherent destruction and immobilization capabilities of vitrification technology. The vitrified waste form will meet, or exceed the performance criteria of the Environmental Assessment (EA) glass that has been accepted as an international standard for immobilizing radioactive waste components and the LDR treatment standards for inorganics and metals for controlling hazardous constituents. The proposal further provides that vitrified mixed waste would be responsibly managed under the Atomic Energy Act (AEA) while reducing overall costs. Full regulatory authority by the EPA or a State would be maintained until an acceptable vitrified mixed waste form, protective of human health and the environment, is produced.

  16. Distribution and localization of regulatory peptides.


    Ballesta, J; Bloom, S R; Polak, J M


    A new group of modulatory substances present in both endocrine cells and central and peripheral nerves has been described in the past few years. These substances are biochemically recognized as peptides and their actions affect many bodily functions. They are now widely known as regulatory peptides. The development of new immunocytochemical techniques, closely allied to radioimmunoassay, has disclosed that the regulatory peptides are present either in cells or in nerves, in almost every tissue of the body. The presence of peptides (the classical hormones) in endocrine cells was already known at the beginning of the century, but the presence of similar substances in nerve fibers, where they probably act as neurotransmitters, is a recent and revolutionary discovery. More than 30 peptides (neuropeptides) have been found to be present in nerves, to which the term "peptidergic" has been applied, although it is now known that in certain cases a neuropeptide can be present in the same nerves as a classical neurotransmitter, for example acetylcholine with VIP, or noradrenaline with NPY. Little is known about the physiological role of these neuropeptides. It is not yet fully accepted that they act as neurotransmitters although there is strong evidence for this, particularly in the case of substance P and VIP. The investigation of the regulatory peptides is now in an initial phase. The involvement of new disciplines, such as molecular biology, in this field is producing new and very exciting discoveries, including the isolation of novel peptides and precursors, the study of which will further contribute to the understanding of the basic control mechanisms. PMID:2412761

  17. Delineating the molecular mechanisms of tamoxifen's oncolytic actions in estrogen receptor-negative cancers.


    Radin, Daniel P; Patel, Parth


    Since its clinical inception, tamoxifen (TAM) has proved to be a powerful tool in treating estrogen receptor-positive breast cancers while exhibiting manageable side effects. Although TAM was synthesized as an estrogen receptor antagonist, reports have found that a significant fraction of women with estrogen receptor-negative cancers have benefitted from TAM treatment, suggesting the possibility of an alternate anti-cancer mechanism. In this paper, we present a review of recent and past literature in an attempt to clarify how TAM inhibits cell proliferation and induces apoptosis in cells lacking the estrogen receptor. Our analysis indicates that micromolar concentrations of TAM selectively elevate intracellular calcium concentrations in malignant cells, possibly by inversely agonizing cannabinoid receptors, producing considerable mitochondrial distress followed by the rapid production of reactive oxygen species. In response, cytoplasmic proteins such as JNK1 are activated, which mediates the activation of caspase-8. Fyn kinase auto phosphorylates in response to increased reactive oxygen species and directs the ubiquitin ligase c-Cbl to tag growth factor receptors for ubiquitination, potentially abrogating constitutively active survival pathways that are hallmarks of cancer progression. We attempt to differentiate the effect that TAM has on purified Protein Kinase C (PKC) compared to that in an intact cell, suggesting that low micromolar concentrations of TAM indirectly inhibit PKC by inducing EGFR destruction and high micromolar concentrations of TAM inhibits PKC through a direct binding mechanism. PMID:27083550

  18. 75 FR 18245 - Public Federal Regulatory Enforcement Fairness Hearing Region IX Regulatory Fairness Board

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office SMALL BUSINESS ADMINISTRATION Public Federal Regulatory Enforcement Fairness Hearing Region IX Regulatory Fairness Board.... Small Business Administration (SBA) Region IX Regulatory Fairness Board and the SBA Office of...

  19. 77 FR 74712 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Order Approving...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Order Approving Proposed Rule Change To Amend the Customer and Industry Codes of Arbitration Procedure Relating to... Financial Industry Regulatory Authority, Inc. (``FINRA'') filed with the Securities and Exchange...

  20. Fur-Mediated Global Regulatory Circuits in Pathogenic Neisseria Species

    PubMed Central

    Yu, Chunxiao


    The ferric uptake regulator (Fur) protein has been shown to function as a repressor of transcription in a number of diverse microorganisms. However, recent studies have established that Fur can function at a global level as both an activator and a repressor of transcription through both direct and indirect mechanisms. Fur-mediated indirect activation occurs via the repression of additional repressor proteins, or small regulatory RNAs, thereby activating transcription of a previously silent gene. Fur mediates direct activation through binding of Fur to the promoter regions of genes. Whereas the repressive mechanism of Fur has been thoroughly investigated, emerging studies on direct and indirect Fur-mediated activation mechanisms have revealed novel global regulatory circuits. PMID:22885296

  1. Regulatory T cells: present facts and future hopes.


    Becker, Christian; Stoll, Sabine; Bopp, Tobias; Schmitt, Edgar; Jonuleit, Helmut


    Naturally occurring CD4(+)CD25(+)Foxp3(+) regulatory T cells and several subsets of induced suppressor T cells are key players of the immune tolerance network and control the induction and effector phase of our immunological defense system. These T cell populations actively control the properties of other immune cells by suppressing their functional activity to prevent autoimmunity and transplant rejection but also influence the immune response to allergens as well as against tumor cells and pathogens. Even though we are far from completely understanding the molecular and cellular mechanisms that manage the different regulatory T cell populations, increasing evidence exists about their functional importance. The knowledge on their induction and activation opens the possibility for their selective manipulation in vivo as an attractive approach for an immunotherapy of unwanted immune responses. This review summarizes this knowledge and discusses the potential of regulatory T cells for novel immunointervention strategies in the future. PMID:16715254

  2. MicroRNA Regulatory Networks in Cardiovascular Development

    PubMed Central

    Liu, Ning; Olson, Eric N.


    The heart, more than any other organ, requires precise function on a second-to-second basis throughout the lifespan of the organism. Even subtle perturbations in cardiac structure or function have catastrophic consequences, resulting in lethal forms of congenital and adult heart disease. Such intolerance of the heart to variability necessitates especially robust regulatory mechanisms to govern cardiac gene expression. Recent studies have revealed central roles for microRNAs (miRNAs) as governors of gene expression during cardiovascular development and disease. The integration of miRNAs into the genetic circuitry of the heart provides a rich and robust array of regulatory interactions to control cardiac gene expression. miRNA regulatory networks also offer opportunities for therapeutically modulating cardiac function through the manipulation of pathogenic and protective miRNAs. We discuss the roles of miRNAs as regulators of cardiac form and function, unresolved questions in the field, and issues for the future. PMID:20412767

  3. 78 FR 44329 -