Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells.

PubMed

Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S

2011-11-01

Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular

RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells

PubMed Central

Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen

2011-01-01

Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury

Egr1 gene knockdown affects embryonic ocular development in zebrafish.

PubMed

Hu, Chao-Yu; Yang, Chang-Hao; Chen, Wei-Yu; Huang, Chiu-Ju; Huang, Hsing-Yen; Chen, Muh-Shy; Tsai, Huai-Jen

2006-10-26

To identify the changes in zebrafish embryonic ocular development after early growth response factor 1 (Egr1) gene knockdown by Egr1-specific translation inhibitor, morpholino oligonucleotides (MO). Two kinds of Egr1-MO were microinjected separately with various dosages into one to four celled zebrafish embryos to find an optimal dose generating an acceptable mortality rate and high frequency of specific phenotype. Chordin-MO served as the positive control; a 5 mismatch MO of Egr1-MO1 and a nonspecific MO served as negative controls. We graded the Egr1 morphants according to their gross abnormalities, and measured their ocular dimensions accordingly. Western blot analysis and synthetic Egr1 mRNA rescue experiments confirmed whether the deformities were caused by Egr1 gene knockdown. Histological examination and three kinds of immunohistochemical staining were applied to identify glutamate receptor one expression in retinal ganglion cells and amacrine cells, to recognize acetylated alpha-tubulin expression which indicated axonogenesis, and to label photoreceptor cells with zpr-1 antibody. After microinjection of 8 ng Egr1-MO1 or 2 ng Egr1-MO2, 81.8% and 97.3% of larvae at 72 h postfertilization had specific defects, respectively. The gross phenotype included string-like heart, flat head, and deformed tail. The more severely deformed larvae had smaller eyes and pupils. Co-injection of 8 ng Egr1-MO1 and supplementary 12 pg synthetic Egr1 mRNA reduced the gross abnormality rate from 84.4% to 29.7%, and decreased the severity of deformities. Egr1 protein appeared in the wildtype and rescued morphants, but was lacking in the Egr1 morphants with specific deformities. Lenses of Egr1 morphants were smaller and had some residual nucleated lens fiber cells. Morphants' retinal cells arranged disorderly and compactly with thin plexiform layers. Immunohistochemical studies showed that morphants had a markedly decreased number of mature retinal ganglion cells, amacrine cells, and

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

[Effect of NOR1 gene knockdown on the biological behavior of HeLa cells].

PubMed

Tan, Yixin; Li, Wenjuan; Yi, Mei; Wang, Wei; Zheng, Pan; Zhang, Haijing; Xiang, Bo; Li, Guiyuan

2014-08-01

To explore the effect of the oxidored nitro domain containing protein 1 (NOR1) gene knockdown on the biological behavior of HeLa cells in cervical carcinoma. The recombinant plasmids pSUPER-shNOR1-1, pSUPER-shNOR1-2 and pSUPERscramble, which targeted to NOR1 gene, were constructed by pSUPER.neo+GFP vector, transfected into HeLa cells respectively using Lipofectamine 2000 reagent, and followed by G418 selection. The expression level of NOR1 mRNA and protein were determined by RT-PCR and Western blotting, respectively. Methyl thiazolyl tetrazolium (MTT) assay was performed to determine the growth curve of cell viability. The stable transfectants were treated with H₂O₂ and cell apoptosis was determined by Hoechst 33258 staining and terminal deoxynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) assay. The expression levels of Bcl-2, cleaved caspase 9 and poly ADP-ribose polymerase (PARP) were measured by Western blot. NOR1- knockdown HeLa cells were successfully constructed by transfection of pSUPER-shNOR1-1 or pSUPER-shNOR1-2 plasmids into HeLa cells. MTT assay showed that the silence of endogenous NOR1 in HeLa cells could lead to the increase in cell viability and proliferation, and the inhibition of H₂O₂-induced apoptosis compared with the negative control. Western blot showed that the expression level of active caspase 9 and cleaved PARP was inhibited in NOR1-knockdown cells when they were treated with H₂O₂ while the expression level of Bcl-2 protein increased. Silence of endogenous NOR1 facilitates the cell viability and growth of HeLa cells, and attenuates HeLa cells apoptosis induced by H₂O₂, which might be mediated by up-regulation of Bcl-2 level and down-regulation of the cleaved caspase 9 cascade.

Novel liposomal combination treatments using dual genes knockdown in oral cancer treatment

NASA Astrophysics Data System (ADS)

Wu, Jyun-Sian; Yeh, Chia-Hsien; Huang, Leaf; Hsu, Yih-Chih

2018-02-01

Small interfering RNA (siRNA) can be used to treat tumor because it can effectively knockdown target oncoprotein expression and it leads to cancer cell death and apoptosis. Hypoxia-inducible factors-1 (HIF-1) is a transcription factor gene. Its high expression of tumor hypoxia cells, activation of transcription factor HIF-1α and angiogenesis found in most cancerous tissues. HIF-1α protein in cancer cells are critical to cell survival, tumor growth and proliferation. Epidermal growth factor receptor (EGFR) gene is another common head and neck oncogene. The dual self-designed siRNA sequences were encapsulated in the lipid-calcium-phosphate (LCP) and targeted to sigma receptors on the surface of cancer cells via binding to amino ethyl anisamide (AEAA). We used human oral cancer cells to establish the xenograft animal model to study the combination therapy for therapeutic results.

[Effect of Golgi α-mannosidase 2 (GM2) gene knockdown on adhesion abilities of human gastric carcinoma cell line BGC-823 and its mechanism].

PubMed

Zeng, Bo; Zeng, Zhen; Liu, Chang; Yang, Yaying

2017-06-01

Objective To investigate the effect of Golgi α-mannosidase II (GM2) gene knockdown on adhesion abilities of BGC-823 human gastric carcinoma cells. Methods Three plasmid vectors expressing GM2 shRNAs and a negative control plasmid vector were designed, constructed and then transfected into BGC-823 cells by Lipofectamine TM 2000. After transfection, the mRNA and protein levels of GM2 in BGC-823 cells were detected by real-time quantitative PCR (qRT-PCR) and Western blotting to evaluate the transfection efficacy. The best plasmid for GM2 gene knockdown was selected and stably transfected into BGC-823 cells. Adhesion abilities of BGC-823 cells after GM2 gene silencing were observed by cell-cell, cell-matrix and cell-endothelial cell adhesion assays. At the same time, the expressions of E-cadherin, P-selectin, CD44v6 and intercellular adhesion molecule-1 (ICAM-1) proteins were detected by Western blotting after GM2 gene knockdown. Results The expression of GM2 was effectively knockdown in GM2-shRNA-2-transfected BGC-823 cells. Compared with the blank control group and the negative control group, the intercellular adhesion ability of the GM2-shRNA-2-transfected cells increased significantly, while their cell-matrix and cell-endothelium adhesion abilities markedly decreased. In GM2-shRNA-2 transfection group, E-cadherin expression was significantly elevated and the P-selectin expression was significantly reduced, while the expression levels of CD44v6 and ICAM-1 were not obviously changed. Conclusion After GM2 gene knockdown, the intercellular adhesion ability of gastric carcinoma BGC-823 cells is enhanced, while the adhesion abilities with the extracellular matrix and endothelial cells are weakened. The changes might be related to the up-regulated expression of E-cadherin and the down-regulation of P-selectin.

Geometric morphometrics reveals shifts in flower shape symmetry and size following gene knockdown of CYCLOIDEA and ANTHOCYANIDIN SYNTHASE.

PubMed

Berger, Brent A; Ricigliano, Vincent A; Savriama, Yoland; Lim, Aedric; Thompson, Veronica; Howarth, Dianella G

2017-11-17

While floral symmetry has traditionally been assessed qualitatively, recent advances in geometric morphometrics have opened up new avenues to specifically quantify flower shape and size using robust multivariate statistical methods. In this study, we examine, for the first time, the ability of geometric morphometrics to detect morphological differences in floral dorsoventral asymmetry following virus-induced gene silencing (VIGS). Using Fedia graciliflora Fisch. & Meyer (Valerianaceae) as a model, corolla shape of untreated flowers was compared using canonical variate analysis to knockdown phenotypes of CYCLOIDEA2A (FgCYC2A), ANTHOCYANIDIN SYNTHASE (FgANS), and empty vector controls. Untreated flowers and all VIGS treatments were morphologically distinct from each other, suggesting that VIGS may cause subtle shifts in floral shape. Knockdowns of FgCYC2A were the most dramatic, affecting the position of dorsal petals in relation to lateral petals, thereby resulting in more actinomorphic-like flowers. Additionally, FgANS knockdowns developed larger flowers with wider corolla tube openings. These results provide a method to quantify the role that specific genes play in the developmental pathway affecting the dorsoventral axis of symmetry in zygomorphic flowers. Additionally, they suggest that ANS may have an unintended effect on floral size and shape.

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

PubMed Central

Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E.; Seidman, Jonathan G.; Pu, William T.; Wang, Da-Zhi

2016-01-01

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimalimmunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations. PMID:28060283

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.

PubMed

Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E; Seidman, Jonathan G; Pu, William T; Wang, Da-Zhi

2016-12-17

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

A Pre- and Co-Knockdown of RNAseT Enzyme, Eri-1, Enhances the Efficiency of RNAi Induced Gene Silencing in Caenorhabditis elegans

PubMed Central

Jadiya, Pooja; Nazir, Aamir

2014-01-01

Background The approach of RNAi mediated gene knockdown, employing exogenous dsRNA, is being beneficially exploited in various fields of functional genomics. The immense utility of the approach came to fore from studies with model system C. elegans, but quickly became applicable with varied research models ranging from in vitro to various in vivo systems. Previously, there have been reports on the refractoriness of the neuronal cells to RNAi mediated gene silencing following which several modulators like eri-1 and lin-15 were described in C. elegans which, when present, would negatively impact the gene knockdown. Methodology/Principal Findings Taking a clue from these findings, we went on to screen hypothesis-driven- methodologies towards exploring the efficiency in the process of RNAi under various experimental conditions, wherein these genes would be knocked down preceding to, or concurrently with, the knocking down of a gene of interest. For determining the efficiency of gene knockdown, we chose to study visually stark phenotypes of uncoordinated movement, dumpy body morphology and blistered cuticle obtained by knocking down of genes unc-73, dpy-9 and bli-3 respectively, employing the RNAi-by-feeding protocol in model system C. elegans. Conclusions/Significance Our studies led to a very interesting outcome as the results reveal that amongst various methods tested, pre-incubation with eri-1 dsRNA synthesizing bacteria followed by co-incubation with eri-1 and gene-of-interest dsRNA synthesizing bacteria leads to the most efficient gene silencing as observed by the analysis of marker phenotypes. This provides an approach for effectively employing RNAi induced gene silencing while working with different genetic backgrounds including transgenic and mutant strains. PMID:24475317

Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus, by Knockdown of Primordial Germ Cell Genes with Copper-Sensitive Constructs.

PubMed

Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Elaswad, Ahmed; Alsaqufi, Ahmed; Perera, Dayan A; Qin, Zhenkui; Odin, Ramji; Vo, Khoi; Drescher, David; Robinson, Dalton; Dong, Sheng; Zhang, Dan; Shang, Mei; Abass, Nermeen; Das, Sanjay K; Bangs, Max; Dunham, Rex A

2018-06-01

Repressible knockdown approaches were investigated to manipulate for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown and an off-target gene, vasa, was monitored. Two potentially copper-sensitive repressible promoters, yeast ctr3 (M) and ctr3-reduced (Mctr), were coupled with four knockdown strategies separately including: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA), and ds-sh RNA-targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with copper sulfate as the repressor compound. Spawning rates of full-sibling P 1 fish exposed or not exposed to the constructs as treated and untreated embryos were 85 and 54%, respectively, indicating potential sterilization of fish and repression of the constructs. In F 1 fish, mRNA expressions of PGC marker genes for most constructs were downregulated in the untreated group and the knockdown was repressed in the treated group. Gonad development in transgenic, untreated F 1 channel catfish was reduced compared to non-transgenic fish for MctrN2, MN1, MN2, and MDND. For 3-year-old adults, gonad size in the transgenic untreated group was 93.4% smaller than the non-transgenic group for females and 92.3% for males. However, mean body weight of transgenic females (781.8 g) and males (883.8 g) was smaller than of non-transgenic counterparts (984.2 and 1254.3 g) at 3 years of age, a 25.8 and 41.9% difference for females and males, respectively. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but negative pleiotropic effects can result.

Gene Knockdown of Venezuelan Equine Encephalitis Virus E2 Glycoprotein Using DNA-Directed RNA Interference

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE r/sYDEFENSE Gene Knockdown of Venezuelan Equine...Further research is required to develop an antiviral against VEE that is both safe and effective. One antiviral strategy that has shown considerable...Novagen, Madison, WI)) on a MJ Research PTC-200 DNA engine (Bio-Rad, formerly MJ Research , Mississauga, ON). Amplification products (5 pL) were

Knockdown of miR-210 decreases hypoxic glioma stem cells stemness and radioresistance.

PubMed

Yang, Wei; Wei, Jing; Guo, Tiantian; Shen, Yueming; Liu, Fenju

2014-08-01

Glioma contains abundant hypoxic regions which provide niches to promote the maintenance and expansion of glioma stem cells (GSCs), which are resistant to conventional therapies and responsible for recurrence. Given the fact that miR-210 plays a vital role in cellular adaption to hypoxia and in stem cell survival and stemness maintenance, strategies correcting the aberrantly expressed miR-210 might open up a new therapeutic avenue to hypoxia GSCs. In the present study, to explore the possibility of miR-210 as an effective therapeutic target to hypoxic GSCs, we employed a lentiviral-mediated anti-sense miR-210 gene transfer technique to knockdown miR-210 expression and analyze phenotypic changes in hypoxic U87s and SHG44s cells. We found that hypoxia led to an increased HIF-2α mRNA expression and miR-210 expression in GSCs. Knockdown of miR-210 decreased neurosphere formation capacity, stem cell marker expression and cell viability, and induced differentiation and G0/G1 arrest in hypoxic GSCs by partially rescued Myc antagonist (MNT) protein expression. Knockdown of MNT could reverse the gene expression changes and the growth inhibition resulting from knockdown of miR-210 in hypoxic GSCs. Moreover, knockdown of miR-210 led to increased apoptotic rate and Caspase-3/7 activity and decreased invasive capacity, reactive oxygen species (ROS) and lactate production and radioresistance in hypoxic GSCs. These findings suggest that miR-210 might be a potential therapeutic target to eliminate GSCs located in hypoxic niches. Copyright © 2014 Elsevier Inc. All rights reserved.

RNCR3 knockdown inhibits diabetes mellitus-induced retinal reactive gliosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chang; Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai; The Fourth School of Clinical Medicine, Nanjing Medical University, Nanjing

Retinal reactive gliosis is an important pathological feature of diabetic retinopathy. Identifying the underlying mechanisms causing reactive gliosis will be important for developing new therapeutic strategies for treating diabetic retinopathy. Herein, we show that long noncoding RNA-RNCR3 knockdown significantly inhibits retinal reactive gliosis. RNCR3 knockdown leads to a marked reduction in the release of several cytokines. RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration, as shown by less apoptotic retinal cells and ameliorative visual function. RNCR3 knockdown could also decrease Müller glial cell viability and proliferation, and reduce the expression of glial reactivity-related genes including GFAP and vimentin in vitro. Collectively, thismore » study shows that RNCR3 knockdown may be a promising strategy for the prevention of diabetes mellitus-induced retinal neurodegeneration. - Highlights: • RNCR3 knockdown inhibits retinal reactive gliosis. • RNCR3 knockdown causes a significant change in cytokine profile. • RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration. • RNCR3 knockdown affects Müller glial cell function in vitro.« less

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

DOE PAGES

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E.; ...

2015-03-31

Here, we document a collection of ~7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstratemore » reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates.« less

Adapted Resistance to the Knockdown Effect of shRNA-Derived Srsf3 siRNAs in Mouse Littermates | Center for Cancer Research

Cancer.gov

Gene silencing techniques are widely used to control gene expression and have potential for RNAi-based therapeutics. In this report, transgenic mouse lines were created for conditional knockdown of Srsf3 (SRp20) expression in liver and mammary gland tissues by expressing Srsf3-specific shRNAs driven by a U6 promoter.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

PubMed Central

De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

2006-01-01

RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

PubMed Central

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E; Chen, Kuchuan; Anguiano-Zarate, Stephanie; Cantu Gutierrez, Manuel; Busby, Theodore; Lin, Wen-Wen; He, Yuchun; Schulze, Karen L; Booth, Benjamin W; Evans-Holm, Martha; Venken, Koen JT; Levis, Robert W; Spradling, Allan C; Hoskins, Roger A; Bellen, Hugo J

2015-01-01

Here, we document a collection of ∼7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstrate reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates. DOI: http://dx.doi.org/10.7554/eLife.05338.001 PMID:25824290

Gene Therapy by Targeted Adenovirus-mediated Knockdown of Pulmonary Endothelial Tph1 Attenuates Hypoxia-induced Pulmonary Hypertension

PubMed Central

Morecroft, Ian; White, Katie; Caruso, Paola; Nilsen, Margaret; Loughlin, Lynn; Alba, Raul; Reynolds, Paul N; Danilov, Sergei M; Baker, Andrew H; MacLean, Margaret R

2012-01-01

Serotonin is produced by pulmonary arterial endothelial cells (PAEC) via tryptophan hydroxylase-1 (Tph1). Pathologically, serotonin acts on underlying pulmonary arterial cells, contributing to vascular remodeling associated with pulmonary arterial hypertension (PAH). The effects of hypoxia on PAEC-Tph1 activity are unknown. We investigated the potential of a gene therapy approach to PAH using selective inhibition of PAEC-Tph1 in vivo in a hypoxic model of PAH. We exposed cultured bovine pulmonary arterial smooth muscle cells (bPASMCs) to conditioned media from human PAECs (hPAECs) before and after hypoxic exposure. Serotonin levels were increased in hypoxic PAEC media. Conditioned media evoked bPASMC proliferation, which was greater with hypoxic PAEC media, via a serotonin-dependent mechanism. In vivo, adenoviral vectors targeted to PAECs (utilizing bispecific antibody to angiotensin-converting enzyme (ACE) as the selective targeting system) were used to deliver small hairpin Tph1 RNA sequences in rats. Hypoxic rats developed PAH and increased lung Tph1. PAEC-Tph1 expression and development of PAH were attenuated by our PAEC-Tph1 gene knockdown strategy. These results demonstrate that hypoxia induces Tph1 activity and selective knockdown of PAEC-Tph1 attenuates hypoxia-induced PAH in rats. Further investigation of pulmonary endothelial-specific Tph1 inhibition via gene interventions is warranted. PMID:22525513

Gene knockdown by morpholino-modified oligonucleotides in the zebrafish model: applications for developmental toxicology

PubMed Central

Timme-Laragy, Alicia R.; Karchner, Sibel I.; Hahn, Mark E.

2014-01-01

Summary The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knock-down via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level, while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e. phenotypic anchoring). In this chapter we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use. PMID:22669659

Knockdown of cullin 4A inhibits growth and increases chemosensitivity in lung cancer cells.

PubMed

Hung, Ming-Szu; Chen, I-Chuan; You, Liang; Jablons, David M; Li, Ya-Chin; Mao, Jian-Hua; Xu, Zhidong; Lung, Jr-Hau; Yang, Cheng-Ta; Liu, Shih-Tung

2016-07-01

Cullin 4A (Cul4A) has been observed to be overexpressed in various cancers. In this study, the role of Cul4A in the growth and chemosensitivity in lung cancer cells were studied. We showed that Cul4A is overexpressed in lung cancer cells and tissues. Knockdown of the Cul4A expression by shRNA in lung cancer cells resulted in decreased cellular proliferation and growth in lung cancer cells. Increased sensitivity to gemcitabine, a chemotherapy drug, was also noted in those Cul4A knockdown lung cancer cells. Moreover, increased expression of p21, transforming growth factor (TGF)-β inducible early gene-1 (TIEG1) and TGF beta-induced (TGFBI) was observed in lung cancer cells after Cul4A knockdown, which may be partially related to increased chemosensitivity to gemcitabine. G0/G1 cell cycle arrest was also noted after Cul4A knockdown. Notably, decreased tumour growth and increased chemosensitivity to gemcitabine were also noted after Cul4A knockdown in lung cancer xenograft nude mice models. In summary, our study showed that targeting Cul4A with RNAi or other techniques may provide a possible insight to the development of lung cancer therapy in the future. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

PlGF gene knockdown in human retinal pigment epithelial cells.

PubMed

Akrami, Hassan; Soheili, Zahra-Soheila; Sadeghizadeh, Majid; Ahmadieh, Hamid; Rezaeikanavi, Mozhgan; Samiei, Shahram; Khalooghi, Keynoush

2011-04-01

To evaluate the knockdown of placental growth factor (PlGF) gene expression in human retinal pigment epithelium (RPE) cells and its effect on cell proliferation, apoptosis and angiogenic potential of RPE cells. Human RPE cells were isolated by dispase I solution and cultured in DMEM/F12 supplemented with 10% fetal calf serum (FCS). A small interfering RNA (siRNA) corresponding to PlGF mRNA and a scrambled siRNA (scRNA) were introduced into the cells. Cell proliferation and cell death were examined by ELISA. PlGF mRNA and protein were quantified by real-time polymerase chain reaction (PCR) and western blot. The levels of gene expression for human retinal pigment epithelium-specific protein 65 kDa (RPE65), cellular retinaldehyde-binding protein (CRALBP) and tyrosinase were examined by real-time PCR. The angiogenic activity of RPE cell-derived conditioned media was assayed by a tube formation assay using human umbilical vein endothelial cells (HUVECs). At a final siRNA concentration of 20 pmol/ml, the transfection efficiency was about 80%. The amount of PlGF transcripts was reduced to 10% after 36 h of incubation, and the amount of PlGF protein in culture supernatant was significantly decreased. Suppression of PlGF gene had no effect on RPE cell proliferation and survival, and there were no notable changes in the transcript levels of RPE65, CRALBP or tyrosinase for the cultures treated by siRNA cognate to PlGF. Vascular tube formation was efficiently reduced in HUVECs. Our findings present PlGF as a key modulator of angiogenic potential in RPE cells of the human retina.

Sustained conditional knockdown reveals intracellular bone sialoprotein as essential for breast cancer skeletal metastasis.

PubMed

Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M; Berger, Martin R

2014-07-30

Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-reg-ulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic le-sions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant de-creases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions.

Sustained conditional knockdown reveals intracellular bone sialoprotein as essential for breast cancer skeletal metastasis

PubMed Central

Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M.; Berger, Martin R.

2014-01-01

Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-regulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic lesions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant decreases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions. PMID:24980816

Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

PubMed

Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

2015-12-01

The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Knockdown of the coenzyme Q synthesis gene Smed-dlp1 affects planarian regeneration and tissue homeostasis

PubMed Central

Shiobara, Yumiko; Harada, Chiaki; Shiota, Takeshi; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tanaka, Saeko; Tabata, Kenta; Sekie, Kiyoteru; Yamamoto, Yorihiro; Sugiyama, Tomoyasu

2015-01-01

The freshwater planarian is a model organism used to study tissue regeneration that occupies an important position among multicellular organisms. Planarian genomic databases have led to the identification of genes that are required for regeneration, with implications for their roles in its underlying mechanism. Coenzyme Q (CoQ) is a fundamental lipophilic molecule that is synthesized and expressed in every cell of every organism. Furthermore, CoQ levels affect development, life span, disease and aging in nematodes and mice. Because CoQ can be ingested in food, it has been used in preventive nutrition. In this study, we investigated the role of CoQ in planarian regeneration. Planarians synthesize both CoQ9 and rhodoquinone 9 (RQ9). Knockdown of Smed-dlp1, a trans-prenyltransferase gene that encodes an enzyme that synthesizes the CoQ side chain, led to a decrease in CoQ9 and RQ9 levels. However, ATP levels did not consistently decrease in these animals. Knockdown animals exhibited tissue regression and curling. The number of mitotic cells decreased in Smed-dlp1 (RNAi) animals. These results suggested a failure in physiological cell turnover and stem cell function. Accordingly, regenerating planarians died from lysis or exhibited delayed regeneration. Interestingly, the observed phenotypes were partially rescued by ingesting food supplemented with α-tocopherol. Taken together, our results suggest that oxidative stress induced by reduced CoQ9 levels affects planarian regeneration and tissue homeostasis. PMID:26516985

Gene therapy knockdown of VEGFR2 in retinal endothelial cells to treat retinopathy.

PubMed

Simmons, Aaron B; Bretz, Colin A; Wang, Haibo; Kunz, Eric; Hajj, Kassem; Kennedy, Carson; Yang, Zhihong; Suwanmanee, Thipparat; Kafri, Tal; Hartnett, M Elizabeth

2018-05-05

Inhibition of vascular endothelial growth factor (VEGF) in retinopathy of prematurity (ROP) raises concerns for premature infants because VEGF is essential for retinovascular development as well as neuronal and glial health. This study tested the hypothesis that endothelial cell-specific knockdown of VEGF receptor 2 (VEGFR2), or downstream STAT3, would inhibit VEGF-induced retinopathy without delaying physiologic retinal vascular development. We developed an endothelial cell-specific lentiviral vector that delivered shRNAs to VEGFR2 or STAT3 and a green fluorescent protein reporter under control of the VE-cadherin promoter. The specificity and efficacy of the lentiviral vector-driven shRNAs were validated in vitro and in vivo. In the rat oxygen-induced retinopathy model highly representative of human ROP, the effects of endothelial cell knockdown of VEGFR2 or STAT3 were determined on intravitreal neovascularization (IVNV), physiologic retinal vascular development [assessed as area of peripheral avascular/total retina (AVA)], retinal structure, and retinal function. Targeted knockdown of VEGFR2 or STAT3 specifically in retinal endothelial cells by subretinal injection of lentiviral vectors into postnatal day 8 rat pup eyes efficiently inhibited IVNV, and knockdown of VEGFR2 also reduced AVA and increased retinal thickness without altering retinal function. Taken together, our results support specific knockdown of VEGFR2 in retinal endothelial cells as a novel therapeutic method to treat retinopathy.

Knockdown of the coenzyme Q synthesis gene Smed-dlp1 affects planarian regeneration and tissue homeostasis.

PubMed

Shiobara, Yumiko; Harada, Chiaki; Shiota, Takeshi; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tanaka, Saeko; Tabata, Kenta; Sekie, Kiyoteru; Yamamoto, Yorihiro; Sugiyama, Tomoyasu

2015-12-01

The freshwater planarian is a model organism used to study tissue regeneration that occupies an important position among multicellular organisms. Planarian genomic databases have led to the identification of genes that are required for regeneration, with implications for their roles in its underlying mechanism. Coenzyme Q (CoQ) is a fundamental lipophilic molecule that is synthesized and expressed in every cell of every organism. Furthermore, CoQ levels affect development, life span, disease and aging in nematodes and mice. Because CoQ can be ingested in food, it has been used in preventive nutrition. In this study, we investigated the role of CoQ in planarian regeneration. Planarians synthesize both CoQ9 and rhodoquinone 9 (RQ9). Knockdown of Smed-dlp1, a trans-prenyltransferase gene that encodes an enzyme that synthesizes the CoQ side chain, led to a decrease in CoQ9 and RQ9 levels. However, ATP levels did not consistently decrease in these animals. Knockdown animals exhibited tissue regression and curling. The number of mitotic cells decreased in Smed-dlp1 (RNAi) animals. These results suggested a failure in physiological cell turnover and stem cell function. Accordingly, regenerating planarians died from lysis or exhibited delayed regeneration. Interestingly, the observed phenotypes were partially rescued by ingesting food supplemented with α-tocopherol. Taken together, our results suggest that oxidative stress induced by reduced CoQ9 levels affects planarian regeneration and tissue homeostasis. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: applications for developmental toxicology.

PubMed

Timme-Laragy, Alicia R; Karchner, Sibel I; Hahn, Mark E

2012-01-01

The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knockdown via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e., phenotypic anchoring). In this chapter, we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use.

RNAi-mediated knockdown of the Halloween gene spookiest (CYP307B1) impedes adult eclosion in the western tarnished plant bug, Lygus hesperus

USDA-ARS?s Scientific Manuscript database

Ecdysteroids play a critical role in coordinating insect growth, development, and reproduction. A suite of cytochrome P450 monooxygenases coded by what are collectively termed Halloween genes mediate ecdysteroid biosynthesis. In this study, we describe cloning and RNAi-mediated knockdown of the CYP3...

RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

PubMed

Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

2014-01-01

Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

PubMed Central

Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

2014-01-01

Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

Sterilization of sterlet Acipenser ruthenus by using knockdown agent, antisense morpholino oligonucleotide, against dead end gene.

PubMed

Linhartová, Zuzana; Saito, Taiju; Kašpar, Vojtěch; Rodina, Marek; Prášková, Eva; Hagihara, Seishi; Pšenička, Martin

2015-10-15

Sturgeons (chondrostean, acipenseridae) are ancient fish species, widely known for their caviar. Nowadays, most of them are critically endangered. The sterlet (Acipenser ruthenus) is a common Eurasian sturgeon species with a small body size and the fastest reproductive cycle among sturgeons. Such species can be used as a host for surrogate production; application is of value for recovery of critically endangered and huge sturgeon species with an extremely long reproductive cycle. One prerequisite for production of the donor's gametes only is to have a sterile host. Commonly used sterilization techniques in fishes such as triploidization or hybridization do not guarantee sterility in sturgeon. Alternatively, sterilization can be achieved by using a temporary germ cell exclusion-specific gene by a knockdown agent, the antisense morpholino oligonucleotide (MO). The targeted gene for the MO is the dead end gene (dnd) which is a vertebrate-specific gene encoding a RNA-binding protein which is crucial for migration and survival of primordial germ cells (PGCs). For this purpose, a dnd homologue of Russian sturgeon (Agdnd), resulting in the same sequence in the start codon region with isolated fragments of sterlet dnd (Ardnd), was used. Reverse transcription polymerase chain reaction confirmed tissue-specific expression of Ardnd only in the gonads of both sexes. Dnd-MO for depletion of PGCs together with fluorescein isothiocyanate (FITC)-biotin-dextran for PGCs labeling was injected into the vegetal region of one- to four-cell-stage sterlet embryos. In the control groups, only FITC was injected to validate the injection method and labeling of PGCs. After optimization of MO concentration together with volume injection, 250-μM MO was applied for sterilization of sturgeon embryos. Primordial germ cells were detected under a fluorescent stereomicroscope in the genital ridge of the FITC-labeled control group only, whereas no PGCs were present in the body cavities of morphants

Knockdown of astrocyte elevated gene-1 inhibits tumor growth and modifies microRNAs expression profiles in human colorectal cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Sujun; Southern Medical University, Guangzhou, Guangdong 510515; Wu, Binwen, E-mail: wubinwengd@aliyun.com

2014-02-14

Highlights: • AEG-1 expression in CRC cell lines and down-regulation or upregulation of AEG-1 in vitro. • Knockdown of AEG-1 inhibits cell proliferation, colony formation and invasion. • Upregulation of AEG-1 enhances proliferation, invasion and colony formation. • Knockdown of AEG-1 accumulates G0/G1-phase cells and promotes apoptosis in CRC cells. • AEG-1 knockdown increases 5-FU cytotoxicity. - Abstract: Astrocyte elevated gene-1 (AEG-1), upregulated in various types of malignancies including colorectal cancer (CRC), has been reported to be associated with the carcinogenesis. MicroRNAs (miRNAs) are widely involved in the initiation and progression of cancer. However, the functional significance of AEG-1 andmore » the relationship between AEG-1 and microRNAs in human CRC remains unclear. The aim of this study was to investigate whether AEG-1 could serve as a potential therapeutic target of human CRC and its possible mechanism. We adopted a strategy of ectopic overexpression or RNA interference to upregulate or downregulate expression of AEG-1 in CRC models. Their phenotypic changes were analyzed by Western blot, MTT and transwell matrix penetration assays. MicroRNAs expression profiles were performed using microarray analysis followed by validation using qRT-PCR. Knockdown of AEG-1 could significantly inhibit colon cancer cell proliferation, colony formation, invasion and promotes apoptosis. Conversely, upregulation of AEG-1 could significantly enhance cell proliferation, invasion and reduced apoptisis. AEG-1 directly contributes to resistance to chemotherapeutic drug. Targeted downregulation of AEG-1 might improve the expression of miR-181a-2{sup ∗}, -193b and -193a, and inversely inhibit miR-31 and -9{sup ∗}. Targeted inhibition of AEG-1 can lead to modification of key elemental characteristics, such as miRNAs, which may become a potential effective therapeutic strategy for CRC.« less

Dual knockdown of N-ras and epiregulin synergistically suppressed the growth of human hepatoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Meng; He, Hong-wei; Sun, Huan-xing

2009-09-18

Hepatocellular carcinoma (HCC) is a major challenge because of its resistance to conventional cytotoxic chemotherapy and radiotherapy. Multi-targeted therapy might be a new option for HCC treatment. Our previous study showed that N-ras gene was activated in HCC and was inhibited by RNA interference. In the present study, we investigated the alternation of gene expression by microarray in N-Ras-siRNA-treated HepG2 cells. The results revealed that the EREG gene, encoding epiregulin, was dramatically up-regulated in response to silence of N-ras. We speculated that the up-regulation of epiregulin was involved in the compensatory mechanism of N-ras knockdown for cell growth. Therefore, wemore » evaluated whether dual silence of N-ras and epiregulin display a greater suppression of cell growth. The results confirmed that dual knockdown of N-ras and epiregulin synergistically inhibited cell growth. Our results also showed that dual knockdown of N-ras and epiregulin significantly induced cell arrest at G0/G1 phase. Furthermore, Western blot assay showed that dual knockdown of N-ras and epiregulin markedly reduced the phosphorylations of ERK1/2, Akt and Rb, and inhibited the expression of cyclin D1. Our findings imply that multi-targeted silence of oncogenes might be an effective treatment for HCC.« less

Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

PubMed

Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

2017-02-01

RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

[Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

PubMed

Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

2018-01-01

Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

Dmpk gene deletion or antisense knockdown does not compromise cardiac or skeletal muscle function in mice

PubMed Central

Carrell, Samuel T.; Carrell, Ellie M.; Auerbach, David; Pandey, Sanjay K.; Bennett, C. Frank; Dirksen, Robert T.; Thornton, Charles A.

2016-01-01

Myotonic dystrophy type 1 (DM1) is a genetic disorder in which dominant-active DM protein kinase (DMPK) transcripts accumulate in nuclear foci, leading to abnormal regulation of RNA processing. A leading approach to treat DM1 uses DMPK-targeting antisense oligonucleotides (ASOs) to reduce levels of toxic RNA. However, basal levels of DMPK protein are reduced by half in DM1 patients. This raises concern that intolerance for further DMPK loss may limit ASO therapy, especially since mice with Dmpk gene deletion reportedly show cardiac defects and skeletal myopathy. We re-examined cardiac and muscle function in mice with Dmpk gene deletion, and studied post-maturity knockdown using Dmpk-targeting ASOs in mice with heterozygous deletion. Contrary to previous reports, we found no effect of Dmpk gene deletion on cardiac or muscle function, when studied on two genetic backgrounds. In heterozygous knockouts, the administration of ASOs reduced Dmpk expression in cardiac and skeletal muscle by > 90%, yet survival, electrocardiogram intervals, cardiac ejection fraction and muscle strength remained normal. The imposition of cardiac stress by pressure overload, or muscle stress by myotonia, did not unmask a requirement for DMPK. Our results support the feasibility and safety of using ASOs for post-transcriptional silencing of DMPK in muscle and heart. PMID:27522499

A Simple Retroelement Based Knock-Down System in Dictyostelium: Further Insights into RNA Interference Mechanisms.

PubMed

Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang

2015-01-01

We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.

RNA interference knockdown of DNA methyl-transferase 3 affects gene alternative splicing in the honey bee

PubMed Central

Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.

2013-01-01

Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726

RNAi-Mediated Knockdown of IKK1 in Transgenic Mice Using a Transgenic Construct Containing the Human H1 Promoter

PubMed Central

Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos

2014-01-01

Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early developmental defects in the hematopoietic lineage.

PubMed

Tulpule, Asmin; Lensch, M William; Miller, Justine D; Austin, Karyn; D'Andrea, Alan; Schlaeger, Thorsten M; Shimamura, Akiko; Daley, George Q

2010-04-29

Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNA interference (RNAi) strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicate that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease.

Investigating knockdown resistance (kdr) mechanism against pyrethroids/DDT in the malaria vector Anopheles funestus across Africa.

PubMed

Irving, Helen; Wondji, Charles S

2017-08-09

Understanding the molecular basis of insecticide resistance is key to improve the surveillance and monitoring of malaria vector populations under control. In the major malaria vector Anopheles funestus, little is currently known about the role of the knockdown resistance (kdr) mechanism. Here, we investigated the presence and contribution of knockdown resistance (kdr) to pyrethroids/DDT resistance observed in Anopheles funestus across Africa. Pyrosequencing genotyping and sequencing of the voltage gated sodium channel (VGSC) gene did not detect the common L1014F mutation in field collected An. funestus across Africa. Amplification and cloning of the full-length of the sodium channel gene in pyrethroid resistant mosquitoes revealed evidences of alternative splicing events with three transcripts of 2092, 2061 and 2117 amino acids (93% average similarity to An. gambiae). Several amino acid changes were detected close to the domain II of the protein such as L928R, F938 W, I939S, L802S and T1008 M. However, all these mutations are found at low frequency and their role in pyrethroid resistance could not be established. The presence of the exclusive alternative splicing at exon 19 was not associated with resistance phenotype. Analysis of patterns of genetic diversity of the VGSC gene revealed a high polymorphism level of this gene across Africa with no evidence of directional selection suggesting a limited role for knockdown resistance in pyrethroid resistance in An. funestus. Patterns of genetic differentiation correlate with previous observations of the existence of barriers to gene flow Africa-wide with southern population significantly differentiated from other regions. Despite an apparent limited role of knockdown resistance in An. funestus, it is necessary to continue to monitor the contribution of the mutations detected here as increasing selection from insecticide-based interventions may change the dynamic in field populations as previously observed in other

LSD1 knockdown reveals novel histone lysine methylation in human breast cancer MCF-7 cells.

PubMed

Jin, Yue; Huo, Bo; Fu, Xueqi; Cheng, Zhongyi; Zhu, Jun; Zhang, Yu; Hao, Tian; Hu, Xin

2017-08-01

Histone lysine methylation, which plays an important role in the regulation of gene expression, genome stability, chromosome conformation and cell differentiation, is a dynamic process that is collaboratively regulated by lysine methyltransferases (KMTs) and lysine demethylases (KDMs). LSD1, the first identified KDMs, catalyzes the demethylation of mono- and di-methylated H3K4 and H3K9. Here, we systematically investigated the effects of LSD1 knockdown on histone methylations. Surprisingly, in addition to H3K4 and H3K9, the methylation level on other histone lysines, such as H3K27, H3K36 and H3K79, are also increased. The expression of SOX2, E-cadherin and FoxA2 are increased upon LSD1 knockdown, and the methylation level of H3K4, H3K27 and H3K36 in the promoter region of these genes are all changed after LSD1 knockdown. Our results show that LSD1 knockdown has a broad effect on histone lysine methylation, which indicates that LSD1 regulates histone lysine methylation in collaboration with other KMTs and KDMs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Double Knockdown of Prolyyl Hydroxylase and Factor Inhibiting HIF with Non-Viral Minicircle Gene Therapy Enhances Stem Cell Mobilization and Angiogenesis After Myocardial Infarction

PubMed Central

Huang, Mei; Nguyen, Patricia; Jia, Fangjun; Hu, Shijun; Gong, Yongquan; de Almeida, Patricia E.; Wang, Li; Nag, Divya; Kay, Mark A.; Giaccia, Amato J; Robbins, Robert C.; Wu, Joseph C.

2011-01-01

Background Under normoxic conditions, hypoxia inducible factor-1 alpha (HIF-1α) is rapidly degraded by two hydroxylases, prolyl hydroxylase (PHD) and factor inhibiting HIF-1 (FIH). Because HIF-1α mediates the cardioprotective response to ischemic injury, its up-regulation may be an effective therapeutic option for ischemic heart failure. Methods and Results PHD and FIH were cloned from mouse embryonic stem cells. The best candidate short hairpin sequences for inhibiting PHD isoenzyme 2 (shPHD2) and FIH (shFIH) were inserted into novel non-viral minicircle vectors. In vitro studies after cell transfection of mouse C2C12 myoblasts, HL-1 atrial myocytes, and c-kit+ cardiac progenitor cells (CPCs) demonstrated higher expression of angiogenesis factors in the double knockdown group compared to the single knockdown and shScramble control groups. To confirm in vitro data, shRNA minicircle vectors were injected intramyocardially following LAD ligation in adult FVB mice (n=60). Functional studies using magnetic resonance imaging (MRI), echocardiography, and pressure-volume (PV) loops showed greater improvement in cardiac function in the double knockdown group. To assess mechanism(s) of this functional recovery, we performed a cell trafficking experiment, which demonstrated significantly greater recruitment of bone marrow cells to the ischemic myocardium in the double knockdown group. Fluorescence activated cell sorting (FACS) showed significantly higher activation of endogenous c-kit+ cardiac progenitor cells. Immunostaining showed increased neovascularization and decreased apoptosis in areas of injured myocardium. Finally, western blots and laser capture microdissection (LCM) analysis confirmed up-regulation of HIF-1α protein and angiogenesis genes, respectively. Conclusions We demonstrated that HIF-1α up-regulation by double knockdown of PHD and FIH synergistically increases stem cell mobilization and myocardial angiogenesis, leading to improved cardiac function. PMID

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Identification of an alternative knockdown resistance (kdr)-like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage-gated sodium channel gene.

PubMed

Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley

2014-06-01

Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.

Loss-of-function mutation in Hippo suppressed enlargement of lysosomes and neurodegeneration caused by dFIG4 knockdown.

PubMed

Kushimura, Yukie; Azuma, Yumiko; Mizuta, Ikuko; Muraoka, Yuuka; Kyotani, Akane; Yoshida, Hideki; Tokuda, Takahiko; Mizuno, Toshiki; Yamaguchi, Masamitsu

2018-05-08

Charcot-Marie-Tooth disease (CMT) is the most common hereditary neuropathy, and more than 80 CMT-causing genes have been identified to date. CMT4J is caused by a loss-of-function mutation in the Factor-Induced-Gene 4 (FIG4) gene, the product of which plays important roles in endosome-lysosome homeostasis. We hypothesized that Mammalian sterile 20-like kinase (MST) 1 and 2, tumor-suppressor genes, are candidate modifiers of CMT4J. We therefore examined the interaction between dFIG4 and Hippo (hpo), Drosophila counterparts of FIG4 and MSTs, respectively, using the Drosophila CMT4J model with the knockdown of dFIG4. The loss-of-function allele of hpo improved the rough eye morphology, locomotive dysfunction accompanied by structural defects in the presynaptic terminals of motoneurons, and the enlargement of lysosomes caused by the knockdown of dFIG4. Therefore, we identified hpo as a modifier of phenotypes induced by the knockdown of dFIG4. These results in Drosophila may provide an insight into the pathogenesis of CMT4J and contribute toward the development of disease-modifying therapy for CMT. We also identified the regulation of endosome-lysosome homeostasis as a novel probable function of Hippo/MST.

RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum.

PubMed

Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G

2016-07-14

The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.

Knockdown of PLC-gamma-2 and calmodulin 1 genes sensitizes human cervical adenocarcinoma cells to doxorubicin and paclitaxel.

PubMed

Stanislaus, Anthony; Bakhtiar, Athirah; Salleh, Diyana; Tiash, Snigdha; Fatemian, Tahereh; Hossain, Sharif; Akaike, Toshihiro; Chowdhury, Ezharul Hoque

2012-06-18

RNA interference (RNAi) is a powerful approach in functional genomics to selectively silence messenger mRNA (mRNA) expression and can be employed to rapidly develop potential novel drugs against a complex disease like cancer. However, naked siRNA being anionic is unable to cross the anionic cell membrane through passive diffusion and therefore, delivery of siRNA remains a major hurdle to overcome before the potential of siRNA technology can fully be exploited in cancer. pH-sensitive carbonate apatite has recently been developed as an efficient tool to deliver siRNA into the mammalian cells by virtue of its high affinity interaction with the siRNA and the desirable size distribution of the resulting siRNA-apatite complex for effective cellular endocytosis. Moreover, internalized siRNA was found to escape from the endosomes in a time-dependent manner and efficiently silence gene expression. Here we show that carbonate apatite-mediated delivery of siRNA against PLC-gamma-2 (PLCG2) and calmodulin 1 (CALM1) genes has led to the sensitization of a human cervical cancer cell line to doxorubicin- and paclitaxel depending on the dosage of the individual drug whereas no such enhancement in cell death was observed with cisplatin irrespective of the dosage following intracellular delivery of the siRNAs. Thus, PLCG2 and CALM1 genes are two potential targets for gene knockdown in doxorubicin and paclitaxel-based chemotherapy of cervical cancer.

The functional genetic link of NLGN4X knockdown and neurodevelopment in neural stem cells

PubMed Central

Shi, Lingling; Chang, Xiao; Zhang, Peilin; Coba, Marcelo P.; Lu, Wange; Wang, Kai

2013-01-01

Genetic mutations in NLGN4X (neuroligin 4), including point mutations and copy number variants (CNVs), have been associated with susceptibility to autism spectrum disorders (ASDs). However, it is unclear how mutations in NLGN4X result in neurodevelopmental defects. Here, we used neural stem cells (NSCs) as in vitro models to explore the impacts of NLGN4X knockdown on neurodevelopment. Using two shRNAmir-based vectors targeting NLGN4X and one control shRNAmir vector, we modulated NLGN4X expression and differentiated these NSCs into mature neurons. We monitored the neurodevelopmental process at Weeks 0, 0.5, 1, 2, 4 and 6, based on morphological analysis and whole-genome gene expression profiling. At the cellular level, in NSCs with NLGN4X knockdown, we observed increasingly delayed neuronal development and compromised neurite formation, starting from Week 2 through Week 6 post differentiation. At the molecular level, we identified multiple pathways, such as neurogenesis, neuron differentiation and muscle development, which are increasingly disturbed in cells with NLGN4X knockdown. Notably, several postsynaptic genes, including DLG4, NLGN1 and NLGN3, also have decreased expression. Based on in vitro models, NLGN4X knockdown directly impacts neurodevelopmental process during the formation of neurons and their connections. Our functional genomics study highlights the utility of NSCs models in understanding the functional roles of CNVs in affecting neurodevelopment and conferring susceptibility to neurodevelopmental diseases. PMID:23710042

The functional genetic link of NLGN4X knockdown and neurodevelopment in neural stem cells.

PubMed

Shi, Lingling; Chang, Xiao; Zhang, Peilin; Coba, Marcelo P; Lu, Wange; Wang, Kai

2013-09-15

Genetic mutations in NLGN4X (neuroligin 4), including point mutations and copy number variants (CNVs), have been associated with susceptibility to autism spectrum disorders (ASDs). However, it is unclear how mutations in NLGN4X result in neurodevelopmental defects. Here, we used neural stem cells (NSCs) as in vitro models to explore the impacts of NLGN4X knockdown on neurodevelopment. Using two shRNAmir-based vectors targeting NLGN4X and one control shRNAmir vector, we modulated NLGN4X expression and differentiated these NSCs into mature neurons. We monitored the neurodevelopmental process at Weeks 0, 0.5, 1, 2, 4 and 6, based on morphological analysis and whole-genome gene expression profiling. At the cellular level, in NSCs with NLGN4X knockdown, we observed increasingly delayed neuronal development and compromised neurite formation, starting from Week 2 through Week 6 post differentiation. At the molecular level, we identified multiple pathways, such as neurogenesis, neuron differentiation and muscle development, which are increasingly disturbed in cells with NLGN4X knockdown. Notably, several postsynaptic genes, including DLG4, NLGN1 and NLGN3, also have decreased expression. Based on in vitro models, NLGN4X knockdown directly impacts neurodevelopmental process during the formation of neurons and their connections. Our functional genomics study highlights the utility of NSCs models in understanding the functional roles of CNVs in affecting neurodevelopment and conferring susceptibility to neurodevelopmental diseases.

Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

PubMed

Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

2013-01-01

Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

Genetic architecture of a hormonal response to gene knockdown in honey bees.

PubMed

Ihle, Kate E; Rueppell, Olav; Huang, Zachary Y; Wang, Ying; Fondrk, M Kim; Page, Robert E; Amdam, Gro V

2015-01-01

Variation in endocrine signaling is proposed to underlie the evolution and regulation of social life histories, but the genetic architecture of endocrine signaling is still poorly understood. An excellent example of a hormonally influenced set of social traits is found in the honey bee (Apis mellifera): a dynamic and mutually suppressive relationship between juvenile hormone (JH) and the yolk precursor protein vitellogenin (Vg) regulates behavioral maturation and foraging of workers. Several other traits cosegregate with these behavioral phenotypes, comprising the pollen hoarding syndrome (PHS) one of the best-described animal behavioral syndromes. Genotype differences in responsiveness of JH to Vg are a potential mechanistic basis for the PHS. Here, we reduced Vg expression via RNA interference in progeny from a backcross between 2 selected lines of honey bees that differ in JH responsiveness to Vg reduction and measured JH response and ovary size, which represents another key aspect of the PHS. Genetic mapping based on restriction site-associated DNA tag sequencing identified suggestive quantitative trait loci (QTL) for ovary size and JH responsiveness. We confirmed genetic effects on both traits near many QTL that had been identified previously for their effect on various PHS traits. Thus, our results support a role for endocrine control of complex traits at a genetic level. Furthermore, this first example of a genetic map of a hormonal response to gene knockdown in a social insect helps to refine the genetic understanding of complex behaviors and the physiology that may underlie behavioral control in general. © The American Genetic Association. 2015.

Genetic Architecture of a Hormonal Response to Gene Knockdown in Honey Bees

PubMed Central

Rueppell, Olav; Huang, Zachary Y.; Wang, Ying; Fondrk, M. Kim; Page, Robert E.; Amdam, Gro V.

2015-01-01

Variation in endocrine signaling is proposed to underlie the evolution and regulation of social life histories, but the genetic architecture of endocrine signaling is still poorly understood. An excellent example of a hormonally influenced set of social traits is found in the honey bee (Apis mellifera): a dynamic and mutually suppressive relationship between juvenile hormone (JH) and the yolk precursor protein vitellogenin (Vg) regulates behavioral maturation and foraging of workers. Several other traits cosegregate with these behavioral phenotypes, comprising the pollen hoarding syndrome (PHS) one of the best-described animal behavioral syndromes. Genotype differences in responsiveness of JH to Vg are a potential mechanistic basis for the PHS. Here, we reduced Vg expression via RNA interference in progeny from a backcross between 2 selected lines of honey bees that differ in JH responsiveness to Vg reduction and measured JH response and ovary size, which represents another key aspect of the PHS. Genetic mapping based on restriction site-associated DNA tag sequencing identified suggestive quantitative trait loci (QTL) for ovary size and JH responsiveness. We confirmed genetic effects on both traits near many QTL that had been identified previously for their effect on various PHS traits. Thus, our results support a role for endocrine control of complex traits at a genetic level. Furthermore, this first example of a genetic map of a hormonal response to gene knockdown in a social insect helps to refine the genetic understanding of complex behaviors and the physiology that may underlie behavioral control in general. PMID:25596612

GABAA receptor γ2 subunit knockdown mice have enhanced anxiety-like behavior but unaltered hypnotic response to benzodiazepines

PubMed Central

Chandra, Dev; Korpi, Esa R; Miralles, Celia P; De Blas, Angel L; Homanics, Gregg E

2005-01-01

Background Gamma-aminobutyric acid type A receptors (GABAA-Rs) are the major inhibitory receptors in the mammalian brain and are modulated by a number of sedative/hypnotic drugs including benzodiazepines and anesthetics. The significance of specific GABAA-Rs subunits with respect to behavior and in vivo drug responses is incompletely understood. The γ2 subunit is highly expressed throughout the brain. Global γ2 knockout mice are insensitive to the hypnotic effects of diazepam and die perinatally. Heterozygous γ2 global knockout mice are viable and have increased anxiety-like behaviors. To further investigate the role of the γ2 subunit in behavior and whole animal drug action, we used gene targeting to create a novel mouse line with attenuated γ2 expression, i.e., γ2 knockdown mice. Results Knockdown mice were created by inserting a neomycin resistance cassette into intron 8 of the γ2 gene. Knockdown mice, on average, showed a 65% reduction of γ2 subunit mRNA compared to controls; however γ2 gene expression was highly variable in these mice, ranging from 10–95% of normal. Immunohistochemical studies demonstrated that γ2 protein levels were also variably reduced. Pharmacological studies using autoradiography on frozen brain sections demonstrated that binding of the benzodiazepine site ligand Ro15-4513 was decreased in mutant mice compared to controls. Behaviorally, knockdown mice displayed enhanced anxiety-like behaviors on the elevated plus maze and forced novelty exploration tests. Surprisingly, mutant mice had an unaltered response to hypnotic doses of the benzodiazepine site ligands diazepam, midazolam and zolpidem as well as ethanol and pentobarbital. Lastly, we demonstrated that the γ2 knockdown mouse line can be used to create γ2 global knockout mice by crossing to a general deleter cre-expressing mouse line. Conclusion We conclude that: 1) insertion of a neomycin resistance gene into intron 8 of the γ2 gene variably reduced the amount of γ2

The knock-down of the expression of MdMLO19 reduces susceptibility to powdery mildew (Podosphaera leucotricha) in apple (Malus domestica).

PubMed

Pessina, Stefano; Angeli, Dario; Martens, Stefan; Visser, Richard G F; Bai, Yuling; Salamini, Francesco; Velasco, Riccardo; Schouten, Henk J; Malnoy, Mickael

2016-10-01

Varieties resistant to powdery mildew (PM; caused by Podosphaera leucotricha) are a major component of sustainable apple production. Resistance can be achieved by knocking-out susceptibility S-genes to be singled out among members of the MLO (Mildew Locus O) gene family. Candidates are MLO S-genes of phylogenetic clade V up-regulated upon PM inoculation, such as MdMLO11 and 19 (clade V) and MdMLO18 (clade VII). We report the knock-down through RNA interference of MdMLO11 and 19, as well as the complementation of resistance with MdMLO18 in the Arabidopsis thaliana triple mlo mutant Atmlo2/6/12. The knock-down of MdMLO19 reduced PM disease severity by 75%, whereas the knock-down of MdMLO11, alone or in combination with MdMLO19, did not result in any reduction or additional reduction of susceptibility compared with MdMLO19 alone. The test in A. thaliana excluded a role for MdMLO18 in PM susceptibility. Cell wall appositions (papillae) were present in both PM-resistant and PM-susceptible plants, but were larger in resistant lines. No obvious negative phenotype was observed in plants with mlo genes knocked down. Apparently, MdMLO19 plays the pivotal role in apple PM susceptibility and its knock-down induces a very significant level of resistance. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

The effects of Kiaa0319 knockdown on cortical and subcortical anatomy in male rats

PubMed Central

Szalkowski, Caitlin E.; Fiondella, Christopher F.; Truong, Dongnhu T.; Rosen, Glenn D.; LoTurco, Joseph J.; Fitch, Roslyn H.

2012-01-01

Developmental dyslexia is a disorder characterized by a specific deficit in reading despite adequate overall intelligence and educational resources. The neurological substrate underlying these significant behavioral impairments is not known. Studies of post mortem brain tissue from male and female dyslexic individuals revealed focal disruptions of neuronal migration concentrated in the left hemisphere, along with aberrant symmetry of the right and left the planum temporale, and changes in cell size distribution within the medial geniculate nucleus of the thalamus (Galaburda et al., 1985; Humphreys et al., 1990). More recent neuroimaging studies have identified several changes in the brains of dyslexic individuals, including regional changes in gray matter, changes in white matter, and changes in patterns of functional activation. In a further effort to elucidate the etiology of dyslexia, epidemiological and genetic studies have identified several candidate dyslexia susceptibility genes. Some recent work has investigated associations between some of these genetic variants and structural changes in the brain. Variants of one candidate dyslexia susceptibility gene, KIAA0319, have been linked to morphological changes in the cerebellum and functional activational changes in the superior temporal sulcus (Jamadar et al., 2011; Pinel et al., 2012). Animal models have been used to create a knockdown of Kiaa0319 (the rodent homolog of the human gene) via in utero RNA interference in order to study the gene’s effects on brain development and behavior. Studies using this animal model have demonstrated that knocking down the gene leads to focal disruptions of neuronal migration in the form of ectopias and heterotopias, similar to those observed in the brains of human dyslexics. However, further changes to the structure of the brain have not been studied following this genetic disruption. The current study sought to determine the effects of embryonic Kiaa0319 knockdown on

Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

PubMed Central

Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

2010-01-01

Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

PubMed

Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

2017-10-01

RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

Stable SREBP-1a knockdown decreases the cell proliferation rate in human preadipocyte cells without inducing senescence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alvarez, María Soledad; Fernandez-Alvarez, Ana; Cucarella, Carme

2014-04-25

Highlights: • SGBS cells mostly expressed SREBP-1a variant. • SREBP-1a knockdown decreased the proliferation of SGBS cells without inducing senescence. • We have identified RBBP8 and CDKN3 genes as potential SREBP-1a targets. - Abstract: Sterol regulatory element binding proteins (SREBP), encoded by the Srebf1 and Srebf2 genes, are important regulators of genes involved in cholesterol and fatty acid metabolism. Whereas SREBP-2 controls the cholesterol synthesis, SREBP-1 proteins (-1a and -1c) function as the central hubs in lipid metabolism. Despite the key function of these transcription factors to promote adipocyte differentiation, the roles of SREBP-1 proteins during the preadipocyte state remainmore » unknown. Here, we evaluate the role of SREBP-1 in preadipocyte proliferation using RNA interference technology. Knockdown of the SREBP-1a gene decreased the proliferation rate in human SGBS preadipocyte cell strain without inducing senescence. Furthermore, our data identified retinoblastoma binding protein 8 and cyclin-dependent kinase inhibitor 3 genes as new potential SREBP-1 targets, in addition to cyclin-dependent kinase inhibitor 1A which had already been described as a gene regulated by SREBP-1a. These data suggested a new role of SREBP-1 in adipogenesis via regulation of preadipocyte proliferation.« less

Inducible knockdown of pregnancy-associated plasma protein-A gene expression in adult female mice extends life span.

PubMed

Bale, Laurie K; West, Sally A; Conover, Cheryl A

2017-08-01

Pregnancy-associated plasma protein-A (PAPP-A) knockout (KO) mice, generated through homologous recombination in embryonic stem cells, have a significantly increased lifespan compared to wild-type littermates. However, it is unknown whether this longevity advantage would pertain to PAPP-A gene deletion in adult animals. In the present study, we used tamoxifen (Tam)-inducible Cre recombinase-mediated excision of the floxed PAPP-A (fPAPP-A) gene in mice at 5 months of age. fPAPP-A mice, which were either positive (pos) or negative (neg) for Tam-Cre, received Tam treatment with quarterly boosters. Only female mice could be used with this experimental design. fPAPP-A/neg and fPAPP-A/pos mice had similar weights at the start of the experiment and showed equivalent weight gain. We found that fPAPP-A/pos mice had a significant extension of life span (P = 0.005). The median life span was increased by 21% for fPAPP-A/pos compared to fPAPP-A/neg mice. Analysis of mortality in life span quartiles indicated that the proportion of deaths of fPAPP-A/pos mice were lower than fPAPP-A/neg mice at young adult ages (P = 0.002 for 601-800 days) and higher than fPAPP-A/neg mice at older ages (P = 0.004 for >1000 days). Thus, survival curves and age-specific mortality indicate that female mice with knockdown of PAPP-A gene expression as adults have an extended healthy life span. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

The knockdown of chloroplastic ascorbate peroxidases reveals its regulatory role in the photosynthesis and protection under photo-oxidative stress in rice.

PubMed

Caverzan, Andréia; Bonifacio, Aurenivia; Carvalho, Fabricio E L; Andrade, Claudia M B; Passaia, Gisele; Schünemann, Mariana; Maraschin, Felipe Dos Santos; Martins, Marcio O; Teixeira, Felipe K; Rauber, Rafael; Margis, Rogério; Silveira, Joaquim Albenisio Gomes; Margis-Pinheiro, Márcia

2014-01-01

The inactivation of the chloroplast ascorbate peroxidases (chlAPXs) has been thought to limit the efficiency of the water-water cycle and photo-oxidative protection under stress conditions. In this study, we have generated double knockdown rice (Oryza sativa L.) plants in both OsAPX7 (sAPX) and OsAPX8 (tAPX) genes, which encode chloroplastic APXs (chlAPXs). By employing an integrated approach involving gene expression, proteomics, biochemical and physiological analyses of photosynthesis, we have assessed the role of chlAPXs in the regulation of the protection of the photosystem II (PSII) activity and CO2 assimilation in rice plants exposed to high light (HL) and methyl violagen (MV). The chlAPX knockdown plants were affected more severely than the non-transformed (NT) plants in the activity and structure of PSII and CO2 assimilation in the presence of MV. Although MV induced significant increases in pigment content in the knockdown plants, the increases were apparently not sufficient for protection. Treatment with HL also caused generalized damage in PSII in both types of plants. The knockdown and NT plants exhibited differences in photosynthetic parameters related to efficiency of utilization of light and CO2. The knockdown plants overexpressed other antioxidant enzymes in response to the stresses and increased the GPX activity in the chloroplast-enriched fraction. Our data suggest that a partial deficiency of chlAPX expression modulate the PSII activity and integrity, reflecting the overall photosynthesis when rice plants are subjected to acute oxidative stress. However, under normal growth conditions, the knockdown plants exhibit normal phenotype, biochemical and physiological performance. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Knockdown of FoxP2 alters spine density in Area X of the zebra finch.

PubMed

Schulz, S B; Haesler, S; Scharff, C; Rochefort, C

2010-10-01

Mutations in the gene encoding the transcription factor FoxP2 impair human speech and language. We have previously shown that deficits in vocal learning occur in zebra finches after reduction of FoxP2 in Area X, a striatal nucleus involved in song acquisition. We recently showed that FoxP2 is expressed in newly generated spiny neurons (SN) in adult Area X as well as in the ventricular zone (VZ) from which the SN originates. Moreover, their recruitment to Area X increases transiently during the song learning phase. The present report therefore investigated whether FoxP2 is involved in the structural plasticity of Area X. We assessed the proliferation, differentiation and morphology of SN after lentivirally mediated knockdown of FoxP2 in Area X or in the VZ during the song learning phase. Proliferation rate was not significantly affected by knockdown of FoxP2 in the VZ. In addition, FoxP2 reduction both in the VZ and in Area X did not affect the number of new neurons in Area X. However, at the fine-structural level, SN in Area X bore fewer spines after FoxP2 knockdown. This effect was even more pronounced when neurons received the knockdown before differentiation, i.e. as neuroblasts in the VZ. These results suggest that FoxP2 might directly or indirectly regulate spine dynamics in Area X and thereby influence song plasticity. Together, these data present the first evidence for a role of FoxP2 in the structural plasticity of dendritic spines and complement the emerging evidence of physiological synaptic plasticity in FoxP2 mouse models. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society. No claim to original US government works.

Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.

PubMed

Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K

2017-01-01

The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.

RNA interference-mediated knockdown of the hydroxyacid-oxoacid transhydrogenase gene decreases thiamethoxam resistance in adults of the whitefly Bemisia tabaci

PubMed Central

Yang, Xin; Xie, Wen; Li, Ru-mei; Zhou, Xiao-mao; Wang, Shao-li; Wu, Qing-jun; Yang, Ni-na; Xia, Ji-xing; Yang, Ze-zong; Guo, Li-tao; Liu, Ya-ting; Zhang, You-jun

2017-01-01

Bemisia tabaci has developed a high level of resistance to thiamethoxam, a second generation neonicotinoid insecticide that has been widely used to control this pest. In this study, we investigated whether hydroxyacid-oxoacid transhydrogenase (HOT) is involved in resistance to the neonicotinoid insecticide thiamethoxam in the whitefly. We cloned the full-length gene that encodes HOT in B. tabaci. Its cDNA contains a 1428-bp open reading frame encoding 475 amino acid residues. Then we evaluated the mRNA expression level of HOT in different developmental stages, and found HOT expression was significantly greater in thiamethoxam resistance adults than in thiamethoxam susceptible adults. Subsequently, seven field populations of B. tabaci adults were sampled, the expression of mRNA level of HOT significant positive correlated with thiamethoxam resistance level. At last, we used a modified gene silencing system to knock-down HOT expression in B. tabaci adults. The results showed that the HOT mRNA levels decreased by 57% and thiamethoxam resistance decreased significantly after 2 days of feeding on a diet containing HOT dsRNA. The results indicated that down-regulation of HOT expression decreases thiamethoxam resistance in B. tabaci adults. PMID:28117358

Syndecan-1 knockdown inhibits glioma cell proliferation and invasion by deregulating a c-src/FAK-associated signaling pathway.

PubMed

Shi, Shuang; Zhong, Dong; Xiao, Yao; Wang, Bing; Wang, Wentao; Zhang, Fu'an; Huang, Haoyang

2017-06-20

Recent studies have shown that increased syndecan-1 (SDC1) expression in human glioma is associated with higher tumor grades and poor prognoses, but its oncogenic functions and the underlying molecular mechanisms remain unknown. Here, we examined SDC1 expression in datasets from The Cancer Genome Atlas and the National Center for Biotechnology Information Gene Expression Omnibus. Elevated SDC1 expression in glioma was closely associated with increases in tumor progression and shorter survival. We also examined SDC1 expression and evaluated the effects of stable SDC1 knockdown in glioma cell lines. SDC1 knockdown attenuated proliferation and invasion by glioma cells and markedly decreased PCNA and MMP-9 mRNA and protein expression. In a xenograft model, SDC1 knockdown suppressed the tumorigenic effects of U87 cells in vivo. SDC1 knockdown decreased phosphorylation of the c-src/FAK complex and its downstream signaling molecules, Erk, Akt and p38 MAPK. These results suggest that SDC1 may be a novel therapeutic target in the treatment of glioma.

Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene.

PubMed

Fourtounis, Jimmy; Wang, I-Ming; Mathieu, Marie-Claude; Claveau, David; Loo, Tenneille; Jackson, Aimee L; Peters, Mette A; Therien, Alex G; Boie, Yves; Crackower, Michael A

2012-10-12

Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.

Periaqueductal gray knockdown of V2, not V1a and V1b receptor influences nociception in the rat. yj6676@yahoo.com.

PubMed

Yang, Jun; Yang, Yu; Chen, Jian-Min; Wang, Gen; Xu, Hong-Tao; Liu, Wen-Yan; Lin, Bao-Cheng

2007-01-01

Our pervious study has proved that arginine vasopressin (AVP) in periaqueductal gray (PAG) plays a role in antinociception. After establishing a model of local special gene knockdown, the nociceptive effect of vasopressin receptor subunit in PAG was investigated in the rat. Microinjection of short-interfering RNA (siRNA) into PAG, which targeted vasopressin receptor subtypes (V(1a), V(1b) and V(2)), locally weakened the associated mRNA expression and depressed the related receptor synthesis in a dose-dependent manner, in which the significant inhibitive effect occurred on from 7th day to 14th day following 1microg or 2microg siRNA administration. PAG knockdown of V(2) receptor gene markedly decreased pain threshold in from 6th day to 13th day after siRNA administration, whereas local knockdown of either V(1a) or V(1b) receptor gene could not influence pain threshold. The data suggest that V(2) rather than V(1a) and V(1b) receptor in PAG involves in nociception.

RNAi-mediated knock-down of Dab and Numb attenuate Aβ levels via γ-secretase mediated APP processing

PubMed Central

2012-01-01

Amyloid-β-protein (Aβ), the key component of senile plaques in Alzheimer's disease (AD) brain, is produced from amyloid precursor protein (APP) by cleavage of β-secretase and then γ-secretase. APP adaptor proteins with phosphotyrosine-binding (PTB) domains, including Dab (gene: DAB) and Numb (gene: NUMB), can bind to and interact with the conserved YENPTY-motif in the APP C-terminus. Here we describe, for the first time, the effects of RNAi knock-down of Dab and Numb expression on APP processing and Aβ production. RNAi knock-down of Dab and Numb in H4 human neuroglioma cells stably transfected to express either FL-APP (H4-FL-APP cells) or APP-C99 (H4-APP-C99 cells) increased levels of APP-C-terminal fragments (APP-CTFs) and lowered Aβ levels in both cell lines by inhibiting γ-secretase cleavage of APP. Finally, RNAi knock-down of APP also reduced levels of Numb in H4-APP cells. These findings suggest that pharmacologically blocking interaction of APP with Dab and Numb may provide novel therapeutic strategies of AD. The notion of attenuating γ-secretase cleavage of APP via the APP adaptor proteins, Dab and Numb, is particularly attractive with regard to therapeutic potential, given that side effects of γ-secretase inhibition owing to impaired proteolysis of other γ-secretase substrates, e.g. Notch, might be avoided. PMID:23211096

RNAi-mediated knock-down of Dab and Numb attenuate Aβ levels via γ-secretase mediated APP processing.

PubMed

Xie, Zhongcong; Dong, Yuanlin; Maeda, Uta; Xia, Weiming; Tanzi, Rudolph E

2012-03-22

Amyloid-β-protein (Aβ), the key component of senile plaques in Alzheimer's disease (AD) brain, is produced from amyloid precursor protein (APP) by cleavage of β-secretase and then γ-secretase. APP adaptor proteins with phosphotyrosine-binding (PTB) domains, including Dab (gene: DAB) and Numb (gene: NUMB), can bind to and interact with the conserved YENPTY-motif in the APP C-terminus. Here we describe, for the first time, the effects of RNAi knock-down of Dab and Numb expression on APP processing and Aβ production. RNAi knock-down of Dab and Numb in H4 human neuroglioma cells stably transfected to express either FL-APP (H4-FL-APP cells) or APP-C99 (H4-APP-C99 cells) increased levels of APP-C-terminal fragments (APP-CTFs) and lowered Aβ levels in both cell lines by inhibiting γ-secretase cleavage of APP. Finally, RNAi knock-down of APP also reduced levels of Numb in H4-APP cells. These findings suggest that pharmacologically blocking interaction of APP with Dab and Numb may provide novel therapeutic strategies of AD. The notion of attenuating γ-secretase cleavage of APP via the APP adaptor proteins, Dab and Numb, is particularly attractive with regard to therapeutic potential, given that side effects of γ-secretase inhibition owing to impaired proteolysis of other γ-secretase substrates, e.g. Notch, might be avoided.

Insecticidal potency of RNAi-based catalase knockdown in Rhynchophorus ferrugineus (Oliver) (Coleoptera: Curculionidae).

PubMed

Al-Ayedh, Hassan; Rizwan-Ul-Haq, Muhammad; Hussain, Abid; Aljabr, Ahmed M

2016-11-01

Palm trees around the world are prone to notorious Rhynchophorus ferrugineus, which causes heavy losses of palm plantations. In Middle Eastern countries, this pest is a major threat to date palm orchards. Conventional pest control measures with the major share of synthetic insecticides have resulted in insect resistance and environmental issues. Therefore, in order to explore better alternatives, the RNAi approach was employed to knock down the catalase gene in fifth and tenth larval instars with different dsRNA application methods, and their insecticidal potency was studied. dsRNA of 444 bp was prepared to knock down catalase in R. ferrugineus. Out of the three dsRNA application methods, dsRNA injection into larvae was the most effective, followed by dsRNA application by artificial feeding. Both methods resulted in significant catalase knockdown in various tissues, especially the midgut. As a result, the highest growth inhibition of 123.49 and 103.47% and larval mortality of 80 and 40% were observed in fifth-instar larvae, whereas larval growth inhibition remained at 86.83 and 69.08% with larval mortality at 30 and 10% in tenth-instar larvae after dsRNA injection and artificial diet treatment. The topical application method was the least efficient, with the lowest larval growth inhibition of 57.23 and 45.61% and 0% mortality in fifth- and tenth-instar larvae. Generally, better results were noted at the high dsRNA dose of 5 µL. Catalase enzyme is found in most insect body tissues, and thus its dsRNA can cause broad-scale gene knockdown within the insect body, depending upon the application method. Significant larval mortality and growth inhibition after catalase knockdown in R. ferrugineus confirms its insecticidal potency and suggests a bright future for RNAi-based bioinsecticides in pest control. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

Signal Transducer and Activator of Transcription 1 (STAT1) Knock-down Induces Apoptosis in Malignant Pleural Mesothelioma.

PubMed

Arzt, Lisa; Halbwedl, Iris; Gogg-Kamerer, Margit; Popper, Helmut H

2017-07-01

Malignant pleural mesothelioma (MPM) is the most common primary tumor of the pleura. Its incidence is still increasing in Europe and the prognosis remains poor. We investigated the oncogenic function of signal transducer and activator of transcription 1 (STAT1) in MPM in more detail. A miRNA profiling was performed on 52 MPM tissue samples. Upregulated miRNAs (targeting SOCS1/3) were knocked-down using miRNA inhibitors. mRNA expression levels of STAT1/3, SOCS1/3 were detected in MPM cell lines. STAT1 has been knocked-down using siRNA and qPCR was used to detect mRNA expression levels of all JAK/STAT family members and genes that regulate them. An immunohistochemical staining was performed to detect the expression of caspases. STAT1 was upregulated and STAT3 was downregulated, SOCS1/3 protein was not detected but it was possible to detect SOCS1/3 mRNA in MPM cell lines. The upregulated miRNAs were successfully knocked-down, however the expected effect on SOCS1 expression was not detected. STAT1 knock-down had different effects on STAT3/5 expression. Caspase 3a and 8 expression was found to be increased after STAT1 knock-down. The physiologic regulation of STAT1 via SOCS1 is completely lost in MPM and it does not seem that the miRNAs identified by now, do inhibit the expression of SOCS1. MPM cell lines compensate STAT1 knock-down by increasing the expression of STAT3 or STAT5a, two genes which are generally considered to be oncogenes. And much more important, STAT1 knock-down induces apoptosis in MPM cell lines and STAT1 might therefore be a target for therapeutic intervention.

EphA2 knockdown attenuates atherosclerotic lesion development in ApoE(-/-) mice.

PubMed

Jiang, Hong; Li, Xinyun; Zhang, Xiaoli; Liu, Yan; Huang, Shanying; Wang, Xiaowei

2014-01-01

The inflammatory response of vascular endothelial cells plays important roles in the initiation and progression of atherosclerotic lesions. EphA2 receptor activation promotes the endothelial cell inflammatory response, and its expression is increased in the endothelial cell layer of atherosclerotic plaques. However, the association between EphA2 and atherosclerosis has not been determined. Eight-week-old male ApoE(-/-) mice were systemically infected with adenoassociated virus serotype 9 carrying a small hairpin RNA specifically targeting the EphA2 gene to knock down EphA2 expression in aortic endothelial cells. These mice were then fed a high-cholesterol diet for 12 weeks. Blood was collected for the measurement of plasma lipids. The aortas were harvested to evaluate the atherosclerotic lesion size, macrophage components, and expression of proinflammatory genes using Oil Red O staining, immunofluorescence staining, and molecular biology analysis. The lesions formed in the entire aorta and aortic sinus of the ApoE(-/-) mice with EphA2 knockdown were significantly smaller than those in the control mice (10.7%±3.1% versus 25.1%±4.2%; 0.51±0.02mm(2) versus 0.85±0.03mm(2); n=10; P<.05). Furthermore, the lesions in the ApoE(-/-) mice with EphA2 knockdown displayed reduced inflammation compared with the control mice, as reflected by the decreased macrophage infiltration (8.2%±2.9% versus 22.7%±4%; n=10; P<.05); decreased nuclear factor-κβ activation; and diminished expression of vascular cell adhesion molecule-1, E-selectin, and monocyte chemotactic protein-1 (all P<.05). Our data demonstrate that the EphA2 receptor silencing attenuates the extent and inflammation of atherosclerotic lesions in ApoE(-/-) mice. Thus, EphA2 knockdown in endothelial cells represents a novel therapeutic strategy for patients with atherosclerosis. Copyright © 2014 Elsevier Inc. All rights reserved.

Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

PubMed Central

2012-01-01

Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

Time-controllable Nkcc1 knockdown replicates reversible hearing loss in postnatal mice.

PubMed

Watabe, Takahisa; Xu, Ming; Watanabe, Miho; Nabekura, Junichi; Higuchi, Taiga; Hori, Karin; Sato, Mitsuo P; Nin, Fumiaki; Hibino, Hiroshi; Ogawa, Kaoru; Masuda, Masatsugu; Tanaka, Kenji F

2017-10-19

Identification of the causal effects of specific proteins on recurrent and partially reversible hearing loss has been difficult because of the lack of an animal model that provides reversible gene knockdown. We have developed the transgenic mouse line Actin-tTS::Nkcc1 tetO/tetO for manipulatable expression of the cochlear K + circulation protein, NKCC1. Nkcc1 transcription was blocked by the binding of a tetracycline-dependent transcriptional silencer to the tetracycline operator sequences inserted upstream of the Nkcc1 translation initiation site. Administration of the tetracycline derivative doxycycline reversibly regulated Nkcc1 knockdown. Progeny from pregnant/lactating mothers fed doxycycline-free chow from embryonic day 0 showed strong suppression of Nkcc1 expression (~90% downregulation) and Nkcc1 null phenotypes at postnatal day 35 (P35). P35 transgenic mice from mothers fed doxycycline-free chow starting at P0 (delivery) showed weaker suppression of Nkcc1 expression (~70% downregulation) and less hearing loss with mild cochlear structural changes. Treatment of these mice at P35 with doxycycline for 2 weeks reactivated Nkcc1 transcription to control levels and improved hearing level at high frequency; i.e., these doxycycline-treated mice exhibited partially reversible hearing loss. Thus, development of the Actin-tTS::Nkcc1 tetO/tetO transgenic mouse line provides a mouse model for the study of variable hearing loss through reversible knockdown of Nkcc1.

RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

NASA Astrophysics Data System (ADS)

Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Yoon, Ho Sup; Swee Chuan, Tjin; Yong, Ken-Tye

2015-09-01

RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications.

A comparative analysis of soft computing techniques for gene prediction.

PubMed

Goel, Neelam; Singh, Shailendra; Aseri, Trilok Chand

2013-07-01

The rapid growth of genomic sequence data for both human and nonhuman species has made analyzing these sequences, especially predicting genes in them, very important and is currently the focus of many research efforts. Beside its scientific interest in the molecular biology and genomics community, gene prediction is of considerable importance in human health and medicine. A variety of gene prediction techniques have been developed for eukaryotes over the past few years. This article reviews and analyzes the application of certain soft computing techniques in gene prediction. First, the problem of gene prediction and its challenges are described. These are followed by different soft computing techniques along with their application to gene prediction. In addition, a comparative analysis of different soft computing techniques for gene prediction is given. Finally some limitations of the current research activities and future research directions are provided. Copyright © 2013 Elsevier Inc. All rights reserved.

A de novo X;8 translocation creates a PTK2-THOC2 gene fusion with THOC2 expression knockdown in a patient with psychomotor retardation and congenital cerebellar hypoplasia

PubMed Central

Di Gregorio, Eleonora; Bianchi, Federico T.; Schiavi, Alfonso; Chiotto, Alessandra M.A.; Rolando, Marco; di Cantogno, Ludovica Verdun; Grosso, Enrico; Cavalieri, Simona; Calcia, Alessandro; Lacerenza, Daniela; Zuffardi, Orsetta; Retta, Saverio Francesco; Stevanin, Giovanni; Marelli, Cecilia; Durr, Alexandra; Forlani, Sylvie; Chelly, Jamel; Montarolo, Francesca; Tempia, Filippo; Beggs, Hilary E.; Reed, Robin; Squadrone, Stefania; Abete, Maria C.; Brussino, Alessandro; Ventura, Natascia; Di Cunto, Ferdinando; Brusco, Alfredo

2014-01-01

We identified a balanced de novo translocation involving chromosomes Xq25 and 8q24 in an eight year-old girl with a non-progressive form of congenital ataxia, cognitive impairment and cerebellar hypoplasia. Breakpoint definition showed that the promoter of the Protein Tyrosine Kinase 2 (PTK2, also known as Focal Adhesion Kinase, FAK) gene on chromosome 8q24.3 is translocated 2 kb upstream of the THO complex subunit 2 (THOC2) gene on chromosome Xq25. PTK2 is a well-known non-receptor tyrosine kinase whereas THOC2 encodes a component of the evolutionarily conserved multiprotein THO complex, involved in mRNA export from nucleus. The translocation generated a sterile fusion transcript under the control of the PTK2 promoter, affecting expression of both PTK2 and THOC2 genes. PTK2 is involved in cell adhesion and, in neurons, plays a role in axonal guidance, and neurite growth and attraction. However, PTK2 haploinsufficiency alone is unlikely to be associated with human disease. Therefore, we studied the role of THOC2 in the CNS using three models: 1) THOC2 ortholog knockout in C. elegans which produced functional defects in specific sensory neurons; 2) Thoc2 knockdown in primary rat hippocampal neurons which increased neurite extension; 3) Thoc2 knockdown in neuronal stem cells (LC1) which increased their in vitro growth rate without modifying apoptosis levels. We suggest that THOC2 can play specific roles in neuronal cells and, possibly in combination with PTK2 reduction, may affect normal neural network formation, leading to cognitive impairment and cerebellar congenital hypoplasia. PMID:23749989

Knockdown of Lmo7 inhibits chick myogenesis.

PubMed

Possidonio, Ana C B; Soares, Carolina P; Fontenele, Marcio; Morris, Eduardo R; Mouly, Vincent; Costa, Manoel L; Mermelstein, Claudia

2016-02-01

The multifunctional protein Lmo7 has been implicated in some aspects of myogenesis in mammals. Here we studied the distribution and expression of Lmo7 and the effects of Lmo7 knockdown in primary cultures of chick skeletal muscle cells. Lmo7 was localized within the nuclei of myoblasts and at the perinuclear region of myotubes. Knockdown of Lmo7 using siRNA specific to chick reduces the number and width of myotubes and the number of MyoD positive-myoblasts. Both Wnt3a enriched medium and Bio, activators of the Wnt/beta-catenin pathway, could rescue the effects of the Lmo7 knockdown suggesting a crosstalk between the Wnt/beta-catenin and Lmo7-mediated signaling pathways. Our data shows a role of Lmo7 during the initial events of chick skeletal myogenesis, particularly in myoblast survival. © 2016 Federation of European Biochemical Societies.

Knockdown of ferroportin accelerates erastin-induced ferroptosis in neuroblastoma cells.

PubMed

Geng, N; Shi, B-J; Li, S-L; Zhong, Z-Y; Li, Y-C; Xua, W-L; Zhou, H; Cai, J-H

2018-06-01

Ferroptosis is a new-found iron-dependent form of non-apoptotic regulated cell death (RCD), which is activated on therapy with several antitumor agents, but the potential mechanism remains unclear. Erastin, exhibiting selectivity for RAS-mutated cancer cells, induces ferroptosis by increasing iron and lipid reactive oxygen species (ROS) levels in cell. Ferroportin (Fpn), the sole iron export protein, participates in the regulation of intracellular iron concentration. In this study, we investigated the role of Fpn on ferroptosis induced by erastin in SH-SY5Y cells. The cell viability was determined by CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay kit. The activity of caspase-3 was measured by ELISA kit. qRT-PCR was performed to examine the mRNA expression of Fpn. Western blot assay was conducted to examine the expression level of marker proteins. Specific commercial kits were used to examine the levels of MDA, ROS and iron in cells, respectively. Ferroptosis was evaluated by intracellular lipid ROS level and iron concentration. Hepcidin could prevent erastin-induced ferroptosis by degrading Fpn. Erastin (5 μg/mL) was observed to induce ferroptosis in neuroblastoma cells at 6 hours, which was promoted by knockdown of Fpn. The expression of Fpn gene and protein was decreased in SH-SY5Y cells treated with erastin. After treatment with erastin, Fpn siRNA transfection in SH-SY5Y cells was able to accelerate ferroptosis-associated phenotypic changes. Fpn acted as a negative regulator of ferroptosis by reducing intracellular iron concentration. Knockdown of Fpn enhanced anticancer activity of erastin. These results suggested that knockdown of Fpn accelerated erastin-induced ferroptosis by increasing iron-dependent lipid ROS accumulation, highlighting Fpn as a potential therapeutic target site for neuroblastoma. Thus, Fpn inhibitors may provide new access for chemosensitization of neuroblastoma.

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

PubMed

Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

2018-06-01

The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior

PubMed Central

Hermanstyne, Tracey O.; Mellor, Rebecca L.

2017-01-01

Abstract Rapidly activating and inactivating A-type K+ currents (IA) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly (p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). IA was also significantly (p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and IA was larger at night. In addition, Kv4.1-targeted shRNA expression significantly (p < 0.001) increased mean ± SEM nighttime input resistance (Rin; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly (p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded IA channels in regulating circadian rhythms in neuronal excitability and behavior. PMID:28560311

Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior.

PubMed

Hermanstyne, Tracey O; Granados-Fuentes, Daniel; Mellor, Rebecca L; Herzog, Erik D; Nerbonne, Jeanne M

2017-01-01

Rapidly activating and inactivating A-type K + currents (I A ) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly ( p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). I A was also significantly ( p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and I A was larger at night. In addition, Kv4.1-targeted shRNA expression significantly ( p < 0.001) increased mean ± SEM nighttime input resistance (R in ; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly ( p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded I A channels in regulating circadian rhythms in neuronal excitability and behavior.

Catalytic in vivo protein knockdown by small-molecule PROTACs

PubMed Central

Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M

2015-01-01

The current predominant theapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target’s ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522

Role of G-protein-coupled receptor-related genes in insecticide resistance of the mosquito, Culex quinquefasciatus.

PubMed

Li, Ting; Liu, Lena; Zhang, Lee; Liu, Nannan

2014-09-29

G-protein-coupled receptors regulate signal transduction pathways and play diverse and pivotal roles in the physiology of insects, however, the precise function of GPCRs in insecticide resistance remains unclear. Using quantitative RT-PCR and functional genomic methods, we, for the first time, explored the function of GPCRs and GPCR-related genes in insecticide resistance of mosquitoes, Culex quinquefasciatus. A comparison of the expression of 115 GPCR-related genes at a whole genome level between resistant and susceptible Culex mosquitoes identified one and three GPCR-related genes that were up-regulated in highly resistant Culex mosquito strains, HAmCq(G8) and MAmCq(G6), respectively. To characterize the function of these up-regulated GPCR-related genes in resistance, the up-regulated GPCR-related genes were knockdown in HAmCq(G8) and MAmCq(G6) using RNAi technique. Knockdown of these four GPCR-related genes not only decreased resistance of the mosquitoes to permethrin but also repressed the expression of four insecticide resistance-related P450 genes, suggesting the role of GPCR-related genes in resistance is involved in the regulation of resistance P450 gene expression. This results help in understanding of molecular regulation of resistance development in Cx. quinquefasciatus.

Knockdown of human serine/threonine kinase 33 suppresses human small cell lung carcinoma by blocking RPS6/BAD signaling transduction.

PubMed

Sun, E L; Liu, C X; Ma, Z X; Mou, X Y; Mu, X A; Ni, Y H; Li, X L; Zhang, D; Ju, Y R

2017-01-01

Small cell lung cancer (SCLC) is characterized by rapid growth rate and a tendency to metastasize to distinct sites of patients' bodies. The human serine/threonine kinase 33 (STK33) gene has shown its potency as a therapeutic target for prevention of lung carcinomas including non-small cell lung cancer (NSCLC), but its function in the oncogenesis and development of SCLC remains unrevealed. In the current study, it was hypothesized that STK33 played a key role in the proliferation, survival, and invasion of SCLC cells. The expression of STK33 in human SCLC cell lines NCI-H466 and DMS153 was inhibited by specific shRNA. The cell proliferation, cell apoptosis, and cell invasion of the cells were assessed with a series of in vitro assays. To explore the mechanism through which STK33 gene exerted its function in the carcinogenesis of SCLC cells, the effect of STK33 knockdown on the activity of S6K1/RPS6/BAD signaling was detected. Then the results were further confirmed with STK33 inhibitor ML281 and in vivo assays. The results demonstrated that inhibition of STK33 in SCLC cells suppressed the cell proliferation and invasion while induced cell apoptosis. Associated with the change in the phenotypic features, knockdown of STK33 also decreased the phosphorylation of RPS6 and BAD while increased the expression of cleaved caspase 9, indicating that apoptosis induced by STK33 suppression was mediated via mitochondrial pathway. Similar to the results of STK33 knockdown, incubating NCI-H466 cells with STK33 inhibitor also reduced the cell viability by suppressing RPS6/BAD pathways. Additionally, STK33 knockdown also inhibited tumor growth and RPS6/BAD activity in mice models. Findings outlined in our study were different from that in NSCLC to some extent: knockdown of STK33 in SCLC cells induced the apoptosis through mitochondrial pathway but independent of S6K1 function, inferring that the function of STK33 might be cancer type specific.

Analyses of interactions among pair-rule genes and the gap gene Krüppel in Bombyx segmentation.

PubMed

Nakao, Hajime

2015-09-01

In the short-germ insect Tribolium, a pair-rule gene circuit consisting of the Tribolium homologs of even-skipped, runt, and odd-skipped (Tc-eve, Tc-run and Tc-odd, respectively) has been implicated in segment formation. To examine the application of the model to other taxa, I studied the expression and function of pair-rule genes in Bombyx mori, together with a Bombyx homolog of Krüppel (Bm-Kr), a known gap gene. Knockdown embryos of Bombyx homologs of eve, run and odd (Bm-eve, Bm-run and Bm-odd) exhibited asegmental phenotypes similar to those of Tribolium knockdowns. However, pair-rule gene interactions were similar to those of both Tribolium and Drosophila, which, different from Tribolium, shows a hierarchical segmentation mode. Additionally, the Bm-odd expression pattern shares characteristics with those of Drosophila pair-rule genes that receive upstream regulatory input. On the other hand, Bm-Kr knockdowns exhibited a large posterior segment deletion as observed in short-germ insects. However, a detailed analysis of these embryos indicated that Bm-Kr modulates expression of pair-rule genes like in Drosophila, although the mechanisms appear to be different. This suggested hierarchical interactions between Bm-Kr and pair-rule genes. Based on these results, I concluded that the pair-rule gene circuit model that describes Tribolium development is not applicable to Bombyx. Copyright © 2015 Elsevier Inc. All rights reserved.

Knockdown of TNF-α by DNAzyme Gold Nanoparticles as an Anti-inflammatory Therapy for Myocardial Infarction

PubMed Central

Somasuntharam, Inthirai; Yehl, Kevin; Carroll, Sheridan L.; Maxwell, Joshua T.; Martinez, Mario D.; Che, Pao-Lin; Brown, Milton E.; Salaita, Khalid; Davis, Michael E.

2017-01-01

In this study, we used deoxyribozyme (DNAzyme) functionalized gold nanoparticles (AuNPs) to catalytically silence tumor necrosis factor-α (TNF-α) in vivo as a potential therapeutic for myocardial infarction (MI). Using primary macrophages as a model, we demonstrated 50% knockdown of TNF-α, which was not attainable using Lipofectamine-based approaches. Local injection of DNAzyme conjugated to gold particles (AuNPs) in the rat myocardium yielded TNF-α knockdown efficiencies of 50%, which resulted in significant anti-inflammatory effects and improvement in acute cardiac function following MI. Our results represent the first example showing the use of DNAzyme AuNP conjugates in vivo for viable delivery and gene regulation. This is significant as TNF-α is a multibillion dollar drug target implicated in many inflammatory-mediated disorders, thus underscoring the potential impact of DNAzyme-conjugated AuNPs. PMID:26773660

Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia.

PubMed

Hamid, Penny Humaidah; Prastowo, Joko; Widyasari, Anis; Taubert, Anja; Hermosilla, Carlos

2017-06-05

Aedes aegypti is the main vector of several arthropod-borne viral infections in the tropics profoundly affecting humans, such as dengue fever (DF), West Nile (WN), chikungunya and more recently Zika. Eradication of Aedes still largely depends on insecticides, which is the most cost-effective strategy, and often inefficient due to resistance development in exposed Aedes populations. We here conducted a study of Ae. aegypti resistance towards several insecticides regularly used in the city of Denpasar, Bali, Indonesia. Aedes aegypti egg samples were collected with ovitraps and thereafter hatched in the insectary of the Gadjah Mada University. The F0 generation was used for all bioassay-related experiments and knockdown resistance (kdr) assays. Results clearly showed resistance development of Ae. aegypti against tested insecticides. Mortalities of Ae. aegypti were less than 90% with highest resistance observed against 0.75% permethrin. Mosquitoes from the southern parts of Denpasar presented high level of resistance pattern in comparison to those from the western and northern parts of Denpasar. Kdr analysis of voltage-gated sodium channel (Vgsc) gene showed significant association to S989P and V1016G mutations linked to resistance phenotypes against 0.75% permethrin. Conversely, Ae. aegypti F1534C gene mutation did not result in any significant correlation to resistance development. Periodically surveillance of insecticide resistances in Ae. aegypti mosquitoes will help local public health authorities to set better goals and allow proper evaluation of on-going mosquito control strategies. Initial detection of insecticide resistance will contribute to conduct proper actions in delaying mosquito resistance development such as insecticide rotation or combination of compounds in order to prolong chemical efficacy in combating Ae. aegypti vectors in Indonesia.

Knockdown of angiopoietin-like 2 mimics the benefits of intermittent fasting on insulin responsiveness and weight loss.

PubMed

Martel, Cécile; Pinçon, Anthony; Bélanger, Alexandre Maxime; Luo, Xiaoyan; Gillis, Marc-Antoine; de Montgolfier, Olivia; Thorin-Trescases, Nathalie; Thorin, Éric

2018-01-01

Angiopoietin-like 2 (ANGPTL2) is an inflammatory adipokine linking obesity to insulin resistance. Intermittent fasting, on the other hand, is a lifestyle intervention able to prevent obesity and diabetes but difficult to implement and maintain. Our objectives were to characterize a link between ANGPTL2 and intermittent fasting and to investigate whether the knockdown of ANGPTL2 reproduces the benefits of intermittent fasting on weight gain and insulin responsiveness in knockdown and wild-type littermates mice. Intermittent fasting, access to food ad libitum once every other day, was initiated at the age of three months and maintained for four months. Intermittent fasting decreased by 63% (p < 0.05) gene expression of angptl2 in adipose tissue of wild-type mice. As expected, intermittent fasting improved insulin sensitivity (p < 0.05) and limited weight gain (p < 0.05) in wild-type mice. Knockdown mice fed ad libitum, however, were comparable to wild-type mice following the intermittent fasting regimen: insulin sensitivity and weight gain were identical, while intermittent fasting had no additional impact on these parameters in knockdown mice. Energy intake was similar between both wild-type fed intermittent fasting and ANGPTL2 knockdown mice fed ad libitum, suggesting that intermittent fasting and knockdown of ANGPTL2 equally lower feeding efficiency. These results suggest that the reduction of ANGPTL2 could be a useful and promising strategy to prevent obesity and insulin resistance, although further investigation of the mechanisms linking ANGPTL2 and intermittent fasting is warranted. Impact statement Intermittent fasting is an efficient diet pattern to prevent weight gain and improve insulin sensitivity. It is, however, a difficult regimen to follow and compliance is expected to be very low. In this work, we demonstrate that knockdown of ANGPTL2 in mice fed ad libitum mimics the beneficial effects of intermittent fasting on weight gain and insulin

Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells.

PubMed

Yunoki, Tatsuya; Tabuchi, Yoshiaki; Hayashi, Atsushi; Kondo, Takashi

2016-07-01

BCL2-associated athanogene 3 (BAG3), a co-chaperone of the heat shock 70 kDa protein (HSPA) family of proteins, is a cytoprotective protein that acts against various stresses, including heat stress. The aim of the present study was to identify gene networks involved in the enhancement of hyperthermia (HT) sensitivity by the knockdown (KD) of BAG3 in human oral squamous cell carcinoma (OSCC) cells. Although a marked elevation in the protein expression of BAG3 was detected in human the OSCC HSC-3 cells exposed to HT at 44˚C for 90 min, its expression was almost completely suppressed in the cells transfected with small interfering RNA against BAG3 (siBAG) under normal and HT conditions. The silencing of BAG3 also enhanced the cell death that was increased in the HSC-3 cells by exposure to HT. Global gene expression analysis revealed many genes that were differentially expressed by >2-fold in the cells exposed to HT and transfected with siBAG. Moreover, Ingenuity® pathways analysis demonstrated two unique gene networks, designated as Pro-cell death and Anti-cell death, which were obtained from upregulated genes and were mainly associated with the biological functions of induction and the prevention of cell death, respectively. Of note, the expression levels of genes in the Pro-cell death and Anti-cell death gene networks were significantly elevated and reduced in the HT + BAG3-KD group compared to those in the HT control group, respectively. These results provide further insight into the molecular mechanisms involved in the enhancement of HT sensitivity by the silencing of BAG3 in human OSCC cells.

Stable Toll-Like Receptor 10 Knockdown in THP-1 Cells Reduces TLR-Ligand-Induced Proinflammatory Cytokine Expression.

PubMed

Le, Hai Van; Kim, Jae Young

2016-06-01

Toll-like receptor 10 (TLR10) is the only orphan receptor whose natural ligand and function are unknown among the 10 human TLRs. In this study, to test whether TLR10 recognizes some known TLR ligands, we established a stable TLR10 knockdown human monocytic cell line THP-1 using TLR10 short hairpin RNA lentiviral particle and puromycin selection. Among 60 TLR10 knockdown clones that were derived from each single transduced cell, six clones were randomly selected, and then one of those clones, named E7, was chosen for the functional study. E7 exhibited approximately 50% inhibition of TLR10 mRNA and protein expression. Of all the TLRs, only the expression of TLR10 changed significantly in this cell line. Additionally, phorbol 12-myristate 13-acetate-induced macrophage differentiation of TLR10 knockdown cells was not affected in the knockdown cells. When exposed to TLR ligands, such as synthetic diacylated lipoprotein (FSL-1), lipopolysaccharide (LPS), and flagellin, significant induction of proinflammatory cytokine gene expression including Interleukin-8 (IL-8), Interleukin-1 beta (IL-1β), Tumor necrosis factor-alpha (TNF-α) and Chemokine (C-C Motif) Ligand 20 (CCL20) expression, was found in the control THP-1 cells, whereas the TLR10 knockdown cells exhibited a significant reduction in the expression of IL-8, IL-1β, and CCL20. TNF-α was the only cytokine for which the expression did not decrease in the TLR10 knockdown cells from that measured in the control cells. Analysis of putative binding sites for transcription factors using a binding-site-prediction program revealed that the TNF-α promoter does not have putative binding sites for AP-1 or c-Jun, comprising a major transcription factor along with NF-κB for TLR signaling. Our results suggest that TLR10 is involved in the recognition of FSL-1, LPS, and flagellin and TLR-ligand-induced expression of TNF-α does not depend on TLR10.

PhotoMorphs™: A Novel Light-Activated Reagent for Controlling Gene Expression in Zebrafish

PubMed Central

Tomasini, Amber J.; Schuler, Aaron D.; Zebala, John A.; Mayer, Alan N.

2009-01-01

Manipulating gene expression in zebrafish is critical for exploiting the full potential of this vertebrate model organism. Morpholino oligos are the most commonly employed antisense technology for knocking down gene expression. However, morpholinos suffer from a lack of control over the timing and location of knockdown. In this report, we describe a novel light-activatable knockdown reagent called PhotoMorph™. PhotoMorphs can be generated from existing morpholinos by hybridization with a complementary caging strand containing a photocleavable linkage. The caging strand neutralizes the morpholino activity until irradiation of the PhotoMorph with UV light releases the morpholino. We generated PhotoMorphs to target genes encoding enhanced green fluorescent protein (EGFP), No tail, and E-cadherin to illustrate the utility of this approach. Temporal control of gene expression with PhotoMorphs permitted us to circumvent the early lethal phenotype of E-cadherin knockdown. A splice-blocking PhotoMorph directed to the rheb gene showed light-dependent gene knockdown up to 72 hpf. PhotoMorphs thus offer a new class of laboratory reagents suitable for the spatiotemporal control of gene expression in the zebrafish. PMID:19644983

Neuron-specific knockdown of Drosophila PDHB induces reduction of lifespan, deficient locomotive ability, abnormal morphology of motor neuron terminals and photoreceptor axon targeting.

PubMed

Dung, Vuu My; Suong, Dang Ngoc Anh; Okamaoto, Yuji; Hiramatsu, Yu; Thao, Dang Thi Phuong; Yoshida, Hideki; Takashima, Hiroshi; Yamaguchi, Masamitsu

2018-05-15

Pyruvate dehydrogenase complex deficiency (PDCD) is a common primary cause of defects in mitochondrial function and also can lead to peripheral neuropathy. Pyruvate dehydrogenase E1 component subunit beta (PDHB) is a subunit of pyruvate dehydrogenase E1, which is a well-known component of PDC. In Drosophila melanogaster, the CG11876 (dPDHB) gene is a homolog of human PDHB. In this study, we established a Drosophila model with neuron-specific knockdown of dPDHB to investigate its role in neuropathy pathogenesis. Knockdown of dPDHB in pan-neurons induced locomotor defects in both larval and adult stages, which were consistent with abnormal morphology of the motor neuron terminals at neuromuscular junctions and mitochondrial fragmentation in brains. Moreover, neuron-specific knockdown of dPDHB also shortened the lifespan of adult flies. In addition, flies with knockdown of dPDHB manifested a rough eye phenotype and aberrant photoreceptor axon targeting. These results with the Drosophila model suggest the involvement of PDHB in peripheral neuropathy. Copyright © 2018 Elsevier Inc. All rights reserved.

deGradFP: A System to Knockdown GFP-Tagged Proteins.

PubMed

Caussinus, Emmanuel; Affolter, Markus

2016-01-01

Protein depletion by genetic means, in a very general sense including the use of RNA interference [1, 2] or CRISPR/Cas9-based methods, represents a central paradigm of modern biology to study protein functions in vivo. However, acting upstream the proteic level is a limiting factor if the turnover of the target protein is slow or the existing pool of the target protein is important (for instance, in insect embryos, as a consequence of a strong maternal contribution). In order to circumvent these problems, we developed deGradFP [3, 4]. deGradFP harnesses the ubiquitin-proteasome pathway to achieve direct depletion of GFP-tagged proteins. deGradFP is in essence a universal method because it relies on an evolutionarily conserved machinery for protein catabolism in eukaryotic cells; see refs. 5, 6 for review. deGradFP is particularly convenient in Drosophila melanogaster where it is implemented by a genetically encoded effector expressed under the control of the Gal4 system. deGradFP is a ready-to-use solution to perform knockdowns at the protein level if a fly line carrying a functional GFP-tagged version of the gene of interest is available. Many such lines have already been generated by the Drosophila community through different technologies allowing to make genomic rescue constructs or direct GFP knockins: protein-trap stock collections [7, 8] ( http://cooley.medicine.yale.edu/flytrap/ , http://www.flyprot.org/ ), P[acman] system [9], MiMIC lines [10, 11], and CRISPR/Cas9-driven homologous recombination.Two essential controls of a protein knockdown experiment are easily achieved using deGradFP. First, the removal of the target protein can be assessed by monitoring the disappearance of the GFP tag by fluorescence microscopy in parallel to the documentation of the phenotype of the protein knockdown (see Note 1 ). Second, the potential nonspecific effects of deGradFP can be assessed in control fly lacking a GFP-tagged target protein. So far, no nonspecific effects of

Knockdown of Fruit Flies by Imidacloprid Nanoaerosol.

PubMed

Morozov, Victor N; Kanev, Igor L

2015-10-20

This report describes the effects of nanoaerosol particles (NAPs) from imidacloprid (IMI) on fruit flies. NAPs were produced using a newly developed generator which employs electro-hydrodynamic atomization of IMI solution in ethanol. Exposure of Drosophila melanogaster to the IMI NAPs at a concentration of C = 2.7 ± 0.1 ng/cm(3) caused knockdown in half of the flies in T50 = 88 ± 14 min at 22 °C and in T50 = 36 ± 2 min at 33 °C. A number of special experiments precluded IMI volatilization and contact or oral action of IMI upon exposure to the NAPs. It was shown that only the fraction of NAPs in the size range of 7-300 nm is responsible for the knockdown and that dependence of T50 on the NAPs' fraction mass follows Haber's rule, C × T50 = const. Comparison with the oral doses obtained when flies were fed an IMI-sucrose mixture revealed that the inhaled doses that caused knockdown were 2 orders of magnitude lower than the oral ones. This new technology may be used to quickly eliminate insects with nanoaerosols of nonvolatile insecticides in greenhouses and other closed environments.

PTEN knockdown alters dendritic spine/protrusion morphology, not density

PubMed Central

Haws, Michael E.; Jaramillo, Thomas C.; Espinosa-Becerra, Felipe; Widman, Allie; Stuber, Garret D.; Sparta, Dennis R.; Tye, Kay M.; Russo, Scott J.; Parada, Luis F.; Kaplitt, Michael; Bonci, Antonello; Powell, Craig M.

2014-01-01

Mutations in phosphatase and tensin homolog deleted on chromosome ten (PTEN) are implicated in neuropsychiatric disorders including autism. Previous studies report that PTEN knockdown in neurons in vivo leads to increased spine density and synaptic activity. To better characterize synaptic changes in neurons lacking PTEN, we examined the effects of shRNA knockdown of PTEN in basolateral amygdala neurons on synaptic spine density and morphology using fluorescent dye confocal imaging. Contrary to previous studies in dentate gyrus, we find that knockdown of PTEN in basolateral amygdala leads to a significant decrease in total spine density in distal dendrites. Curiously, this decreased spine density is associated with increased miniature excitatory post-synaptic current frequency and amplitude, suggesting an increase in number and function of mature spines. These seemingly contradictory findings were reconciled by spine morphology analysis demonstrating increased mushroom spine density and size with correspondingly decreased thin protrusion density at more distal segments. The same analysis of PTEN conditional deletion in dentate gyrus demonstrated that loss of PTEN does not significantly alter total density of dendritic protrusions in the dentate gyrus, but does decrease thin protrusion density and increases density of more mature mushroom spines. These findings suggest that, contrary to previous reports, PTEN knockdown may not induce de novo spinogenesis, but instead may increase synaptic activity by inducing morphological and functional maturation of spines. Furthermore, behavioral analysis of basolateral amygdala PTEN knockdown suggests that these changes limited only to the basolateral amygdala complex may not be sufficient to induce increased anxiety-related behaviors. PMID:24264880

Effects of gene knockdown of CNP on ventricular remodeling after myocardial ischemia-reperfusion injury through NPRB/Cgmp signaling pathway in rats.

PubMed

Wu, Lian-He; Zhang, Qi; Zhang, Shen; Meng, Lu-Yu; Wang, Yan-Chi; Sheng, Cun-Jian

2018-02-01

This study aimed to explore effects of CNP on ventricular remodeling following myocardial ischemia-reperfusion (I/R) injury through the NPRB/cGMP signaling pathway. Rat cardiomyocytes were assigned into: control, I/R, I/R + CNP, and I/R + 8-Br-cGMP groups. ELISA, qRT-PCR, and Western blotting were used to detect cGMP content and expression, respectively. After model establishment of I/R rats, normal control, CNP -/- control, I/R, and CNP -/- groups were set. Indexes of heart were detected using echocardiography and hemodynamics. ELISA was used to measure serum CNP, cGMP, LDH, cTn I, CK-MB, TNF-α, and IL-6 levels. Myocardial infarct was identified by TTC staining, and apoptosis conditions by TUNEL staining. QRT-PCR and Western blotting were adopted to detect expressions of CNP, NPRB, cGMP, and apoptosis-related genes. Compared with control group, cGMP contents and expression in the I/R, I/R + CNP and I/R + 8-Br-cGMP groups were decreased. Levels of LVEDV, LVESV, LVDS, LVDD, IVSD, LVM, LVEDP, and LVSP were higher in the I/R, CNP -/- control, and CNP -/- groups than normal control group while LVEF, SV, CO, and ±dp/dtmax were lower. Compared with the normal control group, LDH, cTn I, CK-MB, TNF-α, and IL-6 were higher in the I/R, CNP -/- control and CNP -/- groups; pathological changes and myocardial infarction were observed in the I/R, CNP -/- control, and CNP -/- groups; expressions of apoptosis-related genes in those groups were higher; while CNP, NPRB, cGMP, and Bcl-2 expressions were decreased. We came to the conclusion that gene knockdown of CNP blocks the NPRB/cGMP signaling pathway, thereby aggravating myocardial I/R injury and causing ventricular remodeling in rats. © 2017 Wiley Periodicals, Inc.

Knockdown of DISC1 by in utero gene transfer disturbs postnatal dopaminergic maturation in the frontal cortex and leads to adult behavioral deficits

PubMed Central

Niwa, Minae; Kamiya, Atsushi; Murai, Rina; Kubo, Ken-ichiro; Gruber, Aaron J; Tomita, Kenji; Lu, Lingling; Tomisato, Shuta; Jaaro-Peled, Hanna; Seshadri, Saurav; Hiyama, Hideki; Huang, Beverly; Kohda, Kazuhisa; Noda, Yukihiro; O’Donnell, Patricio; Nakajima, Kazunori; Sawa, Akira; Nabeshima, Toshitaka

2011-01-01

SUMMARY Adult brain function and behavior are influenced by neuronal network formation during development. Genetic susceptibility factors for adult psychiatric illnesses, such as Neuregulin-1 and Disrupted-in-Schizophrenia-1 (DISC1), influence adult high brain functions, including cognition and information processing. These factors have roles during neurodevelopment and are likely to cooperate, forming “pathways” or “signalosomes.” Here we report the potential to generate an animal model via in utero gene transfer in order to address an important question of how nonlethal deficits in early development may affect postnatal brain maturation and high brain functions in adulthood, which are impaired in various psychiatric illnesses, such as schizophrenia. We show that transient knockdown of DISC1 in the pre- and peri-natal stages, specifically in a lineage of pyramidal neurons mainly in the prefrontal cortex, leads to selective abnormalities in postnatal mesocortical dopaminergic maturation and behavioral abnormalities associated with disturbed cortical neurocircuitry after puberty. PMID:20188653

Differential Effects of Histone Acetyltransferase GCN5 or PCAF Knockdown on Urothelial Carcinoma Cells

PubMed Central

Koutsogiannouli, Evangelia A.; Hader, Christiane; Pinkerneil, Maria; Hoffmann, Michèle J.; Schulz, Wolfgang A.

2017-01-01

Disturbances in histone acetyltransferases (HATs) are common in cancers. In urothelial carcinoma (UC), p300 and CBP are often mutated, whereas the GNAT family HATs GCN5 and PCAF (General Control Nonderepressible 5, p300/CBP-Associated Factor) are often upregulated. Here, we explored the effects of specific siRNA-mediated knockdown of GCN5, PCAF or both in four UC cell lines (UCCs). Expression of various HATs and marker proteins was measured by qRT-PCR and western blot. Cellular effects of knockdowns were analyzed by flow cytometry and ATP-, caspase-, and colony forming-assays. GCN5 was regularly upregulated in UCCs, whereas PCAF was variable. Knockdown of GCN5 or both GNATs, but not of PCAF alone, diminished viability and inhibited clonogenic growth in 2/4 UCCs, inducing cell cycle changes and caspase-3/7 activity. PCAF knockdown elicited GCN5 mRNA upregulation. Double knockdown increased c-MYC and MDM2 (Mouse Double Minute 2) in most cell lines. In conclusion, GCN5 upregulation is especially common in UCCs. GCN5 knockdown impeded growth of specific UCCs, whereas PCAF knockdown elicited minor effects. The limited sensitivity towards GNAT knockdown and its variation between the cell lines might be due to compensatory effects including HAT, c-MYC and MDM2 upregulation. Our results predict that developing drugs targeting individual HATs for UC treatment may be challenging. PMID:28678170

Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

PubMed

Piras, Bryan A; O'Connor, Daniel M; French, Brent A

2013-01-01

AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

AHR2 morpholino knockdown reduces the toxicity of total particulate matter to zebrafish embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massarsky, Andrey, E-mail: andrey.massarsky@duke.e

The zebrafish embryo has been proposed as a ‘bridge model’ to study the effects of cigarette smoke on early development. Previous studies showed that exposure to total particulate matter (TPM) led to adverse effects in developing zebrafish, and suggested that the antioxidant and aryl hydrocarbon receptor (AHR) pathways play important roles. This study investigated the roles of these two pathways in mediating TPM toxicity. The study consisted of four experiments. In experiment I, zebrafish embryos were exposed from 6 h post fertilization (hpf) until 96 hpf to TPM{sub 0.5} and TPM{sub 1.0} (corresponding to 0.5 and 1.0 μg/mL equi-nicotine units)more » in the presence or absence of an antioxidant (N-acetyl cysteine/NAC) or a pro-oxidant (buthionine sulfoximine/BSO). In experiment II, TPM exposures were performed in embryos that were microinjected with nuclear factor erythroid 2-related factor 2 (Nrf2), AHR2, cytochrome P450 1A (CYP1A), or CYP1B1 morpholinos, and deformities were assessed. In experiment III, embryos were exposed to TPM, and embryos/larvae were collected at 24, 48, 72, and 96 hpf to assess several genes associated with the antioxidant and AHR pathways. Lastly, experiment IV assessed the activity and protein levels of CYP1A and CYP1B1 after exposure to TPM. We demonstrate that the incidence of TPM-induced deformities was generally not affected by NAC/BSO treatments or Nrf2 knockdown. In contrast, AHR2 knockdown reduced, while CYP1A or CYP1B1 knockdowns elevated the incidence of some deformities. Moreover, as shown by gene expression the AHR pathway, but not the antioxidant pathway, was induced in response to TPM exposure, providing further evidence for its importance in mediating TPM toxicity. - Highlights: • Total particulate matter (TPM) is the particulate phase of cigarette smoke. • Zebrafish is proposed as a ‘bridge model’ to study the effects of TPM. • We investigate the roles of antioxidant and aryl hydrocarbon receptor (AHR

Amastin Knockdown in Leishmania braziliensis Affects Parasite-Macrophage Interaction and Results in Impaired Viability of Intracellular Amastigotes.

PubMed

de Paiva, Rita Marcia Cardoso; Grazielle-Silva, Viviane; Cardoso, Mariana Santos; Nakagaki, Brenda Naemi; Mendonça-Neto, Rondon Pessoa; Canavaci, Adriana Monte Cassiano; Souza Melo, Normanda; Martinelli, Patrícia Massara; Fernandes, Ana Paula; daRocha, Wanderson Duarte; Teixeira, Santuza M R

2015-12-01

Leishmaniasis, a human parasitic disease with manifestations ranging from cutaneous ulcerations to fatal visceral infection, is caused by several Leishmania species. These protozoan parasites replicate as extracellular, flagellated promastigotes in the gut of a sandfly vector and as amastigotes inside the parasitophorous vacuole of vertebrate host macrophages. Amastins are surface glycoproteins encoded by large gene families present in the genomes of several trypanosomatids and highly expressed in the intracellular amastigote stages of Trypanosoma cruzi and Leishmania spp. Here, we showed that the genome of L. braziliensis contains 52 amastin genes belonging to all four previously described amastin subfamilies and that the expression of members of all subfamilies is upregulated in L. braziliensis amastigotes. Although primary sequence alignments showed no homology to any known protein sequence, homology searches based on secondary structure predictions indicate that amastins are related to claudins, a group of proteins that are components of eukaryotic tight junction complexes. By knocking-down the expression of δ-amastins in L. braziliensis, their essential role during infection became evident. δ-amastin knockdown parasites showed impaired growth after in vitro infection of mouse macrophages and completely failed to produce infection when inoculated in BALB/c mice, an attenuated phenotype that was reverted by the re-expression of an RNAi-resistant amastin gene. Further highlighting their essential role in host-parasite interactions, electron microscopy analyses of macrophages infected with amastin knockdown parasites showed significant alterations in the tight contact that is normally observed between the surface of wild type amastigotes and the membrane of the parasitophorous vacuole.

Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

PubMed

Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

2017-01-01

Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

Involvement of the Anopheles gambiae Nimrod gene family in mosquito immune responses.

PubMed

Estévez-Lao, Tania Y; Hillyer, Julián F

2014-01-01

Insects fight infection using a variety of signaling pathways and immune effector proteins. In Drosophila melanogaster, three members of the Nimrod gene family (draper, nimC1 and eater) bind bacteria, and this binding leads to phagocytosis by hemocytes. The Nimrod gene family has since been identified in other insects, but their function in non-drosophilids remains unknown. The purpose of this study was to identify the members of the Nimrod gene family in the malaria mosquito, Anopheles gambiae, and to assess their role in immunity. We identified and sequenced three members of this gene family, herein named draper, nimrod and eater, which are the orthologs of D. melanogaster draper, nimB2 and eater, respectively. The three genes are preferentially expressed in hemocytes and their peak developmental expression is in pupae and young adults. Infection induces the transcriptional upregulation of all three genes, but the magnitude of this upregulation becomes more attenuated as mosquitoes become older. RNAi-based knockdown of eater, but not draper or nimrod, decreased a mosquito's ability to kill Escherichia coli in the hemocoel. Knockdown of draper, eater, or any combination of Nimrod family genes rendered mosquitoes more likely to die from Staphylococcus epidermidis. Finally, knockdown of Nimrod family genes did not impact mRNA levels of the antimicrobial peptides defensin (def1), cecropin (cecA) or gambicin (gam1), but eater knockdown led to a decrease in mRNA levels of nitric oxide synthase. Together, these data show that members of the A. gambiae Nimrod gene family are positive regulators of the mosquito antibacterial response. Copyright © 2013 Elsevier Ltd. All rights reserved.

DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION

PubMed Central

LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.

2012-01-01

Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte

Biological Gene Delivery Vehicles: Beyond Viral Vectors

PubMed Central

Seow, Yiqi; Wood, Matthew J

2009-01-01

Gene therapy covers a broad spectrum of applications, from gene replacement and knockdown for genetic or acquired diseases such as cancer, to vaccination, each with different requirements for gene delivery. Viral vectors and synthetic liposomes have emerged as the vehicles of choice for many applications today, but both have limitations and risks, including complexity of production, limited packaging capacity, and unfavorable immunological features, which restrict gene therapy applications and hold back the potential for preventive gene therapy. While continuing to improve these vectors, it is important to investigate other options, particularly nonviral biological agents which include bacteria, bacteriophage, virus-like particles (VLPs), erythrocyte ghosts, and exosomes. Exploiting the natural properties of these biological entities for specific gene delivery applications will expand the repertoire of gene therapy vectors available for clinical use. Here, we review the prospects for nonviral biological delivery vehicles as gene therapy agents with focus on their unique evolved biological properties and respective limitations and potential applications. The potential of these nonviral biological entities to act as clinical gene therapy delivery vehicles has already been shown in clinical trials using bacteria-mediated gene transfer and with sufficient development, these entities will complement the established delivery techniques for gene therapy applications. PMID:19277019

Biological gene delivery vehicles: beyond viral vectors.

PubMed

Seow, Yiqi; Wood, Matthew J

2009-05-01

Gene therapy covers a broad spectrum of applications, from gene replacement and knockdown for genetic or acquired diseases such as cancer, to vaccination, each with different requirements for gene delivery. Viral vectors and synthetic liposomes have emerged as the vehicles of choice for many applications today, but both have limitations and risks, including complexity of production, limited packaging capacity, and unfavorable immunological features, which restrict gene therapy applications and hold back the potential for preventive gene therapy. While continuing to improve these vectors, it is important to investigate other options, particularly nonviral biological agents which include bacteria, bacteriophage, virus-like particles (VLPs), erythrocyte ghosts, and exosomes. Exploiting the natural properties of these biological entities for specific gene delivery applications will expand the repertoire of gene therapy vectors available for clinical use. Here, we review the prospects for nonviral biological delivery vehicles as gene therapy agents with focus on their unique evolved biological properties and respective limitations and potential applications. The potential of these nonviral biological entities to act as clinical gene therapy delivery vehicles has already been shown in clinical trials using bacteria-mediated gene transfer and with sufficient development, these entities will complement the established delivery techniques for gene therapy applications.

Functional analysis of sex-determination genes by gene silencing with LNA-DNA gapmers in the silkworm, Bombyx mori.

PubMed

Sakai, Hiroki; Sakaguchi, Honami; Aoki, Fugaku; Suzuki, Masataka G

2015-08-01

The sexual fate of B. mori is determined genetically; ZW, female and ZZ, male. Recently, we successfully identified a strong candidate gene at the top of the sex determination cascade in B. mori. This gene was termed Feminizer (Fem) and revealed to be a source of Fem-piRNA. Further, we found that B. mori doublesex (Bmdsx) splicing was markedly altered to produce the male-type isoform when a Fem-piRNA inhibitor was injected into ZW embryos. Moreover, knockdown of Masculinizer (Masc), a Fem-piRNA target gene, altered to produce the female-type isoform of Bmdsx in male embryos. However, it remains unclear as to whether Masc directly regulates the sex-specific expression of Bmdsx. In previous studies, we determined that the male-specific isoform of the Bombyx homolog of IGF-II mRNA-binding protein (Imp(M)) was involved in the male-specific splicing of Bmdsx. In an attempt to clarify the genetic relationship between Fem, Masc, Imp(M), and Bmdsx, knockdown experiments were performed. Knockdown of Fem shifted into male-type Bmdsx, Imp(M) and Masc in female embryos. Knockdown of Masc led to the production of the female-type Bmdsx and a dramatic reduction in Imp(M) expression in male embryos. Knockdown of Imp(M) shifted Bmdsx splice mode from the male-type into the female-type. Our results suggest that: (1) Fem reduces Masc expression, (2) Masc dramatically induces Imp(M) expression, and (3) Imp(M) shifting Bmdsx splice mode from the female-type into the male-type. Based on these findings, we propose a possible genetic cascade regulating sex determination in B. mori. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

[siRNA-mediated tissue factor knockdown in porcine neonatal islet cell clusters in vitro].

PubMed

Ji, Ming; Yi, Shounan; Yu, Deling; Wang, Wei

2011-12-01

To determine the genetic modification on neonatal porcine islet cell clusters (NICC) by small interfering RNA (siRNA)-mediated tissue factor (TF) knockdown in vitro. Porcine NICC were transfected with 5 pairs of designed siRNA respectively or in different combinations with lipofectamine 2000. Transfected NICC were analyzed for TF gene by real-time PCR to select the siRNA which worked best. Meanwhile, the viability of NICC after the TF siRNA transfection was examined by FACS. The efficiency of TF gene and protein suppression was measured by real-time PCR and and FACS respectively. Real-time PCR and FACS showed that a 60% reduction in the TF gene expression and a 50% reduction in the protien level of TF on NICC were achieved by transfecting 3 pairs of selected siRNA. The siRNA transfection had no significant effect on the viability of NICC which was analyzed by FACS. The expression of TF on porcine NICC is efficiently suppressed by 3 pairs of designed siRNA in vitro.

Knockdown of RhoA expression alters ovarian cancer biological behavior in vitro and in nude mice.

PubMed

Wang, Xiaoxia; Jiang, Wenyan; Kang, Jiali; Liu, Qicai; Nie, Miaoling

2015-08-01

RhoA regulates cell proliferation, migration, angiogenesis and gene expression. Altered RhoA activity contributes to cancer progression. The present study investigated the effects of RhoA knockdown on the regulation of ovarian cancer biological behavior in vitro and in nude mice. The expression of RhoA was knocked down using a lentivirus carrying RhoA short hairpin RNA (shRNA) in ovarian cancer cells and was confirmed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The altered ovarian cancer biological behaviors were assayed by cell viability, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling (TUNEL), migration, invasion, and nude mice tumorigenicity assays, while the altered gene expression was detected by RT-qPCR and western blot analysis. The results showed that lentivirus-carrying RhoA shRNA significantly suppressed RhoA expression in ovarian cancer cells, which suppressed tumor cell viability, migration, invasion and adhesion in vitro. RhoA silencing also inhibited the tumorigenicity of ovarian cancer cells in nude mice, which was characterized by the suppression of tumor xenograft formation and growth and induction of tumor cell apoptosis. The results of the present study demonstrated that knockdown of RhoA expression had a significant antitumor effect on ovarian cancer cells in vitro and in nude mice, suggesting that RhoA may be a target for the development of a novel therapeutic strategy in the control of ovarian cancer.

tCRISPRi: tunable and reversible, one-step control of gene expression

NASA Astrophysics Data System (ADS)

Li, Xin-Tian; Jun, Yonggun; Erickstad, Michael J.; Brown, Steven D.; Parks, Adam; Court, Donald L.; Jun, Suckjoon

2016-12-01

The ability to control the level of gene expression is a major quest in biology. A widely used approach employs deletion of a nonessential gene of interest (knockout), or multi-step recombineering to move a gene of interest under a repressible promoter (knockdown). However, these genetic methods are laborious, and limited for quantitative study. Here, we report a tunable CRISPR-cas system, “tCRISPRi”, for precise and continuous titration of gene expression by more than 30-fold. Our tCRISPRi system employs various previous advancements into a single strain: (1) We constructed a new strain containing a tunable arabinose operon promoter PBAD to quantitatively control the expression of CRISPR-(d)Cas protein over two orders of magnitude in a plasmid-free system. (2) tCRISPRi is reversible, and gene expression is repressed under knockdown conditions. (3) tCRISPRi shows significantly less than 10% leaky expression. (4) Most important from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step of oligo recombineering. Our results show that tCRISPRi, in combination with recombineering, provides a simple and easy-to-implement tool for gene expression control, and is ideally suited for construction of both individual strains and high-throughput tunable knockdown libraries.

5-HT2C Receptor Knockdown in the Amygdala Inhibits Neuropathic-Pain-Related Plasticity and Behaviors.

PubMed

Ji, Guangchen; Zhang, Wei; Mahimainathan, Lenin; Narasimhan, Madhusudhanan; Kiritoshi, Takaki; Fan, Xiuzhen; Wang, Jigong; Green, Thomas A; Neugebauer, Volker

2017-02-08

animal model of neuropathic pain. Specifically, an integrative approach of gene transfer, systems and brain slice electrophysiology, behavior, and immunohistochemistry was used to advance the novel concept that serotonin receptor subtype 5-HT 2C contributes critically to the imbalance between excitatory and inhibitory drive of amygdala output neurons. Local viral vector-mediated 5-HT 2C R knockdown in the amygdala normalizes the imbalance, decreases neuronal activity, and inhibits neuropathic-pain-related behaviors. The study provides valuable insight into serotonin receptor (dys)function in a limbic brain area. Copyright © 2017 the authors 0270-6474/17/371378-16$15.00/0.

Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei

2014-10-10

Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less

Molecular genetic techniques for gene manipulation in Candida albicans.

PubMed

Xu, Qiu-Rong; Yan, Lan; Lv, Quan-Zhen; Zhou, Mi; Sui, Xue; Cao, Yong-Bing; Jiang, Yuan-Ying

2014-05-15

Candida albicans is one of the most common fungal pathogen in humans due to its high frequency as an opportunistic and pathogenic fungus causing superficial as well as invasive infections in immunocompromised patients. An understanding of gene function in C. albicans is necessary to study the molecular basis of its pathogenesis, virulence and drug resistance. Several manipulation techniques have been used for investigation of gene function in C. albicans, including gene disruption, controlled gene expression, protein tagging, gene reintegration, and overexpression. In this review, the main cassettes containing selectable markers used for gene manipulation in C. albicans are summarized; the advantages and limitations of these cassettes are discussed concerning the influences on the target gene expression and the virulence of the mutant strains.

Knockdown of Mediator Complex Subunit 19 Suppresses the Growth and Invasion of Prostate Cancer Cells

PubMed Central

Zhao, Hongwei; Lv, Wei; Chen, Jian; Wan, Fengchun; Liu, Dongfu; Gao, Zhenli; Wu, Jitao

2017-01-01

Prostate cancer (PCa) is one of the most common cancers in elderly men. Mediator Complex Subunit 19 (Med19) is overexpressed and plays promotional roles in many cancers. However, the roles of Med19 in PCa are still obscure. In this study, by using immunohistochemical staining, we found higher expression level of Med19 in PCa tissues than in adjacent benign prostate tissues. We then knocked down the Med19 expression in PCa cell lines LNCaP and PC3 by using lentivirus siRNA. Cell proliferation, anchor-independent growth, migration, and invasion were suppressed in Med19 knockdown PCa cells. In nude mice xenograft model, we found that Med19 knockdown PCa cells formed smaller tumors with lower proliferation index than did control cells. In the mechanism study, we found that Med19 could regulate genes involved in cell proliferation, cell cycle, and epithelial-mesenchymal transition, including P27, pAKT, pPI3K, IGF1R, E-Cadherin, N-Cadherin, Vimentin, ZEB2, Snail-1 and Snail-2. Targeting Med19 in PCa cells could inhibit the PCa growth and metastasis, and might be a therapeutic option for PCa in the future. PMID:28125713

Reducing AsA leads to leaf lesion and defence response in knock-down of the AsA biosynthetic enzyme GDP-D-mannose pyrophosphorylase gene in tomato plant.

PubMed

Zhang, Chanjuan; Ouyang, Bo; Yang, Changxian; Zhang, Xiaohui; Liu, Hui; Zhang, Yuyang; Zhang, Junhong; Li, Hanxia; Ye, Zhibiao

2013-01-01

As a vital antioxidant, L-ascorbic acid (AsA) affects diverse biological processes in higher plants. Lack of AsA in cell impairs plant development. In the present study, we manipulated a gene of GDP-mannose pyrophosphorylase which catalyzes the conversion of D-mannose-1-P to GDP-D-mannose in AsA biosynthetic pathway and found out the phenotype alteration of tomato. In the tomato genome, there are four members of GMP gene family and they constitutively expressed in various tissues in distinct expression patterns. As expected, over-expression of SlGMP3 increased total AsA contents and enhanced the tolerance to oxidative stress in tomato. On the contrary, knock-down of SlGMP3 significantly decreased AsA contents below the threshold level and altered the phenotype of tomato plants with lesions and further senescence. Further analysis indicated the causes for this symptom could result from failing to instantly deplete the reactive oxygen species (ROS) as decline of free radical scavenging activity. More ROS accumulated in the leaves and then triggered expressions of defence-related genes and mimic symptom occurred on the leaves similar to hypersensitive responses against pathogens. Consequently, the photosynthesis of leaves was dramatically fallen. These results suggested the vital roles of AsA as an antioxidant in leaf function and defence response of tomato.

Knockdown and replacement therapy mediated by artificial mirtrons in spinocerebellar ataxia 7

PubMed Central

Curtis, Helen J.; Wood, Matthew J.A.

2017-01-01

Abstract We evaluate a knockdown-replacement strategy mediated by mirtrons as an alternative to allele-specific silencing using spinocerebellar ataxia 7 (SCA7) as a model. Mirtrons are introns that form pre-microRNA hairpins after splicing, producing RNAi effectors not processed by Drosha. Mirtron mimics may therefore avoid saturation of the canonical processing pathway. This method combines gene silencing mediated by an artificial mirtron with delivery of a functional copy of the gene such that both elements of the therapy are always expressed concurrently, minimizing the potential for undesirable effects and preserving wild-type function. This mutation- and single nucleotide polymorphism-independent method could be crucial in dominant diseases that feature both gain- and loss-of-function pathologies or have a heterogeneous genetic background. Here we develop mirtrons against ataxin 7 with silencing efficacy comparable to shRNAs, and introduce silent mutations into an ataxin 7 transgene such that it is resistant to their effect. We successfully express the transgene and one mirtron together from a single construct. Hence, we show that this method can be used to silence the endogenous allele of ataxin 7 and replace it with an exogenous copy of the gene, highlighting the efficacy and transferability across patient genotypes of this approach. PMID:28575281

Microinjection-based RNA interference knockdown of ecdysteroid biosynthetic genes in a non-model hemipteran pest, Lygus hesperus (western tarnished plant bug)

USDA-ARS?s Scientific Manuscript database

RNAi-mediated knockdown of target transcripts offers great potential, both in terms of insect functional genomics and the development of novel insect pest management strategies. Frequently, dsRNAs targeting transcripts of interest are introduced orally to the target organism via feeding. This delive...

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer.

PubMed

Choi, Sul Ki; Kim, Hoe Suk; Jin, Tiefeng; Moon, Woo Kyung

2017-02-14

Lysyl oxidase (LOX) family genes catalyze collagen cross-link formation. To determine the effects of lysyl oxidase-like 4 (LOXL4) expression on breast tumor formation and metastasis, we evaluated primary tumor growth and lung metastasis in mice injected with LOXL4-knockdown MDA-MB-231 triple-negative human breast cancer cells. In addition, we analyzed overall survival in breast cancer patients based on LOXL4 expression using a public online database. In the mouse xenograft model, LOXL4 knockdown increased primary tumor growth and lung colonization as well as collagen I and IV, lysine hydroxylase 1 and 2, and prolyl 4-hydroxylase subunit alpha 1 and 2 levels. Second harmonic generation imaging revealed that LOXL4 knockdown resulted in the thickening of collagen bundles within tumors. In addition, weak LOXL4 expression was associated with poor overall survival in breast cancer patients from the BreastMark dataset, and this association was strongest in triple-negative breast cancer patients. These results demonstrate that weak LOXL4 expression leads to remodeling of the extracellular matrix through induction of collagen synthesis, deposition, and structural changes. These alterations in turn promote tumor growth and metastasis and are associated with poor clinical outcomes in triple-negative breast cancer.

Conditional knockdown of BCL2A1 reveals rate-limiting roles in BCR-dependent B-cell survival

PubMed Central

Sochalska, M; Ottina, E; Tuzlak, S; Herzog, S; Herold, M; Villunger, A

2016-01-01

Bcl2 family proteins control mitochondrial apoptosis and its members exert critical cell type and differentiation stage-specific functions, acting as barriers against autoimmunity or transformation. Anti-apoptotic Bcl2a1/Bfl1/A1 is frequently deregulated in different types of blood cancers in humans but its physiological role is poorly understood as quadruplication of the Bcl2a1 gene locus in mice hampers conventional gene targeting strategies. Transgenic overexpression of A1, deletion of the A1-a paralogue or constitutive knockdown in the hematopoietic compartment of mice by RNAi suggested rate-limiting roles in lymphocyte development, granulopoiesis and mast cell activation. Here we report on the consequences of conditional knockdown of A1 protein expression using a reverse transactivator (rtTA)-driven approach that highlights a critical role for this Bcl2 family member in the maintenance of mature B-cell homeostasis. Furthermore, we define the A1/Bim (Bcl-2 interacting mediator of cell death) axis as a target of key kinases mediating B-cell receptor (BCR)-dependent survival signals, such as, spleen tyrosine kinase (Syk) and Brutons tyrosine kinase (Btk). As such, A1 represents a putative target for the treatment of B-cell-related pathologies depending on hyperactivation of BCR-emanating survival signals and loss of A1 expression accounts, in part, for the pro-apoptotic effects of Syk- or Btk inhibitors that rely on the ‘BH3-only' protein Bim for cell killing. PMID:26450454

Knockdown of metallothionein 1 and 2 does not affect atrophy or oxidant activity in a novel in vitro model.

PubMed

Hyldahl, Robert D; O'Fallon, Kevin S; Schwartz, Lawrence M; Clarkson, Priscilla M

2010-11-01

Skeletal muscle atrophy is a significant health problem that results in decreased muscle size and function and has been associated with increases in oxidative stress. The molecular mechanisms that regulate muscle atrophy, however, are largely unknown. The metallothioneins (MT), a family of genes with antioxidant properties, have been found to be consistently upregulated during muscle atrophy, although their function during muscle atrophy is unknown. Therefore, we hypothesized that MT knockdown would result in greater oxidative stress and an enhanced atrophy response in C(2)C(12) myotubes subjected to serum reduction (SR), a novel atrophy-inducing stimulus. Forty-eight hours before SR, myotubes were transfected with small interfering RNA (siRNA) sequences designed to decrease MT expression. Muscle atrophy and oxidative stress were then measured at baseline and for 72 h following SR. Muscle atrophy was quantified by immunocytochemistry and myotube diameter measurements. Oxidative stress was measured using the fluorescent probe 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein. SR resulted in a significant increase in oxidative stress and a decrease in myotube size and protein content. However, there were no differences observed in the extent of muscle atrophy or oxidant activity following MT knockdown. We therefore conclude that the novel SR model results in a strong atrophy response and an increase in oxidant activity in cultured myotubes and that knockdown of MT does not affect that response.

In Situ Gene Therapy via AAV-CRISPR-Cas9-Mediated Targeted Gene Regulation.

PubMed

Moreno, Ana M; Fu, Xin; Zhu, Jie; Katrekar, Dhruva; Shih, Yu-Ru V; Marlett, John; Cabotaje, Jessica; Tat, Jasmine; Naughton, John; Lisowski, Leszek; Varghese, Shyni; Zhang, Kang; Mali, Prashant

2018-04-25

Development of efficacious in vivo delivery platforms for CRISPR-Cas9-based epigenome engineering will be critical to enable the ability to target human diseases without permanent modification of the genome. Toward this, we utilized split-Cas9 systems to develop a modular adeno-associated viral (AAV) vector platform for CRISPR-Cas9 delivery to enable the full spectrum of targeted in situ gene regulation functionalities, demonstrating robust transcriptional repression (up to 80%) and activation (up to 6-fold) of target genes in cell culture and mice. We also applied our platform for targeted in vivo gene-repression-mediated gene therapy for retinitis pigmentosa. Specifically, we engineered targeted repression of Nrl, a master regulator of rod photoreceptor determination, and demonstrated Nrl knockdown mediates in situ reprogramming of rod cells into cone-like cells that are resistant to retinitis pigmentosa-specific mutations, with concomitant prevention of secondary cone loss. Furthermore, we benchmarked our results from Nrl knockdown with those from in vivo Nrl knockout via gene editing. Taken together, our AAV-CRISPR-Cas9 platform for in vivo epigenome engineering enables a robust approach to target disease in a genomically scarless and potentially reversible manner. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

ABCC6 knockdown in HepG2 cells induces a senescent-like cell phenotype.

PubMed

Miglionico, Rocchina; Ostuni, Angela; Armentano, Maria Francesca; Milella, Luigi; Crescenzi, Elvira; Carmosino, Monica; Bisaccia, Faustino

2017-01-01

Pseudoxanthoma elasticum (PXE) is characterized by progressive ectopic mineralization of elastic fibers in dermal, ocular and vascular tissues. No effective treatment exists. It is caused by inactivating mutations in the gene encoding for the ATP-binding cassette, sub-family C member 6 transporter (ABCC6), which is mainly expressed in the liver. The ABCC6 substrate (s) and the PXE pathomechanism remain unknown. Recent studies have shown that overexpression of ABCC6 in HEK293 cells results in efflux of ATP, which is rapidly converted into nucleoside monophosphates and pyrophosphate (PPi). Since the latter inhibits mineralization, it was proposed that the absence of circulating PPi in PXE patients results in the characteristic ectopic mineralization. These studies also demonstrated that the presence of ABCC6 modifies cell secretory activity and suggested that ABCC6 can change the cell phenotype. Stable ABCC6 knockdown HepG2 clones were generated using small hairpin RNA (shRNA) technology. The intracellular glutathione and ROS levels were determined. Experiments using cell cycle analysis, real-time PCR and western blot were performed on genes involved in the senescence phenotype. To shed light on the physiological role of ABCC6, we focused on the phenotype of HepG2 cells that lack ABCC6 activity. Interestingly, we found that ABCC6 knockdown HepG2 cells show: 1) intracellular reductive stress; 2) cell cycle arrest in G1 phase; 3) upregulation of p21 Cip p53 independent; and 4) downregulation of lamin A/C. These findings show that the absence of ABCC6 profoundly changes the HepG2 phenotype, suggesting that the PXE syndrome is a complex metabolic disease that is not exclusively related to the absence of pyrophosphate in the bloodstream.

Knockdown of POLDIP2 suppresses tumor growth and invasion capacity and is linked to unfavorable transformation ability and metastatic feature in non-small cell lung cancer.

PubMed

Chen, Ying-Chieh; Kuo, Chih-Chi; Chian, Chih-Feng; Tzao, Ching; Chang, Shan-Yueh; Shih, Yu-Lueng; Lin, Ya-Wen; Yu, Mu-Hsien; Su, Her-Young

2018-07-01

The main problem in the treatment of non-small cell lung cancer (NSCLC) is metastasis. Epithelial-mesenchymal transition (EMT) is known as the critical signaling in tumor progression, metastasis, and also the drug resistance. In this study, we reported a novel gene Polymerase delta-interacting protein 2 (POLDIP2) was downregulated in NSCLC tissues and first demonstrated that overexpression of POLDIP2 increased the anchorage-independent growth (AIG) and invasiveness of H1299 cells. In addition, we examined that knockdown of POLDIP2 in H1299 and A549 cells reduced tumorigenicity and metastatic capacity in vitro and also in vivo. Moreover, downregulation of the cell proliferation marker cyclin D1 and EMT markers CDH2, Slug, and Twist was showed in H1299 cells by POLDIP2 knockdown, suggesting that the inhibition of malignancy was affected by modulating key genes for tumor growth and invasiveness. Taken together, our study is the first study that demonstrated that POLDIP2 gene was function as an oncogene in NSCLC and implied the oncogenic ability might be through promoting cell proliferation or EMT. Copyright © 2018 Elsevier Inc. All rights reserved.

All-optical laser spectral narrowing and line fixing at atomic absorption transition by injection competition and gain knock-down techniques

NASA Astrophysics Data System (ADS)

Gacheva, Lazarina I.; Deneva, Margarita A.; Kalbanov, Mihail H.; Nenchev, Marin N.

2008-12-01

We present two original, all optical techniques, to produce a narrowline laser light, fixed at the frequency of a chosen reference atomic absorption transition. The first type of systems is an essential improvement of our method 3,4 for laser spectral locking using a control by two frequency scanned, competitive injections with disturbed power ratio by the absorption at the reference line. The new development eliminates the narrowing limiting problem, related with the fixed laser longitudinal mode structure. We have proposed an original new technique for continuously tunable single mode laser operation in combination with synchronously and equal continuous tuning of the modes of the amplifier. By adapting the laser differential rate equations, the system is analyzed theoretically in details and is shown its feasibility. The results are in agreement with previous our experiments. The essential advantage, except simplicity of realization, is that the laser line can be of order of magnitude and more narrowed than the absorption linewidth. The second system is based of the laser amplifier arrangement with a gain knock-down from the competitive frequency scanned pulse, except at the wavelength of the desired absorption reference line. The essential advantages of the last system are that the problem of fixing laser mode presence is naturally avoided. The theoretical modeling and the numerical investigations show the peculiarity and advantages of the system proposed. The developed approaches are of interest for applications in spectroscopy, in DIAL monitoring of the atmospheric pollutants, in isotope separation system and potentially - for creation of simple, all optical, frequency standards for optical communications. Also, the continuously tunable single mode laser (and the combination with the simultaneously tunable amplifier) presents itself the interest for many practical applications in spectroscopy, metrology, and holography. We compare the action and the

Fatty acids increase neuronal hypertrophy of Pten knockdown neurons

PubMed Central

Fricano, Catherine J.; DeSpenza, Tyrone; Frazel, Paul W.; Li, Meijie; O'Malley, A. James; Westbrook, Gary L.; Luikart, Bryan W.

2014-01-01

Phosphatase and tensin homolog (Pten) catalyzes the reverse reaction of PI3K by dephosphorylating PIP3 to PIP2. This negatively regulates downstream Akt/mTOR/S6 signaling resulting in decreased cellular growth and proliferation. Co-injection of a lentivirus knocking Pten down with a control lentivirus allows us to compare the effects of Pten knockdown between individual neurons within the same animal. We find that knockdown of Pten results in neuronal hypertrophy by 21 days post-injection. This neuronal hypertrophy is correlated with increased p-S6 and p-mTOR in individual neurons. We used this system to test whether an environmental factor that has been implicated in cellular hypertrophy could influence the severity of the Pten knockdown-induced hypertrophy. Implantation of mini-osmotic pumps delivering fatty acids results in increased neuronal hypertrophy and p-S6/p-mTOR staining. These hypertrophic effects were reversed in response to rapamycin treatment. However, we did not observe a similar increase in hypertrophy in response to dietary manipulations of fatty acids. Thus, we conclude that by driving growth signaling with fatty acids and knocking down a critical regulator of growth, Pten, we are able to observe an additive morphological phenotype of increased soma size mediated by the mTOR pathway. PMID:24795563

Knockdown of long noncoding RNA 00152 (LINC00152) inhibits human retinoblastoma progression.

PubMed

Li, Songhe; Wen, Dacheng; Che, Songtian; Cui, Zhihua; Sun, Yabin; Ren, Hua; Hao, Jilong

2018-01-01

A growing body of evidence supports the involvement of long noncoding RNA 00152 (LINC00152) in the progression and metastasis of multiple cancers. However, the exact roles of LINC00152 in the progression of human retinoblastoma (RB) remain unknown. We explored the expression and biological function of human RB. The expression level of LINC00152 in RB tissues and cells was analyzed using quantitative real-time PCR. The function of LINC00152 was determined using a series of in vitro assays. In vivo, a nude mouse model was established to analyze the function of LINC00152. Gene and protein expressions were detected using quantitative real-time PCR and Western blot assays, respectively. The expression of LINC00152 mRNA was upregulated in RB tissues and cell lines. Knockdown of LINC00152 significantly inhibited cell proliferation, colony formation, migration, and invasion and promoted cell apoptosis and caspase-3 and caspase-8 activities in vitro, as well as suppressing tumorigenesis in vivo. We identified several genes related to proliferation, apoptosis, and invasion including Ki-67, Bcl-2, and MMP-9 that were transcriptionally inactivated by LINC00152. Taken together, these data implicate LINC00152 as a therapeutic target in RB.

Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex.

PubMed

Zhang, Rui; Xu, Jian; Zhao, Jian; Bai, Jinghui

2017-07-11

MicroRNAs have been proved to participate in multiple biological processes in cancers. For developing resistance to cytotoxic drug, cancer cells, especially the cancer stem cells, usually change their microRNA expression profile to survive in hostile environments. In the present study, we found that expression of microRNA-27a was increased in colorectal cancer stem cells. High level of microRNA-27a was indicated to induce the resistance to TNF-related apoptosis-inducing ligand (TRAIL). Knockdown of microRNA-27a resensitized colorectal cancer stem cells to TRAIL-induced cell death. Mechanically, the gene of Apaf-1, which is associated with the mitochondrial apoptosis, was demonstrated to be the target of microRNA-27a in colorectal cancer stem cells. Knockdown of microRNA-27a increased the expression level of Apaf-1, thus enhancing the formation of Apaf-1-caspase-9 complex and subsequently promoting the TRAIL-induced apoptosis in colorectal cancer stem cells. These findings suggested that knockdown of microRNA-27a in colorectal cancer stem cells by the specific antioligonucleotides was potential to reverse the chemoresistance to TRAIL. It may represent a novel therapeutic strategy for treating the colorectal cancer more effectively.

Neuron-specific knockdown of the Drosophila fat induces reduction of life span, deficient locomotive ability, shortening of motoneuron terminal branches and defects in axonal targeting.

PubMed

Nakamura, Aya; Tanaka, Ryo; Morishita, Kazushige; Yoshida, Hideki; Higuchi, Yujiro; Takashima, Hiroshi; Yamaguchi, Masamitsu

2017-07-01

Mutations in FAT4 gene, one of the human FAT family genes, have been identified in Van Maldergem syndrome (VMS) and Hennekam lymphangiectasia-lymphedema syndrome (HS). The FAT4 gene encodes a large protein with extracellular cadherin repeats, EGF-like domains and Laminin G-like domains. FAT4 plays a role in tumor suppression and planar cell polarity. Drosophila contains a human FAT4 homologue, fat. Drosophila fat has been mainly studied with Drosophila eye and wing systems. Here, we specially knocked down Drosophila fat in nerve system. Neuron-specific knockdown of fat shortened the life span and induced the defect in locomotive abilities of adult flies. In consistent with these phenotypes, defects in synapse structure at neuromuscular junction were observed in neuron-specific fat-knockdown flies. In addition, aberrations in axonal targeting of photoreceptor neuron in third-instar larvae were also observed, suggesting that fat involves in axonal targeting. Taken together, the results indicate that Drosophila fat plays an essential role in formation and/or maintenance of neuron. Both VMS and HS show mental retardation and neuronal defects. We therefore consider that these two rare human diseases could possibly be caused by the defect in FAT4 function in neuronal cells. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Enhanced toxic cloud knockdown spray system for decontamination applications

DOEpatents

Betty, Rita G [Rio Rancho, NM; Tucker, Mark D [Albuquerque, NM; Brockmann, John E [Albuquerque, NM; Lucero, Daniel A [Albuquerque, NM; Levin, Bruce L [Tijeras, NM; Leonard, Jonathan [Albuquerque, NM

2011-09-06

Methods and systems for knockdown and neutralization of toxic clouds of aerosolized chemical or biological warfare (CBW) agents and toxic industrial chemicals using a non-toxic, non-corrosive aqueous decontamination formulation.

Anti-tumor effect of estrogen-related receptor alpha knockdown on uterine endometrial cancer

PubMed Central

Matsushima, Hiroshi; Mori, Taisuke; Ito, Fumitake; Yamamoto, Takuro; Akiyama, Makoto; Kokabu, Tetsuya; Yoriki, Kaori; Umemura, Shiori; Akashi, Kyoko; Kitawaki, Jo

2016-01-01

Estrogen-related receptor (ERR)α presents structural similarities with estrogen receptor (ER)α. However, it is an orphan receptor not binding to naturally occurring estrogens. This study was designed to investigate the role of ERRα in endometrial cancer progression. Immunohistochemistry analysis on 50 specimens from patients with endometrial cancer showed that ERRα was expressed in all examined tissues and the elevated expression levels of ERRα were associated with advanced clinical stages and serous histological type (p < 0.01 for each). ERRα knockdown with siRNA suppressed angiogenesis via VEGF and cell proliferation in vitro (p < 0.01). Cell cycle and apoptosis assays using flow cytometry and western blot revealed that ERRα knockdown induced cell cycle arrest during the mitotic phase followed by apoptosis initiated by caspase-3. Additionally, ERRα knockdown sensitized cells to paclitaxel. A significant reduction of tumor growth and angiogenesis was also observed in ERRα knockdown xenografts (p < 0.01). These findings indicate that ERRα may serve as a novel molecular target for the treatment of endometrial cancer. PMID:27153547

Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

PubMed

Firnhaber, Christopher; Hammarlund, Marc

2013-11-01

Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

Knockdown of Uba2 inhibits colorectal cancer cell invasion and migration through downregulation of the Wnt/β-catenin signaling pathway.

PubMed

Cheng, Hongjing; Sun, Xun; Li, Ji; He, Ping; Liu, Wanqi; Meng, Xiangwei

2018-05-10

Colorectal cancer is a serious threat to human health, and has a high mortality rate. There is currently no effective therapy for end-stage colorectal cancer. In recent years, molecular targeted therapy has received increasing attention for cancer treatment. In particular, the role of Uba2, a vital component of SUMO-activating enzyme, has been highlighted, which plays important roles in the progression of certain cancers; however, its role in colorectal cancer remains unclear. Accordingly, the aim of this study was to evaluate the relationship between Uba2 and colorectal cancer. Uba2 expression was knocked down in two colorectal cancer cell lines, and gene microarray analysis was conducted, followed by proliferation, migration, and invasion assays. Uba2 knockdown influenced the expression of several genes, and significantly inhibited the proliferation, migration, and invasion of cancer cells. To determine the underlying mechanism, the expression of related signaling pathways and molecules was evaluated in the knockdown cell lines. Overall, the results suggest that Uba2 participates in the progression, invasion, and metastasis of colorectal cancer, and the possible mechanism is via regulating the Wnt signaling pathway and enhancing epithelial-mesenchymal transition behaviors of colorectal cancer cells. Therefore, Uba2 is expected to be an important oncoprotein and potential therapeutic target in colorectal cancer. © 2018 Wiley Periodicals, Inc.

Brain-Targeted (Pro)Renin Receptor Knockdown attenuates Angiotensin II-Dependent Hypertension

PubMed Central

Li, Wencheng; Peng, Hua; Cao, Theresa; Sato, Ryosuke; McDaniels, Sarah. J.; Kobori, Hiroyuki; Navar, L. Gabriel; Feng, Yumei

2012-01-01

The (pro)renin receptor is a newly discovered member of the brain renin-angiotensin system. To investigate the role of brain (pro)renin receptor in hypertension, adeno-associated virus-mediated (pro)renin receptor shRNA was used to knockdown (pro)renin receptor expression in the brain of non-transgenic normotensive and human renin-angiotensinogen double transgenic hypertensive mice. Blood pressure was monitored using implanted telemetric probes in conscious animals. Real-time PCR and immunostaining were performed to determine (pro)renin receptor, angiotensin II type 1 receptor and vasopressin mRNA levels. Plasma vasopressin levels were determined by Enzyme-Linked Immuno Sorbent Assay. Double transgenic mice exhibited higher blood pressure, elevated cardiac and vascular sympathetic tone, and impaired spontaneous baroreflex sensitivity. Intracerebroventricular delivery of (pro)renin receptor shRNA significantly reduced blood pressure, cardiac and vasomotor sympathetic tone, and improved baroreflex sensitivity compared to the control virus treatment in double transgenic mice. (Pro)renin receptor knockdown significantly reduced angiotensin II type 1 receptor and vasopressin levels in double transgenic mice. These data indicate that (pro)renin receptor knockdown in the brain attenuates angiotensin II-dependent hypertension and is associated with a decrease insympathetic tone and an improvement of the baroreflex sensitivity. In addition, brain-targeted (pro)renin receptor knockdown is associated with down-regulation of angiotensin II type 1 receptor and vasopressin levels. We conclude that central (pro)renin receptor contributes to the pathogenesis of hypertension in human renin-angiotensinogen transgenic mice. PMID:22526255

Knockdown of AMPKα2 Promotes Pulmonary Arterial Smooth Muscle Cells Proliferation via mTOR/Skp2/p27Kip1 Signaling Pathway

PubMed Central

Ke, Rui; Liu, Lu; Zhu, Yanting; Li, Shaojun; Xie, Xinming; Li, Fangwei; Song, Yang; Yang, Lan; Gao, Li; Li, Manxiang

2016-01-01

It has been shown that activation of adenosine monophosphate-activated protein kinase (AMPK) suppresses proliferation of a variety of tumor cells as well as nonmalignant cells. In this study, we used post-transcriptional gene silencing with small interfering RNA (siRNA) to specifically examine the effect of AMPK on pulmonary arterial smooth muscle cells (PASMCs) proliferation and to further elucidate its underlying molecular mechanisms. Our results showed that knockdown of AMPKα2 promoted primary cultured PASMCs proliferation; this was accompanied with the elevation of phosphorylation of mammalian target of rapamycin (mTOR) and S-phase kinase-associated protein 2 (Skp2) protein level and reduction of p27Kip1. Importantly, prior silencing of mTOR with siRNA abolished AMPKα2 knockdown-induced Skp2 upregulation, p27Kip1 reduction as well as PASMCs proliferation. Furthermore, pre-depletion of Skp2 by siRNA also eliminated p27Kip1 downregulation and PASMCs proliferation caused by AMPKα2 knockdown. Taken together, our study indicates that AMPKα2 isoform plays an important role in regulation of PASMCs proliferation by modulating mTOR/Skp2/p27Kip1 axis, and suggests that activation of AMPKα2 might have potential value in the prevention and treatment of pulmonary arterial hypertension. PMID:27258250

Two knockdown models of the autism genes SYNGAP1 and SHANK3 in zebrafish produce similar behavioral phenotypes associated with embryonic disruptions of brain morphogenesis

PubMed Central

Kozol, Robert A.; Cukier, Holly N.; Zou, Bing; Mayo, Vera; De Rubeis, Silvia; Cai, Guiqing; Griswold, Anthony J.; Whitehead, Patrice L.; Haines, Jonathan L.; Gilbert, John R.; Cuccaro, Michael L.; Martin, Eden R.; Baker, James D.; Buxbaum, Joseph D.; Pericak-Vance, Margaret A.; Dallman, Julia E.

2015-01-01

Despite significant progress in the genetics of autism spectrum disorder (ASD), how genetic mutations translate to the behavioral changes characteristic of ASD remains largely unknown. ASD affects 1–2% of children and adults, and is characterized by deficits in verbal and non-verbal communication, and social interactions, as well as the presence of repetitive behaviors and/or stereotyped interests. ASD is clinically and etiologically heterogeneous, with a strong genetic component. Here, we present functional data from syngap1 and shank3 zebrafish loss-of-function models of ASD. SYNGAP1, a synaptic Ras GTPase activating protein, and SHANK3, a synaptic scaffolding protein, were chosen because of mounting evidence that haploinsufficiency in these genes is highly penetrant for ASD and intellectual disability (ID). Orthologs of both SYNGAP1 and SHANK3 are duplicated in the zebrafish genome and we find that all four transcripts (syngap1a, syngap1b, shank3a and shank3b) are expressed at the earliest stages of nervous system development with pronounced expression in the larval brain. Consistent with early expression of these genes, knockdown of syngap1b or shank3a cause common embryonic phenotypes including delayed mid- and hindbrain development, disruptions in motor behaviors that manifest as unproductive swim attempts, and spontaneous, seizure-like behaviors. Our findings indicate that both syngap1b and shank3a play novel roles in morphogenesis resulting in common brain and behavioral phenotypes. PMID:25882707

Hoxa2 knockdown in Xenopus results in hyoid to mandibular homeosis.

PubMed

Baltzinger, Mireille; Ori, Michela; Pasqualetti, Massimo; Nardi, Irma; Rijli, Filippo M

2005-12-01

The skeletal structures of the face and throat are derived from cranial neural crest cells (NCCs) that migrate from the embryonic neural tube into a series of branchial arches (BAs). The first arch (BA1) gives rise to the upper and lower jaw cartilages, whereas hyoid structures are generated from the second arch (BA2). The Hox paralogue group 2 (PG2) genes, Hoxa2 and Hoxb2, show distinct roles for hyoid patterning in tetrapods and fishes. In the mouse, Hoxa2 acts as a selector of hyoid identity, while its paralogue Hoxb2 is not required. On the contrary, in zebrafish Hoxa2 and Hoxb2 are functionally redundant for hyoid arch patterning. Here, we show that in Xenopus embryos morpholino-induced functional knockdown of Hoxa2 is sufficient to induce homeotic changes of the second arch cartilage. Moreover, Hoxb2 is downregulated in the BA2 of Xenopus embryos, even though initially expressed in second arch NCCs, similar to mouse and unlike in zebrafish. Finally, Xbap, a gene involved in jaw joint formation, is selectively upregulated in the BA2 of Hoxa2 knocked-down frog embryos, supporting a hyoid to mandibular change of NCC identity. Thus, in Xenopus Hoxa2 does not act redundantly with Hoxb2 for BA2 patterning, similar to mouse and unlike in fish. These data bring novel insights into the regulation of Hox PG2 genes and hyoid patterning in vertebrate evolution and suggest that Hoxa2 function is required at late stages of BA2 development. Copyright 2005 Wiley-Liss, Inc.

Altered Gene Expressions and Cytogenetic Repair Efficiency in Cells with Suppressed Expression of XPA after Proton Exposure

NASA Technical Reports Server (NTRS)

Zhang, Ye; Rohde, Larry H.; Gridley, Daila S.; Mehta, Satish K.; Pierson, Duane L.; Wu, Honglu

2009-01-01

Cellular responses to damages from ionizing radiation (IR) exposure are influenced not only by the genes involved in DNA double strand break (DSB) repair, but also by non- DSB repair genes. We demonstrated previously that suppressed expression of several non-DSB repair genes, such as XPA, elevated IR-induced cytogenetic damages. In the present study, we exposed human fibroblasts that were treated with control or XPA targeting siRNA to 250 MeV protons (0 to 4 Gy), and analyzed chromosome aberrations and expressions of genes involved in DNA repair. As expected, after proton irradiation, cells with suppressed expression of XPA showed a significantly elevated frequency of chromosome aberrations compared with control siRNA treated (CS) cells. Protons caused more severe DNA damages in XPA knock-down cells, as 36% cells contained multiple aberrations compared to 25% in CS cells after 4Gy proton irradiation. Comparison of gene expressions using the real-time PCR array technique revealed that expressions of p53 and its regulated genes in irradiated XPA suppressed cells were altered similarly as in CS cells, suggesting that the impairment of IR induced DNA repair in XPA suppressed cells is p53-independent. Except for XPA, which was more than 2 fold down regulated in XPA suppressed cells, several other DNA damage sensing and repair genes (GTSE1, RBBP8, RAD51, UNG and XRCC2) were shown a more than 1.5 fold difference between XPA knock-down cells and CS cells after proton exposure. The possible involvement of these genes in the impairment of DNA repair in XPA suppressed cells will be further investigated.

Knockdown of epigenetic transcriptional co-regulator Brd2a disrupts apoptosis and proper formation of hindbrain and midbrain-hindbrain boundary (MHB) region in zebrafish.

PubMed

Murphy, Tami; Melville, Heather; Fradkin, Eliza; Bistany, Giana; Branigan, Gregory; Olsen, Kelly; Comstock, Catharine R; Hanby, Hayley; Garbade, Ellie; DiBenedetto, Angela J

2017-08-01

Brd2 is a member of the bromodomain-extraterminal domain (BET) family of proteins and functions as an acetyl-histone-directed transcriptional co-regulator and recruitment scaffold in chromatin modification complexes affecting signal-dependent transcription. While Brd2 acts as a protooncogene in mammalian blood, developmental studies link it to regulation of neuronal apoptosis and epilepsy, and complete knockout of the gene is invariably embryonic lethal. In Drosophila, the Brd2 homolog acts as a maternal effect factor necessary for segment formation and identity and proper expression of homeotic loci, including Ultrabithorax and engrailed. To test the various roles attributed to Brd2 in a single developmental system representing a non-mammalian vertebrate, we conducted a phenotypic characterization of Brd2a deficient zebrafish embryos produced by morpholino knockdown and corroborated by Crispr-Cas9 disruption and small molecule inhibitor treatments. brd2aMO morphants exhibit reduced hindbrain with an ill-defined midbrain-hindbrain boundary (MHB) region; irregular notochord, neural tube, and somites; and abnormalities in ventral trunk and ventral nerve cord interneuron positioning. Using whole mount TUNEL and confocal microscopy, we uncover a significant decrease, then a dramatic increase, of p53-independent cell death at the start and end of segmentation, respectively. In contrast, using qualitative and quantitative analyses of BrdU incorporation, phosphohistone H3-tagging, and flow cytometry, we detect little effect of Brd2a knockdown on overall proliferation levels in embryos. RNA in situ hybridization shows reduced or absent expression of homeobox gene eng2a and paired box gene pax2a, in the hindbrain domain of the MHB region, and an overabundance of pax2a-positive kidney progenitors, in knockdowns. Together, these results suggest an evolutionarily conserved role for Brd2 in the proper formation and/or patterning of segmented tissues, including the vertebrate

RNAi targeting GPR4 influences HMEC-1 gene expression by microarray analysis

PubMed Central

Ren, Juan; Zhang, Yuelang; Cai, Hui; Ma, Hongbing; Zhao, Dongli; Zhang, Xiaozhi; Li, Zongfang; Wang, Shufeng; Wang, Jiangsheng; Liu, Rui; Li, Yi; Qian, Jiansheng; Wei, Hongxia; Niu, Liying; Liu, Yan; Xiao, Lisha; Ding, Muyang; Jiang, Shiwen

2014-01-01

G-protein coupled receptor 4 (GPR4) belongs to a protein family comprised of 3 closely related G protein-coupled receptors. Recent studies have shown that GPR4 plays important roles in angiogenesis, proton sensing, and regulating tumor cells as an oncogenic gene. How GPR4 conducts its functions? Rare has been known. In order to detect the genes related to GPR4, microarray technology was employed. GPR4 is highly expressed in human vascular endothelial cell HMEC-1. Small interfering RNA against GPR4 was used to knockdown GPR4 expression in HMEC-1. Then RNA from the GPR4 knockdown cells and control cells were analyzed through genome microarray. Microarray results shown that among the whole genes and expressed sequence tags, 447 differentially expressed genes were identified, containing 318 up-regulated genes and 129 down-regulated genes. These genes whose expression dramatically changed may be involved in the GPR4 functions. These genes were related to cell apoptosis, cytoskeleton and signal transduction, cell proliferation, differentiation and cell-cycle regulation, gene transcription and translation and cell material and energy metabolism. PMID:24753754

Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex

PubMed Central

Zhang, Rui; Xu, Jian; Zhao, Jian; Bai, Jinghui

2017-01-01

MicroRNAs have been proved to participate in multiple biological processes in cancers. For developing resistance to cytotoxic drug, cancer cells, especially the cancer stem cells, usually change their microRNA expression profile to survive in hostile environments. In the present study, we found that expression of microRNA-27a was increased in colorectal cancer stem cells. High level of microRNA-27a was indicated to induce the resistance to TNF-related apoptosis-inducing ligand (TRAIL). Knockdown of microRNA-27a resensitized colorectal cancer stem cells to TRAIL-induced cell death. Mechanically, the gene of Apaf-1, which is associated with the mitochondrial apoptosis, was demonstrated to be the target of microRNA-27a in colorectal cancer stem cells. Knockdown of microRNA-27a increased the expression level of Apaf-1, thus enhancing the formation of Apaf-1-caspase-9 complex and subsequently promoting the TRAIL-induced apoptosis in colorectal cancer stem cells. These findings suggested that knockdown of microRNA-27a in colorectal cancer stem cells by the specific antioligonucleotides was potential to reverse the chemoresistance to TRAIL. It may represent a novel therapeutic strategy for treating the colorectal cancer more effectively. PMID:28423356

Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly.

PubMed

Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm

2017-10-01

Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.

Withaferin A inhibits in vivo growth of breast cancer cells accelerated by Notch2 knockdown.

PubMed

Kim, Su-Hyeong; Hahm, Eun-Ryeong; Arlotti, Julie A; Samanta, Suman K; Moura, Michelle B; Thorne, Stephen H; Shuai, Yongli; Anderson, Carolyn J; White, Alexander G; Lokshin, Anna; Lee, Joomin; Singh, Shivendra V

2016-05-01

The present study offers novel insights into the molecular circuitry of accelerated in vivo tumor growth by Notch2 knockdown in triple-negative breast cancer (TNBC) cells. Therapeutic vulnerability of Notch2-altered growth to a small molecule (withaferin A, WA) is also demonstrated. MDA-MB-231 and SUM159 cells were used for the xenograft studies. A variety of technologies were deployed to elucidate the mechanisms underlying tumor growth augmentation by Notch2 knockdown and its reversal by WA, including Fluorescence Molecular Tomography for measurement of tumor angiogenesis in live mice, Seahorse Flux analyzer for ex vivo measurement of tumor metabolism, proteomics, and Luminex-based cytokine profiling. Stable knockdown of Notch2 resulted in accelerated in vivo tumor growth in both cells reflected by tumor volume and/or latency. For example, the wet tumor weight from mice bearing Notch2 knockdown MDA-MB-231 cells was about 7.1-fold higher compared with control (P < 0.0001). Accelerated tumor growth by Notch2 knockdown was highly sensitive to inhibition by a promising steroidal lactone (WA) derived from a medicinal plant. Molecular underpinnings for tumor growth intensification by Notch2 knockdown included compensatory increase in Notch1 activation, increased cellular proliferation and/or angiogenesis, and increased plasma or tumor levels of growth stimulatory cytokines. WA administration reversed many of these effects providing explanation for its remarkable anti-cancer efficacy. Notch2 functions as a tumor growth suppressor in TNBC and WA offers a novel therapeutic strategy for restoring this function.

Effects of Shell-Buckling Knockdown Factors in Large Cylindrical Shells

NASA Technical Reports Server (NTRS)

Hrinda, Glenn A.

2012-01-01

Shell-buckling knockdown factors (SBKF) have been used in large cylindrical shell structures to account for uncertainty in buckling loads. As the diameter of the cylinder increases, achieving the manufacturing tolerances becomes increasingly more difficult. Knockdown factors account for manufacturing imperfections in the shell geometry by decreasing the allowable buckling load of the cylinder. In this paper, large-diameter (33 ft) cylinders are investigated by using various SBKF's. An investigation that is based on finite-element analysis (FEA) is used to develop design sensitivity relationships. Different manufacturing imperfections are modeled into a perfect cylinder to investigate the effects of these imperfections on buckling. The analysis results may be applicable to large- diameter rockets, cylindrical tower structures, bulk storage tanks, and silos.

Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

PubMed

Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

2015-04-20

Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sertoli cell specific knockdown of RAR-related orphan receptor (ROR) alpha at puberty reduces sperm count in rats.

PubMed

Mandal, Kamal; Sarkar, Rajesh K; Sen Sharma, Souvik; Jain, Ayushi; Majumdar, Subeer S

2018-01-30

Globally, there is an alarming decline in sperm count. Very often hormonal supplementation fails to restore normal sperm count. Sertoli cells (Sc) present within seminiferous tubules provide appropriate niche and factors required for the differentiation of germ cells (Gc) into mature sperm (spermatogenesis). Functionally compromised Sc may be one of the reasons for failure of hormones to facilitate normal spermatogenesis. Although role of secretory proteins and signaling molecules of Sc has been studied well, role of transcription factors regulating sperm count has not been addressed appropriately. Retinoic acid receptor-related orphan receptor (ROR)-alpha is one of such transcription factors reported in testis but its role in testicular function is not yet known. In a separate study, we found abundant ROR-alpha binding sites on promoter regions of several genes upregulated in pubertal rat Sc as compared to infant Sc. Immunostaining studies also revealed presence of ROR alpha in nucleus of pubertal Sc. We generated a transgenic knockdown rat model expressing shRNA targeted to ROR-alpha under Sc specific promoter, which is transcriptionally active only at and after puberty. ROR-alpha knockdown animals were found to have abnormal association of Sc and Gc, including Gc sloughing and restricted release of sperm. The knockdown animals displayed compromised spermatogenesis leading to significant reduction in sperm count. This is the first report describing the Sc specific role of ROR-alpha in maintaining quantitatively normal sperm output. Identification of various such molecules can generate avenues to limit or reverse an alarmingly declining sperm count witnessed globally in men. Copyright © 2017 Elsevier B.V. All rights reserved.

Knockdown of HDAC1 expression suppresses invasion and induces apoptosis in glioma cells.

PubMed

Wang, Xiao-Qiang; Bai, Hong-Min; Li, Shi-Ting; Sun, Hui; Min, Ling-Zhao; Tao, Bang-Bao; Zhong, Jun; Li, Bin

2017-07-18

Glioma is the most common malignant tumor of the central nervous system, with a low survival rate of five years worldwide. Although high expression and prognostic value of histone deacetylase 1 (HDAC1) have been recently reported in various types of human tumors, the molecular mechanism underlying the biological function of HDAC1 in glioma is still unclear. We found that HDAC1 was elevated in glioma tissues and cell lines. HDAC1 expression was closely related with pathological grade and overall survival of patients with gliomas. Downregulation of HDAC1 inhibited cell proliferation, prevented invasion of glioma cell lines, and induced cell apoptosis. The expression of apoptosis and metastasis related molecules were detected by RT-PCR and Western blot, respectively, in U251 and T98G cells with HDAC1 knockdown. We found that HDAC1 knockdown upregulated expression of BIM, BAX, cleaved CASPASE3 and E-CADHERIN, and decreased expression of TWIST1, SNAIL and MMP9 in U251 and T98G cells with HDAC1 knockdown. In vivo data showed that knockdown of HDAC1 inhibited tumor growth in nude mice. In summary, HDAC1 may therefore be considered an unfavorable progression indicator for glioma patients, and may also serve as a potential therapeutic target.

Genetic interaction analysis of point mutations enables interrogation of gene function at a residue-level resolution

PubMed Central

Braberg, Hannes; Moehle, Erica A.; Shales, Michael; Guthrie, Christine; Krogan, Nevan J.

2014-01-01

We have achieved a residue-level resolution of genetic interaction mapping – a technique that measures how the function of one gene is affected by the alteration of a second gene – by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine. PMID:24842270

Effects of PHENYLALANINE AMMONIA LYASE ( PAL) knockdown on cell wall composition, biomass digestibility, and biotic and abiotic stress responses in Brachypodium

DOE PAGES

Cass, Cynthia L.; Peraldi, Antoine; Dowd, Patrick F.; ...

2015-06-19

The phenylpropanoid pathway in plants synthesizes a variety of structural and defence compounds, and is an important target in efforts to reduce cell wall lignin for improved biomass conversion to biofuels. Little is known concerning the trade-offs in grasses when perturbing the function of the first gene family in the pathway, PHENYLALANINE AMMONIA LYASE ( PAL). Therefore, PAL isoforms in the model grass Brachypodium distachyon were targeted, by RNA interference (RNAi), and large reductions (up to 85%) in stem tissue transcript abundance for two of the eight putative BdPAL genes were identified. The cell walls of stems of BdPAL-knockdown plantsmore » had reductions of 43% in lignin and 57% in cell wall-bound ferulate, and a nearly 2-fold increase in the amounts of polysaccharide-derived carbohydrates released by thermochemical and hydrolytic enzymic partial digestion. PAL-knockdown plants exhibited delayed development and reduced root growth, along with increased susceptibilities to the fungal pathogens Fusarium culmorum and Magnaporthe oryzae. Surprisingly, these plants generally had wild-type (WT) resistances to caterpillar herbivory, drought, and ultraviolet light. RNA sequencing analyses revealed that the expression of genes associated with stress responses including ethylene biosynthesis and signalling were significantly altered in PAL knocked-down plants under non-challenging conditions. These data reveal that, although an attenuation of the phenylpropanoid pathway increases carbohydrate availability for biofuel, it can adversely affect plant growth and disease resistance to fungal pathogens. Lastly, the data identify notable differences between the stress responses of these monocot pal mutants versus Arabidopsis (a dicot) pal mutants and provide insights into the challenges that may arise when deploying phenylpropanoid pathway-altered bioenergy crops.« less

Effects of PHENYLALANINE AMMONIA LYASE ( PAL) knockdown on cell wall composition, biomass digestibility, and biotic and abiotic stress responses in Brachypodium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cass, Cynthia L.; Peraldi, Antoine; Dowd, Patrick F.

The phenylpropanoid pathway in plants synthesizes a variety of structural and defence compounds, and is an important target in efforts to reduce cell wall lignin for improved biomass conversion to biofuels. Little is known concerning the trade-offs in grasses when perturbing the function of the first gene family in the pathway, PHENYLALANINE AMMONIA LYASE ( PAL). Therefore, PAL isoforms in the model grass Brachypodium distachyon were targeted, by RNA interference (RNAi), and large reductions (up to 85%) in stem tissue transcript abundance for two of the eight putative BdPAL genes were identified. The cell walls of stems of BdPAL-knockdown plantsmore » had reductions of 43% in lignin and 57% in cell wall-bound ferulate, and a nearly 2-fold increase in the amounts of polysaccharide-derived carbohydrates released by thermochemical and hydrolytic enzymic partial digestion. PAL-knockdown plants exhibited delayed development and reduced root growth, along with increased susceptibilities to the fungal pathogens Fusarium culmorum and Magnaporthe oryzae. Surprisingly, these plants generally had wild-type (WT) resistances to caterpillar herbivory, drought, and ultraviolet light. RNA sequencing analyses revealed that the expression of genes associated with stress responses including ethylene biosynthesis and signalling were significantly altered in PAL knocked-down plants under non-challenging conditions. These data reveal that, although an attenuation of the phenylpropanoid pathway increases carbohydrate availability for biofuel, it can adversely affect plant growth and disease resistance to fungal pathogens. Lastly, the data identify notable differences between the stress responses of these monocot pal mutants versus Arabidopsis (a dicot) pal mutants and provide insights into the challenges that may arise when deploying phenylpropanoid pathway-altered bioenergy crops.« less

Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth

PubMed Central

2011-01-01

Introduction MicroRNAs (miRNAs) are a class of small non-coding RNAs (20 to 24 nucleotides) that post-transcriptionally modulate gene expression. A key oncomir in carcinogenesis is miR-21, which is consistently up-regulated in a wide range of cancers. However, few functional studies are available for miR-21, and few targets have been identified. In this study, we explored the role of miR-21 in human breast cancer cells and tissues, and searched for miR-21 targets. Methods We used in vitro and in vivo assays to explore the role of miR-21 in the malignant progression of human breast cancer, using miR-21 knockdown. Using LNA silencing combined to microarray technology and target prediction, we screened for potential targets of miR-21 and validated direct targets by using luciferase reporter assay and Western blot. Two candidate target genes (EIF4A2 and ANKRD46) were selected for analysis of correlation with clinicopathological characteristics and prognosis using immunohistochemistry on cancer tissue microrrays. Results Anti-miR-21 inhibited growth and migration of MCF-7 and MDA-MB-231 cells in vitro, and tumor growth in nude mice. Knockdown of miR-21 significantly increased the expression of ANKRD46 at both mRNA and protein levels. Luciferase assays using a reporter carrying a putative target site in the 3' untranslated region of ANKRD46 revealed that miR-21 directly targeted ANKRD46. miR-21 and EIF4A2 protein were inversely expressed in breast cancers (rs = -0.283, P = 0.005, Spearman's correlation analysis). Conclusions Knockdown of miR-21 in MCF-7 and MDA-MB-231 cells inhibits in vitro and in vivo growth as well as in vitro migration. ANKRD46 is newly identified as a direct target of miR-21 in BC. These results suggest that inhibitory strategies against miR-21 using peptide nucleic acids (PNAs)-antimiR-21 may provide potential therapeutic applications in breast cancer treatment. PMID:21219636

Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth.

PubMed

Yan, Li Xu; Wu, Qi Nian; Zhang, Yan; Li, Yang Yang; Liao, Ding Zhun; Hou, Jing Hui; Fu, Jia; Zeng, Mu Sheng; Yun, Jing Ping; Wu, Qiu Liang; Zeng, Yi Xin; Shao, Jian Yong

2011-01-10

MicroRNAs (miRNAs) are a class of small non-coding RNAs (20 to 24 nucleotides) that post-transcriptionally modulate gene expression. A key oncomir in carcinogenesis is miR-21, which is consistently up-regulated in a wide range of cancers. However, few functional studies are available for miR-21, and few targets have been identified. In this study, we explored the role of miR-21 in human breast cancer cells and tissues, and searched for miR-21 targets. We used in vitro and in vivo assays to explore the role of miR-21 in the malignant progression of human breast cancer, using miR-21 knockdown. Using LNA silencing combined to microarray technology and target prediction, we screened for potential targets of miR-21 and validated direct targets by using luciferase reporter assay and Western blot. Two candidate target genes (EIF4A2 and ANKRD46) were selected for analysis of correlation with clinicopathological characteristics and prognosis using immunohistochemistry on cancer tissue microrrays. Anti-miR-21 inhibited growth and migration of MCF-7 and MDA-MB-231 cells in vitro, and tumor growth in nude mice. Knockdown of miR-21 significantly increased the expression of ANKRD46 at both mRNA and protein levels. Luciferase assays using a reporter carrying a putative target site in the 3' untranslated region of ANKRD46 revealed that miR-21 directly targeted ANKRD46. miR-21 and EIF4A2 protein were inversely expressed in breast cancers (rs = -0.283, P = 0.005, Spearman's correlation analysis). Knockdown of miR-21 in MCF-7 and MDA-MB-231 cells inhibits in vitro and in vivo growth as well as in vitro migration. ANKRD46 is newly identified as a direct target of miR-21 in BC. These results suggest that inhibitory strategies against miR-21 using peptide nucleic acids (PNAs)-antimiR-21 may provide potential therapeutic applications in breast cancer treatment.

The impact of microfluidic mixing of triblock micelleplexes on in vitro / in vivo gene silencing and intracellular trafficking

NASA Astrophysics Data System (ADS)

Feldmann, Daniel P.; Xie, Yuran; Jones, Steven K.; Yu, Dongyue; Moszczynska, Anna; Merkel, Olivia M.

2017-06-01

The triblock copolymer polyethylenimine-polycaprolactone-polyethylene glycol (PEI-PCL-PEG) has been shown to spontaneously assemble into nano-sized particulate carriers capable of complexing with nucleic acids for gene delivery. The objective of this study was to investigate micelleplex characteristics, their in vitro and in vivo fate following microfluidic preparation of siRNA nanoparticles compared to the routinely used batch reactor mixing technique. Herein, PEI-PCL-PEG nanoparticles were prepared with batch reactor or microfluidic mixing techniques and characterized by various biochemical assays and in cell culture. Microfluidic nanoparticles showed a reduction of overall particle size as well as a more uniform size distribution when compared to batch reactor pipette mixing. Confocal microscopy, flow cytometry and qRT-PCR displayed the subcellular delivery of the microfluidic formulation and confirmed the ability to achieve mRNA knockdown. Intratracheal instillation of microfluidic formulation resulted in a significantly more efficient (p < 0.05) knockdown of GAPDH compared to treatment with the batch reactor formulation. The use of microfluidic mixing techniques yields an overall smaller and more uniform PEG-PCL-PEI nanoparticle that is able to more efficiently deliver siRNA in vivo. This preparation method may prove to be useful when a scaled up production of well-defined polyplexes is required.

RNAi knockdown of the focal adhesion protein TES reveals its role in actin stress fibre organisation.

PubMed

Griffith, Elen; Coutts, Amanda S; Black, Donald M

2005-03-01

TES was originally identified as a candidate tumour suppressor gene and has subsequently been found to encode a novel focal adhesion protein. As well as localising to cell-matrix adhesions, TES localises to cell-cell contacts and to actin stress fibres. TES interacts with a variety of cytoskeletal proteins including zyxin, mena, VASP, talin and actin. There is evidence that TES may function in actin-dependent processes as overexpression of TES results in increased cell spreading and decreased cell motility. Together with TES's interacting partners, these data suggest that TES might be involved in regulation of the actin cytoskeleton. Here, for the first time, we have used RNAi to successfully knockdown TES in HeLa cells and we demonstrate that loss of TES from focal adhesions results in loss of actin stress fibres. Similarly, and as previously reported, RNAi-mediated knockdown of zyxin results in loss of actin stress fibres. TES siRNA treated cells show reduced RhoA activity, suggesting that the Rho GTPase pathway may be involved in the TES RNAi-induced loss of stress fibres. We have also used RNAi to examine the requirement of TES and zyxin for each other's localisation at focal adhesions, and we propose a hierarchy of recruitment, with zyxin being first, followed by VASP and then TES. Cell Motil. Copyright 2005 Wiley-Liss, Inc.

Bax-inhibitor-1 knockdown phenotypes are suppressed by Buffy and exacerbate degeneration in a Drosophila model of Parkinson disease

PubMed Central

2017-01-01

that result from altered gene expression. The knockdown of BI-1 in the Drosophila developing eye under the direction of the GMR-Gal4 transgene results in reduced ommatidia number and increased disruption of the ommatidial array. Similarly, the co-expression of BI-1-RNAi with Buffy results in the suppression of the eye phenotypes. The expression of α-synuclein along with the knockdown of BI-1 resulted in reduction of ommatidia number and more disruption of the ommatidial array. Conclusion Knockdown of BI-1 in the dopaminergic neurons of Drosophila results in a shortened lifespan and premature loss in climbing ability, phenotypes that appear to be strongly associated with models of PD in Drosophila, and which are suppressed upon overexpression of Buffy and worsened by co-expression with α-synuclein. This suggests that BI-1 is neuroprotective and its knockdown can be counteracted by the overexpression of the pro-survival Bcl-2 homologue. PMID:28243526

Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1

PubMed Central

Awan, Aashir; Bell, Aaron J.; Satir, Peter

2009-01-01

A critical process that builds and maintains the eukaryotic cilium is intraflagellar transport (IFT). This process utilizes members of the kinesin-2 superfamily to transport cargo into the cilium (anterograde transport) and a dynein motor for the retrograde traffic. Using a novel RNAi knockdown method, we have analyzed the function of the homodimeric IFT kinesin-2, Kin5, in Tetrahymena ciliary transport. In RNAi transformants, Kin5 was severely downregulated and disappeared from the cilia, but cilia did not resorb, although tip structure was affected. After deciliation of the knockdown cell, cilia regrew and cells swam, which suggested that Kin5 is not responsible for the trafficking of axonemal precursors to build the cilium, but could be transporting molecules that act in ciliary signal transduction, such as guanine nucleotide exchange proteins (GEFs). Gef1 is a Tetrahymena ciliary protein, and current coimmunoprecipitation and immunofluorescence studies showed that it is absent in regrowing cilia of the knockdown cells lacking ciliary Kin5. We suggest that one important cargo of Kin5 is Gef1 and knockdown of Kin5 results in cell lethality. PMID:19290045

Thioredoxin reductase 1 knockdown enhances selenazolidine cytotoxicity in human lung cancer cells via mitochondrial dysfunction

PubMed Central

Poerschke, Robyn L.; Moos, Philip J.

2010-01-01

Thioredoxin reductase (TR1) is a selenoprotein that is involved in cellular redox status control and deoxyribonucleotide biosynthesis. Many cancers, including lung, overexpress TR1, making it a potential cancer therapy target. Previous work has shown that TR1 knockdown enhances the sensitivity of cancer cells to anticancer treatments, as well as certain selenocompounds. However, it is unknown if TR1 knockdown produces similar effect on the sensitivity of human lung cancer cells. To further elucidate the role of TR1 in the mechanism of selenocompounds in lung cancer, a lentiviral microRNA delivery system to knockdown TR1 expression in A549 human lung adenocarcinoma cells was utilized. Cell viability was assessed after 48 hr treatment with the selenocysteine prodrug selenazolidines 2-butylselenazolidine-4(R)-carboxylic acid (BSCA) and 2-cyclohexylselenazolidine-4-(R)-carboxylic acid (ChSCA), selenocystine (SECY), methylseleninic acid (MSA), 1,4-phenylenebis(methylene)selenocyanate (p-XSC), and selenomethionine (SEM). TR1 knockdown increased the cytotoxicity of BSCA, ChSCA, and SECY but did not sensitize cells to MSA, SEM, or p-XSC. GSH and TR1 depletion together decreased cell viability, while no change was observed with GSH depletion alone. Reactive oxygen species generation was induced only in TR1 knockdown cells treated with the selenazolidines or SECY. These three compounds also decreased total intracellular glutathione levels and oxidized thioredoxin, but in a TR1 independent manner. TR1 knockdown increased selenazolidine and SECY-induced mitochondrial membrane depolarization, as well as DNA strand breaks and AIF translocation from the mitochondria. These results indicate the ability of TR1 to modulate the cytotoxic effects of BSCA, ChSCA and SECY in human lung cancer cells through mitochondrial dysfunction. PMID:20920480

A novel amino acid substitution in a voltage-gated sodium channel is associated with knockdown resistance to permethrin in Aedes aegypti.

PubMed

Chang, Cheng; Shen, Wen-Kai; Wang, Tzu-Ting; Lin, Ying-Hsi; Hsu, Err-Lieh; Dai, Shu-Mei

2009-04-01

To identify pertinent mutations associated with knockdown resistance to permethrin, the entire coding sequence of the voltage-gated sodium channel gene Aa-para was sequenced and analyzed from a Per-R strain with 190-fold resistance to permethrin and two susceptible strains of Aedes aegypti. The longest transcript, a 6441bp open reading frame, encodes 2147 amino acid residues with an estimated molecular mass of 241kDa. A total of 33 exons were found in the Aa-para gene over 293kb of genomic DNA. Three previously unreported optional exons were identified. The first two exons, m and n, were located within the intracellular domain I/II, and the third, f', was found within the II/III linkers. The two mutually exclusive exons, d and l, were the only alternative exons in all the cDNA clones sequenced in this study. The most distinct finding was a novel amino acid substitution mutation, D1794Y, located within the extracellular linker between IVS5 and IVS6, which is concurrent with the known V1023G mutation in Aa-para of the Per-R strain. The high frequency and coexistence of the two mutations in the Per-R strain suggest that they might exert a synergistic effect to provide the knockdown resistance to permethrin. Furthermore, both cDNA and genomic DNA data from the same individual mosquitoes have demonstrated that RNA editing was not involved in amino acid substitutions of the Per-R strain.

Pax6 influences expression patterns of genes involved in neuro- degeneration.

PubMed

Mishra, Suman; Maurya, Shashank Kumar; Srivastava, Khushboo; Shukla, Sachin; Mishra, Rajnikant

2015-10-01

Pax6, a highly conserved multifunctional transcription factor, has been critical for neurogenesis and neuronal plasticity. It is presumed that if level of Pax6 approaches either low or null, critical genes responsible for maintaining functional status of neurons or glia would be modulated. Therefore, it has been intended to explore possibility of either direct or indirect influence of Pax6 in neurodegeneration. The cell lines having origin of murine embryonic fibroblast (Pax6-non expressing, NIH3T3-cell line), murine neuroblastoma (Pax6-expressing brain-derived, Neuro-2a-cell line), and human glioblastoma-astrocytoma (U87MG) were cultured and maintained in a CO2 incubator at 37°C and 5% CO2 in DMEM containing 10% fetal bovine serum. The knockdown of endogenous Pax6 in Neuro-2a cells was achieved through siRNA based gene knock-down approach. The efficiency and validation of knock-down was done by real time PCR. The knock-down of Pax6 was successfully achieved. The levels of expression of transcripts of some of the proposed putative markers of neurodegeneration like Pax6, S100β, GFAP, BDNF, NGN2, p73α, p73δ, LDH, SOD, and Catalase were analyzed in Pax6 knockdown condition for analysis of role of Pax6 in neurodegeneration. Since the Pax6 has been proposed to bind to promoter sequences of catalase, and catalase suppresses TGFβ, relative lower levels of catalase in Neuro-2a and U-87MG as compared to NIH-3T3 indicates a possible progressive dominant negative impact of Pax6. However, presence of SOD and LDH indicates alternative protective mechanism. Presence of BDNF and TGFβ indicates association between them in glioblastoma-astrocytoma. Therefore, Pax6 seems to be involved directly with p53 and TGFβ mediated pathways and indirectly with redox-sensitive pathway regulation. The neurodegenerative markers S100β, GFAP, BDNF, NGN2, p73α, p73δ, observed downregulated in Pax6 knockdown condition suggest Pax6-mediated regulation of these markers. Observations enlighten

A study of structural properties of gene network graphs for mathematical modeling of integrated mosaic gene networks.

PubMed

Petrovskaya, Olga V; Petrovskiy, Evgeny D; Lavrik, Inna N; Ivanisenko, Vladimir A

2017-04-01

Gene network modeling is one of the widely used approaches in systems biology. It allows for the study of complex genetic systems function, including so-called mosaic gene networks, which consist of functionally interacting subnetworks. We conducted a study of a mosaic gene networks modeling method based on integration of models of gene subnetworks by linear control functionals. An automatic modeling of 10,000 synthetic mosaic gene regulatory networks was carried out using computer experiments on gene knockdowns/knockouts. Structural analysis of graphs of generated mosaic gene regulatory networks has revealed that the most important factor for building accurate integrated mathematical models, among those analyzed in the study, is data on expression of genes corresponding to the vertices with high properties of centrality.

Knockdown of SLC41A1 magnesium transporter promotes mineralization and attenuates magnesium inhibition during osteogenesis of mesenchymal stromal cells.

PubMed

Tsao, Yu-Tzu; Shih, Ya-Yi; Liu, Yu-An; Liu, Yi-Shiuan; Lee, Oscar K

2017-02-21

Magnesium is essential for numerous physiological functions. Magnesium exists mostly in bone and the amount is dynamically regulated by skeletal remodeling. Accelerating bone mass loss occurs when magnesium intake is insufficient; whereas high magnesium could lead to mineralization defects. However, the underlying magnesium regulatory mechanisms remain elusive. In the present study, we investigated the effects of high extracellular magnesium concentration on osteogenic differentiation of mesenchymal stromal/stem cells (MSCs) and the role of magnesium transporter SLC41A1 in the mineralization process. Murine MSCs derived from the bone marrow of BALB/c mouse or commercially purchased human MSCs were treated with osteogenic induction medium containing 5.8 mM magnesium chloride and the osteogenic differentiation efficiency was compared with that of MSCs in normal differentiation medium containing 0.8 mM magnesium chloride by cell morphology, gene expression profile of osteogenic markers, and Alizarin Red staining. Slc41a1 gene knockdown in MSCs was performed by siRNA transfection using Lipofectamine RNAiMAX, and the differentiation efficiency of siRNA-treated MSCs was also assessed. High concentration of extracellular magnesium ion inhibited mineralization during osteogenic differentiation of MSCs. Early osteogenic marker genes including osterix, alkaline phosphatase, and type I collagen were significantly downregulated in MSCs under high concentration of magnesium, whereas late marker genes such as osteopontin, osteocalcin, and bone morphogenetic protein 2 were upregulated with statistical significance compared with those in normal differentiation medium containing 0.8 mM magnesium. siRNA treatment targeting SLC41A1 magnesium transporter, a member of the solute carrier family with a predominant Mg 2+ efflux system, accelerated the mineralization process and ameliorated the inhibition of mineralization caused by high concentration of magnesium. High concentration of

Evaluation of biolistic gene transfer methods in vivo using non-invasive bioluminescent imaging techniques.

PubMed

Xia, Jixiang; Martinez, Angela; Daniell, Henry; Ebert, Steven N

2011-06-02

Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun") delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI) methods. Plasmid DNA carrying the firefly luciferase (LUC) reporter gene under the control of the human Cytomegalovirus (CMV) promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter) using different DNA Loading Ratios (DLRs), and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50) at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results demonstrate that different tissues show different

Knockdown of Both Mitochondrial Isocitrate Dehydrogenase Enzymes In Pancreatic Beta Cells Inhibits Insulin Secretion

PubMed Central

MacDonald, Michael J.; Brown, Laura J.; Longacre, Melissa J.; Stoker, Scott W.; Kendrick, Mindy A.; Hasan, Noaman M.

2013-01-01

Background There are three isocitrate dehydrogenases (IDHs) in the pancreatic insulin cell; IDH1 (cytosolic) and IDH2 (mitochondrial) use NADP(H). IDH3 is mitochondrial, uses NAD(H) and was believed to be the IDH that supports the citric acid cycle. Methods With shRNAs targeting mRNAs for these enzymes we generated cell lines from INS-1 832/13 cells with severe (80%–90%) knockdown of the mitochondrial IDHs separately and together in the same cell line. Results With knockdown of both mitochondrial IDH’s mRNA, enzyme activity and protein level, but not with knockdown of one mitochondrial IDH, glucose- and BCH (an allosteric activator of glutamate dehydrogenase)-plus-glutamine-stimulated insulin release were inhibited. Cellular levels of citrate, α-ketoglutarate, malate and ATP were altered in patterns consistent with blockage at the mitochondrial IDH reactions. We were able to generate only 50% knockdown of Idh1 mRNA in multiple cell lines (without inhibition of insulin release) possibly because greater knockdown of IDH1 was not compatible with cell line survival. Conclusions The mitochondrial IDHs are redundant for insulin secretion. When both enzymes are severely knocked down, their low activities (possibly assisted by transport of IDH products and other metabolic intermediates from the cytosol into mitochondria) are sufficient for cell growth, but inadequate for insulin secretion when the requirement for intermediates is certainly more rapid. The results also indicate that IDH2 can support the citric acid cycle. General Significance As almost all mammalian cells possess substantial amounts of all three IDH enzymes, the biological principles suggested by these results are probably extrapolatable to many tissues. PMID:23876293

Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases.

PubMed

Sahoo, Pravas Ranjan; Sethy, Kamadev; Mohapatra, Swagat; Panda, Debasis

2016-05-01

India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.

Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-04

The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

Specific knockdown of Oct4 and beta2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells.

PubMed

Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W

2004-01-01

We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.

The Influence of Endocrine Disrupting Chemicals on the Proliferation of ERα Knockdown-Human Breast Cancer Cell Line MCF-7; New Attempts by RNAi Technology

PubMed Central

Miyakoshi, Takashi; Miyajima, Katsuhiro; Takekoshi, Susumu; Osamura, Robert Yoshiyuki

2009-01-01

Bisphenol A (BPA) is a monomer use in manufacturing a wide range of chemical products which include epoxy resins and polycarbonate. It has been reported that BPA increases the cell proliferation activity of human breast cancer MCF-7 cells as well as 17-β estradiol (E2) and diethylstilbestrol (DES). However, BPA induces target genes through ER-dependent and ER-independent manners which are different from the actions induced by E2. Therefore, BPA may be unique in estrogen-dependent cell proliferation compared to other endocrine disrupting chemicals (EDCs). In the present study, to test whether ERα is essential to the BPA-induced proliferation on MCF-7 cells, we suppressed the ERα expression of MCF-7 cells by RNA interference (RNAi). Proliferation effects in the presence of E2, DES and BPA were not observed in ERα-knockdown MCF-7 cells in comparison with control MCF-7. In addition, a marker of proliferative potential, MIB-1 labeling index (LI), showed no change in BPA-treated groups compared with vehicle-treated groups on ERα-knockdown MCF-7 cells. In conclusion, we demonstrated that ERα has a role in BPA-induced cell proliferation as well as E2 and DES. Moreover, this study indicated that the direct knockdown of ERα using RNAi serves as an additional tool to evaluate, in parallel with MCF-7 cell proliferation assay, for potential EDCs. PMID:19492024

Development of functional ectopic compound eyes in scarabaeid beetles by knockdown of orthodenticle.

PubMed

Zattara, Eduardo E; Macagno, Anna L M; Busey, Hannah A; Moczek, Armin P

2017-11-07

Complex traits like limbs, brains, or eyes form through coordinated integration of diverse cell fates across developmental space and time, yet understanding how complexity and integration emerge from uniform, undifferentiated precursor tissues remains limited. Here, we use ectopic eye formation as a paradigm to investigate the emergence and integration of novel complex structures following massive ontogenetic perturbation. We show that down-regulation via RNAi of a single head patterning gene- orthodenticle -induces ectopic structures externally resembling compound eyes at the middorsal adult head of both basal and derived scarabaeid beetle species (Onthophagini and Oniticellini). Scanning electron microscopy documents ommatidial organization of these induced structures, while immunohistochemistry reveals the presence of rudimentary ommatidial lenses, crystalline cones, and associated neural-like tissue within them. Further, RNA-sequencing experiments show that after orthodenticle down-regulation, the transcriptional signature of the middorsal head-the location of ectopic eye induction-converges onto that of regular compound eyes, including up-regulation of several retina-specific genes. Finally, a light-aversion behavioral assay to assess functionality reveals that ectopic compound eyes can rescue the ability to respond to visual stimuli when wild-type eyes are surgically removed. Combined, our results show that knockdown of a single gene is sufficient for the middorsal head to acquire the competence to ectopically generate a functional compound eye-like structure. These findings highlight the buffering capacity of developmental systems, allowing massive genetic perturbations to be channeled toward orderly and functional developmental outcomes, and render ectopic eye formation a widely accessible paradigm to study the evolution of complex systems. Published under the PNAS license.

Pten Knockdown in vivo Increases Excitatory Drive onto Dentate Granule Cells

PubMed Central

Luikart, Bryan W.; Schnell, Eric; Washburn, Eric K.; Bensen, AeSoon L.; Tovar, Kenneth R.; Westbrook, Gary L.

2011-01-01

Some cases of autism spectrum disorder (ASD) have mutations in the lipid phosphatase, Pten (phosphatase and tensin homolog on chromosome 10). Tissue specific deletion of Pten in the hippocampus and cortex of mice causes anatomical and behavioral abnormalities similar to human autism. However, the impact of reductions in Pten on synaptic and circuit function remains unexplored. We used in vivo stereotaxic injections of lentivirus expressing an shRNA to knockdown Pten in mouse neonatal and young adult dentate granule cells. We then assessed the morphology and synaptic physiology between two weeks and four months later. Confocal imaging of the hippocampus revealed a marked increase in granule cell size and an increase in dendritic spine density. The onset of morphological changes occurred earlier in neonatal mice than in young adults. We used whole-cell recordings from granule cells in acute slices to assess synaptic function following Pten knockdown. Consistent with the increase in dendritic spines, the frequency of excitatory miniature and spontaneous postsynaptic currents increased. However, there was little or no effect on inhibitory postsynaptic currents. Thus Pten knockdown results in an imbalance between excitatory and inhibitory synaptic activity. Because reductions in Pten affected mature granule cells as well as developing granule cells, we suggest that the disruption of circuit function by Pten hypofunction may be ongoing well beyond early development. PMID:21411674

Keap1 knockdown increases markers of metabolic syndrome after long-term high fat diet feeding.

PubMed

More, Vijay R; Xu, Jialin; Shimpi, Prajakta C; Belgrave, Clyde; Luyendyk, James P; Yamamoto, Masayuki; Slitt, Angela L

2013-08-01

The nuclear factor E2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway upregulates antioxidant and biotransformation enzyme expression to counter cellular oxidative stress. The contributions of Nrf2 to other cellular functions, such as lipid homeostasis, are emerging. This study was conducted to determine how enhanced Nrf2 activity influences the progression of metabolic syndrome with long-term high-fat diet (HFD) feeding. C57BL/6 and Keap1-knockdown (Keap1-KD) mice, which exhibit enhanced Nrf2 activity, were fed a HFD for 24 weeks. Keap1-KD mice had higher body weight and white adipose tissue mass compared to C57BL/6 mice on HFD, along with increased inflammation and lipogenic gene expression. HFD feeding increased hepatic steatosis and inflammation to a greater extent in Keap1-KD mice compared to C57BL/6 mice, which was associated with increased liver Cd36, fatty acid-binding protein 4, and monocyte chemoattractant protein 1 mRNA expression, as well as increased acetyl-CoA carboxylase 1 and stearoyl-CoA desaturase-1 protein expression. The HFD altered short-term glucose homeostasis to a greater degree in Keap-KD mice compared to C57BL/6 mice, which was accompanied by downregulation of insulin receptor substrate 1 mRNA expression in skeletal muscle. Together, the results indicate that Keap1 knockdown, on treatment with HFD, increases certain markers of metabolic syndrome. Copyright © 2013 Elsevier Inc. All rights reserved.

Knockdown of the juvenile hormone receptor gene inhibits soldier-specific morphogenesis in the damp-wood termite Zootermopsis nevadensis (Isoptera: Archotermopsidae).

PubMed

Masuoka, Yudai; Yaguchi, Hajime; Suzuki, Ryutaro; Maekawa, Kiyoto

2015-09-01

The Methoprene-tolerant (Met) protein has been established as a juvenile hormone (JH) receptor. Knockdown of the Met gene caused precocious metamorphosis and suppression of ovarian development. However, the function of Met in caste development of social insects is unclear. In termites, JH acts as a central factor for caste development, especially for soldier differentiation, which involves two molts from workers via a presoldier stage. Increased JH titer in workers is needed for the presoldier molt, and the high JH titer is maintained throughout the presoldier period. Although presoldiers have the fundamental morphological features of soldiers, the nature of the cuticle is completely different from that of soldiers. We expected that JH signals via Met are involved in soldier-specific morphogenesis of the head and mandibles during soldier differentiation, especially in the presoldier period, in natural conditions. To test this hypothesis, we focused on soldier differentiation in an incipient colony of the damp-wood termite Zootermopsis nevadensis. Met homolog (ZnMet) expression in heads increased just after the presoldier molt. This high expression was reduced by ZnMet double stranded (dsRNA) injection before the presoldier molt. Although this treatment did not cause any morphological changes in presoldiers, it caused strong effects on soldiers, their mandibles being significantly shorter and head capsules smaller than those of control soldiers. Injection of ZnMet dsRNA throughout the presoldier stage did not affect the formation of soldier morphology, including cuticle formation. These results suggested that the rapid increase in ZnMet expression and subsequent activation of JH signaling just after the presoldier molt are needed for the formation of soldier-specific weapons. Therefore, besides its established role in insect metamorphosis, the JH receptor signaling also underlies soldier development in termites. Copyright © 2015 Elsevier Ltd. All rights reserved.

Enhanced radiosensitivity and radiation-induced apoptosis in glioma CD133-positive cells by knockdown of SirT1 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, C.-J.; Hsu, C.-C.; Department of Surgery, Chi-Mei Medical Center, Taipei, Taiwan

2009-03-06

CD133-expressing glioma cells play a critical role in tumor recovery after treatment and are resistant to radiotherapy. Herein, we demonstrated that glioblastoma-derived CD133-positive cells (GBM-CD133{sup +}) are capable of self-renewal and express high levels of embryonic stem cell genes and SirT1 compared to GBM-CD133{sup -} cells. To evaluate the role of SirT1 in GBM-CD133{sup +}, we used a lentiviral vector expressing shRNA to knock-down SirT1 expression (sh-SirT1) in GBM-CD133{sup +}. Silencing of SirT1 significantly enhanced the sensitivity of GBM-CD133{sup +} to radiation and increased the level of radiation-mediated apoptosis. Importantly, knock-down of SirT1 increased the effectiveness of radiotherapy in themore » inhibition of tumor growth in nude mice transplanted with GBM-CD133{sup +}. Kaplan-Meier survival analysis indicated that the mean survival rate of GBM-CD133{sup +} mice treated with radiotherapy was significantly improved by Sh-SirT1 as well. In sum, these results suggest that SirT1 is a potential target for increasing the sensitivity of GBM and glioblastoma-associated cancer stem cells to radiotherapy.« less

Characterization of Gonadotrope Secretoproteome Identifies Neurosecretory Protein VGF-derived Peptide Suppression of Follicle-stimulating Hormone Gene Expression*

PubMed Central

Wang, Qian; Jia, Jingjing; Chikina, Maria; Pincas, Hanna; Dolios, Georgia; Sasaki, Kazuki; Wang, Rong; Minamino, Naoto; Sealfon, Stuart C.

2016-01-01

Reproductive function is controlled by the pulsatile release of hypothalamic gonadotropin-releasing hormone (GnRH), which regulates the expression of the gonadotropins luteinizing hormone and FSH in pituitary gonadotropes. Paradoxically, Fshb gene expression is maximally induced at lower frequency GnRH pulses, which provide a very low average concentration of GnRH stimulation. We studied the role of secreted factors in modulating gonadotropin gene expression. Inhibition of secretion specifically disrupted gonadotropin subunit gene regulation but left early gene induction intact. We characterized the gonadotrope secretoproteome and global mRNA expression at baseline and after Gαs knockdown, which has been found to increase Fshb gene expression (1). We identified 1077 secreted proteins or peptides, 19 of which showed mRNA regulation by GnRH or/and Gαs knockdown. Among several novel secreted factors implicated in Fshb gene regulation, we focused on the neurosecretory protein VGF. Vgf mRNA, whose gene has been implicated in fertility (2), exhibited high induction by GnRH and depended on Gαs. In contrast with Fshb induction, Vgf induction occurred preferentially at high GnRH pulse frequency. We hypothesized that a VGF-derived peptide might regulate Fshb gene induction. siRNA knockdown or extracellular immunoneutralization of VGF augmented Fshb mRNA induction by GnRH. GnRH stimulated the secretion of the VGF-derived peptide NERP1. NERP1 caused a concentration-dependent decrease in Fshb gene induction. These findings implicate a VGF-derived peptide in selective regulation of the Fshb gene. Our results support the concept that signaling specificity from the cell membrane GnRH receptor to the nuclear Fshb gene involves integration of intracellular signaling and exosignaling regulatory motifs. PMID:27466366

YAP and MRTF-A, transcriptional co-activators of RhoA-mediated gene expression, are critical for glioblastoma tumorigenicity.

PubMed

Yu, Olivia M; Benitez, Jorge A; Plouffe, Steven W; Ryback, Daniel; Klein, Andrea; Smith, Jeff; Greenbaum, Jason; Delatte, Benjamin; Rao, Anjana; Guan, Kun-Liang; Furnari, Frank B; Chaim, Olga Meiri; Miyamoto, Shigeki; Brown, Joan Heller

2018-06-11

The role of YAP (Yes-associated protein 1) and MRTF-A (myocardin-related transcription factor A), two transcriptional co-activators regulated downstream of GPCRs (G protein-coupled receptors) and RhoA, in the growth of glioblastoma cells and in vivo glioblastoma multiforme (GBM) tumor development was explored using human glioblastoma cell lines and tumor-initiating cells derived from patient-derived xenografts (PDX). Knockdown of these co-activators in GSC-23 PDX cells using short hairpin RNA significantly attenuated in vitro self-renewal capability assessed by limiting dilution, oncogene expression, and neurosphere formation. Orthotopic xenografts of the MRTF-A and YAP knockdown PDX cells formed significantly smaller tumors and were of lower morbidity than wild-type cells. In vitro studies used PDX and 1321N1 glioblastoma cells to examine functional responses to sphingosine 1-phosphate (S1P), a GPCR agonist that activates RhoA signaling, demonstrated that YAP signaling was required for cell migration and invasion, whereas MRTF-A was required for cell adhesion; both YAP and MRTF-A were required for proliferation. Gene expression analysis by RNA-sequencing of S1P-treated MRTF-A or YAP knockout cells identified 44 genes that were induced through RhoA and highly dependent on YAP, MRTF-A, or both. Knockdown of F3 (tissue factor (TF)), a target gene regulated selectively through YAP, blocked cell invasion and migration, whereas knockdown of HBEGF (heparin-binding epidermal growth factor-like growth factor), a gene selectively induced through MRTF-A, prevented cell adhesion in response to S1P. Proliferation was sensitive to knockdown of target genes regulated through either or both YAP and MRTF-A. Expression of TF and HBEGF was also selectively decreased in tumors from PDX cells lacking YAP or MRTF-A, indicating that these transcriptional pathways are regulated in preclinical GBM models and suggesting that their activation through GPCRs and RhoA contributes to growth and

Gene Profiling Technique to Accelerate Stem Cell Therapies for Eye Diseases

MedlinePlus

... like RPE. They also use a technique called quantitative RT-PCR to measure the expression of genes ... higher in iPS cells than mature RPE. But quantitative RT-PCR only permits the simultaneous measurement of ...

Transcriptome and Proteome Analyses of TNFAIP8 Knockdown Cancer Cells Reveal New Insights into Molecular Determinants of Cell Survival and Tumor Progression.

PubMed

Day, Timothy F; Mewani, Rajshree R; Starr, Joshua; Li, Xin; Chakravarty, Debyani; Ressom, Habtom; Zou, Xiaojun; Eidelman, Ofer; Pollard, Harvey B; Srivastava, Meera; Kasid, Usha N

2017-01-01

Tumor necrosis factor-α-inducible protein 8 (TNFAIP8) is the first discovered oncogenic and an anti-apoptotic member of a conserved TNFAIP8 or TIPE family of proteins. TNFAIP8 mRNA is induced by NF-kB, and overexpression of TNFAIP8 has been correlated with poor prognosis in many cancers. Downregulation of TNFAIP8 expression has been associated with decreased pulmonary colonization of human tumor cells, and enhanced sensitivities of tumor xenografts to radiation and docetaxel. Here we have investigated the effects of depletion of TNFAIP8 on the mRNA, microRNA and protein expression profiles in prostate and breast cancers and melanoma. Depending on the tumor cell type, knockdown of TNFAIP8 was found to be associated with increased mRNA expression of several antiproliferative and apoptotic genes (e.g., IL-24, FAT3, LPHN2, EPHA3) and fatty acid oxidation gene ACADL, and decreased mRNA levels of oncogenes (e.g., NFAT5, MALAT1, MET, FOXA1, KRAS, S100P, OSTF1) and glutamate transporter gene SLC1A1. TNFAIP8 knockdown cells also exhibited decreased expression of multiple onco-proteins (e.g., PIK3CA, SRC, EGFR, IL5, ABL1, GAP43), and increased expression of the orphan nuclear receptor NR4A1 and alpha 1 adaptin subunit of the adaptor-related protein complex 2 AP2 critical to clathrin-mediated endocytosis. TNFAIP8-centric molecules were found to be predominately implicated in the hypoxia-inducible factor-1α (HIF-1α) signaling pathway, and cancer and development signaling networks. Thus TNFAIP8 seems to regulate the cell survival and cancer progression processes in a multifaceted manner. Future validation of the molecules identified in this study is likely to lead to new subset of molecules and functional determinants of cancer cell survival and progression.

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

PubMed

Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited "half-ecdysis". In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control.

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua

PubMed Central

Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1st to 5th instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4th instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20–94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited “half-ecdysis”. In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control. PMID

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

SMARCA4 regulates gene expression and higher-order chromatin structure in proliferating mammary epithelial cells

PubMed Central

Barutcu, A. Rasim; Lajoie, Bryan R.; Fritz, Andrew J.; McCord, Rachel P.; Nickerson, Jeffrey A.; van Wijnen, Andre J.; Lian, Jane B.; Stein, Janet L.; Dekker, Job; Stein, Gary S.; Imbalzano, Anthony N.

2016-01-01

The packaging of DNA into chromatin plays an important role in transcriptional regulation and nuclear processes. Brahma-related gene-1 SMARCA4 (also known as BRG1), the essential ATPase subunit of the mammalian SWI/SNF chromatin remodeling complex, uses the energy from ATP hydrolysis to disrupt nucleosomes at target regions. Although the transcriptional role of SMARCA4 at gene promoters is well-studied, less is known about its role in higher-order genome organization. SMARCA4 knockdown in human mammary epithelial MCF-10A cells resulted in 176 up-regulated genes, including many related to lipid and calcium metabolism, and 1292 down-regulated genes, some of which encode extracellular matrix (ECM) components that can exert mechanical forces and affect nuclear structure. ChIP-seq analysis of SMARCA4 localization and SMARCA4-bound super-enhancers demonstrated extensive binding at intergenic regions. Furthermore, Hi-C analysis showed extensive SMARCA4-mediated alterations in higher-order genome organization at multiple resolutions. First, SMARCA4 knockdown resulted in clustering of intra- and inter-subtelomeric regions, demonstrating a novel role for SMARCA4 in telomere organization. SMARCA4 binding was enriched at topologically associating domain (TAD) boundaries, and SMARCA4 knockdown resulted in weakening of TAD boundary strength. Taken together, these findings provide a dynamic view of SMARCA4-dependent changes in higher-order chromatin organization and gene expression, identifying SMARCA4 as a novel component of chromatin organization. PMID:27435934

Knockdown of microtubule actin crosslinking factor 1 inhibits cell proliferation in MC3T3-E1 osteoblastic cells

PubMed Central

Hu, Lifang; Su, Peihong; Li, Runzhi; Yan, Kun; Chen, Zhihao; Shang, Peng; Qian, Airong

2015-01-01

Microtubule actin crosslinking factor 1 (MACF1), a widely expressed cytoskeletal linker, plays important roles in various cells by regulating cytoskeleton dynamics. However, its role in osteoblastic cells is not well understood. Based on our previous findings that the association of MACF1 with F-actin and microtubules in osteoblast-like cells was altered under magnetic force conditions, here, by adopting a stable MACF1-knockdown MC3T3-E1 osteoblastic cell line, we found that MACF1 knockdown induced large cells with a binuclear/multinuclear structure. Further, immunofluorescence staining showed disorganization of F-actin and microtubules in MACF1-knockdown cells. Cell counting revealed significant decrease of cell proliferation and cell cycle analysis showed an S phase cell cycle arrest in MACF1-knockdown cells. Moreover and interestingly, MACF1 knockdown showed a potential effect on cellular MTT reduction activity and mitochondrial content, suggesting an impact on cellular metabolic activity. These results together indicate an important role of MACF1 in regulating osteoblastic cell morphology and function. [BMB Reports 2015; 48(10): 583-588] PMID:26277981

Knockdown of microtubule actin crosslinking factor 1 inhibits cell proliferation in MC3T3-E1 osteoblastic cells.

PubMed

Hu, Lifang; Su, Peihong; Li, Runzhi; Yan, Kun; Chen, Zhihao; Shang, Peng; Qian, Airong

2015-10-01

Microtubule actin crosslinking factor 1 (MACF1), a widely expressed cytoskeletal linker, plays important roles in various cells by regulating cytoskeleton dynamics. However, its role in osteoblastic cells is not well understood. Based on our previous findings that the association of MACF1 with F-actin and microtubules in osteoblast-like cells was altered under magnetic force conditions, here, by adopting a stable MACF1-knockdown MC3T3-E1 osteoblastic cell line, we found that MACF1 knockdown induced large cells with a binuclear/multinuclear structure. Further, immunofluorescence staining showed disorganization of F-actin and microtubules in MACF1-knockdown cells. Cell counting revealed significant decrease of cell proliferation and cell cycle analysis showed an S phase cell cycle arrest in MACF1-knockdown cells. Moreover and interestingly, MACF1 knockdown showed a potential effect on cellular MTT reduction activity and mitochondrial content, suggesting an impact on cellular metabolic activity. These results together indicate an important role of MACF1 in regulating osteoblastic cell morphology and function.

Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

PubMed

Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

2011-08-23

Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

PubMed Central

Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L

2012-01-01

The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID

Characterization of Gonadotrope Secretoproteome Identifies Neurosecretory Protein VGF-derived Peptide Suppression of Follicle-stimulating Hormone Gene Expression.

PubMed

Choi, Soon Gang; Wang, Qian; Jia, Jingjing; Chikina, Maria; Pincas, Hanna; Dolios, Georgia; Sasaki, Kazuki; Wang, Rong; Minamino, Naoto; Salton, Stephen R J; Sealfon, Stuart C

2016-09-30

Reproductive function is controlled by the pulsatile release of hypothalamic gonadotropin-releasing hormone (GnRH), which regulates the expression of the gonadotropins luteinizing hormone and FSH in pituitary gonadotropes. Paradoxically, Fshb gene expression is maximally induced at lower frequency GnRH pulses, which provide a very low average concentration of GnRH stimulation. We studied the role of secreted factors in modulating gonadotropin gene expression. Inhibition of secretion specifically disrupted gonadotropin subunit gene regulation but left early gene induction intact. We characterized the gonadotrope secretoproteome and global mRNA expression at baseline and after Gα s knockdown, which has been found to increase Fshb gene expression (1). We identified 1077 secreted proteins or peptides, 19 of which showed mRNA regulation by GnRH or/and Gα s knockdown. Among several novel secreted factors implicated in Fshb gene regulation, we focused on the neurosecretory protein VGF. Vgf mRNA, whose gene has been implicated in fertility (2), exhibited high induction by GnRH and depended on Gα s In contrast with Fshb induction, Vgf induction occurred preferentially at high GnRH pulse frequency. We hypothesized that a VGF-derived peptide might regulate Fshb gene induction. siRNA knockdown or extracellular immunoneutralization of VGF augmented Fshb mRNA induction by GnRH. GnRH stimulated the secretion of the VGF-derived peptide NERP1. NERP1 caused a concentration-dependent decrease in Fshb gene induction. These findings implicate a VGF-derived peptide in selective regulation of the Fshb gene. Our results support the concept that signaling specificity from the cell membrane GnRH receptor to the nuclear Fshb gene involves integration of intracellular signaling and exosignaling regulatory motifs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Feedback regulation of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 via ATM/Chk2 pathway contributes to the resistance of MCF-7 breast cancer cells to cisplatin.

PubMed

Lv, Juan; Qian, Ying; Ni, Xiaoyan; Xu, Xiuping; Dong, Xuejun

2017-03-01

The methyl methanesulfonate and ultraviolet-sensitive gene clone 81 protein is a structure-specific nuclease that plays important roles in DNA replication and repair. Knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 has been found to sensitize cancer cells to chemotherapy. However, the underlying molecular mechanism is not well understood. We found that methyl methanesulfonate and ultraviolet-sensitive gene clone 81 was upregulated and the ATM/Chk2 pathway was activated at the same time when MCF-7 cells were treated with cisplatin. By using lentivirus targeting methyl methanesulfonate and ultraviolet-sensitive gene clone 81 gene, we showed that knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 enhanced cell apoptosis and inhibited cell proliferation in MCF-7 cells under cisplatin treatment. Abrogation of ATM/Chk2 pathway inhibited cell viability in MCF-7 cells in response to cisplatin. Importantly, we revealed that ATM/Chk2 was required for the upregulation of methyl methanesulfonate and ultraviolet-sensitive gene clone 81, and knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 resulted in inactivation of ATM/Chk2 pathway in response to cisplatin. Meanwhile, knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 activated the p53/Bcl-2 pathway in response to cisplatin. These data suggest that the ATM/Chk2 may promote the repair of DNA damage caused by cisplatin by sustaining methyl methanesulfonate and ultraviolet-sensitive gene clone 81, and the double-strand breaks generated by methyl methanesulfonate and ultraviolet-sensitive gene clone 81 may activate the ATM/Chk2 pathway in turn, which provide a novel mechanism of how methyl methanesulfonate and ultraviolet-sensitive gene clone 81 modulates DNA damage response and repair.

Silencing the Menkes Copper-Transporting ATPase (Atp7a) Gene in Rat Intestinal Epithelial (IEC-6) Cells Increases Iron Flux via Transcriptional Induction of Ferroportin 1 (Fpn1)123

PubMed Central

Gulec, Sukru; Collins, James F.

2014-01-01

The Menkes copper-transporting ATPase (Atp7a) gene is induced in rat duodenum during iron deficiency, consistent with copper accumulation in the intestinal mucosa and liver. To test the hypothesis that ATP7A influences intestinal iron metabolism, the Atp7a gene was silenced in rat intestinal epithelial (IEC-6) cells using short hairpin RNA (shRNA) technology. Perturbations in intracellular copper homeostasis were noted in knockdown cells, consistent with the dual roles of ATP7A in pumping copper into the trans-Golgi (for cuproenzyme synthesis) and exporting copper from cells. Intracellular iron concentrations were unaffected by Atp7a knockdown. Unexpectedly, however, vectorial iron (59Fe) transport increased (∼33%) in knockdown cells grown in bicameral inserts and increased further (∼70%) by iron deprivation (compared with negative control shRNA-transfected cells). Additional experiments were designed to elucidate the molecular mechanism of increased transepithelial iron flux. Enhanced iron uptake by knockdown cells was associated with increased expression of a ferrireductase (duodenal cytochrome b) and activity of a cell-surface ferrireductase. Increased iron efflux from knockdown cells was likely mediated via transcriptional activation of the ferroportin 1 gene (by an unknown mechanism). Moreover, Atp7a knockdown significantly attenuated expression of an iron oxidase [hephaestin (HEPH); by ∼80%] and membrane ferroxidase activity (by ∼50%). Cytosolic ferroxidase activity, however, was retained in knockdown cells (75% of control cells), perhaps compensating for diminished HEPH activity. This investigation has thus documented alterations in iron homeostasis associated with Atp7a knockdown in enterocyte-like cells. Alterations in copper transport, trafficking, or distribution may underlie the increase in transepithelial iron flux noted when ATP7A activity is diminished. PMID:24174620

Protein Knockdown Technology: Application of Ubiquitin Ligase to Cancer Therapy.

PubMed

Ohoka, Nobumichi; Shibata, Norihito; Hattori, Takayuki; Naito, Mikihiko

2016-01-01

Selective degradation of pathogenic proteins by small molecules in cells is a novel approach for development of therapeutic agents against various diseases, including cancer. We and others have developed a protein knockdown technology with a series of hybrid small compounds, called SNIPERs (Specific and Nongenetic IAP-dependent Protein ERasers); and peptidic chimeric molecules, called PROTACs (proteolysis-targeting chimeric molecules), which induce selective degradation of target proteins via the ubiquitin-proteasome pathway. These compounds include two different ligands connected by a linker; one is a ligand for a ubiquitin ligase and the other is a ligand for the target protein, which are expected to crosslink these proteins in cells. Theoretically, any cytosolic protein can be targeted for degradation by this technology. To date, several SNIPERs and PROTACs against various oncogenic proteins have been developed, which specifically induce polyubiquitylation and proteasomal degradation of the oncogenic proteins, resulting in cell death, growth arrest, or impaired migration of cancer cells. Thus, this protein knockdown technology has a great potential for cancer therapy.

Stable knockdown of Kif5b in MDCK cells leads to epithelial–mesenchymal transition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cui, Ju, E-mail: juzi.cui@gmail.com; Department of Biochemistry, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong SAR; Jin, Guoxiang

2015-07-17

Polarization of epithelial cells requires vectorial sorting and transport of polarity proteins to apical or basolateral domains. Kif5b is the mouse homologue of the human ubiquitous Kinesin Heavy Chain (uKHC). To investigate the function of Kif5b in epithelial cells, we examined the phenotypes of Kif5b-deficient MDCK cells. Stable knockdown of Kif5b in MDCK cells resulted in reduced cell proliferation rate, profound changes in cell morphology, loss of epithelial cell marker, and gain of mesenchymal marker, as well as increased cell migration, invasion, and tumorigenesis abilities. E-cadherin and NMMIIA could interact with Kif5b in polarized MDCK cells, and their expression levelsmore » were decreased in Kif5b-deficient MDCK cells. Overexpression of E-cadherin and NMMIIA in Kif5b depleted MDCK cells could decrease mesenchymal marker expression and cell migration ability. These results indicate that stable knockdown of Kif5b in MDCK cells can lead to epithelial–mesenchymal transition, which is mediated by defective E-cadherin and NMMIIA expression. - Highlights: • Knockdown of Kif5b in MDCK cells resulted in reduced cell proliferation rate. • Kif5b deficient MDCK cells underwent epithelial–mesenchymal transition. • E-cadherin and NMMIIA could interact with Kif5b in polarized MDCK cells. • Decreased E-cadherin and NMMIIA levels mediate EMT in Kif5b deficient MDCK cells. • Overexpression of E-cadherin and NMMIIA reverse the effects of Kif5b knockdown.« less

Study of the Role of siRNA Mediated Promoter Methylation in DNMT3B Knockdown and Alteration of Promoter Methylation of CDH1, GSTP1 Genes in MDA-MB -453 Cell Line.

PubMed

Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas

2017-01-01

Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.

20-Hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body.

PubMed

Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

2013-08-01

Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcR (DN) ) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body.

20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body

PubMed Central

Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

2013-01-01

Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061

Host adaptation to viruses relies on few genes with different cross-resistance properties

PubMed Central

Martins, Nelson E.; Faria, Vítor G.; Nolte, Viola; Schlötterer, Christian; Teixeira, Luis; Sucena, Élio; Magalhães, Sara

2014-01-01

Host adaptation to one parasite may affect its response to others. However, the genetics of these direct and correlated responses remains poorly studied. The overlap between these responses is instrumental for the understanding of host evolution in multiparasite environments. We determined the genetic and phenotypic changes underlying adaptation of Drosophila melanogaster to Drosophila C virus (DCV). Within 20 generations, flies selected with DCV showed increased survival after DCV infection, but also after cricket paralysis virus (CrPV) and flock house virus (FHV) infection. Whole-genome sequencing identified two regions of significant differentiation among treatments, from which candidate genes were functionally tested with RNAi. Three genes were validated—pastrel, a known DCV-response gene, and two other loci, Ubc-E2H and CG8492. Knockdown of Ubc-E2H and pastrel also led to increased sensitivity to CrPV, whereas knockdown of CG8492 increased susceptibility to FHV infection. Therefore, Drosophila adaptation to DCV relies on few major genes, each with different cross-resistance properties, conferring host resistance to several parasites. PMID:24711428

Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).

PubMed

Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash

2015-01-01

The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes

PubMed Central

Place, Elsie S.; Smith, James C.

2017-01-01

Tmem88a is a transmembrane protein that is thought to be a negative regulator of the Wnt signalling pathway. Several groups have used antisense morpholino oligonucleotides in an effort to characterise the role of tmem88a in zebrafish cardiovascular development, but they have not obtained consistent results. Here, we generate an 8 bp deletion in the coding region of the tmem88a locus using TALENs, and we have gone on to establish a viable homozygous tmem88aΔ8 mutant line. Although tmem88aΔ8 mutants have reduced expression of some key haematopoietic genes, differentiation of erythrocytes and neutrophils is unaffected, contradicting our previous study using antisense morpholino oligonucleotides. We find that expression of the tmem88a paralogue tmem88b is not significantly changed in tmem88aΔ8 mutants and injection of the tmem88a splice-blocking morpholino oligonucleotide into tmem88aΔ8 mutants recapitulates the reduction of erythrocytes observed in morphants using o-Dianisidine. This suggests that there is a partial, but inessential, requirement for tmem88a during haematopoiesis and that morpholino injection exacerbates this phenotype in tmem88a morpholino knockdown embryos. PMID:28192479

Knockdown Resistance Mutations in Aedes aegypti (Diptera: Culicidae) From Puerto Rico.

PubMed

Ponce-García, Gustavo; Del Río-Galvan, Samantha; Barrera, Roberto; Saavedra-Rodriguez, Karla; Villanueva-Segura, Karina; Felix, Gilberto; Amador, Manuel; Flores, Adriana E

2016-11-01

Permethrin resistance is widespread in Aedes aegypti (L.), the main dengue, zika, and chikungunya virus vector in Latin America and the Caribbean. A common mechanism of resistance to pyrethroids-knockdown resistance (kdr)-is conferred through mutations in the insect's voltage-dependent sodium channel. In this mosquito, around 10 replacement substitutions in the voltage-gated sodium channel gene (vgsc) have been reported in pyrethroid-resistant strains. Two of these mutations, named Ile1,016 and Cys1,534, are widespread in mosquito populations from Latin America and the Caribbean. This study assessed the levels of permethrin resistance and the frequency of two kdr mutations in eight Ae. aegypti populations collected in Puerto Rico in 2013. Permethrin resistance factors ranged from 33-214-fold relative to the New Orleans reference strain. The frequency of kdr mutation Ile1,016 ranged from 0.65 to fixation (1.0), and for Cys1,534 frequencies varied from 0.8 to fixation. Alarmingly, two populations-Carolina and Caguas-reached fixation at both loci. Our results suggest that permethrin effectiveness for Ae. aegypti control is compromised in these collections from Puerto Rico. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Assessing somatic hypermutation in Ramos B cells after overexpression or knockdown of specific genes.

PubMed

Upton, Dana C; Unniraman, Shyam

2011-11-01

B cells start their life with low affinity antibodies generated by V(D)J recombination. However, upon detecting a pathogen, the variable (V) region of an immunoglobulin (Ig) gene is mutated approximately 100,000-fold more than the rest of the genome through somatic hypermutation (SHM), resulting in high affinity antibodies. In addition, class switch recombination (CSR) produces antibodies with different effector functions depending on the kind of immune response that is needed for a particular pathogen. Both CSR and SHM are initiated by activation-induced cytidine deaminase (AID), which deaminates cytosine residues in DNA to produce uracils. These uracils are processed by error-prone forms of repair pathways, eventually leading to mutations and recombination. Our current understanding of the molecular details of SHM and CSR come from a combination of studies in mice, primary cells, cell lines, and cell-free experiments. Mouse models remain the gold standard with genetic knockouts showing critical roles for many repair factors (e.g. Ung, Msh2, Msh6, Exo1, and polymerase η). However, not all genes are amenable for knockout studies. For example, knockouts of several double-strand break repair proteins are embryonically lethal or impair B-cell development. Moreover, sometimes the specific function of a protein in SHM or CSR may be masked by more global defects caused by the knockout. In addition, since experiments in mice can be lengthy, altering expression of individual genes in cell lines has become an increasingly popular first step to identifying and characterizing candidate genes. Ramos - a Burkitt lymphoma cell line that constitutively undergoes SHM - has been a popular cell-line model to study SHM. One advantage of Ramos cells is that they have a built-in convenient semi-quantitative measure of SHM. Wild type cells express IgM and, as they pick up mutations, some of the mutations knock out IgM expression. Therefore, assaying IgM loss by fluorescence

Bactrocera dorsalis male sterilization by targeted RNA interference of spermatogenesis: empowering sterile insect technique programs

PubMed Central

Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying

2016-01-01

RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174

[MACF1 knockdown in glioblastoma multiforme cells increases temozolomide-induced cytotoxicity].

PubMed

Xie, Si-di; Chen, Zi-Yang; Wang, Hai; He, Min-Yi; Lu, Yun-Tao; Lei, Bing-Xi; Li, He-Zhen; Liu, Ya-Wei; Qi, Song-Tao

2017-09-20

To investigate the role of microtubule-actin crosslinking factor 1 (MACF1) in the response of glioma cells to temozolomide (TMZ). TMZ was applied to a human gliomablastoma cell line (U87) and changes in the protein expression and cellular localization were determined with Western blot, RT-PCR, and immunofluorescence. The responses of the cells with MACF1 expression knockdown by RNA interference to TMZ were assessed. TMZ-induced effects on MACF1 expression were also assessed by immunohistochemistry in a nude mouse model bearing human glioblastoma xenografts. TMZ resulted in significantly increased MACF1 expression (by about 2 folds) and changes in its localization in the gliomablastoma cells both in vitro and in vivo (P<0.01). Knockdown of MACF1 reduced the proliferation (by 45%) of human glioma cell lines treated with TMZ (P<0.01). TMZ-induced changes in MACF1 expression was accompanied by cytoskeletal rearrangement. MACF1 may be a potential therapeutic target for glioblastoma.

Knockdown of stromal interaction molecule 1 inhibits proliferation of colorectal cancer cells by inducing apoptosis.

PubMed

Yang, Dong; Dai, Xiaoyu; Li, Keqiang; Xie, Yangyang; Zhao, Jianpei; Dong, Mingjun; Yu, Hua; Kong, Zhenfang

2018-06-01

Stromal interaction molecule 1 (STIM1) is an endoplasmic reticulum Ca 2+ sensor which has been reported to be overexpressed in numerous types of cancer, and is involved in the cell proliferation, invasion, migration and metastasis frequently observed in cancer. However, the role of STIM1 in colorectal cancer (CRC) remains unknown. The purpose of the present study was to investigate the effect of STIM1 in human CRC. The expression of STIM1 was specifically knocked down using lentivirus-mediated small hairpin RNA (shRNA) interference techniques in the CRC cell lines HCT116 and SW1116. Subsequently, the efficiency of infection was confirmed using green fluorescent protein (GFP)-positive signals. The knockdown efficiency was further determined using the reverse transcription-quantitative polymerase chain reaction and western blotting analysis. As a result, CRC cell lines with STIM1 silenced were successfully constructed and subsequently employed in a series of cell function assays. Knockdown of STIM1 significantly suppressed cell proliferation and colony formation, as revealed by an MTT and colony formation assay. Furthermore, it was identified that STIM1 silencing may promote cell apoptosis through the induction of mitochondria-associated apoptosis, as was identified by increased expression levels of B-cell lymphoma 2 (Bcl-2)-associated death promoter, Bcl-2-associated X protein and poly(ADP-ribose) polymerase cleavage. Therefore, STIM1 may serve a critical role in the progression of CRC by regulating cell proliferation and apoptosis, which may provide a potential therapeutic target for the treatment of CRC.

RNAi-mediated germline knockdown of FABP4 increases body weight but does not improve the deranged nutrient metabolism of diet-induced obese mice.

PubMed

Yang, R; Castriota, G; Chen, Y; Cleary, M A; Ellsworth, K; Shin, M K; Tran, J-Lv; Vogt, T F; Wu, M; Xu, S; Yang, X; Zhang, B B; Berger, J P; Qureshi, S A

2011-02-01

To investigate the impact of reduced adipocyte fatty acid-binding protein 4 (FABP4) in control of body weight, glucose and lipid homeostasis in diet-induced obese (DIO) mice. We applied RNA interference (RNAi) technology to generate FABP4 germline knockdown mice to investigate their metabolic phenotype. RNAi-mediated knockdown reduced FABP4 mRNA expression and protein levels by almost 90% in adipocytes of standard chow-fed mice. In adipocytes of DIO mice, RNAi reduced FABP4 expression and protein levels by 70 and 80%, respectively. There was no increase in adipocyte FABP5 expression in FABP4 knockdown mice. The knockdown of FABP4 significantly increased body weight and fat mass in DIO mice. However, FABP4 knockdown did not affect plasma glucose and lipid homeostasis in DIO mice; nor did it improve their insulin sensitivity. Our data indicate that robust knockdown of FABP4 increases body weight and fat mass without improving glucose and lipid homeostasis in DIO mice.

Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

PubMed

Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

2015-09-01

Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish.

PubMed

Viringipurampeer, I A; Shan, X; Gregory-Evans, K; Zhang, J P; Mohammadi, Z; Gregory-Evans, C Y

2014-05-01

Achromatopsia is a progressive autosomal recessive retinal disease characterized by early loss of cone photoreceptors and later rod photoreceptor loss. In most cases, mutations have been identified in CNGA3, CNGB3, GNAT2, PDE6C or PDE6H genes. Owing to this genetic heterogeneity, mutation-independent therapeutic schemes aimed at preventing cone cell death are very attractive treatment strategies. In pde6c(w59) mutant zebrafish, cone photoreceptors expressed high levels of receptor-interacting protein kinase 1 (RIP1) and receptor-interacting protein kinase 3 (RIP3) kinases, key regulators of necroptotic cell death. In contrast, rod photoreceptor cells were alternatively immunopositive for caspase-3 indicating activation of caspase-dependent apoptosis in these cells. Morpholino gene knockdown of rip3 in pde6c(w59) embryos rescued the dying cone photoreceptors by inhibiting the formation of reactive oxygen species and by inhibiting second-order neuron remodelling in the inner retina. In rip3 morphant larvae, visual function was restored in the cones by upregulation of the rod phosphodiesterase genes (pde6a and pde6b), compensating for the lack of cone pde6c suggesting that cones are able to adapt to their local environment. Furthermore, we demonstrated through pharmacological inhibition of RIP1 and RIP3 activity that cone cell death was also delayed. Collectively, these results demonstrate that the underlying mechanism of cone cell death in the pde6c(w59) mutant retina is through necroptosis, whereas rod photoreceptor bystander death occurs through a caspase-dependent mechanism. This suggests that targeting the RIP kinase signalling pathway could be an effective therapeutic intervention in retinal degeneration patients. As bystander cell death is an important feature of many retinal diseases, combinatorial approaches targeting different cell death pathways may evolve as an important general principle in treatment.

A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis

PubMed Central

Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor

2014-01-01

BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552

Fascin-1 knock-down of human glioma cells reduces their microvilli/filopodia while improving their susceptibility to lymphocyte-mediated cytotoxicity

PubMed Central

Hoa, Neil T; Ge, Lisheng; Erickson, Kate L; Kruse, Carol A; Cornforth, Andrew N; Kuznetsov, Yurii; McPherson, Alex; Martini, Filippo; Jadus, Martin R

2015-01-01

Cancer cells derived from Glioblastoma multiforme possess membranous protrusions allowing these cells to infiltrate surrounding tissue, while resisting lymphocyte cytotoxicity. Microvilli and filopodia are supported by actin filaments cross-linked by fascin. Fascin-1 was genetically silenced within human U251 glioma cells; these knock-down glioma cells lost their microvilli/filopodia. The doubling time of these fascin-1 knock-down cells was doubled that of shRNA control U251 cells. Fascin-1 knock-down cells lost their transmigratory ability responding to interleukin-6 or insulin-like growth factor-1. Fascin-1 silenced U251 cells were more easily killed by cytolytic lymphocytes. Fascin-1 knock-down provides unique opportunities to augment glioma immunotherapy by simultaneously targeting several key glioma functions: like cell transmigration, cell division and resisting immune responses. PMID:25901196

Concerted effects of heterogeneous nuclear ribonucleoprotein C1/C2 to control vitamin D-directed gene transcription and RNA splicing in human bone cells.

PubMed

Zhou, Rui; Park, Juw Won; Chun, Rene F; Lisse, Thomas S; Garcia, Alejandro J; Zavala, Kathryn; Sea, Jessica L; Lu, Zhi-Xiang; Xu, Jianzhong; Adams, John S; Xing, Yi; Hewison, Martin

2017-01-25

Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH) 2 D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH) 2 D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH) 2 D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH) 2 D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH) 2 D-mediated induction of transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Recent advances in functional perturbation and genome editing techniques in studying sea urchin development.

PubMed

Cui, Miao; Lin, Che-Yi; Su, Yi-Hsien

2017-09-01

Studies on the gene regulatory networks (GRNs) of sea urchin embryos have provided a basic understanding of the molecular mechanisms controlling animal development. The causal links in GRNs have been verified experimentally through perturbation of gene functions. Microinjection of antisense morpholino oligonucleotides (MOs) into the egg is the most widely used approach for gene knockdown in sea urchin embryos. The modification of MOs into a membrane-permeable form (vivo-MOs) has allowed gene knockdown at later developmental stages. Recent advances in genome editing tools, such as zinc-finger nucleases, transcription activator-like effector-based nucleases and the clustered regularly interspaced short palindromic repeat/clustered regularly interspaced short palindromic repeat-associated protein 9 (CRISPR/Cas9) system, have provided methods for gene knockout in sea urchins. Here, we review the use of vivo-MOs and genome editing tools in sea urchin studies since the publication of its genome in 2006. Various applications of the CRISPR/Cas9 system and their potential in studying sea urchin development are also discussed. These new tools will provide more sophisticated experimental methods for studying sea urchin development. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Knockdown of peroxiredoxin V increases glutamate‑induced apoptosis in HT22 hippocampal neuron cells.

PubMed

Shen, Gui-Nan; Liu, Lei; Feng, Li; Jin, Yu; Jin, Mei-Hua; Han, Ying-Hao; Jin, Cheng-Hao; Jin, Yong-Zhe; Lee, Dong-Soek; Kwon, Tae Ho; Cui, Yu-Dong; Sun, Hu-Nan

2018-06-01

High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated the regulatory effect of Prx V on glutamate‑induced effects on viability and apoptosis in HT22 cells. Western blotting was used for protein expression analysis and Annexin V/PI staining and flow cytometry for determination of apoptosis. The results demonstrated that glutamate may ROS‑dependently increase HT22 cell apoptosis and upregulate Prx V protein levels. Furthermore, knockdown of Prx V protein expression with a lentivirus significantly enhanced HT22 cell apoptosis mediated by glutamate, which was reversed by inhibition of ROS with N‑acetyl‑L‑cysteine. Inhibiting the extracellular signal‑regulated kinase (ERK) signaling pathway with PD98059, a specific inhibitor for ERK phosphorylation, markedly decreased glutamate‑induced HT22 cell apoptosis in Prx V knockdown cells, indicating the potential involvement of ERK signaling in glutamate‑induced HT22 cell apoptosis. In addition, an increase in nuclear apoptosis‑inducing factor was observed in Prx V knockdown HT22 cells following glutamate treatment, compared with mock cells, whereas no differences in B‑cell lymphoma‑2 and cleaved‑caspase‑3 protein expression levels were observed between mock and Prx V knockdown cells. The results of the present study indicated that Prx V may have potential as a therapeutic molecular target for glutamate‑induced neuronal cell death and provide novel insight into the role of Prx V in oxidative‑stress induced neuronal cell death.

Lentivirus-Mediated knockdown of tectonic family member 1 inhibits medulloblastoma cell proliferation

PubMed Central

Jing, Junjie; Wang, Chengfeng; Liang, Qinchuan; Zhao, Yang; Zhao, Qingshuang; Wang, Shousen; Ma, Jie

2015-01-01

Tectonic family member 1 (TCTN1) encodes a member of the tectonic family which are evolutionarily conserved secreted and transmembrane proteins, involving in a diverse variety of developmental processes. It has been demonstrated that tectonics expressed in regions that participate in Hedgehog (Hh) signaling during mouse embryonic development and was imperative for Hh-mediated patterning of the ventral neural tube. However, the expression and regulation of tectonics in human tumor is still not clear. In this study, shRNA-expressing lentivirus was constructed to knockdown TCTN1 in medulloblastoma cell line Daoy. The results showed that knockdown of TCTN1 inhibited cell proliferation and colony formation in Daoy cell line, also caused cell cycle arrest at the G2/M boundary. Taken all together, our data suggest that TCTN1 might play an important role in the progression of medulloblastoma. PMID:26550235

Lifespan and reproduction in brain-specific miR-29-knockdown mouse.

PubMed

Takeda, Toru; Tanabe, Hiroyuki

2016-03-18

The microRNA miR-29 is widely distributed and highly expressed in adult mouse brain during the mouse's lifetime. We recently created conditional mutant mice whose miR-29 was brain-specifically knocked down through overexpression of an antisense RNA transgene against miR-29. To explore a role for brain miR-29 in maximizing organismal fitness, we assessed somatic growth, reproduction, and lifespan in the miR-29-knockdown (KD) mice and their wild-type (WT) littermates. The KD mice were developmentally indistinguishable from WT mice with respect to gross morphology and physical activity. Fertility testing revealed that KD males were subfertile, whereas KD females were hyperfertile, only in terms of reproductive success, when compared to their gender-matched WT correspondents. Another phenotypic difference between KD and WT animals appeared in their lifespan data; KD males displayed an overall increasing tendency in post-reproductive survival relative to WT males. In contrast, KD females were prone to shorter lifespans than WT females. These results clarify that brain-targeted miR-29 knockdown affects both lifespan and reproduction in a gender-dependent manner, and moreover that the reciprocal responsiveness to the miR-29 knockdown between these two phenotypes in both genders closely follow life-course models based on the classical trade-off prediction wherein elaborate early-life energetic investment in reproduction entails accelerated late-life declines in survival, and vice versa. Thus, this study identified miR-29 as the first mammalian miRNA that is directly implicated in the lifetime trade-off between the two major fitness components, lifespan and reproduction. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Knowledge-guided gene prioritization reveals new insights into the mechanisms of chemoresistance.

PubMed

Emad, Amin; Cairns, Junmei; Kalari, Krishna R; Wang, Liewei; Sinha, Saurabh

2017-08-11

Identification of genes whose basal mRNA expression predicts the sensitivity of tumor cells to cytotoxic treatments can play an important role in individualized cancer medicine. It enables detailed characterization of the mechanism of action of drugs. Furthermore, screening the expression of these genes in the tumor tissue may suggest the best course of chemotherapy or a combination of drugs to overcome drug resistance. We developed a computational method called ProGENI to identify genes most associated with the variation of drug response across different individuals, based on gene expression data. In contrast to existing methods, ProGENI also utilizes prior knowledge of protein-protein and genetic interactions, using random walk techniques. Analysis of two relatively new and large datasets including gene expression data on hundreds of cell lines and their cytotoxic responses to a large compendium of drugs reveals a significant improvement in prediction of drug sensitivity using genes identified by ProGENI compared to other methods. Our siRNA knockdown experiments on ProGENI-identified genes confirmed the role of many new genes in sensitivity to three chemotherapy drugs: cisplatin, docetaxel, and doxorubicin. Based on such experiments and extensive literature survey, we demonstrate that about 73% of our top predicted genes modulate drug response in selected cancer cell lines. In addition, global analysis of genes associated with groups of drugs uncovered pathways of cytotoxic response shared by each group. Our results suggest that knowledge-guided prioritization of genes using ProGENI gives new insight into mechanisms of drug resistance and identifies genes that may be targeted to overcome this phenomenon.

Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene.

PubMed

Finckbeiner, Steve; Ko, Pin-Joe; Carrington, Blake; Sood, Raman; Gross, Kenneth; Dolnick, Bruce; Sufrin, Janice; Liu, Paul

2011-09-26

Despite detailed in vivo knowledge of glycolytic enolases and many bacterial non-enolase members of the superfamily, little is known about the in vivo function of vertebrate non-enolase enolase superfamily members (ENOSF1s). Results of previous studies suggest involvement of the β splice form of ENOSF1 in breast and colon cancers. This study used the zebrafish (Danio rerio) as a vertebrate model of ENOSF1β function. Whole mount in situ hybridization (WISH) showed that zebrafish ENOSF1β (enosf1b) is zygotic and expressed ubiquitously through the first 24 hours post fertilization (hpf). After 24 hpf, enosf1b expression is restricted to the notochord. Embryos injected with enosf1b-EGFP mRNA grew slower than EGFP mRNA-injected embryos but caught up to the EGFP-injected embryos by 48 hpf. Embryos injected with ATG or exon 10 enosf1b mRNA-targeting morpholinos had kinked notochords, shortened anterior-posterior axes, and circulatory edema. WISH for ntl or pax2a expression showed that embryos injected with either morpholino have deformed notochord and pronephros. TUNEL staining revealed increased apoptosis in the peri-notochord region. This study is the first report of ENOSF1 function in a vertebrate and shows that ENOSF1 is required for embryonic development. Increased apoptosis following enosf1b knockdown suggests a potential survival advantage for increased ENOSF1β expression in human cancers.

Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene

PubMed Central

2011-01-01

Background Despite detailed in vivo knowledge of glycolytic enolases and many bacterial non-enolase members of the superfamily, little is known about the in vivo function of vertebrate non-enolase enolase superfamily members (ENOSF1s). Results of previous studies suggest involvement of the β splice form of ENOSF1 in breast and colon cancers. This study used the zebrafish (Danio rerio) as a vertebrate model of ENOSF1β function. Results Whole mount in situ hybridization (WISH) showed that zebrafish ENOSF1β (enosf1b) is zygotic and expressed ubiquitously through the first 24 hours post fertilization (hpf). After 24 hpf, enosf1b expression is restricted to the notochord. Embryos injected with enosf1b-EGFP mRNA grew slower than EGFP mRNA-injected embryos but caught up to the EGFP-injected embryos by 48 hpf. Embryos injected with ATG or exon 10 enosf1b mRNA-targeting morpholinos had kinked notochords, shortened anterior-posterior axes, and circulatory edema. WISH for ntl or pax2a expression showed that embryos injected with either morpholino have deformed notochord and pronephros. TUNEL staining revealed increased apoptosis in the peri-notochord region. Conclusions This study is the first report of ENOSF1 function in a vertebrate and shows that ENOSF1 is required for embryonic development. Increased apoptosis following enosf1b knockdown suggests a potential survival advantage for increased ENOSF1β expression in human cancers. PMID:21943404

Knock-Down of the IFR1 Protein Perturbs the Homeostasis of Reactive Electrophile Species and Boosts Photosynthetic Hydrogen Production in Chlamydomonas reinhardtii

PubMed Central

Venkanna, Deepak; Südfeld, Christian; Baier, Thomas; Homburg, Sarah V.; Patel, Anant V.; Wobbe, Lutz; Kruse, Olaf

2017-01-01

The protein superfamily of short-chain dehydrogenases/reductases (SDR), including members of the atypical type (aSDR), covers a huge range of catalyzed reactions and in vivo substrates. This superfamily also comprises isoflavone reductase-like (IRL) proteins, which are aSDRs highly homologous to isoflavone reductases from leguminous plants. The molecular function of IRLs in non-leguminous plants and green microalgae has not been identified as yet, but several lines of evidence point at their implication in reactive oxygen species homeostasis. The Chlamydomonas reinhardtii IRL protein IFR1 was identified in a previous study, analyzing the transcriptomic changes occurring during the acclimation to sulfur deprivation and anaerobiosis, a condition that triggers photobiological hydrogen production in this microalgae. Accumulation of the cytosolic IFR1 protein is induced by sulfur limitation as well as by the exposure of C. reinhardtii cells to reactive electrophile species (RES) such as reactive carbonyls. The latter has not been described for IRL proteins before. Over-accumulation of IFR1 in the singlet oxygen response 1 (sor1) mutant together with the presence of an electrophile response element, known to be required for SOR1-dependent gene activation as a response to RES, in the promoter of IFR1, indicate that IFR1 expression is controlled by the SOR1-dependent pathway. An implication of IFR1 into RES homeostasis, is further implied by a knock-down of IFR1, which results in a diminished tolerance toward RES. Intriguingly, IFR1 knock-down has a positive effect on photosystem II (PSII) stability under sulfur-deprived conditions used to trigger photobiological hydrogen production, by reducing PSII-dependent oxygen evolution, in C. reinhardtii. Reduced PSII photoinhibition in IFR1 knock-down strains prolongs the hydrogen production phase resulting in an almost doubled final hydrogen yield compared to the parental strain. Finally, IFR1 knock-down could be successfully

Knock-Down of the IFR1 Protein Perturbs the Homeostasis of Reactive Electrophile Species and Boosts Photosynthetic Hydrogen Production in Chlamydomonas reinhardtii.

PubMed

Venkanna, Deepak; Südfeld, Christian; Baier, Thomas; Homburg, Sarah V; Patel, Anant V; Wobbe, Lutz; Kruse, Olaf

2017-01-01

The protein superfamily of short-chain dehydrogenases/reductases (SDR), including members of the atypical type (aSDR), covers a huge range of catalyzed reactions and in vivo substrates. This superfamily also comprises isoflavone reductase-like (IRL) proteins, which are aSDRs highly homologous to isoflavone reductases from leguminous plants. The molecular function of IRLs in non-leguminous plants and green microalgae has not been identified as yet, but several lines of evidence point at their implication in reactive oxygen species homeostasis. The Chlamydomonas reinhardtii IRL protein IFR1 was identified in a previous study, analyzing the transcriptomic changes occurring during the acclimation to sulfur deprivation and anaerobiosis, a condition that triggers photobiological hydrogen production in this microalgae. Accumulation of the cytosolic IFR1 protein is induced by sulfur limitation as well as by the exposure of C. reinhardtii cells to reactive electrophile species (RES) such as reactive carbonyls. The latter has not been described for IRL proteins before. Over-accumulation of IFR1 in the singlet oxygen response 1 ( sor1 ) mutant together with the presence of an electrophile response element, known to be required for SOR1-dependent gene activation as a response to RES, in the promoter of IFR1 , indicate that IFR1 expression is controlled by the SOR1-dependent pathway. An implication of IFR1 into RES homeostasis, is further implied by a knock-down of IFR1 , which results in a diminished tolerance toward RES. Intriguingly, IFR1 knock-down has a positive effect on photosystem II (PSII) stability under sulfur-deprived conditions used to trigger photobiological hydrogen production, by reducing PSII-dependent oxygen evolution, in C. reinhardtii . Reduced PSII photoinhibition in IFR1 knock-down strains prolongs the hydrogen production phase resulting in an almost doubled final hydrogen yield compared to the parental strain. Finally, IFR1 knock-down could be

Knockdown of antiapoptotic genes in breast cancer cells by siRNA loaded into hybrid nanoparticles

NASA Astrophysics Data System (ADS)

João de Mello, Leônidas, Jr.; Rosa Souza, Gabriela Regina; Winter, Evelyn; Silva, Adny Henrique; Pittella, Frederico; Creczynski-Pasa, Tânia Beatriz

2017-04-01

Tumorigenesis is related to an imbalance in controlling mechanisms of apoptosis. Expression of the genes BCL-2 and BCL-xL results in the promotion of cell survival by inhibiting apoptosis. Thus, a novel approach to suppress antiapoptotic genes is the use of small interfering RNA (siRNA) in cancer cells. However, there are some limitations for the application of siRNA such as the need for vectors to pass the cell membrane and deliver the nucleic acid. In this study CaP-siRNA-PEG-polyanion hybrid nanoparticles were developed to promote siRNA delivery to cultured human breast cancer cells (MCF-7) in order to evaluate whether the silencing of antiapoptotic genes BCL-2 and BCL-xL by siRNA would increase cancer cell death. After 48 h of incubation the expression of BCL-2 and BCL-xL genes decreased to 49% and 23%, respectively. The siRNA sequence used induced cancer cell death at a concentration of 200 nM siRNA after 72 h of incubation. As the targeted proteins are related to the resistance to chemotherapeutic drugs, the nanocarriers systems were also tested in the presence of doxorubicin (DOX). The results showed a significant reduction in the CC50 of the DOX, after silencing the antiapoptotic genes. In addition, an increase in apoptotic cell counts for both incubations conditions was observed as well. In conclusion, silencing antiapoptotic genes such as BCL-2 and BCL-xL through the use of siRNA carried by hybrid nanoparticles showed to be effective in vitro, and presents a promising strategy for pre-clinical analysis, especially when combined with DOX against breast cancer.

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

ZmDof3, a maize endosperm-specific Dof protein gene, regulates starch accumulation and aleurone development in maize endosperm.

PubMed

Qi, Xin; Li, Shixue; Zhu, Yaxi; Zhao, Qian; Zhu, Dengyun; Yu, Jingjuan

2017-01-01

To explore the function of Dof transcription factors during kernel development in maize, we first identified Dof genes in the maize genome. We found that ZmDof3 was exclusively expressed in the endosperm of maize kernel and had the features of a Dof transcription factor. Suppression of ZmDof3 resulted in a defective kernel phenotype with reduced starch content and a partially patchy aleurone layer. The expression levels of starch synthesis-related genes and aleurone differentiation-associated genes were down-regulated in ZmDof3 knockdown kernels, indicating that ZmDof3 plays an important role in maize endosperm development. The maize endosperm, occupying a large proportion of the kernel, plays an important role in seed development and germination. Current knowledge regarding the regulation of endosperm development is limited. Dof proteins, a family of plant-specific transcription factors, play critical roles in diverse biological processes. In this study, an endosperm-specific Dof protein gene, ZmDof3, was identified in maize through genome-wide screening. Suppression of ZmDof3 resulted in a defective kernel phenotype. The endosperm of ZmDof3 knockdown kernels was loosely packed with irregular starch granules observed by electronic microscope. Through genome-wide expression profiling, we found that down-regulated genes were enriched in GO terms related to carbohydrate metabolism. Moreover, ZmDof3 could bind to the Dof core element in the promoter of starch biosynthesis genes Du1 and Su2 in vitro and in vivo. In addition, the aleurone at local position in mature ZmDof3 knockdown kernels varied from one to three layers, which consisted of smaller and irregular cells. Further analyses showed that knockdown of ZmDof3 reduced the expression of Nkd1, which is involved in aleurone cell differentiation, and that ZmDof3 could bind to the Dof core element in the Nkd1 promoter. Our study reveals that ZmDof3 functions in maize endosperm development as a positive regulator in

si-RNA-mediated knockdown of PDLIM5 suppresses gastric cancer cell proliferation in vitro.

PubMed

Li, Yanliang; Gao, Yongsheng; Xu, Yue; Sun, Xianjun; Song, Xilin; Ma, Heng; Yang, Mingshan

2015-04-01

Gastric cancer is the second most prominent cause of cancer mortality in the world. This study was designed to identify the possible use of si-RNA-mediated PDLIM5 gene silencing as a therapeutic tool for gastric cancer. Expression levels of PDLIM5 were detected in several gastric cancer cell lines using Western blot and qRT-PCR. We found PDLIM5 is highly expressed in all cultured gastric cancer cell lines. Small interfering RNA (si-RNA) was then employed to knock down PDLIM5 expression in MGC80-3 gastric cancer cells. Knockdown of PDLIM5 significantly inhibited cell proliferation and colony formation. Moreover, the absence of PDLIM5 in MGC80-3 cells led to S phase cell cycle arrest and apoptosis. This study highlights the critical role of PDLIM5 in gastric cancer cell growth and suggests that si-RNA-mediated silencing of PDLIM5 might serve as a potential therapeutic approach for the treatment of gastric cancer. © 2014 John Wiley & Sons A/S.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

N-Myc knockdown and apigenin treatment controlled growth of malignant neuroblastoma cells having N-Myc amplification

PubMed Central

Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

2013-01-01

Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. PMID:23941992

N-Myc knockdown and apigenin treatment controlled growth of malignant neuroblastoma cells having N-Myc amplification.

PubMed

Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

2013-10-15

Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. © 2013 Elsevier B.V. All rights reserved.

Conditional RNAi: towards a silent gene therapy.

PubMed

Lee, Sang-Kyung; Kumar, Priti

2009-07-02

RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.

Determination, mechanism and monitoring of knockdown resistance in permethrin-resistant human head lice, Pediculus humanus capitis

PubMed Central

Clark, J. Marshall

2009-01-01

Permethrin resistance has been reported worldwide and clinical failures to commercial pediculicides containing permethrin have likewise occurred. Permethrin resistance in head lice populations from the U.S. is widespread but is not yet uniform and the level of resistance is relatively low (~4–8 fold). Permethrin-resistant lice are cross-resistant to pyrethrins, PBO-synergized pyrethrins and to DDT. Nix®, when applied to human hair tufts following manufacture’s instructions, did not provide 100% control when assessed by the hair tuft bioassay in conjunction with the in vitro rearing system. Resistance to permethrin is due to knockdown resistance (kdr), which is the result of three point mutations within the α-subunit gene of the voltage-gated sodium channel that causes amino acid substitutions, leading to nerve insensitivity. A three-tiered resistance monitoring system has been established based on molecular resistance detection techniques. Quantitative sequencing (QS) has been developed to predict the kdr allele frequency in head lice at a population level. The speed, simplicity and accuracy of QS made it an ideal candidate for a routine primary resistance monitoring tool to screen a large number of louse populations as an alternative to conventional bioassay. As a secondary monitoring method, real-time PASA (rtPASA) has been devised for a more precise determination of low resistance allele frequencies. To obtain more detailed information on resistance allele zygosity, as well as allele frequency, serial invasive signal amplification reaction (SISAR) has been developed as an individual genotyping method. Our approach of using three tiers of molecular resistance detection should facilitate large-scale routine resistance monitoring of permethrin resistance in head lice using field-collected samples. PMID:20161186

A Systematic Survey of Expression and Function of Zebrafish frizzled Genes

PubMed Central

Nikaido, Masataka; Law, Edward W. P.; Kelsh, Robert N.

2013-01-01

Wnt signaling is crucial for the regulation of numerous processes in development. Consistent with this, the gene families for both the ligands (Wnts) and receptors (Frizzleds) are very large. Surprisingly, while we have a reasonable understanding of the Wnt ligands likely to mediate specific Wnt-dependent processes, the corresponding receptors usually remain to be elucidated. Taking advantage of the zebrafish model's excellent genomic and genetic properties, we undertook a comprehensive analysis of the expression patterns of frizzled (fzd) genes in zebrafish. To explore their functions, we focused on testing their requirement in several developmental events known to be regulated by Wnt signaling, convergent extension movements of gastrulation, neural crest induction, and melanocyte specification. We found fourteen distinct fzd genes in the zebrafish genome. Systematic analysis of their expression patterns between 1-somite and 30 hours post-fertilization revealed complex, dynamic and overlapping expression patterns. This analysis demonstrated that only fzd3a, fzd9b, and fzd10 are expressed in the dorsal neural tube at stages corresponding to the timing of melanocyte specification. Surprisingly, however, morpholino knockdown of these, alone or in combination, gave no indication of reduction of melanocytes, suggesting the important involvement of untested fzds or another type of Wnt receptor in this process. Likewise, we found only fzd7b and fzd10 expressed at the border of the neural plate at stages appropriate for neural crest induction. However, neural crest markers were not reduced by knockdown of these receptors. Instead, these morpholino knockdown studies showed that fzd7a and fzd7b work co-operatively to regulate convergent extension movement during gastrulation. Furthermore, we show that the two fzd7 genes function together with fzd10 to regulate epiboly movements and mesoderm differentiation. PMID:23349976

Knockdown of connexin43-mediated regulation of the zone of polarizing activity in the developing chick limb leads to digit truncation.

PubMed

Law, Lee Yong; Lin, Jun Sheng; Becker, David L; Green, Colin R

2002-12-01

In the developing chick wing, the use of antisense oligodeoxynucleotides to transiently knock down the expression of the gap junction protein, connexin43 (Cx43), results in limb patterning defects, including deletion of the anterior digits. To understand more about how such defects arise, the effects of transient Cx43 knockdown on the expression patterns of several genes known to play pivotal roles in limb formation were examined. Sonic hedgehog (Shh), which is normally expressed in the zone of polarizing activity (ZPA) and is required to maintain both the ZPA and the apical ectodermal ridge (AER), was found to be downregulated in treated limbs within 30 h. Bone morphogenetic protein-2 (Bmp-2), a gene downstream of Shh, was similarly downregulated. Fibroblast growth factor-8 expression, however, was unaltered 30 h after treatment but was greatly reduced at 48 h post-treatment, when the AER begins to regress. Expressions of Bmp-4 and Muscle segment homeobox-like gene (Msx-1) were not affected at any of the time points examined. Cx43 expression is therefore involved in some, but not all patterning cascades, and appears to play a role in the regulation of ZPA activity.

The flipflop orphan genes are required for limb bud eversion in the Tribolium embryo.

PubMed

Thümecke, Susanne; Beermann, Anke; Klingler, Martin; Schröder, Reinhard

2017-01-01

Unlike Drosophila but similar to other arthropod and vertebrate embryos, the flour beetle Tribolium castaneum develops everted limb buds during embryogenesis. However, the molecular processes directing the evagination of epithelia are only poorly understood. Here we show that the newly discovered genes Tc-flipflop1 and Tc-flipflop2 are involved in regulating the directional budding of appendages. RNAi-knockdown of Tc-flipflop results in a variety of phenotypic traits. Most prominently, embryonic limb buds frequently grow inwards rather than out, leading to the development of inverted appendages inside the larval body. Moreover, affected embryos display dorsal closure defects. The Tc-flipflop genes are evolutionarily non-conserved, and their molecular function is not evident. We further found that Tc-RhoGEF2 , a highly-conserved gene known to be involved in actomyosin-dependent cell movement and cell shape changes, shows a Tc-flipflop -like RNAi-phenotype. The similarity of the inverted appendage phenotype in both the flipflop - and the RhoGEF2 RNAi gene knockdown led us to conclude that the Tc-flipflop orphan genes act in a Rho-dependent pathway that is essential for the early morphogenesis of polarised epithelial movements. Our work describes one of the few examples of an orphan gene playing a crucial role in an important developmental process.

Identification and functional analyses of sex determination genes in the sexually dimorphic stag beetle Cyclommatus metallifer.

PubMed

Gotoh, Hiroki; Zinna, Robert A; Warren, Ian; DeNieu, Michael; Niimi, Teruyuki; Dworkin, Ian; Emlen, Douglas J; Miura, Toru; Lavine, Laura C

2016-03-22

Genes in the sex determination pathway are important regulators of sexually dimorphic animal traits, including the elaborate and exaggerated male ornaments and weapons of sexual selection. In this study, we identified and functionally analyzed members of the sex determination gene family in the golden metallic stag beetle Cyclommatus metallifer, which exhibits extreme differences in mandible size between males and females. We constructed a C. metallifer transcriptomic database from larval and prepupal developmental stages and tissues of both males and females. Using Roche 454 pyrosequencing, we generated a de novo assembled database from a total of 1,223,516 raw reads, which resulted in 14,565 isotigs (putative transcript isoforms) contained in 10,794 isogroups (putative identified genes). We queried this database for C. metallifer conserved sex determination genes and identified 14 candidate sex determination pathway genes. We then characterized the roles of several of these genes in development of extreme sexual dimorphic traits in this species. We performed molecular expression analyses with RT-PCR and functional analyses using RNAi on three C. metallifer candidate genes--Sex-lethal (CmSxl), transformer-2 (Cmtra2), and intersex (Cmix). No differences in expression pattern were found between the sexes for any of these three genes. In the RNAi gene-knockdown experiments, we found that only the Cmix had any effect on sexually dimorphic morphology, and these mimicked the effects of Cmdsx knockdown in females. Knockdown of CmSxl had no measurable effects on stag beetle phenotype, while knockdown of Cmtra2 resulted in complete lethality at the prepupal period. These results indicate that the roles of CmSxl and Cmtra2 in the sex determination cascade are likely to have diverged in stag beetles when compared to Drosophila. Our results also suggest that Cmix has a conserved role in this pathway. In addition to those three genes, we also performed a more complete

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

Identification of Isthmin 1 as a Novel Clefting and Craniofacial Patterning Gene in Humans.

PubMed

Lansdon, Lisa A; Darbro, Benjamin W; Petrin, Aline L; Hulstrand, Alissa M; Standley, Jennifer M; Brouillette, Rachel B; Long, Abby; Mansilla, M Adela; Cornell, Robert A; Murray, Jeffrey C; Houston, Douglas W; Manak, J Robert

2018-01-01

Orofacial clefts are one of the most common birth defects, affecting 1-2 per 1000 births, and have a complex etiology. High-resolution array-based comparative genomic hybridization has increased the ability to detect copy number variants (CNVs) that can be causative for complex diseases such as cleft lip and/or palate. Utilizing this technique on 97 nonsyndromic cleft lip and palate cases and 43 cases with cleft palate only, we identified a heterozygous deletion of Isthmin 1 in one affected case, as well as a deletion in a second case that removes putative 3' regulatory information. Isthmin 1 is a strong candidate for clefting, as it is expressed in orofacial structures derived from the first branchial arch and is also in the same "synexpression group" as fibroblast growth factor 8 and sprouty RTK signaling antagonist 1a and 2 , all of which have been associated with clefting. CNVs affecting Isthmin 1 are exceedingly rare in control populations, and Isthmin 1 scores as a likely haploinsufficiency locus. Confirming its role in craniofacial development, knockdown or clustered randomly interspaced short palindromic repeats/Cas9-generated mutation of isthmin 1 in Xenopus laevis resulted in mild to severe craniofacial dysmorphologies, with several individuals presenting with median clefts. Moreover, knockdown of isthmin 1 produced decreased expression of LIM homeobox 8 , itself a gene associated with clefting, in regions of the face that pattern the maxilla. Our study demonstrates a successful pipeline from CNV identification of a candidate gene to functional validation in a vertebrate model system, and reveals Isthmin 1 as both a new human clefting locus as well as a key craniofacial patterning gene. Copyright © 2018 by the Genetics Society of America.

Knockdown of RMI1 impairs DNA repair under DNA replication stress.

PubMed

Xu, Chang; Fang, Lianying; Kong, Yangyang; Xiao, Changyan; Yang, Mengmeng; Du, Li-Qing; Liu, Qiang

2017-12-09

RMI1 (RecQ-mediated genome instability protein 1) forms a conserved BTR complex with BLM, Topo IIIα, and RMI2, and its absence causes genome instability. It has been revealed that RMI1 localizes to nuclear foci with BLM and Topo IIIα in response to replication stress, and that RMI1 functions downstream of BLM in promoting replication elongation. However, the precise functions of RMI1 during replication stress are not completely understood. Here we report that RMI1 knockdown cells are hypersensitive to hydroxyurea (HU). Using comet assay, we show that RMI1 knockdown cells exhibit accumulation of broken DNAs after being released from HU treatment. Moreover, we demonstrate that RMI1 facilitates the recovery from activated checkpoint and resuming the cell cycle after replicative stress. Surprisingly, loss of RMI1 results in a failure of RAD51 loading onto DNA damage sites. These findings reveal the importance of RMI1 in response to replication stress, which could explain the molecular basis for its function in maintaining genome integrity. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Tumor SHB gene expression affects disease characteristics in human acute myeloid leukemia.

PubMed

Jamalpour, Maria; Li, Xiujuan; Cavelier, Lucia; Gustafsson, Karin; Mostoslavsky, Gustavo; Höglund, Martin; Welsh, Michael

2017-10-01

The mouse Shb gene coding for the Src Homology 2-domain containing adapter protein B has recently been placed in context of BCRABL1-induced myeloid leukemia in mice and the current study was performed in order to relate SHB to human acute myeloid leukemia (AML). Publicly available AML databases were mined for SHB gene expression and patient survival. SHB gene expression was determined in the Uppsala cohort of AML patients by qPCR. Cell proliferation was determined after SHB gene knockdown in leukemic cell lines. Despite a low frequency of SHB gene mutations, many tumors overexpressed SHB mRNA compared with normal myeloid blood cells. AML patients with tumors expressing low SHB mRNA displayed longer survival times. A subgroup of AML exhibiting a favorable prognosis, acute promyelocytic leukemia (APL) with a PMLRARA translocation, expressed less SHB mRNA than AML tumors in general. When examining genes co-expressed with SHB in AML tumors, four other genes ( PAX5, HDAC7, BCORL1, TET1) related to leukemia were identified. A network consisting of these genes plus SHB was identified that relates to certain phenotypic characteristics, such as immune cell, vascular and apoptotic features. SHB knockdown in the APL PMLRARA cell line NB4 and the monocyte/macrophage cell line MM6 adversely affected proliferation, linking SHB gene expression to tumor cell expansion and consequently to patient survival. It is concluded that tumor SHB gene expression relates to AML survival and its subgroup APL. Moreover, this gene is included in a network of genes that plays a role for an AML phenotype exhibiting certain immune cell, vascular and apoptotic characteristics.

PKD knockdown inhibits pressure overload-induced cardiac hypertrophy by promoting autophagy via AKT/mTOR pathway.

PubMed

Zhao, Di; Wang, Wei; Wang, Hao; Peng, Honghai; Liu, Xiangjuan; Guo, Weixing; Su, Guohai; Zhao, Zhuo

2017-01-01

Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively regulating autophagy using the technique of PKD knockdown by siRNA. Cardiac hypertrophy was induced in 8-week old male C57BL/6 mice by transverse aortic constriction (TAC). TAC mice were then divided into five groups receiving the treatments of vehicle (DMSO), an autophagy inducer rapamycin (1 mg/kg/day, i.p.), control siRNA, lentiviral PKD siRNA (2×10 8 transducing units/0.1 ml, i.v. injection in one day after surgery, and repeated in 2 weeks after surgery), and PKD siRNA plus 3-methyladenine (3-MA, an autophagy inhibitor, 20 mg/kg/day, i.p.), respectively. Four weeks after TAC surgery, echocardiographic study, hematoxylin and eosin (HE) staining, and Masson's staining showed mice with TAC had significantly hypertrophy and remodeling compared with sham animals. Treatments with PKD siRNA or rapamycin significantly ameliorated the cardiac hypertrophy and dysfunction. Moreover, PKD siRNA increased cardiac autophagic activity determined by electron micrographic study and the biomarkers by Western blot, accompanied with the downregulated AKT/mTOR/S6K signaling pathway. All the cardiac effects of PDK knockdown were inhibited by co-treatment with 3-MA. These results suggest that PKD is involved in the development of cardiac hypertrophy by inhibiting cardiac autophagy via AKT/mTOR pathway.

PKD knockdown inhibits pressure overload-induced cardiac hypertrophy by promoting autophagy via AKT/mTOR pathway

PubMed Central

Zhao, Di; Wang, Wei; Wang, Hao; Peng, Honghai; Liu, Xiangjuan; Guo, Weixing; Su, Guohai; Zhao, Zhuo

2017-01-01

Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively regulating autophagy using the technique of PKD knockdown by siRNA. Cardiac hypertrophy was induced in 8-week old male C57BL/6 mice by transverse aortic constriction (TAC). TAC mice were then divided into five groups receiving the treatments of vehicle (DMSO), an autophagy inducer rapamycin (1 mg/kg/day, i.p.), control siRNA, lentiviral PKD siRNA (2×108 transducing units/0.1 ml, i.v. injection in one day after surgery, and repeated in 2 weeks after surgery), and PKD siRNA plus 3-methyladenine (3-MA, an autophagy inhibitor, 20 mg/kg/day, i.p.), respectively. Four weeks after TAC surgery, echocardiographic study, hematoxylin and eosin (HE) staining, and Masson's staining showed mice with TAC had significantly hypertrophy and remodeling compared with sham animals. Treatments with PKD siRNA or rapamycin significantly ameliorated the cardiac hypertrophy and dysfunction. Moreover, PKD siRNA increased cardiac autophagic activity determined by electron micrographic study and the biomarkers by Western blot, accompanied with the downregulated AKT/mTOR/S6K signaling pathway. All the cardiac effects of PDK knockdown were inhibited by co-treatment with 3-MA. These results suggest that PKD is involved in the development of cardiac hypertrophy by inhibiting cardiac autophagy via AKT/mTOR pathway. PMID:28367092

Knockdown of Cbp/P300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 inhibits cell division and increases apoptosis in gastric cancer.

PubMed

Tang, Ze; He, Gan; Xu, Jie; Zhongfu, Li

2017-05-01

Cbp/P300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) is a pleiotropic protein associated with numerous cell functions, including transcription and differentiation. The role of CITED2 has been investigated in a number of malignancies; however, the roles of this protein in gastric cancers remain unclear. Therefore, we determined the role of CITED2 in gastric cancers. Gastric cancer cell lines (MKN74, MKN28, 7901, and AGS) were used to assess CITED2 transcript levels. Messenger RNA levels were determined using quantitative polymerase chain reaction. Lentiviral vectors containing CITED2 small interfering RNA were used to knockdown CITED2 expression. Cell proliferation was assessed with fluorescent imaging and 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assays. Apoptosis and cell cycle stages were assessed through flow cytometry, and formation of colonies was determined using a fluorescent microscope. All cell lines tested in this study expressed CITED2. The cell line expressing the highest levels of CITED2 (MKN74) showed significant knockdown of endogenous CITED2 expression on lentiviral infection. Cell proliferation was shown to be lower in CITED2 knockdown MKN74 cells. G1/S-phase cell cycle arrest was observed on silencing of CITED2 in MKN74 cells. A significant increase in apoptosis was observed on CITED2 knock down in MKN74 cells, while colony forming ability was significantly inhibited after knock down of CITED2. CITED2 supports gastric cancer cell colony formation and proliferation while inhibiting apoptosis making it a potential gene therapy target for gastric cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

Evaluation of hepatitis B viral replication and proteomic analysis of HepG2.2.15 cell line after knockdown of HBx.

PubMed

Xie, Hai-Yang; Cheng, Jun; Xing, Chun-Yang; Wang, Jin-Jin; Su, Rong; Wei, Xu-Yong; Zhou, Lin; Zheng, Shu-Sen

2011-06-01

Hepatitis B virus (HBV) is one of the major pathogens of human liver disease. Studies have shown that HBV X protein (HBx) plays an important role in promoting viral gene expression and replication. In this study we performed a global proteomic profiling to identify the downstream functional proteins of HBx, thereby detecting the mechanisms of action of HBx on virion replication. HBx in the HepG2.2.15 cell line was knocked down by the transfection of small interfering RNA (siRNA). The replication level of HBV was evaluated by microparticle enzyme immunoassay analysis of HBsAg and HBeAg in the culture supernatant, and real-time quantitative PCR analysis of HBV DNA. Two-dimensional electrophoresis combined with MALDI-TOF/TOF was performed to analyze the changes in protein expression profile after treatment with HBx siRNA. Knockdown of HBx disturbed HBV replication in vitro. HBx target siRNA significantly inhibited the expression of HBsAg, HBeAg and the replication of HBV DNA. Twelve significantly changed proteins (7 upregulated and 5 downregulated) were successfully identified by MALDI-TOF/TOF using proteomics differential expression analysis after the knockdown of HBx. Among these identified proteins, HSP70 was validated by Western blotting. The results of the study indicated the positive effect of HBx on HBV replication, and a group of downstream target proteins of HBx may be responsible for this effect.

CREBBP knockdown enhances RAS/RAF/MEK/ERK signaling in Ras pathway mutated acute lymphoblastic leukemia but does not modulate chemotherapeutic response.

PubMed

Dixon, Zach A; Nicholson, Lindsay; Zeppetzauer, Martin; Matheson, Elizabeth; Sinclair, Paul; Harrison, Christine J; Irving, Julie A E

2017-04-01

Relapsed acute lymphoblastic leukemia is the most common cause of cancer-related mortality in young people and new therapeutic strategies are needed to improve outcome. Recent studies have shown that heterozygous inactivating mutations in the histone acetyl transferase, CREBBP , are particularly frequent in relapsed childhood acute lymphoblastic leukemia and associated with a hyperdiploid karyotype and KRAS mutations. To study the functional impact of CREBBP haploinsufficiency in acute lymphoblastic leukemia, RNA interference was used to knock down expression of CREBBP in acute lymphoblastic leukemia cell lines and various primagraft acute lymphoblastic leukemia cells. We demonstrate that attenuation of CREBBP results in reduced acetylation of histone 3 lysine 18, but has no significant impact on cAMP-dependent target gene expression. Impaired induction of glucocorticoid receptor targets was only seen in 1 of 4 CREBBP knockdown models, and there was no significant difference in glucocorticoid-induced apoptosis, sensitivity to other acute lymphoblastic leukemia chemotherapeutics or histone deacetylase inhibitors. Importantly, we show that CREBBP directly acetylates KRAS and that CREBBP knockdown enhances signaling of the RAS/RAF/MEK/ERK pathway in Ras pathway mutated acute lymphoblastic leukemia cells, which are still sensitive to MEK inhibitors. Thus, CREBBP mutations might assist in enhancing oncogenic RAS signaling in acute lymphoblastic leukemia but do not alter response to MEK inhibitors. Copyright© Ferrata Storti Foundation.

SPARC (secreted protein acidic and rich in cysteine) knockdown protects mice from acute liver injury by reducing vascular endothelial cell damage

PubMed Central

Peixoto, E; Atorrasagasti, C; Aquino, JB; Militello, R; Bayo, J; Fiore, E; Piccioni, F; Salvatierra, E; Alaniz, L; García, MG; Bataller, R; Corrales, F; Gidekel, M; Podhajcer, O; Colombo, MI; Mazzolini, G

2015-01-01

Secreted protein, acidic and rich in cysteine (SPARC) is involved in many biological process including liver fibrogenesis, but its role in acute liver damage is unknown. To examine the role of SPARC in acute liver injury, we used SPARC knock-out (SPARC−/−) mice. Two models of acute liver damage were used: concanavalin A (Con A) and the agonistic anti-CD95 antibody Jo2. SPARC expression levels were analyzed in liver samples from patients with acute-on-chronic alcoholic hepatitis (AH). SPARC expression is increased on acute-on-chronic AH patients. Knockdown of SPARC decreased hepatic damage in the two models of liver injury. SPARC−/− mice showed a marked reduction in Con A-induced necroinflammation. Infiltration by CD4+ T cells, expression of tumor necrosis factor-α and interleukin-6 and apoptosis were attenuated in SPARC−/− mice. Sinusoidal endothelial cell monolayer was preserved and was less activated in Con A-treated SPARC−/− mice. SPARC knockdown reduced Con A-induced autophagy of cultured human microvascular endothelial cells (HMEC-1). Hepatic transcriptome analysis revealed several gene networks that may have a role in the attenuated liver damaged found in Con A-treated SPARC−/− mice. SPARC has a significant role in the development of Con A-induced severe liver injury. These results suggest that SPARC could represent a therapeutic target in acute liver injury. PMID:25410742

Knockdown of Pim-3 suppresses the tumorigenicity of glioblastoma by regulating cell cycle and apoptosis.

PubMed

Quan, J; Zhou, L; Qu, J

2015-03-09

Products of the Pim (the proviral integration site for the Moloney murine leukemia virus) family of proto—oncogenes possess serine/threonine kinase activity and belong to the Ca2+/calmodulin—dependent protein kinase group. Pim—3, a member of the Pim family is closely linked to the development of a variety of tumors. However, the role of Pim—3 in human glioblastoma remains unknown. In this study, we elucidated the role of Pim—3 in the growth and apoptosis of glioblastoma cells. Western blotting was used for determination of protein levels, and shRNA was used for Pim—3 knockdown. The MTT assay was used to evaluate cell proliferation and flow cytometry was used to determine cell cycle status and the number of apoptotic cells. A mouse xenograft model was established by injecting nude mice with Pim—3—depleted glioblastoma cells in order to determine tumor growth in vivo. We demonstrated that Pim—3 was highly expressed in human glioblastoma cell lines. We also found that knockdown of Pim—3 by specific shRNA slowed decreased proliferation, induced cell cycle arrest in the G0/G1 phase, and increased apoptosis in glioblastoma cells. Pim—3 knockdown potently inhibited the growth of subcutaneously implanted glioblastoma cells in vivo. We further revealed that Pim—3 knockdown induced growth inhibition by reducing the levels of the anti—apoptotic protein Bcl—xl and cell cycle regulatory proteins, including cyclin D1 and Cdc25C, and increasing the levels of the pro—apoptotic protein Bax.

Angiotensin II Type 1 Receptor Knockdown Impairs Interleukin-1β-Induced Cytokines in Human Periodontal Fibroblasts.

PubMed

Gabriele, Lilian Gobbo; Morandini, Ana Carolina; Dionísio, Thiago José; Santos, Carlos Ferreira

2017-01-01

The renin-angiotensin (Ang) system (RAS) has been reported as an important modulator of inflammatory and immune responses. Evidence suggests an alternative Ang 1-7/Mas receptor axis as counter-regulatory to the classic RAS Ang II/Ang II Type 1 (AT1) receptor axis. It is known that periodontal pathogens elicit host-derived immune response due to release of cytokines such as interleukin (IL)-1β, and fibroblasts are among the most numerous sentinel cells that contribute to this production. The aim of this study is to determine whether AT1 receptor (AT1R) contributes to production of inflammatory cytokines that are important for periodontal pathogenesis using primary human gingival fibroblasts (HGFs) and human periodontal ligament fibroblasts (HPLFs) stimulated with IL-1β. Through RNA interference or pharmacologic inhibition using AT1R antagonist losartan, HGF and HPLF were stimulated by IL-1β for 3 (messenger RNA [mRNA]) or 24 (protein) hours. IL-1β upregulated mRNA expression of AT1R, IL-1β, IL-6, IL-8, tumor necrosis factor-alpha, and osteoprotegerin (OPG) in HGF and HPLF. AT1R knockdown impaired IL-1β-induced IL-6 and IL-8 secretion in cultured HGF and HPLF. AT1R silencing also increased OPG gene expression in HGF only. Pharmacologic inhibition of AT1R through losartan modulated mRNA transcription of IL-6 and IL-8 in HPLF but not in HGF. In contrast, IL-1β-induced secretion of IL-6 and IL-8 was not influenced by losartan in HGF or HPLF. These results suggest that AT1R knockdown and AT1R pharmacologic blockade by losartan may differently control balance of inflammatory cytokines, such as IL-6 and IL-8, in primary human periodontal fibroblasts.

Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action

PubMed Central

2013-01-01

Background Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Methods Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Results Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. Conclusions This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the

Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action.

PubMed

Lanz, Thomas A; Guilmette, Edward; Gosink, Mark M; Fischer, James E; Fitzgerald, Lawrence W; Stephenson, Diane T; Pletcher, Mathew T

2013-11-15

Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the broadest efficacy across the diverse

Functional Conservation of MIKC*-Type MADS Box Genes in Arabidopsis and Rice Pollen Maturation[C][W

PubMed Central

Liu, Yuan; Cui, Shaojie; Wu, Feng; Yan, Shuo; Lin, Xuelei; Du, Xiaoqiu; Chong, Kang; Schilling, Susanne; Theißen, Günter; Meng, Zheng

2013-01-01

There are two groups of MADS intervening keratin-like and C-terminal (MIKC)-type MADS box genes, MIKCC type and MIKC* type. In seed plants, the MIKCC type shows considerable diversity, but the MIKC* type has only two subgroups, P- and S-clade, which show conserved expression in the gametophyte. To examine the functional conservation of MIKC*-type genes, we characterized all three rice (Oryza sativa) MIKC*-type genes. All three genes are specifically expressed late in pollen development. The single knockdown or knockout lines, respectively, of the S-clade MADS62 and MADS63 did not show a mutant phenotype, but lines in which both S-clade genes were affected showed severe defects in pollen maturation and germination, as did knockdown lines of MADS68, the only P-clade gene in rice. The rice MIKC*-type proteins form strong heterodimeric complexes solely with partners from the other subclade; these complexes specifically bind to N10-type C-A-rich-G-boxes in vitro and regulate downstream gene expression by binding to N10-type promoter motifs. The rice MIKC* genes have a much lower degree of functional redundancy than the Arabidopsis thaliana MIKC* genes. Nevertheless, our data indicate that the function of heterodimeric MIKC*-type protein complexes in pollen development has been conserved since the divergence of monocots and eudicots, roughly 150 million years ago. PMID:23613199

Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams.

PubMed

Centanni, Tracy Michelle; Booker, Anne B; Chen, Fuyi; Sloan, Andrew M; Carraway, Ryan S; Rennaker, Robert L; LoTurco, Joseph J; Kilgard, Michael P

2016-04-27

Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC-) before any behavioral training. A separate group of 8 rats (3 DC-) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing

Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams

PubMed Central

Booker, Anne B.; Chen, Fuyi; Sloan, Andrew M.; Carraway, Ryan S.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.

2016-01-01

Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC−) before any behavioral training. A separate group of 8 rats (3 DC−) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. SIGNIFICANCE STATEMENT Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Knockdown of Oncogenic KRAS in Non-Small Cell Lung Cancers Suppresses Tumor Growth and Sensitizes Tumor Cells to Targeted Therapy

PubMed Central

Sunaga, Noriaki; Shames, David S.; Girard, Luc; Peyton, Michael; Larsen, Jill E.; Imai, Hisao; Soh, Junichi; Sato, Mitsuo; Yanagitani, Noriko; Kaira, Kyoichi; Xie, Yang; Gazdar, Adi F.; Mori, Masatomo; Minna, John D.

2011-01-01

Oncogenic KRAS is found in >25% of lung adenocarcinomas, the major histologic subtype of non-small cell lung cancer (NSCLC), and is an important target for drug development. To this end, we generated four NSCLC lines with stable knockdown selective for oncogenic KRAS. As expected, stable knockdown of oncogenic KRAS led to inhibition of in vitro and in vivo tumor growth in the KRAS mutant NSCLC cells, but not in NSCLC cells that have wild-type KRAS (but mutant NRAS). Surprisingly, we did not see large-scale induction of cell death and the growth inhibitory effect was not complete. To further understand the ability of NSCLCs to grow despite selective removal of mutant KRAS expression, we performed microarray expression profiling of NSCLC cell lines with or without mutant KRAS knockdown and isogenic human bronchial epithelial cell lines (HBECs) with and without oncogenic KRAS. We found that while the MAPK pathway is significantly down-regulated after mutant KRAS knockdown, these NSCLCs showed increased levels of phospho-STAT3 and phospho-EGFR, and variable changes in phospho-Akt. In addition, mutant KRAS knockdown sensitized the NSCLCs to p38 and EGFR inhibitors. Our findings suggest that targeting oncogenic KRAS by itself will not be sufficient treatment but may offer possibilities of combining anti-KRAS strategies with other targeted drugs. PMID:21306997

CRISPR/Cas9 Allows Efficient and Complete Knock-In of a Destabilization Domain-Tagged Essential Protein in a Human Cell Line, Allowing Rapid Knockdown of Protein Function

PubMed Central

Park, Arnold; Won, Sohui T.; Pentecost, Mickey; Bartkowski, Wojciech; Lee, Benhur

2014-01-01

Although modulation of protein levels is an important tool for study of protein function, it is difficult or impossible to knockdown or knockout genes that are critical for cell growth or viability. For such genes, a conditional knockdown approach would be valuable. The FKBP protein-based destabilization domain (DD)-tagging approach, which confers instability to the tagged protein in the absence of the compound Shield-1, has been shown to provide rapid control of protein levels determined by Shield-1 concentration. Although a strategy to knock-in DD-tagged protein at the endogenous loci has been employed in certain parasite studies, partly due to the relative ease of knock-in as a result of their mostly haploid lifecycles, this strategy has not been demonstrated in diploid or hyperploid mammalian cells due to the relative difficulty of achieving complete knock-in in all alleles. The recent advent of CRISPR/Cas9 homing endonuclease-mediated targeted genome cleavage has been shown to allow highly efficient homologous recombination at the targeted locus. We therefore assessed the feasibility of using CRISPR/Cas9 to achieve complete knock-in to DD-tag the essential gene Treacher Collins-Franceschetti syndrome 1 (TCOF1) in human 293T cells. Using a double antibiotic selection strategy to select clones with at least two knock-in alleles, we obtained numerous complete knock-in clones within three weeks of initial transfection. DD-TCOF1 expression in the knock-in cells was Shield-1 concentration-dependent, and removal of Shield-1 resulted in destabilization of DD-TCOF1 over the course of hours. We further confirmed that the tagged TCOF1 retained the nucleolar localization of the wild-type untagged protein, and that destabilization of DD-TCOF1 resulted in impaired cell growth, as expected for a gene implicated in ribosome biogenesis. CRISPR/Cas9-mediated homologous recombination to completely knock-in a DD tag likely represents a generalizable and efficient strategy to

CRISPR/Cas9 allows efficient and complete knock-in of a destabilization domain-tagged essential protein in a human cell line, allowing rapid knockdown of protein function.

PubMed

Park, Arnold; Won, Sohui T; Pentecost, Mickey; Bartkowski, Wojciech; Lee, Benhur

2014-01-01

Although modulation of protein levels is an important tool for study of protein function, it is difficult or impossible to knockdown or knockout genes that are critical for cell growth or viability. For such genes, a conditional knockdown approach would be valuable. The FKBP protein-based destabilization domain (DD)-tagging approach, which confers instability to the tagged protein in the absence of the compound Shield-1, has been shown to provide rapid control of protein levels determined by Shield-1 concentration. Although a strategy to knock-in DD-tagged protein at the endogenous loci has been employed in certain parasite studies, partly due to the relative ease of knock-in as a result of their mostly haploid lifecycles, this strategy has not been demonstrated in diploid or hyperploid mammalian cells due to the relative difficulty of achieving complete knock-in in all alleles. The recent advent of CRISPR/Cas9 homing endonuclease-mediated targeted genome cleavage has been shown to allow highly efficient homologous recombination at the targeted locus. We therefore assessed the feasibility of using CRISPR/Cas9 to achieve complete knock-in to DD-tag the essential gene Treacher Collins-Franceschetti syndrome 1 (TCOF1) in human 293T cells. Using a double antibiotic selection strategy to select clones with at least two knock-in alleles, we obtained numerous complete knock-in clones within three weeks of initial transfection. DD-TCOF1 expression in the knock-in cells was Shield-1 concentration-dependent, and removal of Shield-1 resulted in destabilization of DD-TCOF1 over the course of hours. We further confirmed that the tagged TCOF1 retained the nucleolar localization of the wild-type untagged protein, and that destabilization of DD-TCOF1 resulted in impaired cell growth, as expected for a gene implicated in ribosome biogenesis. CRISPR/Cas9-mediated homologous recombination to completely knock-in a DD tag likely represents a generalizable and efficient strategy to

Overexpression of HOXA4 and HOXA9 genes promotes self-renewal and contributes to colon cancer stem cell overpopulation.

PubMed

Bhatlekar, Seema; Viswanathan, Vignesh; Fields, Jeremy Z; Boman, Bruce M

2018-02-01

Because HOX genes encode master regulatory transcription factors that regulate stem cells (SCs) during development and aberrant expression of HOX genes occurs in various cancers, our goal was to determine if dysregulation of HOX genes is involved in the SC origin of colorectal cancer (CRC). We previously reported that HOXA4 and HOXD10 are expressed in the colonic SC niche and are overexpressed in CRC. HOX gene expression was studied in SCs from human colon tissue and CRC cells (CSCs) using qPCR and immunostaining. siRNA-mediated knockdown of HOX expression was used to evaluate the role of HOX genes in modulating cancer SC (CSC) phenotype at the level of proliferation, SC marker expression, and sphere formation. All-trans-retinoic-acid (ATRA), a differentiation-inducing agent was evaluated for its effects on HOX expression and CSC growth. We found that HOXA4 and HOXA9 are up-regulated in CRC SCs. siRNA knockdown of HOXA4 and HOXA9 reduced: (i) proliferation and sphere-formation and (ii) gene expression of known SC markers (ALDH1, CD166, LGR5). These results indicate that proliferation and self-renewal ability of CRC SCs are reduced in HOXA4 and HOXA9 knockdown cells. ATRA decreased HOXA4, HOXA9, and HOXD10 expression in parallel with reduction in ALDH1 expression, self-renewal, and proliferation. Overall, our findings indicate that overexpression of HOXA4 and HOXA9 contributes to self-renewal and overpopulation of SCs in CRC. Strategies designed to modulate HOX expression may provide ways to target malignant SCs and to develop more effective therapies for CRC. © 2017 Wiley Periodicals, Inc.

Application of the CRISPR/Cas9 gene editing technique to research on functional genomes of parasites.

PubMed

Cui, Yubao; Yu, Lili

2016-12-01

The clustered regularly-interspaced short palindromic repeats (CRISPR) structural family functions as an acquired immune system in prokaryotes. Gene editing techniques have co-opted CRISPR and the associated Cas nucleases to allow for the precise genetic modification of human cells, zebrafish, mice, and other eukaryotes. Indeed, this approach has been used to induce a variety of modifications including directed insertion/deletion (InDel) of bases, gene knock-in, introduction of mutations in both alleles of a target gene, and deletion of small DNA fragments. Thus, CRISPR technology offers a precise molecular tool for directed genome modification with a range of potential applications; further, its high mutation efficiency, simple process, and low cost provide additional advantages over prior editing techniques. This paper will provide an overview of the basic structure and function of the CRISPR gene editing system as well as current and potential applications to research on parasites. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Deiodinase knockdown during early zebrafish development affects growth, development, energy metabolism, motility and phototransduction.

PubMed

Bagci, Enise; Heijlen, Marjolein; Vergauwen, Lucia; Hagenaars, An; Houbrechts, Anne M; Esguerra, Camila V; Blust, Ronny; Darras, Veerle M; Knapen, Dries

2015-01-01

Thyroid hormone (TH) balance is essential for vertebrate development. Deiodinase type 1 (D1) and type 2 (D2) increase and deiodinase type 3 (D3) decreases local intracellular levels of T3, the most important active TH. The role of deiodinase-mediated TH effects in early vertebrate development is only partially understood. Therefore, we investigated the role of deiodinases during early development of zebrafish until 96 hours post fertilization at the level of the transcriptome (microarray), biochemistry, morphology and physiology using morpholino (MO) knockdown. Knockdown of D1+D2 (D1D2MO) and knockdown of D3 (D3MO) both resulted in transcriptional regulation of energy metabolism and (muscle) development in abdomen and tail, together with reduced growth, impaired swim bladder inflation, reduced protein content and reduced motility. The reduced growth and impaired swim bladder inflation in D1D2MO could be due to lower levels of T3 which is known to drive growth and development. The pronounced upregulation of a large number of transcripts coding for key proteins in ATP-producing pathways in D1D2MO could reflect a compensatory response to a decreased metabolic rate, also typically linked to hypothyroidism. Compared to D1D2MO, the effects were more pronounced or more frequent in D3MO, in which hyperthyroidism is expected. More specifically, increased heart rate, delayed hatching and increased carbohydrate content were observed only in D3MO. An increase of the metabolic rate, a decrease of the metabolic efficiency and a stimulation of gluconeogenesis using amino acids as substrates may have been involved in the observed reduced protein content, growth and motility in D3MO larvae. Furthermore, expression of transcripts involved in purine metabolism coupled to vision was decreased in both knockdown conditions, suggesting that both may impair vision. This study provides new insights, not only into the role of deiodinases, but also into the importance of a correct TH balance

Deiodinase Knockdown during Early Zebrafish Development Affects Growth, Development, Energy Metabolism, Motility and Phototransduction

PubMed Central

Bagci, Enise; Heijlen, Marjolein; Vergauwen, Lucia; Hagenaars, An; Houbrechts, Anne M.; Esguerra, Camila V.; Blust, Ronny; Darras, Veerle M.; Knapen, Dries

2015-01-01

Thyroid hormone (TH) balance is essential for vertebrate development. Deiodinase type 1 (D1) and type 2 (D2) increase and deiodinase type 3 (D3) decreases local intracellular levels of T3, the most important active TH. The role of deiodinase-mediated TH effects in early vertebrate development is only partially understood. Therefore, we investigated the role of deiodinases during early development of zebrafish until 96 hours post fertilization at the level of the transcriptome (microarray), biochemistry, morphology and physiology using morpholino (MO) knockdown. Knockdown of D1+D2 (D1D2MO) and knockdown of D3 (D3MO) both resulted in transcriptional regulation of energy metabolism and (muscle) development in abdomen and tail, together with reduced growth, impaired swim bladder inflation, reduced protein content and reduced motility. The reduced growth and impaired swim bladder inflation in D1D2MO could be due to lower levels of T3 which is known to drive growth and development. The pronounced upregulation of a large number of transcripts coding for key proteins in ATP-producing pathways in D1D2MO could reflect a compensatory response to a decreased metabolic rate, also typically linked to hypothyroidism. Compared to D1D2MO, the effects were more pronounced or more frequent in D3MO, in which hyperthyroidism is expected. More specifically, increased heart rate, delayed hatching and increased carbohydrate content were observed only in D3MO. An increase of the metabolic rate, a decrease of the metabolic efficiency and a stimulation of gluconeogenesis using amino acids as substrates may have been involved in the observed reduced protein content, growth and motility in D3MO larvae. Furthermore, expression of transcripts involved in purine metabolism coupled to vision was decreased in both knockdown conditions, suggesting that both may impair vision. This study provides new insights, not only into the role of deiodinases, but also into the importance of a correct TH balance

Alpha2,3-sialyltransferase III knockdown sensitized ovarian cancer cells to cisplatin-induced apoptosis.

PubMed

Wang, Xiaoyu; Zhang, Yiting; Lin, Haiyingjie; Liu, Yan; Tan, Yi; Lin, Jie; Gao, Fenze; Lin, Shaoqiang

2017-01-22

Emerging evidence indicates that β-galactoside-α2,3-sialyltransferase III (ST3Gal3) involves in development, inflammation, neoplastic transformation, and metastasis. However, the role of ST3Gal3 in regulating cancer chemoresistance remains elusive. Herein, we investigated the functional effects of ST3Gal3 in cisplatin-resistant ovarian cancer cells. We found that the levels of ST3Gal3 mRNA differed significantly among ovarian cancer cell lines. HO8910PM cells that have high invasive and metastatic capacity express elevated ST3Gal3 mRNA and are resistant to cisplatin, comparing to SKOV3 cells that have a lower level of ST3Gal3 expression and are more chemosensitive to cisplatin. We found that the expression of ST3Gal3 has reverse correlation with the dosage of cisplatin used in both SKOV3 and HO8910PM cells, and high dose of cisplatin could down-regulate ST3Gal3 expression. We then examined the functional effects of ST3Gal3 knockdown in cancer cell lines using FACS analysis. The number of apoptotic cells was much higher in cells if ST3Gal3 expression was knocked down by siRNA and/or by treating cells with higher dosage of cisplatin in comparison to control cells. Interestingly, in HO8910PM cells with ST3Gal3 knockdown, the levels of caspase 8 and caspase 3 proteins increased, which was more obvious in cells treated with both ST3Gal3 knockdown and cisplatin, suggesting that ST3Gal3 knockdown synergistically enhanced cisplatin-induced apoptosis in ovarian cancer cells. Taken together, these results uncover an alternative mechanism of cisplatin-resistance through ST3Gal3 and open a window for effective prevention of chemoresistance and relapse of ovarian cancer by targeting ST3Gal3. Copyright © 2016 Elsevier Inc. All rights reserved.

Effective gene prediction by high resolution frequency estimator based on least-norm solution technique

PubMed Central

2014-01-01

Linear algebraic concept of subspace plays a significant role in the recent techniques of spectrum estimation. In this article, the authors have utilized the noise subspace concept for finding hidden periodicities in DNA sequence. With the vast growth of genomic sequences, the demand to identify accurately the protein-coding regions in DNA is increasingly rising. Several techniques of DNA feature extraction which involves various cross fields have come up in the recent past, among which application of digital signal processing tools is of prime importance. It is known that coding segments have a 3-base periodicity, while non-coding regions do not have this unique feature. One of the most important spectrum analysis techniques based on the concept of subspace is the least-norm method. The least-norm estimator developed in this paper shows sharp period-3 peaks in coding regions completely eliminating background noise. Comparison of proposed method with existing sliding discrete Fourier transform (SDFT) method popularly known as modified periodogram method has been drawn on several genes from various organisms and the results show that the proposed method has better as well as an effective approach towards gene prediction. Resolution, quality factor, sensitivity, specificity, miss rate, and wrong rate are used to establish superiority of least-norm gene prediction method over existing method. PMID:24386895

USP22 knockdown enhanced chemosensitivity of hepatocellular carcinoma cells to 5-Fu by up-regulation of Smad4 and suppression of Akt

PubMed Central

Li, Jiazhi; Yang, Xiaozhou; Yin, Huimin; Xiao, Congshu; Sheng, Jie; Li, Yang; Tang, Bo; Li, Rongkuan

2017-01-01

USP22, a member of the deubiquitinases (DUBs) family, is known to be a key subunit of the human Spt-Ada-Gcn5 acetyltransferase (hSAGA) transcriptional cofactor complex. Within hSAGA, USP22 removes ubiquitin from histone proteins, thus regulating the transcription and expression of downstream genes. USP22 plays important roles in many cancers; however, its effect and the mechanism underlying HCC chemoresistance remain unclear. In the present study, we found that USP22 was highly expressed in chemoresistant HCC tissues and cells and was correlated with the prognosis of HCC patients who received chemotherapy. Silencing USP22 in chemoresistant HCC Bel/Fu cells dramatically inhibited proliferation, migration, invasion and epithelial-mesenchymal transition in vitro; suppressed tumorigenic and metastatic capacities in vivo; and inhibited drug resistance-related proteins (MDR1, LRP, MRP1). Mechanistically, we found that USP22 knockdown exerts its function through down-regulating PI3K and activating Smad4, which inhibited phosphorylation of Akt. Silencing Smad4 blocked USP22 knockdown-induced Akt inhibition in Bel/Fu cells. Our results, for the first time, provide evidence that USP22 plays a critical role in the development of chemoresistant HCC cells and that high USP22 expression serves as a molecular marker for the prognosis of HCC patients who undergo chemotherapy. PMID:28445968

USP22 knockdown enhanced chemosensitivity of hepatocellular carcinoma cells to 5-Fu by up-regulation of Smad4 and suppression of Akt.

PubMed

Zhang, Jing; Luo, Nan; Tian, Yu; Li, Jiazhi; Yang, Xiaozhou; Yin, Huimin; Xiao, Congshu; Sheng, Jie; Li, Yang; Tang, Bo; Li, Rongkuan

2017-04-11

USP22, a member of the deubiquitinases (DUBs) family, is known to be a key subunit of the human Spt-Ada-Gcn5 acetyltransferase (hSAGA) transcriptional cofactor complex. Within hSAGA, USP22 removes ubiquitin from histone proteins, thus regulating the transcription and expression of downstream genes. USP22 plays important roles in many cancers; however, its effect and the mechanism underlying HCC chemoresistance remain unclear. In the present study, we found that USP22 was highly expressed in chemoresistant HCC tissues and cells and was correlated with the prognosis of HCC patients who received chemotherapy. Silencing USP22 in chemoresistant HCC Bel/Fu cells dramatically inhibited proliferation, migration, invasion and epithelial-mesenchymal transition in vitro; suppressed tumorigenic and metastatic capacities in vivo; and inhibited drug resistance-related proteins (MDR1, LRP, MRP1). Mechanistically, we found that USP22 knockdown exerts its function through down-regulating PI3K and activating Smad4, which inhibited phosphorylation of Akt. Silencing Smad4 blocked USP22 knockdown-induced Akt inhibition in Bel/Fu cells. Our results, for the first time, provide evidence that USP22 plays a critical role in the development of chemoresistant HCC cells and that high USP22 expression serves as a molecular marker for the prognosis of HCC patients who undergo chemotherapy.

Knockdown of Decoy Receptor 3 Impairs Growth and Invasiveness of Hepatocellular Carcinoma Cell Line of HepG2.

PubMed

Zhou, Xiao-Na; Li, Guang-Ming; Xu, Ying-Chen; Zhao, Tuan-Jie; Wu, Ji-Xiang

2016-11-05

Decoy receptor 3 (DcR3) binds to Fas ligand (FasL) and inhibits FasL-induced apoptosis. The receptor is overexpressed in hepatocellular carcinoma (HCC), and it is associated with the growth and metastatic spread of tumors. DcR3 holds promises as a new target for the treatment of HCC, but little is known regarding the molecular mechanisms underlying the oncogenic properties of DcR3. The present work, therefore, examined the role of DcR3 in regulating the growth and invasive property of liver cancer cell HepG2. HepG2 cells were stably transfected with lentivirus-based short hairpin RNA vector targeting DcR3. After the knockdown of DcR3 was confirmed, cell proliferation, clone formation, ability of migrating across transwell membrane, and wound healing were assessed in vitro. Matrix metalloproteinase-9 (MMP 9) and vascular epithelial growth factor (VEGF)-C and D expressions of the DcR3 knockdown were also studied. Comparisons between multiple groups were done using one-way analysis of variance (ANOVA), while pairwise comparisons were performed using Student's t test. P< 0.05 was regarded statistically significant. DcR3 was overexpressed in HepG2 compared to other HCC cell lines and normal hepatocyte Lo-2. Stable knockdown of DcR3 slowed down the growth of HepG2 (P < 0.05) and reduced the number of clones formed by 50% compared to those without DcR3 knockdown (P < 0.05). The knockdown also reduced the migration of HepG2 across transwell matrix membrane by five folds compared to the control (P < 0.05) and suppressed the closure of scratch wound (P < 0.05). In addition, the messenger RNA levels of MMP 9, VEGF-C, and VEGF-D were significantly suppressed by DcR3 knockdown by 90% when compared with the mock control (P < 0.05). Loss of DcR3 impaired the growth and invasive property of HCC cell line of HepG2. Targeting DcR3 may be a potential therapeutic approach for the treatment of HCC.

Knockdown of Decoy Receptor 3 Impairs Growth and Invasiveness of Hepatocellular Carcinoma Cell Line of HepG2

PubMed Central

Zhou, Xiao-Na; Li, Guang-Ming; Xu, Ying-Chen; Zhao, Tuan-Jie; Wu, Ji-Xiang

2016-01-01

Background: Decoy receptor 3 (DcR3) binds to Fas ligand (FasL) and inhibits FasL-induced apoptosis. The receptor is overexpressed in hepatocellular carcinoma (HCC), and it is associated with the growth and metastatic spread of tumors. DcR3 holds promises as a new target for the treatment of HCC, but little is known regarding the molecular mechanisms underlying the oncogenic properties of DcR3. The present work, therefore, examined the role of DcR3 in regulating the growth and invasive property of liver cancer cell HepG2. Methods: HepG2 cells were stably transfected with lentivirus-based short hairpin RNA vector targeting DcR3. After the knockdown of DcR3 was confirmed, cell proliferation, clone formation, ability of migrating across transwell membrane, and wound healing were assessed in vitro. Matrix metalloproteinase-9 (MMP 9) and vascular epithelial growth factor (VEGF)-C and D expressions of the DcR3 knockdown were also studied. Comparisons between multiple groups were done using one-way analysis of variance (ANOVA), while pairwise comparisons were performed using Student's t test. P < 0.05 was regarded statistically significant. Results: DcR3 was overexpressed in HepG2 compared to other HCC cell lines and normal hepatocyte Lo-2. Stable knockdown of DcR3 slowed down the growth of HepG2 (P < 0.05) and reduced the number of clones formed by 50% compared to those without DcR3 knockdown (P < 0.05). The knockdown also reduced the migration of HepG2 across transwell matrix membrane by five folds compared to the control (P < 0.05) and suppressed the closure of scratch wound (P < 0.05). In addition, the messenger RNA levels of MMP 9, VEGF-C, and VEGF-D were significantly suppressed by DcR3 knockdown by 90% when compared with the mock control (P < 0.05). Conclusions: Loss of DcR3 impaired the growth and invasive property of HCC cell line of HepG2. Targeting DcR3 may be a potential therapeutic approach for the treatment of HCC. PMID:27779171

Differential prioritization between relevance and redundancy in correlation-based feature selection techniques for multiclass gene expression data.

PubMed

Ooi, Chia Huey; Chetty, Madhu; Teng, Shyh Wei

2006-06-23

Due to the large number of genes in a typical microarray dataset, feature selection looks set to play an important role in reducing noise and computational cost in gene expression-based tissue classification while improving accuracy at the same time. Surprisingly, this does not appear to be the case for all multiclass microarray datasets. The reason is that many feature selection techniques applied on microarray datasets are either rank-based and hence do not take into account correlations between genes, or are wrapper-based, which require high computational cost, and often yield difficult-to-reproduce results. In studies where correlations between genes are considered, attempts to establish the merit of the proposed techniques are hampered by evaluation procedures which are less than meticulous, resulting in overly optimistic estimates of accuracy. We present two realistically evaluated correlation-based feature selection techniques which incorporate, in addition to the two existing criteria involved in forming a predictor set (relevance and redundancy), a third criterion called the degree of differential prioritization (DDP). DDP functions as a parameter to strike the balance between relevance and redundancy, providing our techniques with the novel ability to differentially prioritize the optimization of relevance against redundancy (and vice versa). This ability proves useful in producing optimal classification accuracy while using reasonably small predictor set sizes for nine well-known multiclass microarray datasets. For multiclass microarray datasets, especially the GCM and NCI60 datasets, DDP enables our filter-based techniques to produce accuracies better than those reported in previous studies which employed similarly realistic evaluation procedures.

Mitochondrial aquaporin-8 knockdown in human hepatoma HepG2 cells causes ROS-induced mitochondrial depolarization and loss of viability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marchissio, Maria Julia; Francés, Daniel Eleazar Antonio; Carnovale, Cristina Ester

Human aquaporin-8 (AQP8) channels facilitate the diffusional transport of H{sub 2}O{sub 2} across membranes. Since AQP8 is expressed in hepatic inner mitochondrial membranes, we studied whether mitochondrial AQP8 (mtAQP8) knockdown in human hepatoma HepG2 cells impairs mitochondrial H{sub 2}O{sub 2} release, which may lead to organelle dysfunction and cell death. We confirmed AQP8 expression in HepG2 inner mitochondrial membranes and found that 72 h after cell transfection with siRNAs targeting two different regions of the human AQP8 molecule, mtAQP8 protein specifically decreased by around 60% (p < 0.05). Studies in isolated mtAQP8-knockdown mitochondria showed that H{sub 2}O{sub 2} release, assessedmore » by Amplex Red, was reduced by about 45% (p < 0.05), an effect not observed in digitonin-permeabilized mitochondria. mtAQP8-knockdown cells showed an increase in mitochondrial ROS, assessed by dichlorodihydrofluorescein diacetate (+ 120%, p < 0.05) and loss of mitochondrial membrane potential (− 80%, p < 0.05), assessed by tetramethylrhodamine-coupled quantitative fluorescence microscopy. The mitochondria-targeted antioxidant MitoTempol prevented ROS accumulation and dissipation of mitochondrial membrane potential. Cyclosporin A, a mitochondrial permeability transition pore blocker, also abolished the mtAQP8 knockdown-induced mitochondrial depolarization. Besides, the loss of viability in mtAQP8 knockdown cells verified by MTT assay, LDH leakage, and trypan blue exclusion test could be prevented by cyclosporin A. Our data on human hepatoma HepG2 cells suggest that mtAQP8 facilitates mitochondrial H{sub 2}O{sub 2} release and that its defective expression causes ROS-induced mitochondrial depolarization via the mitochondrial permeability transition mechanism, and cell death. -- Highlights: ► Aquaporin-8 is expressed in mitochondria of human hepatoma HepG2 cells. ► Aquaporin-8 knockdown impairs mitochondrial H{sub 2}O{sub 2} release and increases ROS. �

X-Linked Retinitis Pigmentosa 2 Is a Novel Maternal-Effect Gene Required for Left-Right Asymmetry in Zebrafish.

PubMed

Desvignes, Thomas; Nguyen, Thaovi; Chesnel, Franck; Bouleau, Aurélien; Fauvel, Christian; Bobe, Julien

2015-08-01

Retinitis pigmentosa 2 (RP2) gene is responsible for up to 20% of X-linked retinitis pigmentosa, a severe heterogeneous genetic disorder resulting in progressive retinal degeneration in humans. In vertebrates, several bodies of evidence have clearly established the role of Rp2 protein in cilia genesis and/or function. Unexpectedly, some observations in zebrafish have suggested the oocyte-predominant expression of the rp2 gene, a typical feature of maternal-effect genes. In the present study, we investigate the maternal inheritance of rp2 gene products in zebrafish eggs in order to address whether rp2 could be a novel maternal-effect gene required for normal development. Although both rp2 mRNA and corresponding protein are expressed during oogenesis, rp2 mRNA is maternally inherited, in contrast to Rp2 protein. A knockdown of the protein transcribed from both rp2 maternal and zygotic mRNA results in delayed epiboly and severe developmental defects, including eye malformations, that were not observed when only the protein from zygotic origin was knocked down. Moreover, the knockdown of maternal and zygotic Rp2 revealed a high incidence of left-right asymmetry establishment defects compared to only zygotic knockdown. Here we show that rp2 is a novel maternal-effect gene exclusively expressed in oocytes within the zebrafish ovary and demonstrate that maternal rp2 mRNA is essential for successful embryonic development and thus contributes to egg developmental competence. Our observations also reveal that Rp2 protein translated from maternal mRNA is important to allow normal heart loop formation, thus providing evidence of a direct maternal contribution to left-right asymmetry establishment. © 2015 by the Society for the Study of Reproduction, Inc.

Effect of Tbx1 knock-down on cardiac performance in zebrafish.

PubMed

Zhang, Li-feng; Gui, Yong-hao; Wang, Yue-xiang; Jiang, Qiu; Song, Hou-yan

2010-05-05

Tbx1 is the major candidate gene for DiGeorge syndrome (DGS). Similar to defects observed in DGS patients, the structures disrupted in Tbx1(-/-) animal models are derived from the neural crest cells during development. Although the morphological phenotypes of some Tbx1 knock-down animal models have been well described, analysis of the cardiac performance is limited. Therefore, myocardial performance was explored in Tbx1 morpholino injected zebrafish embryos. To elucidate these issues, Tbx1 specific morpholino was used to reduce the function of Tbx1 in zebrafish. The differentiation of the myocardial cells was observed using whole mount in situ hybridization. Heart rates were observed and recorded under the microscope from 24 to 72 hours post fertilization (hpf). The cardiac performance was analyzed by measuring ventricular shortening fraction and atrial shortening fraction. Tbx1 morpholino injected embryos were characterized by defects in the pharyngeal arches, otic vesicle, aortic arches and thymus. In addition, Tbx1 knock down reduced the amount of pharyngeal neural crest cells in zebrafish. Abnormal cardiac morphology was visible in nearly 20% of the Tbx1 morpholino injected embryos. The hearts in these embryos did not loop or loop incompletely. Importantly, cardiac performance and heart rate were reduced in Tbx1 morpholino injected embryos. Tbx1 might play an essential role in the development of pharyngeal neural crest cells in zebrafish. Cardiac performance is impaired by Tbx1 knock down in zebrafish.

Long non-coding RNA expression profile in Cdk5-knockdown mouse skin.

PubMed

Ji, Kaiyuan; Fan, Ruiwen; Zhang, Junzhen; Yang, Shanshan; Dong, Changsheng

2018-06-08

To elucidate the Cdk5 regulatory molecular mechanism in skin, we generated Cdk5-knockdown mice and subjected their skins to lncRNA sequencing. The results showed that there were 4533 novel lncRNAs from 142 lncRNA families. In total, 693 lncRNAs were significantly differentially expressed. Alignment analysis of the lncRNAs in miRBase identified 45 pre-mRNAs. By KEGG PATHWAY Database analysis, we found that lncRNAs (lnc-NONMMUT064276.2, lnc-NONMMUT075728.1, and lnc-NONMMUT039653.2) may regulate pigmentation by regulating target genes. To reveal potential antisense lncRNA-mRNA interactions, we searched all lncRNA-mRNA duplexes using RNAplex, and found 97 lncRNAs interacted with mRNAs. The luciferase assay confirmed that TCONS_00049140 binded to Krt80 by the co-transfection of pVAX1-TCONS_00049140 and pGL0-Krt80 expression plasmids in 293T cell, based on the bioinformatics analysis. Overexpression of TCONS_00049140 in mouse melanocytes down-regulated Krt80 and resulted in the phenotype of increased cell proliferation and increased melanin production. The results suggested that TCONS_00049140 contributed to skin thickening through Krt80. Our findings provide a direction for research of the molecular mechanism of Cdk5 function. Copyright © 2017. Published by Elsevier B.V.

Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

ERIC Educational Resources Information Center

Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

2009-01-01

We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

HSP27 knockdown produces synergistic induction of apoptosis by HSP90 and kinase inhibitors in glioblastoma multiforme.

PubMed

Belkacemi, Louiza; Hebb, Matthew O

2014-09-01

The heat-shock proteins HSP27 and HSP90 perpetuate the malignant nature of glioblastoma multiforme (GBM) and offer promise as targets for novel cancer therapeutics. The present study sought to define synergistic antitumor benefits of concurrent HSP27-knockdown and the HSP90 inhibitor, 17-N-allylamino-17-demethoxygeldanamycin (17-AAG) or, comparatively, the non-selective kinase inhibitor, staurosporine, in GBM cells. Dose-response relations were determined for 17-AAG and staurosporine in three GBM cell lines. HSP27-targeted siRNA was administered alone or in combination with subtherapeutic concentrations of each drug and cells were evaluated for viability, proliferation and apoptosis. Adjuvant HSP27 knockdown with 17-AAG or staurosporine produced marked and synergistic decrease in GBM cell viability and proliferation, with robust elevation of apoptotic fractions and caspase-3 activation. HSP27 knockdown confers potent chemosensitization of GBM cells. These novel data support the development of HSP-targeting strategies and, specifically, anti-HSP27 agents for the treatment of GBM. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.

PubMed

Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro

2018-05-03

Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.

The atypical mitogen-activated protein kinase ERK3 is essential for establishment of epithelial architecture.

PubMed

Takahashi, Chika; Miyatake, Koichi; Kusakabe, Morioh; Nishida, Eisuke

2018-06-01

Epithelia contribute to physical barriers that protect internal tissues from the external environment and also support organ structure. Accordingly, establishment and maintenance of epithelial architecture are essential for both embryonic development and adult physiology. Here, using gene knockout and knockdown techniques along with gene profiling, we show that extracellular signal-regulated kinase 3 (ERK3), a poorly characterized atypical mitogen-activated protein kinase (MAPK), regulates the epithelial architecture in vertebrates. We found that in Xenopus embryonic epidermal epithelia, ERK3 knockdown impairs adherens and tight-junction protein distribution, as well as tight-junction barrier function, resulting in epidermal breakdown. Moreover, in human epithelial breast cancer cells, inhibition of ERK3 expression induced thickened epithelia with aberrant adherens and tight junctions. Results from microarray analyses suggested that transcription factor AP-2α (TFAP2A), a transcriptional regulator important for epithelial gene expression, is involved in ERK3-dependent changes in gene expression. Of note, TFAP2A knockdown phenocopied ERK3 knockdown in both Xenopus embryos and human cells, and ERK3 was required for full activation of TFAP2A-dependent transcription. Our findings reveal that ERK3 regulates epithelial architecture, possibly together with TFAP2A. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterization of Acyl-CoA Synthetase Isoforms In Pancreatic Beta Cells: Gene Silencing Shows Participation of ACSL3 and ACSL4 In Insulin Secretion

PubMed Central

Ansari, Israr-ul H.; Longacre, Melissa J.; Stoker, Scott W.; Kendrick, Mindy A.; O’Neill, Lucas M.; Zitur, Laura J.; Fernandez, Luis A.; Ntambi, James M.; MacDonald, Michael J.

2017-01-01

Long-chain acyl-CoA synthetases (ACSLs) convert fatty acids to fatty acyl-CoAs to regulate various physiologic processes. We characterized the ACSL isoforms in a cell line of homogeneous rat beta cells (INS-1 832/13 cells) and human pancreatic islets. ACSL4 and ACSL3 proteins were present in the beta cells and human and rat pancreatic islets and concentrated in insulin secretory granules and less in mitochondria and negligible in other intracellular organelles. ACSL1 and ACSL6 proteins were not seen in INS-1 832/13 cells or pancreatic islets. ACSL5 protein was seen only in INS-1 832/13 cells. With shRNA-mediated gene silencing we developed stable ACSL knockdown cell lines from INS-1 832/13 cells. Glucose-stimulated insulin release was inhibited ~ 50% with ACSL4 and ACSL3 knockdown and unaffected in cell lines with knockdown of ACSL5, ACLS6 and ACSL1. Lentivirus shRNA-mediated gene silencing of ACSL4 and ACSL3 in human pancreatic islets inhibited glucose-stimulated insulin release. ACSL4 and ACSL3 knockdown cells showed inhibition of ACSL enzyme activity more with arachidonate than with palmitate as a substrate, consistent with their preference for unsaturated fatty acids as substrates. ACSL4 knockdown changed the patterns of fatty acids in phosphatidylserines and phosphatidylethanolamines. The results show the involvement of ACLS4 and ACLS3 in insulin secretion. PMID:28193492

On the role of PDZ domain-encoding genes in Drosophila border cell migration.

PubMed

Aranjuez, George; Kudlaty, Elizabeth; Longworth, Michelle S; McDonald, Jocelyn A

2012-11-01

Cells often move as collective groups during normal embryonic development and wound healing, although the mechanisms governing this type of migration are poorly understood. The Drosophila melanogaster border cells migrate as a cluster during late oogenesis and serve as a powerful in vivo genetic model for collective cell migration. To discover new genes that participate in border cell migration, 64 out of 66 genes that encode PDZ domain-containing proteins were systematically targeted by in vivo RNAi knockdown. The PDZ domain is one of the largest families of protein-protein interaction domains found in eukaryotes. Proteins that contain PDZ domains participate in a variety of biological processes, including signal transduction and establishment of epithelial apical-basal polarity. Targeting PDZ proteins effectively assesses a larger number of genes via the protein complexes and pathways through which these proteins function. par-6, a known regulator of border cell migration, was a positive hit and thus validated the approach. Knockdown of 14 PDZ domain genes disrupted migration with multiple RNAi lines. The candidate genes have diverse predicted cellular functions and are anticipated to provide new insights into the mechanisms that control border cell movement. As a test of this concept, two genes that disrupted migration were characterized in more detail: big bang and the Dlg5 homolog CG6509. We present evidence that Big bang regulates JAK/STAT signaling, whereas Dlg5/CG6509 maintains cluster cohesion. Moreover, these results demonstrate that targeting a selected class of genes by RNAi can uncover novel regulators of collective cell migration.

The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.

PubMed

Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María

2016-09-01

The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

Comparative analysis of temporal gene expression patterns in the developing ovary of the embryonic chicken

PubMed Central

YU, Minli; XU, Yali; YU, Defu; YU, Debing; DU, Wenxing

2015-01-01

Many genes participate in the process of ovarian germ cell development, while the combined action mechanisms of these molecular regulators still need clarification. The present study was focused on determination of differentially expressed genes and gene functions at four critical time points in chicken ovarian development. Comparative transcriptional profiling of ovaries from embryonic day 5.5 (E5.5), E12.5, E15.5 and E18.5 was performed using an Affymetrix GeneChip chicken genome microarray. Differential expression patterns for genes specifically depleted and enriched in each stage were identified. The results showed that most of the up- and downregulated genes were involved in the metabolism of retinoic acid (RA) and synthesis of hormones. Among them, a higher number of up- and downregulated genes in the E15.5 ovary were identified as being involved in steroid biosynthesis and retinol metabolism, respectively. To validate gene changes, expressions of twelve candidate genes related to germ cell development were examined by real-time PCR and found to be consistent with the of GeneChip data. Moreover, the immunostaining results suggested that ovarian development during different stages was regulated by different genes. Furthermore, a Raldh2 knockdown chicken model was produced to investigate the fundamental role of Raldh2 in meiosis initiation. It was found that meiosis occurred abnormally in Raldh2 knockdown ovaries, but the inhibitory effect on meiosis was reversed by the addition of exogenous RA. This study offers insights into the profile of gene expression and mechanisms regulating ovarian development, especially the notable role of Raldh2 in meiosis initiation in the chicken. PMID:25736178

Overexpression and knock-down studies highlight that a disintegrin and metalloproteinase 28 controls proliferation and migration in human prostate cancer.

PubMed

Rudnicka, Caroline; Mochizuki, Satsuki; Okada, Yasunori; McLaughlin, Claire; Leedman, Peter J; Stuart, Lisa; Epis, Michael; Hoyne, Gerard; Boulos, Sherif; Johnson, Liam; Schlaich, Markus; Matthews, Vance

2016-10-01

Prostate cancer is one of the most prevalent cancers in men. It is critical to identify and characterize oncogenes that drive the pathogenesis of human prostate cancer. The current study builds upon previous research showing that a disintegrin and metallproteinase (ADAM)28 is involved in the pathogenesis of numerous cancers. Our novel study used overexpression, pharmacological, and molecular approaches to investigate the biological function of ADAM28 in human prostate cancer cells, with a focus on cell proliferation and migration. The results of this study provide important insights into the role of metalloproteinases in human prostate cancer.The expression of ADAM28 protein levels was assessed within human prostate tumors and normal adjacent tissue by immunohistochemistry. Immunocytochemistry and western blotting were used to assess ADAM28 protein expression in human prostate cancer cell lines. Functional assays were conducted to assess proliferation and migration in human prostate cancer cells in which ADAM28 protein expression or activity had been altered by overexpression, pharmacological inhibition, or by siRNA gene knockdown.The membrane bound ADAM28 was increased in human tumor biopsies and prostate cancer cell lines. Pharmacological inhibition of ADAM28 activity and/or knockdown of ADAM28 significantly reduced proliferation and migration of human prostate cancer cells, while overexpression of ADAM28 significantly increased proliferation and migration.ADAM28 is overexpressed in primary human prostate tumor biopsies, and it promotes human prostate cancer cell proliferation and migration. This study supports the notion that inhibition of ADAM28 may be a potential novel therapeutic strategy for human prostate cancer.

Reduced 64Cu uptake and tumor growth inhibition by knockdown of human copper transporter 1 in xenograft mouse model of prostate cancer.

PubMed

Cai, Huawei; Wu, Jiu-sheng; Muzik, Otto; Hsieh, Jer-Tsong; Lee, Robert J; Peng, Fangyu

2014-04-01

Copper is an element required for cell proliferation and angiogenesis. Human prostate cancer xenografts with increased (64)Cu radioactivity were visualized previously by PET using (64)CuCl2 as a radiotracer ((64)CuCl2 PET). This study aimed to determine whether the increased tumor (64)Cu radioactivity was due to increased cellular uptake of (64)Cu mediated by human copper transporter 1 (hCtr1) or simply due to nonspecific binding of ionic (64)CuCl2 to tumor tissue. In addition, the functional role of hCtr1 in proliferation of prostate cancer cells and tumor growth was also assessed. A lentiviral vector encoding short-hairpin RNA specific for hCtr1 (Lenti-hCtr1-shRNA) was constructed for RNA interference-mediated knockdown of hCtr1 expression in prostate cancer cells. The degree of hCtr1 knockdown was determined by Western blot, and the effect of hCtr1 knockdown on copper uptake and proliferation were examined in vitro by cellular (64)Cu uptake and cell proliferation assays. The effects of hCtr1 knockdown on tumor uptake of (64)Cu were determined by PET quantification and tissue radioactivity assay. The effects of hCtr1 knockdown on tumor growth were assessed by PET/CT and tumor size measurement with a caliper. RNA interference-mediated knockdown of hCtr1 was associated with the reduced cellular uptake of (64)Cu and the suppression of prostate cancer cell proliferation in vitro. At 24 h after intravenous injection of the tracer (64)CuCl2, the (64)Cu uptake by the tumors with knockdown of hCtr1 (4.02 ± 0.31 percentage injected dose per gram [%ID/g] in Lenti-hCtr1-shRNA-PC-3 and 2.30 ± 0.59 %ID/g in Lenti-hCtr1-shRNA-DU-145) was significantly lower than the (64)Cu uptake by the control tumors without knockdown of hCtr1 (7.21 ± 1.48 %ID/g in Lenti-SCR-shRNA-PC-3 and 5.57 ± 1.20 %ID/g in Lenti-SCR-shRNA-DU-145, P < 0.001) by PET quantification. Moreover, the volumes of prostate cancer xenograft tumors with knockdown of hCtr1 (179 ± 111 mm(3) for Lenti-hCtr1-sh

A High-Throughput Fluorescence-Based Assay System for Appetite-Regulating Gene and Drug Screening

PubMed Central

Shimada, Yasuhito; Hirano, Minoru; Nishimura, Yuhei; Tanaka, Toshio

2012-01-01

The increasing number of people suffering from metabolic syndrome and obesity is becoming a serious problem not only in developed countries, but also in developing countries. However, there are few agents currently approved for the treatment of obesity. Those that are available are mainly appetite suppressants and gastrointestinal fat blockers. We have developed a simple and rapid method for the measurement of the feeding volume of Danio rerio (zebrafish). This assay can be used to screen appetite suppressants and enhancers. In this study, zebrafish were fed viable paramecia that were fluorescently-labeled, and feeding volume was measured using a 96-well microplate reader. Gene expression analysis of brain-derived neurotrophic factor (bdnf), knockdown of appetite-regulating genes (neuropeptide Y, preproinsulin, melanocortin 4 receptor, agouti related protein, and cannabinoid receptor 1), and the administration of clinical appetite suppressants (fluoxetine, sibutramine, mazindol, phentermine, and rimonabant) revealed the similarity among mechanisms regulating appetite in zebrafish and mammals. In combination with behavioral analysis, we were able to evaluate adverse effects on locomotor activities from gene knockdown and chemical treatments. In conclusion, we have developed an assay that uses zebrafish, which can be applied to high-throughput screening and target gene discovery for appetite suppressants and enhancers. PMID:23300705

Genes and Gene Therapy

MedlinePlus

... a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

PubMed

Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

2009-04-01

Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

PubMed

Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

2008-04-01

Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

New genes often acquire male-specific functions but rarely become essential in Drosophila.

PubMed

Kondo, Shu; Vedanayagam, Jeffrey; Mohammed, Jaaved; Eizadshenass, Sogol; Kan, Lijuan; Pang, Nan; Aradhya, Rajaguru; Siepel, Adam; Steinhauer, Josefa; Lai, Eric C

2017-09-15

Relatively little is known about the in vivo functions of newly emerging genes, especially in metazoans. Although prior RNAi studies reported prevalent lethality among young gene knockdowns, our phylogenomic analyses reveal that young Drosophila genes are frequently restricted to the nonessential male reproductive system. We performed large-scale CRISPR/Cas9 mutagenesis of "conserved, essential" and "young, RNAi-lethal" genes and broadly confirmed the lethality of the former but the viability of the latter. Nevertheless, certain young gene mutants exhibit defective spermatogenesis and/or male sterility. Moreover, we detected widespread signatures of positive selection on young male-biased genes. Thus, young genes have a preferential impact on male reproductive system function. © 2017 Kondo et al.; Published by Cold Spring Harbor Laboratory Press.

An increase in liver PPARγ2 is an initial event to induce fatty liver in response to a diet high in butter: PPARγ2 knockdown improves fatty liver induced by high-saturated fat.

PubMed

Yamazaki, Tomomi; Shiraishi, Sayaka; Kishimoto, Kyoko; Miura, Shinji; Ezaki, Osamu

2011-06-01

The effects of a diet rich in saturated fat on fatty liver formation and the related mechanisms that induce fatty liver were examined. C57BL/6J mice were fed butter or safflower oil as a high-fat (HF) diet (40% fat calories) for 2, 4, 10, or 17 weeks. Although both HF diets induced similar levels of obesity, HF butter-fed mice showed a two to threefold increase in liver triacylglycerol (TG) concentration compared to HF safflower oil-fed mice at 4 or 10 weeks without hyperinsulinemia. At 4 weeks, increases in peroxisome proliferator-activated receptor γ2 (PPARγ2), CD36, and adipose differentiation-related protein (ADRP) mRNAs were observed in HF butter-fed mice; at 10 weeks, an increase in sterol regulatory element-binding protein-1c (SREBP-1c) was observed; at 17 weeks, these increases were attenuated. At 4 weeks, a single injection of adenoviral vector-based short hairpin interfering RNA against PPARγ2 in HF butter-fed mice reduced PPARγ protein and mRNA of its target genes (CD36 and ADRP) by 43%, 43%, and 39%, respectively, with a reduction in liver TG concentration by 38% in 5 days. PPARγ2 knockdown also reduced mRNAs in lipogenic genes (fatty-acid-synthase, stearoyl-CoA desaturase 1, acetyl-CoA carboxylase 1) without alteration of SREBP-1c mRNA. PPARγ2 knockdown reduced mRNAs in genes related to inflammation (CD68, interleukin-1β, tumor necrosis factor-α, and monocyte chemoattractant protein-1). In conclusion, saturated fatty acid-rich oil induced fatty liver in mice, and this was triggered initially by an increase in PPARγ2 protein in the liver, which led to increased expression of lipogenic genes. Inactivation of PPARγ2 may improve fatty liver induced by HF saturated fat. Copyright © 2011 Elsevier Inc. All rights reserved.

Knockdown of IL-8 Provoked Premature Senescence of Placenta-Derived Mesenchymal Stem Cells.

PubMed

Li, Juan-Juan; Ma, Feng-Xia; Wang, You-Wei; Chen, Fang; Lu, Shi-Hong; Chi, Ying; Du, Wen-Jing; Song, Bao-Quan; Hu, Liang-Ding; Chen, Hu; Han, Zhong-Chao

2017-06-15

Mesenchymal stem cells (MSCs) have shown promise for use in cell therapy, and due to their tumor tropism can serve as vehicles for delivering therapeutic agents to tumor sites. Because interleukin-8 (IL-8) is known to mediate the protumor effect of MSCs, elimination of IL-8 secretion by MSCs may enhance their safety for use in cancer gene therapy. However, little is known concerning the effect of endogenously secreted IL-8 on MSCs. We performed studies using placenta-derived MSCs (PMSCs) to determine whether knockdown of IL-8 would influence their biological activity. We first verified that IL-8 and its membrane receptor CXCR2, but not CXCR1, were highly expressed in PMSCs. We then employed lentivirus-mediated small hairpin RNA interference to generate stable IL-8-silenced PMSCs, which displayed a variety of characteristic senescent phenotypes. We observed that at day 9 post-transfection, IL-8-silenced PMSCs had become larger and displayed a more flattened appearance when compared with their controls. Moreover, their proliferation, colony forming unit-fibroblast formation, adipogenic and osteogenic differentiation, and immunosuppressive potentials were significantly impaired. Enhanced senescence-associated β-galactosidase (SA-β-gal) activity and specific global gene expression profiles confirmed that IL-8 silencing evoked the senescence process in PMSCs. Increased levels of p-Akt and decreased levels of FOXO3a protein expression suggested that reactive oxygen species played a role in the initiation and maintenance of senescence in IL-8-silenced PMSCs. Notably, the majority of CXCR2 ligands were downregulated in presenescent IL-8-silenced PMSCs but upregulated in senescent cells, indicating an antagonistic pleiotropy of the IL-8/CXCR2 signaling pathway in PMSCs. This effect may promote the proliferation of young cells and accelerate senescence of old cells.

An RNA Origami Octahedron with Intrinsic siRNAs for Potent Gene Knockdown.

PubMed

Høiberg, Hans Christian; Sparvath, Steffen M; Andersen, Veronica L; Kjems, Jørgen; Andersen, Ebbe S

2018-05-26

The fields of DNA and RNA nanotechnology have established nucleic acids as valuable building blocks for functional nanodevices with applications in nanomedicine. Here, a simple method for designing and assembling a 3D scaffolded RNA origami wireframe structure with intrinsic functioning small interfering RNAs (siRNAs) embedded is introduced. Uniquely, the method uses an mRNA fragment as scaffold strand, which is folded by sequence-complementarity of nine shorter synthetic strands. High-yield production of the intended 3D structure is verified by transmission electron microscopy (TEM). Production of functional siRNAs is facilitated by incorporating recognition sites for Dicer at selected locations in the structure, and efficient silencing of a target reporter gene is demonstrated. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Knock-down of ZEB1 inhibits the proliferation, invasion and migration of gastric cancer cells].

PubMed

Chen, Dengyu; Chu, Yifan; Zheng, Qingwei; Xu, Zhiben; Zhou, Ping; Li, Sheng

2017-08-01

Objective To down-regulate the expression of zinc-finger E-box binding homeobox 1 (ZEB1) gene by shRNA, and investigate its effect on invasion, migration and proliferation, as well as the related gene expressions of lncRNA HOTAIR and E-cadherin in human gastric cancer BGC823 cells. Methods RNA interfering (RNAi) was used to knock down ZEB1 in gastric cancer BGC823 cells. The recombinant plasmid shZEB1 was constructed and transfected into the gastric cancer BGC823 cells by Lipofectamine TM 2000, and the stably transfected cells were isolated by G418 selection and limited dilution. The expression of ZEB1 mRNA and protein was detected by real-time quantitative PCR and Western blot analysis. Cell proliferation was determined by MTT assay, and the invasion and migration abilities of BGC823 cells were monitored by Transwell TM invasion assay and wound healing assay, respectively. The expressions of lncRNA HOTAIR and E-cadherin mRNA were detected by real-time quantitative PCR. Results After ZEB1 expression was successfully down-regulated in BGC823 cells by siRNA, the proliferation, invasion and migration rates in shZEB1 transfection group were significantly lower than those in control group; meanwhile, the expression of lncRNA HOTAIR was reduced and E-cadherin expression was enhanced. Conclusion Knock-down of ZEB1 expression by RNA interference can decease lncRNA HOTAIR expression and restrain cell proliferation, invasion and migration in gastric cancer BGC823 cells.

Circadian clock gene plays a key role on ovarian cycle and spontaneous abortion.

PubMed

Li, Ruiwen; Cheng, Shuting; Wang, Zhengrong

2015-01-01

Circadian locomotor output cycles protein kaput (CLOCK) plays a key role in maintaining circadian rhythms and activation of downstream elements. However, its function on human female reproductive system remains unknown. To investigate the potential role of CLOCK, CLOCK-shRNAs were transfected into mouse 129 ES cells or injected into the ovaries of adult female mice. Western blotting was utilized to analyze the protein interactions and flow cytometry was used to assess apoptosis. The expression of CLOCK peaked at the 6th week in the healthy fetuses. However, an abnormal expression of CLOCK was detected in fetuses from spontaneous miscarriage. To determine the effect of CLOCK on female fertility, a small hairpin RNA (shRNA) strategy was used to specifically knockdown the CLOCK gene expression in vitro and in vivo. Knockdown of CLOCK induced apoptosis in mouse embryonic stem (mES) cells and inhibited the proliferation in mES cells in vitro. CLOCK knockdown also led to decreased release of oocytes and smaller litter size compared with control in vivo. Collectively, theses findings indicate that CLOCK plays an important role in fertility and that the CLOCK knockdown leads to reduction in reproduction and increased miscarriage risk. © 2015 S. Karger AG, Basel.

Fndc5 knockdown induced suppression of mitochondrial integrity and significantly decreased cardiac differentiation of mouse embryonic stem cells.

PubMed

Nazem, Shima; Rabiee, Farzaneh; Ghaedi, Kamran; Babashah, Sadegh; Sadeghizadeh, Majid; Nasr-Esfahani, Mohammad Hossein

2018-06-01

Fibronectin type III domain-containing 5 protein (Fndc5) is a glycosylated protein with elevated expression in high energy demanded tissues as heart, brain, and muscle. It has been shown that upregulation of Fndc5 is regulated by peroxisome proliferator-activated receptor-γ coactivator-1 alpha (PGC-1α), which is known as a master regulator of mitochondrial function and biogenesis. Also, our group indicated that Fndc5 expression increases gradually during cardiac differentiation of mouse embryonic stem cells (mESCs). In this paper, to clarify the importance of Fndc5 in cardiac differentiation, we south to knock down Fndc5 expression by generation a stably transduced mESC line that derives the expression of a short hairpin RNA (shRNA) against Fndc5 gene following doxycycline (Dox) induction. Knock-down of Fndc5 demonstrated a considerable decrease in expression of cardiac progenitor and cardiomyocyte markers. Considering the fact that mitochondria play a crucial role in cardiac differentiation of ESCs, we investigated the role of Fndc5, as a downstream target of PGC1-α, on mitochondrial indices. Results showed that expression of nuclear encoded mitochondrial genes including PGC1-α, Atp5b, Ndufb5, and SOD2 significantly decreased. Moreover, mitochondrial membrane potential (ΔΨm) and relative ATP content of cardiomyocytes decreased markedly with relative ROS level increase. Together, our results suggest that Fndc5 attenuates process of cardiac differentiation of mESCs which is associated with modulation of mitochondrial function and gene expression. © 2017 Wiley Periodicals, Inc.

Regulators of Long-Term Memory Revealed by Mushroom Body-Specific Gene Expression Profiling in Drosophila melanogaster.

PubMed

Widmer, Yves F; Bilican, Adem; Bruggmann, Rémy; Sprecher, Simon G

2018-06-20

Memory formation is achieved by genetically tightly controlled molecular pathways that result in a change of synaptic strength and synapse organization. While for short-term memory traces rapidly acting biochemical pathways are in place, the formation of long-lasting memories requires changes in the transcriptional program of a cell. Although many genes involved in learning and memory formation have been identified, little is known about the genetic mechanisms required for changing the transcriptional program during different phases of long-term memory formation. With Drosophila melanogaster as a model system we profiled transcriptomic changes in the mushroom body, a memory center in the fly brain, at distinct time intervals during appetitive olfactory long-term memory formation using the targeted DamID technique. We describe the gene expression profiles during these phases and tested 33 selected candidate genes for deficits in long-term memory formation using RNAi knockdown. We identified 10 genes that enhance or decrease memory when knocked-down in the mushroom body. For vajk-1 and hacd1 , the two strongest hits, we gained further support for their crucial role in appetitive learning and forgetting. These findings show that profiling gene expression changes in specific cell-types harboring memory traces provides a powerful entry point to identify new genes involved in learning and memory. The presented transcriptomic data may further be used as resource to study genes acting at different memory phases. Copyright © 2018, Genetics.

TRAF1 knockdown alleviates palmitate-induced insulin resistance in HepG2 cells through NF-κB pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wanlu; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, 19 Qixiu Road, Nantong 226001, Jiangsu Province; Tang, Zhuqi

High-fat diet (HFD) and inflammation are key contributors to insulin resistance (IR) and Type 2 diabetes mellitus (T2DM). With HFD, plasma free fatty acids (FFAs) can activate the nuclear factor-κB (NF-κB) in target tissues, then initiate negative crosstalk between FFAs and insulin signaling. However, the molecular link between IR and inflammation remains to be identified. We here reported that tumor necrosis factor receptor-associated factor 1 (TRAF1), an adapter in signal transduction, was involved in the onset of IR in hepatocytes. TRAF1 was significantly up-regulated in insulin-resistant liver tissues and palmitate (PA)-treated HepG2 cells. In addition, we showed that depletion ofmore » TRAF1 led to inhibition of the activity of NF-κB. Given the fact that the activation of NF-κB played a facilitating role in IR, the phosphorylation of Akt and GSK3β was also analyzed. We found that depletion of TRAF1 markedly reversed PA-induced attenuation of the phosphorylation of Akt and GSK3β in the cells. The accumulation of lipid droplets in hepatocyte and expression of two key gluconeogenic enzymes, PEPCK and G6Pase, were also determined and found to display a similar tendency with the phosphorylation of Akt and GSK3β. Glucose uptake assay indicated that knocking down TRAF1 blocked the effect of PA on the suppression of glucose uptake. These data implicated that TRAF1 knockdown might alleviate PA-induced IR in HepG2 cells through NF-κB pathway. - Highlights: • TRAF1 accelerated PA-induced IR in HepG2 cells mediated through NF-κB signaling. • Knockdown of TRAF1 alleviated PA-induced IR in HepG2 cells. • Knockdown of TRAF1 alleviated PA-induced lipid accumulation in HepG2 cells. • Knockdown of TRAF1 reversed PA-induced suppression of glucose uptake in HepG2 cells. • Knockdown of TRAF1 reversed PA-induced gluconeogenesis in HepG2 cells.« less

Knockdown Resistance Allele Frequencies in North American Head Louse (Anoplura: Pediculidae) Populations

PubMed Central

Yoon, Kyong Sup; Previte, Domenic J.; Hodgdon, Hilliary E.; Poole, Bryan C.; Kwon, Deok Ho; El-Ghar, Gamal E. Abo; Lee, Si Hyeock; Clark, J. Marshall

2014-01-01

The study examines the extent and frequency of a knockdown-type resistance allele (kdr type) in North American populations of human head lice. Lice were collected from 32 locations in Canada and the United States. DNA was extracted from individual lice and used to determine their zygosity using the serial invasive signal amplification technique to detect the kdr-type T917I (TI) mutation, which is most responsible for nerve insensitivity that results in the kdr phenotype and permethrin resistance. Previously sampled sites were resampled to determine if the frequency of the TI mutation was changing. The TI frequency was also reevaluated using a quantitative sequencing method on pooled DNA samples from selected sites to validate this population genotyping method. Genotyping substantiated that TI occurs at high levels in North American lice (88.4%). Overall, the TI frequency in U.S. lice was 84.4% from 1999 to 2009, increased to 99.6% from 2007 to 2009, and was 97.1% in Canadian lice in 2008. Genotyping results using the serial invasive signal amplification reaction (99.54%) and quantitative sequencing (99.45%) techniques were highly correlated. Thus, the frequencies of TI in North American head louse populations were found to be uniformly high, which may be due to the high selection pressure from the intensive and widespread use of the pyrethrins- or pyrethroid-based pediculicides over many years, and is likely a main cause of increased pediculosis and failure of pyrethrins- or permethrin-based products in Canada and the United States. Alternative approaches to treatment of head lice infestations are critically needed. PMID:24724296

STAT3 Knockdown Reduces Pancreatic Cancer Cell Invasiveness and Matrix Metalloproteinase-7 Expression in Nude Mice

PubMed Central

Huang, Ke jian; Wu, Wei dong; Jiang, Tao; Cao, Jun; Feng, Zhen zhong; Qiu, Zheng jun

2011-01-01

Aims Transducer and activator of transcription-3 (STAT3) plays an important role in tumor cell invasion and metastasis. The aim of the present study was to investigate the effects of STAT3 knockdown in nude mouse xenografts of pancreatic cancer cells and underlying gene expression. Methods A STAT3 shRNA lentiviral vector was constructed and infected into SW1990 cells. qRT-PCR and western immunoblot were performed to detect gene expression. Nude mouse xenograft assays were used to assess changes in phenotypes of these stable cells in vivo. HE staining was utilized to evaluate tumor cell invasion and immunohistochemistry was performed to analyze gene expression. Results STAT3 shRNA successfully silenced expression of STAT3 mRNA and protein in SW1990 cells compared to control cells. Growth rate of the STAT3-silenced tumor cells in nude mice was significantly reduced compared to in the control vector tumors and parental cells-generated tumors. Tumor invasion into the vessel and muscle were also suppressed in the STAT3-silenced tumors compared to controls. Collagen IV expression was complete and continuous surrounding the tumors of STAT3-silenced SW1990 cells, whereas collagen IV expression was incomplete and discontinuous surrounding the control tumors. Moreover, microvessel density was significantly lower in STAT3-silenced tumors than parental or control tumors of SW1990 cells. In addition, MMP-7 expression was reduced in STAT3-silenced tumors compared to parental SW1990 xenografts and controls. In contrast, expression of IL-1β and IgT7α was not altered. Conclusion These data clearly demonstrate that STAT3 plays an important role in regulation of tumor growth, invasion, and angiogenesis, which could be act by reducing MMP-7 expression in pancreatic cancer cells. PMID:21991388

Effects of simultaneous knockdown of HER2 and PTK6 on malignancy and tumor progression in human breast cancer cells.

PubMed

Ludyga, Natalie; Anastasov, Natasa; Rosemann, Michael; Seiler, Jana; Lohmann, Nadine; Braselmann, Herbert; Mengele, Karin; Schmitt, Manfred; Höfler, Heinz; Aubele, Michaela

2013-04-01

Breast cancer is the most common malignancy in women of the Western world. One prominent feature of breast cancer is the co- and overexpression of HER2 and protein tyrosine kinase 6 (PTK6). According to the current clinical cancer therapy guidelines, HER2-overexpressing tumors are routinely treated with trastuzumab, a humanized monoclonal antibody targeting HER2. Approximately, 30% of HER2-overexpressing breast tumors at least initially respond to the anti-HER2 therapy, but a subgroup of these tumors develops resistance shortly after the administration of trastuzumab. A PTK6-targeted therapy does not yet exist. Here, we show for the first time that the simultaneous knockdown in vitro, compared with the single knockdown of HER2 and PTK6, in particular in the trastuzumab-resistant JIMT-1 cells, leads to a significantly decreased phosphorylation of crucial signaling proteins: mitogen-activated protein kinase 1/3 (MAPK 1/3, ERK 1/2) and p38 MAPK, and (phosphatase and tensin homologue deleted on chromosome ten) PTEN that are involved in tumorigenesis. In addition, dual knockdown strongly reduced the migration and invasion of the JIMT-1 cells. Moreover, the downregulation of HER2 and PTK6 led to an induction of p27, and the dual knockdown significantly diminished cell proliferation in JIMT-1 and T47D cells. In vivo experiments showed significantly reduced levels of tumor growth following HER2 or PTK6 knockdown. Our results indicate a novel strategy also for the treatment of trastuzumab resistance in tumors. Thus, the inhibition of these two signaling proteins may lead to a more effective control of breast cancer. ©2013 AACR.

Mutations in six nephrosis genes delineate a pathogenic pathway amenable to treatment.

PubMed

Ashraf, Shazia; Kudo, Hiroki; Rao, Jia; Kikuchi, Atsuo; Widmeier, Eugen; Lawson, Jennifer A; Tan, Weizhen; Hermle, Tobias; Warejko, Jillian K; Shril, Shirlee; Airik, Merlin; Jobst-Schwan, Tilman; Lovric, Svjetlana; Braun, Daniela A; Gee, Heon Yung; Schapiro, David; Majmundar, Amar J; Sadowski, Carolin E; Pabst, Werner L; Daga, Ankana; van der Ven, Amelie T; Schmidt, Johanna M; Low, Boon Chuan; Gupta, Anjali Bansal; Tripathi, Brajendra K; Wong, Jenny; Campbell, Kirk; Metcalfe, Kay; Schanze, Denny; Niihori, Tetsuya; Kaito, Hiroshi; Nozu, Kandai; Tsukaguchi, Hiroyasu; Tanaka, Ryojiro; Hamahira, Kiyoshi; Kobayashi, Yasuko; Takizawa, Takumi; Funayama, Ryo; Nakayama, Keiko; Aoki, Yoko; Kumagai, Naonori; Iijima, Kazumoto; Fehrenbach, Henry; Kari, Jameela A; El Desoky, Sherif; Jalalah, Sawsan; Bogdanovic, Radovan; Stajić, Nataša; Zappel, Hildegard; Rakhmetova, Assel; Wassmer, Sharon-Rose; Jungraithmayr, Therese; Strehlau, Juergen; Kumar, Aravind Selvin; Bagga, Arvind; Soliman, Neveen A; Mane, Shrikant M; Kaufman, Lewis; Lowy, Douglas R; Jairajpuri, Mohamad A; Lifton, Richard P; Pei, York; Zenker, Martin; Kure, Shigeo; Hildebrandt, Friedhelm

2018-05-17

No efficient treatment exists for nephrotic syndrome (NS), a frequent cause of chronic kidney disease. Here we show mutations in six different genes (MAGI2, TNS2, DLC1, CDK20, ITSN1, ITSN2) as causing NS in 17 families with partially treatment-sensitive NS (pTSNS). These proteins interact and we delineate their roles in Rho-like small GTPase (RLSG) activity, and demonstrate deficiency for mutants of pTSNS patients. We find that CDK20 regulates DLC1. Knockdown of MAGI2, DLC1, or CDK20 in cultured podocytes reduces migration rate. Treatment with dexamethasone abolishes RhoA activation by knockdown of DLC1 or CDK20 indicating that steroid treatment in patients with pTSNS and mutations in these genes is mediated by this RLSG module. Furthermore, we discover ITSN1 and ITSN2 as podocytic guanine nucleotide exchange factors for Cdc42. We generate Itsn2-L knockout mice that recapitulate the mild NS phenotype. We, thus, define a functional network of RhoA regulation, thereby revealing potential therapeutic targets.

A Kinetic Model for Calcium Dynamics in RAW 264.7 Cells: 2. Knockdown Response and Long-Term Response

PubMed Central

Maurya, Mano Ram; Subramaniam, Shankar

2007-01-01

This article addresses how quantitative models such as the one proposed in the companion article can be used to study cellular network perturbations such as knockdowns and pharmacological perturbations in a predictive manner. Using the kinetic model for cytosolic calcium dynamics in RAW 264.7 cells developed in the companion article, the calcium response to complement 5a (C5a) for the knockdown of seven proteins (C5a receptor; G-β-2; G-α,i-2,3; regulator of G-protein signaling-10; G-protein coupled receptor kinase-2; phospholipase C β-3; arrestin) is predicted and validated against the data from the Alliance for Cellular Signaling. The knockdown responses provide insights into how altered expressions of important proteins in disease states result in intermediate measurable phenotypes. Long-term response and long-term dose response have also been predicted, providing insights into how the receptor desensitization, internalization, and recycle result in tolerance. Sensitivity analysis of long-term response shows that the mechanisms and parameters in the receptor recycle path are important for long-term calcium dynamics. PMID:17483189

Electrophysiological Features of Single Store-Operated Calcium Channels in HEK S4 Cell Line with Stable STIM1 Protein Knockdown.

PubMed

Shalygin, A V; Vigont, V A; Glushankova, L N; Zimina, O A; Kolesnikov, D O; Skopin, A Yu; Kaznacheeva, E V

2017-07-01

An important role in intracellular calcium signaling is played by store-operated channels activated by STIM proteins, calcium sensors of the endoplasmic reticulum. In stable STIM1 knockdown HEK S4 cells, single channels activated by depletion of intracellular calcium stores were detected by cell-attached patch-clamp technique and their electrophysiological parameters were described. Comparison of the properties of single channels in HEK293 and HEK S4 cells revealed no significant differences in their current-voltage curves, while regulation of store-operated calcium channels in these cell lines depended on the level of STIM1 expression. We can conclude that electrophysiological peculiarities of store-regulated calcium entry observed in different cells can be explained by differences in STIM1 expression.

Integration of Steady-State and Temporal Gene Expression Data for the Inference of Gene Regulatory Networks

PubMed Central

Wang, Yi Kan; Hurley, Daniel G.; Schnell, Santiago; Print, Cristin G.; Crampin, Edmund J.

2013-01-01

We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data. PMID:23967277

Cyclophilin B as a co-regulator of prolactin-induced gene expression and function in breast cancer cells

PubMed Central

Fang, Feng; Zheng, Jiamao; Galbaugh, Traci L; Fiorillo, Alyson A; Hjort, Elizabeth E; Zeng, Xianke; Clevenger, Charles V

2010-01-01

The effects of prolactin (PRL) during the pathogenesis of breast cancer are mediated in part though Stat5 activity enhanced by its interaction with its transcriptional inducer, the prolyl isomerase cyclophilin B (CypB). We have demonstrated that knockdown of CypB decreases cell growth, proliferation, and migration, and CypB expression is associated with malignant progression of breast cancer. In this study, we examined the effect of CypB knockdown on PRL signaling in breast cancer cells. CypB knockdown with two independent siRNAs was shown to impair PRL-induced reporter expression in breast cancer cell line. cDNA microarray analysis was performed on these cells to assess the effect of CypB reduction, and revealed a significant decrease in PRL-induced endogenous gene expression in two breast cancer cell lines. Parallel functional assays revealed corresponding alterations of both anchorage-independent cell growth and cell motility of breast cancer cells. Our results demonstrate that CypB expression levels significantly modulate PRL-induced function in breast cancer cells ultimately resulting in enhanced levels of PRL-responsive gene expression, cell growth, and migration. Given the increasingly appreciated role of PRL in the pathogenesis of breast cancer, the actions of CypB detailed here are of biological significance. PMID:20237142

Cyclophilin B as a co-regulator of prolactin-induced gene expression and function in breast cancer cells.

PubMed

Fang, Feng; Zheng, Jiamao; Galbaugh, Traci L; Fiorillo, Alyson A; Hjort, Elizabeth E; Zeng, Xianke; Clevenger, Charles V

2010-06-01

The effects of prolactin (PRL) during the pathogenesis of breast cancer are mediated in part though Stat5 activity enhanced by its interaction with its transcriptional inducer, the prolyl isomerase cyclophilin B (CypB). We have demonstrated that knockdown of CypB decreases cell growth, proliferation, and migration, and CypB expression is associated with malignant progression of breast cancer. In this study, we examined the effect of CypB knockdown on PRL signaling in breast cancer cells. CypB knockdown with two independent siRNAs was shown to impair PRL-induced reporter expression in breast cancer cell line. cDNA microarray analysis was performed on these cells to assess the effect of CypB reduction, and revealed a significant decrease in PRL-induced endogenous gene expression in two breast cancer cell lines. Parallel functional assays revealed corresponding alterations of both anchorage-independent cell growth and cell motility of breast cancer cells. Our results demonstrate that CypB expression levels significantly modulate PRL-induced function in breast cancer cells ultimately resulting in enhanced levels of PRL-responsive gene expression, cell growth, and migration. Given the increasingly appreciated role of PRL in the pathogenesis of breast cancer, the actions of CypB detailed here are of biological significance.

Expression of cyclophilin B is associated with malignant progression and regulation of genes implicated in the pathogenesis of breast cancer.

PubMed

Fang, Feng; Flegler, Ayanna J; Du, Pan; Lin, Simon; Clevenger, Charles V

2009-01-01

Cyclophilin B (CypB) is a 21-kDa protein with peptidyl-prolyl cis-trans isomerase activity that functions as a transcriptional inducer for Stat5 and as a ligand for CD147. To better understand the global function of CypB in breast cancer, T47D cells with a small interfering RNA-mediated knockdown of CypB were generated. Subsequent expression profiling analysis showed that 663 transcripts were regulated by CypB knockdown, and that many of these gene products contributed to cell proliferation, cell motility, and tumorigenesis. Real-time PCR confirmed that STMN3, S100A4, S100A6, c-Myb, estrogen receptor alpha, growth hormone receptor, and progesterone receptor were all down-regulated in si-CypB cells. A linkage analysis of these array data to protein networks resulted in the identification of 27 different protein networks that were impacted by CypB knockdown. Functional assays demonstrated that CypB knockdown also decreased cell growth, proliferation, and motility. Immunohistochemical and immunofluorescent analyses of a matched breast cancer progression tissue microarray that was labeled with an anti-CypB antibody demonstrated a highly significant increase in CypB protein levels as a function of breast cancer progression. Taken together, these results suggest that the enhanced expression of CypB in malignant breast epithelium may contribute to the pathogenesis of this disease through its regulation of the expression of hormone receptors and gene products that are involved in cell proliferation and motility.

Technique of retinal gene therapy: delivery of viral vector into the subretinal space

PubMed Central

Xue, K; Groppe, M; Salvetti, A P; MacLaren, R E

2017-01-01

Purpose Safe and reproducible delivery of gene therapy vector into the subretinal space is essential for successful targeting of the retinal pigment epithelium (RPE) and photoreceptors. The success of surgery is critical for the clinical efficacy of retinal gene therapy. Iatrogenic detachment of the degenerate (often adherent) retina in patients with hereditary retinal degenerations and small volume (eg, 0.1 ml) subretinal injections pose new surgical challenges. Methods Our subretinal gene therapy technique involved pre-operative planning with optical coherence tomography (OCT) and autofluorescence (AF) imaging, 23 G pars plana vitrectomy, internal limiting membrane staining with Membrane Blue Dual (DORC BV, Zuidland, Netherlands), a two-step subretinal injection using a 41 G Teflon tipped cannula (DORC) first with normal saline to create a parafoveal bleb followed by slow infusion of viral vector via the same self-sealing retinotomy. Surgical precision was further enhanced by intraoperative OCT (Zeiss Rescan 7000, Carl Zeiss Meditec AG, Jena, Germany). Foveal functional and structural recovery was evaluated using best-corrected Early Treatment Diabetic Retinopathy Study (ETDRS) visual acuity, microperimetry and OCT. Results Two patients with choroideremia aged 29 (P1) and 27 (P2) years, who had normal and symmetrical levels of best-corrected visual acuity (BCVA) in both eyes, underwent unilateral gene therapy with the fellow eye acting as internal control. The surgeries were uncomplicated in both cases with successful detachment of the macula by subretinal vector injection. Both treated eyes showed recovery of BCVA (P1: 76–77 letters; P2: 84–88 letters) and mean threshold sensitivity of the central macula (P1: 10.7–10.7 dB; P2: 14.2–14.1 dB) to baseline within a month. This was accompanied by normalisation of central retinal thickness on OCT. Conclusions Herein we describe a reliable technique for subretinal gene therapy, which is currently used

Knockdown of SALL4 Protein Enhances All-trans Retinoic Acid-induced Cellular Differentiation in Acute Myeloid Leukemia Cells*

PubMed Central

Liu, Li; Liu, Liang; Leung, Lai-Han; Cooney, Austin J.; Chen, Changyi; Rosengart, Todd K.; Ma, Yupo; Yang, Jianchang

2015-01-01

All-trans retinoic acid (ATRA) is a differentiation agent that revolutionized the treatment of acute promyelocytic leukemia. However, it has not been useful for other types of acute myeloid leukemia (AML). Here we explored the effect of SALL4, a stem cell factor, on ATRA-induced AML differentiation in both ATRA-sensitive and ATRA-resistant AML cells. Aberrant SALL4 expression has been found in nearly all human AML cases, whereas, in normal bone marrow and peripheral blood cells, its expression is only restricted to hematopoietic stem/progenitor cells. We reason that, in AMLs, SALL4 activation may prevent cell differentiation and/or protect self-renewal that is seen in normal hematopoietic stem/progenitor cells. Indeed, our studies show that ATRA-mediated myeloid differentiation can be largely blocked by exogenous expression of SALL4, whereas ATRA plus SALL4 knockdown causes significantly increased AML differentiation and cell death. Mechanistic studies indicate that SALL4 directly associates with retinoic acid receptor α and modulates ATRA target gene expression. SALL4 is shown to recruit lysine-specific histone demethylase 1 (LSD1) to target genes and alter the histone methylation status. Furthermore, coinhibition of LSD1 and SALL4 plus ATRA treatment exhibited the strongest anti-AML effect. These findings suggest that SALL4 plays an unfavorable role in ATRA-based regimes, highlighting an important aspect of leukemia therapy. PMID:25737450

Polymorphism of intron-1 in the voltage-gated sodium channel gene of Anopheles gambiae s.s. populations from Cameroon with emphasis on insecticide knockdown resistance mutations.

PubMed

Etang, Josiane; Vicente, Jose L; Nwane, Philippe; Chouaibou, Mouhamadou; Morlais, Isabelle; Do Rosario, Virgilio E; Simard, Frederic; Awono-Ambene, Parfait; Toto, Jean Claude; Pinto, Joao

2009-07-01

Sequence variation at the intron-1 of the voltage-gated sodium channel gene in Anopheles gambiae M- and S-forms from Cameroon was assessed to explore the number of mutational events originating knockdown resistance (kdr) alleles. Mosquitoes were sampled between December 2005 and June 2006 from three geographical areas: (i) Magba in the western region; (ii) Loum, Tiko, Douala, Kribi, and Campo along the Atlantic coast; and (iii) Bertoua, in the eastern continental plateau. Both 1014S and 1014F kdr alleles were found in the S-form with overall frequencies of 14% and 42% respectively. Only the 1014F allele was found in the M-form at lower frequency (11%). Analysis of a 455 bp region of intron-1 upstream the kdr locus revealed four independent mutation events originating kdr alleles, here named MS1 -1014F, S1-1014S and S2-1014S kdr-intron-1 haplotypes in S-form and MS3-1014F kdr-intron-1 haplotype in the M-form. Furthermore, there was evidence for mutual introgression of kdr 1014F allele between the two molecular forms, MS1 and MS3 being widely shared by them. Although no M/S hybrid was observed in analysed samples, this wide distribution of haplotypes MS1 and MS3 suggests inter-form hybridizing at significant level and emphasizes the rapid diffusion of the kdr alleles in Africa. The mosaic of genetic events found in Cameroon is representative of the situation in the West-Central African region and highlights the importance of evaluating the spatial and temporal evolution of kdr alleles for a better management of insecticide resistance.

NHR-23 dependent collagen and hedgehog-related genes required for molting.

PubMed

Kouns, Nathaniel A; Nakielna, Johana; Behensky, Frantisek; Krause, Michael W; Kostrouch, Zdenek; Kostrouchova, Marta

2011-10-07

NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparative expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa. Copyright © 2011 Elsevier Inc. All rights reserved.

Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus▿

PubMed Central

Cosme, Ruth S. Cruz; Yamamura, Yasuhiro; Tang, Qiyi

2009-01-01

Human cytomegalovirus (HCMV), a member of the β subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

GATA4 and GATA6 Knockdown During Luteinization Inhibits Progesterone Production and Gonadotropin Responsiveness in the Corpus Luteum of Female Mice.

PubMed

Convissar, Scott M; Bennett, Jill; Baumgarten, Sarah C; Lydon, John P; DeMayo, Francesco J; Stocco, Carlos

2015-12-01

The surge of luteinizing hormone triggers the genomic reprogramming, cell differentiation, and tissue remodeling of the ovulated follicle, leading to the formation of the corpus luteum. During this process, called luteinization, follicular granulosa cells begin expressing a new set of genes that allow the resulting luteal cells to survive in a vastly different hormonal environment and to produce the extremely high amounts of progesterone (P4) needed to sustain pregnancy. To better understand the molecular mechanisms involved in the regulation of luteal P4 production in vivo, the transcription factors GATA4 and GATA6 were knocked down in the corpus luteum by crossing mice carrying Gata4 and Gata6 floxed genes with mice carrying Cre recombinase fused to the progesterone receptor. This receptor is expressed exclusively in granulosa cells after the luteinizing hormone surge, leading to recombination of floxed genes during follicle luteinization. The findings demonstrated that GATA4 and GATA6 are essential for female fertility, whereas targeting either factor alone causes subfertility. When compared to control mice, serum P4 levels and luteal expression of key steroidogenic genes were significantly lower in conditional knockdown mice. The results also showed that GATA4 and GATA6 are required for the expression of the receptors for prolactin and luteinizing hormone, the main luteotropic hormones in mice. The findings demonstrate that GATA4 and GATA6 are crucial regulators of luteal steroidogenesis and are required for the normal response of luteal cells to luteotropins. © 2015 by the Society for the Study of Reproduction, Inc.

Knockdown of HIF-1α and IL-8 induced apoptosis of hepatocellular carcinoma triggers apoptosis of vascular endothelial cells.

PubMed

Choi, Sung Hoon; Park, Jun Yong; Kang, Wonseok; Kim, Seung Up; Kim, Do Young; Ahn, Sang Hoon; Ro, Simon Wonsang; Han, Kwang-Hyub

2016-01-01

A local hypoxic microenvironment is one of the most important characteristics of solid tumors. Hypoxia inducible factor-1α (HIF-1α) and Interleukin-8 (IL-8) activate tumor survival from hypoxic-induced apoptosis in each pathway. This study aimed to evaluate whether knockdown of HIF-1α and IL-8 induced apoptosis of the hepatocellular carcinoma (HCC) and endothelial cell lines. HCC cell lines were infected with adenovirus-expressing shRNA for HIF-1α and IL-8 and maintained under hypoxic conditions (1% O2, 24 h). The expression levels of HIF-1α and both apoptotic and growth factors were examined by real-time quantitative PCR and western blot. We also investigated apoptosis by TUNEL assay (FACS and Immunofluorescence) and measured the concentration of cytochrome C. Inhibition of HIF-1α and IL-8 up-regulated the expression of apoptotic factors while downregulating anti-apoptotic factors simultaneously. Knockdown of HIF-1α and IL-8 increased the concentration of cytochrome C and enhanced DNA fragmentation in HCC cell lines. Moreover, culture supernatant collected from the knockdown of HIF-1α and IL-8 in HCC cell lines induced apoptosis in human umbilical vein endothelial cells under hypoxia, and the expression of variable apoptotic ligand increased from HCC cell lines, time-dependently. These data suggest that adenovirus-mediated knockdown of HIF-1α and IL-8 induced apoptosis in HCC cells and triggered apoptosis of vascular endothelial cells.

Effects of Nrf2 knockdown on the properties of irradiated cell conditioned medium from A549 human lung cancer cells.

PubMed

Yoshino, Hironori; Murakami, Kanna; Nawamaki, Mikoto; Kashiwakura, Ikuo

2018-05-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) plays an important role in cellular defense against oxidative stress. Recent studies have demonstrated that Nrf2 is a useful target for cancer treatment, including radiation therapy. Ionizing radiation affects, not only the irradiated cells, but also the non-irradiated neighboring cells, and this effect is known as radiation-induced bystander effect. Upon exposure to radiation, the irradiated cells transmit signals to the non-irradiated cells via gap junctions or soluble factors. These signals in turn cause biological effects, such as a decrease in the clonogenic potential and cell death, in the non-irradiated neighboring cells. Nrf2 inhibition enhances cellular radiosensitivity. However, whether this modification of radiosensitivity by Nrf2 inhibition affects the radiation-induced bystander effects is unknown. In this study, we prepared an Nrf2 knockdown human lung cancer cell A549 and investigated whether the effects of irradiated cell conditioned medium (ICCM) on cell growth and cell death induction of non-irradiated cells vary depending on the Nrf2 knockdown. We found that Nrf2 knockdown resulted in a decrease in the cell growth and an increase in the radiosensitivity of A549 cells. When non-irradiated A549 cells were transfected with control siRNA and treated with ICCM, no significant difference was observed in the cell growth and proportion of Annexin V + dead cells between ICCM from non-irradiated cells and that from 2 or 8 Gy-irradiated cells. Similarly, no significant difference was observed in the cell growth and cell death induction upon treatment with ICCM in the Nrf2 knockdown A549 cells. Taken together, these results suggest that Nrf2 knockdown decreases cell growth and enhances the radiosensitivity of A549 cells; however, it does not alter the effect of ICCM on cell growth.

Knockdown of SLC39A7 inhibits cell growth and induces apoptosis in human colorectal cancer cells.

PubMed

Sheng, Nengquan; Yan, Li; You, Weiqiang; Tan, Gewen; Gong, Jianfeng; Chen, Hongqi; Yang, Yi; Hu, Landian; Wang, Zhigang

2017-10-01

SLC39A7 (zip7) is a zinc transporter that plays a key role in intestinal epithelial self-renewal. However, little is known about SLC39A7 in colorectal cancer. To assess the biological function of SLC39A7 in colorectal cancer, the expression of SLC39A7 in human colorectal tumors and five colorectal cancer cell lines were evaluated by Oncomine Cancer Microarray Database and western blot analysis. In addition, short hairpin RNAs specifically targeting SLC39A7 were transfected into HCT116 and SW1116 cells to knockdown SLC39A7 expression. Then, the effects of SLC39A7 knockdown on colorectal cancer cells were detected by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide, colony-forming assay and flow cytometry. Our results showed that colorectal tumors have higher expression levels of SLC39A7 than normal colon tissues. Knockdown of SLC39A7 exhibited a significant decrease in cell viability and proliferation of colorectal cancer cells. It was also shown that knockdown of SLC39A7 interfered with cell cycle progression and induced G2/M cell cycle arrest, as well as boosted early and late apoptosis in colorectal cancer cells. Furthermore, downregulation of SLC39A7 promoted the cleavage of PARP and enhanced the expression of Bad, Caspase-9, and cleaved-Caspase-3, as well as suppressed Bcl-2 expression. In conclusion, our results suggest that SLC39A7 plays a crucial role in the proliferation and survival of colorectal cancer cells, which associates with colorectal tumorigenesis. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Nrf2 Knockdown Disrupts the Protective Effect of Curcumin on Alcohol-Induced Hepatocyte Necroptosis.

PubMed

Lu, Chunfeng; Xu, Wenxuan; Zhang, Feng; Shao, Jiangjuan; Zheng, Shizhong

2016-12-05

It has emerged that hepatocyte necroptosis plays a critical role in chronic alcoholic liver disease (ALD). Our previous study has identified that the beneficial therapeutic effect of curcumin on alcohol-caused liver injury might be attributed to activation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2), whereas the role of curcumin in regulating necroptosis and the underlying mechanism remain to be determined. We first found that chronic alcohol consumption triggered obvious hepatocyte necroptosis, leading to increased expression of receptor-interacting protein 1, receptor-interacting protein 3, high-mobility group box 1, and phosphorylated mixed lineage kinase domain-like in murine livers. Curcumin dose-dependently ameliorated hepatocyte necroptosis and alleviated alcohol-caused decrease in hepatic Nrf2 expression in alcoholic mice. Then Nrf2 shRNA lentivirus was introduced to generate Nrf2-knockdown mice. Our results indicated that Nrf2 knockdown aggravated the effects of alcohol on liver injury and necroptosis and even abrogated the inhibitory effect of curcumin on necroptosis. Further, activated Nrf2 by curcumin inhibited p53 expression in both livers and cultured hepatocytes under alcohol stimulation. The next in vitro experiments, similar to in vivo ones, revealed that although Nrf2 knockdown abolished the suppression of curcumin on necroptosis of hepatocytes exposed to ethanol, p53 siRNA could clearly rescued the relative effect of curcumin. In summary, for the first time, we concluded that curcumin attenuated alcohol-induced hepatocyte necroptosis in a Nrf2/p53-dependent mechanism. These findings make curcumin an excellent candidate for ALD treatment and advance the understanding of ALD mechanisms associated with hepatocyte necroptosis.

CD147 knockdown improves the antitumor efficacy of trastuzumab in HER2-positive breast cancer cells

PubMed Central

Wu, Chenglin; Fu, Kaifei; Wang, Yuxiao; Zhang, Yan; Liu, Yan; Zhou, Lijun

2016-01-01

Trastuzumab is widely used in the clinical treatment of human epidermal growth factor receptor-2 (HER2)-positive breast cancer, but the patient response rate is low. CD147 stimulates cancer cell proliferation, migration, metastasis and differentiation and is involved in chemoresistance in many types of cancer cells. Whether CD147 alters the effect of trastuzumab on HER2-positive breast cancer cells has not been previously reported. Our study confirmed that CD147 suppression enhances the effects of trastuzumab both in vitro and in vivo. CD147 suppression increased the inhibitory rate of trastuzumab and cell apoptosis in SKBR3, BT474, HCC1954 and MDA-MB453 cells compared with the controls. Furthermore, CD147 knockdown increased expression of cleaved Caspase-3/9 and poly (ADP-ribose) polymerase (PARP) and decreased both mitogen-activated protein kinase (MAPK) and Akt phosphorylation in the four cell lines. In an HCC1954 xenograft model, trastuzumab achieved greater suppression of tumor growth in the CD147-knockdown group than in the shRNA negative control (NC) group. These data indicated that enhancement of the effect of trastuzumab on HER2-positive cells following CD147 knockdown might be attributed to increased apoptosis and decreased phosphorylation of signaling proteins. CD147 may be a key protein for enhancing the clinical efficacy of trastuzumab. PMID:27363028

CD147 knockdown improves the antitumor efficacy of trastuzumab in HER2-positive breast cancer cells.

PubMed

Xiong, Lijuan; Ding, Li; Ning, Haoyong; Wu, Chenglin; Fu, Kaifei; Wang, Yuxiao; Zhang, Yan; Liu, Yan; Zhou, Lijun

2016-09-06

Trastuzumab is widely used in the clinical treatment of human epidermal growth factor receptor-2 (HER2)-positive breast cancer, but the patient response rate is low. CD147 stimulates cancer cell proliferation, migration, metastasis and differentiation and is involved in chemoresistance in many types of cancer cells. Whether CD147 alters the effect of trastuzumab on HER2-positive breast cancer cells has not been previously reported. Our study confirmed that CD147 suppression enhances the effects of trastuzumab both in vitro and in vivo. CD147 suppression increased the inhibitory rate of trastuzumab and cell apoptosis in SKBR3, BT474, HCC1954 and MDA-MB453 cells compared with the controls. Furthermore, CD147 knockdown increased expression of cleaved Caspase-3/9 and poly (ADP-ribose) polymerase (PARP) and decreased both mitogen-activated protein kinase (MAPK) and Akt phosphorylation in the four cell lines. In an HCC1954 xenograft model, trastuzumab achieved greater suppression of tumor growth in the CD147-knockdown group than in the shRNA negative control (NC) group. These data indicated that enhancement of the effect of trastuzumab on HER2-positive cells following CD147 knockdown might be attributed to increased apoptosis and decreased phosphorylation of signaling proteins. CD147 may be a key protein for enhancing the clinical efficacy of trastuzumab.

Neuromedin U receptor 2 knockdown in the paraventricular nucleus modifies behavioral responses to obesogenic high-fat food and leads to increased body weight.

PubMed

Benzon, C R; Johnson, S B; McCue, D L; Li, D; Green, T A; Hommel, J D

2014-01-31

Neuromedin U (NMU) is a highly conserved neuropeptide which regulates food intake and body weight. Transgenic mice lacking NMU are hyperphagic and obese, making NMU a novel target for understanding and treating obesity. Neuromedin U receptor 2 (NMUR2) is a high-affinity receptor for NMU found in discrete regions of the central nervous system, in particular the paraventricular nucleus of the hypothalamus (PVN), where it may be responsible for mediating the anorectic effects of NMU. We hypothesized that selective knock down of NMUR2 in the PVN of rats would increase their sensitivity to the reinforcing properties of food resulting in increased intake and preference for high-fat obesogenic food. To this end, we used viral-mediated RNAi to selectively knock down NMUR2 gene expression in the PVN. In rats fed a standard chow, NMUR2 knockdown produced no significant effect on food intake or body weight. However, when the same rats were fed a high-fat diet (45% fat), they consumed significantly more food, gained more body weight, and had increased feed efficiency relative to controls. Furthermore, NMUR2 knockdown rats demonstrated significantly greater binge-type food consumption of the high-fat diet and showed a greater preference for higher-fat food. These results demonstrate that NMUR2 signaling in the PVN regulates consumption and preference for high-fat foods without disrupting feeding behavior associated with non-obesogenic standard chow. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

Amyloid precursor protein regulates migration and metalloproteinase gene expression in prostate cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyazaki, Toshiaki; Ikeda, Kazuhiro; Horie-Inoue, Kuniko

Highlights: • APP knockdown reduced proliferation and migration of prostate cancer cells. • APP knockdown reduced expression of metalloproteinase and EMT-related genes. • APP overexpression promoted LNCaP cell migration. • APP overexpression increased expression of metalloproteinase and EMT-related genes. - Abstract: Amyloid precursor protein (APP) is a type I transmembrane protein, and one of its processed forms, β-amyloid, is considered to play a central role in the development of Alzheimer’s disease. We previously showed that APP is a primary androgen-responsive gene in prostate cancer and that its increased expression is correlated with poor prognosis for patients with prostate cancer. APPmore » has also been implicated in several human malignancies. Nevertheless, the mechanism underlying the pro-proliferative effects of APP on cancers is still not well-understood. In the present study, we explored a pathophysiological role for APP in prostate cancer cells using siRNA targeting APP (siAPP). The proliferation and migration of LNCaP and DU145 prostate cancer cells were significantly suppressed by siAPP. Differentially expressed genes in siAPP-treated cells compared to control siRNA-treated cells were identified by microarray analysis. Notably, several metalloproteinase genes, such as ADAM10 and ADAM17, and epithelial–mesenchymal transition (EMT)-related genes, such as VIM, and SNAI2, were downregulated in siAPP-treated cells as compared to control cells. The expression of these genes was upregulated in LNCaP cells stably expressing APP when compared with control cells. APP-overexpressing LNCaP cells exhibited enhanced migration in comparison to control cells. These results suggest that APP may contribute to the proliferation and migration of prostate cancer cells by modulating the expression of metalloproteinase and EMT-related genes.« less

Knockdown of CAVEOLIN-1 Sensitizes Human Basal-Like Triple-Negative Breast Cancer Cells to Radiation.

PubMed

Zou, Man; Li, Yanhui; Xia, Shu; Chu, Qian; Xiao, Xiaoguang; Qiu, Hong; Chen, Yu; Zheng, Zu'an; Liu, Fei; Zhuang, Liang; Yu, Shiying

2017-01-01

Triple-negative breast cancer (TNBC) is a high-risk breast cancer phenotype without specific targeted therapy options and is significantly associated with increased local recurrence in patients treated with radiotherapy. CAVEOLIN-1 (CAV-1)-mediated epidermal growth factor receptor (EGFR) nuclear translocation following irradiation promotes DNA repair and thus induces radiation resistance. In this study, we aimed to determine whether knockdown of CAV-1 enhances the radiosensitivity of basal-like TNBC cell lines and to explore the possible mechanisms. Western blotting was used to compare protein expression in a panel of breast cancer cell lines. Nuclear accumulation of EGFR as well as DNA repair and damage at multiple time points following irradiation with or without CAV-1 siRNA pretreatment were investigated using western blotting and confocal microscopy. The radiosensitizing effect of CAV-1 siRNA was evaluated using a clonogenic assay. Flowcytometry was performed to analyse cell apoptosis and cell cycle alteration. We found that CAV-1 is over-expressed in basal-like TNBC cell lines and barely expressed in HER-2-positive cells; additionally, we observed that HER-2-positive cell lines are more sensitive to irradiation than basal-like TNBC cells. Our findings revealed that radiation-induced EGFR nuclear translocation was impaired by knockdown of CAV-1. In parallel, radiation-induced elevation of DNA repair proteins was also hampered by pretreatment with CAV-1 siRNA before irradiation. Silencing of CAV-1 also promoted DNA damage 24 h after irradiation. Colony formation assays verified that cells could be radiosensitized after knockdown of CAV-1. Furthermore, G2/M cell cycle arrest and apoptosis enhancement may also contribute to the radiosensitizing effect of CAV-1 siRNA. Our results support the hypothesis that CAV-1 knockdown by siRNA causes increased radiosensitivity in basal-like TNBC cells. The mechanisms associated with this effect are reduced DNA repair through

Peptidoglycan recognition protein genes and their roles in the innate immune pathways of the red flour beetle, Tribolium castaneum.

PubMed

Koyama, Hiroaki; Kato, Daiki; Minakuchi, Chieka; Tanaka, Toshiharu; Yokoi, Kakeru; Miura, Ken

2015-11-01

We have previously demonstrated that the functional Toll and IMD innate immune pathways indeed exist in the model beetle, Tribolium castaneum while the beetle's pathways have broader specificity in terms of microbial activation than that of Drosophila. To elucidate the molecular basis of this broad microbial activation, we here focused on potential upstream sensors of the T. castaneum innate immune pathways, peptidoglycan recognition proteins (PGRPs). Our phenotype analyses utilizing RNA interference-based comprehensive gene knockdown followed by bacterial challenge suggested: PGRP-LA functions as a pivotal sensor of the IMD pathway for both Gram-negative and Gram-positive bacteria; PGRP-LC acts as an IMD pathway-associated sensor mainly for Gram-negative bacteria; PGRP-LE also has some roles in Gram-negative bacterial recognition of the IMD pathway. On the other hand, we did not obtain clear phenotype changes by gene knockdown of short-type PGRP genes, probably because of highly inducible nature of these genes. Our results may collectively account for the promiscuous bacterial activation of the T. castaneum innate immune pathways at least in part. Copyright © 2015 Elsevier Inc. All rights reserved.

Knockdown resistance (kdr)-like mutations in the voltage-gated sodium channel of a malaria vector Anopheles stephensi and PCR assays for their detection.

PubMed

Singh, Om P; Dykes, Cherry L; Lather, Manila; Agrawal, Om P; Adak, Tridibes

2011-03-14

Knockdown resistance (kdr) in insects, resulting from mutation(s) in the voltage-gated sodium channel (vgsc) gene is one of the mechanisms of resistance against DDT and pyrethroid-group of insecticides. The most common mutation(s) associated with knockdown resistance in insects, including anophelines, has been reported to be present at residue Leu1014 in the IIS6 transmembrane segment of the vgsc gene. This study reports the presence of two alternative kdr-like mutations, L1014S and L1014F, at this residue in a major malaria vector Anopheles stephensi and describes new PCR assays for their detection. Part of the vgsc (IIS4-S5 linker-to-IIS6 transmembrane segment) of An. stephensi collected from Alwar (Rajasthan, India) was PCR-amplified from genomic DNA, sequenced and analysed for the presence of deduced amino acid substitution(s). Analysis of DNA sequences revealed the presence of two alternative non-synonymous point mutations at L1014 residue in the IIS6 transmembrane segment of vgsc, i.e., T>C mutation on the second position and A>T mutation on the third position of the codon, leading to Leu (TTA)-to-Ser (TCA) and -Phe (TTT) amino acid substitutions, respectively. Polymerase chain reaction (PCR) assays were developed for identification of each of these two point mutations. Genotyping of An. stephensi mosquitoes from Alwar by PCR assays revealed the presence of both mutations, with a high frequency of L1014S. The PCR assays developed for detection of the kdr mutations were specific as confirmed by DNA sequencing of PCR-genotyped samples. Two alternative kdr-like mutations, L1014S and L1014F, were detected in An. stephensi with a high allelic frequency of L1014S. The occurrence of L1014S is being reported for the first time in An. stephensi. Two specific PCR assays were developed for detection of two kdr-like mutations in An. stephensi.

RNA interference in a cestode reveals specific silencing of selected highly expressed gene transcripts.

PubMed

Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G

2010-04-01

Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for

Speech Sound Processing Deficits and Training-Induced Neural Plasticity in Rats with Dyslexia Gene Knockdown

PubMed Central

Centanni, Tracy M.; Chen, Fuyi; Booker, Anne M.; Engineer, Crystal T.; Sloan, Andrew M.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.

2014-01-01

In utero RNAi of the dyslexia-associated gene Kiaa0319 in rats (KIA-) degrades cortical responses to speech sounds and increases trial-by-trial variability in onset latency. We tested the hypothesis that KIA- rats would be impaired at speech sound discrimination. KIA- rats needed twice as much training in quiet conditions to perform at control levels and remained impaired at several speech tasks. Focused training using truncated speech sounds was able to normalize speech discrimination in quiet and background noise conditions. Training also normalized trial-by-trial neural variability and temporal phase locking. Cortical activity from speech trained KIA- rats was sufficient to accurately discriminate between similar consonant sounds. These results provide the first direct evidence that assumed reduced expression of the dyslexia-associated gene KIAA0319 can cause phoneme processing impairments similar to those seen in dyslexia and that intensive behavioral therapy can eliminate these impairments. PMID:24871331

Knockdown of Zebrafish Lumican Gene (zlum) Causes Scleral Thinning and Increased Size of Scleral Coats*

PubMed Central

Yeh, Lung-Kun; Liu, Chia-Yang; Kao, Winston W.-Y.; Huang, Chang-Jen; Hu, Fung-Rong; Chien, Chung-Liang; Wang, I-Jong

2010-01-01

The lumican gene (lum), which encodes one of the major keratan sulfate proteoglycans (KSPGs) in the vertebrate cornea and sclera, has been linked to axial myopia in humans. In this study, we chose zebrafish (Danio rerio) as an animal model to elucidate the role of lumican in the development of axial myopia. The zebrafish lumican gene (zlum) spans ∼4.6 kb of the zebrafish genome. Like human (hLUM) and mouse (mlum), zlum consists of three exons, two introns, and a TATA box-less promoter at the 5′-flanking region of the transcription initiation site. Sequence analysis of the cDNA predicts that zLum encodes 344 amino acids. zLum shares 51% amino acid sequence identity with human lumican. Similar to hLUM and mlum, zlum mRNA is expressed in the eye and many other tissues, such as brain, muscle, and liver as well. Transgenic zebrafish harboring an enhanced GFP reporter gene construct downstream of a 1.7-kb zlum 5′-flanking region displayed enhanced GFP expression in the cornea and sclera, as well as throughout the body. Down-regulation of zlum expression by antisense zlum morpholinos manifested ocular enlargement resembling axial myopia due to disruption of the collagen fibril arrangement in the sclera and resulted in scleral thinning. Administration of muscarinic receptor antagonists, e.g. atropine and pirenzepine, effectively subdued the ocular enlargement caused by morpholinos in in vivo zebrafish larvae assays. The observation suggests that zebrafish can be used as an in vivo model for screening compounds in treating myopia. PMID:20551313

Nanoparticle-mediated knockdown of DNA repair sensitizes cells to radiotherapy and extends survival in a genetic mouse model of glioblastoma.

PubMed

Kievit, Forrest M; Wang, Kui; Ozawa, Tatsuya; Tarudji, Aria W; Silber, John R; Holland, Eric C; Ellenbogen, Richard G; Zhang, Miqin

2017-10-01

Glioblastoma (GBM) remains incurable, and recurrent tumors rarely respond to standard-of-care radiation and chemo-therapies. Therefore, strategies that enhance the effects of these therapies should provide significant benefits to GBM patients. We have developed a nanoparticle delivery vehicle that can stably bind and protect nucleic acids for specific delivery into brain tumor cells. These nanoparticles can deliver therapeutic siRNAs to sensitize GBM cells to radiotherapy and improve GBM treatment via systemic administration. We show that nanoparticle-mediated knockdown of the DNA repair protein apurinic endonuclease 1 (Ape1) sensitizes GBM cells to radiotherapy and extend survival in a genetic mouse model of GBM. Specific knockdown of Ape1 activity by 30% in brain tumor tissue doubled the extended survival achieved with radiotherapy alone. Ape1 is a promising target for increasing the effectiveness of radiotherapy, and nanoparticle-mediated delivery of siRNA is a promising strategy for tumor specific knockdown of Ape1. Copyright © 2017. Published by Elsevier Inc.

Cap 'n' collar C regulates genes responsible for imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata.

PubMed

Gaddelapati, Sharath Chandra; Kalsi, Megha; Roy, Amit; Palli, Subba Reddy

2018-08-01

The Colorado potato beetle (CPB), Leptinotarsa decemlineata developed resistance to imidacloprid after exposure to this insecticide for multiple generations. Our previous studies showed that xenobiotic transcription factor, cap 'n' collar isoform C (CncC) regulates the expression of multiple cytochrome P450 genes, which play essential roles in resistance to plant allelochemicals and insecticides. In this study, we sought to obtain a comprehensive picture of the genes regulated by CncC in imidacloprid-resistant CPB. We performed sequencing of RNA isolated from imidacloprid-resistant CPB treated with dsRNA targeting CncC or gene coding for green fluorescent protein (control). Comparative transcriptome analysis showed that CncC regulated the expression of 1798 genes, out of which 1499 genes were downregulated in CncC knockdown beetles. Interestingly, expression of 79% of imidacloprid induced P450 genes requires CncC. We performed quantitative real-time PCR to verify the reduction in the expression of 20 genes including those coding for detoxification enzymes (P450s, glutathione S-transferases, and esterases) and ABC transporters. The genes coding for ABC transporters are induced in insecticide resistant CPB and require CncC for their expression. Knockdown of genes coding for ABC transporters simultaneously or individually caused an increase in imidacloprid-induced mortality in resistant beetles confirming their contribution to insecticide resistance. These studies identified CncC as a transcription factor involved in regulation of genes responsible for imidacloprid resistance. Small molecule inhibitors of CncC or suppression of CncC by RNAi could provide effective synergists for pest control or management of insecticide resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.

Gene masking - a technique to improve accuracy for cancer classification with high dimensionality in microarray data.

PubMed

Saini, Harsh; Lal, Sunil Pranit; Naidu, Vimal Vikash; Pickering, Vincel Wince; Singh, Gurmeet; Tsunoda, Tatsuhiko; Sharma, Alok

2016-12-05

High dimensional feature space generally degrades classification in several applications. In this paper, we propose a strategy called gene masking, in which non-contributing dimensions are heuristically removed from the data to improve classification accuracy. Gene masking is implemented via a binary encoded genetic algorithm that can be integrated seamlessly with classifiers during the training phase of classification to perform feature selection. It can also be used to discriminate between features that contribute most to the classification, thereby, allowing researchers to isolate features that may have special significance. This technique was applied on publicly available datasets whereby it substantially reduced the number of features used for classification while maintaining high accuracies. The proposed technique can be extremely useful in feature selection as it heuristically removes non-contributing features to improve the performance of classifiers.

A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages

PubMed Central

Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

2016-01-01

Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in RAW264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of RAW264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the RAW264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

Silencing a sugar transporter gene reduces growth and fecundity in the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

PubMed

Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai

2015-07-17

The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.

Gene Transfer of Brain-derived Neurotrophic Factor (BDNF) Prevents Neurodegeneration Triggered by FXN Deficiency.

PubMed

Katsu-Jiménez, Yurika; Loría, Frida; Corona, Juan Carlos; Díaz-Nido, Javier

2016-05-01

Friedreich's ataxia is a predominantly neurodegenerative disease caused by recessive mutations that produce a deficiency of frataxin (FXN). Here, we have used a herpesviral amplicon vector carrying a gene encoding for brain-derived neurotrophic factor (BDNF) to drive its overexpression in neuronal cells and test for its effect on FXN-deficient neurons both in culture and in the mouse cerebellum in vivo. Gene transfer of BDNF to primary cultures of mouse neurons prevents the apoptosis which is triggered by the knockdown of FXN gene expression. This neuroprotective effect of BDNF is also observed in vivo in a viral vector-based knockdown mouse cerebellar model. The injection of a lentiviral vector carrying a minigene encoding for a FXN-specific short hairpin ribonucleic acid (shRNA) into the mouse cerebellar cortex triggers a FXN deficit which is accompanied by significant apoptosis of granule neurons as well as loss of calbindin in Purkinje cells. These pathological changes are accompanied by a loss of motor coordination of mice as assayed by the rota-rod test. Coinjection of a herpesviral vector encoding for BDNF efficiently prevents both the development of cerebellar neuropathology and the ataxic phenotype. These data demonstrate the potential therapeutic usefulness of neurotrophins like BDNF to protect FXN-deficient neurons from degeneration.

Knockdown of desmin in zebrafish larvae affects interfilament spacing and mechanical properties of skeletal muscle.

PubMed

Li, Mei; Andersson-Lendahl, Monika; Sejersen, Thomas; Arner, Anders

2013-03-01

Skeletal muscle was examined in zebrafish larvae in order to address questions related to the function of the intermediate filament protein desmin and its role in the pathogenesis of human desminopathy. A novel approach including mechanical and structural studies of 4-6-d-old larvae was applied. Morpholino antisense oligonucleotides were used to knock down desmin. Expression was assessed using messenger RNA and protein analyses. Histology and synchrotron light-based small angle x-ray diffraction were applied. Functional properties were analyzed with in vivo studies of swimming behavior and with in vitro mechanical examinations of muscle. The two desmin genes normally expressed in zebrafish could be knocked down by ~50%. This resulted in a phenotype with disorganized muscles with altered attachments to the myosepta. The knockdown larvae were smaller and had diminished swimming activity. Active tension was lowered and muscles were less vulnerable to acute stretch-induced injury. X-ray diffraction revealed wider interfilament spacing. In conclusion, desmin intermediate filaments are required for normal active force generation and affect vulnerability during eccentric work. This is related to the role of desmin in anchoring sarcomeres for optimal force transmission. The results also show that a partial lack of desmin, without protein aggregates, is sufficient to cause muscle pathology resembling that in human desminopathy.

Knockdown of Tripartite-59 (TRIM59) Inhibits Cellular Proliferation and Migration in Human Cervical Cancer Cells.

PubMed

Aierken, Gulijiahan; Seyiti, Ayinuer; Alifu, Mayinuer; Kuerban, Gulina

2017-03-13

The tripartite motif (TRIM) family of proteins is a class of highly conservative proteins that have been implicated in multiple processes. TRIM59, one member of the TRIM family, has now received recognition as a key regulator in the development and progression of human diseases. However, its role in human tumorigenesis has remained largely unknown. In this study, the effects of TRIM59 expression on cell proliferation and migration were investigated in human cervical cancer cells. The expression of TRIM59 in clinical cervical cancer tissues and cervical cancer cells was initially determined by RT-PCR and Western blot. Specific shRNA against TRIM59 was then employed to knock down the expression of TRIM59 in cervical cancer lines HeLa and SiHa. The effects of TRIM59 knockdown on cell proliferation was assessed by MTT assay and colony formation assay. Transwell assay was conducted to reveal cell migration and invasion abilities before and after TRIM59 knockdown. Our results showed that the expression of TRIM59 was significantly elevated in cervical cancers. Knockdown of TRIM59 significantly inhibited cell proliferation and colony formation as well as cell migration and invasion abilities in cervical cancer HeLa and SiHa cells. Cell cycle progression analysis showed that TRIM59-depleted cells preferred to accumulate in the S phase. These data suggest that TRIM59 is a potential target that promotes the progression of cervical cancer.

Expression of Cyclophilin B is Associated with Malignant Progression and Regulation of Genes Implicated in the Pathogenesis of Breast Cancer

PubMed Central

Fang, Feng; Flegler, Ayanna J.; Du, Pan; Lin, Simon; Clevenger, Charles V.

2009-01-01

Cyclophilin B (CypB) is a 21-kDa protein with peptidyl-prolyl cis-trans isomerase activity that functions as a transcriptional inducer for Stat5 and as a ligand for CD147. To better understand the global function of CypB in breast cancer, T47D cells with a small interfering RNA-mediated knockdown of CypB were generated. Subsequent expression profiling analysis showed that 663 transcripts were regulated by CypB knockdown, and that many of these gene products contributed to cell proliferation, cell motility, and tumorigenesis. Real-time PCR confirmed that STMN3, S100A4, S100A6, c-Myb, estrogen receptor α, growth hormone receptor, and progesterone receptor were all down-regulated in si-CypB cells. A linkage analysis of these array data to protein networks resulted in the identification of 27 different protein networks that were impacted by CypB knockdown. Functional assays demonstrated that CypB knockdown also decreased cell growth, proliferation, and motility. Immunohistochemical and immunofluorescent analyses of a matched breast cancer progression tissue microarray that was labeled with an anti-CypB antibody demonstrated a highly significant increase in CypB protein levels as a function of breast cancer progression. Taken together, these results suggest that the enhanced expression of CypB in malignant breast epithelium may contribute to the pathogenesis of this disease through its regulation of the expression of hormone receptors and gene products that are involved in cell proliferation and motility. PMID:19056847

Small-Interfering RNA–Eluting Surfaces as a Novel Concept for Intravascular Local Gene Silencing

PubMed Central

Nolte, Andrea; Walker, Tobias; Schneider, Martina; Kray, Oya; Avci-Adali, Meltem; Ziemer, Gerhard; Wendel, Hans Peter

2011-01-01

New drug-eluting stent (DES) methods have recently been demonstrated to improve outcomes of intravascular interventions. A novel technique is the design of gene-silencing stents that elute specific small-interfering RNAs (siRNAs) for better vascular wall regeneration. Although siRNAs used to alter gene expression have surpassed expectations in in vitro experiments, the functional and local delivery of siRNAs is still the major obstacle for the in vivo application of RNA interference. In this preliminary in vitro study we investigated a surface-immobilized siRNA delivery technique that would be readily adaptable for local intravascular applications in vivo. The transfection potency of gelatin coatings consisting of a specific siRNA complexed with polyethylenimine (PEI) was examined in primary human endothelial cells by flow cytometry and quantitative real-time polymerase chain reaction. Several media conditions, such as the presence or absence of serum during cultivation, were investigated. Furthermore, different siRNA and PEI amounts, as well as nitrogen/phosphate ratios, were tested for their transfection efficiency. Gelatin coatings consisting of PEI and siRNA against an exemplary endothelial adhesion molecule receptor achieved a significant knockdown of around 70%. The transfection efficiency of the coatings was not influenced by the presence of serum. The results of this preliminary study support the expectation that this novel coating may be favorable for local in vivo gene silencing (for example, when immobilized on stents or balloons for percutanous transluminal coronary angioplasty). However, further animal experiments are needed to confirm the translation into clinical practice. This intriguing technology leads the way to more sophisticated and individualized coatings for the post-DES era, toward silencing of genes involved in the pathway of intimal hyperplasia. PMID:21792480

NFI Transcription Factors Interact with FOXA1 to Regulate Prostate-Specific Gene Expression

PubMed Central

Elliott, Amicia D.; DeGraff, David J.; Anderson, Philip D.; Anumanthan, Govindaraj; Yamashita, Hironobu; Sun, Qian; Friedman, David B.; Hachey, David L.; Yu, Xiuping; Sheehan, Jonathan H.; Ahn, Jung-Mo; Raj, Ganesh V.; Piston, David W.; Gronostajski, Richard M.; Matusik, Robert J.

2014-01-01

Androgen receptor (AR) action throughout prostate development and in maintenance of the prostatic epithelium is partly controlled by interactions between AR and forkhead box (FOX) transcription factors, particularly FOXA1. We sought to identity additional FOXA1 binding partners that may mediate prostate-specific gene expression. Here we identify the nuclear factor I (NFI) family of transcription factors as novel FOXA1 binding proteins. All four family members (NFIA, NFIB, NFIC, and NFIX) can interact with FOXA1, and knockdown studies in androgen-dependent LNCaP cells determined that modulating expression of NFI family members results in changes in AR target gene expression. This effect is probably mediated by binding of NFI family members to AR target gene promoters, because chromatin immunoprecipitation (ChIP) studies found that NFIB bound to the prostate-specific antigen enhancer. Förster resonance energy transfer studies revealed that FOXA1 is capable of bringing AR and NFIX into proximity, indicating that FOXA1 facilitates the AR and NFI interaction by bridging the complex. To determine the extent to which NFI family members regulate AR/FOXA1 target genes, motif analysis of publicly available data for ChIP followed by sequencing was undertaken. This analysis revealed that 34.4% of peaks bound by AR and FOXA1 contain NFI binding sites. Validation of 8 of these peaks by ChIP revealed that NFI family members can bind 6 of these predicted genomic elements, and 4 of the 8 associated genes undergo gene expression changes as a result of individual NFI knockdown. These observations suggest that NFI regulation of FOXA1/AR action is a frequent event, with individual family members playing distinct roles in AR target gene expression. PMID:24801505

Cdx ParaHox genes acquired distinct developmental roles after gene duplication in vertebrate evolution.

PubMed

Marlétaz, Ferdinand; Maeso, Ignacio; Faas, Laura; Isaacs, Harry V; Holland, Peter W H

2015-08-01

The functional consequences of whole genome duplications in vertebrate evolution are not fully understood. It remains unclear, for instance, why paralogues were retained in some gene families but extensively lost in others. Cdx homeobox genes encode conserved transcription factors controlling posterior development across diverse bilaterians. These genes are part of the ParaHox gene cluster. Multiple Cdx copies were retained after genome duplication, raising questions about how functional divergence, overlap, and redundancy respectively contributed to their retention and evolutionary fate. We examined the degree of regulatory and functional overlap between the three vertebrate Cdx genes using single and triple morpholino knock-down in Xenopus tropicalis followed by RNA-seq. We found that one paralogue, Cdx4, has a much stronger effect on gene expression than the others, including a strong regulatory effect on FGF and Wnt genes. Functional annotation revealed distinct and overlapping roles and subtly different temporal windows of action for each gene. The data also reveal a colinear-like effect of Cdx genes on Hox genes, with repression of Hox paralogy groups 1 and 2, and activation increasing from Hox group 5 to 11. We also highlight cases in which duplicated genes regulate distinct paralogous targets revealing pathway elaboration after whole genome duplication. Despite shared core pathways, Cdx paralogues have acquired distinct regulatory roles during development. This implies that the degree of functional overlap between paralogues is relatively low and that gene expression pattern alone should be used with caution when investigating the functional evolution of duplicated genes. We therefore suggest that developmental programmes were extensively rewired after whole genome duplication in the early evolution of vertebrates.

Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

PubMed

Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

2018-01-01

Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

Small interfering RNA mediated knockdown of irisin suppresses food intake and modulates appetite regulatory peptides in zebrafish.

PubMed

Sundarrajan, Lakshminarasimhan; Unniappan, Suraj

2017-10-01

Irisin is a myokine encoded in fibronectin type III domain containing 5 (FNDC5). FNDC5 forms an integral part of the muscle post-exercise, and causes an increase in energy expenditure in mammals. Irisin is abundantly expressed in cardiac and skeletal muscles and is secreted upon activation of peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1 alpha). Irisin regulates feeding behaviour and cardiovascular function in mammals. More recently, irisin has gained importance as a potential biomarker for myocardial infarction due to its abundance in cardiac muscle. The goal of this research was to determine whether irisin influences feeding, and regulates appetite regulatory peptides in zebrafish. Intraperitoneal injection of irisin [0.1, 1, 10 and 100ng/g body weight (BW)] did not affect feeding, but its knockdown using siRNA (10ng/g BW) caused a significant reduction in food intake. Knockdown of irisin reduced ghrelin and orexin-A mRNA expression, and increased cocaine and amphetamine regulated transcript mRNA expression in zebrafish brain and gut. siRNA mediated knockdown of irisin also downregulated brain derived neurotrophic factor mRNA in zebrafish. The role of endogenous irisin on food intake is likely mediated by its actions on other metabolic peptides. Collectively, these results indicate that unaltered endogenous irisin is required to maintain food intake in zebrafish. Copyright © 2017 Elsevier Inc. All rights reserved.

Knockdown of human deubiquitinase PSMD14 induces cell cycle arrest and senescence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byrne, Ann; McLaren, Rajashree P.; Mason, Paul

2010-01-15

The PSMD14 (POH1, also known as Rpn11/MPR1/S13/CepP1) protein within the 19S complex (19S cap; PA700) is responsible for substrate deubiquitination during proteasomal degradation. The role of PSMD14 in cell proliferation and senescence was explored using siRNA knockdown in carcinoma cell lines. Our results reveal that down-regulation of PSMD14 by siRNA transfection had a considerable impact on cell viability causing cell arrest in the G0-G1 phase, ultimately leading to senescence. The molecular events associated with decreased cell proliferation, cell cycle arrest and senescence include down-regulation of cyclin B1-CDK1-CDC25C, down-regulation of cyclin D1 and up-regulation of p21{sup /Cip} and p27{sup /Kip1}. Mostmore » notably, phosphorylation of the retinoblastoma protein was markedly reduced in PSMD14 knockdown cells. A comparative study with PSMB5, a subunit of the 20S proteasome, revealed that PSMB5 and PSMD14 have different effects on cell cycle, senescence and associated molecular events. These data support the view that the 19S and 20S subunits of the proteasome have distinct biological functions and imply that targeting 19S and 20S would have distinct molecular consequences on tumor cells.« less

Inducible Knock-Down of the Mineralocorticoid Receptor in Mice Disturbs Regulation of the Renin-Angiotensin-Aldosterone System and Attenuates Heart Failure Induced by Pressure Overload.

PubMed

Montes-Cobos, Elena; Li, Xiao; Fischer, Henrike J; Sasse, André; Kügler, Sebastian; Didié, Michael; Toischer, Karl; Fassnacht, Martin; Dressel, Ralf; Reichardt, Holger M

2015-01-01

Mineralocorticoid receptor (MR) inactivation in mice results in early postnatal lethality. Therefore we generated mice in which MR expression can be silenced during adulthood by administration of doxycycline (Dox). Using a lentiviral approach, we obtained two lines of transgenic mice harboring a construct that allows for regulatable MR inactivation by RNAi and concomitant expression of eGFP. MR mRNA levels in heart and kidney of inducible MR knock-down mice were unaltered in the absence of Dox, confirming the tightness of the system. In contrast, two weeks after Dox administration MR expression was significantly diminished in a variety of tissues. In the kidney, this resulted in lower mRNA levels of selected target genes, which was accompanied by strongly increased serum aldosterone and plasma renin levels as well as by elevated sodium excretion. In the healthy heart, gene expression and the amount of collagen were unchanged despite MR levels being significantly reduced. After transverse aortic constriction, however, cardiac hypertrophy and progressive heart failure were attenuated by MR silencing, fibrosis was unaffected and mRNA levels of a subset of genes reduced. Taken together, we believe that this mouse model is a useful tool to investigate the role of the MR in pathophysiological processes.

Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

PubMed Central

Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

2014-01-01

In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

Molecular characterisation of two α-esterase genes involving chlorpyrifos detoxification in the diamondback moth, Plutella xylostella.

PubMed

Xie, Miao; Ren, Na-Na; You, Yan-Chun; Chen, Wei-Jun; Song, Qi-Sheng; You, Min-Sheng

2017-06-01

Carboxylesterases (CarEs) are involved in metabolic detoxification of dietary and environmental xenobiotics in insects. However, owing to the complexity of the protein family, the involvement of CarEs in insecticide metabolism in Plutella xylostella has not been fully elucidated. This study aimed to characterise two CarE genes and assess their potential roles in response to chlorpyrifos in P. xylostella. Synergistic tests showed that triphenyl phosphate decreased the resistance of the third-instar larvae to chlorpyrifos. The treatment of the third-instar larvae with chlorpyrifos at the LC 30 dose led to a significant increase in CarE activity. Two CarE cDNAs (Pxae18 and Pxae28) were subsequently sequenced and characterised. Both genes were expressed predominantly in the larval midgut. Most importantly, two CarE genes showed significantly higher expression in the chlorpyrifos-resistant strain than in the susceptible strain. RNAi knockdown of Pxae18 and Pxae28 significantly increased the mortality to chlorpyrifos from 40% in the control to 73.8 and 63.3% respectively. RNAi knockdown of Pxae18 and Pxae28 significantly inhibited detoxification ability and increased the mortality in P. xylostella. The results indicate that these two CarE genes play important roles in the detoxification of chlorpyrifos in P. xylostella. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Colon Cancer-Upregulated Long Non-Coding RNA lincDUSP Regulates Cell Cycle Genes and Potentiates Resistance to Apoptosis.

PubMed

Forrest, Megan E; Saiakhova, Alina; Beard, Lydia; Buchner, David A; Scacheri, Peter C; LaFramboise, Thomas; Markowitz, Sanford; Khalil, Ahmad M

2018-05-09

Long non-coding RNAs (lncRNAs) are frequently dysregulated in many human cancers. We sought to identify candidate oncogenic lncRNAs in human colon tumors by utilizing RNA sequencing data from 22 colon tumors and 22 adjacent normal colon samples from The Cancer Genome Atlas (TCGA). The analysis led to the identification of ~200 differentially expressed lncRNAs. Validation in an independent cohort of normal colon and patient-derived colon cancer cell lines identified a novel lncRNA, lincDUSP, as a potential candidate oncogene. Knockdown of lincDUSP in patient-derived colon tumor cell lines resulted in significantly decreased cell proliferation and clonogenic potential, and increased susceptibility to apoptosis. The knockdown of lincDUSP affects the expression of ~800 genes, and NCI pathway analysis showed enrichment of DNA damage response and cell cycle control pathways. Further, identification of lincDUSP chromatin occupancy sites by ChIRP-Seq demonstrated association with genes involved in the replication-associated DNA damage response and cell cycle control. Consistent with these findings, lincDUSP knockdown in colon tumor cell lines increased both the accumulation of cells in early S-phase and γH2AX foci formation, indicating increased DNA damage response induction. Taken together, these results demonstrate a key role of lincDUSP in the regulation of important pathways in colon cancer.

AKI after Conditional and Kidney-Specific Knockdown of Stanniocalcin-1

PubMed Central

Huang, Luping; Belousova, Tatiana; Pan, Jenny Szu-Chin; Du, Jie; Ju, Huiming; Lu, Lianghao; Zhang, Pumin; Truong, Luan D.; Nuotio-Antar, Alli

2014-01-01

Stanniocalcin-1 is an intracrine protein; it binds to the cell surface, is internalized to the mitochondria, and diminishes superoxide generation through induction of uncoupling proteins. In vitro, stanniocalcin-1 inhibits macrophages and preserves endothelial barrier function, and transgenic overexpression of stanniocalcin-1 in mice protects against ischemia-reperfusion kidney injury. We sought to determine the kidney phenotype after kidney endothelium-specific expression of stanniocalcin-1 small hairpin RNA (shRNA). We generated transgenic mice that express stanniocalcin-1 shRNA or scrambled shRNA upon removal of a floxed reporter (phosphoglycerate kinase-driven enhanced green fluorescent protein) and used ultrasound microbubbles to deliver tyrosine kinase receptor-2 promoter-driven Cre to the kidney to permit kidney endothelium-specific shRNA expression. Stanniocalcin-1 mRNA and protein were expressed throughout the kidney in wild-type mice. Delivery of tyrosine kinase receptor-2 promoter-driven Cre to stanniocalcin-1 shRNA transgenic kidneys diminished the expression of stanniocalcin-1 mRNA and protein throughout the kidneys. Stanniocalcin-1 mRNA and protein expression did not change in similarly treated scrambled shRNA transgenic kidneys, and we observed no Cre protein expression in cultured and tyrosine kinase receptor-2 promoter-driven Cre–transfected proximal tubule cells, suggesting that knockdown of stanniocalcin-1 in epithelial cells in vivo may result from stanniocalcin-1 shRNA transfer from endothelial cells to epithelial cells. Kidney-specific knockdown of stanniocalcin-1 led to severe proximal tubule injury characterized by vacuolization, decreased uncoupling of protein-2 expression, greater generation of superoxide, activation of the unfolded protein response, initiation of autophagy, cell apoptosis, and kidney failure. Our observations suggest that stanniocalcin-1 is critical for tubular epithelial survival under physiologic conditions. PMID

Gene Expression Elucidates Functional Impact of Polygenic Risk for Schizophrenia

PubMed Central

Fromer, Menachem; Roussos, Panos; Sieberts, Solveig K; Johnson, Jessica S; Kavanagh, David H; Perumal, Thanneer M; Ruderfer, Douglas M; Oh, Edwin C; Topol, Aaron; Shah, Hardik R; Klei, Lambertus L; Kramer, Robin; Pinto, Dalila; Gümüş, Zeynep H; Cicek, A. Ercument; Dang, Kristen K; Browne, Andrew; Lu, Cong; Xie, Lu; Readhead, Ben; Stahl, Eli A; Parvizi, Mahsa; Hamamsy, Tymor; Fullard, John F; Wang, Ying-Chih; Mahajan, Milind C; Derry, Jonathan M J; Dudley, Joel; Hemby, Scott E; Logsdon, Benjamin A; Talbot, Konrad; Raj, Towfique; Bennett, David A; De Jager, Philip L; Zhu, Jun; Zhang, Bin; Sullivan, Patrick F; Chess, Andrew; Purcell, Shaun M; Shinobu, Leslie A; Mangravite, Lara M; Toyoshiba, Hiroyoshi; Gur, Raquel E; Hahn, Chang-Gyu; Lewis, David A; Haroutunian, Vahram; Peters, Mette A; Lipska, Barbara K; Buxbaum, Joseph D; Schadt, Eric E; Hirai, Keisuke; Roeder, Kathryn; Brennand, Kristen J; Katsanis, Nicholas; Domenici, Enrico; Devlin, Bernie; Sklar, Pamela

2016-01-01

Over 100 genetic loci harbor schizophrenia associated variants, yet how these variants confer liability is uncertain. The CommonMind Consortium sequenced RNA from dorsolateral prefrontal cortex of schizophrenia cases (N = 258) and control subjects (N = 279), creating a resource of gene expression and its genetic regulation. Using this resource, ~20% of schizophrenia loci have variants that could contribute to altered gene expression and liability. In five loci, only a single gene was involved: FURIN, TSNARE1, CNTN4, CLCN3, or SNAP91. Altering expression of FURIN, TSNARE1, or CNTN4 changes neurodevelopment in zebrafish; knockdown of FURIN in human neural progenitor cells yields abnormal migration. Of 693 genes showing significant case/control differential expression, their fold changes are ≤ 1.33, and an independent cohort yields similar results. Gene co-expression implicates a network relevant for schizophrenia. Our findings show schizophrenia is polygenic and highlight the utility of this resource for mechanistic interpretations of genetic liability for brain diseases. PMID:27668389

Gene expression elucidates functional impact of polygenic risk for schizophrenia.

PubMed

Fromer, Menachem; Roussos, Panos; Sieberts, Solveig K; Johnson, Jessica S; Kavanagh, David H; Perumal, Thanneer M; Ruderfer, Douglas M; Oh, Edwin C; Topol, Aaron; Shah, Hardik R; Klei, Lambertus L; Kramer, Robin; Pinto, Dalila; Gümüş, Zeynep H; Cicek, A Ercument; Dang, Kristen K; Browne, Andrew; Lu, Cong; Xie, Lu; Readhead, Ben; Stahl, Eli A; Xiao, Jianqiu; Parvizi, Mahsa; Hamamsy, Tymor; Fullard, John F; Wang, Ying-Chih; Mahajan, Milind C; Derry, Jonathan M J; Dudley, Joel T; Hemby, Scott E; Logsdon, Benjamin A; Talbot, Konrad; Raj, Towfique; Bennett, David A; De Jager, Philip L; Zhu, Jun; Zhang, Bin; Sullivan, Patrick F; Chess, Andrew; Purcell, Shaun M; Shinobu, Leslie A; Mangravite, Lara M; Toyoshiba, Hiroyoshi; Gur, Raquel E; Hahn, Chang-Gyu; Lewis, David A; Haroutunian, Vahram; Peters, Mette A; Lipska, Barbara K; Buxbaum, Joseph D; Schadt, Eric E; Hirai, Keisuke; Roeder, Kathryn; Brennand, Kristen J; Katsanis, Nicholas; Domenici, Enrico; Devlin, Bernie; Sklar, Pamela

2016-11-01

Over 100 genetic loci harbor schizophrenia-associated variants, yet how these variants confer liability is uncertain. The CommonMind Consortium sequenced RNA from dorsolateral prefrontal cortex of people with schizophrenia (N = 258) and control subjects (N = 279), creating a resource of gene expression and its genetic regulation. Using this resource, ∼20% of schizophrenia loci have variants that could contribute to altered gene expression and liability. In five loci, only a single gene was involved: FURIN, TSNARE1, CNTN4, CLCN3 or SNAP91. Altering expression of FURIN, TSNARE1 or CNTN4 changed neurodevelopment in zebrafish; knockdown of FURIN in human neural progenitor cells yielded abnormal migration. Of 693 genes showing significant case-versus-control differential expression, their fold changes were ≤ 1.33, and an independent cohort yielded similar results. Gene co-expression implicates a network relevant for schizophrenia. Our findings show that schizophrenia is polygenic and highlight the utility of this resource for mechanistic interpretations of genetic liability for brain diseases.

Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

PubMed Central

van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel

2004-01-01

Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

A splice junction-targeted CRISPR approach (spJCRISPR) reveals human FOXO3B to be a protein-coding gene.

PubMed

Santo, Evan E; Paik, Jihye

2018-06-17

The rapid development of CRISPR technology is revolutionizing molecular approaches to the dissection of complex biological phenomena. Here we describe an alternative generally applicable implementation of the CRISPR-Cas9 system that allows for selective knockdown of extremely homologous genes. This strategy employs the lentiviral delivery of paired sgRNAs and nickase Cas9 (Cas9D10A) to achieve targeted deletion of splice junctions. This general strategy offers several advantages over standard single-guide exon-targeting CRISPR-Cas9 such as greatly reduced off-target effects, more restricted genomic editing, routine disruption of target gene mRNA expression and the ability to differentiate between closely related genes. Here we demonstrate the utility of this strategy by achieving selective knockdown of the highly homologous human genes FOXO3A and suspected pseudogene FOXO3B. We find the spJCRISPR strategy to efficiently and selectively disrupt FOXO3A and FOXO3B mRNA and protein expression; thus revealing that the human FOXO3B locus encodes a bona fide human gene. Unlike FOXO3A, we find the FOXO3B protein to be cytosolically localized in both the presence and absence of active Akt. The ability to selectively target and efficiently disrupt the expression of the closely-related FOXO3A and FOXO3B genes demonstrates the efficacy of the spJCRISPR approach. Copyright © 2018. Published by Elsevier B.V.

Identification of Genes Potentially Regulated by Human Polynucleotide Phosphorylase (hPNPaseold-35) Using Melanoma as a Model

PubMed Central

Sokhi, Upneet K.; Bacolod, Manny D.; Dasgupta, Santanu; Emdad, Luni; Das, Swadesh K.; Dumur, Catherine I.; Miles, Michael F.; Sarkar, Devanand; Fisher, Paul B.

2013-01-01

Human Polynucleotide Phosphorylase (hPNPaseold-35 or PNPT1) is an evolutionarily conserved 3′→5′ exoribonuclease implicated in the regulation of numerous physiological processes including maintenance of mitochondrial homeostasis, mtRNA import and aging-associated inflammation. From an RNase perspective, little is known about the RNA or miRNA species it targets for degradation or whose expression it regulates; except for c-myc and miR-221. To further elucidate the functional implications of hPNPaseold-35 in cellular physiology, we knocked-down and overexpressed hPNPaseold-35 in human melanoma cells and performed gene expression analyses to identify differentially expressed transcripts. Ingenuity Pathway Analysis indicated that knockdown of hPNPaseold-35 resulted in significant gene expression changes associated with mitochondrial dysfunction and cholesterol biosynthesis; whereas overexpression of hPNPaseold-35 caused global changes in cell-cycle related functions. Additionally, comparative gene expression analyses between our hPNPaseold-35 knockdown and overexpression datasets allowed us to identify 77 potential “direct” and 61 potential “indirect” targets of hPNPaseold-35 which formed correlated networks enriched for cell-cycle and wound healing functional association, respectively. These results provide a comprehensive database of genes responsive to hPNPaseold-35 expression levels; along with the identification new potential candidate genes offering fresh insight into cellular pathways regulated by PNPT1 and which may be used in the future for possible therapeutic intervention in mitochondrial- or inflammation-associated disease phenotypes. PMID:24143183

PABPN1 gene therapy for oculopharyngeal muscular dystrophy

PubMed Central

Malerba, A.; Klein, P.; Bachtarzi, H.; Jarmin, S. A.; Cordova, G.; Ferry, A.; Strings, V.; Espinoza, M. Polay; Mamchaoui, K.; Blumen, S. C.; St Guily, J. Lacau; Mouly, V.; Graham, M.; Butler-Browne, G.; Suhy, D. A.; Trollet, C.; Dickson, G.

2017-01-01

Oculopharyngeal muscular dystrophy (OPMD) is an autosomal dominant, late-onset muscle disorder characterized by ptosis, swallowing difficulties, proximal limb weakness and nuclear aggregates in skeletal muscles. OPMD is caused by a trinucleotide repeat expansion in the PABPN1 gene that results in an N-terminal expanded polyalanine tract in polyA-binding protein nuclear 1 (PABPN1). Here we show that the treatment of a mouse model of OPMD with an adeno-associated virus-based gene therapy combining complete knockdown of endogenous PABPN1 and its replacement by a wild-type PABPN1 substantially reduces the amount of insoluble aggregates, decreases muscle fibrosis, reverts muscle strength to the level of healthy muscles and normalizes the muscle transcriptome. The efficacy of the combined treatment is further confirmed in cells derived from OPMD patients. These results pave the way towards a gene replacement approach for OPMD treatment. PMID:28361972

Evaluation of amplification refractory mutation system (ARMS) technique for quick and accurate prenatal gene diagnosis of CHM variant in choroideremia.

PubMed

Yang, Lisha; Ijaz, Iqra; Cheng, Jingliang; Wei, Chunli; Tan, Xiaojun; Khan, Md Asaduzzaman; Fu, Xiaodong; Fu, Junjiang

2018-01-01

Choroideremia is a rare X-linked recessive inherited disorder that causes chorioretinal dystrophy leading to visual impairment in its early stages which finally causes total blindness in the affected person. It is caused due to mutations in the CHM gene. In this study, we have recruited a pedigree with choroideremia and detected a nonsense variant (c.C799T:p.R267X) in CHM of the proband (I:1). Different primer sets for amplification refractory mutation system (ARMS) were designed and PCR conditions were optimized. Then, we evaluated the sequence variant in the patient, carrier, and a fetus by using ARMS technique to identify if they inherited the pathogenic gene from parental generation; we used amniotic fluid DNA for the diagnosis of the gene in the fetus. The primer pairs, WT2+C and MT+C, amplified high specific products in different DNAs which were verified by Sanger sequencing. Based on our results, ARMS technique is fast, accurate, and reliable prenatal gene diagnostic tool to assess CHM variants. Taken together, our study indicates that ARMS technique can be used as a potential molecular tool in the diagnosis of prenatal mutation for choroideremia as well as other genetic diseases in undeveloped and developing countries, where there might be shortage of medical resources and supplies.

Aldolase B knockdown prevents high glucose-induced methylglyoxal overproduction and cellular dysfunction in endothelial cells.

PubMed

Liu, Jianghai; Mak, Timothy Chun-Ping; Banigesh, Ali; Desai, Kaushik; Wang, Rui; Wu, Lingyun

2012-01-01

We used cultured endothelial cells as a model to examine whether up-regulation of aldolase B and enhanced methylglyoxal (MG) formation play an important role in high glucose-induced overproduction of advanced glycosylation endproducts (AGEs), oxidative stress and cellular dysfunction. High glucose (25 mM) incubation up-regulated mRNA levels of aldose reductase (an enzyme converting glucose to fructose) and aldolase B (a key enzyme that catalyzes MG formation from fructose) and enhanced MG formation in human umbilical vein endothelial cells (HUVECs) and HUVEC-derived EA. hy926 cells. High glucose-increased MG production in EA. hy926 cells was completely prevented by siRNA knockdown of aldolase B, but unaffected by siRNA knockdown of aldolase A, an enzyme responsible for MG formation during glycolysis. In addition, inhibition of cytochrome P450 2E1 or semicarbazide-sensitive amine oxidase which produces MG during the metabolism of lipid and proteins, respectively, did not alter MG production. Both high glucose (25 mM) and MG (30, 100 µM) increased the formation of N(ε)-carboxyethyl-lysine (CEL, a MG-induced AGE), oxidative stress (determined by the generation of oxidized DCF, H(2)O(2), protein carbonyls and 8-oxo-dG), O-GlcNAc modification (product of the hexosamine pathway), membrane protein kinase C activity and nuclear translocation of NF-κB in EA. hy926 cells. However, the above metabolic and signaling alterations induced by high glucose were completely prevented by knockdown of aldolase B and partially by application of aminoguanidine (a MG scavenger) or alagebrium (an AGEs breaker). In conclusion, efficient inhibition of aldolase B can prevent high glucose-induced overproduction of MG and related cellular dysfunction in endothelial cells.

RNAi-Mediated Knockdown of vATPase Subunits Affects Survival and Reproduction of Bed Bugs (Hemiptera: Cimicidae).

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-04

The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) has resurged as one of the most troublesome household pests affecting people across the globe. Bed bug infestations have increased in recent years primarily due to the evolution of insecticide resistance and the insect's ability to hitchhike with travelers. vATPases are one of the most evolutionarily conserved holoenzymes in eukaryotes, which are mainly involved in proton transport across the plasma membranes and intracellular organelles. RNA interference (RNAi) has been developed as a promising tool for insect control. In this study, we used RNAi as an approach to knock down subunits A and E of the vATPase gene of bed bugs. Delivery of 0.2 µg/insect of dsRNA specific to vATPase-A and vATPase-E into female bed bugs dramatically impaired the laying and viability of eggs over time. Injection of the vATPase-E dsRNA decreased survival of the bed bugs over 30 d. Our results also showed that the knockdown of mRNA is highly effective and persistent up to 30 d post injection. This research demonstrated that silencing of the two vATPase subunits A and E offers a potential strategy to suppress bed bug populations.

Gene silencing using the recessive rice bacterial blight resistance gene xa13 as a new paradigm in plant breeding.

PubMed

Li, Changyan; Wei, Jing; Lin, Yongjun; Chen, Hao

2012-05-01

Resistant germplasm resources are valuable for developing resistant varieties in agricultural production. However, recessive resistance genes are usually overlooked in hybrid breeding. Compared with dominant traits, however, they may confer resistance to different pathogenic races or pest biotypes with different mechanisms of action. The recessive rice bacterial blight resistance gene xa13, also involved in pollen development, has been cloned and its resistance mechanism has been recently characterized. This report describes the conversion of bacterial blight resistance mediated by the recessive xa13 gene into a dominant trait to facilitate its use in a breeding program. This was achieved by knockdown of the corresponding dominant allele Xa13 in transgenic rice using recently developed artificial microRNA technology. Tissue-specific promoters were used to exclude most of the expression of artificial microRNA in the anther to ensure that Xa13 functioned normally during pollen development. A battery of highly bacterial blight resistant transgenic plants with normal seed setting rates were acquired, indicating that highly specific gene silencing had been achieved. Our success with xa13 provides a paradigm that can be adapted to other recessive resistance genes.

Intramyocardial Injection of siRNAs Can Efficiently Establish Myocardial Tissue-Specific Renalase Knockdown Mouse Model.

PubMed

Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili

2016-01-01

Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.

Effects of Buckling Knockdown Factor, Internal Pressure and Material on the Design of Stiffened Cylinders

NASA Technical Reports Server (NTRS)

Lovejoy, Andrew E.; Hilburger, Mark W.; Chunchu, Prasad B.

2010-01-01

A design study was conducted to investigate the effect shell buckling knockdown factor (SBKF), internal pressure and aluminum alloy material selection on the structural weight of stiffened cylindrical shells. Two structural optimization codes were used for the design study to determine the optimum minimum-weight design for a series of design cases, and included an in-house developed genetic algorithm (GA) code and PANDA2. Each design case specified a unique set of geometry, material, knockdown factor combinations and loads. The resulting designs were examined and compared to determine the effects of SBKF, internal pressure and material selection on the acreage design weight and controlling failure mode. This design study shows that use of less conservative SBKF values, including internal pressure, and proper selection of material alloy can result in significant weight savings for stiffened cylinders. In particular, buckling-critical cylinders with integrally machined stiffener construction can benefit from the use of thicker plate material that enables taller stiffeners, even when the stiffness, strength and density properties of these materials appear to be inferior.

Design of 8-ft-Diameter Barrel Test Article Attachment Rings for Shell Buckling Knockdown Factor Project

NASA Technical Reports Server (NTRS)

Lovejoy, Andrew E.; Hilburger, Mark W.

2010-01-01

The Shell Buckling Knockdown Factor (SBKF) project includes the testing of sub-scale cylinders to validate new shell buckling knockdown factors for use in the design of the Ares-I and Ares-V launch vehicles. Test article cylinders represent various barrel segments of the Ares-I and Ares-V vehicles, and also include checkout test articles. Testing will be conducted at Marshall Space Flight Center (MSFC) for test articles having an eight-foot diameter outer mold line (OML) and having lengths that range from three to ten feet long. Both ends of the test articles will be connected to the test apparatus using attachment rings. Three multiple-piece and one single-piece design for the attachment rings were developed and analyzed. The single-piece design was chosen and will be fabricated from either steel or aluminum (Al) depending on the required safety factors (SF) for test hardware. This report summarizes the design and analysis of these attachment ring concepts.

Knockdown of Ice-Binding Proteins in Brachypodium distachyon Demonstrates Their Role in Freeze Protection.

PubMed

Bredow, Melissa; Vanderbeld, Barbara; Walker, Virginia K

2016-01-01

Sub-zero temperatures pose a major threat to the survival of cold-climate perennials. Some of these freeze-tolerant plants produce ice-binding proteins (IBPs) that offer frost protection by restricting ice crystal growth and preventing expansion-induced lysis of the plasma membranes. Despite the extensive in vitro characterization of such proteins, the importance of IBPs in the freezing stress response has not been investigated. Using the freeze-tolerant grass and model crop, Brachypodium distachyon, we characterized putative IBPs (BdIRIs) and generated the first 'IBP-knockdowns'. Seven IBP sequences were identified and expressed in Escherichia coli, with all of the recombinant proteins demonstrating moderate to high levels of ice-recrystallization inhibition (IRI) activity, low levels of thermal hysteresis (TH) activity (0.03-0.09°C at 1 mg/mL) and apparent adsorption to ice primary prism planes. Following plant cold acclimation, IBPs purified from wild-type B. distachyon cell lysates similarly showed high levels of IRI activity, hexagonal ice-shaping, and low levels of TH activity (0.15°C at 0.5 mg/mL total protein). The transfer of a microRNA construct to wild-type plants resulted in the attenuation of IBP activity. The resulting knockdown mutant plants had reduced ability to restrict ice-crystal growth and a 63% reduction in TH activity. Additionally, all transgenic lines were significantly more vulnerable to electrolyte leakage after freezing to -10°C, showing a 13-22% increase in released ions compared to wild-type. IBP-knockdown lines also demonstrated a significant decrease in viability following freezing to -8°C, with some lines showing only two-thirds the survival seen in control lines. These results underscore the vital role IBPs play in the development of a freeze-tolerant phenotype and suggests that expression of these proteins in frost-susceptible plants could be valuable for the production of more winter-hardy crops.

More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

PubMed Central

Ladunga, Istvan

2007-01-01

Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

PRX1 knockdown potentiates vitamin K3 toxicity in cancer cells: a potential new therapeutic perspective for an old drug.

PubMed

He, Tiantian; Hatem, Elie; Vernis, Laurence; Lei, Ming; Huang, Meng-Er

2015-12-21

Many promising anticancer molecules are abandoned during the course from bench to bedside due to lack of clear-cut efficiency and/or severe side effects. Vitamin K3 (vitK3) is a synthetic naphthoquinone exhibiting significant in vitro and in vivo anticancer activity against multiple human cancers, and has therapeutic potential when combined with other anticancer molecules. The major mechanism for the anticancer activity of vitK3 is the generation of cytotoxic reactive oxygen species (ROS). We thus reasoned that a rational redox modulation of cancer cells could enhance vitK3 anticancer efficiency. Cancer cell lines with peroxiredoxin 1 (PRX1) gene transiently or stably knocked-down and corresponding controls were exposed to vitK3 as well as a set of anticancer molecules, including vinblastine, taxol, doxorubicin, daunorubicin, actinomycin D and 5-fluorouracil. Cytotoxic effects and cell death events were evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-based assay, cell clonogenic assay, measurement of mitochondrial membrane potential and annexin V/propidium iodide double staining. Global ROS accumulation and compartment-specific H2O2 generation were determined respectively by a redox-sensitive chemical probe and H2O2-sensitive sensor HyPer. Oxidation of endogenous antioxidant proteins including TRX1, TRX2 and PRX3 was monitored by redox western blot. We observed that the PRX1 knockdown in HeLa and A549 cells conferred enhanced sensitivity to vitK3, reducing substantially the necessary doses to kill cancer cells. The same conditions (combination of vitK3 and PRX1 knockdown) caused little cytotoxicity in non-cancerous cells, suggesting a cancer-cell-selective property. Increased ROS accumulation had a crucial role in vitK3-induced cell death in PRX1 knockdown cells. The use of H2O2-specific sensors HyPer revealed that vitK3 lead to immediate accumulation of H2O2 in the cytosol, nucleus, and mitochondrial matrix. PRX1 silencing

GCN-2 dependent inhibition of protein synthesis activates osmosensitive gene transcription via WNK and Ste20 kinase signaling

PubMed Central

Lee, Elaine Choung-Hee

2012-01-01

Increased gpdh-1 transcription is required for accumulation of the organic osmolyte glycerol and survival of Caenorhabditis elegans during hypertonic stress. Our previous work has shown that regulators of gpdh-1 (rgpd) gene knockdown constitutively activates gpdh-1 expression. Fifty-five rgpd genes play essential roles in translation suggesting that inhibition of protein synthesis is an important signal for regulating osmoprotective gene transcription. We demonstrate here that translation is reduced dramatically by hypertonic stress or knockdown of rgpd genes encoding aminoacyl-tRNA synthetases and eukaryotic translation initiation factors (eIFs). Toxin-induced inhibition of translation also activates gpdh-1 expression. Hypertonicity-induced translation inhibition is mediated by general control nonderepressible (GCN)-2 kinase signaling and eIF-2α phosphoryation. Loss of gcn-1 or gcn-2 function prevents eIF-2α phosphorylation, completely blocks reductions in translation, and inhibits gpdh-1 transcription. gpdh-1 expression is regulated by the highly conserved with-no-lysine kinase (WNK) and Ste20 kinases WNK-1 and GCK-3, which function in the GCN-2 signaling pathway downstream from eIF-2α phosphorylation. Our previous work has shown that hypertonic stress causes rapid and dramatic protein damage in C. elegans and that inhibition of translation reduces this damage. The current studies demonstrate that reduced translation also serves as an essential signal for activation of WNK-1/GCK-3 kinase signaling and subsequent transcription of gpdh-1 and possibly other osmoprotective genes. PMID:23076791

A High-Throughput Method for Direct Detection of Therapeutic Oligonucleotide-Induced Gene Silencing In Vivo

PubMed Central

Coles, Andrew H.; Osborn, Maire F.; Alterman, Julia F.; Turanov, Anton A.; Godinho, Bruno M.D.C.; Kennington, Lori; Chase, Kathryn; Aronin, Neil

2016-01-01

Preclinical development of RNA interference (RNAi)-based therapeutics requires a rapid, accurate, and robust method of simultaneously quantifying mRNA knockdown in hundreds of samples. The most well-established method to achieve this is quantitative real-time polymerase chain reaction (qRT-PCR), a labor-intensive methodology that requires sample purification, which increases the potential to introduce additional bias. Here, we describe that the QuantiGene® branched DNA (bDNA) assay linked to a 96-well Qiagen TissueLyser II is a quick and reproducible alternative to qRT-PCR for quantitative analysis of mRNA expression in vivo directly from tissue biopsies. The bDNA assay is a high-throughput, plate-based, luminescence technique, capable of directly measuring mRNA levels from tissue lysates derived from various biological samples. We have performed a systematic evaluation of this technique for in vivo detection of RNAi-based silencing. We show that similar quality data is obtained from purified RNA and tissue lysates. In general, we observe low intra- and inter-animal variability (around 10% for control samples), and high intermediate precision. This allows minimization of sample size for evaluation of oligonucleotide efficacy in vivo. PMID:26595721

Reactivation of maternal SNORD116 cluster via SETDB1 knockdown in Prader-Willi syndrome iPSCs

PubMed Central

Cruvinel, Estela; Budinetz, Tara; Germain, Noelle; Chamberlain, Stormy; Lalande, Marc; Martins-Taylor, Kristen

2014-01-01

Prader-Willi syndrome (PWS), a disorder of genomic imprinting, is characterized by neonatal hypotonia, hypogonadism, small hands and feet, hyperphagia and obesity in adulthood. PWS results from the loss of paternal copies of the cluster of SNORD116 C/D box snoRNAs and their host transcript, 116HG, on human chromosome 15q11-q13. We have investigated the mechanism of repression of the maternal SNORD116 cluster and 116HG. Here, we report that the zinc-finger protein ZNF274, in association with the histone H3 lysine 9 (H3K9) methyltransferase SETDB1, is part of a complex that binds to the silent maternal but not the active paternal alleles. Knockdown of SETDB1 in PWS-specific induced pluripotent cells (iPSCs) causes a decrease in the accumulation of H3K9 trimethylation (H3K9me3) at 116HG and corresponding accumulation of the active chromatin mark histone H3 lysine 4 dimethylation (H3K4me2). We also show that upon knockdown of SETDB1 in PWS-specific iPSCs, expression of maternally silenced 116HG RNA is partially restored. SETDB1 knockdown in PWS iPSCs also disrupts DNA methylation at the PWS-IC where a decrease in 5-methylcytosine is observed in association with a concomitant increase in 5-hydroxymethylcytosine. This observation suggests that the ZNF274/SETDB1 complex bound to the SNORD116 cluster may protect the PWS-IC from DNA demethylation during early development. Our findings reveal novel epigenetic mechanisms that function to repress the maternal 15q11-q13 region. PMID:24760766

Knock-down and speed of kill of a combination of fipronil and permethrin for the prevention of Ctenocephalides felis flea infestation in dogs.

PubMed

Halos, Lénaïg; Fourie, Josephus J; Fankhauser, Becky; Beugnet, Frederic

2016-02-02

A topical combination of fipronil + permethrin (Frontline Tri-Act/Frontect, Merial) has recently been developed to control fleas, ticks, mosquitoes, sandflies and stable flies on dogs. Two studies were conducted to assess its speed of kill and knock-down effect on Ctenocephalides felis fleas. The combination was compared to either fipronil alone or to a combination of permethrin, dinotefuran, and pyriproxyfen, In each study, 18 dogs were randomly allocated to one of three groups: (Group 1: untreated dog; Group 2: treated once on D0 with the combination of fipronil and permethrin; Group 3: treated once on D0 either with fipronil alone (study 1) or with a combination of permethrin, dinetofuran and pyriproxyfen (study 2)). Each dog was infested with 100 unfed adult C. felis fleas on Days 2 (study 2), 7, 14, 21 and 28. Fleas were collected from dogs at 1 h and 12 h post- infestations (PI) (study 1) or at 2 h and 6 h PI (study 2) to assess efficacy and from collection pans underneath cages 1 h (study 1) or 5 min (study 2) PI to assess knock-down effect. All treated dogs had significantly (p ≤ 0.01) lower flea counts than untreated dogs at every time point in both studies. For a whole month, a significant knock-down effect against infesting fleas is obtained in five minutes PI with the combination of permethrin and fipronil. Complete efficacy (>95%) was achieved in 1 h (study 1) or 2 h (study 2) PI for 14 days and by 6 h PI for all challenges conducted throughout the month. Efficacy remains >85% at 2 h PI for the whole month. A significantly higher efficacy of the fipronil + permethrin combination compared to other treatments was demonstrated at the earliest time points for the month (1 h knock-down effect and insecticidal efficacy compared to fipronil alone; 5 min knock-down effect compared to the combination of permethrin + dinetofuran + pyriproxyfen). The rapid flea knock-down effect and speed of kill demonstrated by the spot on combination of

Vector delivery technique affects gene transfer in the cornea in vivo.

PubMed

Mohan, Rajiv R; Sharma, Ajay; Cebulko, Tyler C; Tandon, Ashish

2010-11-27

or 30 s air-dried corneas showed insignificant CD11b-positive cells compared to control corneas. Controlled corneal drying with hair dryer increases vector absorption significantly. The dispensing of efficacious AAV serotype into cornea with optimized minimally invasive topical application technique could provide high and targeted expression of therapeutic genes in the stroma in vivo without causing significant side effects.

Using RNAi in C. "elegans" to Demonstrate Gene Knockdown Phenotypes in the Undergraduate Biology Lab Setting

ERIC Educational Resources Information Center

Roy, Nicole M.

2013-01-01

RNA interference (RNAi) is a powerful technology used to knock down genes in basic research and medicine. In 2006 RNAi technology using "Caenorhabditis elegans" ("C. elegans") was awarded the Nobel Prize in medicine and thus students graduating in the biological sciences should have experience with this technology. However,…

Raman spectroscopic study of keratin 8 knockdown oral squamous cell carcinoma derived cells

NASA Astrophysics Data System (ADS)

Singh, S. P.; Alam, Hunain; Dmello, Crismita; Vaidya, Milind M.; Krishna, C. Murali

2012-03-01

Keratins are one of most widely used markers for oral cancers. Keratin 8 and 18 are expressed in simple epithelia and perform both mechanical and regulatory functions. Their expression are not seen in normal oral tissues but are often expressed in oral squamous cell carcinoma. Aberrant expression of keratins 8 and 18 is most common change in human oral cancer. Optical-spectroscopic methods are sensitive to biochemical changes and being projected as novel diagnostic tools for cancer diagnosis. Aim of this study was to evaluate potentials of Raman spectroscopy in detecting minor changes associated with differential level of keratin expression in tongue-cancer-derived AW13516 cells. Knockdown clones for K8 were generated and synchronized by growing under serum-free conditions. Cell pellets of three independent experiments in duplicate were used for recording Raman spectra with fiberoptic-probe coupled HE-785 Raman-instrument. A total of 123 and 96 spectra from knockdown clones and vector controls respectively in 1200-1800 cm-1 region were successfully utilized for classification using LDA. Two separate clusters with classification-efficiency of ~95% were obtained. Leave-one-out cross-validation yielded ~63% efficiency. Findings of the study demonstrate the potentials of Raman spectroscopy in detecting even subtle changes such as variations in keratin expression levels. Future studies towards identifying Raman signals from keratin in oral cells can help in precise cancer diagnosis.

Steroid Receptor Coactivator-1 Knockdown Decreases Synaptic Plasticity and Impairs Spatial Memory in the Hippocampus of Mice.

PubMed

Bian, Chen; Huang, Yan; Zhu, Haitao; Zhao, Yangang; Zhao, Jikai; Zhang, Jiqiang

2018-05-01

Steroids have been demonstrated to play profound roles in the regulation of hippocampal function by acting on their receptors, which need coactivators for their transcriptional activities. Previous studies have shown that steroid receptor coactivator-1 (SRC-1) is the predominant coactivator in the hippocampus, but its exact role and the underlying mechanisms remain unclear. In this study, we constructed SRC-1 RNA interference (RNAi) lentiviruses, injected them into the hippocampus of male mice, and then examined the changes in the expression of selected synaptic proteins, CA1 synapse density, postsynaptic density (PSD) thickness, and in vivo long-term potentiation (LTP). Spatial learning and memory behavior changes were investigated using the Morris water maze. We then transfected the lentiviruses into cultured hippocampal cells and examined the changes in synaptic protein and phospho-cyclic AMP response element-binding protein (pCREB) expression. The in vivo results showed that SRC-1 knockdown significantly decreased the expression of synaptic proteins and CA1 synapse density as well as PSD thickness; SRC-1 knockdown also significantly impaired in vivo LTP and disrupted spatial learning and memory. The in vitro results showed that while the expression of synaptic proteins was significantly decreased by SRC-1 knockdown, pCREB expression was also significantly decreased. The above results suggest a pivotal role of SRC-1 in the regulation of hippocampal synaptic plasticity and spatial learning and memory, strongly indicating SRC-1 may serve as a novel therapeutic target for hippocampus-dependent memory disorders. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Depletion of autophagy receptor p62/SQSTM1 enhances the efficiency of gene delivery in mammalian cells.

PubMed

Tsuchiya, Megumi; Ogawa, Hidesato; Koujin, Takako; Kobayashi, Shouhei; Mori, Chie; Hiraoka, Yasushi; Haraguchi, Tokuko

2016-08-01

Novel methods that increase the efficiency of gene delivery to cells will have many useful applications. Here, we report a simple approach involving depletion of p62/SQSTM1 to enhance the efficiency of gene delivery. The efficiency of reporter gene delivery was remarkably higher in p62-knockout murine embryonic fibroblast (MEF) cells compared with normal MEF cells. This higher efficiency was partially attenuated by ectopic expression of p62. Furthermore, siRNA-mediated knockdown of p62 clearly increased the efficiency of transfection of murine embryonic stem (mES) cells and human HeLa cells. These data indicate that p62 acts as a key regulator of gene delivery. © 2016 Federation of European Biochemical Societies.

Partial redundancy and functional specialization of E-class SEPALLATA genes in an early-diverging eudicot.

PubMed

Soza, Valerie L; Snelson, Corey D; Hewett Hazelton, Kristen D; Di Stilio, Verónica S

2016-11-01

Plant MADS-box genes have duplicated extensively, allegedly contributing to the immense diversity of floral form in angiosperms. In Arabidopsis thaliana (a core eudicot model plant), four SEPALLATA (SEP) genes comprise the E-class from the extended ABCE model of flower development. They are redundantly involved in the development of the four types of floral organs (sepals, petals, stamens and carpels) and in floral meristem determinacy. E-class genes have been examined in other core eudicots and monocots, but have been less investigated in non-core eudicots. Our goal was to functionally characterize the E-class genes in the early-diverging eudicot Thalictrum thalictroides (Ranunculaceae), whose flowers are apetalous. We identified four SEP orthologs, which when placed in a phylogenetic context, resulted from a major gene duplication event before the origin of angiosperms and a subsequent duplication at the origin of the Ranunculales. We used Virus-Induced Gene Silencing (VIGS) to down-regulate the three expressed paralogs individually and in combination to investigate their function and to determine the degree of conservation versus divergence of this important plant transcription factor. All loci were partially redundant in sepal and stamen identity and in promoting petaloidy of sepals, yet the SEP3 ortholog had a more pronounced role in carpel identity and development. The two other paralogs appear to have subfunctionalized in their cadastral roles to keep the boundaries between either sepal and stamen zones or stamen and carpel zones. Double knockdowns had enhanced phenotypes and the triple knockdown had an even more severe phenotype that included partial to complete homeotic conversion of stamens and carpels to sepaloid organs and green sepals, highlighting a role of E-class genes in petaloidy of sepals in this species. While no floral meristem determinacy defects were observed, this could be due to residual amounts of gene expression in the VIGS experiments

Thyroid hormone and COUP-TF1 regulate kallikrein-binding protein (KBP) gene expression.

PubMed

Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen; Brent, Gregory A

2011-03-01

Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T(3) and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5' flanking region (-53 to -29) and nTRE2, located in the first intron (104-132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T(3). COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T(3) repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T(3). Nuclear corepressor knockdown resulted in loss of T(3) repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T(3) induction of positive thyroid hormone response elements, reverses T(3) repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T(3) and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T(3).

Thyroid Hormone and COUP-TF1 Regulate Kallikrein-Binding Protein (KBP) Gene Expression

PubMed Central

Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen

2011-01-01

Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T3 and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5′ flanking region (−53 to −29) and nTRE2, located in the first intron (104–132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T3. COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T3 repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T3. Nuclear corepressor knockdown resulted in loss of T3 repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T3 induction of positive thyroid hormone response elements, reverses T3 repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T3 and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T3. PMID:21266512

Knockdown of hypocretin attenuates extended access of cocaine self-administration in rats.

PubMed

Schmeichel, Brooke E; Matzeu, Alessandra; Koebel, Pascale; Vendruscolo, Leandro F; Sidhu, Harpreet; Shahryari, Roxana; Kieffer, Brigitte L; Koob, George F; Martin-Fardon, Rémi; Contet, Candice

2018-04-06

The hypocretin/orexin (HCRT) neuropeptide system regulates feeding, arousal state, stress responses, and reward, especially under conditions of enhanced motivational relevance. In particular, HCRT neurotransmission facilitates drug-seeking behavior in circumstances that demand increased effort and/or motivation to take the drug. The present study used a shRNA-encoding adeno-associated viral vector to knockdown Hcrt expression throughout the dorsal hypothalamus in adult rats and determine the role of HCRT in cocaine self-administration. Chronic Hcrt silencing did not impact cocaine self-administration under short-access conditions, but robustly attenuated cocaine intake under extended access conditions, a model that mimics key features of compulsive cocaine taking. In addition, Hcrt silencing decreased motivation for both cocaine and a highly palatable food reward (i.e., sweetened condensed milk; SCM) under a progressive ratio schedule of reinforcement, but did not alter responding for SCM under a fixed ratio schedule. Importantly, Hcrt silencing did not affect food or water consumption, and had no consequence for general measures of arousal and stress reactivity. At the molecular level, chronic Hcrt knockdown reduced the number of neurons expressing dynorphin (DYN), and to a smaller extent melanin-concentrating hormone (MCH), in the dorsal hypothalamus. These original findings support the hypothesis that HCRT neurotransmission promotes operant responding for both drug and non-drug rewards, preferentially under conditions requiring a high degree of motivation. Furthermore, the current study provides compelling evidence for the involvement of the HCRT system in cocaine self-administration also under low-effort conditions in rats allowed extended access, possibly via functional interactions with DYN and MCH signaling.

Confusion, knock-down and kill of Aedes aegypti using metofluthrin in domestic settings: a powerful tool to prevent dengue transmission?

PubMed Central

2013-01-01

Background Dengue control methods are reliant upon control of the vector, primarily Aedes aegypti. Current adulticiding methods in North Queensland include treating premises with residual synthetic pyrethroid insecticides (interior residual spraying; IRS), a laborious, intrusive task. The vapor active synthetic pyrethroid metofluthrin might offer an efficient alternative as some studies indicate that it prevents biting and has strong knockdown effects. However, its expellant and/or irritant effects, longevity, residual activity and the speed with which biting behavior is disrupted have not yet been characterized. Methods We exposed cohorts of Cairns colony (F2-4) Ae. aegypti to rooms (17–24 m3) treated with 5% and 10% AI metofluthrin emanators. Using free-flying and caged populations we measured biting (human landing rate), expulsion through unscreened windows, knockdown and death over periods ranging between a few minutes and 24 hrs. Observations of the behavior of single female Ae. aegypti exposed to metofluthrin were also made. Results Female Ae. aegypti exposed to 5% or 10% metofluthrin formulations were almost entirely inhibited from biting. This was the result of rapid knockdown and mortality (80-90% in less than one hour) and to the behavioral impacts of exposure that, within minutes, caused female Ae. aegypti to become disoriented, stop landing on hosts, and seek resting sites. Exposed mosquitoes did not exhibit any increased propensity to exit treated rooms and the 10% AI resin remained fully active for at least 20 days. Conclusion The new, high-dose, resin formulations of metofluthrin act quickly to prevent biting and to knockdown and kill free-flying female Ae. aegypti in our experimental rooms. There was no evidence that metofluthrin induced escape from treated areas. Resin-based metofluthrin emanators show great potential as a replacement for labor intensive IRS for dengue vector control. PMID:24025232

Sqstm1 knock-down causes a locomotor phenotype ameliorated by rapamycin in a zebrafish model of ALS/FTLD.

PubMed

Lattante, Serena; de Calbiac, Hortense; Le Ber, Isabelle; Brice, Alexis; Ciura, Sorana; Kabashi, Edor

2015-03-15

Mutations in SQSTM1, encoding for the protein SQSTM1/p62, have been recently reported in 1-3.5% of patients with amyotrophic lateral sclerosis and frontotemporal lobar degeneration (ALS/FTLD). Inclusions positive for SQSTM1/p62 have been detected in patients with neurodegenerative disorders, including ALS/FTLD. In order to investigate the pathogenic mechanisms induced by SQSTM1 mutations in ALS/FTLD, we developed a zebrafish model. Knock-down of the sqstm1 zebrafish ortholog, as well as impairment of its splicing, led to a specific phenotype, consisting of behavioral and axonal anomalies. Here, we report swimming deficits associated with shorter motor neuronal axons that could be rescued by the overexpression of wild-type human SQSTM1. Interestingly, no rescue of the loss-of-function phenotype was observed when overexpressing human SQSTM1 constructs carrying ALS/FTLD-related mutations. Consistent with its role in autophagy regulation, we found increased mTOR levels upon knock-down of sqstm1. Furthermore, treatment of zebrafish embryos with rapamycin, a known inhibitor of the mTOR pathway, yielded an amelioration of the locomotor phenotype in the sqstm1 knock-down model. Our results suggest that loss-of-function of SQSTM1 causes phenotypic features characterized by locomotor deficits and motor neuron axonal defects that are associated with a misregulation of autophagic processes. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression.

PubMed

Wang, Lixin; Brugge, Joan S; Janes, Kevin A

2011-10-04

Gene expression networks are complicated by the assortment of regulatory factors that bind DNA and modulate transcription combinatorially. Single-cell measurements can reveal biological mechanisms hidden by population averages, but their value has not been fully explored in the context of mRNA regulation. Here, we adapted a single-cell expression profiling technique to examine the gene expression program downstream of Forkhead box O (FOXO) transcription factors during 3D breast epithelial acinar morphogenesis. By analyzing patterns of mRNA fluctuations among individual matrix-attached epithelial cells, we found that a subset of FOXO target genes was jointly regulated by the transcription factor Runt-related transcription factor 1 (RUNX1). Knockdown of RUNX1 causes hyperproliferation and abnormal morphogenesis, both of which require normal FOXO function. Down-regulating RUNX1 and FOXOs simultaneously causes widespread oxidative stress, which arrests proliferation and restores normal acinar morphology. In hormone-negative breast cancers lacking human epidermal growth factor receptor 2 (HER2) amplification, we find that RUNX1 down-regulation is strongly associated with up-regulation of FOXO1, which may be required to support growth of RUNX1-negative tumors. The coordinate function of these two tumor suppressors may provide a failsafe mechanism that inhibits cancer progression.

Stable knock-down of the sphingosine 1-phosphate receptor S1P1 influences multiple functions of human endothelial cells.

PubMed

Krump-Konvalinkova, Vera; Yasuda, Satoshi; Rubic, Tina; Makarova, Natalia; Mages, Jörg; Erl, Wolfgang; Vosseler, Claudia; Kirkpatrick, C James; Tigyi, Gabor; Siess, Wolfgang

2005-03-01

Sphingosine 1-phosphate (S1P) is a bioactive phospholipid acting both as a ligand for the G protein-coupled receptors S1P1-5 and as a second messenger. Because S1P1 knockout is lethal in the transgenic mouse, an alternative approach to study the function of S1P1 in endothelial cells is needed. All human endothelial cells analyzed expressed abundant S1P1 transcripts. We permanently silenced (by RNA interference) the expression of S1P1 in the human endothelial cell lines AS-M.5 and ISO-HAS.1. The S1P1 knock-down cells manifested a distinct morphology and showed neither actin ruffles in response to S1P nor an angiogenic reaction. In addition, these cells were more sensitive to oxidant stress-mediated injury. New S1P1-dependent gene targets were identified in human endothelial cells. S1P1 silencing decreased the expression of platelet-endothelial cell adhesion molecule-1 and VE-cadherin and abolished the induction of E-selectin after cell stimulation with lipopolysaccharide or tumor necrosis factor-alpha. Microarray analysis revealed downregulation of further endothelial specific transcripts after S1P1 silencing. Long-term silencing of S1P1 enabled us for the first time to demonstrate the involvement of S1P1 in key functions of endothelial cells and to identify new S1P1-dependent gene targets.

Fundamental study of detection of muscle hypertrophy-oriented gene doping by myostatin knock down using RNA interference.

PubMed

Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

2012-01-01

To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.

Fundamental Study of Detection of Muscle Hypertrophy-Oriented Gene Doping by Myostatin Knock Down Using RNA Interference

PubMed Central

Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

2012-01-01

To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray. PMID:24149203

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

PubMed

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

PubMed Central

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

Knockdown of versican 1 blocks cigarette-induced loss of insoluble elastin in human lung fibroblasts.

PubMed

Xu, Lu-lu; Lu, Yun-tao; Zhang, Jing; Wu, Lian; Merrilees, Mervyn J; Qu, Jie-ming

2015-08-15

COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown of V1, and add-back of CS, on CCL-210 lung fibroblasts treated with cigarette smoke extract (CSE) as a model for COPD. CSE inhibited fibroblast proliferation, viability, tropoelastin synthesis, and elastin deposition, and increased V1 synthesis and secretion. V1 siRNA decreased V1 and constituent CS, did not affect tropoelastin production, but blocked the CSE-induced loss in insoluble elastin. Exogenous CS reduced insoluble elastin, even in the presence of V1 siRNA. These findings confirm that V1 and CS impair the assembly of tropoelastin monomers into insoluble fibers, and further demonstrate that specific knockdown of V1 alleviates the impaired assembly of elastin seen in cultures of pulmonary fibroblasts exposed to CSE, indicating a regulatory role for this protein in the pathophysiology of COPD. Copyright © 2015 Elsevier B.V. All rights reserved.

The BTB and CNC homology 1 (BACH1) target genes are involved in the oxidative stress response and in control of the cell cycle.

PubMed

Warnatz, Hans-Jörg; Schmidt, Dominic; Manke, Thomas; Piccini, Ilaria; Sultan, Marc; Borodina, Tatiana; Balzereit, Daniela; Wruck, Wasco; Soldatov, Alexey; Vingron, Martin; Lehrach, Hans; Yaspo, Marie-Laure

2011-07-01

The regulation of gene expression in response to environmental signals and metabolic imbalances is a key step in maintaining cellular homeostasis. BTB and CNC homology 1 (BACH1) is a heme-binding transcription factor repressing the transcription from a subset of MAF recognition elements at low intracellular heme levels. Upon heme binding, BACH1 is released from the MAF recognition elements, resulting in increased expression of antioxidant response genes. To systematically address the gene regulatory networks involving BACH1, we combined chromatin immunoprecipitation sequencing analysis of BACH1 target genes in HEK 293 cells with knockdown of BACH1 using three independent types of small interfering RNAs followed by transcriptome profiling using microarrays. The 59 BACH1 target genes identified by chromatin immunoprecipitation sequencing were found highly enriched in genes showing expression changes after BACH1 knockdown, demonstrating the impact of BACH1 repression on transcription. In addition to known and new BACH1 targets involved in heme degradation (HMOX1, FTL, FTH1, ME1, and SLC48A1) and redox regulation (GCLC, GCLM, and SLC7A11), we also discovered BACH1 target genes affecting cell cycle and apoptosis pathways (ITPR2, CALM1, SQSTM1, TFE3, EWSR1, CDK6, BCL2L11, and MAFG) as well as subcellular transport processes (CLSTN1, PSAP, MAPT, and vault RNA). The newly identified impact of BACH1 on genes involved in neurodegenerative processes and proliferation provides an interesting basis for future dissection of BACH1-mediated gene repression in neurodegeneration and virus-induced cancerogenesis.

Sall2 knockdown exacerbates palmitic acid induced dysfunction and apoptosis of pancreatic NIT-1 beta cells.

PubMed

Wang, Ye; Liu, Jie; Liu, Zheng; Chen, Jing; Hu, Xuemei; Hu, Yimeng; Yuan, Yin; Wu, Guijun; Dai, Zhe; Xu, Yancheng

2018-05-18

Spalt-like (Sall) proteins are a class of transcription factors. The role of Sall2 in beta cells remain poorly understood. Here, we aimed to explore whether Sall2 involved in lipotoxicity-mediated dysfunction and apoptosis in pancreatic NIT-1 beta cells. Our results showed that high concentrations of palmitic acid (PA) led to impaired cell viability and decreased Sall2 expression in NIT-1 cells. Knocking down of Sall2 in NIT-1 cells resulted in increased sensitivity to lipotoxicity and caused higher rates of cell apoptosis following PA treatment. Additionally, Sall2 Knockdown impaired insulin synthesis and secretion in response to glucose. Further research indicated Sall2 knockdown attenuate antioxidant capacity and decreased expression level of Peroxiredoxin 2 in NIT-1 cells. These finding implicate that Sall2 may play a significant role in NIT-1 cell function and cell apoptosis under lipotoxic conditions. Therefore, the study of Sall2 in NIT-1 cells provided a new perspective for molecular mechanism of lipotoxicity mediating dysfunction and apoptosis of beta cells. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

NHR-23 dependent collagen and hedgehog-related genes required for molting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kouns, Nathaniel A.; Nakielna, Johana; Behensky, Frantisek

2011-10-07

Highlights: {yields} NHR-23 is a critical regulator of nematode development and molting. {yields} The manuscript characterizes the loss-of-function phenotype of an nhr-23 mutant. {yields} Whole genome expression analysis identifies new potential targets of NHR-23. {yields} Hedgehog-related genes are identified as NHR-23 dependent genes. {yields} New link between sterol mediated signaling and regulation by NHR-23 is found. -- Abstract: NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparativemore » expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa.« less

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

PubMed

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Knockdown of Pentraxin 3 suppresses tumorigenicity and metastasis of human cervical cancer cells.

PubMed

Ying, Tsung-Ho; Lee, Chien-Hsing; Chiou, Hui-Ling; Yang, Shun-Fa; Lin, Chu-Liang; Hung, Chia-Hung; Tsai, Jen-Pi; Hsieh, Yi-Hsien

2016-07-05

Pentraxin 3 (PTX3) as an inflammatory molecule has been shown to be involved in immune response, inflammation, and cancer. However, the effects of PTX3 on the biological features of cervical cancer cells in vitro and in vivo have not been delineated. Immunohistochemical staining showed that increased PTX3 expression was significantly associated with tumor grade (P < 0.011) and differentiation (P < 0.019). Knocking down PTX3 with lentivirus-mediated small hairpin RNA (shRNA) in cervical cancer cell lines resulted in inhibited cell viability, diminished colony-forming ability, and induced cell cycle arrest at the G2/M phase of the cell cycle, along with downregulated expression of cyclin B1, cdc2, and cdc25c, and upregulated expression of p-cdc2, p-cdc25c, p21, and p27. Furthermore, knockdown of PTX3 significantly decreased the potential of migration and invasion of cervical cancer cells by inhibiting matrix metalloproteidase-2 (MMP-2), MMP-9, and urokinase plasminogen activator (uPA). Moreover, in vivo functional studies showed PTX3-knockdown in mice suppressed tumorigenicity and lung metastatic potential. Conversely, overexpression of PTX3 enhanced proliferation and invasion both in vitro and in vivo. Our results demonstrated that PTX3 contributes to tumorigenesis and metastasis of human cervical cancer cells. Further studies are warranted to demonstrate PTX3 as a novel therapeutic biomarker for human cervical cancer.

ZEB1 knockdown mediated using polypeptide cationic micelles inhibits metastasis and effects sensitization to a chemotherapeutic drug for cancer therapy

NASA Astrophysics Data System (ADS)

Fang, Shengtao; Wu, Lei; Li, Mingxing; Yi, Huqiang; Gao, Guanhui; Sheng, Zonghai; Gong, Ping; Ma, Yifan; Cai, Lintao

2014-08-01

Metastasis and drug resistance are the main causes for the failure in clinical cancer therapy. Emerging evidence suggests an intricate role of epithelial-mesenchymal transition (EMT) and cancer stem cells (CSCs) in metastasis and drug resistance. The EMT-activator ZEB1 is crucial in malignant tumor progression by linking EMT-activation and stemness-maintenance. Here, we used multifunctional polypeptide micelle nanoparticles (NP) as nanocarriers for the delivery of ZEB1 siRNA and doxorubicin (DOX). The nanocarriers could effectively deliver siRNA to the cytoplasm and knockdown the target gene in H460 cells and H460 xenograft tumors, leading to reduced EMT and repressed CSC properties in vitro and in vivo. The complex micelle nanoparticles with ZEB1 siRNA (siRNA-NP) significantly reduced metastasis in the lung. When DOX and siRNA were co-delivered by the nanocarriers (siRNA-DOX-NP), a synergistic therapeutic effect was observed, resulting in dramatic inhibition of tumor growth in a H460 xenograft model. These results demonstrated that the siRNA-NP or siRNA-DOX-NP complex targeting ZEB1 could be developed into a new therapeutic approach for non-small cell lung cancer (NSCLC) treatment.Metastasis and drug resistance are the main causes for the failure in clinical cancer therapy. Emerging evidence suggests an intricate role of epithelial-mesenchymal transition (EMT) and cancer stem cells (CSCs) in metastasis and drug resistance. The EMT-activator ZEB1 is crucial in malignant tumor progression by linking EMT-activation and stemness-maintenance. Here, we used multifunctional polypeptide micelle nanoparticles (NP) as nanocarriers for the delivery of ZEB1 siRNA and doxorubicin (DOX). The nanocarriers could effectively deliver siRNA to the cytoplasm and knockdown the target gene in H460 cells and H460 xenograft tumors, leading to reduced EMT and repressed CSC properties in vitro and in vivo. The complex micelle nanoparticles with ZEB1 siRNA (siRNA-NP) significantly reduced

PTTG1, A novel androgen responsive gene is required for androgen-induced prostate cancer cell growth and invasion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Zheng; Jin, Bo; Jin, Yaqiong

Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that themore » PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.« less

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

PubMed

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

Identifying candidate genes for 2p15p16.1 microdeletion syndrome using clinical, genomic, and functional analysis

PubMed Central

Bagheri, Hani; Badduke, Chansonette; Qiao, Ying; Colnaghi, Rita; Abramowicz, Iga; Alcantara, Diana; Dunham, Christopher; Wen, Jiadi; Wildin, Robert S.; Nowaczyk, Malgorzata J.M.; Eichmeyer, Jennifer; Lehman, Anna; Maranda, Bruno; Martell, Sally; Shan, Xianghong; Lewis, Suzanne M.E.; O’Driscoll, Mark; Gregory-Evans, Cheryl Y.

2016-01-01

The 2p15p16.1 microdeletion syndrome has a core phenotype consisting of intellectual disability, microcephaly, hypotonia, delayed growth, common craniofacial features, and digital anomalies. So far, more than 20 cases of 2p15p16.1 microdeletion syndrome have been reported in the literature; however, the size of the deletions and their breakpoints vary, making it difficult to identify the candidate genes. Recent reports pointed to 4 genes (XPO1, USP34, BCL11A, and REL) that were included, alone or in combination, in the smallest deletions causing the syndrome. Here, we describe 8 new patients with the 2p15p16.1 deletion and review all published cases to date. We demonstrate functional deficits for the above 4 candidate genes using patients’ lymphoblast cell lines (LCLs) and knockdown of their orthologs in zebrafish. All genes were dosage sensitive on the basis of reduced protein expression in LCLs. In addition, deletion of XPO1, a nuclear exporter, cosegregated with nuclear accumulation of one of its cargo molecules (rpS5) in patients’ LCLs. Other pathways associated with these genes (e.g., NF-κB and Wnt signaling as well as the DNA damage response) were not impaired in patients’ LCLs. Knockdown of xpo1a, rel, bcl11aa, and bcl11ab resulted in abnormal zebrafish embryonic development including microcephaly, dysmorphic body, hindered growth, and small fins as well as structural brain abnormalities. Our multifaceted analysis strongly implicates XPO1, REL, and BCL11A as candidate genes for 2p15p16.1 microdeletion syndrome. PMID:27699255

Expression pattern of L-FABP gene in different tissues and its regulation of fat metabolism-related genes in duck.

PubMed

He, Jun; Tian, Yong; Li, Jinjun; Shen, Junda; Tao, Zhengrong; Fu, Yan; Niu, Dong; Lu, Lizhi

2013-01-01

Liver fatty acid binding protein (L-FABP) is a member of intracellular lipid-binding proteins responsible for the transportation of fatty acids. The expression pattern of duck L-FABP mRNA was examined in this study by quantitative RT-PCR. The results showed that duck L-FABP gene was expressed in many tissues, including heart, lung, kidney, muscle, ovary, brain, intestine, stomach and adipocyte tissues, and highly expressed in liver. Several lipid metabolism-related genes were selected to detect the regulation of L-FABP in duck. The expression of L-FABP and lipoprotein lipase was promoted by oleic acid. The L-FABP knockdown decreased the expression levels of peroxisome proliferator-activated receptor α (PPARα), fatty acid synthase and lipoprotein lipase by 61.1, 42.3 and 53.7 %, respectively (P < 0.05), but had no influences on the mRNA levels of PPARγ and leptin receptor. L-FABP might function through the PPARα to regulate the fat metabolism-related gene expression and play important roles in lipid metabolism in duck hepatocytes.

Mutations in the evolutionarily highly conserved KEOPS complex genes cause nephrotic syndrome with microcephaly

PubMed Central

Braun, Daniela A.; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A.; Schanze, Denny; Ashraf, Shazia; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I. Chiara; Sanchez-Ferras, Oraly; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E.; Pabst, Werner L.; Warejko, Jillian; Daga, Ankana; LeBerre, Tamara Basta; Matejas, Verena; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T.; Gipson, Patrick E.; Hsu, Chyong-Hsin; Kari, Jameela A.; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okasha; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth; Rump, Patrick; Schnur, Rhonda E.; Shiihara, Takashi; Sinha, Manish; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A.; Tsai, Wen-Hui; Tsai, Jeng-Daw; Vester, Udo; Viskochil, David H.; Vatanavicharn, Nithiwat; Waxler, Jessica L.; Wolf, Matthias T.F.; Wong, Sik-Nin; Poduri, Annapurna; Truglio, Gessica; Mane, Shrikant; Lifton, Richard P.; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Calleweart, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm

2018-01-01

Galloway-Mowat syndrome (GAMOS) is a severe autosomal-recessive disease characterized by the combination of early-onset steroid-resistant nephrotic syndrome (SRNS) and microcephaly with brain anomalies. To date, mutations of WDR73 are the only known monogenic cause of GAMOS and in most affected individuals the molecular diagnosis remains elusive. We here identify recessive mutations of OSGEP, TP53RK, TPRKB, or LAGE3, encoding the 4 subunits of the KEOPS complex in 33 individuals of 30 families with GAMOS. CRISPR/Cas9 knockout in zebrafish and mice recapitulates the human phenotype of microcephaly and results in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibits cell proliferation, which human mutations fail to rescue, and knockdown of either gene activates DNA damage response signaling and induces apoptosis. OSGEP and TP53RK molecularly interact and co-localize with the actin-regulating ARP2/3 complex. Furthermore, knockdown of OSGEP and TP53RK induces defects of the actin cytoskeleton and reduces migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identify 4 novel monogenic causes of GAMOS, describe the first link between KEOPS function and human disease, and delineate potential pathogenic mechanisms. PMID:28805828

Zebrafish hox paralogue group 2 genes function redundantly as selector genes to pattern the second pharyngeal arch.

PubMed

Hunter, Michael P; Prince, Victoria E

2002-07-15

The pharyngeal arches are one of the defining features of the vertebrates, with the first arch forming the mandibles of the jaw and the second forming jaw support structures. The cartilaginous elements of each arch are formed from separate migratory neural crest cell streams, which derive from the dorsal aspect of the neural tube. The second and more posterior crest streams are characterized by specific Hox gene expression. The zebrafish has a larger overall number of Hox genes than the tetrapod vertebrates, as the result of a duplication event in its lineage. However, in both zebrafish and mouse, there are just two members of Hox paralogue group 2 (PG2): Hoxa2 and Hoxb2. Here, we show that morpholino-mediated "knock-down" of both zebrafish Hox PG2 genes results in major defects in second pharyngeal arch cartilages, involving replacement of ventral elements with a mirror-image duplication of first arch structures, and accompanying changes to pharyngeal musculature. In the mouse, null mutants of Hoxa2 have revealed that this single Hox gene is required for normal second arch patterning. By contrast, loss-of-function of either zebrafish Hox PG2 gene individually has no phenotypic consequence, showing that these two genes function redundantly to confer proper pattern to the second pharyngeal arch. We have also used hoxb1a mis-expression to induce localized ectopic expression of zebrafish Hox PG2 genes in the first arch; using this strategy, we find that ectopic expression of either Hox PG2 gene can confer second arch identity onto first arch structures, suggesting that the zebrafish Hox PG2 genes act as "selector genes." 2002 Elsevier Science (USA).

RNAi-mediated knockdown of SPOOK reduces ecdysteroid titers and causes precocious metamorphosis in the desert locust Schistocerca gregaria.

PubMed

Sugahara, Ryohei; Tanaka, Seiji; Shiotsuki, Takahiro

2017-09-01

The Halloween gene SPOOK (SPO) is involved in the production of the active metabolite of ecdysteroid, 20-hydroxyecdysone (20E), in insects. A previous study showed that RNAi-mediated knockdown of SPO in Schistocerca gregaria last instar nymphs markedly reduced the hemolymph 20E titer, but did not affect metamorphosis. In the present study, the effects of SPO interference on development were re-examined in this locust. Injections of SPO double-stranded RNA (dsSPO) into nymphs at mid and late instars significantly delayed nymphal development and interfered with molting. The 20E levels of dsSPO-treated nymphs were generally low, with a delayed, small peak, suggesting that disturbance of the 20E levels caused the above developmental abnormalities. A small proportion of the dsSPO-injected nymphs metamorphosed precociously, producing adults and adultoids. Precocious adults were characterized by small body size, short wings with abbreviated venation, and normal reproductive activity. Fourth instar nymphs that precociously metamorphosed at the following instar exhibited temporal expression patterns of ecdysone-induced protein 93F and the juvenile hormone (JH) early-inducible gene Krüppel homolog 1 similar to those observed at the last instar in normal nymphs. Adultoids displayed mating behavior and adultoid females developed eggs, but never laid eggs. JH injection around the expected time of the 20E peak in the dsSPO-injected nymphs completely inhibited the appearance of adultoids, suggesting that appearance of adultoids might be due to a reduced titer of JH rather than of 20E. These results suggest that SPO plays an important role in controlling morphogenesis, metamorphosis, and reproduction in S. gregaria. Copyright © 2017 Elsevier Inc. All rights reserved.

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

CXCL5 knockdown expression inhibits human bladder cancer T24 cells proliferation and migration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Jiajia; Zhu, Xi; Zhang, Jie, E-mail: zhangjiebjmu@163.com

2014-03-28

Highlights: • We first demonstrated CXCL5 is highly expressed in human bladder tumor tissues and cells. • CXCL5 knockdown inhibits proliferation, migration and promotes apoptosis in T24 cells. • CXCL5 knockdown inhibits Snail, PI3K-AKT and ERK1/2 signaling pathways in T24 cells. • CXCL5 is critical for bladder tumor growth and progression. - Abstract: CXCL5 (epithelial neutrophil activating peptide-78) which acts as a potent chemoattractant and activator of neutrophil function was reported to play a multifaceted role in tumorigenesis. To investigate the role of CXCL5 in bladder cancer progression, we examined the CXCL5 expression in bladder cancer tissues by real-time PCRmore » and Western blot, additionally, we used shRNA-mediated silencing to generate stable CXCL5 silenced bladder cancer T24 cells and defined its biological functions. Our results demonstrated that mRNA and protein of CXCL5 is increased in human bladder tumor tissues and cell lines, down-regulation of CXCL5 in T24 cells resulted in significantly decreased cell proliferation, migration and increased cell apoptosis in vitro through Snail, PI3K-AKT and ERK1/2 signaling pathways. These data suggest that CXCL5 is critical for bladder tumor growth and progression, it may represent a potential application in cancer diagnosis and therapy.« less

Doxycycline modulates VEGF-A expression: Failure of doxycycline-inducible lentivirus shRNA vector to knockdown VEGF-A expression in transgenic mice.

PubMed

Merentie, Mari; Rissanen, Riina; Lottonen-Raikaslehto, Line; Huusko, Jenni; Gurzeler, Erika; Turunen, Mikko P; Holappa, Lari; Mäkinen, Petri; Ylä-Herttuala, Seppo

2018-01-01

Vascular endothelial growth factor-A (VEGF-A) is the master regulator of angiogenesis, vascular permeability and growth. However, its role in mature blood vessels is still not well understood. To better understand the role of VEGF-A in the adult vasculature, we generated a VEGF-A knockdown mouse model carrying a doxycycline (dox)-regulatable short hairpin RNA (shRNA) transgene, which silences VEGF-A. The aim was to find the critical level of VEGF-A reduction for vascular well-being in vivo. In vitro, the dox-inducible lentiviral shRNA vector decreased VEGF-A expression efficiently and dose-dependently in mouse endothelial cells and cardiomyocytes. In the generated transgenic mice plasma VEGF-A levels decreased shortly after the dox treatment but returned back to normal after two weeks. VEGF-A expression decreased shortly after the dox treatment only in some tissues. Surprisingly, increasing the dox exposure time and dose led to elevated VEGF-A expression in some tissues of both wildtype and knockdown mice, suggesting that dox itself has an effect on VEGF-A expression. When the effect of dox on VEGF-A levels was further tested in naïve/non-transduced cells, the dox administration led to a decreased VEGF-A expression in endothelial cells but to an increased expression in cardiomyocytes. In conclusion, the VEGF-A knockdown was achieved in a dox-regulatable fashion with a VEGF-A shRNA vector in vitro, but not in the knockdown mouse model in vivo. Dox itself was found to regulate VEGF-A expression explaining the unexpected results in mice. The effect of dox on VEGF-A levels might at least partly explain its previously reported beneficial effects on myocardial and brain ischemia. Also, this effect on VEGF-A should be taken into account in all studies using dox-regulated vectors.

In Vivo Functional Genomic Studies of Sterol Carrier Protein-2 Gene in the Yellow Fever Mosquito

PubMed Central

Peng, Rong; Maklokova, Vilena I.; Chandrashekhar, Jayadevi H.; Lan, Que

2011-01-01

A simple and efficient DNA delivery method to introduce extrachromosomal DNA into mosquito embryos would significantly aid functional genomic studies. The conventional method for delivery of DNA into insects is to inject the DNA directly into the embryos. Taking advantage of the unique aspects of mosquito reproductive physiology during vitellogenesis and an in vivo transfection reagent that mediates DNA uptake in cells via endocytosis, we have developed a new method to introduce DNA into mosquito embryos vertically via microinjection of DNA vectors in vitellogenic females without directly manipulating the embryos. Our method was able to introduce inducible gene expression vectors transiently into F0 mosquitoes to perform functional studies in vivo without transgenic lines. The high efficiency of expression knockdown was reproducible with more than 70% of the F0 individuals showed sufficient gene expression suppression (<30% of the controls' levels). At the cohort level, AeSCP-2 expression knockdown in early instar larvae resulted in detectable phenotypes of the expression deficiency such as high mortality, lowered fertility, and distorted sex ratio after induction of AeSCP-2 siRNA expression in vivo. The results further confirmed the important role of AeSCP-2 in the development and reproduction of A. aegypti. In this study, we proved that extrachromosaomal transient expression of an inducible gene from a DNA vector vertically delivered via vitellogenic females can be used to manipulate gene expression in F0 generation. This new method will be a simple and efficient tool for in vivo functional genomic studies in mosquitoes. PMID:21437205

Short-hairpin Mediated Myostatin Knockdown Resulted in Altered Expression of Myogenic Regulatory Factors with Enhanced Myoblast Proliferation in Fetal Myoblast Cells of Goats.

PubMed

Kumar, Rohit; Singh, Satyendra Pal; Mitra, Abhijit

2018-01-02

Myostatin (MSTN) is a well-known negative regulator of skeletal muscle development. Reduced expression due to natural mutations in the coding region and knockout as well as knockdown of MSTN results in an increase in the muscle mass. In the present study, we demonstrated as high as 60 and 52% downregulation (p < 0.01) of MSTN mRNA and protein in the primary fetal myoblast cells of goats using synthetic shRNAs (n = 3), without any interferon response. We, for the first time, evaluated the effect of MSTN knockdown on the expression of MRFs (namely, MyoD, Myf5), follistatin (FST), and IGFs (IGF-1 & IGF-2) in goat myoblast cells. MSTN knockdown caused an upregulation (p < 0.05) of MyoD and downregulation (p < 0.01) of MYf5 and FST expression. Moreover, we report up to ∼four fold (p < 0.001) enhanced proliferation in myoblasts after four days of culture. The anti-MSTN shRNA demonstrated in the present study could be used for the production of transgenic goats to increase the muscle mass.

Knockdown of Host Antioxidant Defense Genes Enhances the Effect of Glucantime on Intracellular Leishmania braziliensis in Human Macrophages.

PubMed

Téllez, Jair; Romero, Ibeth; Soares, Maurilio José; Steindel, Mario; Romanha, Alvaro José

2017-07-01

Leishmaniasis is a neglected tropical disease that affects millions of people worldwide and represents a major public health problem. Information on protein expression patterns and functional roles within the context of Leishmania -infected human monocyte-derived macrophages (MDMs) under drug treatment conditions is essential for understanding the role of these cells in leishmaniasis treatment. We analyzed functional changes in the expression of human MDM genes and proteins during in vitro infection by Leishmania braziliensis and treatment with Glucantime (Sb V ), using quantitative PCR (qPCR) arrays, Western blotting, confocal microscopy, and small interfering RNA (siRNA) human gene inhibition assays. Comparison of the results from gene transcription and protein expression analyses revealed that glutathione S -transferase π1 (GSTP1), glutamate-cysteine ligase modifier subunit (GCLM), glutathione reductase (GSR), glutathione synthetase (GSS), thioredoxin (TRX), and ATP-binding cassette, subfamily B, member 5 (ABCB5), were strongly upregulated at both the mRNA and protein levels in human MDMs that were infected and treated, compared to the control group. Subcellular localization studies showed a primarily phagolysosomal location for the ABCB5 transporter, indicating that this protein may be involved in the transport of Sb V By inducing a decrease in L. braziliensis intracellular survival in THP-1 macrophages, siRNA silencing of GSTP1 , GSS , and ABCB5 resulted in an increased leishmanicidal effect of Sb V exposure in vitro Our results suggest that human MDMs infected with L. braziliensis and treated with Sb V express increased levels of genes participating in antioxidant defense, whereas our functional analyses provide evidence for the involvement of human MDMs in drug detoxification. Therefore, we conclude that GSS, GSTP1, and ABCB5 proteins represent potential targets for enhancing the leishmanicidal activity of Glucantime. Copyright © 2017 American Society for

Knockdown of Host Antioxidant Defense Genes Enhances the Effect of Glucantime on Intracellular Leishmania braziliensis in Human Macrophages

PubMed Central

Romero, Ibeth; Soares, Maurilio José; Romanha, Alvaro José

2017-01-01

ABSTRACT Leishmaniasis is a neglected tropical disease that affects millions of people worldwide and represents a major public health problem. Information on protein expression patterns and functional roles within the context of Leishmania-infected human monocyte-derived macrophages (MDMs) under drug treatment conditions is essential for understanding the role of these cells in leishmaniasis treatment. We analyzed functional changes in the expression of human MDM genes and proteins during in vitro infection by Leishmania braziliensis and treatment with Glucantime (SbV), using quantitative PCR (qPCR) arrays, Western blotting, confocal microscopy, and small interfering RNA (siRNA) human gene inhibition assays. Comparison of the results from gene transcription and protein expression analyses revealed that glutathione S-transferase π1 (GSTP1), glutamate-cysteine ligase modifier subunit (GCLM), glutathione reductase (GSR), glutathione synthetase (GSS), thioredoxin (TRX), and ATP-binding cassette, subfamily B, member 5 (ABCB5), were strongly upregulated at both the mRNA and protein levels in human MDMs that were infected and treated, compared to the control group. Subcellular localization studies showed a primarily phagolysosomal location for the ABCB5 transporter, indicating that this protein may be involved in the transport of SbV. By inducing a decrease in L. braziliensis intracellular survival in THP-1 macrophages, siRNA silencing of GSTP1, GSS, and ABCB5 resulted in an increased leishmanicidal effect of SbV exposure in vitro. Our results suggest that human MDMs infected with L. braziliensis and treated with SbV express increased levels of genes participating in antioxidant defense, whereas our functional analyses provide evidence for the involvement of human MDMs in drug detoxification. Therefore, we conclude that GSS, GSTP1, and ABCB5 proteins represent potential targets for enhancing the leishmanicidal activity of Glucantime. PMID:28461312

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

PubMed Central

McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

PubMed

Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

Knockdown of an inflorescence meristem-specific cytokinin oxidase - OsCKX2 in rice reduces yield penalty under salinity stress condition.

PubMed

Joshi, Rohit; Sahoo, Khirod Kumar; Tripathi, Amit Kumar; Kumar, Ritesh; Gupta, Brijesh Kumar; Pareek, Ashwani; Singla-Pareek, Sneh Lata

2018-05-01

Cytokinins play a significant role in determining grain yield in plants. Cytokinin oxidases catalyse irreversible degradation of cytokinins and hence modulate cellular cytokinin levels. Here, we studied the role of an inflorescence meristem-specific rice cytokinin oxidase - OsCKX2 - in reducing yield penalty under salinity stress conditions. We utilized an RNAi-based approach to study the function of OsCKX2 in maintaining grain yield under salinity stress condition. Ultra-performance liquid chromatography-based estimation revealed a significant increase in cytokinins in the inflorescence meristem of OsCKX2-knockdown plants. To determine if there exists a correlation between OsCKX2 levels and yield under salinity stress condition, we assessed the growth, physiology and grain yield of OsCKX2-knockdown plants vis-à-vis the wild type. OsCKX2-knockdown plants showed better vegetative growth, higher relative water content and photosynthetic efficiency and reduced electrolyte leakage as compared with the wild type under salinity stress. Importantly, we found a negative correlation between OsCKX2 expression and plant productivity as evident by assessment of agronomical parameters such as panicle branching, filled grains per plant and harvest index both under control and salinity stress conditions. These results suggest that OsCKX2, via controlling cytokinin levels, regulates floral primordial activity modulating rice grain yield under normal as well as abiotic stress conditions. © 2017 John Wiley & Sons Ltd.

Acute sterol o-acyltransferase 2 (SOAT2) knockdown rapidly mobilizes hepatic cholesterol for fecal excretion.

PubMed

Marshall, Stephanie M; Gromovsky, Anthony D; Kelley, Kathryn L; Davis, Matthew A; Wilson, Martha D; Lee, Richard G; Crooke, Rosanne M; Graham, Mark J; Rudel, Lawrence L; Brown, J Mark; Temel, Ryan E

2014-01-01

The primary risk factor for atherosclerotic cardiovascular disease is LDL cholesterol, which can be reduced by increasing cholesterol excretion from the body. Fecal cholesterol excretion can be driven by a hepatobiliary as well as a non-biliary pathway known as transintestinal cholesterol efflux (TICE). We previously showed that chronic knockdown of the hepatic cholesterol esterifying enzyme sterol O-acyltransferase 2 (SOAT2) increased fecal cholesterol loss via TICE. To elucidate the initial events that stimulate TICE, C57Bl/6 mice were fed a high cholesterol diet to induce hepatic cholesterol accumulation and were then treated for 1 or 2 weeks with an antisense oligonucleotide targeting SOAT2. Within 2 weeks of hepatic SOAT2 knockdown (SOAT2HKD), the concentration of cholesteryl ester in the liver was reduced by 70% without a reciprocal increase in hepatic free cholesterol. The rapid mobilization of hepatic cholesterol stores resulted in a ∼ 2-fold increase in fecal neutral sterol loss but no change in biliary cholesterol concentration. Acute SOAT2HKD increased plasma cholesterol carried primarily in lipoproteins enriched in apoB and apoE. Collectively, our data suggest that acutely reducing SOAT2 causes hepatic cholesterol to be swiftly mobilized and packaged onto nascent lipoproteins that feed cholesterol into the TICE pathway for fecal excretion.

Annexin A11 knockdown inhibits in vitro proliferation and enhances survival of Hca-F cell via Akt2/FoxO1 pathway and MMP-9 expression.

PubMed

Liu, Shuqing; Wang, Jiasheng; Guo, Chunmei; Qi, Houbao; Sun, Ming-Zhong

2015-03-01

Annexin A11 (Anxa11), a Ca(2+)-regulated phospholipid-binding protein, is involved in cell apoptosis, differentiation, vesicle trafficking, cancer progression and autoimmune diseases. Previous study from our group indicated that Anxa11 was associated with lymphatic metastatic potential of murine hepatocarcinoma cells. Herein, we investigated the effects and action mechanism of Anxa11 knockdown on in vitro cell proliferation and apoptosis of Hca-F, a murine hepatocarcinoma cell with∼75% lymph node metastatic potential. Real-time PCR and western blotting assays indicated that Anxa11 was significantly downregulated in monoclonal Anxa11-shRNA-transfected Hca-F cells. Anxa11 knockdown in Hca-F suppressed its in vitro proliferation and cell apoptosis capacities. Following Anxa11 knockdown in Hca-F cells, Bax/Bcl-2 expression level ratio, Akt2 and FoxO1 (pSer319) expression levels as well as MMP-9 mRNA and active MMP-9 protein levels were significantly elevated in Hca-F cells. In conclusion, Annexin A11 knockdown inhibits the in vitro proliferation and cell apoptosis of Hca-F cell via Akt2/FoxO1 and/or MMP-9 expression pathway. Anxa11 might play an important role in hepatocarcinoma cell invasion and metastasis and hepatocarcinoma malignancy. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Knockdown of BAG3 sensitizes bladder cancer cells to treatment with the BH3 mimetic ABT-737.

PubMed

Mani, Jens; Antonietti, Patrick; Rakel, Stefanie; Blaheta, Roman; Bartsch, Georg; Haferkamp, Axel; Kögel, Donat

2016-02-01

BAG3 is overexpressed in several malignancies and mediates a non-canonical, selective form of (macro)autophagy. By stabilizing pro-survival Bcl-2 proteins in complex with HSP70, BAG3 can also exert an apoptosis-antagonizing function. ABT-737 is a high affinity Bcl-2 inhibitor that fails to target Mcl-1. This failure may confer resistance in various cancers. Urothelial cancer cells were treated with the BH3 mimetics ABT-737 and (-)-gossypol, a pan-Bcl-2 inhibitor which inhibits also Mcl-1. To clarify the importance of the core autophagy regulator ATG5 and BAG3 in ABT-737 treatment, cell lines carrying a stable lentiviral knockdown of ATG5 and BAG3 were created. The synergistic effect of ABT-737 and pharmaceutical inhibition of BAG3 with the HSF1 inhibitor KRIBB11 or sorafenib was also evaluated. Total cell death and apoptosis were quantified by FACS analysis of propidium iodide, annexin. Target protein analysis was conducted by Western blotting. Knockdown of BAG3 significantly downregulated Mcl-1 protein levels and sensitized urothelial cancer cells to apoptotic cell death induced by ABT-737, while inhibition of bulk autophagy through depletion of ATG5 had no discernible effect on cell death. Similar to knockdown of BAG3, pharmacological targeting of the BAG3/Mcl-1 pathway with KRIBB11 was capable to sensitize both cell lines to treatment with ABT-737. Our results show that BAG3, but not bulk autophagy has a major role in the response of bladder cancer cells to BH3 mimetics. They also suggest that BAG3 is a suitable target for combined therapies aimed at synergistically inducing apoptosis in bladder cancer.

[Gene doping: gene transfer and possible molecular detection].

PubMed

Argüelles, Carlos Francisco; Hernández-Zamora, Edgar

2007-01-01

The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

Endoplasmic reticulum-Golgi intermediate compartment protein 3 knockdown suppresses lung cancer through endoplasmic reticulum stress-induced autophagy.

PubMed

Hong, Seong-Ho; Chang, Seung-Hee; Cho, Kyung-Cho; Kim, Sanghwa; Park, Sungjin; Lee, Ah Young; Jiang, Hu-Lin; Kim, Hyeon-Jeong; Lee, Somin; Yu, Kyeong-Nam; Seo, Hwi Won; Chae, Chanhee; Kim, Kwang Pyo; Park, Jongsun; Cho, Myung-Haing

2016-10-04

Trafficking from the endoplasmic reticulum (ER) to the Golgi apparatus is elevated in cancer cells. Therefore, proteins of the ER-Golgi intermediate compartment (ERGIC) attract significant attention as targets for cancer treatment. Enhanced cancer cell growth and epithelial-mesenchymal transition by ERGICs correlates with poor-prognosis of lung cancer. This prompted us to assess whether knockdown of ERGIC3 may decrease lung cancer growth. To test the hypothesis, the effects of ERGIC3 short hairpin RNA (shERGIC3) on ER stress-induced cell death and lung tumorigenesis were investigated both in vitro and in vivo. Knockdown of ERGIC3 led to ER stress-induced autophagic cell death and suppression of proliferation in the A549 human lung cancer cell-line. Moreover, non-invasive aerosol-delivery of shERGIC3 using the biocompatible carrier glycerol propoxylate triacrylate and spermine (GPT-SPE) inhibited lung tumorigenesis in the K-rasLA1 murine model of lung cancer. Our data suggest that suppression of ERGIC3 could provide a framework for the development of effective lung cancer therapies.

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

PubMed

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes