Science.gov

Sample records for gene lmnb1 encoding

  1. Structural organization of the human gene (LMNB1) encoding nuclear lamin B1

    SciTech Connect

    Lin, F.; Worman, H.J.

    1995-05-20

    The authors have determined the structural organization of the human gene (LMNB1) that encodes nuclear lamin B1, an intermediate filament protein of the nuclear envelope. The transcription unit spans more than 45 kb and the transcription start site is 348 nucleotides upstream from the translation initiation codon. Lamin B1 is encoded by 11 exons. Exon 1 codes for the amino-terminal head domain and the first portion of the central rod domain, exons 2 through 6 the central rod domain, and exons 7 through 11 the carboxyl-terminal tail domain of this intermediate filament protein. Intron positions are conserved in other lamin genes from frogs, mice, and humans but different in lamin genes from Drosophila melanogaster and Caenorhabditis elegans. In the region encoding the central rod domain, intron positions are also similar to those in the gene for an invertebrate nonneuronal cytoplasmic intermediate filament protein and the genes for most vertebrate cytoplasmic intermediate filament proteins except neurofilaments and nestin. 51 refs., 3 figs.

  2. Analysis of LMNB1 Duplications in Autosomal Dominant Leukodystrophy Provides Insights into Duplication Mechanisms and Allele-Specific Expression

    PubMed Central

    Giorgio, Elisa; Rolyan, Harshvardhan; Kropp, Laura; Chakka, Anish Baswanth; Yatsenko, Svetlana; Gregorio, Eleonora Di; Lacerenza, Daniela; Vaula, Giovanna; Talarico, Flavia; Mandich, Paola; Toro, Camilo; Pierre, Eleonore Eymard; Labauge, Pierre; Capellari, Sabina; Cortelli, Pietro; Vairo, Filippo Pinto; Miguel, Diego; Stubbolo, Danielle; Marques, Lourenco Charles; Gahl, William; Boespflug-Tanguy, Odile; Melberg, Atle; Hassin-Baer, Sharon; Cohen, Oren S; Pjontek, Rastislav; Grau, Armin; Klopstock, Thomas; Fogel, Brent; Meijer, Inge; Rouleau, Guy; Bouchard, Jean-Pierre L; Ganapathiraju, Madhavi; Vanderver, Adeline; Dahl, Niklas; Hobson, Grace; Brusco, Alfredo; Brussino, Alessandro; Padiath, Quasar Saleem

    2013-01-01

    ABSTRACT Autosomal dominant leukodystrophy (ADLD) is an adult onset demyelinating disorder that is caused by duplications of the lamin B1 (LMNB1) gene. However, as only a few cases have been analyzed in detail, the mechanisms underlying LMNB1 duplications are unclear. We report the detailed molecular analysis of the largest collection of ADLD families studied, to date. We have identified the minimal duplicated region necessary for the disease, defined all the duplication junctions at the nucleotide level and identified the first inverted LMNB1 duplication. We have demonstrated that the duplications are not recurrent; patients with identical duplications share the same haplotype, likely inherited from a common founder and that the duplications originated from intrachromosomal events. The duplication junction sequences indicated that nonhomologous end joining or replication-based mechanisms such fork stalling and template switching or microhomology-mediated break induced repair are likely to be involved. LMNB1 expression was increased in patients’ fibroblasts both at mRNA and protein levels and the three LMNB1 alleles in ADLD patients show equal expression, suggesting that regulatory regions are maintained within the rearranged segment. These results have allowed us to elucidate duplication mechanisms and provide insights into allele-specific LMNB1 expression levels. PMID:23649844

  3. A large genomic deletion leads to enhancer adoption by the lamin B1 gene: a second path to autosomal dominant adult-onset demyelinating leukodystrophy (ADLD)

    SciTech Connect

    Giorgio, E.; Robyr, D.; Spielmann, M.; Ferrero, E.; Di Gregorio, E.; Imperiale, D.; Vaula, G.; Stamoulis, G.; Santoni, F.; Atzori, C.; Gasparini, L.; Ferrera, D.; Canale, C.; Guipponi, M.; Pennacchio, L. A.; Antonarakis, S. E.; Brussino, A.; Brusco, A.

    2015-02-20

    Chromosomal rearrangements with duplication of the lamin B1 (LMNB1) gene underlie autosomal dominant adult-onset demyelinating leukodystrophy (ADLD), a rare neurological disorder in which overexpression of LMNB1 causes progressive central nervous system demyelination. However, we previously reported an ADLD family (ADLD-1-TO) without evidence of duplication or other mutation in LMNB1 despite linkage to the LMNB1 locus and lamin B1 overexpression. By custom array-CGH, we further investigated this family and report here that patients carry a large (~660 kb) heterozygous deletion that begins 66 kb upstream of the LMNB1 promoter. Lamin B1 overexpression was confirmed in further ADLD-1-TO tissues and in a postmortem brain sample, where lamin B1 was increased in the frontal lobe. Through parallel studies, we investigated both loss of genetic material and chromosomal rearrangement as possible causes of LMNB1 overexpression, and found that ADLD-1-TO plausibly results from an enhancer adoption mechanism. The deletion eliminates a genome topological domain boundary, allowing normally forbidden interactions between at least three forebrain-directed enhancers and the LMNB1 promoter, in line with the observed mainly cerebral localization of lamin B1 overexpression and myelin degeneration. Finally, this second route to LMNB1 overexpression and ADLD is a new example of the relevance of regulatory landscape modifications in determining Mendelian phenotypes.

  4. A large genomic deletion leads to enhancer adoption by the lamin B1 gene: a second path to autosomal dominant adult-onset demyelinating leukodystrophy (ADLD)

    DOE PAGESBeta

    Giorgio, E.; Robyr, D.; Spielmann, M.; Ferrero, E.; Di Gregorio, E.; Imperiale, D.; Vaula, G.; Stamoulis, G.; Santoni, F.; Atzori, C.; et al

    2015-02-20

    Chromosomal rearrangements with duplication of the lamin B1 (LMNB1) gene underlie autosomal dominant adult-onset demyelinating leukodystrophy (ADLD), a rare neurological disorder in which overexpression of LMNB1 causes progressive central nervous system demyelination. However, we previously reported an ADLD family (ADLD-1-TO) without evidence of duplication or other mutation in LMNB1 despite linkage to the LMNB1 locus and lamin B1 overexpression. By custom array-CGH, we further investigated this family and report here that patients carry a large (~660 kb) heterozygous deletion that begins 66 kb upstream of the LMNB1 promoter. Lamin B1 overexpression was confirmed in further ADLD-1-TO tissues and in amore » postmortem brain sample, where lamin B1 was increased in the frontal lobe. Through parallel studies, we investigated both loss of genetic material and chromosomal rearrangement as possible causes of LMNB1 overexpression, and found that ADLD-1-TO plausibly results from an enhancer adoption mechanism. The deletion eliminates a genome topological domain boundary, allowing normally forbidden interactions between at least three forebrain-directed enhancers and the LMNB1 promoter, in line with the observed mainly cerebral localization of lamin B1 overexpression and myelin degeneration. Finally, this second route to LMNB1 overexpression and ADLD is a new example of the relevance of regulatory landscape modifications in determining Mendelian phenotypes.« less

  5. [Development genes encoding transcription factors and dysmorphology].

    PubMed

    Lacombe, Didier

    2009-04-01

    Studies of children with developmental abnormalities of genetic origin are necessary for accurate diagnosis, prognostication, patient management, and genetic counseling. Such studies can also help to identify genes involved in normal and abnormal morphogenesis, which often act as patterning genes and are also potential oncogenes. Many encode transcription factors that regulate other genes during embryonic development. PMID:20120282

  6. Gene encoding plant asparagine synthetase

    DOEpatents

    Coruzzi, Gloria M.; Tsai, Fong-Ying

    1993-10-26

    The identification and cloning of the gene(s) for plant asparagine synthetase (AS), an important enzyme involved in the formation of asparagine, a major nitrogen transport compound of higher plants is described. Expression vectors constructed with the AS coding sequence may be utilized to produce plant AS; to engineer herbicide resistant plants, salt/drought tolerant plants or pathogen resistant plants; as a dominant selectable marker; or to select for novel herbicides or compounds useful as agents that synchronize plant cells in culture. The promoter for plant AS, which directs high levels of gene expression and is induced in an organ specific manner and by darkness, is also described. The AS promoter may be used to direct the expression of heterologous coding sequences in appropriate hosts.

  7. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, P.G.; Ohlrogge, J.B.

    1996-09-24

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  8. Gene encoding acetyl-coenzyme A carboxylase

    DOEpatents

    Roessler, Paul G.; Ohlrogge, John B.

    1996-01-01

    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  9. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.

    1999-10-26

    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  10. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, Jonathan D.; Scott-Craig, John S.

    1999-01-01

    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  11. Evolutionary relationship of nuclear genes encoding mitochondrial proteins across grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Comparative genome studies were done across taxa to provide a basic understanding of genome evolution regarding nuclear genes encoding for mitochondrial proteins and their conservation in grass species. Two different mitochondria-related gene sets, one from rice and another from Arabidopsis, were us...

  12. Trichoderma asperellum Chi42 Genes Encode Chitinase

    PubMed Central

    Quang, Hoang Tan; Hung, Nguyen Bao; Huy, Nguyen Duc; Phuong, Truong Thi Bich; Ha, Tran Thi Thu

    2011-01-01

    Four Trichoderma strains (CH2, SH16, PQ34, and TN42) were isolated from soil samples collected from Quang Tri and Thua Thien Hue provinces in Vietnam. The strains exhibited high chitinolytic secretion. Strain PQ34 formed the largest zone of chitinase-mediated clearance (> 4 cm in diameter) in agar containing 1% (w/v) colloidal chitin. Analysis of the internal transcribed spacer regions of these strains indicated that they were Trichoderma asperellum. The molecular weights of the chitinases were approximately 42 kDa. Chitinase genes (chi42) of T. asperellum strains TN42, CH2, SH16, and PQ34 were 98~99% homologous to the ech42 gene of T. harzianum CB-Pin-01 (accession No. DQ166036). The deduced amino acid sequences of both T. asperellum strains SH16 and TN42 shared 100% similarity. PMID:22783101

  13. A reanalysis of mouse ENCODE comparative gene expression data

    PubMed Central

    Gilad, Yoav; Mizrahi-Man, Orna

    2015-01-01

    Recently, the Mouse ENCODE Consortium reported that comparative gene expression data from human and mouse tend to cluster more by species rather than by tissue. This observation was surprising, as it contradicted much of the comparative gene regulatory data collected previously, as well as the common notion that major developmental pathways are highly conserved across a wide range of species, in particular across mammals. Here we show that the Mouse ENCODE gene expression data were collected using a flawed study design, which confounded sequencing batch (namely, the assignment of samples to sequencing flowcells and lanes) with species. When we account for the batch effect, the corrected comparative gene expression data from human and mouse tend to cluster by tissue, not by species. PMID:26236466

  14. Selection for genes encoding secreted proteins and receptors.

    PubMed Central

    Klein, R D; Gu, Q; Goddard, A; Rosenthal, A

    1996-01-01

    Extracellular proteins play an essential role in the formation, differentiation, and maintenance of multicellular organisms. Despite that, the systematic identification of genes encoding these proteins has not been possible. We describe here a highly efficient method to isolate genes encoding secreted and membrane-bound proteins by using a single-step selection in yeast. Application of this method, termed signal peptide selection, to various tissues yielded 559 clones that appear to encode known or novel extracellular proteins. These include members of the transforming growth factor and epidermal growth factor protein families, endocrine hormones, tyrosine kinase receptors, serine/threonine kinase receptors, seven transmembrane receptors, cell adhesion molecules, extracellular matrix proteins, plasma proteins, and ion channels. The eventual identification of most, or all, extracellular signaling molecules will advance our understanding of fundamental biological processes and our ability to intervene in disease states. Images Fig. 1 PMID:8692953

  15. (Structure and expression of nuclear genes encoding rubisco activase)

    SciTech Connect

    Zielinski, R.E.

    1990-01-01

    Our activities during the past year have centered around two basic aspects of the project: describing more thoroughly the diurnal and light irradiance effects on activase gene expression in barley; and isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Three appendices are included that summarize these activities.

  16. Functions Encoded by Pyrrolnitrin Biosynthetic Genes from Pseudomonas fluorescens

    PubMed Central

    Kirner, Sabine; Hammer, Philip E.; Hill, D. Steven; Altmann, Annett; Fischer, Ilona; Weislo, Laura J.; Lanahan, Mike; van Pée, Karl-Heinz; Ligon, James M.

    1998-01-01

    Pyrrolnitrin is a secondary metabolite derived from tryptophan and has strong antifungal activity. Recently we described four genes, prnABCD, from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin. In the work presented here, we describe the function of each prn gene product. The four genes encode proteins identical in size and serology to proteins present in wild-type Pseudomonas fluorescens, but absent from a mutant from which the entire prn gene region had been deleted. The prnA gene product catalyzes the chlorination of l-tryptophan to form 7-chloro-l-tryptophan. The prnB gene product catalyzes a ring rearrangement and decarboxylation to convert 7-chloro-l-tryptophan to monodechloroaminopyrrolnitrin. The prnC gene product chlorinates monodechloroaminopyrrolnitrin at the 3 position to form aminopyrrolnitrin. The prnD gene product catalyzes the oxidation of the amino group of aminopyrrolnitrin to a nitro group to form pyrrolnitrin. The organization of the prn genes in the operon is identical to the order of the reactions in the biosynthetic pathway. PMID:9537395

  17. (Genetic engineering with a gene encoding a soybean storage protein)

    SciTech Connect

    Beachy, R.N.

    1985-12-18

    We have isolated and characterized a gene which encodes the alpha prime subunit of beta conglycinin. This gene was fully sequenced by DNA sequence analysis and a report of that work was prepared and submitted for publication in early November 1985. This represented the culmination of several years of research effort by several scientists. A preprint of that work is attached to this report and has been offered by Dr. J.J. Doyle, Dr. Mary A. Schuler and Dr. Jerry Slighton, as well as myself. This paper is a comparison of the alpha prime subunit gene with a similar gene from phaseolus vulgaris, the common garden bean. In this paper we compare the sequences that are 5' of the gene, and which would represent the transcriptional promoter, as well as the sequences within the structural region of the gene. The sequence paper also compares the amino acid sequence of these two genes with that of other genes from Phaseolus, peas and from soybeans. On the basis of this comparison, we predict evolutionary trends within the multigene families which encode these proteins in the various plants, as well as to look at the protein itself to try to predict regions of the protein that might have functional significance. All of this work was done on a prior DOE-BER grant and has simply been reported here for the first time.

  18. A complex gene superfamily encodes actin in petunia.

    PubMed Central

    Baird, W V; Meagher, R B

    1987-01-01

    We have shown by several independent criteria that actin is encoded by a very large and complex superfamily of genes in Petunia. Several cDNA and genomic probes encoding actins from diverse organisms (Dictyostelium, Drosophila, chicken and soybean) hybridize to hundreds of restriction fragments in the petunia genome. Actin-hybridizing sequences were isolated from a petunia genomic library at a rate of at least 200 per genome equivalent. Twenty randomly selected actin-hybridizing clones were characterized in more detail. DNA sequence data from four representative and highly divergent clones, PAc2, PAc3, PAc4 and PAc7, demonstrate that these actin-like sequences are related to functional actin genes. Intron positions typical of other known plant actin genes are conserved in these clones. Four of six clones analyzed (PAc1, PAc2, PAc3, PAc4) hybridize to leaf mRNA of the same size (1.7 kb) as that reported for other plant actin mRNAs and to a slightly smaller mRNA species (1.5 kb). Five distinct subfamilies of actin-related genes were characterized which varied in size from a few members to several dozen members. It is clear from our data that other actin gene subfamilies must also exist within the genome. Possible mechanisms of actin gene amplification and genome turnover are discussed. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3428258

  19. Expression of genes encoding extracellular matrix proteins: A macroarray study

    PubMed Central

    FUTYMA, KONRAD; MIOTŁA, PAWEŁ; RÓŻYŃSKA, KRYSTYNA; ZDUNEK, MAŁGORZATA; SEMCZUK, ANDRZEJ; RECHBERGER, TOMASZ; WOJCIEROWSKI, JACEK

    2014-01-01

    Endometrial cancer (EC) is one of the most common gynecological malignancies in Poland, with well-established risk factors. Genetic instability and molecular alterations responsible for endometrial carcinogenesis have been systematically investigated. The aim of the present study was to investigate, by means of cDNA macroarrays, the expression profiles of genes encoding extracellular matrix (ECM) proteins in ECs. Tissue specimens were collected during surgical procedures from 40 patients with EC, and control tissue was collected from 9 patients with uterine leiomyomas. RNA was isolated and RT-PCR with radioisotope-labeled cDNA was performed. The levels of ECM protein gene expression in normal endometrial tissues were compared to the expression of these genes in EC specimens. Statistically significant differences in gene expression, stratified by clinical stage of the ECs, were detected for aggrecan, vitronectin, tenascin R, nidogen and two collagen proteins: type VIII chain α1 and type XI chain α2. All of these proteins were overexpressed in stage III endometrial carcinomas compared to levels in stage I and II uterine neoplasms. In conclusion, increased expression of genes encoding ECM proteins may play an important role in facilitating accelerated disease progression of human ECs. PMID:25231141

  20. Kluyveromyces lactis genome harbours a functional linker histone encoding gene.

    PubMed

    Staneva, Dessislava; Georgieva, Milena; Miloshev, George

    2016-06-01

    Linker histones are essential components of chromatin in eukaryotes. Through interactions with linker DNA and nucleosomes they facilitate folding and maintenance of higher-order chromatin structures and thus delicately modulate gene activity. The necessity of linker histones in lower eukaryotes appears controversial and dubious. Genomic data have shown that Schizosaccharomyces pombe does not possess genes encoding linker histones while Kluyveromyces lactis has been reported to have a pseudogene. Regarding this controversy, we have provided the first direct experimental evidence for the existence of a functional linker histone gene, KlLH1, in K. lactis genome. Sequencing of KlLH1 from both genomic DNA and copy DNA confirmed the presence of an intact open reading frame. Transcription and splicing of the KlLH1 sequence as well as translation of its mRNA have been studied. In silico analysis revealed homology of KlLH1p to the histone H1/H5 protein family with predicted three domain structure characteristic for the linker histones of higher eukaryotes. This strongly proves that the yeast K. lactis does indeed possess a functional linker histone gene thus entailing the evolutionary preservation and significance of linker histones. The nucleotide sequences of KlLH1 are deposited in the GenBank under accession numbers KT826576, KT826577 and KT826578. PMID:27189369

  1. Genome-wide analysis of NBS-encoding disease resistance genes in Cucumis sativus and phylogenetic study of NBS-encoding genes in Cucurbitaceae crops

    PubMed Central

    2013-01-01

    Background Plant nucleotide-binding site (NBS)-leucine-rich repeat (LRR) proteins encoded by resistance genes play an important role in the responses of plants to various pathogens, including viruses, bacteria, fungi, and nematodes. In this study, a comprehensive analysis of NBS-encoding genes within the whole cucumber genome was performed, and the phylogenetic relationships of NBS-encoding resistance gene homologues (RGHs) belonging to six species in five genera of Cucurbitaceae crops were compared. Results Cucumber has relatively few NBS-encoding genes. Nevertheless, cucumber maintains genes belonging to both Toll/interleukine-1 receptor (TIR) and CC (coiled-coil) families. Eight commonly conserved motifs have been established in these two families which support the grouping into TIR and CC families. Moreover, three additional conserved motifs, namely, CNBS-1, CNBS-2 and TNBS-1, have been identified in sequences from CC and TIR families. Analyses of exon/intron configurations revealed that some intron loss or gain events occurred during the structural evolution between the two families. Phylogenetic analyses revealed that gene duplication, sequence divergence, and gene loss were proposed as the major modes of evolution of NBS-encoding genes in Cucurbitaceae species. Compared with NBS-encoding sequences from the Arabidopsis thaliana genome, the remaining seven TIR familes of NBS proteins and RGHs from Cucurbitaceae species have been shown to be phylogenetically distinct from the TIR family of NBS-encoding genes in Arabidopsis, except for two subfamilies (TIR4 and TIR9). On the other hand, in the CC-NBS family, they grouped closely with the CC family of NBS-encoding genes in Arabidopsis. Thus, the NBS-encoding genes in Cucurbitaceae crops are shown to be ancient, and NBS-encoding gene expansions (especially the TIR family) may have occurred before the divergence of Cucurbitaceae and Arabidopsis. Conclusion The results of this paper will provide a genomic framework

  2. Human xeroderma pigmentosum group G gene encodes a DNA endonuclease.

    PubMed Central

    Habraken, Y; Sung, P; Prakash, L; Prakash, S

    1994-01-01

    Because of defective nucleotide excision repair of ultraviolet damaged DNA, xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers. Cell fusion studies have identified seven XP complementation groups, A to G. Previous studies have implicated the products of these seven XP genes in the recognition of ultraviolet-induced DNA damage and in incision of the damage-containing DNA strand. Here, we express the XPG-encoded protein in Sf9 insect cells and purify it to homogeneity. We demonstrate that XPG is a single-strand specific DNA endonuclease, thus identifying the catalytic role of the protein in nucleotide excision repair. We suggest that XPG nuclease acts on the single-stranded region created as a result of the combined action of the XPB helicase and XPD helicase at the DNA damage site. Images PMID:8078765

  3. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    DOEpatents

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  4. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    DOEpatents

    Jarvis, E.E.; Roessler, P.G.

    1999-07-27

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

  5. Characterization of a plasmid-encoded urease gene cluster found in members of the family Enterobacteriaceae.

    PubMed

    D'Orazio, S E; Collins, C M

    1993-03-01

    Plasmid-encoded urease gene clusters found in uropathogenic isolates of Escherichia coli, Providencia stuartii, and Salmonella cubana demonstrated DNA homology, similar positions of restriction endonuclease cleavage sites, and manners of urease expression and therefore represent the same locus. DNA sequence analysis indicated that the plasmid-encoded urease genes are closely related to the Proteus mirabilis urease genes. PMID:8449894

  6. Zebrafish tyrosine hydroxylase 2 gene encodes tryptophan hydroxylase.

    PubMed

    Ren, Guiqi; Li, Song; Zhong, Hanbing; Lin, Shuo

    2013-08-01

    The primary pathological hallmark of Parkinson disease (PD) is the profound loss of dopaminergic neurons in the substantia nigra pars compacta. To facilitate the understanding of the underling mechanism of PD, several zebrafish PD models have been generated to recapitulate the characteristics of dopaminergic (DA) neuron loss. In zebrafish studies, tyrosine hydroxylase 1 (th1) has been frequently used as a molecular marker of DA neurons. However, th1 also labels norepinephrine and epinephrine neurons. Recently, a homologue of th1, named tyrosine hydroxylase 2 (th2), was identified based on the sequence homology and subsequently used as a novel marker of DA neurons. In this study, we present evidence that th2 co-localizes with serotonin in the ventral diencephalon and caudal hypothalamus in zebrafish embryos. In addition, knockdown of th2 reduces the level of serotonin in the corresponding th2-positive neurons. This phenotype can be rescued by both zebrafish th2 and mouse tryptophan hydroxylase 1 (Tph1) mRNA as well as by 5-hydroxytryptophan, the product of tryptophan hydroxylase. Moreover, the purified Th2 protein has tryptophan hydroxylase activity comparable with that of the mouse TPH1 protein in vitro. Based on these in vivo and in vitro results, we conclude that th2 is a gene encoding for tryptophan hydroxylase and should be used as a marker gene of serotonergic neurons. PMID:23754283

  7. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  8. Genomic organization of the human NSP gene, prototype of a novel gene family encoding reticulons

    SciTech Connect

    Roebroek, A.J.M.; Ayoubi, T.A.Y.; Velde, H.J.K. van de; Schoenmakers, E.F.P.M.; Pauli, I.G.L.; Van De Ven, W.J.M.

    1996-03-01

    Recently, cDNA cloning and expression of three mRNA variants of the human NSP gene were described. This neuroendocrine-specific gene encodes three NSP protein isoforms with unique amino-terminal parts, but common carboxy-terminal parts. The proteins, with yet unknown function, are associated with the endoplasmic reticulum and therefore are named NSP reticulons. Potentially, these proteins are neuroendocrine markers of a novel category in human lung cancer diagnosis. Here, the genomic organization of this gene was studied by analysis of genomic clones isolated from lambda phage and YAC libraries. The NSP exons were found to be dispersed over a genomic region of about 275 kb. The present elucidation of the genomic organization of the NSP gene explains the generation of NSP mRNA variants encoding NSP protein isoforms. Multiple promoters rather than alternative splicing of internal exons seem to be involved in this diversity. Furthermore, comparison of NSP genomic and cDNA sequences with databank nucleotide sequences resulted in the discovery of other human members of this novel family of reticulons encoding genes. 25 refs., 4 figs.

  9. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Pseudomonas putida.

    PubMed Central

    Allison, S L; Phillips, A T

    1990-01-01

    The hutC gene of Pseudomonas putida encodes a repressor which, in combination with the inducer urocanate, regulates expression of the five structural genes necessary for conversion of histidine to glutamate, ammonia, and formate. The nucleotide sequence of the hutC region was determined and found to contain two open reading frames which overlapped by one nucleotide. The first open reading frame (ORF1) appeared to encode a 27,648-dalton protein of 248 amino acids whose sequence strongly resembled that of the hut repressor of Klebsiella aerogenes (A. Schwacha and R. A. Bender, J. Bacteriol. 172:5477-5481, 1990) and contained a helix-turn-helix motif that could be involved in operator binding. The gene was preceded by a sequence which was nearly identical to that of the operator site located upstream of hutU which controls transcription of the hutUHIG genes. The operator near hutC would presumably allow the hut repressor to regulate its own synthesis as well as the expression of the divergent hutF gene. A second open reading frame (ORF2) would encode a 21,155-dalton protein, but because this region could be deleted with only a slight effect on repressor activity, it is not likely to be involved in repressor function or structure. PMID:2203753

  10. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  11. (Genetic engineering with a gene encoding a soybean storage protein). Progress report

    SciTech Connect

    Beachy, R.N.

    1985-01-01

    Progress is reported on research directed toward introducing a gene (Gmg 17.1) encoding the ..cap alpha..'-subunit of ..beta..-conglycinin, a soybean seed protein, into petunia plants using gene transfer mechanisms. (ACR)

  12. The maize brittle 1 gene encodes amyloplast membrane polypeptides.

    PubMed

    Sullivan, T D; Kaneko, Y

    1995-01-01

    A chimeric protein, formed of 56 amino acids from the carboxy terminus of the maize (Zea mays L.) wild-type Brittle1 (Bt1) protein fused to the glutathione-S-transferase gene, was synthesized in Escherichia coli, and used to raise antibodies. Following affinity purification, the antibodies recognized a set of 38- to 42-kDa proteins in endosperm from wild-type Bt1 plants, as well as from brittle2, shrunken2 and sugary1 plants, but not in mutant bt1 endosperm. Bt1 proteins were not detected with the preimmune antibodies. A low level of Bt1-specific proteins was detected at 10 d after pollination (DAP) and increased to a plateau at 16 DAP. At the same time, the ratio of slow- to fast-migrating forms of the protein decreased. During endosperm fractionation by differential centrifugation and membrane sedimentation in sucrose gradients, the Bt1 proteins co-purified with the carotenoid-containing plastid membranes. They were localized to amyloplasts by electron-microscopic immunocytochemistry; most of the signal was detected at the plastid periphery. These results are consistent with predictions made from the deduced amino-acid sequence and previous in-vitro experiments that the bt1 locus encodes amyloplast membrane proteins. PMID:7647682

  13. Expression cloning of genes encoding human peroxisomal proteins

    SciTech Connect

    Spathaky, J.M.; Tate, A.W.; Cox, T.M.

    1994-09-01

    Numerous metabolic disorders associated with diverse peroxisomal defects have been identified but their molecular characterization has been hampered by difficulties associated with the purification of proteins from this fragile organelle. We have utilized antibodies directed against the C-terminal tripeptide peroxisomal targeting signal to detect hitherto unknown peroxisomal proteins in tissue fractions and to isolate genes encoding peroxisonal proteins from human expression libraries. We immunized rabbits with a peptide conjugate encompassing the C-terminal nine amino acids of rat peroxisomal acyl CoA oxidase. Immunoprecipitation assays using radio-labelled peptide showed that the antibody specifically recognizes the terminal SKL motif as well as C-terminal SHL and SRL but not SHL at an internal position. Affinity-purified antibody was used to probe Western blots of crude and peroxisome-enriched monkey liver preparations and detected 8-10 proteins specifically in the peroxisome fractions. 100 positive clones were identified on screening a human liver cDNA expression library in {lambda}-gt11. Sequence analysis has confirmed the identity of cDNA clones for human acyl CoA oxidase and epoxide hydrolase. Four clones show no sequence identity and their putative role in the human peroxisome is being explored.

  14. A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription.

    PubMed Central

    Grépin, C; Dagnino, L; Robitaille, L; Haberstroh, L; Antakly, T; Nemer, M

    1994-01-01

    In contrast to skeletal muscle, the mechanisms responsible for activation and maintenance of tissue-specific transcription in cardiac muscle remain poorly understood. A family of hormone-encoding genes is expressed in a highly specific manner in cardiac but not skeletal myocytes. This includes the A- and B-type natriuretic peptide (ANP and BNP) genes, which encode peptide hormones with crucial roles in the regulation of blood volume and pressure. Since these genes are markers of cardiac cells, we have used them to probe the mechanisms for cardiac muscle-specific transcription. Cloning and functional analysis of the rat BNP upstream sequences revealed unexpected structural resemblance to erythroid but not to muscle-specific promoters and enhancers, including a requirement for regulatory elements containing GATA motifs. A cDNA clone corresponding to a member of the GATA family of transcription factors was isolated from a cardiomyocyte cDNA library. Transcription of this GATA gene is restricted mostly to the heart and is undetectable in skeletal muscle. Within the heart, GATA transcripts are localized in ANP- and BNP-expressing myocytes, and forced expression of the GATA protein in heterologous cells markedly activates transcription from the natural cardiac muscle-specific ANP and BNP promoters. This GATA-dependent pathway defines the first mechanism for cardiac muscle-specific transcription. Moreover, the present findings reveal striking similarities between the mechanisms controlling gene expression in hematopoietic and cardiac cells and may have important implications for studies of cardiogenesis. Images PMID:8164667

  15. The rolB gene activates the expression of genes encoding microRNA processing machinery.

    PubMed

    Bulgakov, Victor P; Veremeichik, Galina N; Shkryl, Yuri N

    2015-04-01

    The rolB gene of Agrobacterium rhizogenes renders cells more tolerant of environmental stresses and increases their defense potential. However, these effects, coupled with the developmental abnormalities caused by rolB, have not yet been explained. In rolB-transformed Arabidopsis thaliana cells, we detected a 2.2 to 7-fold increase in the expression of genes encoding core and accessory proteins (DCL1, SE, HYL1, AGO1, TGH, DDL, HEN1, AGO4 and RDR2) of the microRNA processing machinery. However, the rolB gene did not affect the expression of DCL2, DCL3 and HST. The diverse and complex effects of rolB on transformed plant cells may be attributable to changes caused by this gene in particular RNA silencing pathways. PMID:25491479

  16. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima)

    PubMed Central

    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming

    2015-01-01

    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4–0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  17. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima).

    PubMed

    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming

    2015-01-01

    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4-0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  18. DNA sequence of a gene encoding a BALB/c mouse Ld transplantation antigen.

    PubMed

    Moore, K W; Sher, B T; Sun, Y H; Eakle, K A; Hood, L

    1982-02-01

    The sequence of a gene, denoted 27.5, encoding a transplantation antigen for the BALB/c mouse has been determined. Gene transfer studies and comparison of the translated sequence with the partial amino acid sequence of the Ld transplantation antigen establish that gene 27.5 encodes an Ld polypeptide. A comparison of the gene 27.5 sequence with several complementary DNA sequences suggests that the BALB/c mouse may contain a number of closely related L-like genes. Gene 27.5 has eight exons that correlate with the structural domains of the transplantation antigen. PMID:7058332

  19. Phylogeny and molecular dating of the cerato-platanin-encoding genes

    PubMed Central

    Yu, Hanying; Li, Lin

    2014-01-01

    The cerato-platanin family consists of proteins that can induce immune responses, cause necrosis, change chemotaxis and locomotion and may be related to the growth and development of various fungi. In this work, we analyzed the phylogenetic relationships among genes encoding members of the cerato-platanin family and computed the divergence times of the genes and corresponding fungi. The results showed that cerato-platanin-encoding genes could be classified into 10 groups but did not cluster according to fungal classes or their functions. The genes transferred horizontally and showed duplication. Molecular dating and adaptive evolution analyses indicated that the cerato-platanin gene originated with the appearance of saprophytes and that the gene was under positive selection. This finding suggests that cerato-platanin-encoding genes evolved with the development of fungal parasitic characteristics. PMID:25071408

  20. SurfaceomeDB: a cancer-orientated database for genes encoding cell surface proteins.

    PubMed

    de Souza, Jorge Estefano Santana; Galante, Pedro Alexandre Favoretto; de Almeida, Renan Valieris Bueno; da Cunha, Julia Pinheiro Chagas; Ohara, Daniel Takatori; Ohno-Machado, Lucila; Old, Lloyd J; de Souza, Sandro José

    2012-01-01

    Cell surface proteins (CSPs) are excellent targets for the development of diagnostic and therapeutic reagents, and it is estimated that 10-20% of all genes in the human genome encode CSPs. In an effort to integrate all data publicly available for genes encoding cell surface proteins, a database (SurfaceomeDB) was developed. SurfaceomeDB is a gene-centered portal containing different types of information, including annotation for gene expression, protein domains, somatic mutations in cancer, and protein-protein interactions for all human genes encoding CSPs. SurfaceomeDB was implemented as an integrative and relational database in a user-friendly web interface, where users can search for gene name, gene annotation, or keywords. There is also a streamlined graphical representation of all data provided and links to the most important data repositories and databases, such as NCBI, UCSC Genome Browser, and EBI. PMID:23390370

  1. The Drosophila gene escargot encodes a zinc finger motif found in snail-related genes.

    PubMed

    Whiteley, M; Noguchi, P D; Sensabaugh, S M; Odenwald, W F; Kassis, J A

    1992-02-01

    Two independent P-element enhancer detection lines were obtained that express lacZ in a pattern of longitudinal stripes early in germband elongation. In this paper, molecular and genetic characterization of a gene located near these transposons is presented. Sequence analysis of a cDNA clone from the region reveals that this gene has a high degree of similarity with the Drosophila snail gene (Boulay et al., 1987). The sequence similarity extends over 400 nucleotides, and includes a region encoding five tandem zinc finger motifs (72% nucleotide identity; 76% amino acid identity). This region is also conserved in the snail homologue from Xenopus laevis (76% nucleotide identity; 83% amino acid identity) (Sargent and Bennett, 1990). We have named the Drosophila snail-related gene escargot (esg), and the region of sequence conservation common to all three genes the 'snailbox'. A number of Drosophila genomic DNA fragments cross-hybridize to a probe from the snailbox region suggesting that snail and escargot are members of a multigene family. The expression pattern of escargot is dynamic and complex. Early in germband elongation, escargot RNA is expressed in a pattern of longitudinal stripes identical to the one observed in the two enhancer detection lines. Later in development, escargot is expressed in cells that will form the larval imaginal tissues, escargot is allelic with l(2)35Ce, an essential gene located near snail in the genome. PMID:1571289

  2. Molecular cloning and transcriptional analysis of the Aspergillus terreus gla1 gene encoding a glucoamylase.

    PubMed Central

    Ventura, L; González-Candelas, L; Pérez-González, J A; Ramón, D

    1995-01-01

    The Aspergillus terreus gla1 gene, coding for a glucoamylase, has been cloned by heterologous hybridization. The gene is interrupted by four introns and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The expression of the gene is induced by starch and maltose and repressed by glucose. PMID:7534054

  3. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    PubMed

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates. PMID:23441914

  4. Cloning, sequencing, and expression of bacteriophage BF23 late genes 24 and 25 encoding tail proteins.

    PubMed Central

    Nakayama, S; Kaneko, T; Ishimaru, H; Moriwaki, H; Mizobuchi, K

    1994-01-01

    Two bacteriophage BF23 late genes, genes 24 and 25, were isolated on a 7.4-kb PstI fragment from the phage DNA, and their nucleotide sequences were determined. Gene 24 encodes a minor tail protein with the expected M(r) of 34,309, and gene 25 located 4 bp upstream of gene 24 encodes a major tail protein with the expected M(r) of 50,329. When total cellular RNA isolated from either phage-infected cells or cells bearing the cloned genes was analyzed by the primer extension method using the primers specific to either gene 25 or gene 24, we identified a possible late gene promoter, designated P25, in the 5'-flanking region of gene 25. This promoter was similar in structure to Escherichia coli promoters for sigma 70. Studies of the translational gene 25- and gene 24-lacZ fusions in the cloned gene system revealed that the promoter P25 was responsible for the expression of both genes 25 and 24 even in the absence of the regulatory genes which were absolutely required for late gene expression in the normal phage-infected cells. These results indicate that the two genes constitute an operon under the control of P25 and that the regulatory gene products of BF23 do not participate directly in specifying the late gene promoter. Images PMID:7961500

  5. A single gene encodes a selective toxin causal to the development of tan spot of wheat.

    PubMed Central

    Ciuffetti, L M; Tuori, R P; Gaventa, J M

    1997-01-01

    The identification and characterization of pathogenicity factors are essential to an understanding of the molecular events that regulate the interaction of plant-pathogenic microbes with their hosts. We have isolated the gene that encodes a host-selective toxic protein produced by the fungus Pyrenophora tritici-repentis and confirmed that this gene functions in the plant as the primary determinant of pathogenicity in the Pyrenophora-wheat interaction. These results demonstrate that a single gene encodes the production of a host-selective toxin and that transformation of this gene into a non-toxin-producing isolate of P. tritici-repentis leads to both toxin production and pathogenicity. PMID:9061946

  6. RAmy2A; a novel alpha-amylase-encoding gene in rice.

    PubMed

    Huang, N; Reinl, S J; Rodriguez, R L

    1992-02-15

    The structure and expression of the alpha-amylase-encoding gene, RAmy2A, are described. This only representative of the Amy2 subfamily in rice differs from other cereal alpha-amylase-encoding genes in several respects. It contains the largest introns of all the cereal alpha-amylase-encoding genes examined to date. Moreover, the second of three introns in this gene contains a long inverted repeat sequence that can potentially form a large and stable stem-loop structure in the unspliced RNA transcript. Finally, RAmy2A is constitutively expressed at very low levels in germinated seeds, root, etiolated leaves, immature seeds and callus. This is in marked contrast to the Amy2 genes of wheat and barley which are highly expressed in the aleurone layer of the germinated seeds. PMID:1541400

  7. A highly divergent gene cluster in honey bees encodes a novel silk family

    PubMed Central

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

    2006-01-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins. PMID:17065612

  8. Divergence of genes encoding non-specific lipid transfer proteins in the poaceae family.

    PubMed

    Jang, Cheol Seong; Jung, Jae Hyeong; Yim, Won Cheol; Lee, Byung-Moo; Seo, Yong Weon; Kim, Wook

    2007-10-31

    The genes encoding non-specific lipid transfer proteins (nsLTPs), members of a small multigene family, show a complex pattern of expressional regulation, suggesting that some diversification may have resulted from changes in their expression after duplication. In this study, the evolution of nsLTP genes within the Poaceae family was characterized via a survey of the pseudogenes and unigenes encoding the nsLTP in rice pseudomolecules and the NCBI unigene database. nsLTP-rich regions were detected in the distal portions of rice chromosomes 11 and 12; these may have resulted from the most recent large segmental duplication in the rice genome. Two independent tandem duplications were shown to occur within the nsLTP-rich regions of rice. The genomic distribution of the nsLTP genes in the rice genome differs from that in wheat. This may be attributed to gene migration, chromosomal rearrangement, and/or differential gene loss. The genomic distribution pattern of nsLTP genes in the Poaceae family points to the existence of some differences among cereal nsLTP genes, all of which diverged from an ancient gene. The unigenes encoding nsLTPs in each cereal species are clustered into five groups. The somewhat different distribution of nsLTP-encoding EST clones between the groups across cereal species imply that independent duplication(s) followed by subfunctionalization (and/or neofunctionalization) of the nsLTP gene family in each species occurred during speciation. PMID:17978574

  9. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    SciTech Connect

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  10. NBS-LRR-Encoding genes in sorghum and their role in plant defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nucleotide-binding site leucine-rich repeats (NBS-LRR) proteins are encoded by a large class of plant genes and many of them play an important role in plant defense against pest attack. Identification and characterization of the whole set of NBS-LRR genes in a plant genome will provide insights int...

  11. Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.

    PubMed

    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V

    2015-06-01

    The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. PMID:25816930

  12. Regulation of nuclear genes encoding mitochondrial proteins in Saccharomyces cerevisiae.

    PubMed Central

    Brown, T A; Evangelista, C; Trumpower, B L

    1995-01-01

    Selection for mutants which release glucose repression of the CYB2 gene was used to identify genes which regulate repression of mitochondrial biogenesis. We have identified two of these as the previously described GRR1/CAT80 and ROX3 genes. Mutations in these genes not only release glucose repression of CYB2 but also generally release respiration of the mutants from glucose repression. In addition, both mutants are partially defective in CYB2 expression when grown on nonfermentable carbon sources, indicating a positive regulatory role as well. ROX3 was cloned by complementation of a glucose-inducible flocculating phenotype of an amber mutant and has been mapped as a new leftmost marker on chromosome 2. The ROX3 mutant has only a modest defect in glucose repression of GAL1 but is substantially compromised in galactose induction of GAL1 expression. This mutant also has increased SUC2 expression on nonrepressing carbon sources. We have also characterized the regulation of CYB2 in strains carrying null mutation in two other glucose repression genes, HXK2 and SSN6, and show that HXK2 is a negative regulator of CYB2, whereas SSN6 appears to be a positive effector of CYB2 expression. PMID:7592476

  13. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    PubMed

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes. PMID:22733202

  14. An essential yeast gene with homology to the exonuclease-encoding XRN1/KEM1 gene also encodes a protein with exoribonuclease activity

    SciTech Connect

    Kenna, M.; Douglas, M.G. ); Stevens, A. ); McCammon, M. )

    1993-01-01

    This is a study of a temperature-sensitive (ts) mutant from Saccharomyces cerevisiae which was obtained in a screen for mutants reduced in the synthesis of binding of a hybrid protein which competes for the transport of protein precursors into mitochondria. Examination of this mutant lead to the characterization of a gene with significant primary sequence homology to a previously identified gene, XRN1 or KEM1. Often called XRN1/KEM1, it encodes a protein of 175kDa which appears to have a multitude of properties, including involvement in recombination, RNA processing and turnover, involvement in recombination, RNA processing and turnover, microtubule function, karyogamy and DNA replication. The related gene describes further characterization of the HKE1/RAT1 gene and an hkal mutant and shows that p116 is a protein having 5[prime]-->3[prime] exoribonuclease activity, a major activity of the product of the related XRN1/KEM1 gene.

  15. THE BRASSICA RAPA ELONGATED INTERNODE (EIN) GENE ENCODES PHYTOCHROME B

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The elongated internode (ein) mutation of Brassica rapa leads to a deficiency in immunochemically detectable phytochrome B. Molecular analysis of the PHYB gene from ein indicates a deletion in the flanking DNA 5' of the ATG start codon, which could interfere either with PHYB transcription or process...

  16. The Novelty of Human Cancer/Testis Antigen Encoding Genes in Evolution

    PubMed Central

    Dobrynin, Pavel; Matyunina, Ekaterina; Malov, S. V.; Kozlov, A. P.

    2013-01-01

    In order to be inherited in progeny generations, novel genes should originate in germ cells. Here, we suggest that the testes may play a special “catalyst” role in the birth and evolution of new genes. Cancer/testis antigen encoding genes (CT genes) are predominantly expressed both in testes and in a variety of tumors. By the criteria of evolutionary novelty, the CT genes are, indeed, novel genes. We performed homology searches for sequences similar to human CT in various animals and established that most of the CT genes are either found in humans only or are relatively recent in their origin. A majority of all human CT genes originated during or after the origin of Eutheria. These results suggest relatively recent origin of human CT genes and align with the hypothesis of the special role of the testes in the evolution of the gene families. PMID:23691492

  17. Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

    2008-02-01

    The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

  18. The bat gene of Halobacterium halobium encodes a trans-acting oxygen inducibility factor.

    PubMed Central

    Gropp, F; Betlach, M C

    1994-01-01

    Oxygen and light affect the expression of the bacterioopsin gene (bop), which encodes a light-driven proton pump in the purple membrane of Halobacterium halobium. This response is thought to be mediated by a set of genes located adjacent to the bop gene. DNA fragments containing either the bop gene or the entire bop gene cluster reversed the phenotype of purple membrane-deficient strains with mutations in the bop gene. Purple membrane synthesis was constitutive in one of these strains transformed with the bop gene alone. The same strain transformed with the bop gene cluster was inducible by low oxygen tension. Moreover, another strain that constitutively expresses purple membrane remained constitutive when transformed with the bop gene alone but the phenotype of the strain changed to inducible when transformed with the bop gene cluster. Additional experiments have confirmed that one of the genes of the bop gene cluster, the bat gene, encodes a trans-acting factor that is necessary and sufficient to confer inducibility of purple membrane synthesis by low oxygen tension. Images PMID:8202511

  19. The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene.

    PubMed Central

    Purves, F C; Spector, D; Roizman, B

    1991-01-01

    Earlier studies have shown that a herpes simplex virus 1 (HSV-1) open reading frame, US3, encodes a novel protein kinase and have characterized the cognate amino acid sequence which is phosphorylated by this enzyme. This report identifies an apparently essential viral phosphoprotein whose posttranslational processing involves the viral protein kinase. Analyses of viral proteins phosphorylated in the course of productive infection revealed a phosphoprotein whose mobility was viral protein kinase and serotype dependent. Thus, the corresponding HSV-1 and HSV-2 phosphoproteins differ in their electrophoretic mobilities, and the phosphoprotein specified by the HSV-1 mutant deleted in US3 (R7041) differs from that of the corresponding HSV-1 and HSV-2 proteins. Analyses of HSV-1 x HSV-2 recombinants mapped the phosphoprotein between 0.42 and 0.47 map units on the prototype HSV-1 DNA map. Within this region, the UL34 open reading frame was predicted to encode a protein of appropriate molecular weight which would also contain the consensus target site for phosphorylation by the viral protein kinase as previously defined with synthetic peptides. Replacement of the native UL34 gene with a UL34 gene tagged with a 17-amino-acid epitope from the alpha 4 protein identified this gene as encoding the phosphoprotein. Finally, mutagenesis of the predicted phosphorylation site on UL34 in the viral genome, and specifically the substitution of threonine or serine with alanine in the product of the UL34 gene, yielded phosphoproteins whose electrophoretic mobilities could not be differentiated from that of the US3- mutant. We conclude that the posttranslational processing of the UL34 gene product to its wild-type phenotype requires the participation of the viral protein kinase. While the viral protein kinase is not essential for viral replication in cells in culture, the UL34 gene product itself may not be dispensable. Images PMID:1656069

  20. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  1. The gene encoding topoisomerase II from Plasmodium falciparum.

    PubMed Central

    Cheesman, S; McAleese, S; Goman, M; Johnson, D; Horrocks, P; Ridley, R G; Kilbey, B J

    1994-01-01

    The gene for topoisomerase II has been isolated from genomic libraries of strain K1 of the human malarial parasite, Plasmodium falciparum. The sequence reveals an open reading frame of 4194 nucleotides which predicts a polypeptide of 1398 amino acids. There are apparently no introns. The sequence is present as a single copy which has an identity of 47.4% and a similarity of 65.4% with its human homologue. Sequences conserved in topoisomerase II from other species are present in Pftopoisomerase II but in addition it has two adjacent asparagine-rich insertions which are unique to it. We have also detected asparagine-rich regions in the gene for PfDNA polymerase alpha. The gene for Pftopoisomerase II has been localised to chromosome 14 and northern analysis reveals a transcript of 5.8 kb. Two independent antisera raised in mice against glutathione-S-transferase fusion proteins containing the amino terminal portion of the malarial protein detect a weak band on western blots at about 160kDa, the expected size of the protein. Use of the same antisera for immunofluorescence analysis suggests that the protein is present at all stages of intraerythrocytic growth of the parasite. Images PMID:8041616

  2. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.

    2002-01-01

    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  3. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    NASA Astrophysics Data System (ADS)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  4. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus).

    PubMed

    Yue, Jia-Xing; Holland, Nicholas D; Holland, Linda Z; Deheyn, Dimitri D

    2016-01-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  5. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    PubMed Central

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-01-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  6. Analysis of genes encoding an alternative nitrogenase in the archaeon Methanosarcina barkeri 227.

    PubMed

    Chien, Y T; Auerbuch, V; Brabban, A D; Zinder, S H

    2000-06-01

    Methanosarcina barkeri 227 possesses two clusters of genes potentially encoding nitrogenases. We have previously demonstrated that one cluster, called nif2, is expressed under molybdenum (Mo)-sufficient conditions, and the deduced amino acid sequences for nitrogenase structural genes in that cluster most closely resemble those for the Mo nitrogenase of the gram-positive eubacterium Clostridium pasteurianum. The previously cloned nifH1 from M. barkeri shows phylogenetic relationships with genes encoding components of eubacterial Mo-independent eubacterial alternative nitrogenases and other methanogen nitrogenases. In this study, we cloned and sequenced nifD1 and part of nifK1 from M. barkeri 227. The deduced amino acid sequence encoded by nifD1 from M. barkeri showed great similarity with vnfD gene products from vanadium (V) nitrogenases, with an 80% identity at the amino acid level with the vnfD gene product from Anabaena variabilis. Moreover, there was a small open reading frame located between nifD1 and nifK1 with clear homology to vnfG, a hallmark of eubacterial alternative nitrogenases. Stimulation of diazotrophic growth of M. barkeri 227 by V in the absence of Mo was demonstrated. The unusual complement of nif genes in M. barkeri 227, with one cluster resembling that from a gram-positive eubacterium and the other resembling a eubacterial V nitrogenase gene cluster, suggests horizontal genetic transfer of those genes. PMID:10809706

  7. Experimental strategies for cloning or identifying genes encoding DNA-binding proteins.

    PubMed

    Carey, Michael F; Peterson, Craig L; Smale, Stephen T

    2012-02-01

    This article describes experimental strategies for cloning or identifying genes encoding DNA-binding proteins. DNA-binding proteins are most commonly identified by electrophoretic mobility-shift assay (EMSA) or DNase I footprinting. To identify the gene encoding a protein detected by EMSA or DNase footprinting, the protein often needs to be purified and its sequence analyzed, as described here. Other methods are also available which do not resort to protein purification, including the one-hybrid screen, in vitro expression library screen, and mammalian expression cloning. These methods are outlined, and their advantages and disadvantages are discussed. PMID:22301659

  8. Human Genetic Disorders Caused by Mutations in Genes Encoding Biosynthetic Enzymes for Sulfated Glycosaminoglycans*

    PubMed Central

    Mizumoto, Shuji; Ikegawa, Shiro; Sugahara, Kazuyuki

    2013-01-01

    A number of genetic disorders are caused by mutations in the genes encoding glycosyltransferases and sulfotransferases, enzymes responsible for the synthesis of sulfated glycosaminoglycan (GAG) side chains of proteoglycans, including chondroitin sulfate, dermatan sulfate, and heparan sulfate. The phenotypes of these genetic disorders reflect disturbances in crucial biological functions of GAGs in human. Recent studies have revealed that mutations in genes encoding chondroitin sulfate and dermatan sulfate biosynthetic enzymes cause various disorders of connective tissues. This minireview focuses on growing glycobiological studies of recently described genetic diseases caused by disturbances in biosynthetic enzymes for sulfated GAGs. PMID:23457301

  9. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    NASA Technical Reports Server (NTRS)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  10. Population-level expression variability of mitochondrial DNA-encoded genes in humans

    PubMed Central

    Wang, Gang; Yang, Ence; Mandhan, Ishita; Brinkmeyer-Langford, Candice L; Cai, James J

    2014-01-01

    Human mitochondria contain multiple copies of a circular genome made up of double-stranded DNA (mtDNA) that encodes proteins involved in cellular respiration. Transcript abundance of mtDNA-encoded genes varies between human individuals, yet the level of variation in the general population has not been systematically assessed. In the present study, we revisited large-scale RNA sequencing data generated from lymphoblastoid cell lines of HapMap samples of European and African ancestry to estimate transcript abundance and quantify expression variation for mtDNA-encoded genes. In both populations, we detected up to over 100-fold difference in mtDNA gene expression between individuals. The marked variation was not due to differences in mtDNA copy number between individuals, but was shaped by the transcription of hundreds of nuclear genes. Many of these nuclear genes were co-expressed with one another, resulting in a module-enriched co-expression network. Significant correlations in expression between genes of the mtDNA and nuclear genomes were used to identify factors involved with the regulation of mitochondrial functions. In conclusion, we determined the baseline amount of variability in mtDNA gene expression in general human populations and cataloged a complete set of nuclear genes whose expression levels are correlated with those of mtDNA-encoded genes. Our findings will enable the integration of information from both mtDNA and nuclear genetic systems, and facilitate the discovery of novel regulatory pathways involving mitochondrial functions. PMID:24398800

  11. Genetic Variants in Nuclear-Encoded Mitochondrial Genes Influence AIDS Progression

    PubMed Central

    Hendrickson, Sher L.; Lautenberger, James A.; Chinn, Leslie Wei; Malasky, Michael; Sezgin, Efe; Kingsley, Lawrence A.; Goedert, James J.; Kirk, Gregory D.; Gomperts, Edward D.; Buchbinder, Susan P.; Troyer, Jennifer L.; O'Brien, Stephen J.

    2010-01-01

    Background The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression. Methodology/Principal Findings Here we explore whether single nucleotide polymorphisms (SNPs) within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs) influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4) on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI) on chromosome 6. Conclusions Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis. PMID:20877624

  12. Cloning, nucleotide sequence, and expression of the Escherichia coli gene encoding carnitine dehydratase.

    PubMed Central

    Eichler, K; Schunck, W H; Kleber, H P; Mandrand-Berthelot, M A

    1994-01-01

    Carnitine dehydratase from Escherichia coli O44 K74 is an inducible enzyme detectable in cells grown anaerobically in the presence of L-(-)-carnitine or crotonobetaine. The purified enzyme catalyzes the dehydration of L-(-)-carnitine to crotonobetaine (H. Jung, K. Jung, and H.-P. Kleber, Biochim. Biophys. Acta 1003:270-276, 1989). The caiB gene, encoding carnitine dehydratase, was isolated by oligonucleotide screening from a genomic library of E. coli O44 K74. The caiB gene is 1,215 bp long, and it encodes a protein of 405 amino acids with a predicted M(r) of 45,074. The identity of the gene product was first assessed by its comigration in sodium dodecyl sulfate-polyacrylamide gels with the purified enzyme after overexpression in the pT7 system and by its enzymatic activity. Moreover, the N-terminal amino acid sequence of the purified protein was found to be identical to that predicted from the gene sequence. Northern (RNA) analysis showed that caiB is likely to be cotranscribed with at least one other gene. This other gene could be the gene encoding a 47-kDa protein, which was overexpressed upstream of caiB. Images PMID:8188598

  13. Genetic location of genes encoding enterobacterial common antigen.

    PubMed Central

    Meier, U; Mayer, H

    1985-01-01

    A new rff mutation (rff-726) of Escherichia coli is described which affects the biosynthesis of the enterobacterial common antigen. This mutation was detected in an rfe-defective strain. A Tn10 insertion near the rfe locus was isolated to facilitate further mapping. Both mutations rfe and rff were mapped by transduction with bacteriophage P1, giving the gene order ilv rfe rff uvrD metE. The F' factor F14 was able to complement both mutations rfe and rff, whereas the F' factor F16 could complement the rfe but not the rff mutation. The rff mutation did not affect the biosynthesis of N-acetyl-D-mannosaminuronic acid, as the previously described rff mutations in Salmonella typhimurium do (H. C. Lew, H. Nikaido, and P. H. Mäkelä, J. Bacteriol. 136:227-233, 1978), and also did not affect the biosynthesis of other enterobacterial common antigen components; however, the biosynthesis of the complete enterobacterial common antigen molecule was blocked. PMID:3894334

  14. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  15. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    PubMed

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum. PMID:9310943

  16. Arabidopsis thaliana contains a single gene encoding squalene synthase.

    PubMed

    Busquets, Antoni; Keim, Verónica; Closa, Marta; del Arco, Ana; Boronat, Albert; Arró, Montserrat; Ferrer, Albert

    2008-05-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate (FPP) to produce squalene (SQ), the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. Arabidopsis thaliana contains two SQS-annotated genomic sequences, At4g34640 (SQS1) and At4g34650 (SQS2), organized in a tandem array. Here we report that the SQS1 gene is widely expressed in all tissues throughout plant development, whereas SQS2 is primarily expressed in the vascular tissue of leaf and cotyledon petioles, and the hypocotyl of seedlings. Neither the complete A. thaliana SQS2 protein nor the chimeric SQS resulting from the replacement of the 69 C-terminal residues of SQS2 by the 111 C-terminal residues of the Schizosaccharomyces pombe SQS were able to confer ergosterol prototrophy to a Saccharomyces cerevisiae erg9 mutant strain lacking SQS activity. A soluble form of SQS2 expressed in Escherichia coli and purified was unable to synthesize SQ from FPP in the presence of NADPH and either Mg2+ or Mn2+. These results demonstrated that SQS2 has no SQS activity, so that SQS1 is the only functional SQS in A. thaliana. Mutational studies revealed that the lack of SQS activity of SQS2 cannot be exclusively attributed to the presence of an unusual Ser replacing the highly conserved Phe at position 287. Expression of green fluorescent protein (GFP)-tagged versions of SQS1 in onion epidermal cells demonstrated that SQS1 is targeted to the endoplasmic reticulum (ER) membrane and that this location is exclusively dependent on the presence of the SQS1 C-terminal hydrophobic trans-membrane domain. PMID:18236008

  17. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    PubMed Central

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-01-01

    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  18. Characterization of the BMR1 gene encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae.

    PubMed

    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Tanaka, Chihiro; Ueno, Makoto; Arase, Sakae

    2008-04-01

    We isolated and characterized Bipolaris melanin regulation 1 gene (BMR1) encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. Sequence analysis showed that the BMR1 gene encodes a putative protein of 1012 amino acids that has 99% sequence similarity to transcription factor Cmr1 of Cochliobolus heterostrophus. The predicted B. oryzae Bmr1 protein has two DNA-binding motifs, two Cys2His2 zinc finger domains, and a Zn(II)2Cys6 binuclear cluster domain at the N-terminal region of Bmr1. Targeted disruption of the BMR1 gene showed that BMR1 is essential for melanin biosynthesis in B. oryzae. The overexpression of the BMR1 gene led to more dark colonies than in the wild-type strain under dark conditions. Real-time PCR analysis showed that the BMR1 expression of the overexpression transformant was about 10-fold that of the wild type under dark conditions and of the expression of three melanin biosynthesis genes. These results indicated that BMR1 encodes the transcription factor of melanin biosynthesis genes in B. oryzae. PMID:18312572

  19. Borrelia burgdorferi supercoiled plasmids encode multicopy tandem open reading frames and a lipoprotein gene family.

    PubMed Central

    Porcella, S F; Popova, T G; Akins, D R; Li, M; Radolf, J D; Norgard, M V

    1996-01-01

    DNA sequencing and Southern blot analyses of a Borrelia burgdorferi DNA fragment encoding a signal sequence led to the discovery of a genetic locus, designated 2.9, which appears to be present in at least seven copies in virulent B. burgdorferi 297. DNA sequence analysis of these regions revealed that each 2.9 locus contained an operon of four genes (ABCD) and open reading frames designated rep+ (positive strand) and rep- (negative strand) which encoded multiple repeat motifs. Downstream of the rep+ gene(s) in six of the completely cloned and sequenced 2.9 loci also were lipoprotein (LP) genes possessing highly similar signal sequences but encoding variable mature polypeptides. The lipoproteins could he separated into two classes on the basis of hydrophilicity profiles, sequence similarities, and reactivity with specific antibodies. The 2.9 loci were localized to two (20- and 30-kb) supercoiled plasmids in B. burgdorferi 297. Northern (RNA) blot analysis established that the 2.9 ABCD operon was only minimally expressed, whereas the rep- gene(s) and at least three of the seven LP genes were expressed by B. burgdorferi in vitro. A single putative promoter element was identified by RNA primer extension analysis upstream of the ABCD operon, whereas a number of potential promoter regions existed upstream of the LP genes. The combined data indicate that the ABCD operon, rep+ and rep- genes, and LP genes are separately transcribed during in vitro growth. The 2.9 loci possess a repetitiveness, diversity, and complexity not previously described for B. burgdorferi; differential expression of these genes may facilitate the spirochete's ability to survive in diverse host environments. PMID:8655511

  20. Molecular cloning and characterization of the pgm gene encoding phosphoglucomutase of Escherichia coli.

    PubMed Central

    Lu, M; Kleckner, N

    1994-01-01

    We report here the identification and characterization of pgm, a gene in Escherichia coli that encodes the enzyme phosphoglucomutase, specifically required for the catalysis of the interconversion of glucose 1-phosphate and glucose 6-phosphate. The predicted amino acid sequence of the pgm gene is highly conserved in E. coli, Acetobacter xylinum, Saccharomyces cerevisiae, rabbits, and humans. pgm deletion mutant strains are deficient in phosphoglucomutase activity. Images PMID:8083177

  1. Genes Encoding Phospholipases A2 Mediate Insect Nodulation Reactions to Bacterial Challenge

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We propose that expression of four genes encoding secretory phospholipases A2 (sPLA2) mediates insect nodulation responses to bacterial infection. Nodulation is the quantitatively predominant cellular defense reaction to bacterial infection. This reaction is mediated by eicosanoids, the biosynthesis...

  2. Haplotypes of the steroid 21-hydroxylase gene region encoding mild steroid 21-hydroxylase deficiency.

    PubMed Central

    Haglund-Stengler, B; Martin Ritzén, E; Gustafsson, J; Luthman, H

    1991-01-01

    Haplotypes of the complement 4 (C4) and steroid 21-hydroxylase [21-OHase; steroid hydrogen-donor: oxygen oxidoreductase (21-hydroxylating), EC 1.14.99.10] repeated gene complex were studied in nine families with at least one member affected with a mild form of 21-OHase deficiency. DNA probes from different parts of the repeated C4/21-OHase unit were used to follow the segregation of hybridization patterns in the families. Ten structurally distinct haplotypes of the C4/21-OHase gene region were identified, and the encoded phenotype was assigned to 34 of the 36 C4/21-OHase haplotypes. Four structurally different haplotypes with three C4/21-OHase repeat units were found. Eight of the nine haplotypes found with triplications of the C4/21-OHase repeat unit encoded the mild form of 21-OHase deficiency, whereas one particular triplicated haplotype encoded a severe form of the disease. In one case the mild form of 21-OHase deficiency was encoded by a haplotype with a single C4/21-OHase repeat unit. Mild 21-OHase deficiency was predicted in a patient by the presence of a triplicated haplotype. The finding of deranged 21-OHase genes on all triplicated C4/21-OHase haplotypes indicate that most of these common haplotypes carry mutated 21-OHase genes, and thus may cause functional polymorphism of general importance in the population. PMID:1924294

  3. Multiple proteins encoded within the urease gene complex of Proteus mirabilis.

    PubMed

    Walz, S E; Wray, S K; Hull, S I; Hull, R A

    1988-03-01

    Chromosomal DNA fragments from a uropathogenic isolate of Proteus mirabilis were inserted into the cosmid vector pHC79 to construct a genomic library in Escherichia coli HB101. A urease-positive recombinant cosmid, designated pSKW1, was recovered. Sequential recombinant manipulation of pSKW1 yielded a 10.2-kilobase plasmid, designated pSKW4, which encoded three urease isozymes with electrophoretic mobilities identical to those of the donor P. mirabilis strain. Plasmid pSKW4 gene sequences encode seven proteins designated 68K (apparent molecular weight, of 68,000), 28K, 25K, 22.5K, 18.5K, 7.5K, and 5.2K within the limits of the urease gene complex. Insertion mutations in genes encoding the 68K, 28K, 25K, 22.5K, 7.5K, and 5.2K proteins resulted in complete or partial (22.5K) loss of urease activity. There was no reduction in urease activity when the gene encoding the 18.5K protein was inactivated. PMID:2830226

  4. The cloning and expression of a gene encoding haemolytic activity from the fish pathogen Renibacterium salmoninarum.

    PubMed

    Evenden, A J; Gilpin, M L; Munn, C B

    1990-09-01

    A gene encoding haemolytic activity from Renibacterium salmoninarum (strain PPD) was cloned into Escherichia coli using the cosmid vector pHC79, and subsequently subcloned on a 1.6 kbp SAlI fragment into pBR328. Southern blot hybridisation revealed that a homologous sequence is found in other strains of R. salmoninarum. PMID:2276613

  5. Cloning of human genes encoding novel G protein-coupled receptors

    SciTech Connect

    Marchese, A.; Docherty, J.M.; Heiber, M.

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  6. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.

    PubMed

    Conner, T W; Thompson, M D; Silflow, C D

    1989-12-14

    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  7. Nucleotide sequence and expression of alpha-glucosidase-encoding gene (agdA) from Aspergillus oryzae.

    PubMed

    Minetoki, T; Gomi, K; Kitamoto, K; Kumagai, C; Tamura, G

    1995-08-01

    We have isolated an alpha-glucosidase(AGL)-encoding gene (agdA) from Aspergillus oryzae by heterologous hybridization using the corresponding Aspergillus niger gene as a probe. Southern hybridization analysis showed that the agdA gene is on a 5.0-kb ScaI fragment and there is a single copy in the A. oryzae chromosome. Comparison with the A. niger agdA gene indicated that the agdA gene contains three putative introns from 52 to 59 nucleotides long, and that it encodes 985 amino acid residues. The deduced amino acid sequence of A. oryzae AGL is 78% homologous with the A. niger AGL. The high degree of homology with the amino acid sequence bordering the putative catalytic residue of a number of AGL enzymes, and this enzyme suggests that Asp492 is a catalytic residue of A. oryzae AGL. The cloned gene was functional. Transformants of A. oryzae containing multiple copies of the cloned agdA gene showed a 6-16 fold increase in AGL activity. Like the Taka-amylase A and glucoamylase genes of A. oryzae, expression of the agdA gene was induced when maltose was provided as a carbon source, but expression was not induced by glucose. This result suggested that cis-element(s) involved in maltose induction may be also present in the agdA promoter region. PMID:7549103

  8. Genes Encoding Cher-TPR Fusion Proteins Are Predominantly Found in Gene Clusters Encoding Chemosensory Pathways with Alternative Cellular Functions

    PubMed Central

    Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino

    2012-01-01

    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  9. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1990--June 30, 1992

    SciTech Connect

    Kuchka, M.R.

    1992-08-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5` UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  10. Multiple conversion between the genes encoding bacterial class-I release factors

    PubMed Central

    Ishikawa, Sohta A.; Kamikawa, Ryoma; Inagaki, Yuji

    2015-01-01

    Bacteria require two class-I release factors, RF1 and RF2, that recognize stop codons and promote peptide release from the ribosome. RF1 and RF2 were most likely established through gene duplication followed by altering their stop codon specificities in the common ancestor of extant bacteria. This scenario expects that the two RF gene families have taken independent evolutionary trajectories after the ancestral gene duplication event. However, we here report two independent cases of conversion between RF1 and RF2 genes (RF1-RF2 gene conversion), which were severely examined by procedures incorporating the maximum-likelihood phylogenetic method. In both cases, RF1-RF2 gene conversion was predicted to occur in the region encoding nearly entire domain 3, of which functions are common between RF paralogues. Nevertheless, the ‘direction’ of gene conversion appeared to be opposite from one another—from RF2 gene to RF1 gene in one case, while from RF1 gene to RF2 gene in the other. The two cases of RF1-RF2 gene conversion prompt us to propose two novel aspects in the evolution of bacterial class-I release factors: (i) domain 3 is interchangeable between RF paralogues, and (ii) RF1-RF2 gene conversion have occurred frequently in bacterial genome evolution. PMID:26257102

  11. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    PubMed Central

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged H4 variant (hH4v) not described in other species. The hH4-1 and hH4-2 genes, which are 96% identical in their coding regions and encode identical proteins, were inactivated independently. Strains with inactivating mutations in either gene were phenotypically wild type, in terms of growth rates and fertility, but the double mutants were inviable. As expected, we were unable to isolate null alleles of hH2A, hH2B, or hH3. The genomic arrangement of the histone and histone variant genes was determined. hH2Az and the hH3-hH4-1 gene pair are on LG IIR, with hH2Az centromere-proximal to hH3-hH4-1 and hH3 centromere-proximal to hH4-1. hH3v and hH4-2 are on LG IIIR with hH3v centromere-proximal to hH4-2. hH4v is on LG IVR and the hH2A-hH2B pair is located immediately right of the LG VII centromere, with hH2A centromere-proximal to hH2B. Except for the centromere-distal gene in the pairs, all of the histone genes are transcribed toward the centromere. Phylogenetic analysis of the N. crassa histone genes places them in the Euascomycota lineage. In contrast to the general case in eukaryotes, histone genes in euascomycetes are few in number and contain introns. This may be a reflection of the evolution of the RIP (repeat-induced point mutation) and MIP (methylation induced premeiotically) processes that detect sizable duplications and silence associated genes. PMID:11901114

  12. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  13. Structure and expression of nuclear genes encoding rubisco activase. Final technical report

    SciTech Connect

    Zielinski, R.E.

    1994-06-01

    Rubisco activase (Rca) is a soluble chloroplast protein that catalyzes the activation of rubisco, the enzyme that initiates the photosynthetic carbon reduction cycle, to catalytic competency. Rca in barley consists of three polypeptides, one of 46- and two of 42-kDa, but the quaternary structure of the protein is not known. The authors have isolated and completely sequenced 8.8 kb of barley genomic DNA containing two, tandemly oriented activase genes (RcaA and RcaB) and three different cDNAs encoding the 42- and 46-kDa Rca polypeptide isoforms. Genomic Southern blot assays indicate that these sequences represent the entire Rca gene family in barley. Pre-mRNAs transcribed from the RcaA gene are alternatively spliced to give mRNAs encoding both 46- (RcaA1) and 42-kDa (RcaA2) Rca isoforms. The RcaB gene encodes a single polypeptide of 42 kDa. Primer extension and northern blot assays indicate that RcaB mRNA is expressed at a level that is 10- to 100-fold lower than RcaA mRNA. Analyses at the mRNA and protein level showed that Rca gene expression is coordinated by that of the rubisco subunits during barley leaf development.

  14. Systematic Identification and Characterization of Novel Human Skin-Associated Genes Encoding Membrane and Secreted Proteins

    PubMed Central

    Buhren, Bettina Alexandra; Martinez, Cynthia; Schrumpf, Holger; Gasis, Marcia; Grether-Beck, Susanne; Krutmann, Jean

    2013-01-01

    Through bioinformatics analyses of a human gene expression database representing 105 different tissues and cell types, we identified 687 skin-associated genes that are selectively and highly expressed in human skin. Over 50 of these represent uncharacterized genes not previously associated with skin and include a subset that encode novel secreted and plasma membrane proteins. The high levels of skin-associated expression for eight of these novel therapeutic target genes were confirmed by semi-quantitative real time PCR, western blot and immunohistochemical analyses of normal skin and skin-derived cell lines. Four of these are expressed specifically by epidermal keratinocytes; two that encode G-protein-coupled receptors (GPR87 and GPR115), and two that encode secreted proteins (WFDC5 and SERPINB7). Further analyses using cytokine-activated and terminally differentiated human primary keratinocytes or a panel of common inflammatory, autoimmune or malignant skin diseases revealed distinct patterns of regulation as well as disease associations that point to important roles in cutaneous homeostasis and disease. Some of these novel uncharacterized skin genes may represent potential biomarkers or drug targets for the development of future diagnostics or therapeutics. PMID:23840300

  15. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.

    PubMed

    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G

    1992-08-01

    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  16. Identification of the Gene Encoding the Enzyme Deficient in Mucopolysaccharidosis IIIC (Sanfilippo Disease Type C)

    PubMed Central

    Fan, Xiaolian; Zhang, Huiwen; Zhang, Sunqu; Bagshaw, Richard D.; Tropak, Michael B.; Callahan, John W.; Mahuran, Don J.

    2006-01-01

    Mucopolysaccharidosis IIIC (MPS IIIC), or Sanfilippo C, represents the only MPS disorder in which the responsible gene has not been identified; however, the gene has been localized to the pericentromeric region of chromosome 8. In an ongoing proteomics study of mouse lysosomal membrane proteins, we identified an unknown protein whose human homolog, TMEM76, was encoded by a gene that maps to 8p11.1. A full-length mouse expressed sequence tag was expressed in human MPS IIIC fibroblasts, and its protein product localized to the lysosome and corrected the enzymatic defect. The mouse sequence was used to identify the full-length human homolog (HGSNAT), which encodes a protein with no homology to other proteins of known function but is highly conserved among plants and bacteria. Mutational analyses of two MPS IIIC cell lines identified a splice-junction mutation that accounted for three mutant alleles, and a single base-pair insertion accounted for the fourth. PMID:16960811

  17. Cloning and expression analysis of a prion protein encoding gene in guppy ( Poecilia reticulata)

    NASA Astrophysics Data System (ADS)

    Wu, Suihan; Wei, Qiwei; Yang, Guanpin; Wang, Dengqiang; Zou, Guiwei; Chen, Daqing

    2008-11-01

    The full length cDNA of a prion protein (PrP) encoding gene of guppy ( Poecilia reticulata) and the corresponding genomic DNA were cloned. The cDNA was 2245 bp in length and contained an open reading frame (ORF) of 1545 bp encoding a protein of 515 amino acids, which held all typical structural characteristics of the functional PrP. The cloned genomic DNA fragment corresponding to the cDNA was 3720 bp in length, consisting of 2 introns and 2 exons. The 5' untranslated region of cDNA originated from the 2 exons, while the ORF originated from the second exon. Although the gene was transcribed in diverse tissues including brain, eye, liver, intestine, muscle and tail, its transcript was most abundant in the brain. In addition, the transcription of the gene was enhanced by 5 salinity, implying that it was associated with the response of guppy to saline stress.

  18. A novel gene encoding amidinotransferase in the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum.

    PubMed

    Shalev-Alon, Gali; Sukenik, Assaf; Livnah, Oded; Schwarz, Rakefet; Kaplan, Aaron

    2002-03-19

    The hepatotoxin cylindrospermopsin is produced by several cyanobacteria species, which may flourish in tropical and sub-tropical lakes. Biosynthesis of cylindrospermopsin is poorly understood but its chemical nature, and feeding experiments with stable isotopes, suggested that guanidinoacetic acid is the starter unit and indicated involvement of a polyketide synthase. We have identified a gene encoding an amidinotransferase from the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum. This is the first report on an amidinotransferase gene in cyanobacteria. It is likely to be involved in the formation of guanidinoacetic acid. The aoaA is located in a genomic region bearing genes encoding a polyketide synthase and a peptide synthetase, further supporting its putative role in cylindrospermopsin biosynthesis. PMID:12007659

  19. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase

    PubMed Central

    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E.; Segerson, Nicholas A.; Kannan, Latha

    2013-01-01

    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  20. Characterization of the gene encoding a fibrinogen-related protein expressed in Crassostrea gigas hemocytes.

    PubMed

    Skazina, M A; Gorbushin, A M

    2016-07-01

    Four exons of the CgFrep1 gene (3333 bp long) encode a putative fibrinogen-related protein (324 aa) bearing a single C-terminal FBG domain. Transcripts of the gene obtained from hemocytes of different Pacific oysters show prominent individual variation based on SNP and indels of tandem repeats resulted in polymorphism of N-terminus of the putative CgFrep1 polypeptide. The polypeptide chain bears N-terminal coiled-coil region potentially acting as inter-subunit interface in the protein oligomerization. It is suggested that CgFrep1 gene encodes the oligomeric lectin composed of at least two subunits. PMID:27189918

  1. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase.

    PubMed

    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E; Segerson, Nicholas A; Kannan, Latha; Mor, Tsafrir S

    2013-04-01

    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  2. Expression patterns of genes encoding plasma membrane aquaporins during fruit development in cucumber (Cucumis sativus L.).

    PubMed

    Shi, Jin; Wang, Jinfang; Li, Ren; Li, Dianbo; Xu, Fengfeng; Sun, Qianqian; Zhao, Bin; Mao, Ai-Jun; Guo, Yang-Dong

    2015-11-01

    Aquaporins are membrane channels precisely regulating water movement through cell membranes in most living organisms. Despite the advances in the physiology of fruit development, their participation during fruit development in cucumber still barely understood. In this paper, the expressions of 12 genes encoding plasma membrane intrinsic proteins (PIPs) were analyzed during cucumber fruit development in our work. Based on the homology search with known PIPs from rice, Arabidopsis and strawberry, 12 cucumber PIP genes subfamily members were identified. Cellular localization assays indicated that CsPIPs were localized in the plasma membrane. The qRT-PCR analysis of CsPIPs showed that 12 CsPIPs were differentially expressed during fruit development. These results suggest that 12 genes encoding plasma membrane intrinsic proteins (CsPIPs) play very important roles in cucumber life cycle and the data generated will be helpful in understanding their precise roles during fruit development in cucumber. PMID:26351149

  3. Cloning and expression of a gene segment encoding the enzymatic moiety of Pseudomonas aeruginosa exotoxin A.

    PubMed Central

    Mozola, M A; Wilson, R B; Jordan, E M; Draper, R K; Clowes, R C

    1984-01-01

    Using the broad-host-range plasmid vector pRO1614, we cloned a segment of the gene from Pseudomonas aeruginosa PA103 encoding the enzymatically active part of the exotoxin A protein. Expression of the cloned gene segment has been achieved both in Escherichia coli and in a nontoxigenic P. aeruginosa host, as assayed by the production of exotoxin A-related antigen and by the ability of the gene product to ADP-ribosylate elongation factor 2. Western blot hybridization analysis revealed a series of polypeptides antigenically related to exotoxin A, the largest of which had a molecular weight of ca. 50,000. Images PMID:6086583

  4. Horse cDNA clones encoding two MHC class I genes

    SciTech Connect

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  5. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    PubMed Central

    Karlyshev, A.V.; Thacker, G.; Jones, M.A.; Clements, M.O.; Wren, B.W.

    2014-01-01

    According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection. PMID:24918062

  6. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1991--May 31, 1992

    SciTech Connect

    Kuchka, M.R.

    1992-05-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  7. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  8. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity

    PubMed Central

    Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.

    2016-01-01

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  9. A gene encoding a new cold-active lipase from an Antarctic isolate of Penicillium expansum.

    PubMed

    Mohammed, Suja; Te'o, Junior; Nevalainen, Helena

    2013-08-01

    Cold-active lipases are of significant interest as biocatalysts in industrial processes. We have identified a lipase that displayed activity towards long carbon-chain-p-nitrophenyl substrates (C12-C18) at 25 °C from the culture supernatant of an Antarctic Penicillium expansum strain assigned P. expansum SM3. Zymography revealed a protein band of around 30 kDa with activity towards olive oil. DNA fragments of a lipase gene designated as lipPE were isolated from the genomic DNA of P. expansum SM3 by genomic walking PCR. Subsequently, the complete genomic lipPE gene was amplified using gene-specific primers designed from the 5'- and 3'-regions. Reverse transcription PCR was used to amplify the lipPE cDNA. The deduced amino acid sequence consisted of 285 residues that included a predicted signal peptide. Three peptides identified by LC/MS/MS analysis of the proteins in the culture supernatant of P. expansum were also present in the deduced amino acid sequence of the lipPE gene suggesting that this gene encoded the lipase identified by initial zymogram activity analysis. Full analysis of the nucleotide and the deduced amino acid sequences indicated that the lipPE gene encodes a novel P. expansum lipase. The lipPE gene was expressed in E. coli for further characterization of the enzyme with a view of assessing its suitability for industrial applications. PMID:23779196

  10. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    PubMed

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-01-01

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  11. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  12. Isolation and expression of two aquaporin-encoding genes from the marine phanerogam Posidonia oceanica.

    PubMed

    Maestrini, Pierluigi; Giordani, Tommaso; Lunardi, Andrea; Cavallini, Andrea; Natali, Lucia

    2004-12-01

    Seagrasses such as Posidonia oceanica (L.) Delile are marine phanerogams, widespread in various seas, where they form large prairies representing dynamic substrates exceeding the area of the sediment surface several times over and allowing settlement of epiphyte organisms. Studying mechanisms involved in water transport in marine plants, we isolated two aquaporin-encoding genes, PoPIP1;1 and PoTIP1;1, showing high similarity to plasma membrane- and tonoplast-intrinsic protein-encoding genes, respectively. PoPIP1;1 is unique in the genome of P. oceanica, while PoTIP1;1 belongs to an aquaporin subfamily of at least four members. PoPIP1;1 and PoTIP1;1 encode functional proteins, as indicated by expression experiments in Xenopus oocytes. Both genes are constitutively expressed in the leaves, with higher levels of transcripts in young than in differentiated leaf tissues. Variations of salt concentration in aquarium determined different PoPIP1;1 and PoTIP1;1 transcript accumulation, indicating the existence of adaptation mechanisms related to gene expression also in marine plants, i.e. adapted to very high salt concentrations. Hyposalinity induced lower levels of PIP1 transcripts, while hypersalinity determined more PIP1 transcripts than normal salinity. TIP1 transcripts increased in response to both hypo- and hypersalinity after 2 days of treatment and went back to control levels after 5 d. PMID:15653802

  13. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce.

    PubMed

    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka

    2011-07-15

    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. PMID:21616548

  14. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.

    PubMed

    Perumal, N; Murugesan, S; Krishnan, P

    2016-01-01

    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates. PMID:27514959

  15. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  16. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein

    SciTech Connect

    Hickey, E.; Brandon, S.E.; Weber, L.A.; Lloyd, D.

    1989-06-01

    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89/alpha/ and hspio/beta/) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89/alpha/, is induced by the adenovirus E1A gene product. The authors have isolated a human hsp89/alpha/ gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression n a /beta/-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89/alpha/ protein sequence differed from the human hsp89/beta/ sequence reported elsewhere in at least 99 out of the 732 amino acids. Transcription of the hsp89/alpha/ gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycles. hsp89/alpha/ mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells.

  17. The Coxiella burnetii Cryptic Plasmid Is Enriched in Genes Encoding Type IV Secretion System Substrates▿ †

    PubMed Central

    Voth, Daniel E.; Beare, Paul A.; Howe, Dale; Sharma, Uma M.; Samoilis, Georgios; Cockrell, Diane C.; Omsland, Anders; Heinzen, Robert A.

    2011-01-01

    The intracellular bacterial pathogen Coxiella burnetii directs biogenesis of a phagolysosome-like parasitophorous vacuole (PV), in which it replicates. The organism encodes a Dot/Icm type IV secretion system (T4SS) predicted to deliver to the host cytosol effector proteins that mediate PV formation and other cellular events. All C. burnetii isolates carry a large, autonomously replicating plasmid or have chromosomally integrated plasmid-like sequences (IPS), suggesting that plasmid and IPS genes are critical for infection. Bioinformatic analyses revealed two candidate Dot/Icm substrates with eukaryotic-like motifs uniquely encoded by the QpH1 plasmid from the Nine Mile reference isolate. CpeC, containing an F-box domain, and CpeD, possessing kinesin-related and coiled-coil regions, were secreted by the closely related Legionella pneumophila Dot/Icm T4SS. An additional QpH1-specific gene, cpeE, situated in a predicted operon with cpeD, also encoded a secreted effector. Further screening revealed that three hypothetical proteins (CpeA, CpeB, and CpeF) encoded by all C. burnetii plasmids and IPS are Dot/Icm substrates. By use of new genetic tools, secretion of plasmid effectors by C. burnetii during host cell infection was confirmed using β-lactamase and adenylate cyclase translocation assays, and a C-terminal secretion signal was identified. When ectopically expressed in HeLa cells, plasmid effectors trafficked to different subcellular sites, including autophagosomes (CpeB), ubiquitin-rich compartments (CpeC), and the endoplasmic reticulum (CpeD). Collectively, these results suggest that C. burnetii plasmid-encoded T4SS substrates play important roles in subversion of host cell functions, providing a plausible explanation for the absolute maintenance of plasmid genes by this pathogen. PMID:21216993

  18. Mammalian ets-1 and ets-2 genes encode highly conserved proteins

    SciTech Connect

    Watson, D.K.; McWilliams, M.J.; Lapis, P.; Lautenberger, J.A.; Schweinfest, C.W.; Papas, T.S. )

    1988-11-01

    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, the authors have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is >95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published finding indicates that ets is a family of genes whose members share distinct domains.

  19. Mammalian ets-1 and ets-2 genes encode highly conserved proteins.

    PubMed Central

    Watson, D K; McWilliams, M J; Lapis, P; Lautenberger, J A; Schweinfest, C W; Papas, T S

    1988-01-01

    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, we have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is greater than 95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published findings indicates that ets is a family of genes whose members share distinct domains. PMID:2847145

  20. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  1. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  2. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.

    PubMed

    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J

    1996-12-15

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  3. Cloning and characterization of two Lactobacillus casei genes encoding a cystathionine lyase.

    PubMed

    Irmler, Stefan; Raboud, Sylvie; Beisert, Beata; Rauhut, Doris; Berthoud, Hélène

    2008-01-01

    Volatile sulfur compounds are key flavor compounds in several cheese types. To better understand the metabolism of sulfur-containing amino acids, which certainly plays a key role in the release of volatile sulfur compounds, we searched the genome database of Lactobacillus casei ATCC 334 for genes encoding putative homologs of enzymes known to degrade cysteine, cystathionine, and methionine. The search revealed that L. casei possesses two genes that putatively encode a cystathionine beta-lyase (CBL; EC 4.4.1.8). The enzyme has been implicated in the degradation of not only cystathionine but also cysteine and methionine. Recombinant CBL proteins catalyzed the degradation of L-cystathionine, O-succinyl-L-homoserine, L-cysteine, L-serine, and L-methionine to form alpha-keto acid, hydrogen sulfide, or methanethiol. The two enzymes showed notable differences in substrate specificity and pH optimum. PMID:17993563

  4. Human TOP3: a single-copy gene encoding DNA topoisomerase III.

    PubMed Central

    Hanai, R; Caron, P R; Wang, J C

    1996-01-01

    A human cDNA encoding a protein homologous to the Escherichia coli DNA topoisomerase I subfamily of enzymes has been identified through cloning and sequencing. Expressing the cloned human cDNA in yeast (delta)top1 cells lacking endogenous DNA topoisomerase I yielded an activity in cell extracts that specifically reduces the number of supercoils in a highly negatively supercoiled DNA. On the basis of these results, the human gene containing the cDNA sequence has been denoted TOP3, and the protein it encodes has been denoted DNA topoisomerase III. Screening of a panel of human-rodent somatic hybrids and fluorescence in situ hybridization of cloned TOP3 genomic DNA to metaphase chromosomes indicate that human TOP3 is a single-copy gene located at chromosome 17p11.2-12. Images Fig. 2 PMID:8622991

  5. Immunoglobulin kappa light chain variable region gene complex organization and immunoglobulin genes encoding anti-DNA autoantibodies in lupus mice.

    PubMed Central

    Kofler, R; Strohal, R; Balderas, R S; Johnson, M E; Noonan, D J; Duchosal, M A; Dixon, F J; Theofilopoulos, A N

    1988-01-01

    We have investigated the genetic origin of autoantibody production in several strains of mice that spontaneously develop a systemic lupus erythematosus-like disease. Restriction fragment length polymorphism analyses of gene loci encoding kappa light chain variable regions (Igk-V) demonstrated, as shown previously for the Ig heavy chain locus, that autoantibody production and disease occur in different Igk-V haplotypes. Moreover, autoimmune mice with known genetic derivation inherited their Igk-V loci essentially unaltered from their nonautoimmune ancestors. New Zealand black lupus mice, with unknown genetic derivation, had a possibly recombinant Igk-V haplotype, composed of V kappa loci that were primarily indistinguishable from those of nonautoimmune strains from either of the two potential donor haplotypes. The heavy and light chain gene segments (variable, diversity, joining) encoding anti-DNA antibodies were diverse and often closely related, or even identical, to those found in antibodies to foreign antigens in normal mice. Only 1 of 11 sequenced variable region genes could not be assigned to existing variable region gene families; however, corresponding germline genes were present in the genome of normal mice as well. These data argue against abnormalities in the genes and mechanisms generating antibody diversity in lupus mice and suggest a remarkable genetic and structural diversity in the generation of anti-DNA binding sites. Images PMID:3138286

  6. Identification of the Repressor-Encoding Gene of the Lactobacillus Bacteriophage A2

    PubMed Central

    Ladero, Victor; García, Pilar; Bascarán, Victoria; Herrero, Mónica; Alvarez, Miguel A.; Suárez, Juan E.

    1998-01-01

    The repressor gene of the Lactobacillus phage A2 has the following properties: it (i) encodes a 224-residue polypeptide with DNA binding and RecA cleavage motifs, (ii) is expressed in lysogenic cultures, and (iii) confers superinfection immunity on the host. Adjacent, but divergently transcribed, lies another open reading frame whose product resembles the λ Cro protein. In the 161-bp intergenic segment, putative promoters and operators have been detected. PMID:9642205

  7. Nucleotide sequence, transcription and phylogeny of the gene encoding the superoxide dismutase of Sulfolobus acidocaldarius.

    PubMed

    Klenk, H P; Schleper, C; Schwass, V; Brudler, R

    1993-07-18

    The gene encoding the superoxide dismutase (SOD) of the thermophilic archaeon Sulfolobus acidocaldarius has been isolated and sequenced. Both the start site and the termination sites of the corresponding transcript were mapped. The deduced amino acid sequence of the protein is very similar to the sequence of manganese- or iron-containing SODs. Phylogenetic sequence analysis corroborated the monophyletic nature of the archaeal domain. PMID:8334170

  8. Cloning and Expression of clt Genes Encoding Milk-Clotting Proteases from Myxococcus xanthus 422

    PubMed Central

    Poza, M.; Prieto-Alcedo, M.; Sieiro, C.; Villa, T. G.

    2004-01-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems. PMID:15466588

  9. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  10. Genes encoding farnesyl cysteine carboxyl methyltransferase in Schizosaccharomyces pombe and Xenopus laevis.

    PubMed Central

    Imai, Y; Davey, J; Kawagishi-Kobayashi, M; Yamamoto, M

    1997-01-01

    The mam4 mutation of Schizosaccharomyces pombe causes mating deficiency in h- cells but not in h+ cells. h- cells defective in mam4 do not secrete active mating pheromone M-factor. We cloned mam4 by complementation. The mam4 gene encodes a protein of 236 amino acids, with several potential membrane-spanning domains, which is 44% identical with farnesyl cysteine carboxyl methyltransferase encoded by STE14 and required for the modification of a-factor in Saccharomyces cerevisiae. Analysis of membrane fractions revealed that mam4 is responsible for the methyltransferase activity in S. pombe. Cells defective in mam4 produced farnesylated but unmethylated cysteine and small peptides but no intact M-factor. These observations strongly suggest that the mam4 gene product is farnesyl cysteine carboxyl methyltransferase that modifies M-factor. Furthermore, transcomplementation of S. pombe mam4 allowed us to isolate an apparent homolog of mam4 from Xenopus laevis (Xmam4). In addition to its sequence similarity to S. pombe mam4, the product of Xmam4 was shown to have a farnesyl cysteine carboxyl methyltransferase activity in S. pombe cells. The isolation of a vertebrate gene encoding farnesyl cysteine carboxyl methyltransferase opens the way to in-depth studies of the role of methylation in a large body of proteins, including Ras superfamily proteins. PMID:9032282

  11. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    PubMed Central

    Liao, Liao; Vimolmangkang, Sornkanok; Wei, Guochao; Zhou, Hui; Korban, Schuyler S.; Han, Yuepeng

    2015-01-01

    Proanthocyanidins (PAs) are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR) and anthocyanidin reductase (ANR) was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis. PMID:25914714

  12. Four genes from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin.

    PubMed Central

    Hammer, P E; Hill, D S; Lam, S T; Van Pée, K H; Ligon, J M

    1997-01-01

    Pyrrolnitrin is a secondary metabolite of Pseudomonas and Burkholderia sp. strains with strong antifungal activity. Production of pyrrolnitrin has been correlated with the ability of some bacteria to control plant diseases caused by fungal pathogens, including the damping-off pathogen Rhizoctonia solani. Pseudomonas fluorescens BL915 has been reported to produce pyrrolnitrin and to be an effective biocontrol agent for this pathogen. We have isolated a 32-kb genomic DNA fragment from this strain that contains genes involved in the biosynthesis of pyrrolnitrin. Marker-exchange mutagenesis of this DNA with Tn5 revealed the presence of a 6.2-kb region that contains genes required for the synthesis of pyrrolnitrin. The nucleotide sequence of the 6.2-kb region was determined and found to contain a cluster of four genes that are required for the production of pyrrolnitrin. Deletion mutations in any of the four genes resulted in a pyrrolnitrin-nonproducing phenotype. The putative coding sequences of the four individual genes were cloned by PCR and fused to the tac promoter from Escherichia coli. In each case, the appropriate tac promoter-pyrrolnitrin gene fusion was shown to complement the pyrrolnitrin-negative phenotype of the corresponding deletion mutant. Transfer of the four gene cluster to E. coli resulted in the production of pyrrolnitrin by this organism, thereby demonstrating that the four genes are sufficient for the production of this metabolite and represent all of the genes required to encode the pathway for pyrrolnitrin biosynthesis. PMID:9172332

  13. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  14. The yeast SNF3 gene encodes a glucose transporter homologous to the mammalian protein.

    PubMed Central

    Celenza, J L; Marshall-Carlson, L; Carlson, M

    1988-01-01

    The SNF3 gene is required for high-affinity glucose transport in the yeast Saccharomyces cerevisiae and has also been implicated in control of gene expression by glucose repression. We report here the nucleotide sequence of the cloned SNF3 gene. The predicted amino acid sequence shows that SNF3 encodes a 97-kilodalton protein that is homologous to mammalian glucose transporters and has 12 putative membrane-spanning regions. We also show that a functional SNF3-lacZ gene-fusion product cofractionates with membrane proteins and is localized to the cell surface, as judged by indirect immunofluorescence microscopy. Expression of the fusion protein is regulated by glucose repression. Images PMID:3281163

  15. A Putative Gene Cluster from a Lyngbya wollei Bloom that Encodes Paralytic Shellfish Toxin Biosynthesis

    PubMed Central

    Mihali, Troco K.; Carmichael, Wayne W.; Neilan, Brett A.

    2011-01-01

    Saxitoxin and its analogs cause the paralytic shellfish-poisoning syndrome, adversely affecting human health and coastal shellfish industries worldwide. Here we report the isolation, sequencing, annotation, and predicted pathway of the saxitoxin biosynthetic gene cluster in the cyanobacterium Lyngbya wollei. The gene cluster spans 36 kb and encodes enzymes for the biosynthesis and export of the toxins. The Lyngbya wollei saxitoxin gene cluster differs from previously identified saxitoxin clusters as it contains genes that are unique to this cluster, whereby the carbamoyltransferase is truncated and replaced by an acyltransferase, explaining the unique toxin profile presented by Lyngbya wollei. These findings will enable the creation of toxin probes, for water monitoring purposes, as well as proof-of-concept for the combinatorial biosynthesis of these natural occurring alkaloids for the production of novel, biologically active compounds. PMID:21347365

  16. Neurally expressed Drosophila genes encoding homologs of the NSF and SNAP secretory proteins.

    PubMed Central

    Ordway, R W; Pallanck, L; Ganetzky, B

    1994-01-01

    Several lines of investigation have now converged to indicate that the neurotransmitter release apparatus is formed by assembly of cytosolic proteins with proteins of the synaptic vesicle and presynaptic terminal membranes. We are undertaking a genetic approach in Drosophila melanogaster to investigate the functions of two types of cytosolic proteins thought to function in this complex: N-ethylmaleimide-sensitive fusion protein (NSF) and the soluble NSF attachment proteins (SNAPs). We have identified Drosophila homologs of the vertebrate and yeast NSF and SNAP genes. Both Drosophila genes encode polypeptides that closely resemble their vertebrate counterparts and are expressed in the nervous system; neither appears to be in a family of closely related Drosophila genes. These results indicate that the Drosophila NSF and SNAP genes are excellent candidates for mutational analysis of neurotransmitter release. Images PMID:8202553

  17. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    PubMed Central

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-01-01

    Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of

  18. Conservation of structure in the human gene encoding argininosuccinate synthetase and the argG genes of the archaebacteria Methanosarcina barkeri MS and Methanococcus vannielii

    SciTech Connect

    Morris, C.J.; Reeve, J.N.

    1988-07-01

    The DNA sequences of the argG genes of Methanosarcina barkeri MS and Methanococcus vannielii were determined. The polypeptide products of these methanogen genes have amino acid sequences which are 50% identical to each other and 38% identical to the amino acid sequence encoded by the exons of the human argininosuccinate synthetase gene. Introns in the human chromosomal gene separate regions which encode amino acids conserved in both the archaebacterial and human gene products. An open reading frame immediately upstream of argG in Methanosarcina barkeri MS codes for an amino acid sequence which is 45 and 31% identical to the sequences of the large subunits of carbamyl phosphate synthetase in Escherichia coli and Saccharomyces cerevisiae, respectively. If this gene encodes carbamyl phosphate synthetase in Methanosarcina barkeri, this is the first example, in an archaebacterium, of physical linkage of genes that encode enzymes which catalyze reactions in the same amino acid biosynthetic pathway.

  19. funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi

    PubMed Central

    2014-01-01

    Background RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA http://funrna.riceblast.snu.ac.kr/, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. Description To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. Conclusions funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi. PMID:25522231

  20. Somatic diversity in CDR3 loops allows single V-genes to encode innate immunological memories for multiple pathogens.

    PubMed

    Thomson, Christy A; Little, Ken Q; Reason, Donald C; Schrader, John W

    2011-02-15

    The human Ab response to many common pathogens is oligoclonal, with restricted usage of Ig V-genes. Intriguingly, the IGVK3-11 and IGVH3-30 V-genes are repeatedly paired in protective Abs against the 23F polysaccharide of Streptococcus pneumoniae, as well as against the gB envelope protein of human CMV, where germline-encoded amino acids make key contacts with the gB protein. We constructed IgGs encoded by the germline IGVK3-11 and IGVH3-30 V-genes together with DNA encoding the respective CDR3 regions of the L chain and H chain found in a hypermutated anti-23F Ab. These IgGs encoded by germline V-genes bound specifically to 23F pneumococcal capsular polysaccharides with no reactivity to other serotypes of pneumococcal capsular polysaccharides or arrayed glycans and recognized L-rhamnose, a component of the 23F repeating subunit. IgGs encoded by this pair of germline V-genes mediated complement-dependent phagocytosis of encapsulated 23F S. pneumoniae by human neutrophils. Mutations in CDRL3 and CDRH3 had significant effects on binding. Thus, IGKV3-11 and IGHV3-30, depending on with which distinct DNA sequences encoding CDR3 they are recombined, can encode binding sites for protective Abs against chemically distinct Ags and thus, may encode innate immunological memory against human CMV and S. pneumoniae. PMID:21228346

  1. Identification of candidate genes encoding an LDL-C QTL in baboons[S

    PubMed Central

    Karere, Genesio M.; Glenn, Jeremy P.; Birnbaum, Shifra; Hafizi, Sussan; Rainwater, David L.; Mahaney, Michael C.; VandeBerg, John L.; Cox, Laura A.

    2013-01-01

    Cardiovascular disease (CVD) is the leading cause of death in developed countries, and dyslipidemia is a major risk factor for CVD. We previously identified a cluster of quantitative trait loci (QTL) on baboon chromosome 11 for multiple, related quantitative traits for serum LDL-cholesterol (LDL-C). Here we report differentially regulated hepatic genes encoding an LDL-C QTL that influences LDL-C levels in baboons. We performed hepatic whole-genome expression profiling for LDL-C-discordant baboons fed a high-cholesterol, high-fat (HCHF) diet for seven weeks. We detected expression of 117 genes within the QTL 2-LOD support interval. Three genes were differentially expressed in low LDL-C responders and 8 in high LDL-C responders in response to a HCHF diet. Seven genes (ACVR1B, CALCOCO1, DGKA, ERBB3, KRT73, MYL6B, TENC1) showed discordant expression between low and high LDL-C responders. To prioritize candidate genes, we integrated miRNA and mRNA expression profiles using network tools and found that four candidates (ACVR1B, DGKA, ERBB3, TENC1) were miRNA targets and that the miRNAs were inversely expressed to the target genes. Candidate gene expression was validated using QRT-PCR and Western blotting. This study reveals candidate genes that influence variation in LDL-C in baboons and potential genetic mechanisms for further investigation. PMID:23596326

  2. Clusters of genes encoding fructan biosynthesizing enzymes in wheat and barley.

    PubMed

    Huynh, Bao-Lam; Mather, Diane E; Schreiber, Andreas W; Toubia, John; Baumann, Ute; Shoaei, Zahra; Stein, Nils; Ariyadasa, Ruvini; Stangoulis, James C R; Edwards, James; Shirley, Neil; Langridge, Peter; Fleury, Delphine

    2012-10-01

    Fructans are soluble carbohydrates with health benefits and possible roles in plant adaptation. Fructan biosynthetic genes were isolated using comparative genomics and physical mapping followed by BAC sequencing in barley. Genes encoding sucrose:sucrose 1-fructosyltransferase (1-SST), fructan:fructan 1-fructosyltransferase (1-FFT) and sucrose:fructan 6-fructosyltransferase (6-SFT) were clustered together with multiple copies of vacuolar invertase genes and a transposable element on two barley BAC. Intron-exon structures of the genes were similar. Phylogenetic analysis of the fructosyltransferases and invertases in the Poaceae showed that the fructan biosynthetic genes may have evolved from vacuolar invertases. Quantitative real-time PCR was performed using leaf RNA extracted from three wheat cultivars grown under different conditions. The 1-SST, 1-FFT and 6-SFT genes had correlated expression patterns in our wheat experiment and in existing barley transcriptome database. Single nucleotide polymorphism (SNP) markers were developed and successfully mapped to a major QTL region affecting wheat grain fructan accumulation in two independent wheat populations. The alleles controlling high- and low- fructan in parental lines were also found to be associated in fructan production in a diverse set of 128 wheat lines. To the authors' knowledge, this is the first report on the mapping and sequencing of a fructan biosynthetic gene cluster and in particular, the isolation of a novel 1-FFT gene from barley. PMID:22864927

  3. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    PubMed

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. PMID:20722697

  4. Entamoeba histolytica: a unicellular organism containing two active genes encoding for members of the TBP family.

    PubMed

    Castañon-Sanchez, Carlos Alberto; Luna-Arias, Juan Pedro; de Dios-Bravo, Ma Guadalupe; Herrera-Aguirre, Maria Esther; Olivares-Trejo, Jose J; Orozco, Esther; Hernandez, Jose Manuel

    2010-03-01

    Entamoeba histolytica is the protozoan parasite which causes human amoebiasis. In this parasite, few encoding genes for transcription factors have been cloned and characterized. The E. histolytica TATA-box binding protein (EhTBP) is the first basal transcription factor that has been studied. To continue with the identification of other members of the basal transcription machinery, we performed an in silico analysis of the E. histolytica genome and found three loci encoding for polypeptides with similarity to EhTBP. One locus has a 100% identity to the previously Ehtbp gene reported by our group. The second locus encodes for a 212 aa polypeptide that is 100% identical to residues 23-234 from EhTBP. The third one encodes for a 216 aa polypeptide of 24kDa that showed 42.6% identity and 73.7% similarity to EhTBP. This protein was named E. histolytica TBP-related factor 1 (EhTRF1). Ehtrf1 gene was expressed in bacteria and the purified 28kDa recombinant polypeptide showed the capacity to bind to TATTTAAA-box by electrophoretic mobility shift assays. K(D) values for rEhTBP and rEhTRF1 were (1.71+/-2.90)x10(-12)M and (1.12+/-0.160)x10(-11)M, respectively. Homology modeling of EhTRF1 and EhTBP revealed that, although they were very similar, they showed some differences on their surfaces. Thus, E. histolytica is a unicellular organism having two members of the TBP family. PMID:20026212

  5. Cloning and characterization of a Pseudomonas mendocina KR1 gene cluster encoding toluene-4-monooxygenase

    SciTech Connect

    Kwangmu Yen; Karl, M.R.; Blatt, L.M.; Simon, M.J.; Winter, R.B.; Fausset, P.R.; Lu, H.S.; Harcourt, A.A.; Chen, K.K. )

    1991-09-01

    Pseudomonas mendocina KR1 metabolizes toluene as a carbon source by a previously unknown pathway. The initial step of the pathway is hydroxylation of toluene to form p-cresol by a multicomponent toluene-4-monooxygenase (T4MO) system. The authors have cloned and characterized a gene cluster from KR 1 that determines the T4MO activity. To clone the T4MO genes, KR1 DNA libraries were constructed in Escherichia coli HB 101 by using a broad-host-range vector and transferred to a KR1 mutant able to grow on p-cresol but no on toluene. An insert consisting of two SacI fragments of identical size was shown to complement the mutant for growth on toluene. One of the SacI fragments, when cloned into the E. coli vector pUC19, was found to direct the synthesis of indigo dye. The indigo-forming property was correlated with the presence of T4MO activity. The T4MO genes were mapped to a 3.6-kb region, and the direction of transcription was determined. DNA sequencing and N-terminal amino acid determination identified a five-gene cluster, tmoABCDE, within this region. Expression of this cluster carrying a single mutation in each gene demonstrated that each of the five genes is essential for T4MO activity. Other evidence presented indicated that none of the tmo genes was involved in the regulation of the tmo gene cluster, in the control of substrate transport of the T4MO system, or in major processing of the products of the tmo genes. It was tentatively concluded that the tmoABCDE genes encode structural polypeptides of the T4MO enzyme system. One of the tmo genes was tentatively identified as a ferredoxin gene.

  6. Response of NBS encoding resistance genes linked to both heat and fungal stress in Brassica oleracea.

    PubMed

    Kim, Young-Wook; Jung, Hee-Jeong; Park, Jong-In; Hur, Yoonkang; Nou, Ill-Sup

    2015-01-01

    Environmental stresses, including both abiotic and biotic stresses, cause considerable yield loss in crops and can significantly affect their development. Under field conditions, crops are exposed to a variety of concurrent stresses. Among abiotic and biotic stresses, heat and Fusarium oxysporum, are the most important factors affecting development and yield productivity of Brassica oleracea. Genes encoding the nucleotide-binding site (NBS) motif are known to be related to responses to abiotic and biotic stresses in many plants. Hence, this study was conducted to characterize the NBS encoding genes obtained from transcriptome profiles of two cabbage genotypes with contrasting responses to heat stress, and to test expression levels of selected NBS- leucine reich repeat (LRR) genes in F. oxysporum infected plants. We selected 80 up-regulated genes from a total of 264 loci, among which 17 were confirmed to be complete and incomplete members of the TIR-NBS-LRR (TNL) class families, and another identified as an NFYA-HAP2 family member. Expression analysis using qRT-PCR revealed that eight genes showed significant responses to heat shock treatment and F. oxysporum infection. Additionally, in the commercial B. oleracea cultivars with resistance to F. oxysporum, the Bol007132, Bol016084, and Bol030522 genes showed dramatically higher expression in the F. oxysporum resistant line than in the intermediate and susceptible lines. The results of this study will facilitate the identification and the development of molecular markers based on multiple stress resistance genes related to heat and fungal stress under field conditions in B. oleracea. PMID:25461701

  7. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae.

    PubMed

    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem

    2014-09-01

    Proteins containing nucleotide binding sites (NBS) encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL)-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution. PMID:25249784

  8. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    PubMed Central

    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem

    2014-01-01

    Proteins containing nucleotide binding sites (NBS) encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL)-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution. PMID:25249784

  9. The Arabidopsis HUELLENLOS Gene, Which Is Essential for Normal Ovule Development, Encodes a Mitochondrial Ribosomal Protein

    PubMed Central

    Skinner, Debra J.; Baker, Shawn C.; Meister, Robert J.; Broadhvest, Jean; Schneitz, Kay; Gasser, Charles S.

    2001-01-01

    The HUELLENLOS (HLL) gene participates in patterning and growth of the Arabidopsis ovule. We have isolated the HLL gene and shown that it encodes a protein homologous to the L14 proteins of eubacterial ribosomes. The Arabidopsis genome also includes a highly similar gene, HUELLENLOS PARALOG (HLP), and genes for both cytosolic (L23) and chloroplast ribosome L14 proteins. Phylogenetic analysis shows that HLL and HLP differ significantly from these other two classes of such proteins. HLL and HLP fusions to green fluorescent protein were localized to mitochondria. Ectopic expression of HLP complemented the hll mutant, indicating that HLP and HLL share redundant functions. We conclude that HLL and HLP encode L14 subunits of mitochondrial ribosomes. HLL mRNA was at significantly higher levels than HLP mRNA in pistils, with the opposite pattern in leaves. This differential expression can explain the confinement of effects of hll mutations to gynoecia and ovules. Our elucidation of the nature of HLL shows that metabolic defects can have specific effects on developmental patterning. PMID:11752383

  10. Comparative sequence analysis of double stranded RNA binding protein encoding gene of parapoxviruses from Indian camels.

    PubMed

    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Sivakumar, G; Tuteja, F C; Narnaware, S D; Mehta, S C; Singh, Raghvendar; Patil, N V

    2014-03-01

    The dsRNA binding protein (RBP) encoding gene of parapoxviruses (PPVs) from the Dromedary camels, inhabitating different geographical region of Rajasthan, India were amplified by polymerase chain reaction using the primers of pseudocowpoxvirus (PCPV) from Finnish reindeer and cloned into pGEM-T for sequence analysis. Analysis of RBP encoding gene revealed that PPV DNA from Bikaner shared 98.3% and 76.6% sequence identity at the amino acid level, with Pali and Udaipur PPV DNA, respectively. Reference strains of Bovine papular stomatitis virus (BPSV) and PCPV (reindeer PCPV and human PCPV) shared 52.8% and 86.9% amino acid identity with RBP gene of camel PPVs from Bikaner, respectively. But different strains of orf virus (ORFV) from different geographical areas of the world shared 69.5-71.7% amino acid identity with RBP gene of camel PPVs from Bikaner. These findings indicate that the camel PPVs described are closely related to bovine PPV (PCPV) in comparison to caprine and ovine PPV (ORFV). PMID:25685494

  11. Identification and characterization of a Neisseria gonorrhoeae gene encoding a glycolipid-binding adhesin.

    PubMed Central

    Paruchuri, D K; Seifert, H S; Ajioka, R S; Karlsson, K A; So, M

    1990-01-01

    We recently identified a set of mammalian cell receptors for Neisseria gonorrhoeae that are glycolipids. These receptors, lactosylceramide [Gal(beta 1-4)Glc(beta 1-1)Cer], gangliotriosylceramide [GalNAc( beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], and gangliotetraosylceramide [Gal(beta 1-3)GalNAc(beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], were shown to be specifically bound by a gonococcal outer membrane protein distinct from pilin and protein II. Here we report the isolation of the gene encoding the gangliotetraosylceramide-binding adhesin from a N. gonorrhoeae MS11 gene bank in Escherichia coli. Transposon mutagenesis studies in E. coli indicate that the adhesion is a protein with a molecular mass of 36,000 Da. The gene encoding the 36-kDa protein is duplicated in MS11 since two transposon insertions were required to abolish expression of the gene in this bacterium. This protein is present on the surface of the gonococcus and is not associated with the pilus. Images PMID:2153292

  12. Identification and characterization of a Neisseria gonorrhoeae gene encoding a glycolipid-binding adhesin.

    PubMed

    Paruchuri, D K; Seifert, H S; Ajioka, R S; Karlsson, K A; So, M

    1990-01-01

    We recently identified a set of mammalian cell receptors for Neisseria gonorrhoeae that are glycolipids. These receptors, lactosylceramide [Gal(beta 1-4)Glc(beta 1-1)Cer], gangliotriosylceramide [GalNAc( beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], and gangliotetraosylceramide [Gal(beta 1-3)GalNAc(beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], were shown to be specifically bound by a gonococcal outer membrane protein distinct from pilin and protein II. Here we report the isolation of the gene encoding the gangliotetraosylceramide-binding adhesin from a N. gonorrhoeae MS11 gene bank in Escherichia coli. Transposon mutagenesis studies in E. coli indicate that the adhesion is a protein with a molecular mass of 36,000 Da. The gene encoding the 36-kDa protein is duplicated in MS11 since two transposon insertions were required to abolish expression of the gene in this bacterium. This protein is present on the surface of the gonococcus and is not associated with the pilus. PMID:2153292

  13. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    PubMed Central

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens. PMID:25514417

  14. The immune gene repertoire encoded in the purple sea urchin genome.

    PubMed

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P

    2006-12-01

    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology. PMID:17027739

  15. Decay of Genes Encoding the Oomycete Flagellar Proteome in the Downy Mildew Hyaloperonospora arabidopsidis

    PubMed Central

    Judelson, Howard S.; Shrivastava, Jolly; Manson, Joseph

    2012-01-01

    Zoospores are central to the life cycles of most of the eukaryotic microbes known as oomycetes, but some genera have lost the ability to form these flagellated cells. In the plant pathogen Phytophthora infestans, genes encoding 257 proteins associated with flagella were identified by comparative genomics. These included the main structural components of the axoneme and basal body, proteins involved in intraflagellar transport, regulatory proteins, enzymes for maintaining ATP levels, and others. Transcripts for over three-quarters of the genes were up-regulated during sporulation, and persisted to varying degrees in the pre-zoospore stage (sporangia) and motile zoospores. Nearly all of these genes had orthologs in other eukaryotes that form flagella or cilia, but not species that lack the organelle. Orthologs of 211 of the genes were also absent from a sister taxon to P. infestans that lost the ability to form flagella, the downy mildew Hyaloperonospora arabidopsidis. Many of the genes retained in H. arabidopsidis were also present in other non-flagellates, suggesting that they play roles both in flagella and other cellular processes. Remnants of the missing genes were often detected in the H. arabidopsidis genome. Degradation of the genes was associated with local compaction of the chromosome and a heightened propensity towards genome rearrangements, as such regions were less likely to share synteny with P. infestans. PMID:23077652

  16. Developmental expression of tobacco pistil-specific genes encoding novel extensin-like proteins.

    PubMed Central

    Goldman, M H; Pezzotti, M; Seurinck, J; Mariani, C

    1992-01-01

    We have sought to identify pistil-specific genes that can be used as molecular markers to study pistil development. For this purpose, a cDNA library was constructed from poly(A)+ RNA extracted from tobacco stigmas and styles at different developmental stages. Differential screening of this library led to the isolation of cDNA clones that correspond to genes preferentially or specifically expressed in the pistil. Seven of these cDNA clones encode proteins containing repetitions of the pentapeptide Ser-Pro4, which is a typical motif found in extensins. Unlike extensin genes, the extensin-like genes described here are not induced under stress conditions. RNA gel blot hybridizations demonstrated the organ-specific expression of the extensin-like genes and their temporal regulation during pistil development. After pollination, the transcript levels of the pistil-specific extensin-like genes change relative to levels in unpollinated pistils. In situ hybridization experiments showed that at least one of these pistil-specific genes is specifically expressed in cells of the transmitting tissue. The possible roles of the extensin-like proteins in pistils are discussed. PMID:1392607

  17. The complete inventory of receptors encoded by the rat natural killer cell gene complex

    PubMed Central

    Flornes, Line M.; Nylenna, Øyvind; Saether, Per C.; Daws, Michael R.; Dissen, Erik

    2010-01-01

    The natural killer cell gene complex (NKC) encodes receptors belonging to the C-type lectin superfamily expressed primarily by NK cells and other leukocytes. In the rat, the chromosomal region that starts with the Nkrp1a locus and ends with the Ly49i8 locus is predicted to contain 67 group V C-type lectin superfamily genes, making it one of the largest congregation of paralogous genes in vertebrates. Based on physical proximity and phylogenetic relationships between these genes, the rat NKC can be divided into four major parts. We have previously reported the cDNA cloning of the majority of the genes belonging to the centromeric Nkrp1/Clr cluster and the two telomeric groups, the Klre1–Klri2 and the Ly49 clusters. Here, we close the gap between the Nkrp1/Clr and the Klre1–Klri2 clusters by presenting the cDNA cloning and transcription patterns of eight genes spanning from Cd69 to Dectin1, including the novel Clec2m gene. The definition, organization, and evolution of the rat NKC are discussed. Electronic supplementary material The online version of this article (doi:10.1007/s00251-010-0455-y) contains supplementary material, which is available to authorized users. PMID:20544345

  18. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed.

    PubMed

    Rocca, Jennifer D; Hall, Edward K; Lennon, Jay T; Evans, Sarah E; Waldrop, Mark P; Cotner, James B; Nemergut, Diana R; Graham, Emily B; Wallenstein, Matthew D

    2015-08-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes. PMID:25535936

  19. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    PubMed Central

    Rocca, Jennifer D; Hall, Edward K; Lennon, Jay T; Evans, Sarah E; Waldrop, Mark P; Cotner, James B; Nemergut, Diana R; Graham, Emily B; Wallenstein, Matthew D

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes. PMID:25535936

  20. A mutation in the pnp gene encoding polynucleotide phosphorylase attenuates virulence of Salmonella enterica serovar typhimurium in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for ...

  1. A bacterial gene codA encoding cytosine deaminase is an effective conditional negative selectable marker in Glycine max

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Conditional negative selection is a powerful technique whereby the absence of a gene product allows survival in otherwise lethal conditions. In plants, the Escherichia coli gene codA has been employed as a negative selection marker. CodA is a conditionally lethal dominant gene encoding cy...

  2. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    SciTech Connect

    Kashtanov, S.N.; Kazakova, T.I.

    1995-02-01

    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  3. Genes encoding FAD-binding proteins in Volvariella volvacea exhibit differential expression in homokaryons and heterokaryons.

    PubMed

    Meng, Li; Yan, Junjie; Xie, Baogui; Li, Yu; Chen, Bingzhi; Liu, Shuyan; Li, Dan; Yang, Zhiyun; Zeng, Xiancheng; Deng, Youjin; Jiang, Yuji

    2013-10-01

    Flavin adenine dinucleotide (FAD)-binding proteins play a vital role in energy transfer and utilization during fungal growth and mycelia aggregation. We sequenced the genome of Volvariella volvacea, an economically important edible fungus, and discovered 41 genes encoding FAD-binding proteins. Gene expression profiles revealed that the expression levels of four distinctly differentially expressed genes in heterokaryotic strain H1521 were higher than in homokaryotic strains PYd15 and PYd21 combined. These observations were validated by quantitative real-time PCR. The results suggest that the differential expression of FAD-binding proteins may be important in revealing the distinction between homokaryons and heterokaryons on the basis of FAD-binding protein functionality. PMID:23570970

  4. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    PubMed

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  5. The Drosophila melanogaster developmental gene g1 encodes a variant zinc-finger-motif protein.

    PubMed

    Bouchard, M L; Côté, S

    1993-03-30

    In Drosophila melanogaster, the mechanisms involved in the pattern formation of complex internal organs are still largely unknown. However, the identity of the molecular determinants that control the development of these specific tissues is emerging from the combined use of genetic and molecular approaches. We have cloned a gene that is expressed in the mesoderm, one of the fundamental embryonic germ layers which gives rise to internal structures, such as the musculature. Here, we describe the molecular characterization of this gene, designated as g1. The nucleotide (nt) sequence of its cDNA shows an open reading frame of 852 nt, which encodes a 32-kDa protein with two putative zinc fingers, and a serine/glutamine/proline-rich region. These features indicate a functional role for g1, which remains to be elucidated, in regulating gene expression during mesoderm formation. PMID:8462875

  6. [Identification of the Gene Encoding Nucleostemin in the Eye Tissues of Pleurodeles waltl].

    PubMed

    Markitantova, Y V; Avdonin, P P; Grigoryan, E N

    2015-01-01

    Nucleotide sequences were identified in the eye tissues (lens, retina, and retinal pigment epithelium) of the adult newt Pleurodeles waltl by the polymerase chain reaction with primers for the Ns gene. Sequencing showed that these nucleotide sequences belong to the Ns gene of the newt P. walt, which encodes the nucleolar protein nucleostemin. Structural analysis revealed a high homology of Ns nucleotide sequences of P. walt! with those of newts. Cynops pyrrhogaster and Notophthalmus viridescens. The expression of the Ns gene of P. walt, identified in the specialized eye cells of adult newts of the studied species, indicates that these differentiated cells retain some of the molecular characteristics inherent to the undifferentiated cells. PMID:26638232

  7. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    NASA Astrophysics Data System (ADS)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin

    2010-01-01

    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  8. Functional investigation of a gene encoding pteridine glycosyltransferase for cyanopterin synthesis in Synechocystis sp. PCC 6803.

    PubMed

    Hwang, Yoon Kyung; Kang, Ji Youn; Woo, Hyun Joo; Choi, Yong Kee; Park, Young Shik

    2002-03-15

    A gene (slr1166) putatively encoding pteridine glycosyltransferase was disrupted with a kanamycin resistance cassette in Synechocystis sp. PCC 6803, which produces cyanopterin. The deduced polypeptide from slr1166 consisted of 354 amino acid residues sharing 45% sequence identity with UDP-glucose:tetrahydrobiopterin alpha-glucosyltransferase (BGluT) isolated previously from Synechococcus sp. PCC 7942. The knockout mutant was unable to produce cyanopterin but only 6-hydroxymethylpterin-beta-galactoside, verifying that slr1166 encodes a pteridine glycosyltransferase, which is responsible for transfer of the second sugar glucuronic acid in cyanopterin synthesis. The mutant was affected in its intracellular pteridine content and growth rate, which were 74% and 80%, respectively, of wild type, demonstrating that the second sugar residue is still required for quantitative maintenance of cyanopterin. This supports the previous suggestion that glycosylation may contribute to high cellular concentration of pteridine compounds. PMID:11985899

  9. Trypanosoma rangeli and Trypanosoma cruzi: molecular characterization of genes encoding putative calcium-binding proteins, highly conserved in trypanosomatids.

    PubMed

    Porcel, B M; Bontempi, E J; Henriksson, J; Rydåker, M; Aslund, L; Segura, E L; Pettersson, U; Ruiz, A M

    1996-12-01

    Genes encoding a 29-kDa flagellar calcium-binding protein (F29) in Trypanosoma cruzi, strongly homologous to EF-hand calcium-binding protein-encoding genes previously reported in this parasite, were isolated by immunoscreening. F29 is encoded by a number of very similar genes, highly conserved among different T. cruzi isolates. The genes are located on a pair of homologous chromosomes, arranged in one or two clusters of tandem repeats. PCR amplification of Trypanosoma rangeli genomic DNA, using primers derived from the T. cruzi F29 sequence made it possible to isolate the homologous gene in T. rangeli, encoding a 23-kDa protein called TrCaBP. Gene sequence comparisons showed homology to EF-hand calcium-binding proteins from T. cruzi (82.8%), Trypanosoma brucei brucei (60.2%), and Entamoeba histolytica (28.4%). Northern blot analysis revealed that the TrCaBP gene is expressed in T. rangeli as a polyadenylated transcript. The TrCaBP-encoding genes are present in at least 20 copies per cell, organized in tandem arrays, on large T. rangeli chromosomes in some isolates and on two smaller ones in others. This gene, however, seems to be absent from Leishmania. PMID:8948328

  10. Regulation of genes encoding cellulolytic enzymes by Pal-PacC signaling in Aspergillus nidulans.

    PubMed

    Kunitake, Emi; Hagiwara, Daisuke; Miyamoto, Kentaro; Kanamaru, Kyoko; Kimura, Makoto; Kobayashi, Tetsuo

    2016-04-01

    Cellulosic biomass represents a valuable potential substitute for fossil-based fuels. As such, there is a strong need to develop efficient biotechnological processes for the enzymatic hydrolysis of cellulosic biomass via the optimization of cellulase production by fungi. Ambient pH is an important factor affecting the industrial production of cellulase. In the present study, we demonstrate that several Aspergillus nidulans genes encoding cellulolytic enzymes are regulated by Pal-PacC-mediated pH signaling, as evidenced by the decreased cellulase productivity of the palC mutant and pacC deletants of A. nidulans. The deletion of pacC was observed to result in delayed induction and decreased expression of the cellulase genes based on time course expression analysis. The genome-wide identification of PacC-regulated genes under cellobiose-induced conditions demonstrated that genes expressed in a PacC-dependent manner included 82 % of ClrB (a transcriptional activator of the cellulase genes)-regulated genes, including orthologs of various transporter and β-glucosidase genes considered to be involved in cellobiose uptake or production of stronger inducer molecules. Together with the significant overlap between ClrB- and PacC-regulated genes, the results suggest that PacC-mediated regulation of the cellulase genes involves not only direct regulation by binding to their promoter regions but also indirect regulation via modulation of the expression of genes involved in ClrB-dependent transcriptional activation. Our findings are expected to contribute to the development of more efficient industrial cellulase production methods. PMID:26946171

  11. Cloning of the genes encoding two murine and human cochlear unconventional type I myosins

    SciTech Connect

    Crozet, F.; El Amraoui, Z.; Blanchard, S.

    1997-03-01

    Several lines of evidence indicate a crucial role for unconventional myosins in the function of the sensory hair cells of the inner ear. We report here the characterization of the cDNAs encoding two unconventional type I myosins from a mouse cochlear cDNA library. The first cDNA encodes a putative protein named Myo1c, which is likely to be the murine orthologue of the bullfrog myosin I{beta} and which may be involved in the gating of the mechanotransduction channel of the sensory hair cells. This myosin belongs to the group of short-tailed myosins I, with its tail ending shortly after a polybasic, TH-1-like domain. The second cDNA encodes a novel type I myosin Myo1f which displays three regions: a head domain with the conserved ATP- and actin-binding sites, a neck domain with a single IQ motif, and a tail domain with the tripartite structure initially described in protozoan myosins I. The tail of Myo1f includes (1) a TH-1 region rich in basic residues, which may interact with anionic membrane phospholipids; (2) a TH-2 proline-rich region, expected to contain an ATP-insensitive actin-binding site; and (3) an SH-3 domain found in a variety of cytoskeletal and signaling proteins. Northern blot analysis indicated that the genes encoding Myo1c and Myo1f display a widespread tissue expression in the adult mouse. Myo1c and Myo1f were mapped by in situ hybridization to the chromosomal regions 11D-11E and 17B-17C, respectively. The human orthologuous genes MYO1C and MYO1F were also characterized, and mapped to the human chromosomal regions 17p13 and 19p13.2- 19p1.3.3, respectively. 45 refs., 5 figs., 2 tabs.

  12. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    PubMed

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea. PMID:23811228

  13. Full-genome identification and characterization of NBS-encoding disease resistance genes in wheat.

    PubMed

    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem

    2015-02-01

    Host resistance is the most economical, effective and ecologically sustainable method of controlling diseases in crop plants. In bread wheat, despite the high number of resistance loci that have been cataloged to date, only few have been cloned, underlying the need for genomics-guided investigations capable of providing a prompt and acute knowledge on the identity of effective resistance genes that can be used in breeding programs. Proteins with a nucleotide-binding site (NBS) encoded by the major plant disease resistance (R) genes play an important role in the responses of plants to various pathogens. In this study, a comprehensive analysis of NBS-encoding genes within the whole wheat genome was performed, and the genome scale characterization of this gene family was established. From the recently published wheat genome sequence, we used a data mining and automatic prediction pipeline to identify 580 complete ORF candidate NBS-encoding genes and 1,099 partial-ORF ones. Among complete gene models, 464 were longer than 200 aa, among them 436 had less than 70 % of sequence identity to each other. This gene models set was deeply characterized. (1) First, we have analyzed domain architecture and identified, in addition to typical domain combinations, the presence of particular domains like signal peptides, zinc fingers, kinases, heavy-metal-associated and WRKY DNA-binding domains. (2) Functional and expression annotation via homology searches in protein and transcript databases, based on sufficient criteria, enabled identifying similar proteins for 60 % of the studied gene models and expression evidence for 13 % of them. (3) Shared orthologous groups were defined using NBS-domain proteins of rice and Brachypodium distachyon. (4) Finally, alignment of the 436 NBS-containing gene models to the full set of scaffolds from the IWGSC's wheat chromosome survey sequence enabled high-stringence anchoring to chromosome arms. The distribution of the R genes was found balanced

  14. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    PubMed

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. PMID:27554144

  15. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene

    PubMed Central

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.

    2012-01-01

    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  16. Cloning and orientation of the gene encoding polynucleotide phosphorylase in Escherichia coli.

    PubMed Central

    Crofton, S; Dennis, P P

    1983-01-01

    Mutations which affect the activity of polynucleotide phosphorylase (PNPase) map near 69 min on the bacterial chromosome. This region of the chromosome has been cloned by inserting the kanamycin-resistant transposon Tn5 near the argG and mtr loci at 68.5 min. Large SalI fragments of chromosomal DNA containing the Tn5 element were inserted into pBR322, and selection was made for kanamycin-resistant recombinant plasmids. Two of these plasmids were found to produce high levels of PNPase activity in both wild-type and host strains lacking PNPase activity. The pnp gene was further localized and subcloned on a 4.8 kilobase HindIII-EcoRI fragment. This fragment was shown to encode an 84,000-molecular weight protein which comigrated with purified PNPase during sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The orientation of the pnp gene was determined by insertion of Tn5 into the 4.8 kilobase fragment cloned in pBR322. Some of the insertions had lost the ability to elevate the level of PNPase activity in the host bacterium. Restriction mapping of the positions of the Tn5 insertions and analysis of plasmid-encoded polypeptides in UV-irradiated maxi-cells indicated that the pnp gene is oriented in the counterclockwise direction on the bacterial chromosome. Images PMID:6300041

  17. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  18. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    SciTech Connect

    Lindner, I.; Ehlers, B. . E-mail: ehlersb@rki.de; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-20

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1{sub h}, ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1{sub h} and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation.

  19. A pin gene families encoding components of auxin efflux carriers in Brassica juncea.

    PubMed

    Ni, Wei Min; Chen, Xiao Ya; Xu, Zhi Hong; Xue, Hong Wei

    2002-09-01

    Based on the sequence information of Arabidopsis PIN1, two cDNAs encoding PIN homologues from Brassica juncea, Bjpin2 and Bjpin3, were isolated through cDNA library screening. Bjpin2 and Bjpin3 encoded proteins containing 640 and 635 amino acid residues, respectively, which shared 97.5% identities with each other and were highly homologous to Arabidopsis PIN1, PIN2 and other putative PIN proteins. BjPIN2 and BjPIN3 had similar structures as AtPIN proteins. Northern blot analysis indicated that Bjpin2 was expressed in stem, leaf and floral tissues, while Bjpin3 was expressed predominantly in stem and hypocotyls. Two promoter fragments of pin genes, Bjpin-X and Bjpin-Z, were isolated by 'genome walking' technique using primers at 5'-end of pin cDNA. Promoter-gus fusion studies revealed the GUS activities driven by Bjpin-X were at internal side of xylem and petal; while those driven by Bjpin-Z were detected at leaf vein, epidermal cell and cortex of stem, vascular tissues and anther. Results of the pin genes with different expression patterns in B. juncea suggested the presence of a gene family. PMID:12296384

  20. Cloning and characterization of glyceraldehyde-3-phosphate dehydrogenase encoding gene in Gracilaria/Gracilariopsis lemaneiformis

    NASA Astrophysics Data System (ADS)

    Ren, Xueying; Sui, Zhenghong; Zhang, Xuecheng

    2006-04-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays important roles in various cellular processes. A cytosolic GAPDH encoding gene ( gpd) of Gracilaria/Gracilariopsis lemaneiformis was cloned and characterized. Deduced amino acid sequence of the enzyme of G. lemaneiformis had high homology with those of seven red algae. The 5'-untranslated regions of the GAPDHs encoding genes of these red algae varied greatly. GAPDHs of these red algae shared the highly conserved glyceraldehyde 3-phosphate dehydrogenase active site ASCTTNCL. However, such active site of Cyanidium caldarium was different from those of the other six algae at the last two residues (CL to LF), thus the spatial structure of its GAPDH active center may be different from those of the other six. Phylogenetic analysis indicated that GAPDH of G. lemaneiformis might have undergone an evolution similar to those of Porphyra yezoensis, Chondrus crispus, and Gracilaria verrucosa. C. caldarium had a closer evolutionary relationship with Cyanidioschyzon merolae than with Cyanidium sp. Virtual Northern blot analysis revealed that gpd of G. lemaneiformis expressed constitutively, which suggested that it might be house-keeping and could be adapted as an inner control in gene expression analysis of G. lemaneiformis.

  1. Yeast RAD14 and human xeroderma pigmentosum group A DNA-repair genes encode homologous proteins.

    PubMed

    Bankmann, M; Prakash, L; Prakash, S

    1992-02-01

    Xeroderma pigmentosum (XP), a human autosomal recessive disorder, is characterized by extreme sensitivity to sunlight and high incidence of skin cancers. XP cells are defective in the incision step of excision repair of DNA damaged by ultraviolet light. Cell fusion studies have defined seven XP complementation groups, XP-A to XP-G. Similar genetic complexity of excision repair is observed in the yeast Saccharomyces cerevisiae. Mutations in any one of five yeast genes, RAD1, RAD2, RAD3, RAD4, and RAD10, cause a total defect in incision and an extreme sensitivity to ultraviolet light. Here we report the characterization of the yeast RAD14 gene. The available rad14 point mutant is only moderately ultraviolet-sensitive, and it performs a substantial amount of incision of damaged DNA. Our studies with the rad14 deletion (delta) mutation indicate an absolute requirement of RAD14 in incision. RAD14 encodes a highly hydrophilic protein of 247 amino acids containing zinc-finger motifs, and it is similar to the protein encoded by the human XPAC gene that complements XP group A cell lines. PMID:1741034

  2. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    PubMed

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  3. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    SciTech Connect

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures.

  4. Genes encoding putative natural killer cell C-type lectin receptors in teleostean fishes

    PubMed Central

    Sato, Akie; Mayer, Werner E.; Overath, Peter; Klein, Jan

    2003-01-01

    Mammalian natural killer (NK) cells are cytotoxic lymphocytes that express receptors specific for MHC class I molecules. The NK cell receptors belong to two structurally unrelated families, the killer cell Ig-like receptors and the killer cell C-type lectin receptors. We describe a cDNA clone derived from the bony (cichlid) fish Paralabidochromis chilotes and show that it encodes a protein related to the CD94/NK cell group 2 (NKG2) subfamily of the killer cell C-type lectin receptors. The gene encoding this receptor in a related species, Oreochromis niloticus, has a similar structure to the human CD94/NKG2 genes and is a member of a multigene cluster that resembles the mammalian NK cell gene complex. Thus, the CD94/NKG2 subfamily of NK cell receptors must have arisen before the divergence of fish and tetrapods and may have retained its function (possibly monitoring the expression of MHC class I molecules) for >400 million years. PMID:12802013

  5. Two Origins for the Gene Encoding α-Isopropylmalate Synthase in Fungi

    PubMed Central

    Larson, Erica M.; Idnurm, Alexander

    2010-01-01

    Background The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings Here we identified the leuA gene encoding α-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3+ gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events. PMID:20657649

  6. Divergence among Genes Encoding the Elongation Factor Tu of Yersinia Species▿

    PubMed Central

    Isabel, Sandra; Leblanc, Éric; Boissinot, Maurice; Boudreau, Dominique K.; Grondin, Myrian; Picard, François J.; Martel, Eric A.; Parham, Nicholas J.; Chain, Patrick S. G.; Bader, Douglas E.; Mulvey, Michael R.; Bryden, Louis; Roy, Paul H.; Ouellette, Marc; Bergeron, Michel G.

    2008-01-01

    Elongation factor Tu (EF-Tu), encoded by tuf genes, carries aminoacyl-tRNA to the ribosome during protein synthesis. Duplicated tuf genes (tufA and tufB), which are commonly found in enterobacterial species, usually coevolve via gene conversion and are very similar to one another. However, sequence analysis of tuf genes in our laboratory has revealed highly divergent copies in 72 strains spanning the genus Yersinia (representing 12 Yersinia species). The levels of intragenomic divergence between tufA and tufB sequences ranged from 8.3 to 16.2% for the genus Yersinia, which is significantly greater than the 0.0 to 3.6% divergence observed for other enterobacterial genera. We further explored tuf gene evolution in Yersinia and other Enterobacteriaceae by performing directed sequencing and phylogenetic analyses. Phylogenetic trees constructed using concatenated tufA and tufB sequences revealed a monophyletic genus Yersinia in the family Enterobacteriaceae. Moreover, Yersinia strains form clades within the genus that mostly correlate with their phenotypic and genetic classifications. These genetic analyses revealed an unusual divergence between Yersinia tufA and tufB sequences, a feature unique among sequenced Enterobacteriaceae and indicative of a genus-wide loss of gene conversion. Furthermore, they provided valuable phylogenetic information for possible reclassification and identification of Yersinia species. PMID:18790860

  7. Stress-dependent regulation of the gene encoding thioredoxin reductase from the fission yeast.

    PubMed

    Hong, Sung-Min; Lim, Hye-Won; Kim, Il-Han; Kim, Kanghwa; Park, Eun-Hee; Lim, Chang-Jin

    2004-05-15

    The unique putative gene for thioredoxin reductase (TrxR) was isolated from the chromosomal DNA of the fission yeast Schizosaccharomyces pombe. The determined DNA sequence carries 3125 bp, and encodes the plausible 322 amino acid sequence of TrxR with a molecular mass of 34,618 Da. The S. pombe cells harboring the cloned TrxR gene contain increased TrxR activity, and shows higher survivals on solid media with mercuric chloride or aluminum chloride. The 1526 bp upstream region was fused into promoterless beta-galactosidase gene of the shuttle vector YEp367R to generate the fusion plasmid. The synthesis of beta-galactosidase from the fusion plasmid pYUTR10 was enhanced by menadione, mercuric chloride, hydrogen peroxide, aluminium chloride and sodium selenite. Menadione significantly enhanced the TrxR mRNA level in the S. pombe cells, which was detected by RT-PCR. Induction of the S. pombe TrxR gene by menadione and mercuric chloride occurs through the mediation of the transcription factor Pap1. These results suggest that the S. pombe TrxR gene is one of the stress response-related genes. PMID:15135546

  8. The fdx gene encoding the [2Fe--2S] ferredoxin of Halobacterium salinarium (H. halobium).

    PubMed

    Pfeifer, F; Griffig, J; Oesterhelt, D

    1993-05-01

    The gene encoding the [2Fe--2S] ferredoxin (fdx gene) was isolated from Halobacterium salinarium using two oligonucleotides deduced from the ferredoxin sequence as probes. Cosmid DNAs exhibiting hybridization were isolated, the fdx gene was localized to smaller subfragments and the nucleotide sequence determined. The 390 bp coding sequence is located in the halobacterial FI-DNA and transcribed as a 440 nucleotide mRNA. S1 mapping indicated that the 5' terminus of the mRNA maps immediately upstream of the ATG start codon. The promoter box A, centred around position -25 (5' AC-TATG 3'), and box B (TG) elements at the start of the transcript resemble the sequences of a typical archaeal promoter. The restriction pattern of an approximately 50 kb region surrounding the fdx gene is conserved in various Halobacterium species. The halobacterial ferredoxin and the major gas vesicle protein GvpA exhibit up to 70% similarity to their respective counterparts in cyanobacteria suggesting lateral gene transfer between the organisms. These similarities prompted a more detailed investigation of the relative positions of the genes in the halobacterial genome. PMID:8510664

  9. Plant eR Genes That Encode Photorespiratory Enzymes Confer Resistance against Disease

    PubMed Central

    Taler, Dvir; Galperin, Marjana; Benjamin, Ido; Cohen, Yigal; Kenigsbuch, David

    2004-01-01

    Downy mildew caused by the oomycete pathogen Pseudoperonospora cubensis is a devastating foliar disease of cucurbits worldwide. We previously demonstrated that the wild melon line PI 124111F (PI) is highly resistant to all pathotypes of P. cubensis. That resistance was controlled genetically by two partially dominant, complementary loci. Here, we show that unlike other plant disease resistance genes, which confer an ability to resist infection by pathogens expressing corresponding avirulence genes, the resistance of PI to P. cubensis is controlled by enhanced expression of the enzymatic resistance (eR) genes At1 and At2. These constitutively expressed genes encode the photorespiratory peroxisomal enzyme proteins glyoxylate aminotransferases. The low expression of At1 and At2 in susceptible melon lines is regulated mainly at the transcriptional level. This regulation is independent of infection with the pathogen. Transgenic melon plants overexpressing either of these eR genes displayed enhanced activity of glyoxylate aminotransferases and remarkable resistance against P. cubensis. The cloned eR genes provide a new resource for developing downy mildew–resistant melon varieties. PMID:14688292

  10. A human alcohol dehydrogenase gene (ADH6) encoding an additional class of isozyme.

    PubMed Central

    Yasunami, M; Chen, C S; Yoshida, A

    1991-01-01

    The human alcohol dehydrogenase (ADH; alcohol:NAD+ oxidoreductase, EC 1.1.1.1) gene family consists of five known loci (ADH1-ADH5), which have been mapped close together on chromosome 4 (4q21-25). ADH isozymes encoded by these genes are grouped in three distinct classes in terms of their enzymological properties. A moderate structural similarity is observed between the members of different classes. We isolated an additional member of the ADH gene family by means of cross-hybridization with the ADH2 (class I) cDNA probe. cDNA clones corresponding to this gene were derived from PCR-amplified libraries as well. The coding sequence of a 368-amino-acid-long open reading frame was interrupted by introns into eight exons and spanned approximately 17 kilobases on the genome. The gene contains a glucocorticoid response element at the 5' region. The transcript was detected in the stomach and liver. The deduced amino acid sequence of the open reading frame showed about 60% positional identity with known human ADHs. This extent of homology is comparable to interclass similarity in the human ADH family. Thus, the newly identified gene, which is designated ADH6, governs the synthesis of an enzyme that belongs to another class of ADHs presumably with a distinct physiological role. Images PMID:1881901

  11. Cloning DPB3, the gene encoding the third subunit of DNA polymerase II of Saccharomyces cerevisiae.

    PubMed Central

    Araki, H; Hamatake, R K; Morrison, A; Johnson, A L; Johnston, L H; Sugino, A

    1991-01-01

    DNA polymerase II purified from Saccharomyces cerevisiae contains polypeptides with apparent molecular masses of greater than 200, 80, 34, 30 and 29 kDa, the two largest of which (subunits A and B) are encoded by the essential genes POL2 and DPB2. By probing a lambda gt11 expression library of yeast DNA with antiserum against DNA polymerase II, we isolated a single gene, DPB3, that encodes both the 34- and 30-kDa polypeptides (subunit C and C'). The nucleotide sequence of DPB3 contained an open reading frame encoding a 23-kDa protein, significantly smaller than the observed molecular masses, 34- or 30-kDa, which might represent post-translationally modified forms of the DPB3 product. The predicted amino acid sequence contained a possible NTP-binding motif and a glutamate-rich region. NTP-binding motif and a glutamate-rich region. A dpb3 deletion mutant (dpb3 delta) was viable and yielded a DNA polymerase II lacking the 34- and 30-kDa polypeptides. dpb3 delta strains exhibited an increased spontaneous mutation rate, suggesting that the DPB3 product is required to maintain fidelity of chromosomal replication. Since a fifth, 29-kDa polypeptide was present in DNA polymerase II preparations from wild-type cell extracts throughout purification, the subunit composition appears to be A, B, C (or C and C') and D. The 5' nontranscribed region of DPB3 contained the MulI-related sequence ACGCGA, while the 0.9-kb DPB3 transcript accumulated periodically during the cell cycle and peaked at the G1/S boundary. The level of DPB3 transcript thus appears to be under the same cell cycle control as those of POL2, DPB2 and other DNA replication genes. DPB3 was mapped to chromosome II, 30 cM distal to his7. Images PMID:1923754

  12. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP) Which Is Overexpressed in Highly Proliferating Tissues

    PubMed Central

    Szafron, Lukasz Michal; Balcerak, Anna; Grzybowska, Ewa Anna; Pienkowska-Grela, Barbara; Felisiak-Golabek, Anna; Podgorska, Agnieszka; Kulesza, Magdalena; Nowak, Natalia; Pomorski, Pawel; Wysocki, Juliusz; Rubel, Tymon; Dansonka-Mieszkowska, Agnieszka; Konopka, Bozena; Lukasik, Martyna; Kupryjanczyk, Jolanta

    2015-01-01

    CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene. PMID:25978564

  13. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    PubMed

    Pauchet, Yannick; Wilkinson, Paul; Chauhan, Ritika; Ffrench-Constant, Richard H

    2010-01-01

    Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs) are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology. PMID:21179425

  14. Disruption of the plr1+ gene encoding pyridoxal reductase of Schizosaccharomyces pombe.

    PubMed

    Morita, Tomotake; Takegawa, Kaoru; Yagi, Toshiharu

    2004-02-01

    Pyridoxal (PL) reductase encoded by the plr1(+) gene practically catalyzes the irreversible reduction of PL by NADPH to form pyridoxine (PN). The enzyme has been suggested to be involved in the salvage synthesis of pyridoxal 5'-phosphate (PLP), a coenzyme form of vitamin B(6), or the excretion of PL as PN from yeast cells. In this study, a PL reductase-disrupted (plr1 Delta) strain was constructed and its phenotype was examined. The plr1 Delta cells showed almost the same growth curve as that of wild-type cells in YNB and EMM media. In EMM, the plr1 Delta strain became flocculent at the late stationary phase for an unknown reason. The plr1 Delta cells showed low but measurable PL reductase activity catalyzed by some other protein(s) than the enzyme encoded by the plr1(+) gene, which maintained the flow of "PL --> PN --> PNP --> PLP" in the salvage synthesis of PLP. The total vitamin B(6) and pyridoxamine 5'-phosphate contents in the plr1 Delta cells were significantly lower than those in the wild-type ones. The percentages of the PLP amount as to the other vitamin B(6) compounds were similar in the two cell types. The amount of PL in the culture medium of the disruptant was significantly higher than that in the wild-type. In contrast, PN was much higher in the latter than the former. The plr1 Delta cells accumulated a 6.1-fold higher amount of PL than the wild-type ones when they were incubated with PL. The results showed that PL reductase encoded by the plr1(+ )gene is involved in the excretion of PL after reducing it to PN, and may not participate in the salvage pathway for PLP synthesis. PMID:15047724

  15. Promoter for the human ferritin heavy chain-encoding gene (FERH): structural and functional characterization.

    PubMed

    Bevilacqua, M A; Giordano, M; D'Agostino, P; Santoro, C; Cimino, F; Costanzo, F

    1992-02-15

    We conducted a functional analysis of the promoter for the human ferritin heavy chain-encoding gene (pFERH) in HepG2 and HeLa cells. The activity of pFERH is equivalent in both cell types, despite their different ferritin (Fer) isotypes. Transfections of a series of 5'-deletion mutants indicate that pFERH activity is essentially dependent on two motifs. One of them, accounting for about 50% of the total transcriptional activity, is recognized by the RNA polymerase II transcription factor, Sp1, and the other by a low-affinity factor present in both the cell types analyzed. PMID:1541403

  16. Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida

    SciTech Connect

    Irie, S.; Doi, S.; Yorifuji, T.; Takagi, M.; Yano, K.

    1987-11-01

    The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed.

  17. Metabolic regulation of the gene encoding glutamine-dependent asparagine synthetase in Arabidopsis thaliana.

    PubMed Central

    Lam, H M; Peng, S S; Coruzzi, G M

    1994-01-01

    Here, we characterize a cDNA encoding a glutamine-dependent asparagine synthetase (ASN1) from Arabidopsis thaliana and assess the effects of metabolic regulation on ASN1 mRNA levels. Sequence analysis shows that the predicted ASN1 peptide contains a purF-type glutamine-binding domain. Southern blot experiments and cDNA clone analysis suggest that ASN1 is the only gene encoding glutamine-dependent asparagine synthetase in A. thaliana. The ASN1 gene is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. This negative effect of light on ASN1 mRNA levels was shown to be mediated, at least in part, via the photoreceptor phytochrome. We also investigated whether light-induced changes in nitrogen to carbon ratios might exert a metabolic regulation of the ASN1 mRNA accumulation. These experiments demonstrated that the accumulation of ASN1 mRNA in dark-grown plants is strongly repressed by the presence of exogenous sucrose. Moreover, this sucrose repression of ASN1 expression can be partially rescued by supplementation with exogenous amino acids such as asparagine, glutamine, and glutamate. These findings suggest that the expression of the ASN1 gene is under the metabolic control of the nitrogen to carbon ratio in cells. This is consistent with the fact that asparagine, synthesized by the ASN1 gene product, is a favored compound for nitrogen storage and nitrogen transport in dark-grown plants. We have put forth a working model suggesting that when nitrogen to carbon ratios are high, the gene product of ASN1 functions to re-direct the flow of nitrogen into asparagine, which acts as a shunt for storage and/or long-distance transport of nitrogen. PMID:7846154

  18. Effects of TCDD on the Expression of Nuclear Encoded Mitochondrial Genes

    PubMed Central

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2014-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 hrs) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change|>1.5 and P-value <0.1). Of these, 8 exhibited a dose response (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 hrs. Dose responsive genes encoded proteins associated with electron transport chain (ETC) complex I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of the 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity. PMID:20399798

  19. Transcription of genes encoding iron and heme acquisition proteins of Haemophilus influenzae during acute otitis media.

    PubMed Central

    Whitby, P W; Sim, K E; Morton, D J; Patel, J A; Stull, T L

    1997-01-01

    Unencapsulated Haemophilus influenzae is the second most common etiologic agent of otitis media in children. H. influenzae requires heme for aerobic growth in vitro and is able to utilize hemoglobin and complexes of heme-hemopexin, heme-albumin, and hemoglobin-haptoglobin and ferritransferrin as sources of iron and heme in vitro. Several of the acquisition mechanisms have been characterized and been shown to be heme repressible in vitro. However, little is known about the expression of heme and/or iron acquisition mechanisms during infections in the middle ear. This study was performed to determine if the genes encoding heme and iron acquisition proteins are transcribed during in vivo growth and to compare these findings with those for samples grown in vitro. Reverse transcriptase PCR (RT-PCR) was used to analyze total RNA fractions derived from in vitro- and in vivo-grown H. influenzae. Genes encoding the transferrin-binding proteins TbpA and TbpB, the 100-kDa hemopexin-binding protein HxuA, and the hemoglobin-binding protein HgpA were transcribed during otitis media. Twelve middle ear fluid samples were analyzed by blind RT-PCR to determine the transcriptional status of these genes in H. influenzae during otitis media. Five isolates had transcripts corresponding to tbpA, tbpB, and hxuA. The presence of hgpA transcripts was variable, depending on the presence of hgpA in the genome of the H. influenzae isolate. Samples without H. influenzae gene transcripts contained other etiologic agents commonly causing otitis media. These data demonstrate that H. influenzae iron and/or heme acquisition genes are transcribed during otitis media and suggest that the microenvironment during acute otitis media starves H. influenzae of heme. PMID:9353052

  20. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-07-15

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  1. Isolation and functional characterisation of the genes encoding Δ(8)-sphingolipid desaturase from Brassica rapa.

    PubMed

    Li, Shu-Fen; Song, Li-Ying; Yin, Wei-Bo; Chen, Yu-Hong; Chen, Liang; Li, Ji-Lin; Wang, Richard R-C; Hu, Zan-Min

    2012-01-01

    Δ(8)-Sphingolipid desaturase is the key enzyme that catalyses desaturation at the C8 position of the long-chain base of sphingolipids in higher plants. There have been no previous studies on the genes encoding Δ(8)-sphingolipid desaturases in Brassica rapa. In this study, four genes encoding Δ(8)-sphingolipid desaturases from B. rapa were isolated and characterised. Phylogenetic analyses indicated that these genes could be divided into two groups: BrD8A, BrD8C and BrD8D in group I, and BrD8B in group II. The two groups of genes diverged before the separation of Arabidopsis and Brassica. Though the four genes shared a high sequence similarity, and their coding desaturases all located in endoplasmic reticulum, they exhibited distinct expression patterns. Heterologous expression in Saccharomyces cerevisiae revealed that BrD8A/B/C/D were functionally diverse Δ(8)-sphingolipid desaturases that catalyse different ratios of the two products 8(Z)- and 8(E)-C18-phytosphingenine. The aluminium tolerance of transgenic yeasts expressing BrD8A/B/C/D was enhanced compared with that of control cells. Expression of BrD8A in Arabidopsis changed the ratio of 8(Z):8(E)-C18-phytosphingenine in transgenic plants. The information reported here provides new insights into the biochemical functional diversity and evolutionary relationship of Δ(8)-sphingolipid desaturase in plants and lays a foundation for further investigation of the mechanism of 8(Z)- and 8(E)-C18-phytosphingenine biosynthesis. PMID:22293117

  2. Common nucleotide sequence of structural gene encoding fibroblast growth factor 4 in eight cattle derived from three breeds.

    PubMed

    Sato, Sho; Takahashi, Toshikiyo; Nishinomiya, Hiroshi; Katoh, Makiko; Itoh, Ryu; Yokoo, Masaki; Yokoo, Mari; Iha, Momoe; Mori, Yuki; Kasuga, Kano; Kojima, Ikuo; Kobayashi, Masayuki

    2012-03-01

    Fibroblast growth factor 4 (FGF4) is considered as a crucial gene for the proper development of bovine embryos. However, the complete nucleotide sequences of the structural genes encoding FGF4 in identified breeds are still unknown. In the present study, direct sequencing of PCR products derived from genomic DNA samples obtained from three Japanese Black, two Japanese Shorthorn and three Holstein cattle, revealed that the nucleotide sequences of the structural gene encoding FGF4 matched completely among these eight cattle. On the other hand, differences in the nucleotide sequences, leading to substitutions, insertions or deletions of amino acid residues were detected when compared with the already reported sequence from unidentified breeds. We cannot rule out a possibility that the structural gene elucidated in the present study is widely distributed in cattle. To the best of our knowledge, this is the first determination of the complete nucleotide sequence of the structural gene encoding bovine FGF4 in identified breeds. PMID:22435631

  3. Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene.

    PubMed Central

    Muhlrad, Paul J; Ward, Samuel

    2002-01-01

    Immature spermatids from Caenorhabditis elegans are stimulated by an external activation signal to reorganize their membranes and cytoskeleton to form crawling spermatozoa. This rapid maturation, termed spermiogenesis, occurs without any new gene expression. To better understand this signal transduction pathway, we isolated suppressors of a mutation in the spe-27 gene, which is part of the pathway. The suppressors bypass the requirement for spe-27, as well as three other genes that act in this pathway, spe-8, spe-12, and spe-29. Eighteen of the suppressor mutations are new alleles of spe-6, a previously identified gene required for an early stage of spermatogenesis. The original spe-6 mutations are loss-of-function alleles that prevent major sperm protein (MSP) assembly in the fibrous bodies of spermatocytes and arrest development in meiosis. We have isolated the spe-6 gene and find that it encodes a predicted protein-serine/threonine kinase in the casein kinase 1 family. The suppressor mutations appear to be reduction-of-function alleles. We propose a model whereby SPE-6, in addition to its early role in spermatocyte development, inhibits spermiogenesis until the activation signal is received. The activation signal is transduced through SPE-8, SPE-12, SPE-27, and SPE-29 to relieve SPE-6 repression, thus triggering the formation of crawling spermatozoa. PMID:12019230

  4. Phylogenetic analysis of the genus Plasmodium based on the gene encoding adenylosuccinate lyase.

    PubMed

    Kedzierski, Lukasz; Escalante, Ananias A; Isea, Raul; Black, Casilda G; Barnwell, John W; Coppel, Ross L

    2002-07-01

    Phylogenetic studies of the genus Plasmodium have been performed using sequences of the nuclear, mitochondrial and plastid genes. Here we have analyzed the adenylosuccinate lyase (ASL) gene, which encodes an enzyme involved in the salvage of host purines needed by malaria parasites for DNA synthesis. The ASL gene is present in several eukaryotic as well as prokaryotic organisms and does not have repeat regions, which facilitates the accuracy of the alignment. Furthermore, it has been shown that ASL is not subject to positive natural selection. We have sequenced the ASL gene of several different Plasmodium species infecting humans, rodents, monkeys and birds and used the obtained sequences along with the previously known P. falciparum ASL sequence, for structural and phylogenetic analysis of the genus Plasmodium. The genetic divergence of ASL is comparable with that observed in other nuclear genes such as cysteine proteinase, although ASL cannot be considered conserved when compared to aldolase or superoxide dismutase, which exhibit a slower rate of evolution. Nevertheless, a protein like ASL has a rate of evolution that provides enough information for elucidating evolutionary relationships. We modeled 3D structures of the ASL protein based on sequences used in the phylogenetic analysis and obtained a consistent structure for four different species despite the divergence observed. Such models would facilitate alignment in further studies with a greater number of plasmodial species or other Apicomplexa. PMID:12798008

  5. Localization of genes encoding three distinct flavin-containing monooxygenases to human chromosome 1q

    SciTech Connect

    Shephard, E.A.; Fox, M.F.; Povey, S. ); Dolphin, C.T.; Phillips, I.R.; Smith, R. )

    1993-04-01

    The authors have used the polymerase chain reaction to map the gene encoding human flavin-containing monooxygenase (FMO) form II (N. Lomri, Q. Gu, and J. R. Cashman, 1992, Proc. Natl. Acad. Sci. USA 89: 1685--1689) to chromosome 1. They propose the designation FMO3 for this gene as it is the third FMO gene to be mapped. The two other human FMO genes identified to date, FMO1 and FMO2, are also located on chromosome 1 (C. Dolphin, E. A. Shephard, S. Povey, C. N. A. Palmer, D. M. Ziegler, R. Ayesh, R. L. Smith, and 1. R. Phillips, 1991, J. Biol. Chem. 266: 12379--12385; C. Dolphin, E. A. Shephard, S. F. Povey, R. L. Smith, and I. R. Phillips, 1992, Biochem. J. 286: 261--267). The localization of FMO1, FMO2, and FMO3 has been refined to the long arm of chromosome 1. Analysis of human metaphase chromosomes by in situ hybridization confirmed the mapping of FMO1 and localized this gene more precisely to 1 q23-q25. 28 refs., 3 figs., 2 tabs.

  6. The Maltase Involved in Starch Metabolism in Barley Endosperm Is Encoded by a Single Gene.

    PubMed

    Andriotis, Vasilios M E; Saalbach, Gerhard; Waugh, Robbie; Field, Robert A; Smith, Alison M

    2016-01-01

    During germination and early seedling growth of barley (Hordeum vulgare), maltase is responsible for the conversion of maltose produced by starch degradation in the endosperm to glucose for seedling growth. Despite the potential relevance of this enzyme for malting and the production of alcoholic beverages, neither the nature nor the role of maltase is fully understood. Although only one gene encoding maltase has been identified with certainty, there is evidence for the existence of other genes and for multiple forms of the enzyme. It has been proposed that maltase may be involved directly in starch granule degradation as well as in maltose hydrolysis. The aim of our work was to discover the nature of maltase in barley endosperm. We used ion exchange chromatography to fractionate maltase activity from endosperm of young seedlings, and we partially purified activity for protein identification. We compared maltase activity in wild-type barley and transgenic lines with reduced expression of the previously-characterised maltase gene Agl97, and we used genomic and transcriptomic information to search for further maltase genes. We show that all of the maltase activity in the barley endosperm can be accounted for by a single gene, Agl97. Multiple forms of the enzyme most likely arise from proteolysis and other post-translational modifications. PMID:27011041

  7. Molecular characterization of enterobacterial pldA genes encoding outer membrane phospholipase A.

    PubMed Central

    Brok, R G; Brinkman, E; van Boxtel, R; Bekkers, A C; Verheij, H M; Tommassen, J

    1994-01-01

    The pldA gene of Escherichia coli encodes an outer membrane phospholipase A. A strain carrying the most commonly used mutant pldA allele appeared to express a correctly assembled PldA protein in the outer membrane. Nucleotide sequence analysis revealed that the only difference between the wild type and the mutant is the replacement of the serine residue in position 152 by phenylalanine. Since mutants that lack the pldA gene were normally viable under laboratory conditions and had no apparent phenotype except for the lack of outer membrane phospholipase activity, the exact role of the enzyme remains unknown. Nevertheless, the enzyme seems to be important for the bacteria, since Western blotting (immunoblotting) and enzyme assays showed that it is widely spread among species of the family Enterobacteriaceae. To characterize the PldA protein further, the pldA genes of Salmonella typhimurium, Klebsiella pneumoniae, and Proteus vulgaris were cloned and sequenced. The cloned genes were expressed in E. coli, and their gene products were enzymatically active. Comparison of the predicted PldA primary structures with that of E. coli PldA revealed a high degree of homology, with 79% of the amino acid residues being identical in all four proteins. Implications of the sequence comparison for the structure and the structure-function relationship of PldA protein are discussed. Images PMID:8300539

  8. Bacterial Biosynthetic Gene Clusters Encoding the Anti-cancer Haterumalide Class of Molecules

    PubMed Central

    Matilla, Miguel A.; Stöckmann, Henning; Leeper, Finian J.; Salmond, George P. C.

    2012-01-01

    Haterumalides are halogenated macrolides with strong antitumor properties, making them attractive targets for chemical synthesis. Unfortunately, current synthetic routes to these molecules are inefficient. The potent haterumalide, oocydin A, was previously identified from two plant-associated bacteria through its high bioactivity against plant pathogenic fungi and oomycetes. In this study, we describe oocydin A (ooc) biosynthetic gene clusters identified by genome sequencing, comparative genomics, and chemical analysis in four plant-associated enterobacteria of the Serratia and Dickeya genera. Disruption of the ooc gene cluster abolished oocydin A production and bioactivity against fungi and oomycetes. The ooc gene clusters span between 77 and 80 kb and encode five multimodular polyketide synthase (PKS) proteins, a hydroxymethylglutaryl-CoA synthase cassette and three flavin-dependent tailoring enzymes. The presence of two free-standing acyltransferase proteins classifies the oocydin A gene cluster within the growing family of trans-AT PKSs. The amino acid sequences and organization of the PKS domains are consistent with the chemical predictions and functional peculiarities associated with trans-acyltransferase PKS. Based on extensive in silico analysis of the gene cluster, we propose a biosynthetic model for the production of oocydin A and, by extension, for other members of the haterumalide family of halogenated macrolides exhibiting anti-cancer, anti-fungal, and other interesting biological properties. PMID:23012376

  9. The Maltase Involved in Starch Metabolism in Barley Endosperm Is Encoded by a Single Gene

    PubMed Central

    Andriotis, Vasilios M. E.; Saalbach, Gerhard; Waugh, Robbie; Field, Robert A.; Smith, Alison M.

    2016-01-01

    During germination and early seedling growth of barley (Hordeum vulgare), maltase is responsible for the conversion of maltose produced by starch degradation in the endosperm to glucose for seedling growth. Despite the potential relevance of this enzyme for malting and the production of alcoholic beverages, neither the nature nor the role of maltase is fully understood. Although only one gene encoding maltase has been identified with certainty, there is evidence for the existence of other genes and for multiple forms of the enzyme. It has been proposed that maltase may be involved directly in starch granule degradation as well as in maltose hydrolysis. The aim of our work was to discover the nature of maltase in barley endosperm. We used ion exchange chromatography to fractionate maltase activity from endosperm of young seedlings, and we partially purified activity for protein identification. We compared maltase activity in wild-type barley and transgenic lines with reduced expression of the previously-characterised maltase gene Agl97, and we used genomic and transcriptomic information to search for further maltase genes. We show that all of the maltase activity in the barley endosperm can be accounted for by a single gene, Agl97. Multiple forms of the enzyme most likely arise from proteolysis and other post-translational modifications. PMID:27011041

  10. Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937.

    PubMed

    Lojkowska, E; Masclaux, C; Boccara, M; Robert-Baudouy, J; Hugouvieux-Cotte-Pattat, N

    1995-06-01

    Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino-terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo-pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo-cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft-rot disease. PMID:8577252

  11. GSH2, a gene encoding gamma-glutamylcysteine synthetase in the methylotrophic yeast Hansenula polymorpha.

    PubMed

    Ubiyvovk, Vira M; Nazarko, Taras Y; Stasyk, Olena G; Sohn, Min Jeong; Kang, Hyun Ah; Sibirny, Andrei A

    2002-08-01

    The GSH2 gene, encoding Hansenula polymorpha gamma-glutamylcysteine synthetase, was cloned by functional complementation of a glutathione (GSH)-deficient gsh2 mutant of H. polymorpha. The gene was isolated as a 4.3-kb XbaI fragment that was capable of restoring GSH synthesis, heavy-metal resistance and cell proliferation when introduced into gsh2 mutant cells. It possesses 53% identical and 69% similar amino acids compared with the Candida albicans homologue (Gcs1p). In comparison to the Saccharomyces cerevisiae homologue (Gsh1p), it possesses 47% identical and 61% similar amino acids. The GSH2 sequence appears in the GenBank database under accession No. AF435121. PMID:12702282

  12. Cytochrome P450-encoding genes from the Heliconius genome as candidates for cyanogenesis.

    PubMed

    Chauhan, R; Jones, R; Wilkinson, P; Pauchet, Y; Ffrench-Constant, R H

    2013-10-01

    Cytochrome P450s are important both in the metabolism of xenobiotics and the production of compounds such as cyanogenic glucosides, which insects use in their defence. In the present study, we use transcriptomic and genomic information to isolate and name P450-encoding genes from the butterfly Heliconius melpomene. We classify each of the putative genes into its appropriate superfamily and compare the distribution of P450s across sequenced insects. We also identify homologues of two P450s known to be involved in cyanogenesis in the six-spot Burnet moth, Zygaena filipendulae. Classification of Heliconius P450s should be an important step in the dissection of their role in the exploitation of their host plant, the passion vine Passiflora. PMID:23834845

  13. The role of polymorphisms of genes encoding collagen IX and XI in lumbar disc disease.

    PubMed

    Janeczko, Łukasz; Janeczko, Magdalena; Chrzanowski, Robert; Zieliński, Grzegorz

    2014-01-01

    The intervertebral disc disease (IDD) is one of the most common musculoskeletal disorders. A number of environment and anthropometric risk factors may contribute to it. The recent reports have suggested the importance of genetic factors, especially these which encode collagen types IX and XI. The allelic variants in the collagen IX genes - COL9A2 (Trp2) and COL9A3 (Trp3) have been identified as genetic risk factors for IDD, because they interfere the cross-linking between collagen types II, IX and XI and result in decreased stability of intervertebral discs. Type XI collagen is a minor component of cartilage collagen fibrils, but it is present in the annulus fibrosus and nucleus pulposus of intervertebral discs. Some studies have shown the association between gene COL11A1 polymorphism c.4603C>T and IDD. The frequency of 4603T allele was significantly higher in the patients with IDD than in the healthy controls. PMID:24636772

  14. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    NASA Astrophysics Data System (ADS)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  15. The KUP gene, located on human chromosome 14, encodes a protein with two distant zinc fingers.

    PubMed Central

    Chardin, P; Courtois, G; Mattei, M G; Gisselbrecht, S

    1991-01-01

    We have isolated a human cDNA (kup), encoding a new protein with two distantly spaced zinc fingers of the C2H2 type. This gene is highly conserved in mammals and is expressed mainly in hematopoietic cells and testis. Its expression was not higher in the various transformed cells tested than in the normal corresponding tissues. The kup gene is located in region q23-q24 of the long arm of human chromosome 14. The kup protein is 433 a.a. long, has a M.W. close to 50 kD and binds to DNA. Although the structure of the kup protein is unusual, the isolated fingers resemble closely those of the Krüppel family, suggesting that this protein is also a transcription factor. The precise function and DNA motif recognized by the kup protein remain to be determined. Images PMID:2027750

  16. Cloning and characterization of the nucleoredoxin gene that encodes a novel nuclear protein related to thioredoxin

    SciTech Connect

    Kurooka, Hisanori; Kato, Keizo; Minoguchi, Shigeru

    1997-02-01

    In a yeast artificial chromosome contig close to the nude locus on mouse chromosome 11, we identified a novel gene, nucleoredoxin, that encodes a protein with similarity to the active site of thioredoxins. Nucleoredoxin is conserved between mammalian species, and two homologous genes were found in Caenorhabditis elegans. The nucleoredoxin transcripts are expressed in all adult tissues examined, but restricted to the nervous system and the limb buds in Day 10.5-11.5 embryos. The nucleoredoxin protein is predominantly localized in the nucleus of cells transfected with the nucleoredoxin expression construct. Since the bacterially expressed protein of nucleoredoxin showed oxidoreductase activity of the insulin disulfide bonds with kinetics similar to that of thioredoxin, it may be a redox regulator of the nuclear proteins, such as transcription factors. 40 refs., 6 figs.

  17. Expression of the gene encoding growth hormone in the human mammary gland

    SciTech Connect

    Mol, J.A.; Misdorp, W.; Rijnberk, A.

    1995-10-01

    Progestins cause a syndrome of growth hormone (GH) excess and enhanced mammary tumorigenesis in the dog. This has been regarded as being specific for the dog. Recently we reported that progestin-induced GH excess originates from foci of hyperplastic ductular epithelium of the mammary gland in the dog. In the present report we demonstrate by reverse-transcriptase PCR and immunohistochemistry that a main factor involved in tissue growth, i.e. GH, is also expressed in normal and neoplastic human mammary glands. The gene expressed in the human mammary gland proved to be identical to the gene encoding GH in the pituitary gland. The role of progesterone in the GH expression of the human mammary gland needs, however, to be proven. It is hypothesized that this locally produced hGH may play a pathogenetic role in breast cancer. 21 refs., 2 figs., 1 tab.

  18. Nucleotide sequence of a gene encoding an organophosphorus nerve agent degrading enzyme from Alteromonas haloplanktis.

    PubMed

    Cheng, T; Liu, L; Wang, B; Wu, J; DeFrank, J J; Anderson, D M; Rastogi, V K; Hamilton, A B

    1997-01-01

    Organophosphorus acid anhydrolases (OPAA) catalyzing the hydrolysis of a variety of toxic organophosphorus cholinesterase inhibitors offer potential for decontamination of G-type nerve agents and pesticides. The gene (opa) encoding an OPAA was cloned from the chromosomal DNA of Alteromonas haloplanktis ATCC 23821. The nucleotide sequence of the 1.7 -kb DNA fragment contained the opa gene (1.3 kb) and its flanking region. We report structural and functional similarity of OPAAs from A. haloplanktis and Alteromonas sp JD6.5 with the enzyme prolidase that hydrolyzes dipeptides with a prolyl residue in the carboxyl-terminal position. These results corroborate the earlier conclusion that the OPAA is a type of X-Pro dipeptidase, and that X-Pro could be the native substrate for such an enzyme in Alteromonas cells. PMID:9079288

  19. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  20. PiggyBac transposon vectors: the tools of the human gene encoding

    PubMed Central

    Zhao, Shuang; Jiang, Enze; Chen, Shuangshuang; Gu, Yuan; Shangguan, Anna Junjie; Lv, Tangfeng

    2016-01-01

    A transposon is a DNA segment, which is able to change its relative position within the entire genome of a cell. The piggyBac (PB) transposon is a movable genetic element that efficiently transposes between vectors and chromosomes through a “cut-and-paste” mechanism. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeats (ITRs) sequences located on both ends of the transposon vector and eight efficiently moves the contents from its original positions and efficiently integrates them into TTAA chromosomal sites. PB has drawn much attention because of its transposition efficiency, safety and stability. Due to its priorities, PB can be used as a new genetic vehicle, a new tool for oncogene screening and a new method for gene therapy. PB has created a new outlook for human gene encoding. PMID:26958506

  1. Characterization and developmental expression of genes encoding the early carotenoid biosynthetic enzymes in Citrus paradisi Macf.

    PubMed

    Costa, Marcio G C; Moreira, Cristina D; Melton, John R; Otoni, Wagner C; Moore, Gloria A

    2012-02-01

    In the present study, the full-length cDNA sequences of PSY, PDS, and ZDS, encoding the early carotenoid biosynthetic enzymes in the carotenoid pathway of grapefruit (Citrus paradisi), were isolated and characterized for the first time. CpPSY contained a 1311-bp open reading frame (ORF) encoding a polypeptide of 436 amino acids, CpPDS contained a 1659-bp ORF encoding a polypeptide of 552 amino acids, and CpZDS contained a 1713-bp ORF encoding a polypeptide of 570 amino acids. Phylogenetic analysis indicated that CpPSY shares homology with PSYs from Citrus, tomato, pepper, Arabidopsis, and the monocot PSY1 group, while CpPDS and CpZDS are most closely related to orthologs from Citrus and tomato. Expression analysis revealed fluctuations in CpPSY, CpPDS, and CpZDS transcript abundance and a non-coordinated regulation between the former and the two latter genes during fruit development in albedo and juice vesicles of white ('Duncan') and red ('Flame') grapefruits. A 3× higher upregulation of CpPSY expression in juice vesicles of red-fleshed 'Flame' as compared to white-fruited 'Duncan' was observed in the middle stages of fruit development, which correlates with the well documented accumulation pattern of lycopene in red grapefruit. Together with previous data, our results suggest that the primary mechanism controlling lycopene accumulation in red grapefruit involves the transcriptional upregulation of CpPSY, which controls the flux into the carotenoid pathway, and the downregulated expression of CpLCYB2, which controls the step of cyclization of lycopene in chromoplasts during fruit ripening. A correlation between CpPSY expression and fruit color evolution in red grapefruit is demonstrated. PMID:21594623

  2. Demonstration by heterologous expression that the Leishmania SCA1 gene encodes an arabinopyranosyltransferase.

    PubMed

    Goswami, Mamta; Dobson, Deborah E; Beverley, Stephen M; Turco, Salvatore J

    2006-03-01

    In part of the life cycle within their sand fly vector, Leishmania major parasites first attach to the fly's midgut through their main surface adhesin lipophosphoglycan (LPG) and later resynthesize a structurally distinct LPG that results in detachment and eventual transmission. One of these structural modifications requires the addition of alpha1,2-D-arabinopyranose caps to beta1,3-galactose side chains in the phosphoglycan repeat unit domain of LPG. We had previously identified two side chain arabinose genes (SCA1/2) that were involved in the alpha1,2-D-Arap capping. SCA1/2 exhibit canonical glycosyltransferase motifs, and overexpression of either gene leads to elevated microsomal alpha1,2-D-ArapT activity, resulting in arabinopyranosylation of beta1,3-Gal side chains in LPG (hereafter called side chain D-arabinopyranosyltransferase [sc-D-ArapT]). Heterologous expression in a null arabinose background was used to determine whether the SCA1 gene encodes the actual sc-D-ArapT. SCA1 expression constructs introduced into both mammalian COS-7 cells and the baculovirus-sf9 cell system exhibited considerable expression of the protein. However, functional sc-D-ArapT activity was observed only in the latter. In in vitro assays incubated with guanidine 59-diphosphate (GDP)-D-[3H]Arap as the sugar donor and utilizing exogenous LPG as an acceptor, significant sc-D-ArapT activity was observed when microsomes from the baculovirus-sf9 cells were incubated in presence of the LPG acceptor. No activity was observed in the absence of LPG. These results demonstrate that SCA1 encodes a sc-D-ArapT and provide the first example of heterologous expression of a D-ArapT gene. PMID:16272216

  3. Transcriptional Regulation of the Gene Cluster Encoding Allantoinase and Guanine Deaminase in Klebsiella pneumoniae▿

    PubMed Central

    Guzmán, Karla; Badia, Josefa; Giménez, Rosa; Aguilar, Juan; Baldoma, Laura

    2011-01-01

    Purines can be used as the sole source of nitrogen by several strains of K. pneumoniae under aerobic conditions. The genes responsible for the assimilation of purine nitrogens are distributed in three separated clusters in the K. pneumoniae genome. Here, we characterize the cluster encompassing genes KPN_01787 to KPN_01791, which is involved in the conversion of allantoin into allantoate and in the deamination of guanine to xanthine. These genes are organized in three transcriptional units, hpxSAB, hpxC, and guaD. Gene hpxS encodes a regulatory protein of the GntR family that mediates regulation of this system by growth on allantoin. Proteins encoded by hpxB and guaD display allantoinase and guanine deaminase activity, respectively. In this cluster, hpxSAB is the most tightly regulated unit. This operon was activated by growth on allantoin as a nitrogen source; however, addition of allantoin to nitrogen excess cultures did not result in hpxSAB induction. Neither guaD nor hpxC was induced by allantoin. Expression of guaD is mainly regulated by nitrogen availability through the action of NtrC. Full induction of hpxSAB by allantoin requires both HpxS and NAC. HpxS may have a dual role, acting as a repressor in the absence of allantoin and as an activator in its presence. HpxS binds to tandem sites, S1 and S2, overlapping the −10 and −35 sequences of the hpxSAB promoter, respectively. The NAC binding site is located between S1 and S2 and partially overlaps S2. In the presence of allantoin, interplay between NAC and HpxS is proposed. PMID:21357483

  4. Identification and functional expression of genes encoding flavonoid O- and C-glycosidases in intestinal bacteria.

    PubMed

    Braune, Annett; Engst, Wolfram; Blaut, Michael

    2016-07-01

    Gut bacteria play a crucial role in the metabolism of dietary flavonoids and thereby influence the bioactivity of these compounds in the host. The intestinal Lachnospiraceae strain CG19-1 and Eubacterium cellulosolvens are able to deglycosylate C- and O-coupled flavonoid glucosides. Growth of strain CG19-1 in the presence of the isoflavone C-glucoside puerarin (daidzein 8-C-glucoside) led to the induction of two proteins (DfgC, DfgD). Heterologous expression of the encoding genes (dfgC, dfgD) in Escherichia coli revealed no C-deglycosylating activity in the resulting cell extracts but cleavage of flavonoid O-glucosides such as daidzin (daidzein 7-O-glucoside). The recombinant DfgC and DfgD proteins were purified and characterized with respect to their quaternary structure, substrate and cofactor specificity. The products of the corresponding genes (dfgC, dfgD) from E. cellulosolvens also catalysed the O-deglycosylation of daidzin following their expression in E. coli. In combination with three recombinant proteins encoded by adjacent genes in E. cellulosolvens (dfgA, dfgB, dfgE), DfgC and DfgD from E. cellulosolvens catalysed the deglycosylation of the flavone C-glucosides homoorientin (luteolin 6-C-glucoside) and isovitexin (apigenin 6-C-glucoside). Even intact cells of E. coli expressing the five E. cellulosolvens genes cleaved these flavone C-glucosides and, also, flavonoid O-glucosides to the corresponding aglycones. PMID:25845411

  5. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley.

    PubMed

    Kristensen, M; Lok, F; Planchot, V; Svendsen, I; Leah, R; Svensson, B

    1999-05-18

    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement with a value of 105 kDa estimated by SDS-PAGE. The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic fragments coupled with matrix assisted laser desorption mass spectrometry. The sequenced peptide fragments cover 70% of the entire protein sequence, which shows 62% and 77% identity to that of starch debranching enzymes from spinach and rice and 37% identity to Klebsiella pullulanase. Sequence alignment supports the multidomain architecture and identifies both secondary structure elements of the catalytic (beta/alpha)8-barrel substrate, catalytic residues, and specificity associated motifs characteristic of members of the glycoside hydrolase family 13 which cleave alpha-1,6-glucosidic bonds. A remarkable distribution of the secondary structure elements to individual exons is observed. PMID:10350630

  6. Chlamydial gene encoding a 70-kilodalton antigen in Escherichia coli: analysis of expression signals and identification of the gene product.

    PubMed Central

    Sardinia, L M; Engel, J N; Ganem, D

    1989-01-01

    In an attempt to identify chlamydial genes whose native promoters allow them to be expressed in Escherichia coli, we isolated and characterized a chlamydial gene identified by screening a library of chlamydial DNA with antichlamydial antibodies. This gene encodes a 70-kilodalton immunoreactive polypeptide in E. coli hosts. Sequence analysis of the 5' portion of the gene identified its product as the chlamydial homolog of the E. coli ribosomal protein S1. The site of transcription initiation of the mRNA in chlamydiae was determined, and its putative promoter regions were identified. These regions apparently do not function efficiently in E. coli; in vitro transcripts generated by using E. coli RNA polymerase did not start at the authentic chlamydial initiation site. Several in vitro transcripts both larger and smaller than the authentic transcript were seen; presumably, these transcripts result from adventitious promoterlike elements in adjacent chlamydial DNA and may be responsible for the expression of the gene in E. coli. Images PMID:2644193

  7. Clarin-1, Encoded by the Usher Syndrome III Causative Gene, Forms a Membranous Microdomain

    PubMed Central

    Tian, Guilian; Zhou, Yun; Hajkova, Dagmar; Miyagi, Masaru; Dinculescu, Astra; Hauswirth, William W.; Palczewski, Krzysztof; Geng, Ruishuang; Alagramam, Kumar N.; Isosomppi, Juha; Sankila, Eeva-Marja; Flannery, John G.; Imanishi, Yoshikazu

    2009-01-01

    Clarin-1 is the protein product encoded by the gene mutated in Usher syndrome III. Although the molecular function of clarin-1 is unknown, its primary structure predicts four transmembrane domains similar to a large family of membrane proteins that include tetraspanins. Here we investigated the role of clarin-1 by using heterologous expression and in vivo model systems. When expressed in HEK293 cells, clarin-1 localized to the plasma membrane and concentrated in low density compartments distinct from lipid rafts. Clarin-1 reorganized actin filament structures and induced lamellipodia. This actin-reorganizing function was absent in the modified protein encoded by the most prevalent North American Usher syndrome III mutation, the N48K form of clarin-1 deficient in N-linked glycosylation. Proteomics analyses revealed a number of clarin-1-interacting proteins involved in cell-cell adhesion, focal adhesions, cell migration, tight junctions, and regulation of the actin cytoskeleton. Consistent with the hypothesized role of clarin-1 in actin organization, F-actin-enriched stereocilia of auditory hair cells evidenced structural disorganization in Clrn1−/− mice. These observations suggest a possible role for clarin-1 in the regulation and homeostasis of actin filaments, and link clarin-1 to the interactive network of Usher syndrome gene products. PMID:19423712

  8. Plasmid-encoded genes influence exosporium assembly and morphology in Bacillus megaterium QM B1551 spores

    PubMed Central

    Manetsberger, Julia; Hall, Elizabeth A. H.; Christie, Graham

    2015-01-01

    Spores of Bacillus megaterium QM B1551 are encased in a morphologically distinctive exosporium. We demonstrate here that genes encoded on the indigenous pBM500 and pBM600 plasmids are required for exosporium assembly and or stability in spores of this strain. Bioinformatic analyses identified genes encoding orthologues of the B. cereus-family exosporium nap and basal layer proteins within the B. megaterium genome. Transcriptional analyses, supported by electron and fluorescent microscopy, indicate that the pole-localized nap, identified here for the first time in B. megaterium QM B1551 spores, is comprised of the BclA1 protein. The role of the BxpB protein, which forms the basal layer of the exosporium in B. cereus spores, is less clear since spores of a null mutant strain display an apparently normal morphology. Retention of the localized nap in bxpB null spores suggests that B. megaterium employs an alternative mechanism to that used by B. cereus spores in anchoring the nap to the spore surface. PMID:26316548

  9. Cell type-specific transcriptional regulation of the gene encoding importin-{alpha}1

    SciTech Connect

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro; Department of Biochemistry, Graduate School of Medicine, Osaka University; JST, CREST, Graduate School of Frontier Biosciences, Osaka University, Yamada-oka, Suita, Osaka 565-0871

    2011-08-15

    Importin-{alpha}1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: {yields} We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. {yields} NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. {yields} Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  10. Disruption of genes encoding subunits of yeast vacuolar H(+)-ATPase causes conditional lethality.

    PubMed Central

    Nelson, H; Nelson, N

    1990-01-01

    The main function of vacuolar H(+)-ATPases in eukaryotic cells is to generate proton and electrochemical gradients across the membranes of the vacuolar system. The enzyme is composed of a catalytic sector with five subunits (A-E) and a membrane sector containing at least two subunits (a and c). We disrupted two genes of this enzyme, in yeast cells, one encoding a subunit of the membrane sector (subunit c) and another encoding a subunit of the catalytic sector (subunit B). The resulting mutants did not grow in medium with a pH value higher than 6.5 and grew well only within a narrow pH range around 5.5. Transformation of the mutants with plasmids containing the corresponding genes repaired the mutations. Thus failure to lower the pH in the vacuolar system of yeast, and probably other eukaryotic cells, is lethal and the mutants may survive only if a low external pH allows for this acidification by fluid-phase endocytosis. Images PMID:2139726

  11. Nucleotide sequence of the gene encoding the two-subunit pilin of Bacteroides nodosus 265.

    PubMed Central

    Elleman, T C; Hoyne, P A; McKern, N M; Stewart, D J

    1986-01-01

    The nucleotide sequence of the gene encoding pilin from Bacteroides nodosus 265 has been determined. The pilin is encoded by a single-copy gene, from which can be predicted a prepilin comprising a single protein chain of Mr 16,637. The prepilin sequence differs in several respects from the mature protein sequence. Seven additional N-terminal amino acid residues are present in prepilin, whereas residue 8, phenylalanine, undergoes posttranslational modification to become the N-methylated amino-terminal residue of mature pilin. In addition, further processing occurs through internal cleavage to produce two noncovalently linked subunits characteristic of pilins from serogroup H of B. nodosus, of which strain 265 is a member. The position of cleavage has been identified between alanine residues at positions 72 and 73 of the mature 149-residue pilin protein. The predicted pilin sequence of B. nodosus 265 shows extensive N-terminal amino acid sequence homology with other pilins of the N-methylphenylalanine type. In addition this sequence also shows homology with these N-methylphenylalanine-type pilins in the C-terminal region of the molecule, especially with pilin from Pseudomonas aeruginosa PAK. Images PMID:2873127

  12. Phylogenetic analysis to uncover organellar origins of nuclear-encoded genes.

    PubMed

    Foth, Bernardo J

    2007-01-01

    Most proteins that are located in mitochondria or plastids are encoded by the nuclear genome, because the organellar genomes have undergone severe reduction during evolution. In many cases, although not all, the nuclear genes encoding organelle-targeted proteins actually originated from the respective organellar genome and thus carry the phylogenetic fingerprint that still bespeaks their evolutionary origin. Phylogenetic analysis is a powerful in silico method that can yield important insights into the evolutionary history or molecular kinship of any gene or protein and that can thus also be used more specifically in the context of organellar targeting as one means to recognize protein candidates (e.g., from genome data) that may be targeted to mitochondria or plastids. This chapter provides protocols for creating multiple sequence alignments and carrying out phylogenetic analysis with the robust and comprehensive software packages Clustal and PHYLIP, which are both available free of charge for multiple computer platforms. Besides presenting step-by-step instructions on how to run these computer programs, this chapter also covers topics such as data collection and presentation of phylogenetic trees. PMID:17951706

  13. Characterization of the gene encoding pisatin demethylase (FoPDA1) in Fusarium oxysporum.

    PubMed

    Coleman, Jeffrey J; Wasmann, Catherine C; Usami, Toshiyuki; White, Gerard J; Temporini, Esteban D; McCluskey, Kevin; VanEtten, Hans D

    2011-12-01

    The pea pathogen Fusarium oxysporum f. sp. pisi is able to detoxify pisatin produced as a defense response by pea, and the gene encoding this detoxification mechanism, FoPDA1, was 82% identical to the cytochrome P450 pisatin demethylase PDA1 gene in Nectria haematococca. A survey of F. oxysporum f. sp. pisi isolates demonstrated that, as in N. haematococca, the PDA gene of F. oxysporum f. sp. pisi is generally located on a small chromosome. In N. haematococca, PDA1 is in a cluster of pea pathogenicity (PEP) genes. Homologs of these PEP genes also were found in the F. oxysporum f. sp. pisi isolates, and PEP1 and PEP5 were sometimes located on the same small chromosomes as the FoPDA1 homologs. Transforming FoPDA1 into a pda(?) F. oxysporum f. sp. lini isolate conferred pda activity and promoted pathogenicity on pea to some transformants. Different hybridization patterns of FoPDA1 were found in F. oxysporum f. sp. pisi but these did not correlate with the races of the fungus, suggesting that races within this forma specialis arose independently of FoPDA1. FoPDA1 also was present in the formae speciales lini, glycines, and dianthi of F. oxysporum but they had mutations resulting in nonfunctional proteins. However, an active FoPDA1 was present in F. oxysporum f. sp. phaseoli and it was virulent on pea. Despite their evolutionary distance, the amino acid sequences of FoPDA1 of F. oxysporum f. sp. pisi and F. oxysporum f. sp. phaseoli revealed only six amino acid differences, consistent with a horizontal gene transfer event accounting for the origin of these genes. PMID:22066900

  14. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    SciTech Connect

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

  15. On the role of PDZ domain-encoding genes in Drosophila border cell migration.

    PubMed

    Aranjuez, George; Kudlaty, Elizabeth; Longworth, Michelle S; McDonald, Jocelyn A

    2012-11-01

    Cells often move as collective groups during normal embryonic development and wound healing, although the mechanisms governing this type of migration are poorly understood. The Drosophila melanogaster border cells migrate as a cluster during late oogenesis and serve as a powerful in vivo genetic model for collective cell migration. To discover new genes that participate in border cell migration, 64 out of 66 genes that encode PDZ domain-containing proteins were systematically targeted by in vivo RNAi knockdown. The PDZ domain is one of the largest families of protein-protein interaction domains found in eukaryotes. Proteins that contain PDZ domains participate in a variety of biological processes, including signal transduction and establishment of epithelial apical-basal polarity. Targeting PDZ proteins effectively assesses a larger number of genes via the protein complexes and pathways through which these proteins function. par-6, a known regulator of border cell migration, was a positive hit and thus validated the approach. Knockdown of 14 PDZ domain genes disrupted migration with multiple RNAi lines. The candidate genes have diverse predicted cellular functions and are anticipated to provide new insights into the mechanisms that control border cell movement. As a test of this concept, two genes that disrupted migration were characterized in more detail: big bang and the Dlg5 homolog CG6509. We present evidence that Big bang regulates JAK/STAT signaling, whereas Dlg5/CG6509 maintains cluster cohesion. Moreover, these results demonstrate that targeting a selected class of genes by RNAi can uncover novel regulators of collective cell migration. PMID:23173089

  16. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  17. The relationship between transcript expression levels of nuclear encoded (TFAM, NRF1) and mitochondrial encoded (MT-CO1) genes in single human oocytes during oocyte maturation

    PubMed Central

    Novin, M Ghaffari; Allahveisi, A; Noruzinia, M; Farhadifar, F; Yousefian, E; Fard, A Dehghani; Salimi, M

    2015-01-01

    In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII) stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA), copied in oocytes, is essential for providing adenosine triphosphate (ATP) during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1) and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (TFAM) in various stages of human oocyte maturation. Nine consenting patients, age 21–35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI) procedures. mRNA levels of mitochondrial-related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR). There was no significant relationship between the relative expression levels in germinal vesicle (GV) stage oocytes (p = 0.62). On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI) and MII (p = 0.03 and p = 0.002). A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation. PMID:26929904

  18. Gene cloning and characterization of the protein encoded by the Neospora caninum bradyzoite-specific antigen gene BAG1.

    PubMed

    Kobayashi, T; Narabu, S; Yanai, Y; Hatano, Y; Ito, A; Imai, S; Ike, K

    2013-06-01

    Neospora caninum is an Apicomplexan parasite that causes repeated abortion and stillbirth in cattle. The aim of this study was to clone the gene encoding the N. caninum orthologue (NcBAG1) of the Toxoplasma gondii bradyzoite-specific protein TgBAG1 and characterize its expression pattern in the parasite. Isolation of the full-length 684-bp gene revealed that it shared 78.3% sequence similarity with TgBAG1. NcBAG1 encodes a predicted protein of 227 amino acids with 80.3% similarity to TgBAG1. A putative signal peptide sequence and an invariant GVL motif characteristic of small heat-shock proteins were identified in the predicted N. caninum amino acid sequence. We expressed the NcBAG1 gene as a recombinant glutathione S-transferase fusion protein (rNcBAG1) in Escherichia coli and used the purified 60 kDa protein to obtain a monoclonal antibody (Mab). rNcBAG1 reacted to Mabs specific for NcBAG1 and TgBAG1. No reaction between the NcBAG1 Mab and N. caninum tachyzoites was observed. Although the predicted molecular mass of NcBAG1 is 25 kDa, Western blot analysis of parasite lysates using the NcBAG1 Mab revealed a cross-reactive protein of approximately 30 kDa. Additionally, immunofluorescence assays using the tachyzoite-specific Mab for NcSAG1 and the bradyzoite-specific Mab for TgBAG1 or NcSAG4 revealed NcBAG1-specific expression in bradyzoites in cultures exposed to sodium nitroprusside, a reagent that increases the frequency of bradyzoites. Interestingly, the NcBAG1 protein was identified in the cytoplasm of the bradyzoite-stage parasites. This preliminary analysis of the NcBAG1 gene will assist investigations into the role of this protein in N. caninum . PMID:23245337

  19. Evidence of Localized Prophage-Host Recombination in the lytA Gene, Encoding the Major Pneumococcal Autolysin ▿

    PubMed Central

    Morales, María; García, Pedro; de la Campa, Adela G.; Liñares, Josefina; Ardanuy, Carmen; García, Ernesto

    2010-01-01

    According to a highly polymorphic region in the lytA gene, encoding the major autolysin of Streptococcus pneumoniae, two different families of alleles can be differentiated by PCR and restriction digestion. Here, we provide evidence that this polymorphic region arose from recombination events with homologous genes of pneumococcal temperate phages. PMID:20304992

  20. Detection of genes encoding antimicrobial peptides in Mexican strains of Trichoplusia ni (Hubner) exposed to Bacillus thuringiensis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The systemic immune response of Trichoplusia ni after Bacillus thuringiensis (Bt) exposure was evaluated by comparing the expression of genes encoding antimicrobial peptides (AMP) in Bt-susceptible and -resistant T. ni strains that were either exposed or not to XenTari® (Bt-XT). AMP genes were dete...

  1. Mutations in the Drosophila melanogaster gene encoding S-adenosylmethionine suppress position-effect variegation

    SciTech Connect

    Larsson, J.; Rasmuson-Lestander, A.; Zhang, Jingpu

    1996-06-01

    In Drosophila melanogaster, the study of trans-acting modifier mutations of position-effect variegation and Polycomb group (Pc-G) genes have been useful tools to investigate genes involved in chromatin structure. We have cloned a modifier gene, Suppressor of zeste 5 (Su(z)5), which encodes S-adenosylmethionine synthetase, and we present here molecular results and data concerning its expression in mutants and genetic interactions. The mutant alleles Su(z)5, l(2)R23 and l(2)M6 show suppression of w{sup m4} and also of two white mutants induced by roo element insertions in the regulatory region i.e., w{sup is} (in combination with z{sup 1}) and w{sup sp1}. Two of the Su(z)5 alleles, as well as a deletion of the gene, also act as enhancers of Polycomb by increasing the size of sex combes on midleg. The results suggest that Su(z)5 is connected with regulation of chromatin structure. The enzyme S-adenosylmethionine synthetase is involved in the synthesis of S-adenosylmethionine, a methyl group donor and also, after decarboxylation, a propylamino group donor in the biosynthesis of polyamines. Our results from HPLC analysis show that in ovaries from heterozygous Su(z)5 mutants the content of spermine is significantly reduced. Results presented here suggest that polyamines are an important molecule class in the regulation of chromatin structure. 50 refs., 5 figs., 3 tabs.

  2. The pep4 gene encoding proteinase A is involved in dimorphism and pathogenesis of Ustilago maydis.

    PubMed

    Soberanes-Gutiérrez, Cinthia V; Juárez-Montiel, Margarita; Olguín-Rodríguez, Omar; Hernández-Rodríguez, César; Ruiz-Herrera, José; Villa-Tanaca, Lourdes

    2015-10-01

    Vacuole proteases have important functions in different physiological processes in fungi. Taking this aspect into consideration, and as a continuation of our studies on the analysis of the proteolytic system of Ustilago maydis, a phytopathogenic member of the Basidiomycota, we have analysed the role of the pep4 gene encoding the vacuolar acid proteinase PrA in the pathogenesis and morphogenesis of the fungus. After confirmation of the location of the protease in the vacuole using fluorescent probes, we obtained deletion mutants of the gene in sexually compatible strains of U. maydis (FB1 and FB2), and analysed their phenotypes. It was observed that the yeast to mycelium dimorphic transition induced by a pH change in the medium, or the use of a fatty acid as sole carbon source, was severely reduced in Δpep4 mutants. In addition, the virulence of the mutants in maize seedlings was reduced, as revealed by the lower proportion of plants infected and the reduction in size of the tumours induced by the pathogen, when compared with wild-type strains. All of these phenotypic alterations were reversed by complementation of the mutant strains with the wild-type gene. These results provide evidence of the importance of the pep4 gene for the morphogenesis and virulence of U. maydis. PMID:25597948

  3. Mutations in the Drosophila Melanogaster Gene Encoding S-Adenosylmethionine Suppress Position-Effect Variegation

    PubMed Central

    Larsson, J.; Zhang, J.; Rasmuson-Lestander, A.

    1996-01-01

    In Drosophila melanogaster, the study of trans-acting modifier mutations of position-effect variegation and Polycomb group (Pc-G) genes have been useful tools to investigate genes involved in chromatin structure. We have cloned a modifier gene, Suppressor of zeste 5 (Su(z)5), which encodes S-adenosylmethionine synthetase, and we present here molecular results and data concerning its expression in mutants and genetic interactions. The mutant alleles Su(z)5, l(2)R23 and l(2)M6 show suppression of w(m4) and also of two white mutants induced by roo element insertions in the regulatory region i.e., w(is) (in combination with z(1)) and w(sp1). Two of the Su(z)5 alleles, as well as a deletion of the gene, also act as enhancers of Polycomb by increasing the size of sex combs on midleg. The results suggest that Su(z)5 is connected with regulation of chromatin structure. The enzyme S-adenosylmethionine synthetase is involved in the synthesis of S-adenosylmethionine, a methyl group donor and also, after decarboxylation, a propylamino group donor in the bio-synthesis of polyamines. Our results from HPLC analysis show that in ovaries from heterozygous Su(z)5 mutants the content of spermine is significantly reduced. Results presented here suggest that polyamines are an important molecule class in the regulation of chromatin structure. PMID:8725236

  4. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.

    PubMed

    Otsuka, Chie; Minami, Ikuko; Oda, Kenji

    2010-01-01

    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia. PMID:21150100

  5. BAGEL3: automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides

    PubMed Central

    van Heel, Auke J.; de Jong, Anne; Montalbán-López, Manuel; Kok, Jan; Kuipers, Oscar P.

    2013-01-01

    Identifying genes encoding bacteriocins and ribosomally synthesized and posttranslationally modified peptides (RiPPs) can be a challenging task. Especially those peptides that do not have strong homology to previously identified peptides can easily be overlooked. Extensive use of BAGEL2 and user feedback has led us to develop BAGEL3. BAGEL3 features genome mining of prokaryotes, which is largely independent of open reading frame (ORF) predictions and has been extended to cover more (novel) classes of posttranslationally modified peptides. BAGEL3 uses an identification approach that combines direct mining for the gene and indirect mining via context genes. Especially for heavily modified peptides like lanthipeptides, sactipeptides, glycocins and others, this genetic context harbors valuable information that is used for mining purposes. The bacteriocin and context protein databases have been updated and it is now easy for users to submit novel bacteriocins or RiPPs. The output has been simplified to allow user-friendly analysis of the results, in particular for large (meta-genomic) datasets. The genetic context of identified candidate genes is fully annotated. As input, BAGEL3 uses FASTA DNA sequences or folders containing multiple FASTA formatted files. BAGEL3 is freely accessible at http://bagel.molgenrug.nl. PMID:23677608

  6. Hyphal tip extension in Aspergillus nidulans requires the manA gene, which encodes phosphomannose isomerase.

    PubMed Central

    Smith, D J; Payton, M A

    1994-01-01

    A strain of Aspergillus nidulans carrying a temperature-sensitive mutation in the manA gene produces cell walls depleted of D-mannose and forms hyphal tip balloons at the restrictive temperature (B.P. Valentine and B.W. Bainbridge, J. Gen. Microbiol. 109:155-168, 1978). We have isolated and characterized the manA gene and physically located it between 3.5 and 5.5 kb centromere distal of the riboB locus on chromosome VIII. The manA gene contains four introns and encodes a 50.6-kDa protein which has significant sequence identity to type I phosphomannose isomerase proteins from other eukaryotes. We have constructed by integrative transformation a null mutation in the manA gene which can only be maintained in a heterokaryotic strain with wild-type manA+ nuclei. Thus, a manA null mutation is lethal in A. nidulans. The phenotype of the mutation was analyzed in germinating conidia. Such conidia are able to commence germination but swell abnormally, sometimes producing a misshapen germ tube, before growth ceases. The reason for the lethality is probably the lack of synthesis of mannose-containing cell wall polymers that must be required for normal cell wall development in growing hyphae. Images PMID:8065336

  7. Unexpected Diversity of pepA Genes Encoding Leucine Aminopeptidases in Sediments from a Freshwater Lake

    PubMed Central

    Tsuboi, Shun; Yamamura, Shigeki; Imai, Akio; Iwasaki, Kazuhiro

    2016-01-01

    We herein designed novel PCR primers for universal detection of the pepA gene, which encodes the representative leucine aminopeptidase gene, and investigated the genetic characteristics and diversity of pepA genes in sediments of hypereutrophic Lake Kasumigaura, Japan. Most of the amino acid sequences deduced from the obtained clones (369 out of 370) were related to PepA-like protein sequences in the M17 family of proteins. The developed primers broadly detected pepA-like clones associated with diverse bacterial phyla—Alpha-, Beta-, Gamma-, and Deltaproteobacteria, Acidobacteria, Actinobacteria, Aquificae, Chlamydiae, Chloroflexi, Cyanobacteria, Firmicutes, Nitrospirae, Planctomycetes, and Spirochetes as well as the archaeal phylum Thaumarchaeota, indicating that prokaryotes in aquatic environments possessing leucine aminopeptidase are more diverse than previously reported. Moreover, prokaryotes related to the obtained pepA-like clones appeared to be r- and K-strategists, which was in contrast to our previous findings showing that the neutral metalloprotease gene clones obtained were related to the r-strategist genus Bacillus. Our results suggest that an unprecedented diversity of prokaryotes with a combination of different proteases participate in sedimentary proteolysis. PMID:26936797

  8. The gusBC Genes of Escherichia coli Encode a Glucuronide Transport System

    PubMed Central

    Liang, Wei-Jun; Wilson, Kate J.; Xie, Hao; Knol, Jan; Suzuki, Shun'ichi; Rutherford, Nicholas G.; Henderson, Peter J. F.; Jefferson, Richard A.

    2005-01-01

    Two genes, gusB and gusC, from a natural fecal isolate of Escherichia coli are shown to encode proteins responsible for transport of β-glucuronides with synthetic [14C]phenyl-1-thio-β-d-glucuronide as the substrate. These genes are located in the gus operon downstream of the gusA gene on the E. coli genome, and their expression is induced by a variety of β-d-glucuronides. Measurements of transport in right-side-out subcellular vesicles show the system has the characteristics of secondary active transport energized by the respiration-generated proton motive force. When the genes were cloned together downstream of the tac operator-promoter in the plasmid pTTQ18 expression vector, transport activity was increased considerably with isopropylthiogalactopyranoside as the inducer. Amplified expression of the GusB and GusC proteins enabled visualization and identification by N-terminal sequencing of both proteins, which migrated at ca. 32 kDa and 44 kDa, respectively. Separate expression of the GusB protein showed that it is essential for glucuronide transport and is located in the inner membrane, while the GusC protein does not catalyze transport but assists in an as yet unknown manner and is located in the outer membrane. The output of glucuronides as waste by mammals and uptake for nutrition by gut bacteria or reabsorption by the mammalian host is discussed. PMID:15774881

  9. The sorghum photoperiod sensitivity gene, Ma3, encodes a phytochrome B.

    PubMed Central

    Childs, K L; Miller, F R; Cordonnier-Pratt, M M; Pratt, L H; Morgan, P W; Mullet, J E

    1997-01-01

    The Ma3 gene is one of six genes that regulate the photoperiodic sensitivity of flowering in sorghum (Sorghum bicolor [L.] Moench). The ma3R mutation of this gene causes a phenotype that is similar to plants that are known to lack phytochrome B, and ma3 sorghum lacks a 123-KD phytochrome that predominates in light-grown plants and that is present in non-ma3 plants. A population segregating for Ma3 and ma3 was created and used to identify two randomly amplified polymorphic DNA markers linked to Ma3. These two markers were cloned and mapped in a recombinant inbred population as restriction fragment length polymorphisms. cDNA clones of PHYA and PHYC were cloned and sequenced from a cDNA library prepared from green sorghum leaves. Using a genome-walking technique, a 7941-bp partial sequence of PHYB, was determined from genomic DNA from ma3 sorghum. PHYA, PHYB, and PHYC all mapped to the same linkage group. The Ma3-linked markers mapped with PHYB more than 121 centimorgans from PHYA and PHYC. A frameshift mutation resulting in a premature stop codon was found in the PHYB sequence from ma3 sorghum. Therefore, we conclude that the Ma3 locus in sorghum is a PHYB gene that encodes a 123-kD phytochrome. PMID:9046599

  10. A Gene Mutated in Nephronophthisis and Retinitis Pigmentosa Encodes a Novel Protein, Nephroretinin, Conserved in Evolution

    PubMed Central

    Otto, Edgar; Hoefele, Julia; Ruf, Rainer; Mueller, Adelheid M.; Hiller, Karl S.; Wolf, Matthias T. F.; Schuermann, Maria J.; Becker, Achim; Birkenhäger, Ralf; Sudbrak, Ralf; Hennies, Hans C.; Nürnberg, Peter; Hildebrandt, Friedhelm

    2002-01-01

    Nephronophthisis (NPHP) comprises a group of autosomal recessive cystic kidney diseases, which constitute the most frequent genetic cause for end-stage renal failure in children and young adults. The most prominent histologic feature of NPHP consists of development of renal fibrosis, which, in chronic renal failure of any origin, represents the pathogenic event correlated most strongly to loss of renal function. Four gene loci for NPHP have been mapped to chromosomes 2q13 (NPHP1), 9q22 (NPHP2), 3q22 (NPHP3), and 1p36 (NPHP4). At all four loci, linkage has also been demonstrated in families with the association of NPHP and retinitis pigmentosa, known as “Senior-Løken syndrome” (SLS). Identification of the gene for NPHP type 1 had revealed nephrocystin as a novel docking protein, providing new insights into mechanisms of cell-cell and cell-matrix signaling. We here report identification of the gene (NPHP4) causing NPHP type 4, by use of high-resolution haplotype analysis and by demonstration of nine likely loss-of-function mutations in six affected families. NPHP4 encodes a novel protein, nephroretinin, that is conserved in evolution—for example, in the nematode Caenorhabditis elegans. In addition, we demonstrate two loss-of-function mutations of NPHP4 in patients from two families with SLS. Thus, we have identified a novel gene with critical roles in renal tissue architecture and ophthalmic function. PMID:12205563