Science.gov

Sample records for gene promoter region

  1. Promoter region of mouse Tcrg genes

    SciTech Connect

    Ishimi, Y.; Huang, Y.Y.; Ohta, S.

    1996-06-01

    The mouse T-cell receptor (Tcr){gamma} chain is characterized by a specific expression of V gene segments in the thymus corresponding to consecutive developmental stages; i.e., the Vg5 in fetal, Vg6 in neonatal, and Vg4 and Vg7 in adult. The order of the Vg gene usage correlates with the localization of the Vg gene segment on the chromosome; i.e., the Vg5 gene, being most proximal to the Jg1, is used first, followed by the Vg segments away from the Jg1 in a sequential manner. Since they all rearrange to the same Jg1 gene segment, the sequences in the coding region and/or in the 5{prime} upstream region are responsible for the stage-specific transcription. Also, Goldman and co-workers reported the germline transcription of Vg genes preceding their rearrangement. Therefore, the stage-specific transcription may be involved in the regulation of the stage-specific rearrangement; we sequenced and analyzed the 5{prime} flanking regions of the Vg5, Vg6, Vg4, and Vg7 genes to study the transcriptional relation. 18 refs., 2 figs., 1 tab.

  2. Polymorphisms in the promoter region of catalase gene and essential hypertension.

    PubMed

    Zhou, Xiao Feng; Cui, Jing; DeStefano, Anita L; Chazaro, Irmarie; Farrer, Lindsay A; Manolis, Athanasios J; Gavras, Haralambos; Baldwin, Clinton T

    2005-01-01

    Genetic variations that predispose individuals to complex disorders, such as essential hypertension, may be found in gene coding regions, intronic regions or in gene promoter regions. Most studies have focused on gene variations that result in amino acid substitutions because they result in different isoforms of the protein, presumably resulting in differences in protein properties. Less attention has been placed on the role of intronic or promoter mutations. In this report, we examined two single nucleotide polymorphisms (SNPs) in the catalase (CAT) gene prompter region in a cohort of hypertensive Caucasians and African Americans with a Mass Spec based Homogenous MassEXTEND assay. We found an association when a specific combination of the two promoter SNPs was examined in Caucasians. No association was observed in African Americans. Our data suggest that genetic variations in the promoter region of catalase gene influence the susceptibility to essential hypertension. In addition, the genetic factors that contribute to hypertension maybe different between ethnic groups. PMID:15735318

  3. Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.

    PubMed

    Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui

    2014-05-01

    Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene. PMID:24464129

  4. Determination of the core promoter regions of the Saccharomyces cerevisiae RPS3 gene.

    PubMed

    Joo, Yoo Jin; Kim, Jin-Ha; Baek, Joung Hee; Seong, Ki Moon; Lee, Jae Yung; Kim, Joon

    2009-01-01

    Ribosomal protein genes (RPG), which are scattered throughout the genomes of all eukaryotes, are subjected to coordinated expression. In yeast, the expression of RPGs is highly regulated, mainly at the transcriptional level. Recent research has found that many ribosomal proteins (RPs) function in multiple processes in addition to protein synthesis. Therefore, detailed knowledge of promoter architecture as well as gene regulation is important in understanding the multiple cellular processes mediated by RPGs. In this study, we investigated the functional architecture of the yeast RPS3 promoter and identified many putative cis-elements. Using beta-galactosidase reporter analysis and EMSA, the core promoter of RPS3 containing UASrpg and T-rich regions was corroborated. Moreover, the promoter occupancy of RPS3 by three transcription factors was confirmed. Taken together, our results further the current understanding of the promoter architecture and trans-elements of the Saccharomyces cerevisiae RPS3 gene. PMID:19853675

  5. Polymorphisms in the Promoter Region of the Chinese Bovine PPARGC1A Gene

    PubMed Central

    Li, M. J.; Liu, M.; Liu, D.; Lan, X. Y.; Lei, C. Z.; Yang, D. Y.; Chen, H.

    2013-01-01

    The peroxisome proliferator-activated receptor gamma coactivator-1 alpha protein, encoded by the PPARGC1A gene, plays an important role in energy homeostasis. The genetic variations within the PPARGC1A gene promoter region were scanned in 808 Chinese native bovines belonging to three cattle breeds and yaks. A total of 6 SNPs and one 4 bp insertion variation in the promoter region of the bovine PPARGC1A gene were identified: SNP -259 T>A, -301_-298insCTTT, -915 A>G, -1175 T>G, -1590 C>T, -1665 C>T and -1690 G>A, which are in the binding sites of some important transcription factors: sex-determining region Y (SRY), myeloid-specific zinc finger-1 (MZF-1) and octamer factor 1(Oct-1). It is expected that these polymorphisms may regulate PPARGC1A gene transcription and might have consequences at a regulatory level. PMID:25049813

  6. Cloning and characterizing of the murine IRF-3 gene promoter region.

    PubMed

    Xu, Hua-Guo; Liu, Lifei; Gao, Shan; Jin, Rui; Ren, Wei; Zhou, Guo-Ping

    2016-08-01

    The interferon regulatory factor 3 (IRF-3) plays essential roles in inflammation and immune response. Here, we cloned the nucleotide sequence of the 5'-flanking region of the murine IRF-3 gene (mIRF-3) and characterized the molecular mechanisms controlling the mIRF-3 transcriptional activity in NIH3T3 cells. Analyses of a series of 5' deletion constructs demonstrated that a 301 bp region (-255/+46) of the mIRF-3 gene is sufficient for full promoter activity. This region contains IK1, Egr2, Cmyb, E2F1 and YY1 putative transcription factor binding sites. Mutation of Egr2 or YY1 site led to 52-68 % decrease of the mIRF-3 promoter activity, and double Egr2 and YY1 mutation reduced the promoter activity to 20 % of the wild-type promoter activity. Furthermore, knockingdown of endogenous Egr2 or YY1 by a siRNA strategy markedly inhibited the mIRF-3 promoter activity. Chromatin immunoprecipitation assays showed that Egr2 and YY1 interact with the mIRF-3 promoter in vivo. These results suggested that the basal promoter activity of the mIRF-3 gene is regulated by transcription factors Egr2 and YY1 in NIH3T3 cells. PMID:26740329

  7. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.

    PubMed

    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G

    1992-08-01

    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  8. Analysis of the sexual development-promoting region of Schizophyllum commune TRP1 gene.

    PubMed

    Sen, Kikuo; Kinoshita, Hideki; Tazuke, Kazuyuki; Maki, Yoshinori; Yoshiura, Yumi; Yakushi, Toshiharu; Shibai, Hiroshiro; Kurosawa, Shin-Ichi

    2016-10-01

    This study aims to elucidate the mechanism of sexual development of basidiomycetous mushrooms from mating to fruit body formation. Sequencing analysis showed the TRP1 gene of basidiomycete Schizophyllum commune encoded an enzyme with three catalytic regions of GAT (glutamine amidotransferase), IGPS (indole-3-glycerol phosphate synthase), and PRAI (5-phosphoribosyl anthranilate isomerase); among these three regions, the trp1 mutant (Trp(-)) had a missense mutation (L→F) of a 338th amino acid residue of the TRP1 protein within the IGPS region. To investigate the function of IGPS region related to sexual development, dikaryons with high, usual, and no expression of the IGPS region of TRP1 gene were made. The dikaryotic mycelia with high expression of the IGPS formed mature fruit bodies earlier than those with usual and no expression of the IGPS. These results showed that the IGPS region in TRP1 gene promoted sexual development of S. commune. PMID:27296855

  9. Functional analysis and nucleotide sequence of the promoter region of the murine hck gene.

    PubMed Central

    Lock, P; Stanley, E; Holtzman, D A; Dunn, A R

    1990-01-01

    The structure and function of the promoter region and exon 1 of the murine hck gene have been characterized in detail. RNase protection analysis has established that hck transcripts initiate from heterogeneous start sites located within the hck gene. Fusion gene constructs containing hck 5'-flanking sequences and the bacterial Neor gene have been introduced into the hematopoietic cell lines FDC-P1 and WEHI-265 by using a self-inactivating retroviral vector. The transcriptional start sites of the fusion gene are essentially identical to those of the endogenous hck gene. Analysis of infected WEHI-265 cell lines treated with bacterial lipopolysaccharide (LPS) reveals a 3- to 5-fold elevation in the levels of endogenous hck mRNA and a 1.4- to 2.6-fold increase in the level of Neor fusion gene transcripts, indicating that hck 5'-flanking sequences are capable of conferring LPS responsiveness on the Neor gene. The 5'-flanking region of the hck gene contains sequences similar to an element which is thought to be involved in the LPS responsiveness of the class II major histocompatibility gene A alpha k. A subset of these sequences are also found in the 5'-flanking regions of other LPS-responsive genes. Moreover, this motif is related to the consensus binding sequence of NF-kappa B, a transcription factor which is known to be regulated by LPS. Images PMID:2388619

  10. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    SciTech Connect

    Liu Yan; Yu Lian; Guo Xiuyang; Guo Tingqing; Wang Shengpeng; Lu Changde . E-mail: cdlu@sibs.ac.cn

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  11. Promoter region of the human platelet-derived growth factor A-chain gene

    SciTech Connect

    Takimoto, Yasuo; Wang, Zhao Yi; Kobler, K.; Deuel, T.F. )

    1991-03-01

    The platelet-derived growth factor (PDGF) A- and B-chain genes are widely expressed in mammalian tissues and their homodimeric gene products appear to regulate the autocrine growth of both normal and transformed cells. In this study, we analyzed the 5{prime} flanking sequences of the human PDGF A-chain gene to seek elements important to regulating its transcription. The promoter reigon was exceptionally G + C-rich and contained a TATA box but no CAAT box. The transcription start site was identified 845 base pairs 5{prime} to the translation initiation site by S1 nuclease mapping and by primer extension. Both in vitro transcription and transient expression of the chloramphenicol acetyltransferase gene linked to the PDGF A-chain 5{prime} flanking sequences established that the putative promoter region was active, and RNase H mapping established that the three characteristic mRNAs used the same transcription start site, which was used in normal endothelial cells and in two human tumor cell lines that express high levels of A-chain transcripts. The results extablished an exceptionally G + C-rich promoter region and a single transcription start site active for each of the three mRNAs of the PDGF A-chain gene. DNA sites of potential importance in mediating the activation of the PDGF A-chain gene in normal cells and in transformed cell lines expressing high levels of PDGF A-chain were identified.

  12. Validation study of genes with hypermethylated promoter regions associated with prostate cancer recurrence

    PubMed Central

    Stott-Miller, Marni; Zhao, Shanshan; Wright, Jonathan L.; Kolb, Suzanne; Bibikova, Marina; Klotzle, Brandy; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

    2014-01-01

    Background One challenge in prostate cancer (PCa) is distinguishing indolent from aggressive disease at diagnosis. DNA promoter hypermethylation is a frequent epigenetic event in PCa, but few studies of DNA methylation in relation to features of more aggressive tumors or PCa recurrence have been completed. Methods We used the Infinium® HumanMethylation450 BeadChip to assess DNA methylation in tumor tissue from 407 patients with clinically localized PCa who underwent radical prostatectomy. Recurrence status was determined by follow-up patient surveys, medical record review, and linkage with the SEER registry. The methylation status of 14 genes for which promoter hypermethylation was previously correlated with advanced disease or biochemical recurrence was evaluated. Average methylation level for promoter region CpGs in patients who recurred compared to those with no evidence of recurrence was analyzed. For two genes with differential methylation, time to recurrence was examined. Results During an average follow-up of 11.7 years, 104 (26%) patients recurred. Significant promoter hypermethylation in at least 50% of CpG sites in two genes, ABHD9 and HOXD3, was found in tumors from patients who recurred compared to those without recurrence. Evidence was strongest for HOXD3 (lowest P = 9.46x10−6), with higher average methylation across promoter region CpGs associated with reduced recurrence-free survival (P = 2×10−4). DNA methylation profiles did not differ by recurrence status for the other genes. Conclusions These results validate the association between promoter hypermethylation of ADHB9 and HOXD3 and PCa recurrence. Impact Tumor DNA methylation profiling may help distinguish PCa patients at higher risk for disease recurrence. PMID:24718283

  13. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central

    2010-01-01

    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  14. Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.

    PubMed

    Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2013-12-01

    Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. PMID:24004543

  15. New single nucleotide variation in the promoter region of androgen receptor (AR) gene in hypospadic patients

    PubMed Central

    Borhani, Nasim; Ghaffari Novin, Marefat; Manoochehri, Mehdi; Rouzrokh, Mohsen; Kazemi, Bahram; Koochaki, Ameneh; Hosseini, Ahmad; Masteri Farahani, Reza; Omrani, Mir Davood

    2014-01-01

    Background: Hypospadias is one of the most common congenital abnormalities in the male which is characterized by altered development of urethra, foreskin and ventral surface of the penis. Androgen receptor gene plays a critical role in the development of the male genital system by mediating the androgens effects. Objective: In present study, we looked for new variations in androgen receptor promoter and screened its exon 1 for five single nucleotide polymorphisms (SNP) in healthy and hypospadias Iranian men. Materials and Methods: In our study, at first DNA was extracted from patients (n=100) and controls (n=100) blood samples. Desired fragments of promoter and exon 1 were amplified using polymerase chain reaction. The promoter region was sequenced for the new variation and exone 1 screened for five SNPs (rs139767835, rs78686797, rs62636528, rs62636529, rs145326748) using restriction fragment length polymorphism technique. Results: The results showed a new single nucleotide variation (C→T) at -480 of two patients’ promoter region (2%). None of the mentioned SNPs were detected in patients and controls groups (0%). Conclusion: This finding indicates that new single nucleotide polymorphism in androgen receptor promoter may have role in etiology of hypospadias and development of this anomaly. This article extracted from Ph.D. thesis. (Nasim Borhani) PMID:24799883

  16. Polymorphisms of the ELANE Gene Promoter Region in End-Stage Chronic Kidney Disease Patients

    PubMed Central

    Fernandes, Rafael; Freitas, Bruno; Miranda, Vasco; Costa, Elísio; Santos-Silva, Alice; Bronze-da-Rocha, Elsa

    2016-01-01

    End-stage renal disease (ESRD) patients have a high mortality rate that exceeds that of non-ESRD population. The hemodialysis procedure induces neutrophil activation and elastase release, which might have a role in the inflammatory process and in the development of oxidative stress. The ELANE gene encodes the neutrophil elastase. We analyzed the effect of ELANE promoter region polymorphisms and its relation with the circulating levels of elastase, as well as several clinical, biochemical and inflammatory markers in 123 ESRD patients. We found two duplications in heterozygosity in the promoter region and a new polymorphism, the c.-801G>A. ESRD patients heterozygous for the c.-903T>G polymorphism had no changes in the circulating levels of elastase or other evaluated variables, and those homozygous for the c.-741G>A polymorphism showed significant effects on neutrophils count, as well as in neutrophils/lymphocytes ratio, which might be associated with an increased inflammatory process. PMID:27136588

  17. Multiple octamer binding sites in the promoter region of the bovine alpha s2-casein gene.

    PubMed Central

    Groenen, M A; Dijkhof, R J; van der Poel, J J; van Diggelen, R; Verstege, E

    1992-01-01

    Using a set of overlapping oligonucleotides from the promoter region of the bovine alpha s2-casein gene we have identified two nuclear factors which probably are involved in expression of this gene and the related calcium sensitive alpha s1- and beta-casein genes. One of these factors which was present in extracts of all tissues that have been tested including Hela cells turned out to be the octamer binding protein OCT-1. Oct-1 binds with different affinity to 4 sites at positions centred around -480, -260, -210 and -50. The strongest of these 4 binding sites, the one around position -50, is highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. The other nuclear factor (MGF, mammary gland factor) which is specifically expressed in the mammary gland, binds to a site around position -90. This binding site is also highly conserved in all calcium sensitive caseins of mouse, rat, rabbit and cattle. Images PMID:1508722

  18. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    PubMed

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  19. Multiple regions within the promoter of the murine Ifnar-2 gene confer basal and inducible expression.

    PubMed Central

    Hardy, Matthew P; Hertzog, Paul J; Owczarek, Catherine M

    2002-01-01

    The (murine) type I interferon (IFN) receptor, muIfnar-2, is expressed ubiquitously, and exists as both transmembrane and soluble forms. In the present study we show that the gene encoding muIfnar-2 spans approx. 33 kb on mouse chromosome 16, and consists of nine exons and eight introns. The three mRNA splice variants resulting in one transmembrane (muIfnar-2c) and two soluble (muIfnar-2a/2a') mRNA isoforms are generated by alternative RNA processing of the muIfnar-2 gene. Treatment of a range of murine cell lines with a combination of type I and II IFN showed that the muIfnar-2a and -2c mRNA isoforms were up-regulated independently of each other in L929 fibroblasts and hepa-1c1c7 hepatoma cells, but not in M1 myeloid leukaemia cells. Analysis of the 5' flanking region of muIfnar-2 using promoter-luciferase reporter constructs defined three regulatory regions: a region proximal to exon 1, conferring high basal expression, a distal region conferring inducible expression, and a negative regulatory region between the two. These data represent the first promoter analysis of a type I IFN receptor and, taken together with our previous data demonstrating high expression levels and dual biological functions for muIfnar-2a protein, suggests that the regulation of muIfnar-2 isoform expression may be an important way of modulating type I IFN responses. PMID:11939908

  20. Characterization of the promoter region of the gene for the rat neutral and basic amino acid transporter and chromosomal localization of the human gene.

    PubMed Central

    Yan, N; Mosckovitz, R; Gerber, L D; Mathew, S; Murty, V V; Tate, S S; Udenfriend, S

    1994-01-01

    The promoter region of the rat kidney neutral and basic amino acid transporter (NBAT) gene has been isolated and sequenced. The major transcription initiation site was mapped by primer extension. The entire promoter region and a set of 5' deletions within it were expressed at a high level in LLC-PK1 cells using the luciferase indicator gene. Positive and negative regulatory elements in the promoter region were observed. A human genomic clone of the transporter was also obtained and was used to localize the NBAT gene at the p21 region of chromosome 2. Images PMID:8052618

  1. Association between VNTR Polymorphism in Promoter Region of Prodynorphin (PDYN) Gene and Methamphetamine Dependence

    PubMed Central

    Saify, Khyber; Saadat, Mostafa

    2015-01-01

    AIM: Prodynorphin (PDYN; OMIM: 131340) is the precursor of the dynorphin related peptides which plays an important role in drug abuse. Previous studies have been shown that the expression of PDYN is regulated by a genetic polymorphism of VNTR in the promoter region of the gene. MATERIALS AND METHODS: The present case-control study was performed on 52 (41 males, 11 females) methamphetamine dependence patients and 635 (525 males, 110 females) healthy blood donors frequency matched with the patients according to age and gender, as a control group was participated in the study. RESULTS: The genotypes of VNTR PDYN polymorphism were determined using PCR method. The HL (OR = 1.22, 95%CI: 0.67-2.20, P = 0.500) and LL (OR = 0.86, 95%CI: 0.28-2.57, P = 0.792) genotypes does not alter the risk of methamphetamine dependence, in comparison with the HH genotypes. CONCLUSION: The present study revealed no association between the VNTR polymorphism in the promoter region of the PDYN gene and methamphetamine dependence risk.

  2. Promoter activity of the 5'-flanking regions of medaka fish soluble guanylate cyclase alpha1 and beta1 subunit genes.

    PubMed Central

    Yamamoto, Takehiro; Suzuki, Norio

    2002-01-01

    We examined the spatial expression pattern of medaka fish (Oryzias latipes) soluble guanylate cyclase alpha(1) and beta(1) subunit genes, OlGCS-alpha(1) and OlGCS-beta(1), and characterized the 5'-flanking region required for expression of both genes by introducing various promoter-luciferase fusion-gene constructs into COS-1 cells and medaka fish embryos. The OlGCS-alpha(1) and OlGCS-beta(1) gene transcripts were detected in whole brain and kidney in 7-day and 9-day embryos. Primer-extension analysis demonstrated that there were no differences among various adult organs (brain, eye, kidney, ovary and testis) in the transcription start site of the OlGCS-alpha(1) and OlGCS-beta(1) genes. Neither gene contained the functional TATA box within its 5'-flanking region, and the basal promoter activity was found between nucleotides +33 and +42 in the OlGCS-alpha(1) gene and between nucleotides +146 and +155 in the OlGCS-beta(1) gene. In the assay of medaka fish embryos, the 5'-flanking region of the OlGCS-beta(1) gene exhibited lower promoter activity than that of the OlGCS-alpha(1) gene. In the experiments on dual-luciferase fusion-gene constructs, the 5'-flanking region of the OlGCS-alpha(1) gene connected to the 5'-flanking region of the OlGCS-beta(1) gene was introduced into medaka fish embryos, and the 5'-flanking regions of both subunit genes were shown to mutually influence each other's promoter activity. PMID:11772405

  3. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    ERIC Educational Resources Information Center

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  4. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    SciTech Connect

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D.

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  5. Hypomethylation within gene promoter regions and type 1 diabetes in discordant monozygotic twins.

    PubMed

    Elboudwarej, Emon; Cole, Michael; Briggs, Farren B S; Fouts, Alexandra; Fain, Pamela R; Quach, Hong; Quach, Diana; Sinclair, Elizabeth; Criswell, Lindsey A; Lane, Julie A; Steck, Andrea K; Barcellos, Lisa F; Noble, Janelle A

    2016-04-01

    Genetic susceptibility to type 1 diabetes (T1D) is well supported by epidemiologic evidence; however, disease risk cannot be entirely explained by established genetic variants identified so far. This study addresses the question of whether epigenetic modification of the inherited DNA sequence may contribute to T1D susceptibility. Using the Infinium HumanMethylation450 BeadChip array (450k), a total of seven long-term disease-discordant monozygotic (MZ) twin pairs and five pairs of HLA-identical, disease-discordant non-twin siblings (NTS) were examined for associations between DNA methylation (DNAm) and T1D. Strong evidence for global hypomethylation of CpG sites within promoter regions in MZ twins with TID compared to twins without T1D was observed. DNA methylation data were then grouped into three categories of CpG sites for further analysis, including those within: 1) the major histocompatibility complex (MHC) region, 2) non-MHC genes with reported T1D association through genome wide association studies (GWAS), and 3) the epigenome, or remainder of sites that did not include MHC and T1D associated genes. Initial results showed modest methylation differences between discordant MZ twins for the MHC region and T1D-associated CpG sites, BACH2, INS-IGF2, and CLEC16A (DNAm difference range: 2.2%-5.0%). In the epigenome CpG set, the greatest methylation differences were observed in MAGI2, FANCC, and PCDHB16, (DNAm difference range: 6.9%-16.1%). These findings were not observed in the HLA-identical NTS pairs. Targeted pyrosequencing of five candidate CpG loci identified using the 450k array in the original discordant MZ twins produced similar results using control DNA samples, indicating strong agreement between the two DNA methylation profiling platforms. However, findings for the top five candidate CpG loci were not replicated in six additional T1D-discordant MZ twin pairs. Our results indicate global DNA hypomethylation within gene promoter regions may contribute to T

  6. [DNA bend sites in the promoter region of the human estrogen receptor alpha gene].

    PubMed

    Kuwabara, K; Sakuma, Y

    1998-12-01

    DNA bend sites in the promoter region of the human estrogen receptor a gene were determined by the circular permutation assay. Among a total of five sites (ERB -4 to -1, and ERB + 1) mapped in the 3 kb region, three matched with the positions of the predicted periodicity while the other two did not. Most of the sites were accompanied by the short poly (dA)-poly (dT) tracts including the potential bend core sequence A2N8A2N8A2 (A/A/A). Fine mapping of the ERB-2 site indicated that this A/A/A and the immediate franking sequences contained motifs for the estrogen response element. This region had a higher affinity for the nuclear scaffold and was included in the core region of the nucleosome structure. However, binding of the nuclear factor(s) to the motifs and disruption of nucleosome structure occurred without ATP. These results suggest that a class of periodic bent DNA could act as a site of multiple interactions among the nuclear scaffold, core histones and nuclear factors. PMID:9893449

  7. Isolation and characterization of a polyubiquitin gene and its promoter region from Mesembryanthemum crystallinum.

    PubMed

    Azad, Muhammad Abul Kalam; Morita, Kunio; Ohnishi, Jun-ichi; Kore-eda, Shin

    2013-01-01

    Transcript levels of the polyubiquitin gene McUBI1 had been reported to be constant during Crassulacean acid metabolism (CAM) induction in the facultative CAM plant, Mesembryanthemum crystallinum. Here, we report the sequences of the full-length cDNA of McUBI1 and its promoter, and validation of the McUBI1 promoter as an internal control driving constitutive expression in transient assays using the dual-luciferase system to investigate the regulation of CAM-related gene expression. The McUBI1 promoter drove strong, constitutive expression during CAM induction. We compared the activities of this promoter with those of the cauliflower mosaic virus (CaMV) 35S promoter in detached C3- and CAM-performing M. crystallinum and tobacco leaves. We confirmed stable expression of the genes controlled by the McUBI1 promoter with far less variability than under the CaMV 35S promoter in M. crystallinum, whereas both promoters worked well in tobacco. We found the McUBI1 promoter more suitable than the CaMV 35S promoter as an internal control for transient expression assays in M. crystallinum. PMID:23470760

  8. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

    PubMed

    Rushton, P J; Hooley, R; Lazarus, C M

    1992-09-01

    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  9. The nucleotide sequence of the promoter region of hisS, the structural gene for histidyl-tRNA synthetase.

    PubMed

    Eisenbeis, S J; Parker, J

    1982-05-01

    A plasmid has been constructed which carries hisS, the structural gene for histidyl-RNA synthetase of E. coli, on a 1.6-kb fragment bounded by PvuII and BstEII sites. The DNA sequence of both ends of this fragment was determined. The amino-terminal sequence of histidyl-tRNA synthetase was also determined to locate the promoter proximal coding region and the frame in which it is read. Three promoters were identified by consensus criteria. The region surrounding these promoters contains extensive twofold symmetry. PMID:6290315

  10. Glyceraldehyde-3-phosphate dehydrogenase gene from Zymomonas mobilis: cloning, sequencing, and identification of promoter region

    SciTech Connect

    Conway, T.; Sewell, G.W.; Ingram, L.O.

    1987-12-01

    The gene encoding glyceraldehyde-3-phosphate dehydrogenase was isolated from a library of Zymomonas mobilis DNA fragments by complementing a deficient strain of Escherichia coli. It contained tandem promoters which were recognized by E. coli but appeared to function less efficiently than the enteric lac promoter in E. coli. The open reading frame for this gene encoded 337 amino acids with an aggregate molecular weight of 36,099 (including the N-terminal methionine). The primary amino acid sequence for this gene had considerable functional homology and amino acid identity with other eukaryotic and bacterial genes. Based on this comparison, the gap gene from Z. mobilis appeared to be most closely related to that of the thermophilic bacteria and to the chloroplast isozymes. Comparison of this gene with other glycolytic enzymes from Z. mobilis revealed a conserved pattern of codon bias and several common features of gene structure. A tentative transcriptional consensus sequence is proposed for Z. mobilis based on comparison of the five known promoters for three glycolytic enzymes.

  11. Two target sites for protein binding in the promoter region of a cell cycle regulated human H1 histone gene.

    PubMed Central

    van Wijnen, A J; Wright, K L; Massung, R F; Gerretsen, M; Stein, J L; Stein, G S

    1988-01-01

    The 5' region of a cell cycle regulated human H1 histone gene appears to contain at least six promoter DNA elements that are shared with some, but not all human core (H2A, H2B, H3 and H4) histone genes. We show that two of these elements represent separate binding sites for two distinct, partially purified factors. The first promoter domain contains A/T rich repeats and is involved in the binding of HiNF-A, a nuclear factor previously found to bind to A/T rich direct repeats in the promoters of human H4 and H3 histone genes. The second domain, containing the general promoter element 5' dACCAAT, acts as a binding site for a two component mosaic factor we have designated HiNF-B. These data suggest that coordinate transcriptional regulation of human H1 and core histone genes may involve two classes of trans-acting factors: those specific for histone gene promoters and those that act on a broad spectrum of human gene promoters. Images PMID:2829131

  12. Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

    PubMed Central

    Zheng, Zhaoqing; Keifer, Joyce

    2014-01-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

  13. Point mutations in the promoter region of the CYBB gene leading to mild chronic granulomatous disease

    PubMed Central

    Weening, R S; De Boer, M; Kuijpers, T W; Neefjes, V M E; Hack, W W M; Roos, D

    2000-01-01

    Chronic granulomatous disease (CGD) is a clinical syndrome of recurrent bacterial and fungal infections caused by a rare disorder of phagocytic cells. In CGD, the phagocytes are unable to generate oxygen radicals after stimulation of these cells, due to a defect in the NADPH oxidase system. This NADPH oxidase is a multicomponent enzyme of at least four subunits, of which the β-subunit of cytochrome b558, gp91-phox, is encoded by an X-linked gene (called CYBB). We report here five patients from two families; in each family we found a different mutation in the promoter region of CYBB. Both mutations prevented the expression of gp91-phox in the patients' neutrophils and thus caused inability of these cells to generate oxygen radicals. However, the mutations left the gp91-phox expression and the function of the NADPH oxidase in the patients' eosinophils intact. The relatively mild course of the CGD in these patients can probably be attributed to the fact that the eosinophils have retained their oxidative capacity. Furthermore, our results indicate that neutrophils and eosinophils differ in their regulation of gp91-phox expression. PMID:11122248

  14. Functional analysis of the promoter region of the human phosphotyrosine phosphatase activator gene: Yin Yang 1 is essential for core promoter activity.

    PubMed Central

    Janssens, V; Van Hoof, C; De Baere, I; Merlevede, W; Goris, J

    1999-01-01

    The phosphotyrosine phosphatase activator (PTPA) has been isolated as an in vitro regulator of protein phosphatase 2A. Human PTPA is encoded by a single gene, the structure and chromosomal localization of which have been determined in our previous work. Here we describe the further isolation, sequencing and functional characterization of the PTPA promoter region. In agreement with its ubiquitous expression, the PTPA promoter displays several characteristics of housekeeping genes: it lacks both a TATA-box and a CAAT-box, it is very GC-rich and it contains an unmethylated CpG island surrounding the transcription initiation site. Transient transfection experiments in different cell types with several truncated chimaeric luciferase reporter gene plasmids revealed the importance of the region between positions -67 and -39 for basal promoter activity. This region coincides remarkably well with the determined CpG island. Further analysis of this region demonstrated the presence of a Yin Yang 1 (YY1) binding motif at positions -52 to -44. Binding of YY1 to this sequence is demonstrated in bandshift and DNase I footprinting experiments. Another YY1 binding motif is found in the 5' untranslated region, at positions +27 to +35. Mutations in either of these sites, abolishing YY1 binding in vitro, have differential effects on promoter activity. Point mutations in both sites completely abolish promoter activity. Moreover, induction of promoter activity by co-transfection with a YY1 expression plasmid is fully dependent upon the presence of both intact YY1 binding sites. Thus YY1 apparently mediates basal transcription of the human PTPA gene through two binding sites within its proximal promoter. PMID:10585862

  15. Identification and genetic effect of a variable duplication in the promoter region of the cattle ADIPOQ gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ADIPOQ gene of cattle, is located in the vicinity of the quantitative trait locus (QTL) wich effects marbling, the rib eye muscle area and fat thickness on BTA1. In our study, a novel variable duplication (NW_003103812.1:g.9232067_9232133 dup) in the bovine ADIPOQ promoter region was identified ...

  16. Multiple Mobile Promoter Regions for the Rare Carbapenem Resistance Gene of Bacteroides fragilis

    PubMed Central

    Podglajen, I.; Breuil, J.; Rohaut, A.; Monsempes, C.; Collatz, E.

    2001-01-01

    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149–154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Eς70 promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters. PMID:11344163

  17. A Novel Mutation in the Promoter Region of the β-Globin Gene: HBB: c.-127G > C.

    PubMed

    Bilgen, Turker; Canatan, Duran; Delibas, Serpil; Keser, Ibrahim

    2016-08-01

    Novel β-globin gene mutations are still occasionally being reported, especially when evaluating milder phenotypes. We report here a novel putative mutation in the promoter region of the β-globin gene and assess its clinical implications. A family, parents and four siblings, with hematological and clinical features suspected of being β-globin gene mutation(s), were involved in this study. In addition to hematological and clinical evaluations of the whole family, molecular analyses of the β-globin gene were performed by direct sequencing. Sequencing of the β-globin gene revealed a novel genomic alteration in the regulatory region of the gene. This novel genomic alteration was defined as HBB: c.-127G > C according to the Human Genome Variation Society (HGVS) nomenclature. Two siblings were found to be carriers of the HBB: c.-127G > C mutation, while the other two siblings were carriers of the codon 8 (-AA) (HBB: c.25_26delAA) deletion of the β-globin gene. The mother was a compound heterozygote for the codon 8 and HBB: c.-127G > C mutations. Based on hematological and clinical evaluations, we conclude that this novel β-globin gene promoter region change would be associated with a mild phenotype of β-thalassemia (β-thal). PMID:27349616

  18. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.

    PubMed

    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R

    2002-02-01

    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  19. Mapping of a replication origin within the promoter region of two unlinked, abundantly transcribed actin genes of Physarum polycephalum.

    PubMed

    Bénard, M; Lagnel, C; Pallotta, D; Pierron, G

    1996-03-01

    We analyzed the replication of two unlinked actin genes, ardB and ardC , which are abundantly transcribed in the naturally synchronous plasmodium of the slime mold Physarum polycephalum. Detection and size measurements of single-stranded nascent replication intermediates (RIs) demonstrate that these two genes are concomitantly replicated at the onset of the 3-h S phase and tightly linked to replication origins. Appearance of RIs on neutral-neutral two-dimensional gels at specific time points in early S phase and analysis of their structure confirmed these results and further established that, in both cases, an efficient, site-specific, bidirectional origin of replication is localized within the promoter region of the gene. We also determined similar elongation rates for the divergent replication forks of the ardC gene replicon. Finally, taking advantage of a restriction fragment length polymorphism, we studied allelic replicons and demonstrate similar localizations and a simultaneous firing of allelic replication origins. Computer search revealed a low level of homology between the promoters of ardB and ardC and, most notably, the absence of DNA sequences similar to the yeast autonomously replicating sequence consensus sequence in these Physarum origin regions. Our results with the ardB and ardC actin genes support the model of early replicating origins located within the promoter regions of abundantly transcribed genes in P. polycephalum. PMID:8622700

  20. Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

    PubMed

    Yoshino, M; Tsutsumi, K; Kanazawa, A

    2015-01-01

    β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. PMID:24943483

  1. Functional analysis of the promoter region of amphioxus β-actin gene: a useful tool for driving gene expression in vivo.

    PubMed

    Feng, Jun; Li, Guang; Liu, Xin; Wang, Jing; Wang, Yi-Quan

    2014-10-01

    Amphioxus is a promising new animal model for developmental biology. To develop molecular tools for this model, we characterized the promoter region of a cytoplasmic β-actin gene (Bb-actin-6-2) from the Chinese amphioxus Branchiostoma belcheri. In situ hybridization and real time-quantitative PCR analyses showed that this gene is expressed in many tissues throughout embryonic development. Cloning of cDNA revealed two isoforms with distinct transcription start sites. Isoform #1 exhibits a similar exon/intron and regulatory element organization to that of vertebrate β-actin, whereas isoform #2 lacks the first exon of isoform #1 and recruits its first intron as a promoter. The activities of upstream promoter regions in the two isoforms were examined using the lacZ reporter system in amphioxus embryos. The proximal promoter of isoform #1 drove reporter gene expression broadly in 58.6 % of injected embryos. That of isoform #2 exhibited much higher activity (91.5 %) than that of isoform #1 or the human EF-1-α gene (38.2 %). We determined the minimal promoter regions of the two isoforms via functional analysis. These two regions, alone or inserted a random DNA fragment upstream, had no detectable activity, but when an upstream enhancer was inserted, the promoters directed reporter gene expression in 61.0 and 93.8 %, respectively, of injected embryos in a tissue-specific manner. Our study not only provides insight into the regulatory mechanism underlying amphioxus Bb-actin-6-2 gene expression, but also identifies two sets of efficient proximal and minimal promoters. These promoters could be used to construct gene expression vectors for transgenic studies using amphioxus as a model. PMID:25078982

  2. Characterization of the Promoter Regions of Two Sheep Keratin-Associated Protein Genes for Hair Cortex-Specific Expression

    PubMed Central

    Zhao, Zhichao; Liu, Guangbin; Li, Xinyun; Huang, Ji; Xiao, Yujing; Du, Xiaoyong; Yu, Mei

    2016-01-01

    The keratin-associated proteins (KAPs) are the structural proteins of hair fibers and are thought to play an important role in determining the physical properties of hair fibers. These proteins are activated in a striking sequential and spatial pattern in the keratinocytes of hair fibers. Thus, it is important to elucidate the mechanism that underlies the specific transcriptional activity of these genes. In this study, sheep KRTAP 3–3 and KRTAP11-1 genes were found to be highly expressed in wool follicles in a tissue-specific manner. Subsequently, the promoter regions of the two genes that contained the 5′ flanking/5′ untranslated regions and the coding regions were cloned. Using an in vivo transgenic approach, we found that the promoter regions from the two genes exhibited transcriptional activity in hair fibers. A much stronger and more uniformly expressed green fluorescent signal was observed in the KRTAP11-1-ZsGreen1 transgenic mice. In situ hybridization revealed the symmetrical expression of sheep KRTAP11-1 in the entire wool cortex. Consistently, immunohistochemical analysis demonstrated that the pattern of ZsGreen1 expression in the hair cortex of transgenic mice matches that of the endogenous KRTAP11-1 gene, indicating that the cloned promoter region contains elements that are sufficient to govern the wool cortex-specific transcription of KRTAP11-1. Furthermore, regulatory regions in the 5′ upstream sequence of the sheep KRTAP11-1 gene that may regulate the observed hair keratinocyte specificity were identified using in vivo reporter assays. PMID:27100288

  3. Characterisation of a genomic clone covering the structural mouse MyoD1 gene and its promoter region.

    PubMed Central

    Zingg, J M; Alva, G P; Jost, J P

    1991-01-01

    We have isolated the mouse MyoD1 gene flanked by its promoter region by screening a genomic library with synthetic oligonucleotides. The structural gene is interrupted by two G + C rich introns. Transfection of the cloned gene inserted into an expression vector converts fibroblasts to myoblasts. Sequence analysis of about 650 bp of the 5' upstream region revealed the presence of several potential regulatory elements such as a TATA-box, an AP2-box, two SP1-boxes and a CAAT-box. In addition, there are three half palindromic estrogen response elements, a potential cAMP response element and various muscle specific elements such as a muscle-specific CAAT-box (MCAT) and four potential binding sites for MyoD1. Using S1 protection analysis the major start site of transcription in muscle and myoblast cells was mapped 3 bp upstream of the published cDNA 5' end. Promoter activity of the 650 bp upstream fragment was tested by in vitro transcription and by transfection analysis of myoblasts and fibroblasts. In all promoter test systems used, MyoD1 promoter activity was detected in myoblasts as well as in fibroblasts. Furthermore, DNA methylation was found to turn off MyoD1 promoter activity both in myoblasts and in fibroblasts. Images PMID:1754380

  4. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels

    PubMed Central

    Zhu, Yi-bing; Huang, Rong-dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = —0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  5. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    PubMed

    Peng, Xian-E; Wu, Yun-Li; Zhu, Yi-Bing; Huang, Rong-Dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  6. A methylation-dependent DNA-binding activity recognising the methylated promoter region of the mouse Xist gene.

    PubMed

    Huntriss, J; Lorenzi, R; Purewal, A; Monk, M

    1997-06-27

    Differential methylation of CpG sites in the promoter region of the mouse Xist gene is correlated with Xist expression and X-chromosome inactivation in the female. Using oligonucleotides encompassing the differentially methylated sites as probes in band-shift assays, we have identified a nuclear protein which binds to a specific region of the promoter (between base pairs -45 and -30 upstream from the transcription start site) only when CpG sites within the CG rich region (GCGCCGCGG, -44 to -36) are methylated. Competition experiments with methylated or unmethylated heterologous oligonucleotides demonstrate that the activity is sequence-specific as well as methylation-dependent. Analysis by Southwestern blot identifies a protein of approximately 100 kDa molecular weight and confirms strong binding to the methylated Xist promoter oligonucleotide. Using a 233bp Xist-promoter luciferase construct in which the cytosines in the three CpG sites in the -44 to -36 region are mutated to thymine, we have established that this region is required for transcription from the mouse Xist promoter. Therefore, we suggest that the binding of the 100kDa protein to the methylated sequence leads to repression of transcription from the methylated Xist allele, thus suggesting a role in the regulation of both imprinted and random Xist transcription and X-chromosome inactivation. PMID:9207230

  7. Structural and functional analysis of the human CD45 gene (PTPRC) upstream region: evidence for a functional promoter within the first intron of the gene

    PubMed Central

    Timón, M; Beverley, P C L

    2001-01-01

    Expression of the leucocyte common antigen (CD45) in mammals is restricted to the nucleated lineages of haematopoietic cells. It appears in early progenitors in the bone marrow and is expressed at the surface of these cells throughout their differentiation. However, at least in T cells, the pattern of expression switches between different isoforms during the successive stages of differentiation in the thymus and after activation in the periphery. In order to understand the mechanisms controlling the transcription of the human CD45 gene, 2·7 kbp of the 5′-flanking region were sequenced and analysed for their ability to direct expression of a reporter gene. The only region with promoter activity was localized within the first intron of the gene. This promoter shows no tissue specificity but could be enhanced by a heterologous enhancer. Mobility shift assays showed complex but specific protein binding. The sequence in this region lacks similarity with known promoters or initiators but is highly conserved in evolution. No transcription initiation could be detected within or downstream of this region, suggesting that this might be a new type of RNA polymerase II promoter able to drive transcription from an upstream sequence. An additional exon was also found upstream of exon 1. The two exons 1 (1a and 1b) are mutually exclusive and both are spliced to exon 2. This makes the structure of the 5′ region of the human CD45 gene identical to its mouse homologue. PMID:11260323

  8. Regulatory regions in the promoters of the Saccharomyces cerevisiae PYC1 and PYC2 genes encoding isoenzymes of pyruvate carboxylase.

    PubMed

    Menéndez, J; Gancedo, C

    1998-07-15

    We have identified regions in the promoters of the PYC1 and PYC2 genes from Saccharomyces cerevisiae involved in their regulation in different culture conditions. In the case of PYC1, a UAS in the region between -330/-297 and three repressing sequences with the common central core CCGCC at positions -457, -432 and -399 were identified. Specific binding of nuclear proteins to the -330/-214 DNA fragment was abolished in rtg mutants suggesting a role for the RTG genes in the control of PYC1 expression. In the case of the PYC2 promoter, elimination of a fragment from -417 to -291 brings about a two-fold decrease in the expression in repressed conditions and a similar increase in derepression. PMID:9682484

  9. Analysis of the promoter region of a cardiac specific phospholipase A{sub 2} gene located at 1p35

    SciTech Connect

    Winstead, M.V.; Chen, J.; Tischfield, J.A.

    1994-09-01

    Phospholipases may play an important role in the pathology of tissue damage and in membrane remodeling. We have previously shown that the Group II PLA{sub 2} gene and two PLA{sub 2}-like gene fragments map to 1p35. We have since shown that at least one of the fragments is part of a cardiac-specific PLA{sub 2} gene. Thus the identification and characterization of the regulatory regions of this new phospholipase A{sub 2} (PLA{sub 2}) may be important for understanding the regulation of this gene under normal and pathologic conditions. HPLA2-10, mainly expressed in heart, is a low molecular weight, Ca{sup 2+}-dependent PLA{sub 2} that we have classified as a new group (Group III) based on structural considerations. The 5{prime} regulatory region of HPLA2-10 was isolated from a human genomic DNA bacteriophage library and cloned into pUC19. Computer analysis of the region`s DNA sequence indicates the presence of multiple transcription factor binding sites. A comparison between the human promoter region and the promoter region of the rat homologue, RPLA2-10, indicates that at least two putative transcription factor binding sites are conserved between the two species. These include a CCAAT box and an AGTCCT hexanucleotide, which has been implicated as a binding site for the glucocorticoid receptor. DNA footprint analysis is being performed to determine whether or not these putative regions are sites of protein binding. Also, a proposed view of the evolution of the distinct groups of low molecular weight PLA{sub 2}s will be presented.

  10. Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

    PubMed Central

    Coffee, Erin M.; Tolan, Dean R.

    2010-01-01

    SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

  11. The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region

    PubMed Central

    Phornphutkul, Chanika; Anikster, Yair; Huizing, Marjan; Braun, Paula; Brodie, Chaya; Chou, Janice Y.; Gahl, William A.

    2001-01-01

    Although >55 CTNS mutations occur in patients with the lysosomal storage disorder cystinosis, no regulatory mutations have been reported, because the promoter has not been defined. Using CAT reporter constructs of sequences 5′ to the CTNS coding sequence, we identified the CTNS promoter as the region encompassing nucleotides −316 to +1 with respect to the transcription start site. This region contains an Sp-1 regulatory element (GGCGGCG) at positions −299 to −293, which binds authentic Sp-1, as shown by electrophoretic-mobility–shift assays. Three patients exhibited mutations in the CTNS promoter. One patient with nephropathic cystinosis carried a −295 G→C substitution disrupting the Sp-1 motif, whereas two patients with ocular cystinosis displayed a −303 G→T substitution in one case and a −303 T insertion in the other case. Each mutation drastically reduced CAT activity when inserted into a reporter construct. Moreover, each failed either to cause a mobility shift when exposed to nuclear extract or to compete with the normal oligonucleotide’s mobility shift. The CTNS promoter region shares 41 nucleotides with the promoter region of an adjacent gene of unknown function, CARKL, whose start site is 501 bp from the CTNS start site. However, the patients’ CTNS promoter mutations have no effect on CARKL promoter activity. These findings suggest that the CTNS promoter region should be examined in patients with cystinosis who have fewer than two coding-sequence mutations. PMID:11505338

  12. Characterization of the promoter region of the rat testis-specific histone H1t gene.

    PubMed

    Clare, S E; Hatfield, W R; Fantz, D A; Kistler, W S; Kistler, M K

    1997-01-01

    Histone H1t is synthesized only in male germ cells during the late pachytene stage of meiosis and is retained in spermatids until the nucleus elongates. Transgenic experiments suggest that spermatocyte-directing sequences lie within 140 base pairs of the cap site. To study the mechanism of this specificity we compared the DNase I footprints made on the immediate promoter regions of H1t and H1d (a typical somatic H1) by testis and liver extracts and observed both common and differentially protected regions. The common footprints of H1t included an Sp1 consensus (GC box 1) and a CCAAT motif. Electrophoretic mobility shift assays (EMSA) identified ubiquitous binding factors for GC box 1 and a binding factor for the CCAAT element that we identified immunologically as H1TF2. H1t-specific footprints occurred over the palindrome CCTAGG and a GC-rich sequence downstream of the TATA box (GC box 2). EMSA analysis of the palindrome identified testis-specific as well as ubiquitous binding factors. UV irradiation of a palindrome-binding reaction generated a cross-linked doublet of about 50 kDa from both testis and liver. Protein factors that bound to the GC box 2 sequence were similar from testis and liver, and GC box 1 and an Sp1 consensus competed for them. In vitro transcription directed by H1t occurred at comparable levels in testis and liver extracts. The importance of both GC box 1 and CCAAT elements was demonstrated by deletion analysis and by oligonucleotide competition. No dependence on the H1t palindrome was observed for in vitro transcription. PMID:9002635

  13. Identification of laticifer-specific genes and their promoter regions from a natural rubber producing plant Hevea brasiliensis.

    PubMed

    Aoki, Yuichi; Takahashi, Seiji; Takayama, Daisuke; Ogata, Yoshiyuki; Sakurai, Nozomu; Suzuki, Hideyuki; Asawatreratanakul, Kasem; Wititsuwannakul, Dhirayos; Wititsuwannakul, Rapepun; Shibata, Daisuke; Koyama, Tanetoshi; Nakayama, Toru

    2014-08-01

    Latex, the milky cytoplasm of highly differentiated cells called laticifers, from Hevea brasiliensis is a key source of commercial natural rubber production. One way to enhance natural rubber production would be to express genes involved in natural rubber biosynthesis by a laticifer-specific overexpression system. As a first step to identify promoters which could regulate the laticifer-specific expression, we identified random clones from a cDNA library of H. brasiliensis latex, resulting in 4325 expressed sequence tags (ESTs) assembled into 1308 unigenes (692 contigs and 617 singletons). Quantitative analyses of the transcription levels of high redundancy clones in the ESTs revealed genes highly and predominantly expressed in laticifers, such as Rubber Elongation Factor (REF), Small Rubber Particle Protein and putative protease inhibitor proteins. HRT1 and HRT2, cis-prenyltransferases involved in rubber biosynthesis, was also expressed predominantly in laticifers, although these transcript levels were 80-fold lower than that of REF. The 5'-upstream regions of these laticifer-specific genes were cloned and analyzed in silico, revealing seven common motifs consisting of eight bases. Furthermore, transcription factors specifically expressed in laticifers were also identified. The common motifs in the laticifer-specific genes and the laticifer-specific transcription factors are potentially involved in the regulation of gene expression in laticifers. PMID:25017153

  14. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    SciTech Connect

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-02-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription.

  15. Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection

    PubMed Central

    Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V.; Franco, Eduardo L.

    2013-01-01

    Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig–McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection. PMID:23677790

  16. Aberrant Methylation of the E-Cadherin Gene Promoter Region in the Endometrium of Women With Uterine Fibroids.

    PubMed

    Li, Yan; Ran, Ran; Guan, Yingxia; Zhu, Xiaoxiong; Kang, Shan

    2016-08-01

    A uterine fibroid is a leiomyoma that originates from the smooth muscle layer of the uterus. A variety of endometrial abnormalities are associated with uterine fibroids. This study aims to investigate the methylation status of the E-cadherin gene (CDH1) promoter region in the endometrium of patients with uterine fibroids. The methylation of CDH1 was studied using methylation-specific polymerase chain reaction in the endometrial tissue of 102 patients with uterine fibroids and 50 control patients. The E-cadherin expression was examined by flow cytometry. The methylation rate of CDH1 promoter region was 33.3% in the endometrium of patients with uterine fibroids and 8% in the endometrium of women without fibroids. The frequency of CDH1 promoter methylation in the endometrium of patients with fibroids was significantly higher than that in the endometrium of women without fibroids (P = .001). Furthermore, the E-cadherin expression level in methylation-positive tissues was significantly lower than that in methylation-negative tissues (P = .017). These results suggest that epigenetic aberration of CDH1 may occur in the endometrium of patients with fibroids, which may be associated with E-cadherin protein expression in endometrial tissue. PMID:26880767

  17. Specific interactions of Saccharomyces cerevisiae proteins with a promoter region of eukaryotic tRNA genes.

    PubMed Central

    Klemenz, R; Stillman, D J; Geiduschek, E P

    1982-01-01

    The specific binding of one or several Saccharomyces cerevisiae proteins to a segment of genes that code for different yeast tRNAs has been demonstrated with the use of the DNase I-protection "footprint" assay of Galas and Schmitz. The analyzed binding occurs near the 3' ends of the genes and is centered on an 11-base-pair DNA sequence that has been well conserved among eukaryotic tRNA genes. Others have shown the involvement of this sequence in initiating the transcription of tRNA genes by RNA polymerase III. The adenovirus gene that codes for VAI RNA also contains this conserved sequence element, and we detect binding of yeast protein(s) to this gene. Competition experiments show that a common set of proteins binds to different tRNA genes. The DNA-protein complex is quite stable at 20 degrees C and low ionic strength. Images PMID:6755466

  18. A 5'-regulatory region and two coding region polymorphisms modulate promoter activity and gene expression of the growth suppressor gene ZBED6 in cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation, and growth. Polymorphisms in its promoter and coding regions are likely to impact ZBED6 transcription and growth traits. In this study, a total of three no...

  19. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  20. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    SciTech Connect

    Gilmour, D.S.; Lis, J.T.

    1986-11-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation.

  1. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    SciTech Connect

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  2. Sequence analysis of the promoter regions of the classical class I gene RT1.A and two other class I genes of the rat MHC

    SciTech Connect

    Lambracht, D.; Wonigeit, K.

    1995-04-01

    Major histocompatibility complex (MHC) class I molecules present peptides to CD8+ T cells and thus play key role in immunosurveillance by T-cell-mediated mechanisms. Their expression depends on complex control mechanisms at two major levels: (1) regulation of transcription mediated through the promoter region and additional regulatory elements of the individual class I gene, and (2) availability of appropriate peptides in the endoplasmic reticulum required to stabilize the ternary complex consisting of class I {alpha} chain, {beta}{sub 2}-microglobulin ({beta}{sub 2}m), and peptide. In addition, differences in the ability of different {alpha} chains to bind {beta}{sub 2}m can influence the transport to and turnover within the cell membrane. We have now analyzed the promoter regions of class I genes of the LEW rat strain carrying the RT1{sup 1} haplotype. The analysis of three class I genes in this region has led to the identification of characteristic regulatory sequences. 20 refs., 2 figs.

  3. Two bi-allelic single nucleotide polymorphisms within the promoter region of the horse tumour necrosis factor alpha gene.

    PubMed

    Matiasovic, J; Lukeszová, L; Horín, P

    2002-08-01

    Primers based on GenBank sequences within the 5' untranslated region (UTR) of the human and horse tumour necrosis factor alpha (TNF-alpha) genes were designed and used to amplify a 522-bp product. Sequencing of five clones derived from five independent PCRs obtained from three different animals of three different breeds (Old Kladruber, Akhal-Teke and Shetland Pony) revealed a high level of sequence identity to the TNF-alpha promoter regions of other species. The existing GenBank horse sequences were confirmed and extended upstream by 230 nucleotides. Based on the sequence obtained, a new horse-specific forward primer was designed to amplify a 213-bp PCR product, which was screened for polymorphism using single-strand conformation polymorphism (SSCP). Three allelic variants of the horse TNF-alpha gene were identified and sequenced (GenBank accession numbers ADF 349558-60). Two single nucleotide polymorphisms explained the existence of the three SSCP alleles detected: C/T and T/C single base pair substitutions at positions 137 and 147, respectively. Differences in allelic frequencies between Old Kladruber and Akhal-Teke breeds were observed. PMID:12121271

  4. Prevention of liver fibrosis by triple helix-forming oligodeoxyribonucleotides targeted to the promoter region of type I collagen gene.

    PubMed

    Koilan, Subramaniyan; Hamilton, David; Baburyan, Narina; Padala, Mythili K; Weber, Karl T; Guntaka, Ramareddy V

    2010-10-01

    Hepatic fibrosis leading to cirrhosis remains a global health problem. The most common etiologies are alcoholism and viral infections. Liver fibrosis is associated with major changes in both quantity and composition of extracellular matix and leads to disorganization of the liver architecture and irreversible damage to the liver function. As of now there is no effective therapy to control fibrosis. The end product of fibrosis is abnormal synthesis and accumulation of type I collagen in the extracellular matrix, which is produced by activated stellate or Ito cells in the damaged liver. Therefore, inhibition of transcription of type I collagen should in principle inhibit its production and accumulation in liver. Normally, DNA exists in a duplex form. However, under some circumstances, DNA can assume triple helical (triplex) structures. Intermolecular triplexes, formed by the addition of a sequence-specific third strand to the major groove of the duplex DNA, have the potential to serve as selective gene regulators. Earlier, we demonstrated efficient triplex formation between the exogenously added triplex-forming oligodeoxyribonucleotides (TFOs) and a specific sequence in the promoter region of the COL1A1 gene. In this study we used a rat model of liver fibrosis, induced by dimethylnitrosamine, to test whether these TFOs prevent liver fibrosis. Our results indicate that both the 25-mer and 18-mer TFOs, specific for the upstream nucleotide sequence from -141 to -165 (relative to the transcription start site) in the 5' end of collagen gene promoter, effectively prevented accumulation of liver collagen and fibrosis. We also observed improvement in liver function tests. However, mutations in the TFO that eliminated formation of triplexes are ineffective in preventing fibrosis. We believe that these TFOs can be used as potential antifibrotic therapeutic molecules. PMID:20818932

  5. Prevention of Liver Fibrosis by Triple Helix-Forming Oligodeoxyribonucleotides Targeted to the Promoter Region of Type I Collagen Gene

    PubMed Central

    Koilan, Subramaniyan; Hamilton, David; Baburyan, Narina; Padala, Mythili K.; Weber, Karl T.

    2010-01-01

    Hepatic fibrosis leading to cirrhosis remains a global health problem. The most common etiologies are alcoholism and viral infections. Liver fibrosis is associated with major changes in both quantity and composition of extracellular matix and leads to disorganization of the liver architecture and irreversible damage to the liver function. As of now there is no effective therapy to control fibrosis. The end product of fibrosis is abnormal synthesis and accumulation of type I collagen in the extracellular matrix, which is produced by activated stellate or Ito cells in the damaged liver. Therefore, inhibition of transcription of type I collagen should in principle inhibit its production and accumulation in liver. Normally, DNA exists in a duplex form. However, under some circumstances, DNA can assume triple helical (triplex) structures. Intermolecular triplexes, formed by the addition of a sequence-specific third strand to the major groove of the duplex DNA, have the potential to serve as selective gene regulators. Earlier, we demonstrated efficient triplex formation between the exogenously added triplex-forming oligodeoxyribonucleotides (TFOs) and a specific sequence in the promoter region of the COL1A1 gene. In this study we used a rat model of liver fibrosis, induced by dimethylnitrosamine, to test whether these TFOs prevent liver fibrosis. Our results indicate that both the 25-mer and 18-mer TFOs, specific for the upstream nucleotide sequence from −141 to −165 (relative to the transcription start site) in the 5′ end of collagen gene promoter, effectively prevented accumulation of liver collagen and fibrosis. We also observed improvement in liver function tests. However, mutations in the TFO that eliminated formation of triplexes are ineffective in preventing fibrosis. We believe that these TFOs can be used as potential antifibrotic therapeutic molecules. PMID:20818932

  6. Capture and identification of proteins that bind to a GGA-rich sequence from the ERBB2 gene promoter region.

    PubMed

    Zhang, Tian; Zhang, Huiping; Wang, Yuexi; McGown, Linda B

    2012-10-01

    The ERBB2 gene (HER2/neu) is overexpressed in many human breast cancers. It is an important therapeutic target and its product protein is a key biomarker for breast cancer. A 28-bp GGA repeat sequence (Pu28-mer) in the nuclease hypersensitive site of the ERBB2 promoter region may play an important role in the regulation of ERBB2 transcription, possibly involving the formation of a G-quadruplex. In order to investigate this possibility, an affinity MALDI-MS approach was used for in vitro protein capture from nuclear extracts from cultured MCF-7 and BT-474 cancer cells at Pu28-mer and control oligonucleotide-modified surfaces. Captured proteins from MCF-7 cells were analyzed by LC-MS/MS. Based on these results, Western blot was then used to interrogate captured proteins from both MCF-7 and the Her-2/neu-positive BT-474 cells. Results support the formation of a G-quadruplex by Pu28-mer, indicated by circular dichroism spectroscopy, that selectively captures transcription factors including Ku70, Ku80, PURA, nucleolin, and hnRNP K. Chromatin immunoprecipitation confirmed binding of Ku70, Ku80, PURA, and nucleolin to ERBB2 promoter in the live BT-474 cells. These findings may lead to a better understanding of the role of non-duplex DNA structures in gene regulation and provide a more complete picture of the regulation of ErbB2 expression in breast cancer. The results also provide a blueprint for development of "genome-inspired" aptamers based on the Pu28-mer sequence for in vitro and in vivo detection of proteins related to regulation of ERBB2 gene expression and breast cancer. PMID:22899247

  7. Haplotypes in the promoter region of the CIDEC gene associated with growth traits in Nanyang cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cell death-inducing DFFA-like effector c (CIDEC, also known as Fsp27) has emerged as an important regulator of metabolism associated with lipodystrophy, diabetes, and hepatic steatosis. It is required for unilocular lipid droplet formation and optimal energy storage. The mechanism between this gene ...

  8. Interspecific Variation in the Promoter Region of A Sucrose Synthase Gene in the Genus Saccharum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sucrose synthase is an important enzyme of sucrose metabolism in sugarcane, a polyploid interspecific hybrid of the genus Saccharum. One of the genes for sucrose synthase (Sus2, homologous to maize Sh1) is more highly expressed in sucrose-storing hybrids than in low sucrose S. spontaneum. We amplifi...

  9. Microsatellite polymorphism in the P1 promoter region of the IGF‑1 gene is associated with endometrial cancer.

    PubMed

    Kwasniewski, Wojciech; Gozdzicka-Jozefiak, Anna; Wolun-Cholewa, Maria; Polak, Grzegorz; Sierocinska-Sawa, Jadwiga; Kwasniewska, Anna; Kotarski, Jan

    2016-06-01

    Endometrial carcinoma (EC) is the most common type of gynecological malignancy. Studies have demonstrated that the insulin growth factor (IGF) pathway is implicated in the development of endometrial tumors and that the serum levels of IGF‑1 are affected by estrogen. Most EC cells with high microsatellite instability (MSI‑H) accumulate mutations at a microsatellite sequence in the IGF‑1 gene. The present study investigated the CA repeat polymorphism in the P1 promoter region of the IGF‑1 gene among Caucasian females with endometrial hyperplasia, EC and healthy control subjects, whose blood serum and surgical tissue specimens were analyzed. Differences or correlations between the analyzed parameters [serum levels of IGF-1 and IGF binding protein (IGFBP)‑1 and IGFBP‑3 as well as estrogens among the polymorphisms] were verified using the χ2, Mann-Whitney U, Kruskal-Wallis or Spearman's rank correlation tests. A PCR amplification and DNA sequencing analysis was used for identification of (CA)n repeats in the P1 region of IGF‑1. ELISA was used to determine the blood serum levels of IGF‑1, IGFBP‑1, IGFBP‑3 and estrogens. Furthermore, IGF-1 was assessed in endometrial tissues by immunohistochemical analysis. The present study indicated no statistically significant differences between serum levels of IGF‑1, IGFBP‑1, IGFBP‑3 and estrone, estriol and estradiol in the control and study groups. A significant correlation was identified between the IGF-1 levels and estrone levels in the MSI-H polymorphism (r=-0.41, P=0.012) as well as a highly negative correlation between IGF-1 levels and the estradiol levels in the MSI-H polymorphism (r=-0.6, P=0.002). Genotypes without the 19 CA allele were predominantly found in EC. Furthermore, statistical analysis indicated that the number of IGF-1-expressing cells was significantly elevated in MSI-H type 18-20 (P=0.0072), MSI-L type 19-20 (P=0.025) and microsatellite-stable MSS type 19-19 (P=0.024) compared with

  10. Microsatellite polymorphism in the P1 promoter region of the IGF-1 gene is associated with endometrial cancer

    PubMed Central

    KWASNIEWSKI, WOJCIECH; GOZDZICKA-JOZEFIAK, ANNA; WOLUN-CHOLEWA, MARIA; POLAK, GRZEGORZ; SIEROCINSKA-SAWA, JADWIGA; KWASNIEWSKA, ANNA; KOTARSKI, JAN

    2016-01-01

    Endometrial carcinoma (EC) is the most common type of gynecological malignancy. Studies have demonstrated that the insulin growth factor (IGF) pathway is implicated in the development of endometrial tumors and that the serum levels of IGF-1 are affected by estrogen. Most EC cells with high microsatellite instability (MSI-H) accumulate mutations at a microsatellite sequence in the IGF-1 gene. The present study investigated the CA repeat polymorphism in the P1 promoter region of the IGF-1 gene among Caucasian females with endometrial hyperplasia, EC and healthy control subjects, whose blood serum and surgical tissue specimens were analyzed. Differences or correlations between the analyzed parameters [serum levels of IGF-1 and IGF binding protein (IGFBP)-1 and IGFBP-3 as well as estrogens among the polymorphisms] were verified using the χ2, Mann-Whitney U, Kruskal-Wallis or Spearman's rank correlation tests. A PCR amplification and DNA sequencing analysis was used for identification of (CA)n repeats in the P1 region of IGF-1. ELISA was used to determine the blood serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrogens. Furthermore, IGF-1 was assessed in endometrial tissues by immunohistochemical analysis. The present study indicated no statistically significant differences between serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrone, estriol and estradiol in the control and study groups. A significant correlation was identified between the IGF-1 levels and estrone levels in the MSI-H polymorphism (r=−0.41, P=0.012) as well as a highly negative correlation between IGF-1 levels and the estradiol levels in the MSI-H polymorphism (r=−0.6, P=0.002). Genotypes without the 19 CA allele were predominantly found in EC. Furthermore, statistical analysis indicated that the number of IGF-1-expressing cells was significantly elevated in MSI-H type 18-20 (P= 0.0072), MSI-L type 19-20 (P=0.025) and microsatellite-stable MSS type 19-19 (P=0.024) compared with those in the MSI-H 20

  11. The chick and human collagen alpha1(XII) gene promoter--activity of highly conserved regions around the first exon and in the first intron.

    PubMed

    Chiquet, M; Mumenthaler, U; Wittwer, M; Jin, W; Koch, M

    1998-10-15

    A single gene encodes collagen XII, an extracellular matrix protein with three large fibronectin-related subunits connected via a short collagen triple helix. Since collagen XII is a component of a specific subset of collagen fibrils in tissues bearing high tensile stress, we are interested to know how its restricted expression is regulated. To this aim, we have isolated the region around the first exon of both the chick and human collagen alpha1(XII) gene. The upstream sequences of the two genes share common features but are not related. Strong similarity starts about 100 bp 5' of the first exon and ends 100 bp into the first intron. In addition, two large conserved regions (56-63% similarity) were found in the first intron. A single major and two clusters of minor transcription start sites were identified in both the chick and human gene. To test for promoter activity, conserved fragments from the chick gene were cloned into reporter plasmids for transient transfection of fibroblasts. A 70-bp stretch containing a conserved nuclear factor-1 binding sequence just upstream of the first transcription start site was found to work as a basal promoter. An adjacent, but nonoverlapping short segment including the more downstream start sites and a conserved TATTAA sequence exhibited independent promoter activity. GC-rich sequences just 5' and 3' of the minimal promoter fragments were required for full activity. In contrast, inclusion of more upstream sequences (up to 2.4 kb) had no effect. The two conserved regions in the first intron showed no promoter activity on their own but modulated activity when linked to autologous or heterologous promoters. Specifically, one of these intronic regions might contain enhancer element(s) that respond to mechanical stress acting on the fibroblasts. We conclude that the collagen XII gene is driven by a basal promoter with two halves that can act independently; conserved control regions are located around the first exon and in the first

  12. The intergenic region of the maize defensin-like protein genes Def1 and Def2 functions as an embryo-specific asymmetric bidirectional promoter.

    PubMed

    Liu, Xiaoqing; Yang, Wenzhu; Li, Ye; Li, Suzhen; Zhou, Xiaojin; Zhao, Qianqian; Fan, Yunliu; Lin, Min; Chen, Rumei

    2016-07-01

    Bidirectional promoters are identified in diverse organisms with widely varied genome sizes, including bacteria, yeast, mammals, and plants. However, little research has been done on any individual endogenous bidirectional promoter from plants. Here, we describe a promoter positioned in the intergenic region of two defensin-like protein genes, Def1 and Def2 in maize (Zea mays). We examined the expression profiles of Def1 and Def2 in 14 maize tissues by qRT-PCR, and the results showed that this gene pair was expressed abundantly and specifically in seeds. When fused to either green fluorescent protein (GFP) or β-glucuronidase (GUS) reporter genes, P ZmBD1 , P ZmDef1 , and P ZmDef2 were active and reproduced the expression patterns of both Def1 and Def2 genes in transformed immature maize embryos, as well as in developing seeds of transgenic maize. Comparative analysis revealed that PZmBD1 shared most of the expression characteristics of the two polar promoters, but displayed more stringent embryo specificity, delayed expression initiation, and asymmetric promoter activity. Moreover, a truncated promoter study revealed that the core promoters only exhibit basic bidirectional activity, while interacting with necessary cis-elements, which leads to polarity and different strengths. The sophisticated interaction or counteraction between the core promoter and cis-elements may potentially regulate bidirectional promoters. PMID:27279278

  13. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    PubMed Central

    Yang, J; Thomas, K

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC-box (Sp1-binding site) situated upstream from the transcription start site. PCR-based in vivo DNase I footprinting analysis of a 600 bp fragment of the proximal LDH/C promoter region (-524/+38) in isolated mouse pachytene spermatocytes identified a single footprint over the GC-box motif. Three DNase I hypersensitive sites were also detectable in vivo, in a region containing (CT)n(GA)n repeats upstream from the CCAT box domain. Functional characterization of the promoter region was carried out in a rat C6 glioma cell line and an SV40 transformed germ cell line (GC-1 spg) using wild-type and mutated LDH/C promoter CAT reporter constructs. These studies provide experimental evidence suggesting that transcriptional activation of the LDH/C promoter is regulated by enhancer-mediated coactivation of the Sp1 proteins bound to the GC-box motif footprinted in vivo in pachytene spermatocytes. PMID:9153323

  14. DoOPSearch: a web-based tool for finding and analysing common conserved motifs in the promoter regions of different chordate and plant genes

    PubMed Central

    Sebestyén, Endre; Nagy, Tibor; Suhai, Sándor; Barta, Endre

    2009-01-01

    Background The comparative genomic analysis of a large number of orthologous promoter regions of the chordate and plant genes from the DoOP databases shows thousands of conserved motifs. Most of these motifs differ from any known transcription factor binding site (TFBS). To identify common conserved motifs, we need a specific tool to be able to search amongst them. Since conserved motifs from the DoOP databases are linked to genes, the result of such a search can give a list of genes that are potentially regulated by the same transcription factor(s). Results We have developed a new tool called DoOPSearch for the analysis of the conserved motifs in the promoter regions of chordate or plant genes. We used the orthologous promoters of the DoOP database to extract thousands of conserved motifs from different taxonomic groups. The advantage of this approach is that different sets of conserved motifs might be found depending on how broad the taxonomic coverage of the underlying orthologous promoter sequence collection is (consider e.g. primates vs. mammals or Brassicaceae vs. Viridiplantae). The DoOPSearch tool allows the users to search these motif collections or the promoter regions of DoOP with user supplied query sequences or any of the conserved motifs from the DoOP database. To find overrepresented gene ontologies, the gene lists obtained can be analysed further using a modified version of the GeneMerge program. Conclusion We present here a comparative genomics based promoter analysis tool. Our system is based on a unique collection of conserved promoter motifs characteristic of different taxonomic groups. We offer both a command line and a web-based tool for searching in these motif collections using user specified queries. These can be either short promoter sequences or consensus sequences of known transcription factor binding sites. The GeneMerge analysis of the search results allows the user to identify statistically overrepresented Gene Ontology terms that

  15. Functional analysis of the long terminal repeats of intracisternal A-particle genes: Sequences within the U3 region determine both the efficiency and direction of promoter activity

    SciTech Connect

    Christy, R.J.; Huang, R.C.C.

    1988-03-01

    The transcriptional activity of five intracisternal A-particle (IAP) long terminal repeats (LTRs) in mouse embryonal carcinoma PCC3-A/1 cells and in Ltk/sup -/ cells was determined. The authors tested the promoter activity of the LTRs by coupling them to the reporter gene chloramphenicol acetyltransferase (CAT) or guanosine-xanthine phosphoribosyltransferase (gpt). Each LTR was tested for promoter function in both the sense (5' to 3') and antisense (3' to 5') orientation preceding the reporter gene. The transcriptional activity of individual IAP gene LTRs varied considerably, and the LTR from IAP81 possessed promoter activity in both directions. The bidirectional activity of the IAP81 LTR was confirmed by monitoring Ecogpt expression in stably transfected Ltk/sup -/ cells, with the initiation sites for sense and antisense transcription being localized to within the IAP81 LTR by S1 nuclease mapping. Deletions of LTR81 show that for normal 5'-to-3' gene transcription (sense direction), the /sup 3'/U3/R region determines the basal level of transcription, whereas sequences within the /sup 5'/U3 region enhance transcription four- to fivefold. Deletion mapping for antisense transcription indicates that a 64-base-pair region (nucleotides 47 to 110) within the U3 region is essential for activity. These data indicate that the U3 region contains all the regulatory elements for bidirectional transcription in IAP LTRs.

  16. In vivo protein binding sites and nuclease hypersensitivity in the promoter region of a cell cycle regulated human H3 histone gene.

    PubMed Central

    Pauli, U; Chrysogelos, S; Nick, H; Stein, G; Stein, J

    1989-01-01

    The chromatin structure and protein-DNA interactions of a cell cycle regulated human H3 histone gene have been examined at different levels of resolution. Using traditional Southern blot analysis we have investigated the accessibility of the H3 coding region and its flanking sequences to DNase I, S1 nuclease and restriction endonuclease digestion. Using the native genomic blotting method recently developed in our laboratory, two sites of protein-DNA interaction in the proximal 240 bp of the promoter region of this H3 gene were established. Further in vivo analysis of protein-DNA binding sites in intact cells by genomic sequencing revealed, with single nucleotide resolution, the guanine contacts and footprints of the proteins bound to the promoter. The relative locations of protein-DNA interactions in this H3 gene are similar to those identified in vivo and in vitro in a cell cycle dependent human H4 histone gene. The proteins complexed with the H3 histone gene promoter can be dissociated between 0.16 and 0.28 M NaCl. The protein-DNA contacts persist throughout the cell cycle and thus may have a functional relationship with the basal level of transcription of this H3 gene that occurs during and outside of S phase. Images PMID:2539585

  17. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  18. MyoD promotes porcine PPARγ gene expression through an E-box and a MyoD-binding site in the PPARγ promoter region.

    PubMed

    Deng, Bing; Zhang, Feng; Chen, Kun; Wen, Jianghui; Huang, Haijun; Liu, Wu; Ye, Shengqiang; Wang, Lixia; Yang, Yu; Gong, Ping; Jiang, Siwen

    2016-08-01

    Peroxisome proliferator-activated receptor γ (PPARγ) is a key transcription factor in adipogenesis and can be regulated by adipogenesis-related factors. However, little information is available regarding its regulation by myogenic factors. In this study, we found that over-expression of MyoD enhanced porcine adipocyte differentiation and up-regulated PPARγ expression, whereas small interfering RNA against MyoD significantly attenuated porcine adipocyte differentiation and inhibited PPARγ expression. The MyoD-binding sites in the PPARγ promoter region at -412 to -396 and -155 to -150 were identified by promoter deletion analysis and site-directed mutagenesis. Electrophoretic mobility shift assays and chromatin immunoprecipitation further showed that these two regions are MyoD-binding sites, both in vitro and in vivo, indicating that MyoD directly interacts with the porcine PPARγ promoter. Thus, our results demonstrate that an Enhancer box and a binding site for a cooperative co-activator of MyoD are present in the promoter region of porcine PPARγ; furthermore, MyoD up-regulates PPARγ expression and promotes porcine adipocyte differentiation. PMID:26944559

  19. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region.

    PubMed

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-05-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼ 70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5'- and 3'-boundaries of the PIC assembly zone. PMID:21288884

  20. 3-Methylcholanthrene elicits DNA adduct formation in the CYP1A1 promoter region and attenuates reporter gene expression in rat H4IIE cells

    SciTech Connect

    Moorthy, Bhagavatula . E-mail: bmoorthy@bcm.tmc.edu; Muthiah, Kathirvel; Fazili, Inayat S.; Kondraganti, Sudha R.; Wang Lihua; Couroucli, Xanthi I.; Jiang Weiwu

    2007-03-23

    Cytochrome CYP1A (CYP1A) enzymes catalyze bioactivation of 3-methylcholanthrene (MC) to genotoxic metabolites. Here, we tested the hypothesis that CYP1A2 catalyzes formation of MC-DNA adducts that are preferentially formed in the promoter region of CYP1A1, resulting in modulation of CYP1A1 gene expression. MC bound covalently to plasmid DNA (50 {mu}g) containing human CYP1A1 promoter (pGL3-1A1), when incubated with wild-type (WT) liver microsomes (2 mg) and NAPPH 37 {sup o}C for 2 h, giving rise to 9 adducts, as determined by {sup 32}P-postlabeling. Eighty percent of adducts was located in the promoter region. Transient transfection of the adducted plasmids into rat hepatoma (H4IIE) cells for 16 h, followed by MC (1 {mu}M) treatment for 24 h inhibited reporter (luciferase) gene expression by 75%, compared to unadducted controls. Our results suggest that CYP1A2 plays a key role in sequence-specific MC-DNA adduct formation in the CYP1A1 promoter region, leading to attenuation of CYP1A1 gene expression.

  1. Cloning of the complete gene for carcinoembryonic antigen: analysis of its promoter indicates a region conveying cell type-specific expression.

    PubMed Central

    Schrewe, H; Thompson, J; Bona, M; Hefta, L J; Maruya, A; Hassauer, M; Shively, J E; von Kleist, S; Zimmermann, W

    1990-01-01

    Carcinoembryonic antigen (CEA) is a widely used tumor marker, especially in the surveillance of colonic cancer patients. Although CEA is also present in some normal tissues, it is apparently expressed at higher levels in tumorous tissues than in corresponding normal tissues. As a first step toward analyzing the regulation of expression of CEA at the transcriptional level, we have isolated and characterized a cosmid clone (cosCEA1), which contains the entire coding region of the CEA gene. A close correlation exists between the exon and deduced immunoglobulin-like domain borders. We have determined a cluster of transcriptional starts for CEA and the closely related nonspecific cross-reacting antigen (NCA) gene and have sequenced their putative promoters. Regions of sequence homology are found as far as approximately 500 nucleotides upstream from the translational starts of these genes, but farther upstream they diverge completely. In both cases we were unable to find classic TATA or CAAT boxes at their expected positions. To characterize the CEA and NCA promoters, we carried out transient transfection assays with promoter-indicator gene constructs in the CEA-producing adenocarcinoma cell line SW403, as well as in nonproducing HeLa cells. A CEA gene promoter construct, containing approximately 400 nucleotides upstream from the translational start, showed nine times higher activity in the SW403 than in the HeLa cell line. This indicates that cis-acting sequences which convey cell type-specific expression of the CEA gene are contained within this region. Images PMID:2342461

  2. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  3. Identification of the Ω4406 Regulatory Region, a Developmental Promoter of Myxococcus xanthus, and a DNA Segment Responsible for Chromosomal Position-Dependent Inhibition of Gene Expression

    PubMed Central

    Loconto, Jennifer; Viswanathan, Poorna; Nowak, Scott J.; Gloudemans, Monica; Kroos, Lee

    2005-01-01

    When starved, Myxococcus xanthus cells send signals to each other that coordinate their movements, gene expression, and differentiation. C-signaling requires cell-cell contact, and increasing contact brought about by cell alignment in aggregates is thought to increase C-signaling, which induces expression of many genes, causing rod-shaped cells to differentiate into spherical spores. C-signaling involves the product of the csgA gene. A csgA mutant fails to express many genes that are normally induced after about 6 h into the developmental process. One such gene was identified by insertion of Tn5 lac at site Ω4406 in the M. xanthus chromosome. Tn5 lac fused transcription of lacZ to the upstream Ω4406 promoter. In this study, the Ω4406 promoter region was identified by analyzing mRNA and by testing different upstream DNA segments for the ability to drive developmental lacZ expression in M. xanthus. The 5′ end of Ω4406 mRNA mapped to approximately 1.3 kb upstream of the Tn5 lac insertion. A 1.0-kb DNA segment from 0.8 to 1.8 kb upstream of the Tn5 lac insertion, when fused to lacZ and integrated at a phage attachment site in the M. xanthus chromosome, showed a similar pattern of developmental expression as Tn5 lac Ω4406. The DNA sequence upstream of the putative transcriptional start site was strikingly similar to promoter regions of other C-signal-dependent genes. Developmental lacZ expression from the 1.0-kb segment was abolished in a csgA mutant but was restored upon codevelopment of the csgA mutant with wild-type cells, which supply C-signal, demonstrating that the Ω4406 promoter responds to extracellular C-signaling. Interestingly, the 0.8-kb DNA segment immediately upstream of Tn5 lac Ω4406 inhibited expression of a downstream lacZ reporter in transcriptional fusions integrated at a phage attachment site in the chromosome but not at the normal Ω4406 location. To our knowledge, this is the first example in M. xanthus of a chromosomal position

  4. Choline availability modulates human neuroblastoma cell proliferation and alters the methylation of the promoter region of the cyclin-dependent kinase inhibitor 3 gene.

    PubMed

    Niculescu, Mihai D; Yamamuro, Yutaka; Zeisel, Steven H

    2004-06-01

    Choline is an important methyl donor and a component of membrane phospholipids. In this study, we tested the hypothesis that choline availability can modulate cell proliferation and the methylation of genes that regulate cell cycling. In several other model systems, hypomethylation of cytosine bases that are followed by a guanosine (CpG) sites in the promoter region of a gene is associated with increased gene expression. We found that in choline-deficient IMR-32 neuroblastoma cells, the promoter of the cyclin-dependent kinase inhibitor 3 gene (CDKN3) was hypomethylated. This change was associated with increased expression of CDKN3 and increased levels of its gene product, kinase-associated phosphatase (KAP), which inhibits the G(1)/S transition of the cell cycle by dephosphorylating cyclin-dependent kinases. Choline deficiency also reduced global DNA methylation. The percentage of cells that accumulated bromodeoxyuridine (proportional to cell proliferation) was 1.8 times lower in the choline-deficient cells than in the control cells. Phosphorylated retinoblastoma (p110) levels were 3 times lower in the choline-deficient cells than in control cells. These findings suggest that the mechanism whereby choline deficiency inhibits cell proliferation involves hypomethylation of key genes regulating cell cycling. This may be a mechanism for our previously reported observation that stem cell proliferation in hippocampus neuroepithelium is decreased in choline-deficient rat and mouse fetuses. PMID:15147518

  5. Choline availability modulates human neuroblastoma cell proliferation and alters the methylation of the promoter region of the cyclin-dependent kinase inhibitor 3 gene

    PubMed Central

    Niculescu, Mihai D.; Yamamuro, Yutaka; Zeisel, Steven H.

    2006-01-01

    Choline is an important methyl donor and a component of membrane phospholipids. In this study, we tested the hypothesis that choline availability can modulate cell proliferation and the methylation of genes that regulate cell cycling. In several other model systems, hypomethylation of cytosine bases that are followed by a guanosine (CpG) sites in the promoter region of a gene is associated with increased gene expression. We found that in choline-deficient IMR-32 neuroblastoma cells, the promoter of the cyclin-dependent kinase inhibitor 3 gene (CDKN3) was hypomethylated. This change was associated with increased expression of CDKN3 and increased levels of its gene product, kinase-associated phosphatase (KAP), which inhibits the G1/S transition of the cell cycle by dephosphorylating cyclin-dependent kinases. Choline deficiency also reduced global DNA methylation. The percentage of cells that accumulated bromodeoxyuridine (proportional to cell proliferation) was 1.8 times lower in the choline-deficient cells than in the control cells. Phosphorylated retinoblastoma (p110) levels were 3 times lower in the choline-deficient cells than in control cells. These findings suggest that the mechanism whereby choline deficiency inhibits cell proliferation involves hypomethylation of key genes regulating cell cycling. This may be a mechanism for our previously reported observation that stem cell proliferation in hippocampus neuroepithelium is decreased in choline-deficient rat and mouse fetuses. PMID:15147518

  6. Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene.

    PubMed Central

    Imataka, H; Sogawa, K; Yasumoto, K; Kikuchi, Y; Sasano, K; Kobayashi, A; Hayami, M; Fujii-Kuriyama, Y

    1992-01-01

    The cDNAs for two DNA binding proteins of BTE, a GC box sequence in the promoter region of the P-450IA1(CYP1A1) gene, have been isolated from a rat liver cDNA library by using the BTE sequence as a binding probe. While one is for the rat equivalent to human Sp1, the other encodes a primary structure of 244 amino acids, a novel DNA binding protein designated BTEB. Both proteins contain a zinc finger domain of Cys-Cys/His-His motif that is repeated three times with sequence similarity of 72% to each other, otherwise they share little or no similarity. The function of BTEB was analysed by transfection of plasmids expressing BTEB and/or Sp1 with appropriate reporter plasmids into a monkey cell line CV-1 and compared with Sp1. BTEB and Sp1 activated the expression of genes with repeated GC box sequences in promoters such as the simian virus 40 early promoter and the human immunodeficiency virus-1 long terminal repeat promoter. In contrast, BTEB repressed the activity of a promoter containing BTE, a single GC box of the CYP1A1 gene that is stimulated by Sp1. When the BTE sequence was repeated five times, however, BTEB turned out to be an activator of the promoter. RNA blot analysis showed that mRNAs for BTEB and Sp1 were expressed in all tissues tested, but their concentrations varied independently in tissues. The former mRNA was rich in the brain, kidney, lung and testis, while the latter was relatively abundant in the thymus and spleen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1356762

  7. The regulation of gene expression in transformed maize aleurone and endosperm protoplasts. Analysis of promoter activity, intron enhancement, and mRNA untranslated regions on expression.

    PubMed Central

    Gallie, D R; Young, T E

    1994-01-01

    Gene expression in the aleurone and endosperm is highly regulated during both seed development and germination. Studies of alpha-amylase expression in the aleurone of barley (Hordeum vulgare) have generated the current paradigm for hormonal control of gene expression in germinating cereal grain. Gene expression studies in both the aleurone and endosperm tissues of maize (Zea mays) seed have been hampered because of a lack of an efficient transformation system. We report here the rapid isolation of protoplasts from maize aleurone and endosperm tissue, their transformation using polyethylene glycol or electroporation, and the regulation of gene expression in these cells. Adh1 promoter activity was reduced relative to the 35S promoter in aleurone and endosperm protoplasts compared to Black Mexican Sweet suspension cells in which it was nearly as strong as the 35S promoter. Intron-mediated stimulation of expression was substantially higher in transformed aleurone or endosperm protoplasts than in cell-suspension culture protoplasts, and the data suggest that the effect of an intron may be affected by cell type. To examine cytoplasmic regulation, the 5' and 3' untranslated regions from a barley alpha-amylase were fused to the firefly luciferase-coding region, and their effect on translation and mRNA stability was examined following the delivery of in vitro synthesized mRNA to aleurone and endosperm protoplasts. The alpha-amylase untranslated regions regulated translational efficiency in a tissue-specific manner, increasing translation in aleurone or endosperm protoplasts but not in maize or carrot cell-suspension protoplasts, in animal cells, or in in vitro translation lysates. PMID:7824660

  8. Analysis of C43G mutation in the promoter region of the XIST gene in patients with idiopathic primary ovarian insufficiency

    PubMed Central

    Yoon, Sang Ho

    2015-01-01

    Objective The XIST gene is considered to be an attractive candidate gene for skewed X-chromosome inactivation and a possible cause of primary ovarian insufficiency (POI). The purpose of this study was to investigate whether the XIST gene promoter mutation is associated with idiopathic POI in a sample of the Korean population. Methods Subjects consisted of 102 idiopathic POI patients and 113 healthy controls with normal menstrual cycles. Patients with the following known causes of POI were excluded in advance: cytogenetic abnormalities, prior chemo- or radiotherapy, or prior bilateral oophorectomy. Genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism analysis. Results The mean age of onset of ovarian insufficiency was 28.7±8.5 years and the mean values of serum luteinizing and follicle-stimulating hormones and estradiol in the POI group were 31.4±18.2 mIU/mL, 74.5±41.1 mIU/mL, and 30.5±36.7 pg/mL, respectively. We found no cytosine to guanine (C43G) variation in the XIST gene in both POI patients and controls. Conclusion The C43G mutation in the promoter region of the XIST gene was not present in the Korean patients with idiopathic POI in our study, in contrast to our expectation, suggesting that the role of XIST in the pathogenesis of POI is not yet clear. PMID:26161334

  9. Interaction of a rhizobial DNA-binding protein with the promoter region of a plant leghemoglobin gene

    SciTech Connect

    Welters, P.; Metz, B.; Felix, G.; Palme, K. ); Szczyglowski, K. ); Bruijn, F.J. de Michigan State Univ., East Lansing, MI )

    1993-08-01

    A nucleotide sequence was identified approximately 650 bp upstream of the Sesbania rostrata leghemoglobin gene Srglb3 start codon, which interacts specifically with a proteinaceous DNA-binding factor found in nodule extracts but not in extracts from leaves or root. The binding site for this factor was delimited using footprinting techniques. The DNA-binding activity of this factor was found to be heat stable, dependent on divalent cations, and derived from the (infecting) Azorhizobium caulinodans bacteria or bacteroids (A. caulinodans bacterial binding factor 1, AcBBF1). A 9- to 10-kD protein was isolated from a free-living culture of A. caulinodans that co-purifies with the DNA-binding activity (A. caulinodans bacterial binding protein 1, AcBBP1) and interacts specifically with its target (S. rostrata bacterial binding site 1, SrBBS1). The amino acid sequence of the N-terminal 27 residues of AcBBP1 was determined and was found to share significant similarity (46% identity; 68% similarity) with a domain of the herpes simplex virus major DNA-binding protein infected cell protein 8(ICP8). An insertion mutation in the SrBBS1 was found to result in a substantial reduction of the expression of a Srglb3-gus reporter gene fusion in nodules of transgenic Lotus corniculatus plants, suggesting a role for this element in Srglb3 promoter activity. Based on these results, the authors propose that (a) bacterial transacting factor(s) may play a role in infected cell-specific expression of the symbiotically induced plant lb genes. 70 refs., 11 figs.

  10. Characterization of the regulatory region of the zebrafish Prep1.1 gene: analogies to the promoter of the human PREP1.

    PubMed

    Bernardi, Elisa; Deflorian, Gianluca; Pezzimenti, Federica; Pezzinenti, Federica; Diaz, Victor M; Mione, Marina; Blasi, Francesco

    2010-01-01

    Prep1 is a developmentally essential TALE class homeodomain transcription factor. In zebrafish and mouse, Prep1 is already ubiquitously expressed at the earliest stages of development, with important tissue-specific peculiarities. The Prep1 gene in mouse is developmentally essential and has haploinsufficient tumor suppressor activity [1]. We have determined the human Prep1 transcription start site (TSS) by primer extension analysis and identified, within 20 bp, the transcription start region (TSR) of the zebrafish Prep1.1 promoter. The functions of the zebrafish 5' upstream sequences were analyzed both by transient transfections in Hela Cells and by injection in zebrafish embryos. This analysis revealed a complex promoter with regulatory sequences extending up to -1.8, possibly -5.0 Kb, responsible for tissue specific expression. Moreover, the first intron contains a conserved tissue-specific enhancer both in zebrafish and in human cells. Finally, a two nucleotides mutation of an EGR-1 site, conserved in all species including human and zebrafish and located at a short distance from the TSS, destroyed the promoter activity of the -5.0 Kb promoter. A transgenic fish expressing GFP under the -1.8 Kb zebrafish promoter/enhancer co-expressed GFP and endogenous Prep1.1 during embryonic development. In the adult fish, GFP was expressed in hematopoietic regions like the kidney, in agreement with the essential function of Prep1 in mouse hematopoiesis. Sequence comparison showed conservation from man to fish of the sequences around the TSS, within the first intron enhancer. Moreover, about 40% of the sequences spread throughout the 5 Kbof the zebrafish promoter are concentrated in the -3 to -5 Kb of the human upstream region. PMID:21203543

  11. Characterization of the Regulatory Region of the Zebrafish Prep1.1 Gene: Analogies to the Promoter of the Human PREP1

    PubMed Central

    Pezzinenti, Federica; Diaz, Victor M.; Mione, Marina; Blasi, Francesco

    2010-01-01

    Prep1 is a developmentally essential TALE class homeodomain transcription factor. In zebrafish and mouse, Prep1 is already ubiquitously expressed at the earliest stages of development, with important tissue-specific peculiarities. The Prep1 gene in mouse is developmentally essential and has haploinsufficient tumor suppressor activity [1]. We have determined the human Prep1 transcription start site (TSS) by primer extension analysis and identified, within 20 bp, the transcription start region (TSR) of the zebrafish Prep1.1 promoter. The functions of the zebrafish 5′ upstream sequences were analyzed both by transient transfections in Hela Cells and by injection in zebrafish embryos. This analysis revealed a complex promoter with regulatory sequences extending up to −1.8, possibly −5.0 Kb, responsible for tissue specific expression. Moreover, the first intron contains a conserved tissue-specific enhancer both in zebrafish and in human cells. Finally, a two nucleotides mutation of an EGR-1 site, conserved in all species including human and zebrafish and located at a short distance from the TSS, destroyed the promoter activity of the −5.0 Kb promoter. A transgenic fish expressing GFP under the −1.8 Kb zebrafish promoter/enhancer co-expressed GFP and endogenous Prep1.1 during embryonic development. In the adult fish, GFP was expressed in hematopoietic regions like the kidney, in agreement with the essential function of Prep1 in mouse hematopoiesis. Sequence comparison showed conservation from man to fish of the sequences around the TSS, within the first intron enhancer. Moreover, about 40% of the sequences spread throughout the 5 Kbof the zebrafish promoter are concentrated in the −3 to −5 Kb of the human upstream region. PMID:21203543

  12. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  13. Further diversity of the 5' promoter region of the MHC class I-related chain B gene.

    PubMed

    Laza-Briviesca, R; Pearson, H; Saudemont, A; Madrigal, J A; Cox, S T

    2016-02-01

    We have now found a total of 15 individual MICB promoter sequences, varying by combination of 18 polymorphic positions within the MICB minimal promoter sequence. Sequence-based typing and cloning characterized the three new 5' promoter sequences as MICB-P13, MICB-P14 and MICB-P15. PMID:26707708

  14. An erythrocyte-specific protein that binds to the poly(dG) region of the chicken beta-globin gene promoter.

    PubMed

    Lewis, C D; Clark, S P; Felsenfeld, G; Gould, H

    1988-07-01

    The promoter region of the chicken adult beta-globin gene contains a sequence of 16 deoxyguanosine residues located at a nucleosome boundary in tissues where the gene is inactive. In definitive erythrocytes that express the beta-globin gene, the nucleosome is displaced, the G-string and adjacent sequences are occupied by sequence-specific DNA-binding proteins, and a nuclease hypersensitive domain is generated in this region. To gain insight into the role of the G-string in this series of events, we have examined the proteins that bind to it. Using the gel mobility shift assay and a monoclonal antibody that blocks specific binding to the G-string, we have identified a specific protein, BGP1, that is found only in chicken erythroid cells and appears at the same time, or shortly before, the changes in chromatin structure. The antibody interacts strongly with BGP1 and cross-reacts weakly with Sp1. Although both BGP1 and Sp1 require Zn2+ for their DNA-binding activity, these proteins differ in their binding-site specificities, chromatographic properties, and molecular weights. In contrast to Sp1, which is found in a wide variety of cell types, BGP1 is restricted to erythrocytes and is most abundant in definitive erythrocytes. Thus, its presence corresponds to the tissue- and stage-specific occupancy of the G-string in vivo. PMID:3209071

  15. Promoter architectures and developmental gene regulation.

    PubMed

    Haberle, Vanja; Lenhard, Boris

    2016-09-01

    Core promoters are minimal regions sufficient to direct accurate initiation of transcription and are crucial for regulation of gene expression. They are highly diverse in terms of associated core promoter motifs, underlying sequence composition and patterns of transcription initiation. Distinctive features of promoters are also seen at the chromatin level, including nucleosome positioning patterns and presence of specific histone modifications. Recent advances in identifying and characterizing promoters using next-generation sequencing-based technologies have provided the basis for their classification into functional groups and have shed light on their modes of regulation, with important implications for transcriptional regulation in development. This review discusses the methodology and the results of genome-wide studies that provided insight into the diversity of RNA polymerase II promoter architectures in vertebrates and other Metazoa, and the association of these architectures with distinct modes of regulation in embryonic development and differentiation. PMID:26783721

  16. Organization of the gene (RHCE) encoding the human blood group RhCcEe antigens and characterization of the promoter region

    SciTech Connect

    Cherif-Zahar, B.; Le Van Kim, C.; Rouillac, C.; Raynal, V.; Cartron, J.P.; Colin, Y. )

    1994-01-01

    The human RH (rhesus) locus is composed of two genes, RHD and RHCE, encoding the D, Cc, and Ee blood group antigens. The RHCE gene was isolated from a human genomic library and characterized. It is organized into 10 exons distributed over 75 kb. Exons 4-8 are alternatively spliced in the different RNA isoforms previously identified. Primer extension analysis indicated that the transcription initiation site is located 83 bp upstream of the initiation codon. The 5[prime] flanking region of the RHCE gene, from nucleotide [minus]600 to +42, exhibited a significant transcriptional activity after transfection in the erythroleukemic cell line K562, but not in the nonhematopoietic cell line HeLa. This result was in agreement with Northern blot analysis, suggesting that the expression of the RH locus is restricted to the erythroid/megakaryocytic lineage. Accordingly, putative binding sites for SP1, GATA-1, and Ets proteins, nuclear factors known to be involved in the erythroid and megakaryocytic gene expression, were identified in this Rh promoter. 36 refs., 5 figs., 1 tab.

  17. Alternative promoters of gene MAGE4a

    SciTech Connect

    De Plaen, E.; Naerhuyzen, B.; De Smet, C.

    1997-03-01

    Gene MAGE-4 (HGMW-approved symbol MAGE4) is expressed in several types of tumors, but not in normal tissues, except testis and placenta. The 5{prime} end of this gene contains eight homologous exons spread over a 5.8-kb region. These exons are alternatively spliced to a unique second exon and a unique third exon, which encodes a protein of 317 amino acids. The analysis of transcripts found in testis, placenta, and a sarcoma cell line showed that each of the alternative first exons is used in at least one of these tissues. Various regions of the promoter of the fifth alternative exon (1.5) were cloned in a luciferase reporter plasmid, and the constructs were transfected in a sarcoma cell line that expresses MAGE-4. Two Ets motifs located between positions -70 and -29 relative to the transcription start site were found to drive 55% of the promoter activity. A region containing an Sp1 consensus binding site located upstream of the two Ets motifs was found to be responsible for 44% of the transcriptional activity. MAGE-4a promoters 1.4 and 1.6, which also contain the Sp1 and the two Ets binding motifs, supported a level of transcription comparable to that of promoter 1.5, whereas promoter 1.1, which contains only one Ets binding site, was sixfold less active. In line with observations made with gene MAGE-1 (HGMW-approved symbol MAGE1), we found that promoter 1.5 stimulated a high level of transcription in a melanoma cell line that does not express MAGE-4. This suggests that the tumor-specific expression of MAGE genes is not determined by the presence of specific transcription factors. 26 refs., 7 figs., 2 tabs.

  18. Polymorphisms in the promoter regions of the CXCL1 and CXCL2 genes contribute to increased risk of alopecia areata in the Korean population.

    PubMed

    Kim, S K; Chung, J-H; Park, H J; Kang, S W; Lim, D-J; Byun, S H; Baek, D G; Ko, H Y; Lew, B-L; Baik, H H; Sim, W-Y

    2015-01-01

    Alopecia areata (AA) is a common disease, which causes hair loss in humans. AA has a genetically complex inheritance. This study investigated the possible correlations between single nucleotide polymorphisms (SNPs) in the promoter regions of the chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1) and chemokine (C-X-C motif) ligand 2 (CXCL2) genes and the development of AA in the Korean population. Two hundred and thirty-five AA patients and 240 control subjects were recruited. The specific SNPs occurring in the promoter regions of the CXCL1 and CXCL2 genes (rs3117604, -429C/T and rs3806792, -264T/C, respectively) were genotyped. All data obtained was evaluated using the SNPStats, SPSS 18.0, and the Haploview v.4.2 software platforms. The Odd's ratios (OR), 95% confidence intervals (CI), and P values were calculated using multiple logistic regression models. Analyses of the genetic sequences obtained revealed a significant correlation between the two SNPs and the development of AA (rs3117604, P = 0.0009 in co-dominant model 1, P = 0.01 in co-dominant model 2, P = 0.004 in the dominant model, P = 0.005 in the log-additive model, P = 0.012 in allele distribution; rs3806792, P = 0.036 in co-dominant model 2, P = 0.0046 in the log-additive model). The TT and CC haplotypes were also observed to show a significant association with increased risk of AA (TT haplotype, P = 0.0018; CC haplotype, P = 0.0349). Our data suggests that the CXCL1 and CXCL2 genes may be associated with AA susceptibility. PMID:26345899

  19. Induction of bovine papillomavirus E2 gene expression and early region transcription by cell growth arrest: correlation with viral DNA amplification and evidence for differential promoter induction.

    PubMed Central

    Burnett, S; Ström, A C; Jareborg, N; Alderborn, A; Dillner, J; Moreno-Lopez, J; Pettersson, U; Kiessling, U

    1990-01-01

    The bovine papillomavirus type 1 (BPV-1) genome replicates as a latent plasmid in mouse C127 cells transformed in vitro by the virus. However, we have recently shown that BPV-1 DNA amplification can be induced in a subpopulation of cells under culture conditions which suppress cell proliferation, a finding which led us to hypothesize that expression of a viral replication factor was regulated by cell growth stage. In this report, we describe the detection in these cells of abundant BPV-1 nuclear E2 antigen by immunofluorescence analysis. Expression of E2 antigen in fibropapilloma tissue was similarly localized to nonproliferating epidermal cells of the lower spinous layers--the natural site of induction of vegetative viral DNA replication. Immunoprecipitation analysis showed that the previously characterized 48-kilodalton (transactivator) and 31-kilodalton (repressor) E2 proteins were both induced in growth-arrested cell cultures. In parallel with E2 antigen synthesis under conditions of serum-deprivation in vitro, we observed a significant increase in levels of BPV-1 early region mRNAs. Furthermore, we present evidence for preferential induction of the P2443 promoter, in addition to specific induction of the P7940 promoter in response to serum deprivation. These observations indicate a central role for E2 transcription factors in the induction of viral DNA amplification in division-arrested cells in vitro and in vivo and suggest that this process is associated with a qualitative switch in the expression of viral early region genes. Images PMID:2170685

  20. Characterization of the promoter region of TCblR/CD320 gene, the receptor for cellular uptake of transcobalamin-bound cobalamin

    PubMed Central

    Jiang, Wenxia; Sequeira, Jeffrey M; Nakayama, Yasumi; Quadros, Edward V.

    2010-01-01

    Cellular uptake of cobalamin (Cbl) is mediated by the transcobalamin receptor (TCblR) that binds and internalizes transcobalamin (TC) saturated with Cbl. These receptors are expressed in actively proliferating cells and are down regulated in quiescent cells. The 5′ region of TCblR gene was analyzed for promoter activity to determine transcriptional regulation of TCblR expression. The region −668 to −455 appears to regulate TCblR expression. We have identified transcription factors MZF-1 (myeloid zinc finger 1) / RREB-1 (Ras-responsive element binding protein 1), C/EBP (CCAAT/enhancer binding protein) / HNF-3ß (hepatocyte nuclear factor 3) and AP-1(activator protein 1) as proteins likely to be involved in this regulation with the former region primarily involved in up regulation and the latter two regions involved in suppression of TCblR expression. These transcription factors are involved in cell proliferation and differentiation. Thus the cell cycle associated expression of TCblR appears to be tightly regulated in synchrony with the proliferative phase of the cell cycle. PMID:20627121

  1. Improvement and induction property of radiation-responsive promoter through DNA shuffling of 5′-flanking regions of the human p21 gene

    PubMed Central

    Kagiya, Go; Ogawa, Ryohei; Cook, John A.; Choudhuri, Rajani; Hatashita, Masanori; Tanaka, Yoshikazu; DeGraff, Bill G.; Mitchell, James B.

    2010-01-01

    A promoter that augments gene expression in response to stimulation of ionizing radiation would be a desired tool for radiogenetic therapy, a combination of radiotherapy and gene therapy. Although various promoters occurring naturally or artificially have been used for researches, one showing higher reactivity to ionizing radiation is desirable. In the present study, we attempted to improve a radiation-responsive promoter of the p21 through a technique called DNA shuffling. A library of DNA fragments was constructed by re-ligation of randomly digested promoter fragments and improved promoters were chosen out of the library. We repeated this process twice to obtain a promoter showing 2.6 fold better reactivity to ionizing radiation compared with its parent, p21 promoter after 10 Gy γ-ray irradiation. Nucleotide sequence analyses revealed that the obtained promoter was densely packed with some of the cis-acting elements including binding sites for p53, NF-κB, NRF-2, AP-1 and NF-Y more than p21 promoter. In addition, it was shown that its induction by ionizing radiation was dependent upon p53 status of a cell line, suggesting that the promoter retained properties of the p21 promoter. This technique is simple and efficient to improve a promoter responsive to other stimulus of interest besides IR. PMID:20541129

  2. Analysis of the Erwinia chrysanthemi ferrichrysobactin receptor gene: resemblance to the Escherichia coli fepA-fes bidirectional promoter region and homology with hydroxamate receptors.

    PubMed Central

    Sauvage, C; Franza, T; Expert, D

    1996-01-01

    The fct cbsCEBA operon from the Erwinia chrysanthemi 3937 chrysobactin-dependent iron assimilation system codes for transport and biosynthetic functions. The sequence of the fct outer membrane receptor gene was determined. The fct promoter region displays a strong resemblance to the Escherichia coli bidirectional intercistronic region controlling the expression of the fepA-entD and fes-entF operons. An apparent Fur-binding site was shown to confer iron regulation on an fct::lac fusion expressed on a low-copy-number plasmid in a Fur-proficient E. coli strain. The fct gene consists of an open reading frame encoding a 735-amino-acid polypeptide with a signal sequence of 38 residues. The Fct protein has 36% sequence homology with the E. coli ferrichrome receptor FhuA and the Yersinia enterocolitica ferrioxamine receptor FoxA. On the basis of secondary-structure predictions and these homologies, we propose a two-dimensional folding model for Fct. PMID:8576065

  3. Polymorphisms in the promoter region of the bovine lactoferrin gene influence milk somatic cell score and milk production traits in Chinese Holstein cows.

    PubMed

    Mao, Yongjiang; Zhu, Xiaorui; Xing, Shiyu; Zhang, Meirong; Zhang, Huimin; Wang, Xiaolong; Karrow, Niel; Yang, Liguo; Yang, Zhangping

    2015-12-01

    Lactoferrin is an iron-binding protein found in cow's milk that plays an important role in preventing mastitis caused by intramammary infection. In this study, 20 Chinese Holstein cows were selected randomly for PCR amplification and sequencing of the bovine lactoferrin gene promoter region and used for SNP discovery in the region between nucleotide positions -461 to -132. Three SNPs (-270T>C, -190G>A and -156A>G) were identified in bovine lactoferrin, then Chinese Holstein cows (n=866) were genotyped using Sequenom MassARRAY (Sequenom Inc., San Diego, CA) based on the previous SNP information in this study, and the associations between SNPs or haplotype and milk somatic cell score (SCS) and production traits were analyzed by the least squares method in the GLM procedure of SAS. SNPs -270T>C and -156A>G showed close linkage disequilibrium (r(2)=0.76). The SNP -190G>A showed a significant association with SCS, and individuals with genotype GG had higher SCS than genotypes AG and AA. Associations were found between the SNPs -270T>C and -190G>A with SCS and the milk composition. The software MatInspector revealed that these SNPs were located within several potential transcription factor binding sites, including NF-κB p50, KLF7 and SP1, and may alter gene expression, but further investigation will be required to elucidate the biological and practical relevance of these SNPs. PMID:26679804

  4. The c.-190 C>A transversion in promoter region of protamine1 gene as a genetic risk factor for idiopathic oligozoospermia.

    PubMed

    Jamali, Shirin; Karimian, Mohammad; Nikzad, Hossein; Aftabi, Younes

    2016-08-01

    The genome condensation in the sperm head is resulted with replacing of histones by protamines during spermatogenesis. It is reported that defects in the protamine 1 (PRM1) and/or 2 (PRM2) genes cause male infertility. Located on chromosome 16 (16p13.2) these genes contain numerous unstudied single nucleotide polymorphisms. This study aimed to investigate the association of c.-190 C>A and g.298 G>C transversions that respectively occur in PRM1 and PRM2 genes with idiopathic oligozoospermia. In a case-control study, we collected blood samples from 130 idiopathic oligozoospermia and 130 fertile men. Detection of c.-190 C>A and g.298 G>C polymorphisms performed by direct sequencing and PCR-RFLP methods respectively. An in silico analysis was performed by ASSP, NetGene 2, and PNImodeler online web servers. Our data revealed that g.298 G>C transversion in PRM2 was not associated with oligozoospermia (P > 0.05). Whereas, -190CA and -190AA genotypes in PRM1 gene were associated significantly with increased risk of oligozoospermia (P = 0.0017 and 0.0103, respectively). Also carriers of A allele (CA+AA) for PRM1 c.-190 C>A were at a high risk for oligozoospermia (OR 3.2440, 95 % CI 1.8060-5.8270, P = 0.0001). Further, in silico analysis revealed that c.-190 C>A transversion may alter transcription factor interactions with the promoter region of PRM1. The results revealed that the c.-190 C>A transversion may involve in the susceptibility for oligozoospermia and could be represented as a noninvasive molecular marker for genetic diagnosis of idiopathic oligozoospermia. PMID:27216534

  5. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    PubMed Central

    2014-01-01

    Background Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Methods Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Results Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Conclusion Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment. PMID:24495356

  6. Apolipoprotein M regulates the orphan nuclear receptor LRH-1 gene expression through binding to its promoter region in HepG2 cells

    PubMed Central

    Pan, Yi; Zhou, Hou-gang; Zhou, Hui; Hu, Min; Tang, Li-jun

    2015-01-01

    Apolipoprotein M (ApoM) is predominantly located in the high-density lipoprotein in human plasma. It has been demonstrated that ApoM expression could be regulated by several crucial nuclear receptors that are involved in the bile acid metabolism. In the present study, by combining gene-silencing experiments, overexpression studies, and chromatin immunoprecipitation assays, we showed that ApoM positively regulated liver receptor homolog-1 (LRH-1) gene expression via direct binding to an LRH-1 promoter region (nucleotides −406/ −197). In addition, we investigated the effects of farnesoid X receptor agonist GW4064 on hepatic ApoM expression in vitro. In HepG2 cell cultures, both mRNA and protein levels of ApoM and LRH-1 were decreased in a time-dependent manner in the presence of 1 μM GW4064, and the inhibition effect was gradually attenuated after 24 hours. In conclusion, our findings present supportive evidence that ApoM is a regulator of human LRH-1 transcription, and further reveal the importance of ApoM as a critical regulator of bile acids metabolism. PMID:25987835

  7. In vitro footprinting of promoter regions within supercoiled plasmid DNA

    PubMed Central

    Sun, Daekyu

    2010-01-01

    Polypurine/polypyrimidine (pPU/pPY) tracts, which exist in the promoter regions of many growth-related genes, have been proposed to be very dynamic in their conformation. In this chapter, we describe a detailed protocol for DNase I and S1 nuclease footprinting experiments with supercoiled plasmid DNA containing such the promoter regions to probe whether there are conformational transitions to B-type DNA, melted DNA and G-quadruplex structures within this tract. This is demonstrated with the proximal promoter region of the human vascular endothelial growth factor (VEGF) gene, which also contains multiple binding sites for Sp1 and Egr-1 transcription factors. PMID:19997887

  8. MicroRNA-mediated regulation of target genes in several brain regions is correlated to both microRNA-targeting-specific promoter methylation and differential microRNA expression

    PubMed Central

    2013-01-01

    Background Public domain databases nowadays provide multiple layers of genome-wide data e.g., promoter methylation, mRNA expression, and miRNA expression and should enable integrative modeling of the mechanisms of regulation of gene expression. However, researches along this line were not frequently executed. Results Here, the public domain dataset of mRNA expression, microRNA (miRNA) expression and promoter methylation patterns in four regions, the frontal cortex, temporal cortex, pons and cerebellum, of human brain were sourced from the National Center for Biotechnology Informations gene expression omnibus, and reanalyzed computationally. A large number of miRNA-mediated regulation of target genes and miRNA-targeting-specific promoter methylation were identified in the six pairwise comparisons among the four brain regions. The miRNA-mediated regulation of target genes was found to be highly correlated with one or both of miRNA-targeting-specific promoter methylation and differential miRNA expression. Genes enriched for Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways that were related to brain function and/or development were found among the target genes of miRNAs whose differential expression patterns were highly correlated with the miRNA-mediated regulation of their target genes. Conclusions The combinatorial analysis of miRNA-mediated regulation of target genes, miRNA-targeting-specific promoter methylation and differential miRNA expression can help reveal the brain region-specific contributions of miRNAs to brain function and development. PMID:23725297

  9. Interactions of the yeast centromere and promoter factor, Cpf1p, with the cytochrome c1 upstream region and functional implications on regulated gene expression.

    PubMed Central

    Oechsner, U; Bandlow, W

    1996-01-01

    The upstream activation site (UAS) of the cytochrome c1 gene, CYT1, contains sequences for DNA-binding of several transcription factors. Among them are the heme-dependent protein, Hap1p, and the multiprotein complex, Hap2/3/4/5, which mediate transcriptional induction under aerobic conditions and after exhaustion of glucose, respectively. The multiple interactions of nuclear proteins with the UAS region of CYT1 observed in electrophoretic mobility shift experiments are influenced by carbon source and oxygen tension, but are independent of both regulators, Hap1p and Hap2/3/4/5. All protein-DNA complexes obtained are solely due to the association of the centromere and promoter factor 1 (Cpf1p) with the centromere determining element (CDE I)-like motif at the 5' boundary of the UAS(CYT1). This motif overlaps with a consensus sequence for the binding of the general factor Abf1p. Functional analyses after the separate introduction of point mutations into both elements reveal no role for the latter protein and only a minor role for Cpf1p in the regulated expression of CYT1/lacZ chimaeric proteins. However, in cpf1-mutants, induction of CYT1 reaches higher steady state levels and adaptation to aerobic conditions occurs faster than in wild-type. Thus, Cpf1p seems to reduce CYT1 promoter activity under partly inducing conditions, e.g. when only one of the activators, Hap1p or the Hap2 complex, exerts its function. PMID:8710512

  10. Interaction between a serotonin transporter gene promoter region polymorphism and stress predicts depressive symptoms in Chinese adolescents: a multi-wave longitudinal study

    PubMed Central

    2013-01-01

    Background The serotonin transporter (5-HTT) gene may play an important role in the onset and development of mental disorders. Past studies have tested whether a functional polymorphism in the 5-HTT gene linked promoter region (5-HTTLPR) moderated the association between stress and depressive symptoms, but the results of these studies were inconsistent. Thus, the aim of the current study was to examine the interaction between 5-HTTLPR and stress that predict depressive symptoms in Chinese adolescents. Methods A total of 252 healthy adolescents (131 females and 121 males, aged from 14 to 18, mean = 16.00, standard deviation = 0.60) participated in this study. During the initial assessment, all participants completed the Center for Epidemiological Studies Depression Scale (CES-D) and Adolescent Life Events Questionnaire (ALEQ) and were genotyped for the 5-HTTLPR polymorphism. Participants subsequently completed CES-D and ALEQ once every three months during the subsequent 24 months. A multilevel model was used to investigate the 5-HTTLPR × stress interaction in predicting depressive symptoms. Results The results indicated no main effect of 5-HTTLPR and a significant 5-HTTLPR × stress interaction in females only. Females with at least one 5-HTTLPR S allele exhibited more depressive symptoms under stressful situations. No significant 5-HTTLPR × stress interaction was found in males. Conclusions In Chinese adolescents, there are gender differences on the interaction between 5-HTTLPR and stress that predict depressive symptoms. The association between stress and depressive symptoms is moderated by 5-HTTLPR in Chinese female adolescents. PMID:23683292

  11. Identification of single nucleotide polymorphisms within the promoter region of the bovine heat shock protein 70 gene and associations with pregnancy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objectives were: 1) determine genetic diversity in a promoter segment of the bovine HSP-70 gene, and 2) determine if the identified single nucleotide polymorphisms (SNPs) were related to pregnancy rates. Genomic DNA was collected from 107 Bos taurus/Bos indicus crossbred cows. Specific primers (HSP-...

  12. Down-regulation of interferon regulatory factor 4 gene expression in leukemic cells due to hypermethylation of CpG motifs in the promoter region

    PubMed Central

    Ortmann, Christina A.; Burchert, Andreas; Hölzle, Katharina; Nitsche, Andreas; Wittig, Burghardt; Neubauer, Andreas; Schmidt, Manuel

    2005-01-01

    Although the bcr-abl translocation has been shown to be the causative genetic aberration in chronic myeloid leukemia (CML), there is mounting evidence that the deregulation of other genes, such as the transcription factor interferon regulatory factor 4 (IRF-4), is also implicated in the pathogenesis of CML. Promoter methylation of CpG target sites or direct deletions/insertions of genes are mechanisms of a reversible or permanent silencing of gene expression, respectively. Therefore, we investigated whether IRF-4 promoter methylation or mutation may be involved in the regulation of IRF-4 expression in leukemia cells. Whereas promoter mutations or structural rearrangements could be excluded as a cause of altered IRF-4 expression in hematopoietic cells, the IRF-4 promoter methylation status was found to significantly influence IRF-4 transcription. First, treatment of IRF-4-negative lymphoid, myeloid and monocytic cell lines with the methylation-inhibitor 5-aza-2-deoxycytidine resulted in a time- and concentration-dependent increase of IRF-4 mRNA and protein levels. Second, using a restriction-PCR-assay and bisulfite-sequencing we identified specifically methylated CpG sites in IRF-4-negative but not in IRF-4-positive cells. Third, we clearly determined promoter methylation as a mechanism for IRF-4 down-regulation via reporter gene assays, but did not detect an association of methylational status and mRNA expression of DNA methyltransferases or methyl-CpG-binding proteins. Together, these data suggest CpG site-specific IRF-4 promoter methylation as a putative mechanism of down-regulated IRF-4 expression in leukemia. PMID:16396836

  13. A Meta-Analysis of the Effects of the 5-Hydroxytryptamine Transporter Gene-Linked Promoter Region Polymorphism on Susceptibility to Lifelong Premature Ejaculation

    PubMed Central

    Wu, Sheng; Shao, Hongbao; Dai, Feng; Peng, Tao; Qin, Feng; Feng, Ninghan

    2013-01-01

    Objective Premature ejaculation (PE) has been reported as the most common male sexual dysfunction with global prevalence rates estimated at approximately 30%. The neurobiogenesis of ejaculation is very complex and involves the serotoninergic (5-hydroxytryptamine, 5-HT) system. Recently, genetic polymorphisms located on SLC6A4 gene codifying for 5-HT transporter (5-HTT), the major regulator of serotonic neurotransmission, have been linked with the pathogenesis and risk of PE. Apparently studies of this type of polymorphism in PE have show conflicting results. Methods A meta-analysis was performed that are available in relation with 5-HTT gene-linked promoter region (5-HTTLPR) polymorphism and the risk of lifelong PE (LPE) in men to clarify this relationship. We searched Pubmed and Embase (last search updated on Aug 2012) using ‘premature ejaculation’, ‘polymorphism or variant’, ‘genotype’, ‘ejaculatory function’, and ‘rapid ejaculation’ as keywords and reference lists of studies corresponded to the inclusion criteria for meta-analysis. These studies involved the total number of 481 LPE men and 466 health control men subjects. Odds ratio (OR) and 95% confidence intervals (CIs) were used to evaluate this relationship. Results In the overall analysis, significant associations between LPE risk and 5-HTTLPR polymorphism were found (L-allele vs. S-allele OR = 0.86, 95% CI = 0.79–0.95, P = 0.002; LL vs. SS: OR = 0.80, 95% CI = 0.68–0.95, P = 0.009; LS vs. SS: OR = 0.85, 95% CI = 0.76–0.97, P = 0.012 and LL+LS vs. SS: OR = 0.88, 95% CI = 0.81–0.95, P = 0.002). Moreover, in subgroup analysis based on ethnicity, similar significant associations were detected. The Egger’s test did not reveal presence of a publication bias. Conclusions Our investigations demonstrate that 5-HTTLPR (L>S) polymorphism might protect men against LPE risk. Further studies based on larger sample size and gene

  14. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  15. Associations between genetic variants in the promoter region of the insulin-like growth factor-1 (IGF1) gene and blood serum IGF1 concentration in Hanwoo cattle.

    PubMed

    Chung, H Y; Choi, Y J; Park, H N; Davis, M E

    2015-01-01

    In this study, we investigated the associations between genetic variants in the promoter region of the insulin-like growth factor-1 (IGF1) gene and blood serum IGF1 concentration in Hanwoo cattle. Polymerase chain reaction primers were based on GenBank accession No. AF404761 and amplified approximately 533-bp segments. Newly identified sequences were submitted to GenBank (accession No. DQ267493). Sequence analysis revealed that genetic variants were located at a nucleotide position 323 for the nucleotide substitution C/A that was first reported in this study and positions 326-349 for a repeat motif (CA10-11). The allele frequencies of g.323C>A were 0.264 (C) and 0.736 (A) without significant deviation from Hardy-Weinberg equilibrium. Frequencies of the repeat motif CA(10) and CA(11) were 0.604 and 0.396, respectively. Statistical analysis revealed that the genetic variation g.323C>A was significantly associated with blood serum IGF1 concentrations with significant additive genetic effects, whereas no associations were found for the repeat motif. IGF1 concentrations were positively (r = 0.453) and negatively (r = -0.445) correlated with weights in the growing stages (16-21 months) and late fattening stages (22-30 months), respectively. The results of the present study and future genotypic data for Hanwoo beef cattle based on the robust genetic variation of IGF1 will provide critical information for genetic improvement and will have a large impact on commercial markets. PMID:25966067

  16. BENZOATE-DEPENDENT INDUCTION FROM THE OP2 OPERATOR-PROMOTER REGION OF THE TOL PWWO IN THE ABSENCE OF KNOWN PLASMID REGULATORY GENES (JOURNAL VERSION)

    EPA Science Inventory

    The OP2 (Pm) operator-promoter region of the TOL plasmid, pWWO, is located immediately upstream from the 'lower' pathway operon responsible for the catabolism of benzoate and related aromatic acids. Induction of the operon in the presence of aromatic acid inducers, requires the x...

  17. Identification of a novel ovine LH-beta promoter region, which dramatically enhances its promoter activity.

    PubMed

    Aherrahrou, Redouane; Aherrahrou, Zouhair; Erdmann, Jeanette; Moumni, Mohieddine

    2015-01-01

    The luteinizing hormone beta subunit (LH-beta) gene plays a critical role in reproduction. In order to characterize and analyze the promoter region of LH-beta in sheep, a genomic library was constructed in phage lambda gt 10 and screened. A novel region of 1,224 bp upstream from the targeted LH-beta gene was identified. Blasting this sequence showed a perfect homology for the first 721 bp sequence with an upstream ovine LH-beta sequence in the database. However, the remaining 5'-503 bp showed no sequence matching. DNA from Moroccan breeds was isolated and the whole region was amplified and confirmed by sequencing. To further confirm the promoter activity of this region, an in vitro analysis using a luciferase assay was carried out. An increase in the promoter activity of the whole region was demonstrated compared to the empty vector. More interestingly, the unpublished region significantly enhanced the promoter activity compared to the known region alone. To predict putative transcription factor binding-sites (TFBSs), an in silico analysis was performed using the TFSEARCH program. The region features many TFBSs and contains two palindrome sequences of 17- and 18-bp. Taken together, a novel region was identified and confirmed in sheep which contained a promoter activity rich with binding sites for a putative regulatory element as shown in silico. PMID:26355566

  18. Characterization of the promoter region of the bovine long-chain acyl-CoA synthetase 1 gene: Roles of E2F1, Sp1, KLF15, and E2F4

    PubMed Central

    Zhao, Zhi-Dong; Zan, Lin-Sen; Li, An-Ning; Cheng, Gong; Li, Shi-Jun; Zhang, Ya-Ran; Wang, Xiao-Yu; Zhang, Ying-Ying

    2016-01-01

    The nutritional value and eating qualities of beef are enhanced when the unsaturated fatty acid content of fat is increased. Long-chain acyl-CoA synthetase 1 (ACSL1) plays key roles in fatty acid transport and degradation, as well as lipid synthesis. It has been identified as a plausible functional and positional candidate gene for manipulations of fatty acid composition in bovine skeletal muscle. In the present study, we determined that bovine ACSL1was highly expressed in subcutaneous adipose tissue and longissimus thoracis. To elucidate the molecular mechanisms involved in bovine ACSL1 regulation, we cloned and characterized the promoter region of ACSL1. Applying 5′-rapid amplification of cDNA end analysis (RACE), we identified multiple transcriptional start sites (TSSs) in its promoter region. Using a series of 5′ deletion promoter plasmids in luciferase reporter assays, we found that the proximal minimal promoter of ACSL1 was located within the region −325/−141 relative to the TSS and it was also located in the predicted CpG island. Mutational analysis and electrophoretic mobility shift assays demonstrated that E2F1, Sp1, KLF15 and E2F4 binding to the promoter region drives ACSL1 transcription. Together these interactions integrate and frame a key functional role for ACSL1 in mediating the lipid composition of beef. PMID:26782942

  19. Molecular organization of the human Raf-1 promoter region.

    PubMed Central

    Beck, T W; Brennscheidt, U; Sithanandam, G; Cleveland, J; Rapp, U R

    1990-01-01

    A genomic DNA fragment containing the Raf-1 promoter region was isolated by using a cDNA extension clone. Nucleotide sequencing of genomic DNA clones, primer extension, and S1 nuclease assays have been used to identify the 5' ends of Raf-1 RNAs. Consistent with its ubiquitous expression, the Raf-1 promoter region had features of a housekeeping gene in that it was GC-rich (HTF-like), lacked TATA and CAAT boxes, and contained heterogeneous RNA start sites and four potential binding sites for the transcription factor SP1. In addition, an octamer motif (ATTTCAT), a potential binding site for the octamer family of transcription factors, was located at -734 base pairs. The Raf-1 promoter region drove reporter gene expression 30-fold over the promoterless reporter in Cos 7 cells. Images PMID:1694010

  20. Nucleosomal promoter variation generates gene expression noise

    PubMed Central

    Brown, Christopher R.; Boeger, Hinrich

    2014-01-01

    Gene product molecule numbers fluctuate over time and between cells, confounding deterministic expectations. The molecular origins of this noise of gene expression remain unknown. Recent EM analysis of single PHO5 gene molecules of yeast indicated that promoter molecules stochastically assume alternative nucleosome configurations at steady state, including the fully nucleosomal and nucleosome-free configuration. Given that distinct configurations are unequally conducive to transcription, the nucleosomal variation of promoter molecules may constitute a source of gene expression noise. This notion, however, implies an untested conjecture, namely that the nucleosomal variation arises de novo or intrinsically (i.e., that it cannot be explained as the result of the promoter’s deterministic response to variation in its molecular surroundings). Here, we show—by microscopically analyzing the nucleosome configurations of two juxtaposed physically linked PHO5 promoter copies—that the configurational variation, indeed, is intrinsically stochastic and thus, a cause of gene expression noise rather than its effect. PMID:25468975

  1. Gene Regions Responding to Skeletal Muscle Atrophy

    NASA Technical Reports Server (NTRS)

    Booth, Frank W.

    1997-01-01

    Our stated specific aims for this project were: 1) Identify the region(s) of the mouse IIb myosin heavy chain (MHC) promoter necessary for in vivo expression in mouse fast-twitch muscle, and 2) Identify the region(s) of the mouse IIb MHC promoter responsive to immobilization in mouse slow-twitch muscle in vivo. We sought to address these specific aims by introducing various MHC IIb promoter/reporter gene constructs directly into the tibialis anterior and gastrocnemius muscles of living mice. Although the method of somatic gene transfer into skeletal muscle by direct injection has been successfully used in our laboratory to study the regulation of the skeletal alpha actin gene in chicken skeletal muscle, we had many difficulties utilizing this procedure in the mouse. Because of the small size of the mouse soleus and the difficulty in obtaining consistent results, we elected not to study this muscle as first proposed. Rather, our MHC IIb promoter deletion experiments were performed in the gastrocnemius. Further, we decided to use hindlimb unloading via tail suspension to induce an upregulation of the MHC IIb gene, rather than immobilization of the hindlimbs via plaster casts. This change was made because tail suspension more closely mimics spaceflight, and this procedure in our lab results in a smaller loss of overall body mass than the mouse hindlimb immobilization procedure. This suggests that the stress level during tail suspension is less than during immobilization. This research has provided an important beginning point towards understanding the molecular regulation of the MHC lIb gene in response to unweighting of skeletal muscle Future work will focus on the regulation of MHC IIb mRNA stability in response to altered loading of skeletal muscle

  2. A leader intron and 115-bp promoter region necessary for expression of the carnation S-adenosylmethionine decarboxylase gene in the pollen of transgenic tobacco.

    PubMed

    Kim, Young Jin; Lee, Sun Hi; Park, Ky Young

    2004-12-17

    The expression of CSDC9 encoding S-adenosylmethionine decarboxylase (SAMDC) is developmentally and spatially regulated in carnation. To examine the regulation of the SAMDC gene, we analyzed the spatial expression of CSDC9 with a 5'-flanking beta-glucuronidase fusion in transgenic tobacco plants. GUS was strongly expressed in flower, pollen, stem and vein of cotyledons. Expression in both anther and stigma was under developmental control; analysis of a series of mutants with deletions of the 5'-flanking region demonstrated differential activation in petal, anther, stigma and pollen grains. All the major cis-regulatory elements required for pollen-specific transcription were located in the upstream region between -273 and -158. This region contains four putative elements related to gibberellin induction (pyrimidine boxes, TTTTTTCC and CCTTTT) and pollen-specific expression (GTGA and AGAAA). In addition, the first 5'-leader intron was necessary for tissue-specific expression. PMID:15589825

  3. Lack of association between rs1800795 (-174 G/C) polymorphism in the promoter region of interleukin-6 gene and susceptibility to type 2 diabetes in Isfahan population

    PubMed Central

    Ghavimi, Reza; Sharifi, Mohammadreza; Mohaghegh, Mohammad Ali; Mohammadian, Hossein; Khadempar, Saedeh; Rezaei, Hamzeh

    2016-01-01

    Background: Type 2 diabetes mellitus (T2DM) is an inflammatory autoimmune disease that mostly affects older adults. The etiology of T2DM includes both genetic and environmental factors. rs1800795 (−174 G/C) single nucleotide polymorphism (SNP) linked with autoimmune disorders predispositions, identified by Genome-Wide Association Study among genes, which immunologically related is considerably over signified. The goal of this study was to evaluate the association between rs1800795 (−174 G/C) polymorphisms in the promoter of interleukin-6 (IL-6) gene with susceptibility to T2DM in a subset of the Iranian population. Materials and Methods: In this case–control study, 120 healthy subjects and 120 patients with T2DM were included. Genomic DNA obtained from whole blood samples and the polymerase chain reaction was used to amplify the fragment of interest contain rs1800795 SNP, restriction fragment length polymorphism method was applied for genotyping of the DNA samples with NlaIII as a restriction enzyme. SPSS for Windows software (version 18.0, SPSS, Chicago, IL, USA) was performed for statistical analysis. Results: No significant differences were found between healthy controls and T2DM patients with respect to the frequency distribution of the cytokine gene polymorphism investigated. Odds ratio, adjusted for sex, age, and smoking status has displayed similar outcomes. Conclusion: These results indicated that the rs1800795 SNP is not a susceptibility gene variant for the development of T2DM in the Isfahan population. Further studies using new data on complex transcriptional interactions between IL-6 polymorphic sites are necessary to determine IL-6 haplotype influence on susceptibility to T2DM. PMID:26962520

  4. Identification of a Novel Rat NR2B Subunit Gene Promoter Region Variant and Its Association with Microwave-Induced Neuron Impairment.

    PubMed

    Wang, Li-Feng; Tian, Da-Wei; Li, Hai-Juan; Gao, Ya-Bing; Wang, Chang-Zhen; Zhao, Li; Zuo, Hong-Yan; Dong, Ji; Qiao, Si-Mo; Zou, Yong; Xiong, Lu; Zhou, Hong-Mei; Yang, Yue-Feng; Peng, Rui-Yun; Hu, Xiang-Jun

    2016-05-01

    Microwave radiation has been implicated in cognitive dysfunction and neuronal injury in animal models and in human investigations; however, the mechanism of these effects is unclear. In this study, single nucleotide polymorphism (SNP) sites in the rat GRIN2B promoter region were screened. The associations of these SNPs with microwave-induced rat brain dysfunction and with rat pheochromocytoma-12 (PC12) cell function were investigated. Wistar rats (n = 160) were exposed to microwave radiation (30 mW/cm(2) for 5 min/day, 5 days/week, over a period of 2 months). Screening of the GRIN2B promoter region revealed a stable C-to-T variant at nucleotide position -217 that was not induced by microwave exposure. The learning and memory ability, amino acid contents in the hippocampus and cerebrospinal fluid, and NR2B expression were then investigated in the different genotypes. Following microwave exposure, NR2B protein expression decreased, while the Glu contents in the hippocampus and CSF increased, and memory impairment was observed in the TT genotype but not the CC and CT genotypes. In PC12 cells, the effects of the T allele were more pronounced than those of the C allele on transcription factor binding ability, transcriptional activity, NR2B mRNA, and protein expression. These effects may be related to the detrimental role of the T allele and the protective role of the C allele in rat brain function and PC12 cells exposed to microwave radiation. PMID:25917873

  5. Identification of a new haplotype within the promoter region of the MSTN gene in horses from five of the most common breeds in Poland.

    PubMed

    Stefaniuk, Monika; Kaczor, Urszula; Augustyn, Romana; Gurgul, Artur; Kulisa, Maria; Podstawski, Zenon

    2014-01-01

    Myostatin (GDF-8) encoded by the MSTN gene is a negative regulator of muscle growth and development and belongs to the TGF-β superfamily of secreted growth and differentiation factors. In Thoroughbred horses, an MSTN sequence polymorphism (g.66493737C>T) is associated with optimum race distance. In the present study, a genetic polymorphism of a predicted promoter of the MSTN gene was investigated in 451 horses belonging to five different breeds: Arabian, Thoroughbred, Polish Konik, Hucul and Polish Heavy Draft. Two SNPs located at g.66495826T>C and g.66495696T>C (chr;18 EquCab 2.0) showed three haplotypes previously described: [g.66495826:T, g.66495696:T], [g.66495826:T, g.66495696:C], [g.66495826:C, g.66495696:T] with frequencies 0.877; 0.101; 0.005; respectively. Analysis performed on Polish Heavy Draft indicated the occurrence of a new haplotype [g.6649582626:C, g.66495696:C] with frequency 0.016. PMID:25403076

  6. Possible consequences of the overlap between the CaMV 35S promoter regions in plant transformation vectors used and the viral gene VI in transgenic plants.

    PubMed

    Podevin, Nancy; du Jardin, Patrick

    2012-01-01

    Multiple variants of the Cauliflower mosaic virus 35S promoter (P35S) are used to drive the expression of transgenes in genetically modified plants, for both research purposes and commercial applications. The genetic organization of the densely packed genome of this virus results in sequence overlap between P35S and viral gene VI, encoding the multifunctional P6 protein. The present paper investigates whether introduction of P35S variants by genetic transformation is likely to result in the expression of functional domains of the P6 protein and in potential impacts in transgenic plants. A bioinformatic analysis was performed to assess the safety for human and animal health of putative translation products of gene VI overlapping P35S. No relevant similarity was identified between the putative peptides and known allergens and toxins, using different databases. From a literature study it became clear that long variants of the P35S do contain an open reading frame, when expressed, might result in unintended phenotypic changes. A flowchart is proposed to evaluate possible unintended effects in plant transformants, based on the DNA sequence actually introduced and on the plant phenotype, taking into account the known effects of ectopically expressed P6 domains in model plants. PMID:22892689

  7. Repetitive Sequence Variations in the Promoter Region of the Adhesin-Encoding Gene sabA of Helicobacter pylori Affect Transcription

    PubMed Central

    Harvey, Vivian C.; Acio, Catherine R.; Bredehoft, Amy K.; Zhu, Laurence; Hallinger, Daniel R.; Quinlivan-Repasi, Vanessa; Harvey, Samuel E.

    2014-01-01

    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract −50 to −33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry −20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection. PMID:25022855

  8. Sequence and regulation of the porcine FSHR gene promoter.

    PubMed

    Wu, Wangjun; Han, Jing; Cao, Rui; Zhang, Jinbi; Li, Bojiang; Liu, Zequn; Liu, Kaiqing; Li, Qifa; Pan, Zengxiang; Chen, Jie; Liu, Honglin

    2015-03-01

    Follicle-stimulating hormone (FSH) plays a crucial role in animal reproduction and exerts its physiological functions by interacting with the FSH receptor (FSHR). The FSHR is exclusively expressed in granulose cells in the ovary and its expression level is closely related to granulose cell differentiation and follicle maturation. In mammal, most of the follicles undergo atresia, while follicle atresia is mainly caused by granulosa cell apoptosis. However, knowledge on the transcriptional regulatory mechanisms of the porcine FSHR gene in granulosa cell is still limited. In this study, approximately 2.1kb of the proximal promoter sequence of the porcine FSHR gene were obtained by genome walking, and the regulatory elements and transcription factors in the porcine FSHR promoter sequence were predicted. Furthermore, the core promoter region (-1195/-598) of the porcine FSHR gene was identified using a luciferase assay. Subsequently, the relationship between expression levels of the porcine FSHR gene and histone H3K9 acetylation levels around the core promoter region (-787/-572) in vivo and invitro were analyzed. Our results showed that an increased FSHR gene expression level was accompanied with an increase in histone H3K9 acetylation levels, suggesting that histone H3K9 acetylation could regulate the expression of the porcine FSHR gene. PMID:25599592

  9. Universal light-switchable gene promoter system

    DOEpatents

    Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

    2005-02-22

    An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

  10. Analysis of the Mycobacterium tuberculosis 85A antigen promoter region.

    PubMed Central

    Kremer, L; Baulard, A; Estaquier, J; Content, J; Capron, A; Locht, C

    1995-01-01

    A mycobacterial expression-secretion vector was constructed in which the Escherichia coli alkaline phosphatase (phoA) reporter gene was placed under the control of the Mycobacterium tuberculosis 85A promoter and secretion signal sequences. In recombinant Mycobacterium smegmatis and Mycobacterium bovis BCG, PhoA activity could readily be detected on the mycobacterial cell surface and in the culture supernatant, indicating that the 85A signals can drive heterologous expression and secretion in both species. In contrast to the mycobacteria, the 85A promoter did not function in E. coli. We mapped the promoter region by progressive deletions using BAL 31 exonuclease and by primer extension analysis. Insertion and deletion mutations within the promoter region indicated that, unlike most E. coli promoters but similar to Streptomyces promoters, the position of the putative -35 region was not critical for efficient promoter activity. In addition, we investigated the ability of the identified signals to drive the production and secretion in BCG of recombinant Schistosoma mansoni glutathione S-transferase (Sm28GST), a protective antigen against schistosomiasis. BALB/c mice immunized with the recombinant BCG by a single dose exhibited a weak but specific T-cell response to Sm28GST. PMID:7836298

  11. Characterization of a barley Rubisco activase gene promoter

    SciTech Connect

    Strickland, J.A.; Rundle, S.J.; Zielinski, R. )

    1990-05-01

    Barley Rubisco Activase (Rca) is a nuclear encoded chloroplast enzyme that activates Rubisco to catalytic competence. Rca mRNA accumulation in barley is light-regulated; the 5{prime}-flanking region of a highly expressed barley Rca gene (HvRca-1) contains several sequence motifs similar to those found in the promoter of other light-regulated, nuclear genes. We have characterized the cis-acting regulatory regions of HvRca-1 by deletion analysis of the 5{prime} flanking region of a cloned gene. These constructs have been assayed in vitro by gel mobility shift assays, as well as by DNA footprinting. Putative regulatory sequences detected in vitro have also been tested in vivo by constructing chimeric genes consisting of deletion mutant promoters fused to a promoterless {beta}-glucuronidase reporter gene. Comparison of results obtained from complimentary parallel in vitro and in vivo assays of identical promoter deletions have provided information on cis-acting regulatory regions of HvRca-1.

  12. [Modifications of gene expression by tumor promoters].

    PubMed

    Zhang, C; Zhao, Q; Guo, S; Zhao, M; Cheng, S

    1995-02-01

    The modifications of gene expression by tumor promoters were analyzed in vitro and in vivo. The results of slot blot hybridizations showed that tumor promoter TPA induced c-fos and c-myc expressions in mouse fibroblast cell line BALB/3T3 and rat liver, decreased the levels of Rb RNA in BALB/3T3 cell line and of alpha 1-I3 RNA in rat liver. It was also demonstrated that tumor promoter phenobarbital influenced c-fos and c-myc expressions and decreased alpha 1I3 mRNA level in rat liver during a long term experiment. Phenobarbital was found to have no effect on c-fos and c-myc expressions in rat liver during a short experiment. Tumor promoters induced the expressions of c-fos and c-myc which were positively-related to cancer formation and inhibited the expressions of Rb and alpha 1-I3 which were negatively-related to cancer formation. This implied that tumor promotion played an important role in cancer development and tumor promoters exerted their effects selectively according to the attributes of different genes. PMID:7540119

  13. Promoter region of the bovine growth hormone receptor gene: single nucleotide polymorphism discovery in cattle and association with performance in Brangus bulls.

    PubMed

    Garrett, A J; Rincon, G; Medrano, J F; Elzo, M A; Silver, G A; Thomas, M G

    2008-12-01

    Expression of the GH receptor (GHR) gene and its binding with GH is essential for growth and fat metabolism. A GT microsatellite exists in the promoter of bovine GHR segregating short (11 bp) and long (16 to 20 bp) allele sequences. To detect SNP and complete an association study of genotype to phenotype, we resequenced a 1,195-bp fragment of DNA including the GT microsatellite and exon 1A. Resequencing was completed in 48 familialy unrelated Holstein, Jersey, Brown Swiss, Simmental, Angus, Brahman, and Brangus cattle. Nine SNP were identified. Phylogeny analyses revealed minor distance (i.e., <5%) in DNA sequence among the 5 Bos taurus breeds; however, sequence from Brahman cattle averaged 27.4 +/- 0.07% divergence from the Bos taurus breeds, whereas divergence of Brangus was intermediate. An association study of genotype to phenotype was completed with data from growing Brangus bulls (n = 553 from 96 sires) and data from 4 of the SNP flanking the GT microsatellite. These SNP were found to be in Hardy-Weinberg equilibrium and in phase based on linkage disequilibrium analyses (r(2) = 0.84 and D'= 0.92). An A/G tag SNP was identified (ss86273136) and was located in exon 1A, which began 88 bp downstream from the GT microsatellite. Minor allele frequency of the tag SNP was greater than 10%, and Mendelian segregation was verified in 3 generation pedigrees. The A allele was derived from Brahman, and the G allele was derived from Angus. This tag SNP genotype was a significant effect in analyses of rib fat data collected with ultrasound when bulls were ~365 d of age. Specifically, bulls of the GG genotype had 6.1% more (P = 0.0204) rib fat than bulls of the AA and AG genotypes, respectively. Tag SNP (ss86273136), located in the promoter of GHR, appears to be associated with a measure of corporal fat in Bos taurus x Bos indicus composite cattle. PMID:18676722

  14. Cloning of a marine cyanobacterial promoter for foreign gene expression using a promoter probe vector

    SciTech Connect

    Sode, Koji; Hatano, Naoaki; Tatara, Masahiro

    1996-06-01

    A marine cyanobacterial promoter was cloned to allow efficient foreign gene expression. This was carried out using chloramphenicol acetyl transferase (CAT) as a marker protein. For rapid and simple measurement of CAT activity, a method based on a fluorescently labeled substrate was improved by utilizing HPLC equipped with a flow-through fluorescent spectrophotometer. This method was used in conjunction with a newly constructed promoter probe vector. Cyanobacterial transformants, harboring plasmid containing a cloned 2-kbp marine cyanobacterial genomic fragment, showed a 10-fold higher CAT activity, compared with that achieved using the kanamycin-resistant gene promoter. From the sequence analysis of the cloned fragment, a putative promoter region was found. 20 refs., 7 figs., 2 tabs.

  15. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    SciTech Connect

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona; and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  16. Promoter polymorphism T-786C, 894G→T at exon 7 of endothelial nitric oxide synthase gene are associated with risk of osteoporosis in Sichuan region male residents

    PubMed Central

    Gu, Zuchao; Zhang, Yu; Qiu, Guixing

    2015-01-01

    Objective: To investigate the association between genetic polymorphism of T-786C in promoter region, 894G→T at exon 7 of endothelial nitric oxide synthase (eNOS) gene and osteoporosis (OP) disease. Method: The genotypes of 350 patients with osteoporosis and 350 healthy controls were detected by polymerase chain reaction (PCR) and DNA sequencing. The allele ratios and genotype distributions in the patients and controls were assessed using the Pearson χ2-test. Odds ratios (OR) with two tailed P-values and 95% confidence intervals (CI) were calculated as a measure of the association of the eNOS genotypes with OP. Result: the C allele distribution frequency of T-786C eNOS gene in OP group (8.5%) was significantly higher than that in control group (3.9%), relative risk (OR) of OP associated with the CC genotype was 2.68 (95% CI, 0.92 to 1.37). The T allele frequency of 894G→T at exon 7 in eNOS gene in OP group (11.5%) was also significantly higher than that in control group (5.2%), OR of OP associated with the TT genotype was 2.60 (all P<0.05). Conclusion: The analysis results indicated that both T-786C in promoter region and 894G→T at exon 7 of eNOS gene might be genetic predisposal factors of OP, these polymorphisms may be independently or synergic with other loci to have an impact on the incidence of OP. PMID:26823879

  17. In vitro mapping of Myotonic Dystrophy (DM) gene promoter

    SciTech Connect

    Storbeck, C.J.; Sabourin, L.; Baird, S.

    1994-09-01

    The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMK only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.

  18. Pseudomonas aeruginosa lasI/rhlI quorum sensing genes promote phagocytosis and aquaporin 9 redistribution to the leading and trailing regions in macrophages

    PubMed Central

    Holm, Angelika; Karlsson, Thommie; Vikström, Elena

    2015-01-01

    Pseudomonas aeruginosa controls production of its multiple virulence factors and biofilm development via the quorum sensing (QS) system. QS signals also interact with and affect the behavior of eukaryotic cells. Host water homeostasis and aquaporins (AQP) are essential during pathological conditions since they interfere with the cell cytoskeleton and signaling, and hereby affect cell morphology and functions. We investigated the contribution of P. aeruginosa QS genes lasI/rhlI to phagocytosis, cell morphology, AQP9 expression, and distribution in human macrophages, using immunoblotting, confocal, and nanoscale imaging. Wild type P. aeruginosa with a functional QS system was a more attractive prey for macrophages than the lasI/rhlI mutant lacking the production of QS molecules, 3O-C12-HSL, and C4-HSL, and associated virulence factors. The P. aeruginosa infections resulted in elevated AQP9 expression and relocalization to the leading and trailing regions in macrophages, increased cell area and length; bacteria with a functional QS system lasI/rhlI achieved stronger responses. We present evidence for a new role of water fluxes via AQP9 during bacteria–macrophage interaction and for the QS system as an important stimulus in this process. These novel events in the interplay between P. aeruginosa and macrophages may influence on the outcome of infection, inflammation, and development of disease. PMID:26388857

  19. A single nucleotide polymorphism in the promoter region of river buffalo stearoyl CoA desaturase gene (SCD) is associated with milk yield.

    PubMed

    Pauciullo, Alfredo; Cosenza, Gianfranco; Steri, Roberto; Coletta, Angelo; La Battaglia, Antonio; Di Berardino, Dino; Macciotta, Nicolò P P; Ramunno, Luigi

    2012-11-01

    An association study between the milk yield trait and the stearoyl-CoA desaturase (SCD) polymorphism (g.133A > C) in Italian Mediterranean river buffalo was carried out. A full characterization of the river buffalo SCD promoter region was presented. Genotyping information was provided and a quick method for allelic discrimination was developed. The frequency of the C allele was 0·16. Test-day (TD) records (43 510) of milk production belonging to 226 lactations of 169 buffalo cows were analysed with a mixed linear model in order to estimate the effect of g.133A > C genotype, as well as the effect of parity and calving season. The SCD genotype was significantly associated with milk yield (P = 0·02). The genotype AC showed an over-dominance effect with an average daily milk yield approximately 2 kg/d higher than CC buffaloes. Such a difference represents about 28% more milk/d. The effect of the genotype was constant across lactation stages. The contribution of SCD genotype (r(2)SCD) to the total phenotypic variance in milk yield was equal to 0·12. This report is among the first indications of genetic association between a trait of economic importance in river buffalo. Although such results need to be confirmed with large-scale studies in the same and other buffalo populations, they might offer useful indications for the application of MAS programmes in river buffalo and in the future they might be of great economic interest for the river buffalo dairy industry. PMID:22994977

  20. Recurrent epimutations activate gene body promoters in primary glioblastoma.

    PubMed

    Nagarajan, Raman P; Zhang, Bo; Bell, Robert J A; Johnson, Brett E; Olshen, Adam B; Sundaram, Vasavi; Li, Daofeng; Graham, Ashley E; Diaz, Aaron; Fouse, Shaun D; Smirnov, Ivan; Song, Jun; Paris, Pamela L; Wang, Ting; Costello, Joseph F

    2014-05-01

    Aberrant DNA hypomethylation may play an important role in the growth rate of glioblastoma (GBM), but the functional impact on transcription remains poorly understood. We assayed the GBM methylome with MeDIP-seq and MRE-seq, adjusting for copy number differences, in a small set of non-glioma CpG island methylator phenotype (non-G-CIMP) primary tumors. Recurrent hypomethylated loci were enriched within a region of chromosome 5p15 that is specified as a cancer amplicon and also encompasses TERT, encoding telomerase reverse transcriptase, which plays a critical role in tumorigenesis. Overall, 76 gene body promoters were recurrently hypomethylated, including TERT and the oncogenes GLI3 and TP73. Recurring hypomethylation also affected previously unannotated alternative promoters, and luciferase reporter assays for three of four of these promoters confirmed strong promoter activity in GBM cells. Histone H3 lysine 4 trimethylation (H3K4me3) ChIP-seq on tissue from the GBMs uncovered peaks that coincide precisely with tumor-specific decrease of DNA methylation at 200 loci, 133 of which are in gene bodies. Detailed investigation of TP73 and TERT gene body hypomethylation demonstrated increased expression of corresponding alternate transcripts, which in TP73 encodes a truncated p73 protein with oncogenic function and in TERT encodes a putative reverse transcriptase-null protein. Our findings suggest that recurring gene body promoter hypomethylation events, along with histone H3K4 trimethylation, alter the transcriptional landscape of GBM through the activation of a limited number of normally silenced promoters within gene bodies, in at least one case leading to expression of an oncogenic protein. PMID:24709822

  1. Characterization of the human 5-lipoxygenase gene promoter

    SciTech Connect

    Hoshiko, S.; Radmark, O.; Samuelsson, B. )

    1990-12-01

    Nucleotide sequences that direct transcription of the human 5-lipoxygenase gene have been examined by ligation to the chloramphenicol acetyltransferase activity in transfected HeLa and HL-60 cells. Various lengths of 5{prime}-flanking sequences up to 5.9 kilobase pairs 5{prime} of the transcriptional initiation sites were tested. Two positive and two negative apparent regulatory regions were seen. Part of the promoter sequence ({minus}179 to {minus}56 from ATG), which includes five repeated GC boxes (the putative Spl binding sequence) was essential for transcription in both HeLa and HL-60 cells. Gel-shift assays (using the DNA fragment {minus}212 to {minus}88) revealed that the transcriptional factor Spl could bind to this region of the 5-lipoxygenase promoter. Furthermore, HL-60 nuclear extracts contained specific nuclear factor(s) binding to 5-lipoxygenase promoter DNA, which could not be detected in HeLa cell nuclear extracts.

  2. The long-range interaction landscape of gene promoters.

    PubMed

    Sanyal, Amartya; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2012-09-01

    The vast non-coding portion of the human genome is full of functional elements and disease-causing regulatory variants. The principles defining the relationships between these elements and distal target genes remain unknown. Promoters and distal elements can engage in looping interactions that have been implicated in gene regulation. Here we have applied chromosome conformation capture carbon copy (5C) to interrogate comprehensively interactions between transcription start sites (TSSs) and distal elements in 1% of the human genome representing the ENCODE pilot project regions. 5C maps were generated for GM12878, K562 and HeLa-S3 cells and results were integrated with data from the ENCODE consortium. In each cell line we discovered >1,000 long-range interactions between promoters and distal sites that include elements resembling enhancers, promoters and CTCF-bound sites. We observed significant correlations between gene expression, promoter-enhancer interactions and the presence of enhancer RNAs. Long-range interactions show marked asymmetry with a bias for interactions with elements located ∼120 kilobases upstream of the TSS. Long-range interactions are often not blocked by sites bound by CTCF and cohesin, indicating that many of these sites do not demarcate physically insulated gene domains. Furthermore, only ∼7% of looping interactions are with the nearest gene, indicating that genomic proximity is not a simple predictor for long-range interactions. Finally, promoters and distal elements are engaged in multiple long-range interactions to form complex networks. Our results start to place genes and regulatory elements in three-dimensional context, revealing their functional relationships. PMID:22955621

  3. Isolation of the promoters of Atlantic salmon MHCII genes.

    PubMed

    Syed, Mohasina; Vestrheim, Olav; Mikkelsen, Birthe; Lundin, Maria

    2003-01-01

    The major histocompatibility complex class II (MHCII) has a central role in the immune response of vertebrates with its function of presenting antigenic peptides to the T-cell receptors. We have isolated the promoters and intron 1 of MHCIIalpha and MHCIIbeta genes of Atlantic salmon. To isolate these promoters, we constructed an Atlantic salmon ( Salmo salar) promoter finder kit (analogous to the commercially available "human promoter finder kit"). By nucleotide sequence alignment of known MHCII promoter regions, we identified the 3 conserved regulatory X, X2, and Y boxes in the salmon promoters. The W box was not found. In contrast, a salmon-specific putative W box was identified. Both of the isolated Atlantic salmon MHCIIalpha and beta promoters (included in patent applications by Genomar A/S, Oslo, Norway) were found to be functional since they both gave positive yellow fluorescence protein signal when inserted as promoters in the pEYFP-1 reporter plasmid and transfected into the salmon head kidney cell line (SHK-1). PMID:14502397

  4. Identification of polymorphisms in the promoter region of the bovine heat shock protein gene and associations with bull calf weaning weight

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our objective was to evaluate the relationship between genotypic variation of the bovine HSP-70 promoter and bull calf weaning weights and serum concentrations of HSP-70 at weaning. Blood samples were collected from 33 crossbred bull calves. Calves were sired by Angus bulls and had Brahman-cross dam...

  5. Characterization of the Promoter Region of an Arabidopsis Gene for 9-cis-Epoxycarotenoid Dioxygenase Involved in Dehydration-Inducible Transcription

    PubMed Central

    Behnam, Babak; Iuchi, Satoshi; Fujita, Miki; Fujita, Yasunari; Takasaki, Hironori; Osakabe, Yuriko; Yamaguchi-Shinozaki, Kazuko; Kobayashi, Masatomo; Shinozaki, Kazuo

    2013-01-01

    Plants respond to dehydration stress and tolerate water-deficit status through complex physiological and cellular processes. Many genes are induced by water deficit. Abscisic acid (ABA) plays important roles in tolerance to dehydration stress by inducing many stress genes. ABA is synthesized de novo in response to dehydration. Most of the genes involved in ABA biosynthesis have been identified, and they are expressed mainly in leaf vascular tissues. Of the products of such genes, 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in ABA biosynthesis. One of the five NCED genes in Arabidopsis, AtNCED3, is significantly induced by dehydration. To understand the regulatory mechanism of the early stages of the dehydration stress response, it is important to analyse the transcriptional regulatory systems of AtNCED3. In the present study, we found that an overlapping G-box recognition sequence (5′-CACGTG-3′) at −2248 bp from the transcriptional start site of AtNCED3 is an important cis-acting element in the induction of the dehydration response. We discuss the possible transcriptional regulatory system of dehydration-responsive AtNCED3 expression, and how this may control the level of ABA under water-deficit conditions. PMID:23604098

  6. ABERRANT PROMOTER METHYLATION OF MULTIPLE GENES IN SPUTUM FROM INDIVIDUALS EXPOSED TO SMOKY COAL EMISSIONS

    EPA Science Inventory

    Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung canc...

  7. Conditional promoters for analysis of essential genes in Zymoseptoria tritici.

    PubMed

    Kilaru, S; Ma, W; Schuster, M; Courbot, M; Steinberg, G

    2015-06-01

    Development of new fungicides, needed for sustainable control of fungal plant pathogens, requires identification of novel anti-fungal targets. Essential fungal-specific proteins are good candidates, but due to their importance, gene deletion mutants are not viable. Consequently, their cellular role often remains elusive. This hindrance can be overcome by the use of conditional mutants, where expression is controlled by an inducible/repressible promoter. Here, we introduce 5 inducible/repressible promoter systems to study essential genes in the wheat pathogen Zymoseptoria tritici. We fused the gene for enhanced green-fluorescent protein (egfp) to the promoter region of Z. tritici nitrate reductase (Pnar1; induced by nitrogen and repressed by ammonium), 1,4-β-endoxylanase A (Pex1A; induced by xylose and repressed by maltodextrin), l-arabinofuranosidase B (PlaraB; induced by arabinose and repressed by glucose), galactose-1-phosphate uridylyltransferase 7 (Pgal7; induced by galactose and repressed by glucose) and isocitrate lyase (Picl1; induced by sodium acetate and repressed by glucose). This was followed by quantitative analysis of cytoplasmic reporter fluorescence under induced and repressed conditions. We show that Pnar1, PlaraB and Pex1A drive very little or no egfp expression when repressed, but induce moderate protein production when induced. In contrast, Pgal7 and Picl1 show considerable egfp expression when repressed, and were strongly induced in the presence of their inducers. Normalising the expression levels of all promoters to that of the α-tubulin promoter Ptub2 revealed that PlaraB was the weakest promoter (∼20% of Ptub2), whereas Picl1 strongly expressed the reporter (∼250% of Ptub2). The use of these tools promises a better understanding of essential genes, which will help developing novel control strategies that protect wheat from Z. tritici. PMID:26092803

  8. Single nucleotide polymorphisms in cytokine MIF gene promoter region are closely associated with human susceptibility to tuberculosis in a southwestern province of China.

    PubMed

    Liu, Aihua; Li, Jing; Bao, Fukai; Zhu, Ziwei; Feng, Shi; Yang, Jiaru; Wang, Lin; Shi, Mei; Wen, Xia; Zhao, Hua; Voravuthikunchai, Supayang P

    2016-04-01

    The gene encoding macrophage migration inhibitory factor (MIF) has been proposed as candidate tuberculosis (TB) susceptibility gene. In order to elucidate whether MIF gene variants are associated with susceptibility to retreatment cases of TB, and prevent drug-resistant TB prevalence, we conducted a study based on paired human population data. MIF -173 G/C single nucleotide polymorphisms (rs755622) were genotyped using polymerase chain reaction-restriction fragment length polymorphism. MIF levels were detected with enzyme-linked immunosorbent assay. Association analysis of polymorphism to TB showed that distribution of MIF -173 genotypes (GC+CC) was significantly higher in total cases of TB than in the controls. Statistically significant differences of frequencies for MIF -173 (GG vs. GC+CC) were demonstrated when comparing total cases of TB, new cases of TB, and retreatment cases of TB to controls, respectively. In contrast, the frequencies of MIF -173 (GG vs. GC+CC) demonstrated no difference between new cases of TB and retreatment cases of TB. Association analysis of MIF protein concentrations to TB indicated that MIF concentration is significantly higher in total cases of TB, new cases of TB, and retreatment cases of TB than in controls (P<0.01). In summary, our results demonstrated that MIF gene -173 G/C single nucleotide polymorphisms implicate in genetic susceptibility to TB, and GC+CC of MIF -173 site increases the risk of TB. We also found that no correlation between -173 G/C single nucleotide polymorphism and retreatment cases of TB in Yunnan Province population of China. PMID:26656832

  9. S1-hypersensitive sites in eukaryotic promoter regions.

    PubMed Central

    Evans, T; Schon, E; Gora-Maslak, G; Patterson, J; Efstratiadis, A

    1984-01-01

    We have examined by fine mapping the S1 nuclease-hypersensitivity of the 5' flanking regions of the human beta-globin and rat preproinsulin II genes and of the SV40 origin/enhancer region. In all cases S1-hypersensitive sites are located in known or presumed promoter/regulatory regions. Though a consensus DNA sequence is not evident, all of these sites reside in predominantly homopurine-homopyrimidine stretches. The alternate (non-B) DNA structure which is revealed by the enzymatic probe is a sequence-dependent feature of a short stretch of DNA, which is retained upon transplantation into a foreign environment. The alternate structure exhibits S1-nicking patterns uniquely different from those associated with the presence of Z-DNA. Images PMID:6095186

  10. A Further Analysis of the Relationship between Yellow Ripe-Fruit Color and the Capsanthin-Capsorubin Synthase Gene in Pepper (Capsicum sp.) Indicated a New Mutant Variant in C. annuum and a Tandem Repeat Structure in Promoter Region

    PubMed Central

    Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui

    2013-01-01

    Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production. PMID:23637942

  11. Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promoter region of the rRNA gene from Tetrahymena pyriformis.

    PubMed Central

    Andersen, A H; Gocke, E; Bonven, B J; Nielsen, O F; Westergaard, O

    1985-01-01

    Topoisomerase I is in situ associated with DNaseI hypersensitive sites located in the promotor and terminator regions of the extrachromosomal rDNA in Tetrahymena thermophila at sites with sequences fitting the motif (sequence in text) Reconstitution experiments with purified topoisomerase I and cloned fragments of rDNA demonstrate that the enzyme exhibits the same binding and cleavage properties on naked DNA. These observations are striking as topoisomerase I previously has been found to exhibit low sequence specificity. The specific binding of the enzyme has an absolute requirement for divalent cations with a preference for Ca2+. The strong binding to the hexadecamer has been characterized by competition experiments, and it has been used to determine the molecular weight of the enzyme. Images PMID:2987828

  12. Association of APOA5 Gene Promoter Region -1131T>C Polymorphism (rs662799) to Plasma Triglyceride Level in Patients with Type 2 Diabetic Nephropathy

    PubMed Central

    Mahrooz, Abdolkarim; Ansari, Vahid; Makhlough, Atieh; Hashemi-Sooteh, Mohammad-Bagher

    2016-01-01

    Introduction Diabetic Nephropathy (DN), a serious complication of Type 2 Diabetic Mellitus (T2DM), is progressive and susceptibility to DN varies among T2DM patients. ApoA5-1131T>C polymorphism revealed that is strongly associated with triglyceride levels and proposed as a predisposing factor for DN. Aim The purpose of this study was to investigate the association -1131T>C ApoA5 gene polymorphism with serum lipids levels in Type 2 diabetic (DM) patients with or without DN in north of Iran (Mazandaran province). Materials and Methods This study comprised patients with established T2DM (n=161) and controls (n=58). Genotyping of APOA5 -1131T>C polymorphisms was performed by PCR–RFLP. Diabetic patients were divided into two groups: with nephropathy (DN+, n = 90) and without nephropathy (DN-, n = 71). Lipids and lipoproteins were assessed by enzymatic methods. Results The genotype frequencies were 63.8 % TT, 31 % TC, 5.2 % CC in controls, 33.8% TT, 52.1 % TC, 14.1 % CC in DN- and 44.4 % TT, 36.7 % TC, 18.9 % CC in DN+ patients. The TC genotype and the CC genotype were overexpressed among DN+ and DN-population in comparison to the control group. The highest and the lowest TG levels in both diabetic patients and controls belonged to CC+TC and TT genotypes, respectively. Furthermore in both patients TG increased with this order: TT< TCC polymorphisms influence lipid levels in type 2 diabetic patients. PMID:27437205

  13. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.

    PubMed

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan

    2010-09-30

    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco. PMID:20123048

  14. Variants on the promoter region of PTEN affect breast cancer progression and patient survival

    PubMed Central

    2011-01-01

    Introduction The PTEN gene, a regulator of the phosphatidylinositol-3-kinase (PI3K)/Akt oncogenic pathway, is mutated in various cancers and its expression has been associated with tumor progression in a dose-dependent fashion. We investigated the effect of germline variation in the promoter region of the PTEN gene on clinical characteristics and survival in breast cancer. Methods We screened the promoter region of the PTEN gene for germline variation in 330 familial breast cancer cases and further determined the genotypes of three detected PTEN promoter polymorphisms -903GA, -975GC, and -1026CA in a total of 2,412 breast cancer patients to evaluate the effects of the variants on tumor characteristics and disease outcome. We compared the gene expression profiles in breast cancers of 10 variant carriers and 10 matched non-carriers and performed further survival analyses based on the differentially expressed genes. Results All three promoter variants associated with worse prognosis. The Cox's regression hazard ratio for 10-year breast cancer specific survival in multivariate analysis was 2.01 (95% CI 1.17 to 3.46) P = 0.0119, and for 5-year breast cancer death or distant metastasis free survival 1.79 (95% CI 1.03 to 3.11) P = 0.0381 for the variant carriers, indicating PTEN promoter variants as an independent prognostic factor. The breast tumors from the promoter variant carriers exhibited a similar gene expression signature of 160 differentially expressed genes compared to matched non-carrier tumors. The signature further stratified patients into two groups with different recurrence free survival in independent breast cancer gene expression data sets. Conclusions Inherited variation in the PTEN promoter region affects the tumor progression and gene expression profile in breast cancer. Further studies are warranted to establish PTEN promoter variants as clinical markers for prognosis in breast cancer. PMID:22171747

  15. Analysis of developmentally regulated chorion gene promoter architecture via electroporation of silk moth follicles.

    PubMed

    Tsatsarounos, S P; Rodakis, G C; Lecanidou, R

    2015-02-01

    In the silk moth Bombyx mori, chorion genes of the same developmental specificity are organized in divergently transcribed α/β gene pairs, sharing a common 5' flanking promoter region. This bidirectional promoter contains a complete set of cis-elements responsible for developmentally accurate gene expression. In the present paper, based on the observation that Bombyx chorion gene promoters contain cis-elements for the same transcription factors without concrete evidence on which of them are essential, we address the question as to how promoter architecture (number, orientation and position of common factor binding sites) facilitates developmentally accurate chorion gene regulation. To this end, we constructed several mutated promoter regions of an early-middle gene pair and cloned them upstream of a reporter gene to introduce these plasmid constructs into silk moth follicle epithelial cells via electroporation as an efficient and quick method for transient expression. This is the first time that an ex vivo method had been applied to test the impact of systematic cis-element mutations on a chorion gene promoter. Our results confirmed the importance of the HMGA factor and the role of the GATA factor as an early repressor, and led to a more detailed understanding of which C/EBP sites participate in the regulation of early-middle chorion gene expression. PMID:25256090

  16. MnTE-2-PyP reduces prostate cancer growth and metastasis by suppressing p300 activity and p300/HIF-1/CREB binding to the promoter region of the PAI-1 gene.

    PubMed

    Tong, Qiang; Weaver, Michael R; Kosmacek, Elizabeth A; O'Connor, Brian P; Harmacek, Laura; Venkataraman, Sujatha; Oberley-Deegan, Rebecca E

    2016-05-01

    To improve radiation therapy-induced quality of life impairments for prostate cancer patients, the development of radio-protectors is needed. Our previous work has demonstrated that MnTE-2-PyP significantly protects urogenital tissues from radiation-induced damage. So, in order for MnTE-2-PyP to be used clinically as a radio-protector, it is fully necessary to explore the effect of MnTE-2-PyP on human prostate cancer progression. MnTE-2-PyP inhibited prostate cancer growth in the presence and absence of radiation and also inhibited prostate cancer migration and invasion. MnTE-2-PyP altered p300 DNA binding, which resulted in the inhibition of HIF-1β and CREB signaling pathways. Accordingly, we also found that MnTE-2-PyP reduced the expression of three genes regulated by HIF-1β and/or CREB: TGF-β2, FGF-1 and PAI-1. Specifically, MnTE-2-PyP decreased p300 complex binding to a specific HRE motif within the PAI-1 gene promoter region, suppressed H3K9 acetylation, and consequently, repressed PAI-1 expression. Mechanistically, less p300 transcriptional complex binding is not due to the reduction of binding between p300 and HIF-1/CREB transcription factors, but through inhibiting the binding of HIF-1/CREB transcription factors to DNA. Our data provide an in depth mechanism by which MnTE-2-PyP reduces prostate cancer growth and metastasis, which validates the clinical use of MnTE-2-PyP as a radio-protector to enhance treatment outcomes in prostate cancer radiotherapy. PMID:26944191

  17. Downregulation of miR-320a/383-sponge-like long non-coding RNA NLC1-C (narcolepsy candidate-region 1 genes) is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation

    PubMed Central

    Lü, M; Tian, H; Cao, Y-x; He, X; Chen, L; Song, X; Ping, P; Huang, H; Sun, F

    2015-01-01

    Long non-coding RNAs (lncRNAs), which are extensively transcribed from the genome, have been proposed to be key regulators of diverse biological processes. However, little is known about the role of lncRNAs in regulating spermatogenesis in human males. Here, using microarray technology, we show altered expression of lncRNAs in the testes of infertile men with maturation arrest (MA) or hypospermatogenesis (Hypo), with 757 and 2370 differentially down-regulated and 475 and 163 up-regulated lncRNAs in MA and Hypo, respectively. These findings were confirmed by quantitative real-time PCR (qRT-PCR) assays on select lncRNAs, including HOTTIP, imsrna320, imsrna292 and NLC1-C (narcolepsy candidate-region 1 genes). Interestingly, NLC1-C, also known as long intergenic non-protein-coding RNA162 (LINC00162), was down-regulated in the cytoplasm and accumulated in the nucleus of spermatogonia and primary spermatocytes in the testes of infertile men with mixed patterns of MA compared with normal control. The accumulation of NLC1-C in the nucleus repressed miR-320a and miR-383 transcript and promoted testicular embryonal carcinoma cell proliferation by binding to Nucleolin. Here, we define a novel mechanism by which lncRNAs modulate miRNA expression at the transcriptional level by binding to RNA-binding proteins to regulate human spermatogenesis. PMID:26539909

  18. Downregulation of miR-320a/383-sponge-like long non-coding RNA NLC1-C (narcolepsy candidate-region 1 genes) is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation.

    PubMed

    Lü, M; Tian, H; Cao, Y-X; He, X; Chen, L; Song, X; Ping, P; Huang, H; Sun, F

    2015-01-01

    Long non-coding RNAs (lncRNAs), which are extensively transcribed from the genome, have been proposed to be key regulators of diverse biological processes. However, little is known about the role of lncRNAs in regulating spermatogenesis in human males. Here, using microarray technology, we show altered expression of lncRNAs in the testes of infertile men with maturation arrest (MA) or hypospermatogenesis (Hypo), with 757 and 2370 differentially down-regulated and 475 and 163 up-regulated lncRNAs in MA and Hypo, respectively. These findings were confirmed by quantitative real-time PCR (qRT-PCR) assays on select lncRNAs, including HOTTIP, imsrna320, imsrna292 and NLC1-C (narcolepsy candidate-region 1 genes). Interestingly, NLC1-C, also known as long intergenic non-protein-coding RNA162 (LINC00162), was down-regulated in the cytoplasm and accumulated in the nucleus of spermatogonia and primary spermatocytes in the testes of infertile men with mixed patterns of MA compared with normal control. The accumulation of NLC1-C in the nucleus repressed miR-320a and miR-383 transcript and promoted testicular embryonal carcinoma cell proliferation by binding to Nucleolin. Here, we define a novel mechanism by which lncRNAs modulate miRNA expression at the transcriptional level by binding to RNA-binding proteins to regulate human spermatogenesis. PMID:26539909

  19. Identification of potential regulatory motifs in odorant receptor genes by analysis of promoter sequences

    PubMed Central

    Michaloski, Jussara S.; Galante, Pedro A.F.

    2006-01-01

    Mouse odorant receptors (ORs) are encoded by >1000 genes dispersed throughout the genome. Each olfactory neuron expresses one single OR gene, while the rest of the genes remain silent. The mechanisms underlying OR gene expression are poorly understood. Here, we investigated if OR genes share common cis-regulatory sequences in their promoter regions. We carried out a comprehensive analysis in which the upstream regions of a large number of OR genes were compared. First, using RLM-RACE, we generated cDNAs containing the complete 5′-untranslated regions (5′-UTRs) for a total number of 198 mouse OR genes. Then, we aligned these cDNA sequences to the mouse genome so that the 5′ structure and transcription start sites (TSSs) of the OR genes could be precisely determined. Sequences upstream of the TSSs were retrieved and browsed for common elements. We found DNA sequence motifs that are overrepresented in the promoter regions of the OR genes. Most motifs resemble O/E-like sites and are preferentially localized within 200 bp upstream of the TSSs. Finally, we show that these motifs specifically interact with proteins extracted from nuclei prepared from the olfactory epithelium, but not from brain or liver. Our results show that the OR genes share common promoter elements. The present strategy should provide information on the role played by cis-regulatory sequences in OR gene regulation. PMID:16902085

  20. Characterization of tissue-specific transcription by the human synapsin I gene promoter

    SciTech Connect

    Thiel, G. Univ. of Texas, Dallas ); Greengard, P. ); Suedhof, T.C. )

    1991-04-15

    Synapsin Ia and synapsin Ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. To identify control elements directing the neuronal expression of synapsins Ia/b, the authors functionally analyzed the promoter region of the human synapsin I gene. A hybrid gene was constructed containing 2 kilobases of 5{prime} flanking sequence from the synapsin I gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and nonneuronal cell lines. In general, expression of the chimeric reporter gene showed excellent correlation with endogenous expression of synapsin I in different neuronal cell lines, whereas transcription was low in all nonneuronal cell lines examined. The addition of the simian virus 40 enhancer promoted non-tissue-specific expression. Deletion mutagenesis of the synapsin I promoter revealed the presence of positive and negative sequence elements. A basal (constitutive) promoter that directs reporter gene expression in neuronal and nonneuronal cell lines was mapped to the region {minus}115 to +47. The promoter region from {minus}422 to {minus}22 contains positive elements that upon fusion with the herpes simplex virus thymidine kinase promoter potentiate its transcription in PC12 and neuroblastoma cells but not in Chinese hamster ovary cells.

  1. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    NASA Astrophysics Data System (ADS)

    Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  2. Promoter Region Hypermethylation and mRNA Expression of MGMT and p16 Genes in Tissue and Blood Samples of Human Premalignant Oral Lesions and Oral Squamous Cell Carcinoma

    PubMed Central

    Bhatia, Vikram; Makker, Annu; Tewari, Shikha; Yadu, Alka; Shilpi, Priyanka; Kumar, Sandeep; Agarwal, S. P.; Goel, Sudhir K.

    2014-01-01

    Promoter methylation and relative gene expression of O6-methyguanine-DNA-methyltransferase (MGMT) and p16 genes were examined in tissue and blood samples of patients with premalignant oral lesions (PMOLs) and oral squamous cell carcinoma (OSCC). Methylation-specific PCR and reverse transcriptase PCR were performed in 146 tissue and blood samples from controls and patients with PMOLs and OSCC. In PMOL group, significant promoter methylation of MGMT and p16 genes was observed in 59% (P = 0.0010) and 57% (P = 0.0016) of tissue samples, respectively, and 39% (P = 0.0135) and 33% (P = 0.0074) of blood samples, respectively. Promoter methylation of both genes was more frequent in patients with OSCC, that is, 76% (P = 0.0001) and 82% (P = 0.0001) in tissue and 57% (P = 0.0002) and 70% (P = 0.0001) in blood, respectively. Significant downregulation of MGMT and p16 mRNA expression was observed in both tissue and blood samples from patients with PMOLs and OSCC. Hypermethylation-induced transcriptional silencing of MGMT and p16 genes in both precancer and cancer suggests important role of these changes in progression of premalignant state to malignancy. Results support use of blood as potential surrogate to tissue samples for screening or diagnosing PMOLs and early OSCC. PMID:24991542

  3. The 5' region of the human thromboxane A(2) receptor gene.

    PubMed

    Saffak, T; Nüsing, R M

    2002-07-01

    Thromboxane is an important modulator of hemostasis and smooth muscle tonus and signals via G-protein-coupled thromboxane receptor. Previously, we characterized the TP receptor gene and suggested the presence of three promoter regions within the gene. The aim of the present study was to examine the regulation of transcriptional gene expression. By primer extension experiments the major transcription initiation site was shown to be a doublet at -160/165 bp upstream of the ATG codon in human megakaryoblastic MEG-01 cells, endothelial ECV 304 cells and in human myometrium smooth muscle cells. In the erythroleukemic HEL 1 cells transcription initiation site was identified at -10 bp. Transcriptional activity of the three 5'flanking regions of TP receptor gene representing the putative promoter regions was evaluated by transfection of MEG-01 cells with chimeric constructs containing luciferase gene-encoding sequence. Promoter region I displayed highest transcriptional activity and RT-PCR analysis confirmed the transcription of TP receptor mRNA driven by promoter I. Although, weak transcriptional activity was also observed regarding promoter region II, we were unable to amplify cDNA fragments representing promoter II-driven mRNA synthesis. Considering promoter region III, transcriptional activity was barely detectable. Various deletions of the 3.9 kb promoter I region revealed a size-dependent transcriptional activity. Further, for full activity a 'core' promoter corresponding to the region from -160/165 to -588 bp appeared to be necessary for full transcriptional activity of promoter 1. PMID:12213432

  4. Aberrant Gene Promoter Methylation Associated with Sporadic Multiple Colorectal Cancer

    PubMed Central

    Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; de Miguel, Cristina Rodríguez; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M. Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni

    2010-01-01

    Background Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. Methodology/Principal Findings We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple

  5. Definition of the human N-myc promoter region during development in a transgenic mouse model.

    PubMed

    Tai, K F; Rogers, S W; Pont-Kingdon, G; Carroll, W L

    1999-09-01

    The N-myc oncogene directs organogenesis, and gene amplification is associated with aggressive forms of neuroblastoma, a common malignant tumor in children. N-myc is expressed in fetal epithelium, and expression decreases markedly postnatally. To localize sequences responsible for directing expression, we have analyzed the human N-myc promoter. We noted previously that N-myc promoter regions 5' to exon 1 directed reporter gene expression in all cell lines, including those without detectable N-myc transcripts. However, when promoter constructs included 3' exon 1 and the 5' portion of intron 1, reporter activity was detected only when there was expression of the endogenous gene. To determine the role of this "tissue-specific region" in directing expression during development, we generated transgenic mice carrying N-myc promoter lacZ minigenes that contained 5' N-myc promoter elements alone or the promoter linked to the 3' exon 1/5' intron 1 tissue-specific region. Animals lacking the tissue-specific exon 1/intron 1 region showed beta-galactosidase expression in the CNS, but expression was not observed in other organs in which endogenously derived N-myc transcripts were seen. Within the CNS, transgene expression was seen mainly in the olfactory system and was not observed in other areas in which expression of the murine gene has been noted. In contrast, no transgene expression was observed in any of the animals carrying the tissue-specific exon 1/intron 1 region. Thus, sequences that direct expression within the olfactory system were contained within our 5' promoter transgene, whereas sequences that guide the ubiquitous expression of N-myc during organogenesis lie outside the regions studied here. Finally, the exon 1/intron 1 region seems to act in a dominant fashion to repress expression in the CNS from the immediate 5' N-myc promoter. PMID:10473038

  6. Bacillus licheniformis APase I gene promoter: a strong well-regulated promoter in B. subtilis.

    PubMed

    Lee, J K; Edwards, C W; Hulett, F M

    1991-05-01

    The 5' regulatory region and the portion of the structural gene coding for the amino-terminal sequence of alkaline phosphatase I (APase I) were isolated from Bacillus licheniformis MC14 using a synthetic oligodeoxynucleotide deduced from the amino acid sequence of the enzyme. The DNA sequence analysis of this region revealed an open reading frame of 129 amino acids containing the amino-terminal sequence of the mature APase protein. The protein sequence was preceded by a putative signal sequence of 32 amino acid residues. The predicted amino acid sequence of the partial APase clone as well as the experimentally determined amino acid sequence of the enzyme indicated that B. licheniformis APase retains the important features conserved among other APases of Bacillus subtilis, Escherichia coli, Saccharomyces cerevisiae, and various human tissues. Heterologous expression studies of the promoter using a fusion with the lacZ gene indicated that it functions as a very strong inducible promoter in B. subtilis that is tightly regulated by phosphate concentration. PMID:1907637

  7. Characterization of the human lipoprotein lipase (LPL) promoter: Evidence of two cis-regulatory regions, LP-[alpha] and LP-[beta] of importance for the differentation-linked induction of the LPL gene during adipogenesis

    SciTech Connect

    Enerbaeck, S.; Ohlsson, B.G.; Samuelsson, L.; Bjursell, G. )

    1992-10-01

    When preadipocytes differentiate into adipocytes, several differentiation-linked genes are activated. Lipo-protein lipase (LPL) is one of the first genes induced during this process. To investigate early events in adipocyte development, we have focused on the transcriptional activation of the LPL gene. For this purpose, we have cloned and fused different parts of intragenic and flanking sequences with a chloramphenicol acetyltransferase reporter gene. Transient transfection experiments and DNase I hypersensitivity assays indicate that several positive as well as negative elements contribute to transcriptional regulation of the LPL gene. When reporter gene constructs were stably introduced into preadipocytes, we were able to monitor and compare the activation patterns of different promoter deletion mutants at selected time points representing the process of adipocyte development. We could delimit two cis-regulatory elements important for gradual activation of the LPL gene during adipocyte development in vitro. These elements, LP-[alpha] (-702 to -666) and LP-[beta] (-468 to -430), contain a striking similarity to a consensus sequence known to bind the transcription factors HNF-3 and fork head. Results of gel mobility shift assays and DNase I and exonuclease III in vitro protection assays indicate that factors with DNA-binding properties similar to those of the HNF-3/fork head family of transcription factors are present in adipocytes and interact with LP-[alpha] and LP-[beta]. We also demonstrate that LP-[alpha] and LP-[beta] were both capable of conferring a differentiation-linked expression pattern to a heterolog promoter, thus mimicking the expression of the endogenous LPL gene during adipocyte differentiation. These findings indicate that interactions with LP-[alpha] and LP-[beta] could be a part of a differentiation switch governing induction of the LPL gene during adipocyte differentiation. 48 refs., 11 figs.

  8. Promoter DNA demethylation of Keap1 gene in diabetic cardiomyopathy

    PubMed Central

    Liu, Zhong-Zhi; Zhao, Xiang-Zhi; Zhang, Xue-Song; Zhang, Mei

    2014-01-01

    Researches have shown that the onset of diabetes is closely associated with oxidative stress and the chronic exposure leads to the development of complications such as diabetic cardiomyopathy. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. The aim of the present study was to investigate the status of Nrf2 mediated antioxidant system in myocardial biopsies of non-diabetic (NDM) and type-2 diabetic (DM-T2) cardiomyopathy patients. The western blot analysis of antioxidant proteins, real-time PCR analysis of Nrf2/Keap1 gene and bisulphate DNA sequencing analysis to study the methylation status of the CpG islands of Keap1 promoter DNA were performed. The immunoblot analysis showed the decreased level of antioxidant proteins other than Keap1 in the diabetic cardiopathy patients. Similarly, mRNA levels of Keap1 showed 5-fold increase in diabetic patients. Further analysis on promoter region of Keap1 gene revealed 80% demethylation in diabetic patients. Altogether, our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance up on diabetes. Thus, our study clearly demonstrates the failure of Nrf2 mediated antioxidant system revealed in biopsies of diabetic cardiomyopathy. PMID:25674242

  9. Aberrant methylation of the CDKN2a/p16INK4a gene promoter region in preinvasive bronchial lesions: a prospective study in high-risk patients without invasive cancer.

    PubMed

    Lamy, Aude; Sesboüé, Richard; Bourguignon, Jeannette; Dautréaux, Brigitte; Métayer, Josette; Frébourg, Thierry; Thiberville, Luc

    2002-07-10

    Among the identified factors involved in malignant transformation, abnormal methylation of the CDKN2A/p16(INK4a) gene promoter has been described as an early event, particularly in bronchial cell cancerization. Precancerous bronchial lesions (n = 70) prospectively sampled during fluorescence endoscopy in a series of 37 patients at high risk for lung cancer were studied with respect to the methylation status of the CDKN2A gene. Methylation-specific polymerase chain reaction was performed on DNA extracted from pure bronchial cell populations derived from biopsies and detection of p16 protein was studied by immunohistochemistry on contiguous parallel biopsies. Aberrant methylation of the CDKN2A gene promoter was found in 19% of preinvasive lesions and its frequency increased with the histologic grade of the lesions. Methylation in at least 1 bronchial site was significantly more frequent in patients with cancer history, although there was no difference in the outcome of patients with or without methylation in bronchial epithelium. The other risk factors studied (tobacco and asbestos exposure) did not influence the methylation status. There was no relationship between CDKN2A methylation and the evolutionary character of the lesions. Our results confirm that abnormal methylation of the CDKN2A gene promoter is an early event in bronchial cell cancerization, which can persist for several years after carcinogen exposure cessation, and show that this epigenetic alteration cannot predict the evolution of precancerous lesions within a 2-year follow-up. PMID:12115568

  10. The distribution of SNPs in human gene regulatory regions

    PubMed Central

    Guo, Yongjian; Jamison, D Curtis

    2005-01-01

    Background As a result of high-throughput genotyping methods, millions of human genetic variants have been reported in recent years. To efficiently identify those with significant biological functions, a practical strategy is to concentrate on variants located in important sequence regions such as gene regulatory regions. Results Analysis of the most common type of variant, single nucleotide polymorphisms (SNPs), shows that in gene promoter regions more SNPs occur in close proximity to transcriptional start sites than in regions further upstream, and a disproportionate number of those SNPs represent nucleotide transversions. Additionally, the number of SNPs found in the predicted transcription factor binding sites is higher than in non-binding site sequences. Conclusion Current information about transcription factor binding site sequence patterns may not be exhaustive, and SNPs may be actively involved in influencing gene expression by affecting the transcription factor binding sites. PMID:16209714

  11. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    SciTech Connect

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J. )

    1988-08-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5{prime} flanking region of the gene revealed a perfect TATA box at position {minus}28 to position {minus}23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5{prime} flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk{sup {minus}} fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides {minus}305 and +75 of the plasminogen activator inhibitor type 1 gene.

  12. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  13. Epigenetic regulation of transposable element derived human gene promoters.

    PubMed

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  14. Cloning and partial characterization of the mouse glutamine:fructose-6-phosphate amidotransferase (GFAT) gene promoter.

    PubMed Central

    Sayeski, P P; Wang, D; Su, K; Han, I O; Kudlow, J E

    1997-01-01

    Glutamine:fructose-6-phosphate amidotransferase (GFAT) is the enzyme that is rate limiting in the synthesis of glucosamine and hexosamines. Glucosamine has been proposed to contribute to the glucotoxicity of diabetes. Evidence that the gene encoding GFAT is transcriptionally regulated prompted us to clone and characterize its promoter. The position of the mouse GFAT promoter relative to the translational start site was located by primer extension and found to be 149 bp upstream of the translational start site. A 1.9 kb SacI fragment of the GFAT gene was found to contain the promoter and 88 bp of sequence downstream of the transcriptional start site. This promoter segment could drive expression of a luciferase reporter gene, could confer correct transcriptional initiation to the reporter and could confer the EGF-responsiveness previously observed in the native gene. The mouse GFAT promoter lacks a canonical TATA box and has several GC boxes within a highly GC-rich region. Deletional analysis of the promoter indicated that a proximal element extending to -120 relative to the transcriptional start site could confer reporter expression at a level of 57% of the 1.9 kb construct. Detailed analysis of this proximal region by DNase I footprinting, electrophoretic mobility shift assays and site-directed mutagenesis indicated that Sp1 binds to three elements in this proximal promoter segment and plays a vital role in regulation of transcription from this gene. PMID:9060444

  15. Architecture of a yeast U6 RNA gene promoter.

    PubMed Central

    Eschenlauer, J B; Kaiser, M W; Gerlach, V L; Brow, D A

    1993-01-01

    The promoters of vertebrate and yeast U6 small nuclear RNA genes are structurally dissimilar, although both are recognized by RNA polymerase III. Vertebrate U6 RNA genes have exclusively upstream promoters, while the U6 RNA gene from the yeast Saccharomyces cerevisiae (SNR6) has internal and downstream promoter elements that match the tRNA gene intragenic A- and B-block elements, respectively. Substitution of the SNR6 A or B block greatly diminished U6 RNA accumulation in vivo, and a subcellular extract competent for RNA polymerase III transcription generated nearly identical DNase I protection patterns over the SNR6 downstream B block and a tRNA gene intragenic B block. We conclude that the SNR6 promoter is functionally similar to tRNA gene promoters, although the effects of extragenic deletion mutations suggest that the downstream location of the SNR6 B block imposes unique positional constraints on its function. Both vertebrate and yeast U6 RNA genes have an upstream TATA box element not normally found in tRNA genes. Substitution of the SNR6 TATA box altered the site of transcription initiation in vivo, while substitution of sequences further upstream had no effect on SNR6 transcription. We present a model for the SNR6 transcription complex that explains these results in terms of their effects on the binding of transcription initiation factor TFIIIB. Images PMID:8474459

  16. Archaeal promoter architecture and mechanism of gene activation.

    PubMed

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  17. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    PubMed Central

    Lakshmi, R.; Jayavardhanan, K. K.; Aravindakshan, T. V.

    2016-01-01

    Aim: To analyze the promoter sequence of toll-like receptor (TLR) genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases. PMID:27397987

  18. Analysis of Polymorphisms in the Lactotransferrin Gene Promoter and Dental Caries

    PubMed Central

    Brancher, João Armando; Pecharki, Giovana Daniela; Doetzer, Andrea Duarte; Medeiros, Kamilla Gabriella dos Santos; Cordeiro Júnior, Carlos Alberto; Sotomaior, Vanessa Santos; Bauer, Peter; Trevilatto, Paula Cristina

    2011-01-01

    Regarding host aspects, there has been strong evidence for a genetic component in the etiology of caries. The salivary protein lactotransferrin (LTF) exhibits antibacterial activity, but there is no study investigating the association of polymorphisms in the promoter region of LTF gene with caries. The objective of this study was firstly to search the promoter region of the human LTF gene for variations and, if existent, to investigate the association of the identified polymorphisms with dental caries in 12-year-old students. From 687 unrelated, 12-year-old, both sex students, 50 individuals were selected and divided into two groups of extreme phenotypes according to caries experience: 25 students without (DMFT = 0) and 25 with caries experience (DMFT ≥ 4). The selection of individuals with extreme phenotypes augments the chances to find gene variations which could be associated with such phenotypes. LTF gene-putative promoter region (+39 to −1143) of the selected 50 individuals was analyzed by high-resolution melting technique. Fifteen students, 8 without (DMFT = 0) and 7 with caries experience (mean DMFT = 6.28), presented deviations of the pattern curve suggestive of gene variations and were sequenced. However, no polymorphisms were identified in the putative promoter region of the LTF gene. PMID:22190933

  19. Delimitation and functional characterization of the bidirectional THOX-DUOXA promoter regions in thyrocytes.

    PubMed

    Christophe-Hobertus, Christiane; Christophe, Daniel

    2010-04-12

    The THOX and DUOXA genes encode components of the oxidative machinery involved in thyroid hormone biosynthesis. Both of these genes are duplicated in mammalian genomes and are positioned in a head-to-head configuration, THOX1 facing DUOXA1 and THOX2 facing DUOXA2, respectively. The intergenic regions in both couples of genes exhibit dissimilar compositions, being highly GC-rich in the case of THOX1-DUOXA1 but not in the other case. In this study we localized precisely the transcription starts of all four genes using the RLM-RACE technique. It revealed that the distance between THOX1 and DUOXA1 transcription units is of about 70bp only, whereas THOX2 and DUOXA2 transcription starts are separated by 170bp. Analysis of these putative promoter regions revealed the presence of several potential binding sites for transcription factor Sp1 within the THOX1-DUOXA1 intergenic space, and of a TATA box and an Inr element in front of DUOXA2 and THOX2 genes, respectively. The putative promoter regions were inserted into a specifically designed vector harbouring two distinct reporter genes facing each other and their activity was investigated in transient transfection experiments in rat thyroid PCCl3 cells. Both regions exhibited bidirectional promoter activity in the assay. Gel shift experiments using extracts obtained from PCCl3 cells demonstrated the existence of at least one functional Sp1 binding site within the THOX1-DUOXA1 promoter. When Sp1 binding was abolished by mutation of the DNA sequence, a clear reduction in promoter activity in both THOX1 and DUOXA1 directions was observed in the functional assay. As these promoter sequences are well conserved in mammalian genomes, it appears very likely that the results we obtained here in the rat may be extended to the other species. PMID:20060878

  20. In Silico Promoter Analysis can Predict Genes of Functional Relevance in Cell Proliferation: Validation in a Colon Cancer Model

    PubMed Central

    Moss, Alan C.; Doran, Peter P.; MacMathuna, Padraic

    2007-01-01

    Specific combinations of transcription-factor binding sites in the promoter regions of genes regulate gene expression, and thus key functional processes in cells. Analysis of such promoter regions in specific functional contexts can be used to delineate novel disease-associated genes based on shared phenotypic properties. The aim of this study was to utilize promoter analysis to predict cell proliferation-associated genes and to test this method in colon cancer cell lines. We used freely-available bioinformatic techniques to identify cell-proliferation-associated genes expressed in colon cancer, extract a shared promoter module, and identify novel genes that also contain this module in the human genome. An EGRF/ETSF promoter module was identified as prevalent in proliferation-associated genes from a colon cancer cDNA library. We detected 30 other genes, from the known promoters of the human genome, which contained this proliferation-associated module. This group included known proliferation-associated genes, such as HERG1 and MCM7, and a number of genes not previously implicated in cell proliferation in cancer, such as TSPAN3, Necdin and APLP2. Suppression of TSPAN3 and APLP2 by siRNA was performed and confirmed by RT-PCR. Inhibition of these genes significantly inhibited cell proliferation in colon cancer cell lines. This study demonstrates that promoter analysis can be used to identify novel cancer-associated genes based on shared functional processes. PMID:23641142

  1. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate–Vertebrate Boundary

    PubMed Central

    Keller, Thomas E.; Han, Priscilla; Yi, Soojin V.

    2016-01-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate–vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate–vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. PMID:26715626

  2. Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

    PubMed Central

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-01-01

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

  3. [Health-Promoting Schools Regional Initiative of the Americas].

    PubMed

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  4. The TATA-less promoter of VP1, a plant gene controlling seed germination.

    PubMed

    Carrari, F; Frankel, N; Lijavetzky, D; Benech-Arnold, R; Sánchez, R; Iusem, N D

    2001-01-01

    Vp1 is a seed-specific gene involved in the control of dormancy and germination. We here present the complete sequence of the sorghum vp1 promoter/enhancer region highlighting its main features, especially the lack of canonical TATA and CAAT boxes and the presence of elements responsive to abscisic acid and light. The region closest to the start of transcription is highly homologous to the partial proximal sequence reported for the maize vp1 promoter. This region is interrupted by a 57-nt stretch containing 14 CT microsatellite repeats. We observed a poor overall homology to the promoter from abi3 gene, the Arabidopsis counterpart bearing a similar coding sequence. However, there exists a high degree of homology (89%) between a TATA-rich 103-bp stretch of the sorghum vp1 promoter located about 700 nt upstream of the startpoint and miniature inverted transposable elements (MITEs) interspersed within the sorghum seed-specific kafirin cluster. This sorghum MITE-like element displays considerable homology (68%) to the TATA-less promoter from the sorghum NADP-malate dehydrogenase gene and lesser similarity to the Tourist, Pilgrim and Batuta MITEs previously identified within the promoter from the maize Abp1 (auxin-binding protein) gene. PMID:11761708

  5. Structures, folding patterns, and functions of intramolecular DNA G-quadruplexes found in eukaryotic promoter regions

    PubMed Central

    Qin, Yong; Hurley, Laurence H.

    2008-01-01

    In its simplest form, a DNA G-quadruplex is a four-stranded DNA structure that is composed of stacked guanine tetrads. G-quadruplex-forming sequences have been identified in eukaryotic telomeres, as well as in non-telomeric genomic regions, such as gene promoters, recombination sites, and DNA tandem repeats. Of particular interest are the G-quadruplex structures that form in gene promoter regions, which have emerged as potential targets for anticancer drug development. Evidence for the formation of G-quadruplex structures in living cells continues to grow. In this review, we examine recent studies on intramolecular G-quadruplex structures that form in the promoter regions of some human genes in living cells and discuss the biological implications of these structures. The identification of G-quadruplex structures in promoter regions provides us with new insights into the fundamental aspects of G-quadruplex topology and DNA sequence–structure relationships. Progress in G-quadruplex structural studies and the validation of the biological role of these structures in cells will further encourage the development of small molecules that target these structures to specifically modulate gene transcription. PMID:18355457

  6. The Promoter of the Cereal VERNALIZATION1 Gene Is Sufficient for Transcriptional Induction by Prolonged Cold

    PubMed Central

    Casao, M. Cristina; Greenup, Aaron A.; Trevaskis, Ben

    2011-01-01

    The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops. PMID:22242122

  7. The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

    PubMed

    Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

    2011-01-01

    The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops. PMID:22242122

  8. Tuning Gene Expression in Yarrowia lipolytica by a Hybrid Promoter Approach▿†

    PubMed Central

    Blazeck, John; Liu, Leqian; Redden, Heidi; Alper, Hal

    2011-01-01

    The development of strong and tunable promoter elements is necessary to enable metabolic and pathway engineering applications for any host organism. Here, we have expanded and generalized a hybrid promoter approach to produce libraries of high-expressing, tunable promoters in the nonconventional yeast Yarrowia lipolytica. These synthetic promoters are comprised of two modular components: the enhancer element and the core promoter element. By exploiting this basic promoter architecture, we have overcome native expression limitations and provided a strategy for both increasing the native promoter capacity and producing libraries for tunable gene expression in a cellular system with ill-defined genetic tools. In doing so, this work has created the strongest promoters ever reported for Y. lipolytica. Furthermore, we have characterized these promoters at the single-cell level through the use of a developed fluorescence-based assay as well as at the transcriptional and whole-cell levels. The resulting promoter libraries exhibited a range of more than 400-fold in terms of mRNA levels, and the strongest promoters in this set had 8-fold-higher fluorescence levels than those of typically used endogenous promoters. These results suggest that promoters in Y. lipolytica are enhancer limited and that this limitation can be partially or fully alleviated through the addition of tandem copies of upstream activation sequences (UASs). Finally, this work illustrates that tandem copies of UAS regions can serve as synthetic transcriptional amplifiers that may be generically used to increase the expression levels of promoters. PMID:21926196

  9. Limited specificity of promoter constructs for gene therapy in osteosarcoma.

    PubMed

    Pollmann, Annika; Kabisch, Hartmut; Block, Andreas; Müller, Jürgen; Hellwinkel, Olaf J C

    2004-10-01

    Osteosarcoma (OS), a malignant bone neoplasia in childhood, has poor prognosis if metastases appear in the lung. A novel therapeutic approach could consist in a gene therapeutic treatment of OS metastases. However, if promiscuous viral vectors are applied for the delivery of potentially toxic transgenes, their misdelivery into normal tissues could cause severe complications. This problem could be circumvented by application of OS-specific promoters for transgene expression control. We analysed the function of promoters described to be tumour-, osteosarcoma- or osteoblast-specific. Expression rates driven by osteoblast- specific fragments from the collagen1A1-promoter, the human Osteocalcin-promoter, the bone-sialoprotein promoter and the beta-catenin promoter depending on vitamin supplementation were analysed in five OS cell lines, in normal lung fibroblasts and in a non-osteoblastic prostate cancer cell line (LNCaP) by dual luciferase assays. In addition, an unspecific but doxycyclin-repressible promoter construct (pAd.3r-luc) was examined. We found that all constructs were active in OS cell lines to varying extents. The complete human Osteocalcin promoter and the bone-sialoprotein promoter were partially induced by vitamin D3 or C respectively while the pAd.3r-luc activity could be shut down by doxycyclin. In contrast, the human Osteocalcin-promoter was not activated by vitamin D3 in LNCaP cells; its action remained relatively low. Interestingly, excepting the beta-catenin promoter, we measured strong activities of all promoters in lung fibroblast cells. Our study demonstrates that promoter activity should be evaluated not only for the target cells of the gene therapeutic approaches, but also for neighbouring normal tissues. Unspecific but repressible promoters could represent an alternative. PMID:15375610

  10. Isolation and characterization of "GmScream" promoters that regulate highly expressing soybean (Glycine max Merr.) genes.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2015-12-01

    To increase our understanding of the regulatory components that control gene expression, it is important to identify, isolate and characterize new promoters. In this study, a group of highly expressed soybean (Glycine max Merr.) genes, which we have named "GmScream", were first identified from RNA-Seq data. The promoter regions were then identified, cloned and fused with the coding region of the green fluorescent protein (gfp) gene, for introduction and analysis in different tissues using 3 tools for validation. Approximately half of the GmScream promoters identified showed levels of GFP expression comparable to or higher than the Cauliflower Mosaic Virus 35S (35S) promoter. Using transient expression in lima bean cotyledonary tissues, the strongest GmScream promoters gave over 6-fold higher expression than the 35S promoter while several other GmScream promoters showed 2- to 3-fold higher expression. The two highest expressing promoters, GmScreamM4 and GmScreamM8, regulated two different elongation factor 1A genes in soybean. In stably transformed soybean tissues, GFP driven by the GmScreamM4 or GmScreamM8 promoter exhibited constitutive high expression in most tissues with preferentially higher expression in proliferative embryogenic tissues, procambium, vascular tissues, root tips and young embryos. Using deletion analysis of the promoter, two proximal regions of the GmScreamM8 promoter were identified as contributing significantly to high levels of gene expression. PMID:26706070

  11. Methylation Status of Vitamin D Receptor Gene Promoter in Benign and Malignant Adrenal Tumors

    PubMed Central

    Pilon, Catia; Rebellato, Andrea; Urbanet, Riccardo; Guzzardo, Vincenza; Cappellesso, Rocco; Sasano, Hironobu; Fassina, Ambrogio

    2015-01-01

    We previously showed a decreased expression of vitamin D receptor (VDR) mRNA/protein in a small group of adrenocortical carcinoma (ACC) tissues, suggesting the loss of a protective role of VDR against malignant cell growth in this cancer type. Downregulation of VDR gene expression may result from epigenetics events, that is, methylation of cytosine nucleotide of CpG islands in VDR gene promoter. We analyzed methylation of CpG sites in the VDR gene promoter in normal adrenals and adrenocortical tumor samples. Methylation of CpG-rich 5′ regions was assessed by bisulfite sequencing PCR using bisulfite-treated DNA from archival microdissected paraffin-embedded adrenocortical tissues. Three normal adrenals and 23 various adrenocortical tumor samples (15 adenomas and 8 carcinomas) were studied. Methylation in the promoter region of VDR gene was found in 3/8 ACCs, while no VDR gene methylation was observed in normal adrenals and adrenocortical adenomas. VDR mRNA and protein levels were lower in ACCs than in benign tumors, and VDR immunostaining was weak or negative in ACCs, including all 3 methylated tissue samples. The association between VDR gene promoter methylation and reduced VDR gene expression is not a rare event in ACC, suggesting that VDR epigenetic inactivation may have a role in adrenocortical carcinogenesis. PMID:26843863

  12. Motif discovery in promoters of genes co-localized and co-expressed during myeloid cells differentiation

    PubMed Central

    Coppe, Alessandro; Ferrari, Francesco; Bisognin, Andrea; Danieli, Gian Antonio; Ferrari, Sergio; Bicciato, Silvio; Bortoluzzi, Stefania

    2009-01-01

    Genes co-expressed may be under similar promoter-based and/or position-based regulation. Although data on expression, position and function of human genes are available, their true integration still represents a challenge for computational biology, hampering the identification of regulatory mechanisms. We carried out an integrative analysis of genomic position, functional annotation and promoters of genes expressed in myeloid cells. Promoter analysis was conducted by a novel multi-step method for discovering putative regulatory elements, i.e. over-represented motifs, in a selected set of promoters, as compared with a background model. The combination of transcriptional, structural and functional data allowed the identification of sets of promoters pertaining to groups of genes co-expressed and co-localized in regions of the human genome. The application of motif discovery to 26 groups of genes co-expressed in myeloid cells differentiation and co-localized in the genome showed that there are more over-represented motifs in promoters of co-expressed and co-localized genes than in promoters of simply co-expressed genes (CEG). Motifs, which are similar to the binding sequences of known transcription factors, non-uniformly distributed along promoter sequences and/or occurring in highly co-expressed subset of genes were identified. Co-expressed and co-localized gene sets were grouped in two co-expressed genomic meta-regions, putatively representing functional domains of a high-level expression regulation. PMID:19059999

  13. Single-nucleotide polymorphisms and activity analysis of the promoter and enhancer of the pig lactase gene.

    PubMed

    Du, Hai-Ting; Zhu, Hong-Yan; Wang, Jia-Mei; Zhao, Wei; Tao, Xiao-Li; Ba, Cai-Feng; Tian, Yu-Min; Su, Yu-Hong

    2014-07-15

    Lactose intolerance in northern Europeans is strongly associated with a single-nucleotide polymorphism (SNP) located 14 kb upstream of the human lactase gene: -13,910 C/T. We examined whether SNPs in the 5' flanking region of the pig lactase gene are similar to those in the human gene and whether these polymorphisms play a functional role in regulating pig lactase gene expression. The 5' flanking region of the lactase gene from several different breeds of pigs was cloned and analyzed for gene regulatory activity of a luciferase reporter gene. One SNP was found in the enhancer region (-797 G/A) and two were found in the promoter region (-308G/C and -301 A/G). The promoter C-308,G-301(Pro-CG) strongly promotes the expression of the lactase gene, but the promoter G-308,A-301(Pro-GA) does not. The enhancer A-797(Enh-A) genotype for Pro-GA can significantly enhance promoter activity, but has an inhibitory effect on Pro-CG. The Enhancer G-797(Enh-G) has a significant inhibitory effect on both promoters. In conclusion, the order of effectiveness on the pig lactase gene is Enh-A+Pro-GA>Enh-A/G+Pro-CG>Enh-G+Pro-GA. PMID:24809963

  14. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  15. Repression of the Drosophila proliferating-cell nuclear antigen gene promoter by zerknuellt protein

    SciTech Connect

    Yamaguchi, Masamitsu; Hirose, Fumiko; Nishida, Yasuyoshi; Matsukage, Akio )

    1991-10-01

    A 631-bp fragment containing the 5{prime}-flanking region of the Drosophila melanogaster proliferating-cell nuclear antigen (PCNA) gene was placed upstream of the chloramphenicol acetyltransferase (CAT) gene of a CAT vector. A transient expression assay of CAT activity in Drosophila Kc cells transfected with this plasmid and a set of 5{prime}-deletion derivatives revealed that the promoter function resided within a 192-bp region. Cotransfection with a zerknuellt (zen)-expressing plasmid specifically repressed CAT expression. However, cotransfection with expression plasmids for a nonfunctional zen mutation, even skipped, or bicoid showed no significant effect on CAT expression. RNase protection analysis revealed that the repression by zen was at the transcription step. The target sequence of zen was mapped within the 34-bp region of the PCNA gene promoter, even though it lacked zen protein-binding sites. Transgenic flies carrying the PCNA gene regulatory region fused with lacZ were established. These results indicate that zen indirectly represses PCNA gene expression, probably by regulating the expression of some transcription factor(s) that binds to the PCNA gene promoter.

  16. Aberrant promoter methylation of multiple genes in sputum from individuals exposed to smoky coal emissions

    PubMed Central

    Liu, Yang; Lan, Qing; Shen, Min; Mumford, Judy; Keohavong, Phouthone

    2010-01-01

    Summary Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung cancer but also in sputum of smokers without the disease, suggesting the potential for aberrant gene promoter methylation in sputum as a predictive marker for lung cancer. In the present study, we investigated promoter methylation of 4 genes frequently detected in lung tumors, including p16, MGMT, RASSF1A and DAPK genes, in sputum samples obtained from 107 individuals, including 34 never-smoking females and 73 mostly smoking males, who had no evidence of lung cancer but who were exposed to smoky coal emission in Xuan Wei County, China, where lung cancer rate is more than 6 times the Chinese national average rate. Forty nine of the individuals showed evidence of chronic bronchitis while the remaining 58 individuals showed no such a symptom. Promoter methylation of p16, MGMT, RASSF1A and DAPK was detected in 51.4% (55/107), 17.8% (19/107), 29.9% (32/107), and 15.9% (17/107) of the sputum samples from these individuals, respectively. There were no differences in promoter methylation frequencies of any of these genes according to smoking status or gender of the subjects or between individuals with chronic bronchitis and those without evidence of such a symptom. Therefore, individuals exposed to smoky coal emissions in this region harbored in their sputum frequent promoter methylation of these genes that have been previously found in lung tumors and implicated in lung cancer development. PMID:18751376

  17. Promoter methylation of candidate genes associated with familial testicular cancer.

    PubMed

    Mirabello, Lisa; Kratz, Christian P; Savage, Sharon A; Greene, Mark H

    2012-01-01

    Recent genomic studies have identified risk SNPs in or near eight genes associated with testicular germ cell tumors (TGCT). Mouse models suggest a role for Dnd1 epigenetics in TGCT susceptibility, and we have recently reported that transgenerational inheritance of epigenetic events may be associated with familial TGCT risk. We now investigate whether aberrant promoter methylation of selected candidate genes is associated with familial TGCT risk. Pyrosequencing assays were designed to evaluate CpG methylation in the promoters of selected genes in peripheral blood DNA from 153 TGCT affecteds and 116 healthy male relatives from 101 multiple-case families. Wilcoxon rank-sum tests and logistic regression models were used to investigate associations between promoter methylation and TGCT. We also quantified gene product expression of these genes, using quantitative PCR. We observed increased PDE11A, SPRY4 and BAK1 promoter methylation, and decreased KITLG promoter methylation, in familial TGCT cases versus healthy male family controls. A significant upward risk trend was observed for PDE11A when comparing the middle and highest tertiles of methylation to the lowest [odds ratio (OR) =1.55, 95% confidence intervals (CI) 0.82-2.93, and 1.94, 95% CI 1.03-3.66], respectively; P(trend)=0.042). A significant inverse association was observed for KITLG when comparing the middle and lowest tertiles to the highest (OR=2.15, 95% CI 1.12-4.11, and 2.15, 95% CI 1.12-4.14, respectively; P(trend)=0.031). There was a weak inverse correlation between promoter methylation and KITLG expression. Our results suggest that familial TGCT susceptibility may be associated with promoter methylation of previously-identified TGCT risk-modifying genes. Larger studies are warranted. PMID:23050052

  18. Identification of a set of genes showing regionally enriched expression in the mouse brain

    PubMed Central

    D'Souza, Cletus A; Chopra, Vikramjit; Varhol, Richard; Xie, Yuan-Yun; Bohacec, Slavita; Zhao, Yongjun; Lee, Lisa LC; Bilenky, Mikhail; Portales-Casamar, Elodie; He, An; Wasserman, Wyeth W; Goldowitz, Daniel; Marra, Marco A; Holt, Robert A; Simpson, Elizabeth M; Jones, Steven JM

    2008-01-01

    Background The Pleiades Promoter Project aims to improve gene therapy by designing human mini-promoters (< 4 kb) that drive gene expression in specific brain regions or cell-types of therapeutic interest. Our goal was to first identify genes displaying regionally enriched expression in the mouse brain so that promoters designed from orthologous human genes can then be tested to drive reporter expression in a similar pattern in the mouse brain. Results We have utilized LongSAGE to identify regionally enriched transcripts in the adult mouse brain. As supplemental strategies, we also performed a meta-analysis of published literature and inspected the Allen Brain Atlas in situ hybridization data. From a set of approximately 30,000 mouse genes, 237 were identified as showing specific or enriched expression in 30 target regions of the mouse brain. GO term over-representation among these genes revealed co-involvement in various aspects of central nervous system development and physiology. Conclusion Using a multi-faceted expression validation approach, we have identified mouse genes whose human orthologs are good candidates for design of mini-promoters. These mouse genes represent molecular markers in several discrete brain regions/cell-types, which could potentially provide a mechanistic explanation of unique functions performed by each region. This set of markers may also serve as a resource for further studies of gene regulatory elements influencing brain expression. PMID:18625066

  19. Regulation of the Hansenula polymorpha maltase gene promoter in H. polymorpha and Saccharomyces cerevisiae1.

    PubMed

    Alamäe, Tiina; Pärn, Pille; Viigand, Katrin; Karp, Helen

    2003-11-01

    Hansenula polymorpha is an exception among methylotrophic yeasts because it can grow on the disaccharides maltose and sucrose. We disrupted the maltase gene (HPMAL1) in H. polymorpha 201 using homologous recombination. Resulting disruptants HP201HPMAL1Delta failed to grow on maltose and sucrose, showing that maltase is essential for the growth of H. polymorpha on both disaccharides. Expression of HPMAL1 in HP201HPMAL1Delta from the truncated variants of the promoter enabled us to define the 5'-upstream region as sufficient for the induction of maltase by disaccharides and its repression by glucose. Expression of the Saccharomyces cerevisiae maltase gene MAL62 was induced by maltose and sucrose, and repressed by glucose if expressed in HP201HPMAL1Delta from its own promoter. Similarly, the HPMAL1 promoter was recognized and correctly regulated by the carbon source in a S. cerevisiae maltase-negative mutant 100-1B. Therefore we suggest that the transcriptional regulators of S. cerevisiae MAL genes (MAL activator and Mig1 repressor) can affect the expression of the H. polymorpha maltase gene, and that homologues of these proteins may exist in H. polymorpha. Using the HPMAL1 gene as a reporter in a H. polymorpha maltase disruption mutant it was shown that the strength of the HPMAL1 promoter if induced by sucrose is quite comparable to the strength of the H. polymorpha alcohol oxidase promoter under conditions of methanol induction, revealing the biotechnological potential of the HPMAL1 promoter. PMID:14613881

  20. Transcriptional Silencing by Hairpin RNAs Complementary to a Gene Promoter

    PubMed Central

    Chu, Yongjun; Kalantari, Roya; Dodd, David W.

    2012-01-01

    Double-stranded RNAs can target gene promoters and inhibit transcription. To date, most research has focused on synthetic RNA duplexes. Transcriptional silencing by hairpin RNAs would facilitate a better understanding of endogenous RNA-mediated regulation of transcription within cells. Here we examine transcriptional silencing of progesterone receptor (PR) expression by hairpin RNAs. We identify the guide strand as the strand complementary to an antisense transcript at the PR promoter and that hairpin RNAs are active transcriptional silencing agents. The sequence of the hairpin loop affects activity, with the highest activity achieved when the loop has the potential for full complementarity to the antisense transcript target. Introduction of centrally mismatched bases relative to the target transcript does not prevent transcriptional silencing unless the mismatches are present on both the guide and passenger strands. These data demonstrate that hairpin RNAs can cause transcriptional silencing and offer insights into the mechanism of gene modulation by RNAs that target gene promoters. PMID:22703280

  1. Transcriptional regulation of teleost aicda genes. Pt 1 suppressors of promiscuous promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to better understand antibody affinity maturation in fishes we sought to identify gene regulatory elements that could drive expression of activated B-cell specific fluorescent reporter transgenes in zebrafish. Specifically the promoter and several non-coding regions of the channel catfish (...

  2. Engineering of core promoter regions enables the construction of constitutive and inducible promoters in Halomonas sp.

    PubMed

    Li, Tingting; Li, Teng; Ji, Weiyue; Wang, Qiuyue; Zhang, Haoqian; Chen, Guo-Qiang; Lou, Chunbo; Ouyang, Qi

    2016-02-01

    Halomonas strain TD01, a newly identified halophilic bacterium, has proven to be a promising low-cost host for the production of chemicals. However, genetic manipulation in Halomonas sp. is still difficult due to the lack of well-characterized and tunable expression systems. In this study, a systematic, efficient method was exploited to construct both a constitutive promoter library and inducible promoters. Porin, a highly expressed protein in Halomonas TD01, was first identified from the Halomonas TD01 proteome. Subsequent study of the intergenic region upstream of porin led to the identification of a core promoter region, including -10 and -35 elements. By randomizing the sequence between the -35 and -10 elements, a constitutive promoter library was obtained with 310-fold variation in transcriptional activity; an inducible promoter with a >200-fold induction was built by integrating a lac operator into the core promoter region. As two complementary expression systems, the constitutive and inducible promoters were then employed to regulate the biosynthetic pathway of poly-3-hydroxybutyrate (PHB) in Halomonas TD01, demonstrating the usefulness of the expression systems, furthermore, they could be applied in future metabolic engineering of Halomonas TD strains, and the systematic method used in this study can be generalized to other less-characterized bacterial strains. PMID:26332342

  3. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.

    PubMed

    Huttly, A K; Phillips, A L; Tregear, J W

    1992-09-01

    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  4. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S

    1995-01-01

    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  5. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

    PubMed Central

    Degl'Innocenti, Andrea

    2016-01-01

    Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a

  6. Alternative promoters are used for genes within maize chloroplast polycistronic transcription units.

    PubMed

    Haley, J; Bogorad, L

    1990-04-01

    Many chloroplast genes are co-transcribed in polycistronic transcription units that give rise to numerous overlapping RNAs, but the significance of this pattern of transcript accumulation is not understood. An analysis of the transcripts of the adjacent and divergent maize psbE-psbF-psbL-ORF40 and ORF31-petE-ORF42 gene clusters indicates that transcription initiation at alternative promoters contributes to the generation of overlapping RNAs for both clusters. Furthermore, developmentally varying transcript ratios for the ORF31-petE-ORF42 gene cluster are determined at least in part by selective promoter usage. During light-induced plastid maturation, increased levels of primarily monocistronic petE transcripts accumulate from a promoter upstream of the internal petE gene. Dark-predominant and non-light-responsive bi- and tricistronic transcripts result from transcription initiation upstream of ORF31, the proximal gene of the cluster. In addition to the transcriptional overlap within gene clusters, divergent transcription units for the two gene clusters overlap and reciprocal antisense RNAs accumulate. The organization of the transcription units in this region raises the possibility of promoter interdependence or other functional interaction between transcription units. PMID:2152119

  7. Ovine HSP90AA1 gene promoter: functional study and epigenetic modifications.

    PubMed

    Salces-Ortiz, Judit; González, Carmen; Bolado-Carrancio, Alfonso; Rodríguez-Rey, Jose Carlos; Calvo, Jorge H; Muñoz, Rubén; Serrano, M Magdalena

    2015-11-01

    When environmental temperatures exceed a certain threshold, the upregulation of the ovine HSP90AA1 gene is produced to cope with cellular injuries caused by heat stress. It has been previously pointed out that several polymorphisms located at the promoter region of this gene seem to be the main responsible for the differences in the heat stress response observed among alternative genotypes in terms of gene expression rate. The present study, focused on the functional study of those candidate polymorphisms by electrophoretic mobility shift assay (EMSA) and in vitro luciferase expression assays, has revealed that the observed differences in the transcriptional activity of the HSP90AA1 gene as response to heat stress are caused by the presence of a cytosine insertion (rs397514115) and a C to G transversion (rs397514116) at the promoter region. Next, we discovered the presence of epigenetic marks at the promoter and along the gene body founding an allele-specific methylation of the rs397514116 mutation in DNA extracted from blood samples. This regulatory mechanism interacts synergistically to modulate gene expression depending on environmental circumstances. Taking into account the results obtained, it is suggested that the transcription of the HSP90AA1 ovine gene is regulated by a cooperative action of transcription factors (TFs) whose binding sites are polymorphic and where the influence of epigenetic events should be also taken into account. PMID:26253285

  8. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  9. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter.

    PubMed Central

    Taira, T; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    A general and sensitive method for the mapping of initiation sites of DNA replication in vivo, developed by Vassilev and Johnson, has revealed replication origins in the region of simian virus 40 ori, in the regions upstream from the human c-myc gene and downstream from the Chinese hamster dihydrofolate reductase gene, and in the enhancer region of the mouse immunoglobulin heavy-chain gene. Here we report that the region containing the promoter of the human heat shock protein 70 (hsp70) gene was identified as a DNA replication origin in HeLa cells by this method. Several segments of the region were cloned into pUC19 and examined for autonomously replicating sequence (ARS) activity. The plasmids carrying the segments replicated episomally and semiconservatively when transfected into HeLa cells. The segments of ARS activity contained the sequences previously identified as binding sequences for a c-myc protein complex (T. Taira, Y. Negishi, F. Kihara, S. M. M. Iguchi-Ariga, and H. Ariga, Biochem. Biophys. Acta 1130:166-174, 1992). Mutations introduced within the c-myc protein complex binding sequences abolished the ARS activity. Moreover, the ARS plasmids stably replicated at episomal state for a long time in established cell lines. The results suggest that the promoter region of the human hsp70 gene plays a role in DNA replication as well as in transcription. Images PMID:8065368

  10. [Cloning and characterization of D-113 gene promoter from cotton].

    PubMed

    Luo, Ke-Ming; Guo, Yu-Long; Xiao, Yue-Hua; Hou, Lei; Pei, Yan

    2002-02-01

    To study the expression of late embryogenesis abundant gene in seeds, the 1,024 bp 5' flanking sequence of D-113 gene, a late embryogenesis abundant gene of Gossypium hirsutum cv. Coker 312, was cloned by PCR. The similarity compared with the sequence of Lea protein gene family published was 92.50%. There are three putative ABREs and one enhancer-like which riches A/T in the promoter. The promoter was fused to the beta-glucuronidase gene to form pLD II. Via a particle bombardment, pLD II was introduced into embryogenic calli of cotton and seeds of Brassica napus which were all treated with abscisic acid for 3d before bombardment, also into roots, stems and leafs of cotton. Transient expression was measured histochemically as spot number 24 h after bombardment. GUS sexpression was observed in the seeds of Brassica napus and the embryogenic calli of cotton, but not found in roots and leaves of cotton. Those results indicated that the expression of D-113 gene promoter was embryo specific. PMID:11902000

  11. Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?

    PubMed Central

    Balasubramanian, Shankar; Hurley, Laurence H.; Neidle, Stephen

    2011-01-01

    G-quadruplexes are four-stranded DNA structures that are over-represented in gene promoter regions and are viewed as emerging therapeutic targets in oncology, as transcriptional repression of oncogenes through stabilization of these structures could be a novel anticancer strategy. Many gene promoter G-quadruplexes have physicochemical properties and structural characteristics that might make them druggable, and their structural diversity suggests that a high degree of selectivity might be possible. Here, we describe the evidence for G-quadruplexes in gene promoters and discuss their potential as therapeutic targets, as well as progress in the development of strategies to harness this potential through intervention with small-molecule ligands. PMID:21455236

  12. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    PubMed Central

    Sun, Jingxu; Song, Yongxi; Wang, Zhenning; Wang, Guoli; Gao, Peng; Chen, Xiaowan; Gao, Zhaohua; Xu, Huimian

    2014-01-01

    Background MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a) was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation). Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01) in gastric cancer after analyzing the correlation between methylation status and clinicopathologic characteristics. Conclusion The promoter region CpG sites were hypermethylated in gastrointestinal cancers. Promoter region hypermethylation status was associated with the expression of miR-148a and tumor invasiveness in gastric cancer, and may prove to be a new biomarker and method for treating gastric cancer. PMID:24920927

  13. Binding of a liver-specific factor to the human albumin gene promoter and enhancer

    SciTech Connect

    Frain, M.; Hardon, E.; Ciliberto, G. ); Sala-Trepat, J.M. )

    1990-03-01

    A segment of 1,022 base pairs (bp) of the 5{prime}-flanking region of the human albumin gene, fused to a reporter gene, directs hepatoma-specific transcription. Three functionally distinct regions have been defined by deletion analysis: a negative element located between bp {minus}673 and {minus}486, an enhancer essential for efficient albumin transcription located between bp {minus}486 and {minus}221, and a promoter spanning a region highly conserved throughout evolution. Protein-binding studies have demonstrated that a liver {ital trans}-acting factor which interacts with the enhancer region is the well-characterized transcription factor LF-B1, which binds to promoters of several liver-specific genes. A synthetic oligodeoxynucleotide containing the LF-B1-binding site is sufficient to act as a tissue-specific transcriptional enhancer when placed in front of the albumin promoter. The fact that the same binding site functions in both an enhancer and a promoter suggests that these two elements influence the initiation of transcription through similar mechanisms.

  14. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  15. Genomic organization and promoter analysis of the Trichomonas vaginalis core histone gene families.

    PubMed

    Cong, Peikuan; Luo, Yingfeng; Bao, Weidong; Hu, Songnian

    2010-03-01

    Core histone gene is a well-established model to study eukaryote gene transcription regulation mechanism. However, the protozoan core histone gene regulation mechanism remains largely unknown. In this study, we observed almost all protozoan Trichomonas vaginalis core histone genes (60/74) organize as gene pairs in a head-to-head manner, thus facilitating the divergent transcription of both partners. Additionally, the majority of both T. vaginalis core histone genes pairs (50/60) and solitary genes (10/14), contain three over-represented motifs with conserved positional architecture at their promoter regions. Notably of the three motifs, Motif I is highly similar to the Inr which mediates the transcription start site selection in T. vaginalis. Motif II and Motif III preferably locate at the promoter regions of the T. vaginalis genome. Those findings reveal that both genomic organization and cis-acting transcription elements facilitate these large number of T. vaginalis core histone genes under the control of the same transcription machine. PMID:19744576

  16. Gene Transfer Strategies to Promote Chondrogenesis and Cartilage Regeneration.

    PubMed

    Im, Gun-Il

    2016-04-01

    Gene transfer has been used experimentally to promote chondrogenesis and cartilage regeneration. While it is controversial to apply gene therapy for nonlethal conditions such as cartilage defect, there is a possibility that the transfer of therapeutic transgenes may dramatically increase the effectiveness of cell therapy and reduce the quantity of cells that are needed to regenerate cartilage. Single or combination of growth factors and transcription factors has been transferred to mesenchymal stem cells or articular chondrocytes using both nonviral and viral approaches. The current challenge for the clinical applications of genetically modified cells is ensuring the safety of gene therapy while guaranteeing effectiveness. Viral gene delivery methods have been mainstays currently with enhanced safety features being recently refined. On the other hand, efficiency has been greatly improved in nonviral delivery. This review summarizes the history and recent update on the gene transfer to enhance chondrogenesis from stem cells or articular chondrocytes. PMID:26414246

  17. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.

    PubMed

    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E

    2014-02-01

    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes. PMID:24213554

  18. 5' control regions of the apolipoprotein(a) gene and members of the related plasminogen gene family.

    PubMed Central

    Wade, D P; Clarke, J G; Lindahl, G E; Liu, A C; Zysow, B R; Meer, K; Schwartz, K; Lawn, R M

    1993-01-01

    Elevated blood levels of apolipoprotein(a), the component of lipoprotein(a) that distinguishes it from low density lipoprotein, are a major risk factor for atherosclerosis. The apolipoprotein(a) gene is highly similar to the plasminogen gene and to at least four other genes or pseudogenes. The 5' untranslated and flanking sequences of these six genes contain extensive regions of near identity and share sequence elements involved in the initiation of transcription and translation. About 1000 base pairs of flanking DNA of each gene are sufficient to promote transcription in cultured hepatocytes. The apolipoprotein(a) gene promoter contains functional interleukin 6-responsive elements, consistent with the reported acute-phase response of apolipoprotein(a). Flanking genomic fragments of the apoliprotein(a) gene from two individuals with vastly different plasma apolipoprotein(a) concentrations have sequence differences that are reflected in differences in the rate of in vitro transcription. Images PMID:7679504

  19. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  20. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  1. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  2. Cloning and Characterization of the Human Trefoil Factor 3 Gene Promoter

    PubMed Central

    Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong

    2014-01-01

    Human trefoil factor 3 (hTFF3) is a small-molecule peptide with potential medicinal value. Its main pharmacological function is to alleviate gastrointestinal mucosal injuries caused by various factors and promote the repair of damaged mucosa. However, how its transcription is regulated is not yet known. The aim of this study was to clone the hTFF3 gene promoter region, identify the core promoter and any transcription factors that bind to the promoter, and begin to clarify the regulation of its expression. The 5′ flanking sequence of the hTFF3 gene was cloned from human whole blood genomic DNA by PCR. Truncated promoter fragments with different were cloned and inserted into the pGL3-Basic vector to determine the position of the core hTFF3 promoter. Transcription element maintaining basic transcriptional activity was assessed by mutation techniques. Protein-DNA interactions were analyzed by chromatin immunoprecipitation (ChIP). RNA interference and gene over-expression were performed to assay the effect of transcription factor on the hTFF3 expression. The results showed that approximately 1,826 bp of the fragment upstream of hTFF3 was successfully amplified, and its core promoter region was determined to be from −300 bp to −280 bp through analysis of truncated mutants. Mutation analysis confirmed that the sequence required to maintain basic transcriptional activity was accurately positioned from −300 bp to −296 bp. Bioinformatic analysis indicated that this area contained a Sp1 binding site. Sp1 binding to the hTFF3 promoter was confirmed by ChIP experiments. Sp1 over-expression and interference experiments showed that Sp1 enhanced the transcriptional activity of the hTFF3 promoter and increased hTFF3 expression. This study demonstrated that Sp1 plays an important role in maintaining the transcription of hTFF3. PMID:24743382

  3. Cloning of mouse telomerase reverse transcriptase gene promoter and identification of proximal core promoter sequences essential for the expression of transgenes in cancer cells.

    PubMed

    Si, Shao-Yan; Song, Shu-Jun; Zhang, Jian-Zhong; Liu, Jun-Li; Liang, Shuang; Feng, Kai; Zhao, Gang; Tan, Xiao-Qing

    2011-08-01

    Telomerase is a ribonucleoprotein complex, whose function is to add motif-specific nucleotides to the end of chromosomes. Telomerase consists of three major subunits, the telomerase RNA template (hTR), the telomerase-associated protein (TEP1) and telomerase reverse transcriptase (TERT). TERT is the most important component responsible for the catalytic activity of telomerase and a rate-limiting determinant of the activity. Telomerase activities were at high levels in approximately 90% of mouse cancers or tumor-derived cell lines through TERT transcriptional up-regulation. Unlike human telomerase, telomerase activity exists in colon, liver, ovary and testis but not in brain, heart, stomach and muscle in normal mouse tissues. In this study, we prepared 5' truncations of 1086 bp fragments upstream of the initiating ATG codon of the mTERT gene to construct luciferase reporter gene plasmids, and transfected these plasmids into a normal mouse cell line and several cancer lines to identify the core promoter region essential for transcriptional activation in cancer cells by a luciferase assay. We constructed a eukaryotic expression vector of membrane-expressing staphylococcal endotoxin A (SEA) gene driven by the core promoter region of the mTERT gene and observed if the core promoter region could express the SEA gene in these cancer cells, but not in normal cells following transfection with the construct. The results showed that the transcriptional activities of each fragment of the mTERT gene promoter in the cancer cell lines Hepa1-6, B16 and CT26 were higher than those in NIH3T3 cells, and the proximal 333-bp fragment was the core promoter of the mTERT gene in the cancer cells. The proximal 333-bp fragment was able to make the SEA express on the surface of the cancer cells, but not in NIH3T3 cells. It provides a foundation for cancer targeting gene therapy by using the mTERT gene promoter. PMID:21567104

  4. Over-represented localized sequence motifs in ribosomal protein gene promoters of basal metazoans.

    PubMed

    Perina, Drago; Korolija, Marina; Roller, Maša; Harcet, Matija; Jeličić, Branka; Mikoč, Andreja; Cetković, Helena

    2011-07-01

    Equimolecular presence of ribosomal proteins (RPs) in the cell is needed for ribosome assembly and is achieved by synchronized expression of ribosomal protein genes (RPGs) with promoters of similar strengths. Over-represented motifs of RPG promoter regions are identified as targets for specific transcription factors. Unlike RPs, those motifs are not conserved between mammals, drosophila, and yeast. We analyzed RPGs proximal promoter regions of three basal metazoans with sequenced genomes: sponge, cnidarian, and placozoan and found common features, such as 5'-terminal oligopyrimidine tracts and TATA-boxes. Furthermore, we identified over-represented motifs, some of which displayed the highest similarity to motifs abundant in human RPG promoters and not present in Drosophila or yeast. Our results indicate that humans over-represented motifs, as well as corresponding domains of transcription factors, were established very early in metazoan evolution. The fast evolving nature of RPGs regulatory network leads to formation of other, lineage specific, over-represented motifs. PMID:21457775

  5. Simultaneous analysis of the bidirectional African cassava mosaic virus promoter activity using two different luciferase genes.

    PubMed

    Frey, P M; Schärer-Hernández, N G; Fütterer, J; Potrykus, I; Puonti-Kaerlas, J

    2001-03-01

    The expression of geminivirus genes is controlled by bidirectional promoters which are located in the large intergenic region of the circular DNA genomes and specifically regulated by virus encoded proteins. In order to study the simultaneous regulation of both orientations of the DNA A and DNA B promoters of African cassava mosaic virus (ACMV), they were cloned between two different luciferase genes with the firefly luciferase gene in complementary-sense and the Renilla luciferase gene in virion-sense orientation. The regulation of the ACMV promoters by proteins encoded by the complete DNA A, as well as by the individually expressed transactivator (TrAP) or replication-associated (Rep) proteins was assessed in tobacco and cassava protoplasts using dual luciferase assays. In addition, the regulation of the DNA A promoter integrated into tobacco genome was also assessed. The results show that TrAP activates virion-sense expression strongly both in cassava and tobacco protoplasts, but not in transgenic tobacco plants. In contrast to this, DNA A encoded proteins activate virion-sense expression both in protoplasts and in transgenic plants. At the same time they reduce the expression of the complementary-sense Rep gene on DNA A but activate the expression of the complementary-sense movement protein (MPB) gene on DNA B. The degree of MBP activation is higher in cassava than in tobacco protoplasts, indicating that the plant host also influences the promoter strength. Transient transformation experiments using linearized DNA indicate that the different regulation of the ACMV DNA A promoter in protoplasts and transgenic plants could be due to different DNA curvature in free plasmids and in genes integrated in plant genomic DNA. PMID:11324760

  6. The influence of promoter architectures and regulatory motifs on gene expression in Escherichia coli.

    PubMed

    Rydenfelt, Mattias; Garcia, Hernan G; Cox, Robert Sidney; Phillips, Rob

    2014-01-01

    The ability to regulate gene expression is of central importance for the adaptability of living organisms to changes in their external and internal environment. At the transcriptional level, binding of transcription factors (TFs) in the promoter region can modulate the transcription rate, hence making TFs central players in gene regulation. For some model organisms, information about the locations and identities of discovered TF binding sites have been collected in continually updated databases, such as RegulonDB for the well-studied case of E. coli. In order to reveal the general principles behind the binding-site arrangement and function of these regulatory architectures we propose a random promoter architecture model that preserves the overall abundance of binding sites to identify overrepresented binding site configurations. This model is analogous to the random network model used in the study of genetic network motifs, where regulatory motifs are identified through their overrepresentation with respect to a "randomly connected" genetic network. Using our model we identify TF pairs which coregulate operons in an overrepresented fashion, or individual TFs which act at multiple binding sites per promoter by, for example, cooperative binding, DNA looping, or through multiple binding domains. We furthermore explore the relationship between promoter architecture and gene expression, using three different genome-wide protein copy number censuses. Perhaps surprisingly, we find no systematic correlation between the number of activator and repressor binding sites regulating a gene and the level of gene expression. A position-weight-matrix model used to estimate the binding affinity of RNA polymerase (RNAP) to the promoters of activated and repressed genes suggests that this lack of correlation might in part be due to differences in basal transcription levels, with repressed genes having a higher basal activity level. This quantitative catalogue relating promoter

  7. A dynamic G-quadruplex region regulates the HIV-1 long terminal repeat promoter.

    PubMed

    Perrone, Rosalba; Nadai, Matteo; Frasson, Ilaria; Poe, Jerrod A; Butovskaya, Elena; Smithgall, Thomas E; Palumbo, Manlio; Palù, Giorgio; Richter, Sara N

    2013-08-22

    G-Quadruplexes, noncanonical nucleic acid structures, act as silencers in the promoter regions of human genes; putative G-quadruplex forming sequences are also present in promoters of other mammals, yeasts, and prokaryotes. Here we show that also the HIV-1 LTR promoter exploits G-quadruplex-mediated transcriptional regulation with striking similarities to eukaryotic promoters and that treatment with a G-quadruplex ligand inhibits HIV-1 infectivity. Computational analysis on 953 HIV-1 strains substantiated a highly conserved G-rich sequence corresponding to Sp1 and NF-κB binding sites. Biophysical/biochemical analysis proved that two mutually exclusive parallel-like intramolecular G-quadruplexes, stabilized by small molecule ligands, primarily fold in this region. Mutations disrupting G-quadruplex formation enhanced HIV promoter activity in cells, whereas treatment with a G-quadruplex ligand impaired promoter activity and displayed antiviral effects. These findings disclose the possibility of inhibiting the HIV-1 LTR promoter by G-quadruplex-interacting small molecules, providing a new pathway to development of anti-HIV-1 drugs with unprecedented mechanism of action. PMID:23865750

  8. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution. PMID:24055488

  9. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  10. Simultaneous gene inactivation and promoter reporting in cyanobacteria.

    PubMed

    Chen, Kangming; Xu, Xinyi; Gu, Liping; Hildreth, Michael; Zhou, Ruanbao

    2015-02-01

    homolog, and a previously unknown function of gene all2508. Thus, gene expression and phenotypic analysis of mutants can be achieved simultaneously by targeted gene inactivation using the pZR606-based system. This combined approach for targeted gene inactivation and its promoter reporting with GFP may be broadly applicable to the study of gene function in other prokaryotic organisms. PMID:25434810

  11. Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment.

    PubMed Central

    Bruce, W B; Christensen, A H; Klein, T; Fromm, M; Quail, P H

    1989-01-01

    The regulatory photoreceptor phytochrome controls the transcription of its own phy genes in a negative feedback fashion. We have exploited microprojectile-mediated gene transfer to develop a rapid transient expression assay system for the study of DNA sequences involved in the phytochrome-regulated expression of these genes. The 5'-flanking sequence and part of the structural region of an oat phy gene have been fused to a reporter coding sequence (chloramphenicol acetyltransferase, CAT) and introduced into intact darkgrown seedlings by using high-velocity microprojectiles. Expression is assayable in less than 24 hr from bombardment. The introduced oat phy-CAT fusion gene is expressed and down-regulated by white light in barley, rice, and oat, whereas no expression is detected in three dicots tested, tobacco, cucumber, and Arabidopsis thaliana. In bombarded rice shoots, red/far-red light-reversible repression of expression of the heterologous oat phy-CAT gene shows that it is regulated by phytochrome in a manner parallel to that of the endogenous rice phy genes. These data indicate that the transduction pathway components and promoter sequences involved in autoregulation of phy expression have been evolutionarily conserved between oat and rice. The experiments show the feasibility of using high-velocity microprojectile-mediated gene transfer for the rapid analysis of light-controlled monocot gene promoters in monocot tissues that until now have been recalcitrant to such studies. Images PMID:2602370

  12. Activation of the cytotactin promoter by the homeobox-containing gene Evx-1.

    PubMed Central

    Jones, F S; Chalepakis, G; Gruss, P; Edelman, G M

    1992-01-01

    Cytotactin is a morphoregulatory molecule of the extracellular matrix affecting cell shape, division, and migration that appears in a characteristic and complex site-restricted pattern during embryogenesis. The promoter region of the gene that encodes chicken cytotactin contains a variety of potential regulatory sequences. These include putative binding sites for homeodomain proteins and a phorbol 12-O-tetradecanoate 13-acetate response element (TRE)/AP-1 element, a potential target for transcription factors thought to be involved in growth-factor signal transduction. To determine the effects of homeobox-containing genes on cytotactin promoter activity, we conducted a series of cotransfection experiments on NIH 3T3 cells using cytotactin promoter-chloramphenicol acetyltransferase (CAT) reporter gene constructs and plasmids driving the expression of mouse homeobox genes Evx-1 and Hox-1.3. cotransfection with Evx-1 stimulated cytotactin promoter activity whereas cotransfection in control experiments with Hox-1.3 had no effect. To localize the sequences required for Evx-1 activation, we tested a series of deletions in the cytotactin promoter. An 89-base-pair region containing a consensus TRE/AP-1 element was found to be required for activation. An oligonucleotide segment containing this TRE/AP-1 site was found to confer Evx-1 inducibility on a simian virus 40 minimal promoter; mutation of the TRE/AP-1 site abolished this activity. To explore the potential role of growth factors in cytotactin promoter activation, chicken embryo fibroblasts, which are known to synthesize cytotactin, were first transfected with cytotactin promoter constructs and cultured under minimal conditions in 1% fetal bovine serum. Although the cells exhibited only low levels of CAT activity under these conditions, cells exposed for 12 h to 10% (vol/vol) fetal bovine serum showed a marked increase in CAT activity. Cotransfection with Evx-1 and cytotactin promoter constructs of cells cultured in 1

  13. Identification of Escherichia coli region III flagellar gene products and description of two new flagellar genes.

    PubMed Central

    Bartlett, D H; Matsumura, P

    1984-01-01

    Region III flagellar genes in Escherichia coli are involved with the assembly and rotation of the flagella, as well as taxis. We subcloned the flaB operon from a lambda fla transducing phage onto plasmid pMK2004. Two additional genes were found at the flaB locus, and we subdivided the flaB gene into flaB1, flaBII, and flaBIII. The cheY suppressor mutations which have previously been mapped to flaB were further localized to flaB11 (Parkinson et al., J. Bacteriol. 155:265-274, 1983). Until now, gene product identification has not been possible for these genes because of their low levels of gene expression. Overexpression of the flagellar genes was accomplished by placing the flaB operon under the control of the lacUV5 or tac promoters. Plasmid-encoded proteins were examined in a minicell expression system. By correlating various deletions and insertions in the flaB operon with the ability to complement specific flagellar mutants and code for polypeptides, we made the following gene product assignments: flaB 1, 60 kilodaltons; flaB 11, 38 kilodaltons; flaB111, 28 kilodaltons; flaC, 56 kilodaltons; fla0, 16 kilodaltons; and flaE, 54 kilodaltons. Images PMID:6094477

  14. Understanding the Pathogenicity of Noncoding Mismatch Repair Gene Promoter Variants in Lynch Syndrome.

    PubMed

    Liu, Qing; Thompson, Bryony A; Ward, Robyn L; Hesson, Luke B; Sloane, Mathew A

    2016-05-01

    Lynch syndrome is the most common familial cancer condition that mainly predisposes to tumors of the colon and endometrium. Cancer susceptibility is caused by the autosomal dominant inheritance of a loss-of-function mutation or epimutation in one of the DNA mismatch repair (MMR) genes. Cancer risk assessment is often possible with nonsynonymous coding region mutations, but in many cases patients present with DNA sequence changes within noncoding regions, including the promoters, of MMR genes. The pathogenic role of promoter variants, and hence clinical significance, is unclear and this hinders the clinical management of carriers. In this review, we provide an overview of the classification of MMR gene variants, outline the laboratory assays and online resources that can be used to assess the causality of promoter variants in Lynch syndrome, and highlight some of the practical challenges of demonstrating the pathogenicity of these variants. In conclusion, we propose a guide that could be integrated into the current InSiGHT classification scheme to help determine if a MMR gene promoter variant is pathogenic. PMID:26888055

  15. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S

    1988-01-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  16. [Cloning and regulation of pig estrogen related receptor β gene (ESRRB) promoter].

    PubMed

    Yang, Yang; Wang, Yaxian; Du, Lixia; Wang, Huayan

    2015-04-01

    The estrogen related receptor family member Esrrb (Estrogen related receptor β) is a gene that expresses in the early stage of embryo and plays an important role in the core pluripotent network. Its function has been analyzed in human and mouse, although no report so far related to pig. Therefore, to explore its mechanism of transcriptional regulation and expression pattern, we cloned a 3.3 kb pig ESRRB promoter by PCR and constructed the green fluorescence protein (GFP) reporter vector pE3.3. We used these vectors to study the ESRRB expression pattern in 293T, Hela and C2C12. Sequence was analyzed for regulatory elements that share homology to known transcription factor binding sites by TFSEARCH and JASPER program. Some pluripotency related genes such as SMAD, STAT3, MYC, KLF4 and ESRRB have been found within the 3.3 kb sequence by co-transfected pig ESRRB promoter and these potential regulators. We found that ESRRB only expressed in 293T and SMAD could activate ESRRB expression obviously. To determine the core promoter region, a series of ESRRB promoter fragments with gradually truncated 5'-end were produced by PCR and inserted into pGL3-Basic vector. After transient transfection into 293T, dual luciferase assay was used to measure these promoter activities. The result suggested that the core promoter of pig ESRRB located within -25 bp to -269 bp region. These results suggest that these transcription factor binding sites and the core promoter region may be essential for transcriptional regulation of pig ESRRB gene. PMID:26380406

  17. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1.

    PubMed

    Saunders, Jacquelyn; Wisidagama, D Roonalika; Morford, Travis; Malone, Cindy S

    2016-08-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor-binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (-399 to +253). Bioinformatics analysis of the Slit2 proximal promoter -399 base pair to -296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  18. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  19. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13)

    SciTech Connect

    Pendas, A.M.; Balbin, M.; Llano, E.

    1997-03-01

    Human collagenase-3 (MMP13) is a recently identified member of the matrix metalloproteinase (MMP) family that is expressed in breast carcinomas and in articular cartilage from arthritic patients. In this work we have isolated and characterized genomic clones coding for human collagenase-3. This gene is composed of 10 exons and 9 introns and spans over 12.5 kb. The overall organization of the collagenase-3 gene is similar to that of other MMP genes clustered at chromosome 11q22, including fibroblast collagenase (MMP-1), matrilysin (MMP-7), and macrophage metalloelastase (MMP-12), but is more distantly related to genes coding for stromelysin-3 (MMP-11), gelatinase-A (MMP-2), and gelatinase-B (MMP-9), which map outside of this gene cluster. Nucleotide sequence analysis of about 1 kb of the 5{prime}-flanking region of the collagenase-3 gene revealed the presence of a TATA box, an AP-1 motif, a PEA-3 consensus sequence, an osteoblast specific element (OSE-2), and a TGF-{beta} inhibitory element. Transient transfection experiments in HeLa and COS-1 cells with chloramphenicol acetyltransferase (CAT)-containing constructs showed that the AP-1 site is functional and responsible for the observed inducibility of the reporter gene by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). However, and in contrast to other MMP genes, no significative synergistic effect on CAT activity between the AP-1 and PEA-3 elements found in the collagenase-3 gene promoter was found. DNA binding analysis with nuclear extracts from HeLa cells revealed the formation of specific complexes between collagenase-3 promoter sequences containing the AP-1 site and nuclear proteins. The presence of this AP-1 functional site, which is able to confer responsiveness to a variety of tumor promoters and oncogene products, may contribute to explaining the high-level expression of collagenase-3 in breast carcinomas and degenerative joint diseases. 48 refs., 5 figs., 2 tabs.

  20. Characterization of 5' promoter and exon 1-3 polymorphism of the RAET1E gene.

    PubMed

    Cox, Steven T; Pearson, Hayley; Laza-Briviesca, Raquel; Pesoa, Susanna; Vullo, Carlos; Madrigal, J Alejandro; Saudemont, Aurore

    2016-01-01

    NKG2D is an activating receptor utilized by natural killer (NK) cells that recognizes upregulated ligands on infected, tumorigenic and damaged cells, leading to their cytolysis. However, the NKG2D ligand (NKG2DL) system is very complex with eight known gene loci encoding slightly different molecules. Furthermore, most NKG2DL gene loci such as MICA and MICB are highly polymorphic with potential for functional differences. NKG2DL expression on tumors varies depending on the malignancy and tumors can also release soluble NKG2DL that exert anergic effects on NK cells when engagement with NKG2D occurs, allowing escape from NK cell immunosurveillance. We carried out RAET1E typing of IHW cell line DNA, including a 580 bp proximal promoter fragment and exons 1-3 identifying 13 of 15 known RAET1E alleles. We determined 7 polymorphisms within the promoter region, including 2 already known that contributed to 9 promoter types. RAET1E alleles with variability in the extracellular region also differed with respect to promoter type and one allele, RAET1E(∗)003, associated with 5 promoter types. We then identified putative transcription factor binding sites for RAET1E, and found 5 of the 7 promoter polymorphisms may disrupt these sites, abrogating binding of transcription factors and varying the potential level of expression. PMID:26519211

  1. Regulation of the promoter of rat apolipoprotein A-I gene in cultured cells

    SciTech Connect

    Chao, Y.; Pan, T.; Wu, T.; Hao, Q.; Yamin, T.; Kroon, P.A.

    1987-05-01

    In order to study the regulation of the promoter of apolipoprotein (apo) A-I gene, they joined the 5' end of rat apo A-I gene (1.9 Kb) to the coding region of bacterial chloramphenicol acetyltransferase (CAT) gene. The chimeric gene produced high levels of CAT activity in both mouse L cells and Hep G2 cells in transient expression assays. Ethanol increased the levels of rat apo A-I promoter activity in both cells. However, dexamethasone increased rat apo A-I promoter activity only in Hep G2 cells. Similar results were obtained in stable expression cell lines. Nucleotide deletion experiments showed DNA sequences between -149 and -469 base pairs upstream from the rat apo A-I transcription site are required for the high level of expression and that the regulatory sequences are located further upstream. These data demonstrated that the 5' end of rat apo A-I gene contains sequences which are responsible for the regulation of apo A-I expression by ethanol and dexamethasone and that the expression and regulation of rat apo A-I promoter are cell specific.

  2. Structure of two solanum tuberosum steroidal glycoalkaloid glycosyltransferase genes and expression of their promoters in transgenic potatoes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Sgt2 gene in potato encodes a solanidine glucosyltransferase and is present as two distinct alleles expressed in cultivated potatoes. Promoter regions upstream from both steroidal glycoalkaloid biosynthetic gene alleles, Sgt2.1 and Sgt2.2, were isolated from Solanum tuberosum cv. Russet Burbank ...

  3. hTERT and BIRC5 gene promoters for cancer gene therapy: A comparative study

    PubMed Central

    Shepelev, Mikhail V.; Kopantzev, Eugene P.; Vinogradova, Tatiana V.; Sverdlov, Eugene D.; Korobko, Igor V.

    2016-01-01

    Human telomerase reverse transcriptase (hTERT) and survivin (BIRC5) gene promoters are frequently used for transcriptional targeting of tumor cells, yet there is no comprehensive comparative analysis allowing rational choice of a promoter for a particular therapy. In the current study, the transcriptional activity of hTERT, human BIRC5 and mouse Birc5 promoters and their modifications were compared in 10 human cancer cell lines using the luciferase reporter gene activity assay. The results revealed that BIRC5- and hTERT-based promoters had strikingly different cell specificities with comparable activities in only 40% of cell lines. Importantly, relative hTERT and BIRC5 transcript abundance cannot be used to predict the most potent promoter. Among the hTERT-based promoters that were assessed, modification with the minimal cytomegalovirus promoter generally resulted in the most potent activity. Mouse Birc5 and modified human BIRC5 promoters were superior to the unmodified human survivin promoter; however, their tumor specificities must be investigated further. In summary, the present results emphasize the desirability for construction of more universal tumor-specific promoters to efficiently target a wide spectrum of tumor cells. PMID:27446419

  4. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    PubMed Central

    Shilpa, V.; Bhagat, Rahul; Premalata, C.S.; Pallavi, V.R.; Ramesh, G.; Krishnamoorthy, Lakshmi

    2014-01-01

    Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O6-methyguanine-DNA methyltransferase (MGMT) is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O6-position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC) tissue samples, 14 low malignant potential (LMP) tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP) after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression. PMID:25579142

  5. Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

    PubMed Central

    Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.

    1988-01-01

    To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981

  6. Characterization of the Human Insulin-induced Gene 2 (INSIG2) Promoter

    PubMed Central

    Fernández-Alvarez, Ana; Soledad Alvarez, María; Cucarella, Carme; Casado, Marta

    2010-01-01

    Insulin-induced gene 2 (INSIG2) and its homolog INSIG1 encode closely related endoplasmic reticulum proteins that regulate the proteolytic activation of sterol regulatory element-binding proteins, transcription factors that activate the synthesis of cholesterol and fatty acids in animal cells. Several studies have been carried out to identify INSIG2 genetic variants associated with metabolic diseases. However, few data have been published regarding the regulation of INSIG2 gene expression. Two Insig2 transcripts have been described in rodents through the use of different promoters that produce different noncoding first exons that splice into a common second exon. Herein we report the cloning and characterization of the human INSIG2 promoter and the detection of an INSIG2-specific transcript homologous to the Insig2b mouse variant in human liver. Deletion analyses on 3 kb of 5′-flanking DNA of the human INSIG2 gene revealed the functional importance of a 350-bp region upstream of the transcription start site. Mutated analyses, chromatin immunoprecipitation assays, and RNA interference analyses unveiled the significance of an Ets-consensus motif in the proximal region and the interaction of the Ets family member SAP1a (serum response factor (SRF) accessory protein-1a) with this region of the human INSIG2 promoter. Moreover, our findings suggest that insulin activated the human INSIG2 promoter in a process mediated by phosphorylated SAP1a. Overall, these results map the functional elements in the human INSIG2 promoter sequence and suggest an unexpected regulation of INSIG2 gene expression in human liver. PMID:20145255

  7. Transcriptional regulation of the human Wilms' tumor gene (WT1). Cell type-specific enhancer and promiscuous promoter.

    PubMed

    Fraizer, G C; Wu, Y J; Hewitt, S M; Maity, T; Ton, C C; Huff, V; Saunders, G F

    1994-03-25

    The Wilms' tumor gene, WT1, is expressed in few tissues, mainly the developing kidney, genitourinary system, and mesothelium, and in immature hematopoietic cells. To develop an understanding of the role of WT1 in development and tumorigenesis, we have identified transcriptional regulatory elements that function in transient reporter gene constructs transfected into kidney and hematopoietic cell lines. We found three transcription start sites of the WT1 gene and have identified an essential promoter region by deletion analysis. The WT1 promoter is a member of the GC-rich, TATA-less, and CCAAT-less class of polymerase II promoters. Whereas the WT1 promoter is similar to other tumor suppressor gene promoters, the WT1 expression pattern (unlike Rb and p53) is tissue-restricted. The WT1 GC-rich promoter is promiscuous, functioning in all cell lines tested, independent of WT1 expression. This finding suggests that the promoter is not tissue-specific, but that tissue-specific expression of WT1 is modulated by additional regulatory elements. Indeed, we have identified a transcriptional enhancer located 3' of the WT1 gene > 50 kilobases downstream from the promoter. This orientation-independent enhancer increases the basal transcription rate of the WT1 promoter in the human erythroleukemia cell line K562, but not in any of the other cell lines tested. PMID:8132626

  8. Variation in Rubisco activase (RCAβ) gene promoters and expression in soybean [Glycine max (L.) Merr].

    PubMed

    Chao, Maoni; Yin, Zhitong; Hao, Derong; Zhang, Jinyu; Song, Haina; Ning, Ailing; Xu, Xiaoming; Yu, Deyue

    2014-01-01

    Understanding the genetic basis of Rubisco activase (RCA) gene regulation and altering its expression levels to optimize Rubisco activation may provide an approach to enhance plant productivity. However, the genetic mechanisms and the effect of RCA expression on phenotype are still unknown in soybean. This work analysed the expression of RCA genes and demonstrated that two RCA isoforms presented different expression patterns. Compared with GmRCAα, GmRCAβ was expressed at higher mRNA and protein levels. In addition, GmRCAα and GmRCAβ were positively correlated with chlorophyll fluorescence parameters and seed yield, suggesting that changes in expression of RCA has a potential applicability in breeding for enhanced soybean productivity. To identify the genetic factors that cause expression level variation of GmRCAβ, expression quantitative trait loci (eQTL) mapping was combined with allele mining in a natural population including 219 landraces. The eQTL mapping showed that a combination of both cis- and trans-acting eQTLs might control GmRCAβ expression. As promoters can affect both cis- and trans-acting eQTLs by altering cis-acting regulatory elements or transcription factor binding sites, this work subsequently focused on the promoter region of GmRCAβ. Single-nucleotide polymorphisms in the GmRCAβ promoter were identified and shown to correlate with expression level diversity. These SNPs were classified into two groups, A and B. Further transient expression showed that GUS expression driven by the group A promoter was stronger than that by the group B promoter, suggesting that promoter sequence types could influence gene expression levels. These results would improve understanding how variation within promoters affects gene expression and, ultimately, phenotypic diversity in natural populations. PMID:24170743

  9. Glial cell-specific expression of the serotonin 2 receptor gene: selective reactivation of a repressed promoter.

    PubMed

    Ding, D; Toth, M; Zhou, Y; Parks, C; Hoffman, B J; Shenk, T

    1993-11-01

    The 5' flanking region of the 5-HT2 receptor gene has been cloned, sequenced and its transcriptional regulatory functions analyzed. The promoter lacks an identifiable TATA motif, and utilizes at least 11 clustered start sites. Promoter function was analyzed by transient assays in rat C6 glioma cells, which were shown to express the endogenous 5-HT2 receptor gene, as well as in rat CREF and human HeLa cells which do not express the endogenous gene. The basal promoter functioned equally well in all three cell lines; and a repression domain, located upstream of the basal promoter, inhibited activity of the promoter in all three cell lines. A far upstream cell specific activator domain restored promoter activity in C6 glioma cells, but did not reactivate the silenced promoter in CREF or HeLa cells. The upstream activator domain, repressor domain and basal promoter functioned in concert to achieve cell type specific expression. The activator domain did not direct C6 glioma cell specific expression in the absence of the repressor domain or in constructs carrying a heterologous basal promoter. These results indicate that glial cell expression of the 5-HT2 receptor gene is achieved through a cell type specific reactivation of a repressed promoter. PMID:8302156

  10. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  11. Silencing of CHD5 Gene by Promoter Methylation in Leukemia

    PubMed Central

    Zhao, Rui; Meng, Fanyi; Wang, Nisha; Ma, Wenli; Yan, Qitao

    2014-01-01

    Chromodomain helicase DNA binding protein 5 (CHD5) was previously proposed to function as a potent tumor suppressor by acting as a master regulator of a tumor-suppressive network. CHD5 is down-regulated in several cancers, including leukemia and is responsible for tumor generation and progression. However, the mechanism of CHD5 down-regulation in leukemia is largely unknown. In this study, quantitative reverse-transcriptase polymerase chain reaction and western blotting analyses revealed that CHD5 was down-regulated in human leukemia cell lines and samples. Luciferase reporter assays showed that most of the baseline regulatory activity was localized from 500 to 200 bp upstream of the transcription start site. Bisulfite DNA sequencing of the identified regulatory element revealed that the CHD5 promoter was hypermethylated in human leukemia cells and samples. Thus, CHD5 expression was inversely correlated with promoter DNA methylation in these samples. Treatment with DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CHD5 expression in human leukemia cell lines. In vitro luciferase reporter assays demonstrated that methylation of the CHD5 promoter repressed its promoter activity. Furthermore, a chromatin immunoprecipitation assay combined with qualitative PCR identified activating protein 2 (AP2) as a potential transcription factor involved in CHD5 expression and indicated that treatment with DAC increases the recruitment of AP2 to the CHD5 promoter. In vitro transcription-factor activity studies showed that AP2 over-expression was able to activate CHD5 promoter activity. Our findings indicate that repression of CHD5 gene expression in human leukemia is mediated in part by DNA methylation of its promoter. PMID:24454811

  12. A multistep bioinformatic approach detects putative regulatory elements in gene promoters

    PubMed Central

    Bortoluzzi, Stefania; Coppe, Alessandro; Bisognin, Andrea; Pizzi, Cinzia; Danieli, Gian Antonio

    2005-01-01

    Background Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences. Genomic sequences of 1 Kb upstream of 91 genes differentially expressed and/or encoding proteins with relevant function in adult human retina were analyzed. Methodology and results were tested by analysing 1,000 groups of putatively unrelated sequences, randomly selected among 17,156 human gene promoters. When applied to a sample of human promoters, the method identified 279 putative motifs frequently occurring in retina promoters sequences. Most of them are localized in the proximal portion of promoters, less variable in central region than in lateral regions and similar to known regulatory sequences. COOP software and reference manual are freely available upon request to the Authors. Conclusion The approach described in this paper seems effective for identifying a tractable number of sequence motifs with putative regulatory role. PMID:15904489

  13. Modular organization and development activity of an Arabidopsis thaliana EF-1 alpha gene promoter.

    PubMed

    Curie, C; Axelos, M; Bardet, C; Atanassova, R; Chaubet, N; Lescure, B

    1993-04-01

    The activity of the Arabidopsis thalana A1 EF-1 alpha gene promoter was analyzed in transgenic Arabidopsis plants. The 5' upstream sequence of the A1 gene and several promoter deletions were fused to the beta-glucuronidase (GUS) coding region. Promoter activity was monitored by quantitative and histochemical assays of GUS activity. The results show that the A1 promoter exhibits a modular organization. Sequences both upstream and downstream relative to the transcription initiation site are involved in quantitative and tissue-specific expression during vegetative growth. One upstream element may be involved in the activation of expression in meristematic tissues; the downstream region, corresponding to an intron within the 5' non-coding region (5'IVS), is important for expression in roots; both upstream and downstream sequences are required for expression in leaves, suggesting combinatorial properties of EF-1 alpha cis-regulatory elements. This notion of specific combinatorial regulation is reinforced by the results of transient expression experiments in transfected Arabidopsis protoplasts. The deletion of the 5'IVS has much more effect on expression when the promoter activity is under the control of A1 EF-1 alpha upstream sequences than when these upstream sequences were replaced by the 35S enhancer. Similarly, a synthetic oligonucleotide corresponding to an A1 EF-1 alpha upstream cis-acting element (the TEF1 box), is able to restore partially the original activity when fused to a TEF1-less EF1-alpha promoter but has no significant effect when fused to an enhancer-less 35S promoter. PMID:8492811

  14. TERT promoter mutations and gene amplification: promoting TERT expression in Merkel cell carcinoma.

    PubMed

    Xie, Hong; Liu, Tiantian; Wang, Na; Björnhagen, Viveca; Höög, Anders; Larsson, Catharina; Lui, Weng-Onn; Xu, Dawei

    2014-10-30

    Telomerase activation through the induction of its catalytic component TERT is essential in carcinogenesis. The regulatory mechanism and clinical significance underlying cancer-specific TERT expression have been extensively investigated in various human malignancies, but little is known about these in Merkel cell carcinoma (MCC), an aggressive neuroendocrine skin tumor. Here we addressed these issues by determining TERT promoter mutations, gene amplification, mRNA expression and association with clinical variables in MCC. TERT mRNA was expressed in 6/6 MCC cell lines and 41 of 43 tumors derived from 35 MCC patients. Telomerase activity was detectable in all 6 cell lines and 11 tumors analyzed. TERT promoter mutations were identified in 1/6 cell lines and 4/35 (11.4%) MCC cases. The mutation exhibited UV signature and occurred in sun-exposed areas. Increased TERT gene copy numbers were observed in 1/6 cell lines and 11/14 (79%) tumors, and highly correlated with its mRNA expression (r = 0.7419, P = 0.0024). Shorter overall survival was significantly associated with higher TERT mRNA levels in MCC patients (P = 0.032). Collectively, TERT expression and telomerase activity is widespread in MCC, and may be attributable to TERT promoter mutations and gene amplification. Higher TERT expression predicts poor patient outcomes. PMID:25301727

  15. c-Ha-ras gene bidirectional promoter expressed in vitro: location and regulation.

    PubMed Central

    Lowndes, N F; Paul, J; Wu, J; Allan, M

    1989-01-01

    Increased transcriptional activity of the c-Ha-ras gene product is correlated with induction of several important human tumor types. For this reason, we have investigated the nature of the c-Ha-ras promoter and the factors that regulate its expression. Using S1 and primer extension analysis of c-Ha-ras RNA from EJ cells, we have identified 18 initiation sites within an upstream exon (exon -1) whose 3' end (the donor splice site [D]) is located 1,105 base pairs (bp) upstream of the ATG codon. The furthest-upstream initiation site is located -191 bp relative to D, and the furthest downstream is located -16 bp relative to D. Transient expression assays, in which a series of mutants spanning this region were ligated to a promoterless chloramphenicol acetyltransferase vector, functionally confirmed the position and extent of this promoter. Mutational analysis further located a 47-bp element located between -243 and -196 relative to D that up-regulated transcriptional activity of the promoter region by 20- to 40-fold. This region contained both a GC box known to bind SP1 and a CCAAT box. Insertion of a simian virus 40 enhancer 5' to the promoter up-regulated transcription from each initiation site by approximately 10- to 20-fold. We have also localized, both by chloramphenicol acetyltransferase assay and by S1 analysis, a strong promoter operating in the direction opposite that of the gene and originating immediately 5' to the 47-bp regulatory region. The reverse promoter was found to have nine initiation sites between -248 and -278 relative to D. Images PMID:2674682

  16. Novel strong tissue specific promoter for gene expression in human germ cells

    PubMed Central

    2010-01-01

    Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS) was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102), where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter). To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD) suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1), whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293). In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X). The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12), and an important role - in the rest two cell lines. PMID:20716342

  17. Activity analysis and preliminary inducer screening of the chicken DAZL gene promoter.

    PubMed

    Zhang, Lei; Zhu, Rui; Zuo, Qisheng; Li, Dong; Lian, Chao; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-01-01

    This study was aimed at identifying the active control area of chicken DAZL gene core promoter, to screen optimum inducers of the DAZL gene, thus to enhance the differentiation of embryonic stem cells into spermatogonial stem cells. Fragments of chicken DAZL gene promoter were cloned into fluorescent reporter plasmids and transfected into DF-1 cells. Then Dual-Luciferase® Reporter Assay System was used to identify the activity of the DAZL gene under different inducers. Our studies showed that the DAZL core promoter region for the Suqin yellow chicken was -383 to -39 bp. The dual-luciferase® reporter showed that all-trans retinoic acid (ATRA), a retinoic acid receptor alpha agonist (tamibarotene/Am80), or estradiol (E2) could significantly enhance DAZL transcription. The in vitro inductive culture of chicken ESCs demonstrated that, with ATRA treatment, DAZL transcription peaked at 6 days and then decreased slowly; whereas, DAZL transcription was continuous and peaked at 10 days with Am80 treatment. E2 treatment significantly increased DAZL expression after 8 days. All three treatments were associated with the appearance of male germ cell (MGC)-like cells on day 10. These results provide the optimum inducer screening of the DAZL gene and lay the foundation for further screening of compounds that can induce the differentiation of ESCs into MGCs in vitro. PMID:25807265

  18. Activity Analysis and Preliminary Inducer Screening of the Chicken DAZL Gene Promoter

    PubMed Central

    Zhang, Lei; Zhu, Rui; Zuo, Qisheng; Li, Dong; Lian, Chao; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-01-01

    This study was aimed at identifying the active control area of chicken DAZL gene core promoter, to screen optimum inducers of the DAZL gene, thus to enhance the differentiation of embryonic stem cells into spermatogonial stem cells. Fragments of chicken DAZL gene promoter were cloned into fluorescent reporter plasmids and transfected into DF-1 cells. Then Dual-Luciferase® Reporter Assay System was used to identify the activity of the DAZL gene under different inducers. Our studies showed that the DAZL core promoter region for the Suqin yellow chicken was −383 to −39 bp. The dual-luciferase® reporter showed that all-trans retinoic acid (ATRA), a retinoic acid receptor alpha agonist (tamibarotene/Am80), or estradiol (E2) could significantly enhance DAZL transcription. The in vitro inductive culture of chicken ESCs demonstrated that, with ATRA treatment, DAZL transcription peaked at 6 days and then decreased slowly; whereas, DAZL transcription was continuous and peaked at 10 days with Am80 treatment. E2 treatment significantly increased DAZL expression after 8 days. All three treatments were associated with the appearance of male germ cell (MGC)-like cells on day 10. These results provide the optimum inducer screening of the DAZL gene and lay the foundation for further screening of compounds that can induce the differentiation of ESCs into MGCs in vitro. PMID:25807265

  19. Genetic and functional analysis of the TBX3 gene promoter in indirect inguinal hernia.

    PubMed

    Zhao, Zhongqing; Tian, Wenjun; Wang, Lin; Wang, Haihua; Qin, Xianyun; Xing, Qining; Pang, Shuchao; Yan, Bo

    2015-01-01

    Inguinal hernia is a common developmental disease in children and most cases are indirect inguinal hernia (IIH). Genetic factors have been suggested to play important roles in IIH. Although IIH has been observed in several human syndromes, genetic causes and molecular mechanisms for IIH remain unknown. TBX3 is a member of the T-box family of transcription factors that are essential to the embryonic development. Human studies and animal experiments have demonstrated that TBX3 is required for the development of the heart, limbs, mammary glands and other tissues and organs. TBX3 gene expression has been detected in human fibroblast and tissues of abdominal wall. We speculated that TBX3 may be involved in the IIH formation. Since TBX3 activity is highly dosage-sensitive, a TBX3 gene promoter was genetically and functionally analyzed in IIH patients and ethnic-matched controls in this study. One heterozygous deletion variant (g.4820_4821del) was identified in one IIH patient, but in none of controls. The variant significantly decreased TBX3 gene promoter activities, likely by creating a binding site for sex-determining region Y (SRY), mobility group transcription factor. One heterozygous insertion variant (g.3913_3914ins) was only found in one control, which did not affect TBX3 gene promoter activities. Taken together, TBX3 gene variants may contribute to IIH as a rare risk factor by reducing TBX3 levels. PMID:25455105

  20. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  1. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    SciTech Connect

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-07-23

    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  2. SMARCAL1 Negatively Regulates C-Myc Transcription By Altering The Conformation Of The Promoter Region

    PubMed Central

    Sharma, Tapan; Bansal, Ritu; Haokip, Dominic Thangminlen; Goel, Isha; Muthuswami, Rohini

    2015-01-01

    SMARCAL1, a member of the SWI2/SNF2 protein family, stabilizes replication forks during DNA damage. In this manuscript, we provide the first evidence that SMARCAL1 is also a transcriptional co-regulator modulating the expression of c-Myc, a transcription factor that regulates 10–15% genes in the human genome. BRG1, SMARCAL1 and RNAPII were found localized onto the c-myc promoter. When HeLa cells were serum starved, the occupancy of SMARCAL1 on the c-myc promoter increased while that of BRG1 and RNAPII decreased correlating with repression of c-myc transcription. Using Active DNA-dependent ATPase A Domain (ADAAD), the bovine homolog of SMARCAL1, we show that the protein can hydrolyze ATP using a specific region upstream of the CT element of the c-myc promoter as a DNA effector. The energy, thereby, released is harnessed to alter the conformation of the promoter DNA. We propose that SMARCAL1 negatively regulates c-myc transcription by altering the conformation of its promoter region during differentiation. PMID:26648259

  3. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  4. The Rhodobacter capsulatus glnB gene is regulated by NtrC at tandem rpoN-independent promoters.

    PubMed Central

    Foster-Hartnett, D; Kranz, R G

    1994-01-01

    The protein encoded by glnB of Rhodobacter capsulatus is part of a nitrogen-sensing cascade which regulates the expression of nitrogen fixation genes (nif). The expression of glnB was studied by using lacZ fusions, primer extension analysis, and in vitro DNase I footprinting. Our results suggest that glnB is transcribed from two promoters, one of which requires the R. capsulatus ntrC gene but is rpoN independent. Another promoter upstream of glnB is repressed by NtrC; purified R. capsulatus NtrC binds to sites that overlap this distal promoter region. Images PMID:8051036

  5. Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Zhu, Jihong; Chen, Liguo; Ma, Aimin

    2015-03-01

    Developing efficient native promoters is important for improving recombinant protein expression by fungal genetic engineering. The promoter region of glyceraldehyde-3-phosphate dehydrogenase gene in Pleurotus ostreatus (Pogpd) was isolated and optimized by upstream truncation. The activities of these promoters with different lengths were further confirmed by fluorescence, quantitative real-time PCR and Western blot analysis. A truncated Pogpd-P2 fragment (795 bp) drove enhanced green fluorescence protein (egfp) gene expression in P. ostreatus much more efficiently than full-length Pogpd-P1. Further truncating Pogpd-P2 to 603, 403 and 231 bp reduced the eGFP expression significantly. However, the 403-bp fragment between -356 bp and the start codon was the minimal but sufficient promoter element for eGFP expression. Compact native promoters for genetic engineering of P. ostreatus were successfully developed and validated in this study. This will broaden the preexisting repertoire of fungal promoters for biotechnology application. PMID:25743073

  6. In vivo selection for metastasis promoting genes in the mouse.

    PubMed

    Gumireddy, Kiranmai; Sun, Fangxian; Klein-Szanto, Andres J; Gibbins, Jonathan M; Gimotty, Phyllis A; Saunders, Aleister J; Schultz, Peter G; Huang, Qihong

    2007-04-17

    Here, we report the identification of a metastasis promoting factor by a forward genetic screen in mice. A retroviral cDNA library was introduced into the nonmetastatic cancer cell line 168FARN, which was then orthotopically transplanted into mouse mammary fat pads, followed by selection for cells that metastasize to the lung. The genes encoding the disulfide isomerase ERp5 and beta-catenin were found to promote breast cancer invasion and metastasis. Disulfide isomerases (thiol isomerases), which catalyze disulfide bond formation, reduction, and isomerization, have not previously been implicated in cancer cell signaling and tumor metastasis. Overexpression of ERp5 promotes both in vitro migration and invasion and in vivo metastasis of breast cancer cells. These effects were shown to involve activation of ErbB2 and phosphoinositide 3-kinase (PI3K) pathways through dimerization of ErbB2. Activation of ErbB2 and PI3K subsequently stimulates RhoA and beta-catenin, which mediate the migration and invasion of tumor cells. Inhibition of ErbB2 and PI3K reverses the phenotypes induced by ERp5. Finally, ERp5 was shown to be up-regulated in human surgical samples of invasive breast cancers. These data identify a link between disulfide isomerases and tumor development, and provide a mechanism that modulates ErbB2 and PI3K signaling in the promotion of cancer progression. PMID:17420453

  7. In vivo selection for metastasis promoting genes in the mouse

    PubMed Central

    Gumireddy, Kiranmai; Sun, Fangxian; Klein-Szanto, Andres J.; Gibbins, Jonathan M.; Gimotty, Phyllis A.; Saunders, Aleister J.; Schultz, Peter G.; Huang, Qihong

    2007-01-01

    Here, we report the identification of a metastasis promoting factor by a forward genetic screen in mice. A retroviral cDNA library was introduced into the nonmetastatic cancer cell line 168FARN, which was then orthotopically transplanted into mouse mammary fat pads, followed by selection for cells that metastasize to the lung. The genes encoding the disulfide isomerase ERp5 and β-catenin were found to promote breast cancer invasion and metastasis. Disulfide isomerases (thiol isomerases), which catalyze disulfide bond formation, reduction, and isomerization, have not previously been implicated in cancer cell signaling and tumor metastasis. Overexpression of ERp5 promotes both in vitro migration and invasion and in vivo metastasis of breast cancer cells. These effects were shown to involve activation of ErbB2 and phosphoinositide 3-kinase (PI3K) pathways through dimerization of ErbB2. Activation of ErbB2 and PI3K subsequently stimulates RhoA and β-catenin, which mediate the migration and invasion of tumor cells. Inhibition of ErbB2 and PI3K reverses the phenotypes induced by ERp5. Finally, ERp5 was shown to be up-regulated in human surgical samples of invasive breast cancers. These data identify a link between disulfide isomerases and tumor development, and provide a mechanism that modulates ErbB2 and PI3K signaling in the promotion of cancer progression. PMID:17420453

  8. Promoter analysis and expression of a phospholipase D gene from castor bean.

    PubMed Central

    Xu, L; Zheng, S; Zheng, L; Wang, X

    1997-01-01

    The expression of a castor bean (Ricinus communis L.) phospholipase D (PLD; EC 3.1.4.4) gene has been studied by examining its promoter activity in transgenic tobacco (Nicotiana tabacum) carrying a PLD promoter-glucuronidase transgene and by monitoring the levels of PLD mRNA in castor bean. Sequence and the 5' truncation analyses revealed that the 5' flanking region from nucleotide -1200 to -730 is required for the regulation and basal function of the PLD promoter. The PLD promoter in vegetative tissues is highly active in the rapidly growing regions such as the shoot apex and the secondary meristem producing axillary buds and vascular tissues of young leaves and stems. The PLD promoter activity in floral tissues was high in stigma, ovary, and pollen grains, but low in petals, sepals, the epidermis of anthers, styles, and filaments. The PLD promoter activity was enhanced by abscisic acid. Northern-blot analysis of PLD in castor bean showed that the PLD mRNA levels were high in young and metabolically more active tissues such as expanding leaves, hypocotyl hooks, developing seeds, and young seedlings, and they decreased in mature tissues such as fully expanded leaves and developed seeds. These patterns of expression suggest a role of PLD in rapid cell growth, proliferation, and reproduction. PMID:9342861

  9. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    PubMed Central

    2011-01-01

    Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR). A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI) genes (OnTI1, OnTI2 and OnTI3), which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters. PMID:21473751

  10. Human Genes Encoding Transcription Factors and Chromatin-Modifying Proteins Have Low Levels of Promoter Polymorphism: A Study of 1000 Genomes Project Data

    PubMed Central

    Ignatieva, Elena V.; Levitsky, Victor G.; Kolchanov, Nikolay A.

    2015-01-01

    The expression level of each gene is controlled by its regulatory regions, which determine the precise regulation in a tissue-specific manner, according to the developmental stage of the body and the necessity of a response to external stimuli. Nucleotide substitutions in regulatory gene regions may modify the affinity of transcription factors to their specific DNA binding sites, affecting the transcription rates of genes. In our previous research, we found that genes controlling the sensory perception of smell and genes involved in antigen processing and presentation were overrepresented significantly among genes with high SNP contents in their promoter regions. The goal of our study was to reveal functional features of human genes containing extremely small numbers of SNPs in promoter regions. Two functional groups were found to be overrepresented among genes whose promoters did not contain SNPs: (1) genes involved in gene-specific transcription and (2) genes controlling chromatin organization. We revealed that the 5′-regulatory regions of genes encoding transcription factors and chromatin-modifying proteins were characterized by reduced genetic variability. One important exception from this rule refers to genes encoding transcription factors with zinc-coordinating DNA-binding domains (DBDs), which underwent extensive expansion in vertebrates, particularly, in primate evolution. Hence, we obtained new evidence for evolutionary forces shaping variability in 5′-regulatory regions of genes. PMID:26417590

  11. Molecular cloning and analysis of a receptor-like promoter of Gbvdr3 gene in sea island cotton.

    PubMed

    Zhang, B-J; Zhang, H-P; Chen, Q-Z; Tang, N; Wang, L-K; Wang, R-F; Zhang, B-L

    2016-01-01

    Verticillium wilt caused by soil borne fungus Verticillium dahliae could significantly reduce cotton yield. The Ve1 homologous gene Gbvdr3 is resistant to Verticillium wilt. In order to understand of the function of the promoter Gbvdr3 in Gossypium barbadense, the promoter region of the receptor-like gene Gbvdr3 was obtained by genome walking, and the cis-element in the promoter was identified using the PLACE software in this study. The sequence analysis showed that the promoter contained elements related to stress resistance and light regulation. The cloned promoter was fused to the GUS reporter gene and transformed into Arabidopsis. GUS expression was specifically detected in roots, flowers, and seeds, suggesting that the expression of Gbvdr3 is tissue-specific. Separation and characterization analysis of the promoter of Gbvdr3 provides a platform for further research and application of this gene. Thorough understanding of the function of the Gbvdr3 promoter is important for better understanding of Gbvdr3 function. These results indicated that the promoter of Gbvdr3 was a tissue-specific promoter. PMID:27323087

  12. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation.

    PubMed

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5 hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5 mC) and 5 hmC at a CCGG site within the 5' γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5 mC and 5 hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5 hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5 hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5 hmC and negatively correlated with 5 mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5 hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  13. Hydroxymethylcytosine and demethylation of the γ-globin gene promoter during erythroid differentiation

    PubMed Central

    Ruiz, Maria Armila; Rivers, Angela; Ibanez, Vinzon; Vaitkus, Kestis; Mahmud, Nadim; DeSimone, Joseph; Lavelle, Donald

    2015-01-01

    The mechanism responsible for developmental stage-specific regulation of γ-globin gene expression involves DNA methylation. Previous results have shown that the γ-globin promoter is nearly fully demethylated during fetal liver erythroid differentiation and partially demethylated during adult bone marrow erythroid differentiation. The hypothesis that 5-hydroxymethylcytosine (5hmC), a known intermediate in DNA demethylation pathways, is involved in demethylation of the γ-globin gene promoter during erythroid differentiation was investigated by analyzing levels of 5-methylcytosine (5mC) and 5hmC at a CCGG site within the 5′ γ-globin gene promoter region in FACS-purified cells from baboon bone marrow and fetal liver enriched for different stages of erythroid differentiation. Our results show that 5mC and 5hmC levels at the γ-globin promoter are dynamically modulated during erythroid differentiation with peak levels of 5hmC preceding and/or coinciding with demethylation. The Tet2 and Tet3 dioxygenases that catalyze formation of 5hmC are expressed during early stages of erythroid differentiation and Tet3 expression increases as differentiation proceeds. In baboon CD34+ bone marrow-derived erythroid progenitor cell cultures, γ-globin expression was positively correlated with 5hmC and negatively correlated with 5mC at the γ-globin promoter. Supplementation of culture media with Vitamin C, a cofactor of the Tet dioxygenases, reduced γ-globin promoter DNA methylation and increased γ-globin expression when added alone and in an additive manner in combination with either DNA methyltransferase or LSD1 inhibitors. These results strongly support the hypothesis that the Tet-mediated 5hmC pathway is involved in developmental stage-specific regulation of γ-globin expression by mediating demethylation of the γ-globin promoter. PMID:25932923

  14. A Novel Protein Isoform of the Multicopy Human NAIP Gene Derives from Intragenic Alu SINE Promoters

    PubMed Central

    Romanish, Mark T.; Nakamura, Hisae; Lai, C. Benjamin; Wang, Yuzhuo; Mager, Dixie L.

    2009-01-01

    The human neuronal apoptosis inhibitory protein (NAIP) gene is no longer principally considered a member of the Inhibitor of Apoptosis Protein (IAP) family, as its domain structure and functions in innate immunity also warrant inclusion in the Nod-Like Receptor (NLR) superfamily. NAIP is located in a region of copy number variation, with one full length and four partly deleted copies in the reference human genome. We demonstrate that several of the NAIP paralogues are expressed, and that novel transcripts arise from both internal and upstream transcription start sites. Remarkably, two internal start sites initiate within Alu short interspersed element (SINE) retrotransposons, and a third novel transcription start site exists within the final intron of the GUSBP1 gene, upstream of only two NAIP copies. One Alu functions alone as a promoter in transient assays, while the other likely combines with upstream L1 sequences to form a composite promoter. The novel transcripts encode shortened open reading frames and we show that corresponding proteins are translated in a number of cell lines and primary tissues, in some cases above the level of full length NAIP. Interestingly, some NAIP isoforms lack their caspase-sequestering motifs, suggesting that they have novel functions. Moreover, given that human and mouse NAIP have previously been shown to employ endogenous retroviral long terminal repeats as promoters, exaptation of Alu repeats as additional promoters provides a fascinating illustration of regulatory innovations adopted by a single gene. PMID:19488400

  15. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  16. Construction of a promoter probe vector autonomously maintained in Aspergillus and characterization of promoter regions derived from A. niger and A. oryzae genomes.

    PubMed

    Ozeki, K; Kanda, A; Hamachi, M; Nunokawa, Y

    1996-03-01

    We used a plasmid carrying a sequence for autonomous maintenance in Aspergillus (AMA1) and the E. coli uidA gene as a reporter gene to search the A. oryzae and A. niger genomes for DNA fragments having strong promoter activity. Beta-glucuronidase (GUS)-producing A. oryzae transformants containing the No. 8AN derived from A. niger, or the No. 9AO derived from A. oryzae, were constitutive for the expression of the uidA gene when cultivated in the presence of a variety of carbon and nitrogen sources. When the GUS-producing transformants were grown in liquid culture, the No. 8AN showed an increase of approximately 3-fold in GUS activity compared to the amyB (alpha-amylase encoding gene) promoter. There was also a corresponding increase in the amount of GUS gene-specific mRNA. When these transformants were grown as rice-koji, the No. 8AN showed an increase of approximately 6-fold compared to the amyB promoter, and the amount of GUS protein produced also increased. These strong promoter regions might be applicable to the production of other heterologous proteins in Aspergillus species. PMID:8901095

  17. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  18. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene.

    PubMed

    Schwachtgen, J L; Janel, N; Barek, L; Duterque-Coquillaud, M; Ghysdael, J; Meyer, D; Kerbiriou-Nabias, D

    1997-12-18

    von Willebrand factor (vWF) gene expression is restricted to endothelial cells and megakaryocytes. Previous results demonstrated that basal transcription of the human vWF gene is mediated through a promoter located between base pairs -89 and +19 (cap site: +1) which is functional in endothelial and non endothelial cells. Two DNA repeats TTTCCTTT correlating with inverted consensus binding sites for the Ets family of transcription factors are present in the -56/-36 sequence. In order to analyse whether these DNA elements are involved in transcription, human umbilical vein endothelial cells (HUVEC), bovine calf pulmonary endothelial cell line (CPAE), HeLa and COS cells were transfected with constructs containing deletions of the -89/+19 fragment, linked to the chloramphenicol acetyl transferase (CAT) reporter gene. The -60/+19 region exhibits significant promoter activity in HUVEC and CPAE cells only. The -42/+19 fragment is not active. Mutations of the -60/+19 promoter fragment in the 5' (-56/-49) Ets binding site abolish transcription in endothelial cells whereas mutations in the 3' (-43/-36) site does not. The -60/-33 fragment forms three complexes with proteins from HUVEC nuclear extracts in electrophoretic mobility shift assay which are dependent on the presence of the 5' Ets binding site. Binding of recombinant Ets-1 protein to the -60/-33 fragment gives a complex which also depends on the 5' site. The -60/+19 vWF gene core promoter is transactivated in HeLa cells by cotransfecting with Ets-1 or Erg (Ets-related gene) expression plasmids. In contrast to the wild type construct, transcription of the 5' site mutants is not increased by these expressed proteins. The results indicate that the promoter activity of the -60/+19 region of the vWF gene depends on transcription factors of the Ets family of which several members like Ets-1, Ets-2 and Erg are expressed in endothelium. Cotransfection of Ets-1 and Erg expression plasmids is sufficient to induce the -60/+19 v

  19. Signatures of accelerated somatic evolution in gene promoters in multiple cancer types

    PubMed Central

    Smith, Kyle S.; Yadav, Vinod K.; Pedersen, Brent S.; Shaknovich, Rita; Geraci, Mark W.; Pollard, Katherine S.; De, Subhajyoti

    2015-01-01

    Cancer-associated somatic mutations outside protein-coding regions remain largely unexplored. Analyses of the TERT locus have indicated that non-coding regulatory mutations can be more frequent than previously suspected and play important roles in oncogenesis. Using a computational method called SASE-hunter, developed here, we identified a novel signature of accelerated somatic evolution (SASE) marked by a significant excess of somatic mutations localized in a genomic locus, and prioritized those loci that carried the signature in multiple cancer patients. Interestingly, even when an affected locus carried the signature in multiple individuals, the mutations contributing to SASE themselves were rarely recurrent at the base-pair resolution. In a pan-cancer analysis of 906 samples from 12 tumor types, we detected SASE in the promoters of several genes, including known cancer genes such as MYC, BCL2, RBM5 and WWOX. Nucleotide substitution patterns consistent with oxidative DNA damage and local somatic hypermutation appeared to contribute to this signature in selected gene promoters (e.g. MYC). SASEs in selected cancer gene promoters were associated with over-expression, and also correlated with the age of onset of cancer, aggressiveness of the disease and survival. Taken together, our work detects a hitherto under-appreciated and clinically important class of regulatory changes in cancer genomes. PMID:25934800

  20. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    SciTech Connect

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi . E-mail: fzhao@uvm.edu

    2006-05-26

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid.

  1. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed

    Kefalas, P; Gray, F C; Allan, J

    1988-01-25

    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. PMID:3340546

  2. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed Central

    Kefalas, P; Gray, F C; Allan, J

    1988-01-01

    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. Images PMID:3340546

  3. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    SciTech Connect

    Yanagawa, H.; Nishio, H.; Takeshima, Y.

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  4. Genomic structure, gene expression, and promoter analysis of human multidrug resistance-associated protein 7

    SciTech Connect

    Kao, Hsin-Hsin; Chang, Ming-Shi; Cheng, Jan-Fang; Huang, Jin-Ding

    2002-03-15

    The multidrug resistance-associated protein (MRP) subfamily transporters associated with anticancer drug efflux are attributed to the multidrug-resistance of cancer cells. The genomic organization of human multidrug resistance-associated protein 7 (MRP7) was identified. The human MRP7 gene, consisting of 22 exons and 21 introns, greatly differs from other members of the human MRP subfamily. A splicing variant of human MRP7, MRP7A, expressed in most human tissues, was also characterized. The 1.93-kb promoter region of MRP7 was isolated and shown to support luciferase activity at a level 4- to 5-fold greater than that of the SV40 promoter. Basal MRP7 gene expression was regulated by 2 regions in the 5-flanking region at 1,780 1,287 bp, and at 611 to 208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity was increased by 226 percent by genotoxic 2-acetylaminofluorene and 347 percent by the histone deacetylase inhibitor, trichostatin A. The protein was expressed in the membrane fraction of transfected MDCK cells.

  5. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  6. Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters.

    PubMed

    Aldea, M; Garrido, T; Pla, J; Vicente, M

    1990-11-01

    The cell division ftsQAZ cluster and the ftsZ-dependent bolA morphogene of Escherichia coli are found to be driven by gearboxes, a distinct class of promoters characterized by showing an activity that is inversely dependent on growth rate. These promoters contain specific sequences upstream from the mRNA start point, and their -10 region is essential for the inverse growth rate dependence. Gearbox promoters are essential for driving ftsQAZ and bolA gene expression so that the encoded products are synthesized at constant amounts per cell independently of cell size. This mode of regulation would be expected for the expression of proteins that either play a regulatory role in cell division or form a stoichiometric component of the septum, a structure that, independently of cell size and growth rate, is produced once per cell cycle. PMID:1698623

  7. Structural and functional analysis of the mouse mdr1b gene promoter.

    PubMed

    Cohen, D; Piekarz, R L; Hsu, S I; DePinho, R A; Carrasco, N; Horwitz, S B

    1991-02-01

    The overproduction of P-glycoprotein, an integral membrane protein thought to function as a drug efflux pump, is the hallmark of the multidrug resistance phenotype. In murine multidrug resistant J774.2 cell lines, distinct mdr genes, mdr1a and mdr1b, encode unique P-glycoprotein isoforms. To examine the transcriptional regulation of the mdr1b gene, its promoter was isolated and characterized. The transcription initiation site was mapped by primer extension, and the 5'-flanking region was sequenced. Several potential regulatory elements were identified in this region. A transient expression vector was constructed by fusion of 540 base pairs of 5'-flanking sequence and part of the first untranslated exon to the chloramphenicol acetyltransferase (CAT) gene. When transfected into monkey kidney COS-1, rat pituitary GH3 or T47D human breast cells, the mdr1b 5'-flanking sequences were capable of driving CAT expression. Transient transfection studies using deletion subclones of the mdr1b-CAT construct were done to locate potential cis-acting sequences. The studies indicate the presence of cis-acting elements in the 5'-flanking region of the mdr1b gene. The implications of these findings for expression and regulation of the mdr1b gene are discussed. PMID:1671222

  8. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    PubMed Central

    2011-01-01

    Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue. PMID:21668942

  9. Regulation of a bovine nonclassical major histocompatibility complex class I gene promoter.

    PubMed

    O'Gorman, Grace M; Al Naib, Abdullah; Naib, Abdullah Al; Ellis, Shirley A; Mamo, Solomon; O'Doherty, Alan M; Lonergan, Pat; Fair, Trudee

    2010-08-01

    Studies have shown in humans and other species that the major histocompatibility complex class I (MHC-I) region is involved at a number of levels in the establishment and maintenance of pregnancy. The aim of this study was to characterize how a bovine nonclassical MHC-I gene (NC1) is regulated. Initial serial deletion experiments of a 2-kb fragment of the NC1 promoter identified regions with positive regulatory elements in the proximal promoter and evidence for a silencer module(s) further upstream that cooperatively contributed to constitutive NC1 expression. The cytokines interferon tau (IFNT), interferon gamma (IFNG), and interleukin 4 (IL4) significantly increased luciferase expression in NC1 promoter reporter constructs and endogenous NC1 mRNA levels in a bovine endometrial cell line. In addition, IFNG, IL3, IL4, and progesterone significantly increased Day 7 bovine blastocyst NC1 mRNA expression when supplemented during in vitro embryo culture. Site-directed mutagenesis analysis identified a STAT6 binding site that conferred IL4 responsiveness in the NC1 proximal promoter. Furthermore, methylation treatment of the proximal promoter, which contains a CpG island, completely abrogated constitutive NC1 expression. Overall, the findings presented here suggest that constitutive NC1 expression is regulated positively by elements in the proximal promoter, which are further controlled by upstream silencer modules. The promoter is responsive to IFNT, IFNG, and IL4, suggesting possible roles for these cytokines in bovine preimplantation embryo survival and/or maternal-fetal tolerance. Our studies also suggest that methylation of the proximal promoter, in particular, could play a significant role in regulating NC1 expression. PMID:20427761

  10. Analysis of Hypothetical Promoter Domains of DKFZp564A1164, NPHS1 and HSPOX1 Genes

    SciTech Connect

    Hammond, S S

    2003-11-29

    For this study, a high throughput method for identifying and testing regulatory elements was examined. In addition, the validity of promoters predicted by FirstEF was tested. It was found that by combining computer based promoter and first exon predictions from FirstEF (Davuluri et al., 2001) with PCR-based cloning to generate luciferase reporter constructs, and by testing reporter activity in cultured mammalian cells plated in a 96 well format one could identify promoter activity in a relatively high throughput manner. The data generated in this study suggest that FirstEF predictions are sometimes incorrect. Therefore, having a strategy for defining which FirstEF predicted promoters to test first may accelerate the process. Initially testing promoters that are at a confirmed transcription start site for a gene, at a possible alternate transcription start site or in a region of conserved sequence would be the best candidates, while promoters predicted in gene desert regions may not be as easy to confirm. The luciferase assay lent itself very well to the high throughput search, however the subcloning did not always go smoothly. The numerous steps that this traditional subcloning method requires were time consuming and increased the opportunities for errors. A faster method that skips many of the traditional subcloning steps, such as the Creator{trademark} system by Clontech is currently being investigated by our lab. The development and testing of substantially larger enhancer/silencer regulatory elements may not be possible at this time using these high throughput methods. These regulatory elements are generally GC rich making them more difficult to PCR and subclone. Additionally, confirming upstream untranslated first exons was not possible within this time scale using the SMART RACE protocol. It will be necessary to further explore the limitations within these procedures in order to confirm these and future regulatory elements. Alterations and modifications to

  11. Effects of dietary intake and genetic factors on hypermethylation of the hMLH1 gene promoter in gastric cancer

    PubMed Central

    Nan, Hong-Mei; Song, Young-Jin; Yun, Hyo-Yung; Park, Joo-Seung; Kim, Heon

    2005-01-01

    AIM: Hypermethylation of the promoter of the hMLH1 gene, which plays an important role in mismatch repair during DNA replication, occurs in more than 30% of human gastric cancer tissues. The purpose of this study was to investigate the effects of environmental factors, genetic polymorphisms of major metabolic enzymes, and microsatellite instability on hypermethylation of the promoter of the hMLH1 gene in gastric cancer. METHODS: Data were obtained from a hospital-based, case-control study of gastric cancer. One hundred and ten gastric cancer patients and 220 age- and sex-matched control patients completed a structured questionnaire regarding their exposure to environmental risk factors. Hypermethylation of the hMLH1 gene promoter, polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, ALDH2 and L-myc genes, microsatellite instability and mutations of p53 and Ki-ras genes were investigated. RESULTS: Both smoking and alcohol consumption were associated with a higher risk of gastric cancer with hypermethylation of the hMLH1 gene promoter. High intake of vegetables and low intake of potato were associated with increased likelihood of gastric cancer with hypermethylation of the hMLH1 gene promoter. Genetic polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, ALDH2, and L-myc genes were not significantly associated with the risk of gastric cancer either with or without hypermethylation in the promoter of the hMLH1 gene. Hypermethylation of the hMLH1 promoter was significantly associated with microsatellite instability (MSI): 10 of the 14 (71.4%) MSI-positive tumors showed hypermethylation, whereas 28 of 94 (29.8%) the MSI-negative tumors were hypermethylated at the hMLH1 promoter region. Hypermethylation of the hMLH1 gene promoter was significantly inversely correlated with mutation of the p53 gene. CONCLUSION: These results suggest that cigarette smoking and alcohol consumption may influence the development of hMLH1-positive gastric cancer. Most dietary factors and

  12. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice. PMID:18952157

  13. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    PubMed Central

    2012-01-01

    Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3%) of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p < 0.05), while CASP8 with older (p < 0.01). MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p < 0.05), while methylation of CASP8 was more frequent in patients who survived shorter than 36 months (p < 0.05). Cox regression analysis showed patient age, treatment, MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p < 0.05). MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome. PMID:22672670

  14. Structure and expression of the nuclear gene coding for the chloroplast ribosomal protein L21: developmental regulation of a housekeeping gene by alternative promoters.

    PubMed Central

    Lagrange, T; Franzetti, B; Axelos, M; Mache, R; Lerbs-Mache, S

    1993-01-01

    We have cloned and sequenced the nuclear gene of the chloroplast ribosomal protein L21 (rpl21) of Spinacia oleracea. The gene consists of five exons and four introns. All introns are located in the sequence which corresponds to the Escherichia coli-like central core of the protein. L21 mRNA is present in photosynthetic (leaves) and nonphotosynthetic (roots and seeds) plant organs, although large quantitative differences exist. Primer extension and S1 nuclease mapping experiments revealed the existence of two types of transcripts in leaves. The two corresponding start sites were defined as P1 and P2. In roots and seeds, we found only the shorter of the two transcripts (initiated at P2). The nucleotide sequence surrounding P2 resembles promoters for housekeeping and vertebrate r-protein genes. Analysis of several promoter constructions by transient expression confirmed that both transcripts originate from transcription initiation. Results are interpreted to mean that the expression of the rpl21 gene is regulated by alternative promoters. One of the promoters (P2) is constitutive, and the other one (P1) is specifically induced in leaves, i.e., its activation should be related to the transformation of amyloplasts or proplastids to chloroplasts. The gene thus represents the first example of a housekeeping gene which is regulated by the organ-specific usage of alternative promoters. Primer extension analysis and S1 nuclease mapping of another nucleus-encoded chloroplast ribosomal protein gene (rps1) give evidence that the same type of regulation by two-promoter usage might be a more general phenomenon of plant chloroplast-related ribosomal protein genes. Preliminary results indicate that presence of conserved sequences within the rpl21 and rps1 promoter regions which compete for the same DNA binding activities. Images PMID:8455634

  15. UpSET recruits HDAC complexes and restricts chromatin accessibility and histone acetylation at promoter regions

    PubMed Central

    Rincon-Arano, Hector; Halow, Jessica; Delrow, Jeffrey J.; Parkhurst, Susan M.; Groudine, Mark

    2012-01-01

    Developmental gene expression results from the orchestrated interplay between genetic and epigenetic mechanisms. Here we describe upSET, a transcriptional regulator encoding a SET domain-containing protein recruited to active and inducible genes in Drosophila. However, unlike other Drosophila SET proteins associated with gene transcription, UpSET is part of an Rpd3/Sin3-containing complex that restricts chromatin accessibility and histone acetylation to promoter regions. In the absence of UpSET, active chromatin marks and chromatin accessibility increase and spread to genic and flanking regions due to destabilization of the histone deacetylase complex. Consistent with this, transcriptional noise increases, as manifest by activation of repetitive elements and off-target genes. Interestingly, upSET mutant flies are female sterile due to up-regulation of key components of Notch signaling during oogenesis. Thus UpSET defines a class of metazoan transcriptional regulators required to fine tune transcription by preventing the spread of active chromatin. PMID:23177352

  16. Analysis of the rolC promoter region involved in somatic embryogenesis-related activation in carrot cell cultures.

    PubMed Central

    Fujii, N; Yokoyama, R; Uchimiya, H

    1994-01-01

    In cell cultures of carrot (Daucus carota L.), somatic embryogenesis can be induced by transferring cells from a medium containing 2,4-dichlorophenoxyacetic acid (2,4-D) to one devoid of 2,4-D. Previous analysis of transgenic carrot cells containing the 5' non-coding sequence of the Ri plasmid rolC and a structural gene for bacterial beta-glucuronidase (uidA) has shown that the chimeric gene is actively expressed after induction of somatic embryogenesis. In this study, we demonstrate that activation of the rolC promoter is dependent on the process of embryo development but not on the duration of the cell culture in 2,4-D-free medium. We also analyzed the cis region of the rolC promoter that is responsible for somatic embryogenesis-related activation (SERA), namely relatively low beta-glucuronidase (GUS) activity in calli and proembryogenic masses (PEM) and high GUS activity in heart- and torpedo-stage embryos. When the -255-bp region of the rolC gene was used, SERA was retained. Internal deletions within this -255-bp region did not alter SERA by the rolC promoter. Furthermore, when a rolC promoter fragment (-848 to -94 bp) was fused to the cauliflower mosaic virus (CaMV) 35S core region (-90 to +6 bp), it conferred relatively low GUS activity in calli and PEM but high GUS activity in heart and torpedo embryos. When -848 to -255-bp or -255- to -94-bp fragments of the rolC promoter were fused to the same CaMV 35S core region, GUS activity patterns were not related to somatic embryogenesis. These results suggest that the combination of several regulatory regions in the rolC promoter may be required for SERA in carrot cell cultures. PMID:8016259

  17. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium. PMID:10542319

  18. Evolution of a Sigma Factor: An All-In-One of Gene Duplication, Horizontal Gene Transfer, Purifying Selection, and Promoter Differentiation

    PubMed Central

    López-Leal, Gamaliel; Cevallos, Miguel A.; Castillo-Ramírez, Santiago

    2016-01-01

    Sigma factors are an essential part of bacterial gene regulation and have been extensively studied as far as their molecular mechanisms and protein structure are concerned. However, their molecular evolution, especially for the alternative sigma factors, is poorly understood. Here, we analyze the evolutionary forces that have shaped the rpoH sigma factors within the alphaproteobacteria. We found that an ancient duplication gave rise to two major groups of rpoH sigma factors and that after this event horizontal gene transfer (HGT) occurred in rpoH1 group. We also noted that purifying selection has differentially affected distinct parts of the gene; singularly, the gene segment that encodes the region 4.2, which interacts with the −35 motif of the RpoH-dependent genes, has been under relaxed purifying selection. Furthermore, these two major groups are clearly differentiated from one another regarding their promoter selectivity, as rpoH1 is under the transcriptional control of σ70 and σ32, whereas rpoH2 is under the transcriptional control of σ24. Our results suggest a scenario in which HGT, gene loss, variable purifying selection and clear promoter specialization occurred after the ancestral duplication event. More generally, our study offers insights into the molecular evolution of alternative sigma factors and highlights the importance of analyzing not only the coding regions but also the promoter regions. PMID:27199915

  19. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  20. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    PubMed

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  1. Mapping and validation of Xanthomonas citri subsp citri genes regulated by putative plant-inducible promoter box (PIP-box).

    PubMed

    Carvalho, F M S; Oliveira, J C F; Laia, M L; Jacob, T R; Ferreira, R M; Ferro, M I T; Tezza, R I D; Zingaretti, S M; Silva, C F; Ferro, J A

    2016-01-01

    Citrus canker, caused by the Gram-negative bacterium Xanthomonas citri subsp citri (Xac), is a major disease affecting citriculture worldwide, because of the susceptibility of the host and the lack of efficient control methods. Previous studies have reported that some genes of phytopathogenic bacteria possess a consensus nucleotide sequence (TTCGC...N15...TTCGC) designated the "plant-inducible-promoter box" (PIP box) located in the promoter region, which is responsible for activating the expression of pathogenicity and virulence factors when the pathogen is in contact with the host plant. In this study, we mapped and investigated the expression of 104 Xac genes associated with the PIP box sequences using a macroarray analysis. Xac gene expression was observed during in vitro (Xac grown for 12 or 20 h in XAM1 induction medium) or in vivo (bacteria grown in orange leaves for 3 to 5 days) infection conditions. Xac grown in non-induction NB liquid medium was used as the control. cDNA was isolated from bacteria grown under the different conditions and hybridized to the macroarray, and 32 genes differentially expressed during the infection period (in vitro or in vivo induction) were identified. The macroarray results were validated for some of the genes through semi-quantitative RT-PCR, and the functionality of the PIP box-containing promoter was demonstrated by activating b-glucuronidase reporter gene activity by the PIP box-containing promoter region during Xac-citrus host interaction. PMID:27173329

  2. Characterization of the promoter and 5'-UTR intron of oleic acid desaturase (FAD2) gene in Brassica napus.

    PubMed

    Xiao, Gang; Zhang, Zhen Qian; Yin, Chang Fa; Liu, Rui Yang; Wu, Xian Meng; Tan, Tai Long; Chen, She Yuan; Lu, Chang Ming; Guan, Chun Yun

    2014-07-15

    In the present study, we characterized the transcriptional regulatory region (KF038144) controlling the expression of a constitutive FAD2 in Brassica napus. There are multiple FAD2 gene copies in B. napus genome. The FAD2 gene characterized and analyzed in the study is located on chromosome A5 and was designated as BnFAD2A5-1. BnFAD2A5-1 harbors an intron (1,192 bp) within its 5'-untranslated region (5'-UTR). This intron demonstrated promoter activity. Deletion analysis of the BnFAD2A5-1 promoter and intron through the β-glucuronidase (GUS) reporter system revealed that the -220 to -1 bp is the minimum promoter region, while -220 to -110 bp and +34 to +285 bp are two important regions conferring high-levels of transcription. BnFAD2 transcripts were induced by light, low temperature, and abscisic acid (ABA). These observations demonstrated that not only the promoter but also the intron are involved in controlling the expression of the BnFAD2A5-1 gene. The intron-mediated regulation is an essential aspect of the gene expression regulation. PMID:24811682

  3. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  4. High-fidelity promoter profiling reveals widespread alternative promoter usage and transposon-driven developmental gene expression

    PubMed Central

    Batut, Philippe; Dobin, Alexander; Plessy, Charles; Carninci, Piero; Gingeras, Thomas R.

    2013-01-01

    Many eukaryotic genes possess multiple alternative promoters with distinct expression specificities. Therefore, comprehensively annotating promoters and deciphering their individual regulatory dynamics is critical for gene expression profiling applications and for our understanding of regulatory complexity. We introduce RAMPAGE, a novel promoter activity profiling approach that combines extremely specific 5′-complete cDNA sequencing with an integrated data analysis workflow, to address the limitations of current techniques. RAMPAGE features a streamlined protocol for fast and easy generation of highly multiplexed sequencing libraries, offers very high transcription start site specificity, generates accurate and reproducible promoter expression measurements, and yields extensive transcript connectivity information through paired-end cDNA sequencing. We used RAMPAGE in a genome-wide study of promoter activity throughout 36 stages of the life cycle of Drosophila melanogaster, and describe here a comprehensive data set that represents the first available developmental time-course of promoter usage. We found that >40% of developmentally expressed genes have at least two promoters and that alternative promoters generally implement distinct regulatory programs. Transposable elements, long proposed to play a central role in the evolution of their host genomes through their ability to regulate gene expression, contribute at least 1300 promoters shaping the developmental transcriptome of D. melanogaster. Hundreds of these promoters drive the expression of annotated genes, and transposons often impart their own expression specificity upon the genes they regulate. These observations provide support for the theory that transposons may drive regulatory innovation through the distribution of stereotyped cis-regulatory modules throughout their host genomes. PMID:22936248

  5. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    SciTech Connect

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  6. Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

    PubMed

    Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

    2013-01-01

    In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells. PMID:24391761

  7. Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

    SciTech Connect

    Jefferis, J.; Rakoczy, J.; Simmons, D.G.; Dawson, P.A.

    2013-03-29

    Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the human SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.

  8. Sox3 binds to 11β-hydroxysteroid dehydrogenase gene promoter suggesting transcriptional interaction in catfish.

    PubMed

    Rajakumar, Anbazhagan; Senthilkumaran, Balasubramanian

    2016-04-01

    In fishes, the expression of steroidogenic enzyme genes and their related transcription factors (TFs) are critical for the regulation of steroidogenesis and gonadal development. 11-KT is the potent androgen and hence, 11β-hsd, enzyme involved in 11-KT production is important. Regulation of 11β-hsd gene was never studied in any fishes. At first 11β-hsd was cloned and recombinant protein was tested for enzyme activity prior to expression and promoter motif analysis. Expression changes revealed stage- and sex-dependent increase in the ontogenic studies. Further, 11β-hsd expression was higher during spawning phase of reproductive cycle and was found to be gonadotropin inducible both in vivo and in vitro. ∼2kb of 5' upstream region of 11β-hsd, was cloned from catfish genomic DNA library and in silico promoter analysis revealed putative TF binding sites such as Sox3, Wt1, Pax2, Dmrt1 and Ad4BP/SF-1. Luciferase reporter assay using the sequential deletion constructs in human embryonic kidney and Chinese hamster ovary cells revealed considerable promoter activity of the constructs containing Sox3, but not with other motifs largely. Site-directed mutagenesis, Sox3 over expression, electrophoretic mobility shift and chromatin immunoprecipitation assays further substantiated the binding of Sox3 to its corresponding cis-acting element in the upstream promoter motif of 11β-hsd. This is the first report to show that Sox3 binds to the 11β-hsd gene promoter and transactivates to regulate male reproduction in a teleost. PMID:26772480

  9. Human PSENEN and U2AF1L4 genes are concertedly regulated by a genuine bidirectional promoter.

    PubMed

    Didych, D A; Shamsutdinov, M F; Smirnov, N A; Akopov, S B; Monastyrskaya, G S; Uspenskaya, N Y; Nikolaev, L G; Sverdlov, E D

    2013-02-15

    Head-to-head genes with a short distance between their transcription start sites may constitute up to 10% of all genes in the genomes of various species. It was hypothesized that this intergenic space may represent bidirectional promoters which are able to initiate transcription of both genes, but the true bidirectionality was proved only for a few of them. We present experimental evidence that, according to several criteria, a 269 bp region located between the PSENEN and U2AF1L4 human genes is a genuine bidirectional promoter regulating a concerted divergent transcription of these genes. Concerted transcription of PSENEN and U2AF1L4 can be necessary for regulation of T-cell activity. PMID:23246698

  10. Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene.

    PubMed

    Banday, Abdul Rouf; Azim, Shafquat; Tabish, Mohammad

    2011-11-01

    Prkar1a gene encodes regulatory type 1 alpha subunit (RIα) of cAMP-dependent protein kinase (PKA) in mouse. The role of this gene has been implicated in Carney complex and many cancer types that suggest its involvement in physiological processes like cell cycle regulation, growth and/or proliferation. We have identified and sequenced partial cDNA clones encoding four alternatively spliced transcripts of mouse Prkar1a gene. These transcripts have alternate 5' UTR structure which results from splicing of three exons (designated as E1a, E1b, and E1c) to canonical exon 2. The designated transcripts T1, T2, T3, and T4 contain 5' UTR exons as E1c, E1a + E1b, E1a, and E1b, respectively. The transcript T1 corresponded to earlier reported transcript in GenBank. In silico study of genomic DNA sequence revealed three distinct promoter regions namely, P1, P2, and P3 upstream of the exons E1a, E1b, and E1c, respectively. P1 is non-CpG-related promoter but P2 and P3 are CpG-related promoters; however, all three are TATA less. RT-PCR analysis demonstrated the expression of all four transcripts in late postnatal stages; however, these were differentially regulated in early postnatal stages of 0.5 day, 3 day, and 15 day mice in different tissue types. Variations in expression of Prkar1a gene transcripts suggest their regulation from multiple promoters that respond to a variety of signals arising in or out of the cell in tissue and developmental stage-specific manner. PMID:21638026

  11. Expression patterns and promoter activity of the cold-regulated gene ci21A of potato.

    PubMed Central

    Schneider, A; Salamini, F; Gebhardt, C

    1997-01-01

    Storage of potato (Solanum tuberosum) tubers at 4 degrees C is associated with the accumulation of several transcripts. DNA sequence analysis of cDNA clone CI21, which corresponds to one of the cold-induced transcripts, revealed high homology to transcripts of tomato (Lycopersicon esculentum) and wild potato (Solanum chacoense) induced by ripening and water stress. Two homologous, nonallelic genes, ci21A and ci21B, were isolated and sequenced. Northern blot analysis showed that CI21 transcripts were present at the highest levels in cold-stored tubers, at lower levels in stems and roots, and at the lowest levels in leaves and tubers stored at room temperature. Treatment with abscisic acid, heat, and a high concentration of salt had no marked effect on CI21 transcript levels in tubers and leaves. Drought was the only stress treatment that induced CI21 transcripts in leaves, but it did not do so in tubers. Western blot analysis detected CI21 protein only in tubers. Chimeric gene constructs between the putative ci21A promoter region and the uidA reporter gene were tested in transgenic potato plants for induction of beta-glucuronidase activity by low temperature. A 2-fold increase of beta-glucuronidase activity in response to tuber storage at 4 degrees C was observed for fragments between 380 and 2000 bp of the ci21A promoter region. PMID:9046587

  12. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.

    2009-01-01

    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  13. Germin-like protein 2 gene promoter from rice is responsive to fungal pathogens in transgenic potato plants.

    PubMed

    Munir, Faiza; Hayashi, Satomi; Batley, Jacqueline; Naqvi, Syed Muhammad Saqlan; Mahmood, Tariq

    2016-01-01

    Controlled transgene expression via a promoter is particularly triggered in response to pathogen infiltration. This is significant for eliciting disease-resistant features in crops through genetic engineering. The germins and germin-like proteins (GLPs) are known to be associated with plant and developmental stages. The 1107-bp Oryza sativa root GLP2 (OsRGLP2) gene promoter fused to a β-glucuronidase (GUS) reporter gene was transformed into potato plants through an Agrobacterium-mediated transformation. The OsRGLP2 promoter was activated in response to Fusarium solani (Mart.) Sacc. and Alternaria solani Sorauer. Quantitative real-time PCR results revealed 4-5-fold increase in promoter activity every 24 h following infection. There was a 15-fold increase in OsRGLP2 promoter activity after 72 h of F. solani (Mart.) Sacc. treatment and a 12-fold increase observed with A. solani Sorauer. Our results confirmed that the OsRGLP2 promoter activity was enhanced under fungal stress. Furthermore, a hyperaccumulation of H2O2 in transgenic plants is a clear signal for the involvement of OsRGLP2 promoter region in the activation of specific genes in the potato genome involved in H2O2-mediated defense response. The OsRGLP2 promoter evidently harbors copies of GT-I and Dof transcription factors (AAAG) that act in response to elicitors generated in the wake of pathogen infection. PMID:26277722

  14. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  15. Evolution of the C4 phosphoenolpyruvate carboxylase promoter of the C4 species Flaveria trinervia: the role of the proximal promoter region

    PubMed Central

    Engelmann, Sascha; Zogel, Corinna; Koczor, Maria; Schlue, Ute; Streubel, Monika; Westhoff, Peter

    2008-01-01

    Background The key enzymes of photosynthetic carbon assimilation in C4 plants have evolved independently several times from C3 isoforms that were present in the C3 ancestral species. The C4 isoform of phosphoenolpyruvate carboxylase (PEPC), the primary CO2-fixing enzyme of the C4 cycle, is specifically expressed at high levels in mesophyll cells of the leaves of C4 species. We are interested in understanding the molecular changes that are responsible for the evolution of this C4-characteristic PEPC expression pattern, and we are using the genus Flaveria (Asteraceae) as a model system. It is known that cis-regulatory sequences for mesophyll-specific expression of the ppcA1 gene of F. trinervia (C4) are located within a distal promoter region (DR). Results In this study we focus on the proximal region (PR) of the ppcA1 promoter of F. trinervia and present an analysis of its function in establishing a C4-specific expression pattern. We demonstrate that the PR harbours cis-regulatory determinants which account for high levels of PEPC expression in the leaf. Our results further suggest that an intron in the 5' untranslated leader region of the PR is not essential for the control of ppcA1 gene expression. Conclusion The allocation of cis-regulatory elements for enhanced expression levels to the proximal region of the ppcA1 promoter provides further insight into the regulation of PEPC expression in C4 leaves. PMID:18208593

  16. The ftsQ1p gearbox promoter of Escherichia coli is a major sigma S-dependent promoter in the ddlB-ftsA region.

    PubMed

    Ballesteros, M; Kusano, S; Ishihama, A; Vicente, M

    1998-10-01

    The most potent promoters in the ddlB-ftsA region of the dcw cluster have been analysed for sigmaS-dependent transcription. Only the gearbox promoter ftsQ1p was found to be transcribed in vitro by RNA polymerase holoenzyme coupled to sigmaS (EsigmaS). This dependency on sigmaS was also found in vivo when single-copy fusions to a reporter gene were analysed in rpoS and rpoS+ backgrounds. Although ftsQ1p can be transcribed by RNA polymerase containing either sigmaD or sigmaS, there is a preference for EsigmaS when the assay conditions include potassium glutamate and supercoiled templates, a property shared with the bolA1p gearbox promoter. The rest of the promoters assayed, ftsQ2p and ftsZ2p3p4p, similarly to the control bolA2p promoter, were preferentially transcribed by EsigmaD, the housekeeper polymerase. The ftsQ1p and the bolA1p promoters also share the presence of AT-rich sequences upstream of the - 35 region and the requirement for an intact wild-type alpha-subunit for a proficient transcription, allowing their joint classification as gearboxes. PMID:9791185

  17. US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY.

    SciTech Connect

    Killinger, M. H.; Griggs, J. R.; Apt, Kenneth E.; Doyle, J. E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  18. Organization of the noncontiguous promoter components of adenovirus VAI RNA gene is strikingly similar to that of eucaryotic tRNA genes.

    PubMed Central

    Bhat, R A; Metz, B; Thimmappaya, B

    1983-01-01

    The intragenic transcriptional control region (internal promoter) of the adenovirus type 2 VAI RNA gene was mutated by deletion, insertion, and substitution of DNA sequences at the plasmid level. The mutant plasmids were assayed for in vitro transcriptional activity by using HeLa cell extracts. The mutant clones with substitution or insertion of DNA sequences or both between nucleotides +18 and +53 of the VAI RNA gene were all transcriptionally active, although to various extents. Substitution of unrelated DNA sequences up to +26 or between +54 and +61 abolished the transcriptional activity completely. Based on these results, the intragenic promoter sequences of the VAI RNA gene can be subdivided into two components: element A, +10 to +18; and element B, +54 to +69. The distance between the A and B components could be enlarged from its normal 35 base pairs to 75 base pairs without destroying the transcriptional activity. However, a deletion of 4 or 6 base pairs in the DNA segment separating the A and B components (segment C) reduced the transcriptional activity of the genes to less than 2% of that of the wild type. When the VAI RNA gene with its element A or B was substituted for the corresponding element A or B of the Xenopus laevis tRNAMet gene, the hybrid genes transcribed close to the level of the wild-type VAI RNA gene and about 10- to 20-fold more efficiently than the tRNAMet gene. Thus, the organization of DNA sequences in the internal promoter of the VAI RNA gene appears to be very similar to that of eucaryotic tRNA genes. This similarity suggests an evolutionary relationship of the VAI RNA gene to tRNA genes. Images PMID:6656762

  19. CpG Promoter Methylation Status is not a Prognostic Indicator of Gene Expression in Beryllium Challenge

    PubMed Central

    Tooker, Brian C.; Ozawa, Katie; Newman, Lee S.

    2016-01-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the 6 CpG sites tested. H36.12J cell TNFα expression was shown to be metal specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNα promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p < 1.17 × 10−9). These findings suggest that in this cell system, promoter hypo

  20. CpG promoter methylation status is not a prognostic indicator of gene expression in beryllium challenge.

    PubMed

    Tooker, Brian C; Ozawa, Katherine; Newman, Lee S

    2016-05-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the six CpG sites tested. H36.12J cell TNFα expression was shown to be metal-specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride, but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNγ promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p < 1.17 × 10(-9)). These findings suggest that, in this cell system, promoter hypo

  1. Identification of a functional antioxidant responsive element in the promoter of the Chinese hamster carbonyl reductase 3 (Chcr3) gene.

    PubMed

    Miura, Takeshi; Taketomi, Ayako; Nakabayashi, Toshikatsu; Nishinaka, Toru; Terada, Tomoyuki

    2015-07-01

    CHCR3, a member of the short-chain dehydrogenase/reductase superfamily, is a carbonyl reductase 3 enzyme in Chinese hamsters. Carbonyl reductase 3 in humans has been believed to involve the metabolism and/or pharmacokinetics of anthracycline drugs, and the mechanism underlying the gene regulation has been investigated. In this study, the nucleotide sequence of the Chcr3 promoter was originally determined, and its promoter activity was characterised. The proximal promoter region is TATA-less and GC-rich, similar to the promoter region of human carbonyl reductase 3. Cobalt stimulated the transcriptional activity of the Chcr3 gene. The results of a luciferase gene reporter assay demonstrated that cobalt-induced stimulation required an antioxidant responsive element. Forced expression of Nrf2, the transcription factor that binds to antioxidant responsive elements, enhanced the transcriptional activity of the Chcr3 gene. These results suggest that cobalt induces the expression of the Chcr3 gene via the Nrf2-antioxidant responsive element pathway. PMID:25677373

  2. Characterization of the 5' flanking region of the human D1A dopamine receptor gene.

    PubMed Central

    Minowa, M T; Minowa, T; Monsma, F J; Sibley, D R; Mouradian, M M

    1992-01-01

    To study how the expression of the D1A dopamine receptor gene is regulated, a human genomic clone was isolated by using a rat cDNA as probe. A 2.3-kilobase genomic fragment spanning -2571 through -236 relative to the adenosine of the first methionine codon was sequenced. The gene has an intron of 116 base pairs in the 5' noncoding region, nucleotides -599 through -484 as determined by S1 mapping and reverse transcription-PCR. It has multiple transcription initiation sites located between -1061 and -1040. The promoter region lacks a TATA box and a CAAT box, is rich in G+C content, and has multiple putative binding sites for transcription factor Sp1. Thus, the promoter region of the human D1A gene has features of "housekeeping" genes. However, it also has consensus sequences for AP1 and AP2 binding sites and a putative cAMP response element. The ability of four deletion mutants of the 2.3-kilobase fragment to modulate transcription of the heterologous chloramphenicol acetyltransferase gene in the promoterless plasmid pCAT-Basic was determined. All mutants demonstrated substantial transcriptional activity in the murine neuroblastoma cell line NS20Y, which expresses the D1A gene endogenously. Transient expression assays suggested the presence of a positive modulator between nucleotides -1340 and -1102, and a negative modulator between -1730 and -1341. The four genomic fragments had no or very low transcriptional activity in NB41A3, C6, and Hep G2 cells, which are not known to express this gene. Thus, the human D1A gene belongs to the category of tissue-specific, regulated genes that have housekeeping-type promoters. Images PMID:1557411

  3. AbrB, a regulator of gene expression in Bacillus, interacts with the transcription initiation regions of a sporulation gene and an antibiotic biosynthesis gene.

    PubMed Central

    Robertson, J B; Gocht, M; Marahiel, M A; Zuber, P

    1989-01-01

    The abrB gene of Bacillus subtilis is believed to encode a repressor that controls the expression of genes involved in starvation-induced processes such as sporulation and the production of antibiotics and degradative enzymes. Two such genes, spoVG, a sporulation gene of B. subtilis, and tycA, which encodes tyrocidine synthetase I of the tyrocidine biosynthetic pathway in Bacillus brevis, are negatively regulated by abrB in B. subtilis. To examine the role of abrB in the repression of gene transcription, the AbrB protein was purified and then tested for its ability to bind to spoVG and tycA promoter DNA. In a gel mobility shift experiment, AbrB was found to bind to a DNA fragment containing the sequence from -95 to +61 of spoVG. AbrB protein exhibited reduced affinity for DNA of two mutant forms of the spoVG promoter that had been shown to be insensitive to abrB-dependent repression in vivo. These studies showed that an upstream A + T-rich sequence from -37 to -95 was required for optimal AbrB binding. AbrB protein was also observed to bind to the tycA gene within a region between the transcription start site and the tycA coding sequence as well as to a region containing the putative tycA promoter. These findings reinforce the hypothesis that AbrB represses gene expression through its direct interaction with the transcription initiation regions of genes under its control. Images PMID:2554317

  4. Identification and characterization of the retinoic acid response elements in the human RIG1 gene promoter

    SciTech Connect

    Jiang, S.-Y.; Wu, M.-S.; Chen, L.-M.; Hung, M.-W.; Lin, H.-E.; Chang, G.-G.; Chang, T.-C. . E-mail: tcchang@ndmctsgh.edu.tw

    2005-06-03

    The expression of retinoic acid-induced gene 1 (RIG1), a class II tumor suppressor gene, is induced in cells treated with retinoids. RIG1 has been shown to express ubiquitously and the increased expression of this gene appears to suppress cell proliferation. Recent studies also demonstrated that this gene may play an important role in cell differentiation and the progression of cancer. In spite of the remarkable regulatory role of this protein, the molecular mechanism of RIG1 expression induced by retinoids remains to be clarified. The present study was designed to study the molecular mechanism underlying the all-trans retinoic acid (atRA)-mediated induction of RIG1 gene expression. Polymerase chain reaction was used to generate a total of 10 luciferase constructs that contain various fragments of the RIG1 5'-genomic region. These constructs were then transfected into human gastric cancer SC-M1 and breast cancer T47D cells for transactivation analysis. atRA exhibited a significant induction in luciferase activity only through the -4910/-5509 fragment of the 5'-genomic region of RIG1 gene relative to the translation initiation site. Further analysis of this promoter fragment indicated that the primary atRA response region is located in between -5048 and -5403 of the RIG1 gene. Within this region, a direct repeat sequence with five nucleotide spacing, 5'-TGACCTctattTGCCCT-3' (DR5, -5243/-5259), and an inverted repeat sequence with six nucleotide spacing, 5'-AGGCCAtggtaaTGGCCT-3' (IR6, -5323/-5340), were identified. Deletion and mutation of the DR5, but not the IR6 element, abolished the atRA-mediated activity. Electrophoretic mobility shift assays with nuclear extract from atRA-treated cells indicated the binding of retinoic acid receptor (RAR) and retinoid X receptor (RXR) heterodimers specifically to this response element. In addition to the functional DR5, the region contains many other potential sequence elements that are required to maximize the at

  5. Keratin promoter based gene manipulation in the murine conducting airway

    PubMed Central

    Malkoski, Stephen P.; Cleaver, Timothy G.; Lu, Shi-Long; Lighthall, Jessyka G.; Wang, Xiao-Jing

    2010-01-01

    Systems capable of targeting genetic manipulations to keratin-positive airway basal cells are more poorly developed than systems targeting other airway epithelial cell populations and this has likely hindered development of animal models of diseases such as lung squamous cell carcinoma. Although keratin promoter driven-Cre recombinase constructs are potentially useful for targeting these cells, these constructs have substantially higher activity in the skin and oral epithelium than in the airways. We developed a method for delivering RU486, the conditional activator of Cre recombinase progesterone receptor (CrePR) fusion proteins to the lung and then examined the activity of three keratin-driven CrePR constructs in the conducting airways. We also developed a technique for survival bronchioalveolar lavage on non-ventilated animals to examine the effects of the acetone/oil vehicle required to deliver RU486 to the lung. K5CrePR1 and K14CrePR1 constructs differ only in the keratin promoter used to target CrePR1 expression while K5Cre*PR contains a truncated progesterone receptor designed to reduce RU486-independent Cre activity. While all three constructs demonstrate RU486-inducible Cre activity in the conducting airways, both construct activity and tightness of regulation vary considerably. K5Cre*PR is the most tightly regulated Cre driver making it ideal for targeting somatic mutations to the airway epithelia while K5CrePR1 and K14CrePR1 may be better suited to studying diseases of the conducting airways where gene targeting of keratin expressing cells and their derivatives is desired. PMID:20140084

  6. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.

    PubMed

    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua

    2003-02-01

    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small. PMID:12555234

  7. Promoter activity and regulation of the corneal CYP4B1 gene by hypoxia.

    PubMed

    Mastyugin, Vladimir; Mezentsev, Alexandre; Zhang, Wen-Xiang; Ashkar, Silvia; Dunn, Michael W; Laniado-Schwartzman, Michal

    2004-04-15

    Hypoxic injury to the ocular surface provokes an inflammatory response that is mediated, in part, by corneal epithelial-derived 12-hydroxyeicosanoids. Recent studies indicate that a cytochrome P450 (CYP) monooxygenase, identified as CYP4B1, is involved in the production of these eicosanoids which exhibit potent inflammatory and angiogenic properties. We have isolated and cloned a corneal epithelial CYP4B1 full-length cDNA and demonstrated that the CYP4B1 mRNA is induced by hypoxia in vitro and in vivo. To further understand the molecular regulation that underlies the synthesis of these potent inflammatory eicosanoids in response to hypoxic injury, we isolated and cloned the CYP4B1 promoter region. GenomeWalker libraries constructed from rabbit corneal epithelial genomic DNA were used as templates for primary and nested PCR amplifications with gene- and adaptor-specific primers. A 3.41-kb DNA fragment of the 5'-flanking region of the CYP4B1 promoter was isolated, cloned, sequenced, and analyzed by computer software for the presence of known cis-acting elements. Analysis of the promoter sequence revealed the presence of consensus DNA binding sequences for factors known to activate gene transcription in response to hypoxia including HIF-1, NFkappaB, and AP-1. Transient transfection of luciferase reporter (pGL3-Basic) vectors containing different lengths of the CYP4B1 promoter fragment demonstrated hypoxia-induced transcription in rabbit corneal epithelial (RCE) cells. Electrophoretic mobility shift assay (EMSA) revealed a marked induction of nuclear binding activity for the labeled HIF-1 probe from the CYP4B1 promoter in nuclear extracts of cells exposed to hypoxia. This binding activity was due to sequence-specific binding to the HIF-1 oligonucleotide probe as shown by competition with excess unlabeled probe for the HIF-1 but not with unlabeled NFkappaB probe. The nuclear binding activity of AP-1 and NFkappaB probes from the CYP4B1 promoter was also enhanced in

  8. Analysis of promoter activity of members of the PECTATE LYASE-LIKE (PLL) gene family in cell separation in Arabidopsis

    PubMed Central

    2010-01-01

    Background Pectate lyases depolymerize pectins by catalyzing the eliminative cleavage of α-1,4-linked galacturonic acid. Pectate lyase-like (PLL) genes make up among the largest and most complex families in plants, but their cellular and organismal roles have not been well characterized, and the activity of these genes has been assessed only at the level of entire organs or plant parts, potentially obscuring important sub-organ or cell-type-specific activities. As a first step to understand the potential functional diversity of PLL genes in plants and specificity of individual genes, we utilized a reporter gene approach to document the spatial and temporal promoter activity for 23 of the 26 members of the Arabidopsis thaliana (Arabidopsis) PLL gene family throughout development, focusing on processes involving cell separation. Results Numerous PLL promoters directed activity in localized domains programmed for cell separation, such as the abscission zones of the sepal, petal, stamen, and seed, as well as the fruit dehiscence zone. Several drove activity in cell types expected to facilitate separation, including the style and root endodermal and cortical layers during lateral root emergence. However, PLL promoters were active in domains not obviously programmed for separation, including the stipule, hydathode and root axis. Nearly all PLL promoters showed extensive overlap of activity in most of the regions analyzed. Conclusions Our results document potential for involvement of PLL genes in numerous aspects of growth and development both dependent and independent of cell separation. Although the complexity of the PLL gene family allows for enormous potential for gene specialization through spatial or temporal regulation, the high degree of overlap of activity among the PLL promoters suggests extensive redundancy. Alternatively, functional specialization might be determined at the post-transcriptional or protein level. PMID:20649977

  9. Length of guanosine homopolymeric repeats modulates promoter activity of subfamily II tpr genes of Treponema pallidum ssp. pallidum.

    PubMed

    Giacani, Lorenzo; Lukehart, Sheila; Centurion-Lara, Arturo

    2007-11-01

    In Treponema pallidum, homopolymeric guanosine repeats of varying length are present upstream of both Subfamily I (tprC, D, F and I) and II (tprE, G and J) tpr genes, a group of potential virulence factors, immediately upstream of the +1 nucleotide. To investigate the influence of these poly-G sequences on promoter activity, tprE, G, J, F and I promoter regions containing homopolymeric tracts with different numbers of Gs, the ribosomal binding site and start codon were cloned in frame with the green fluorescent protein reporter gene (GFP), and promoter activity was measured both as fluorescence emission from Escherichia coli cultures transformed with the different plasmid constructs and using quantitative RT-PCR. For tprJ, G and E-derived clones, fluorescence was significantly higher with constructs containing eight Gs or fewer, while plasmids containing the same promoters with none or more Gs gave modest or no signal above the background. In contrast, tprF/I-derived clones induced similar levels of fluorescence regardless of the number of Gs within the promoter. GFP mRNA quantification showed that all of the promoters induced measurable transcription of the GFP gene; however, only for Subfamily II promoters was message synthesis inversely correlated to the number of Gs in the construct. PMID:17683506

  10. Association Between Promoter Methylation of Serotonin Transporter Gene and Depressive Symptoms: A Monozygotic Twin Study

    PubMed Central

    Zhao, Jinying; Goldberg, Jack; Bremner, James D.; Vaccarino, Viola

    2013-01-01

    Objective Epigenetic mechanisms have been implicated in the pathogenesis of psychiatric disorders. The serotonin transporter gene (SLC6A4) is a key candidate gene for depression. We examined the association between SLC6A4 promoter methylation variation and depressive symptoms using 84 monozygotic twin pairs. Methods DNA methylation level in the SLC6A4 promoter region was quantified by bisulfite pyrosequencing using genomic DNA isolated from peripheral blood leukocytes. The number of current depressive symptoms was assessed using the Beck Depressive Inventory II (BDI-II). The association between methylation variation and depressive symptoms was examined using matched twin-pair analyses, adjusting for body mass index, smoking, physical activity, and alcohol consumption. Multiple testing was controlled by adjusted false discovery rate (q value). Results Intrapair difference in DNA methylation variation at 10 of the 20 studied CpG sites is significantly correlated with intrapair difference in BDI scores. Linear regression using intrapair differences demonstrates that intrapair difference in BDI score was significantly associated with intrapair differences in DNA methylation variation after adjusting for potential confounders and correction for multiple testing. On average, a 10% increase in the difference in mean DNA methylation level was associated with 4.4 increase in the difference in BDI score (95% confidence interval = 0.9–7.9, p = .01). Conclusions This study provides evidence that variation in methylation level within the promoter region of the serotonin transporter gene is associated with variation in depressive symptoms in a large sample of monozygotic twin pairs. This relationship is not confounded by genetic and shared environment. The 5-HTTLPR genotype also does not modulate this association. PMID:23766378

  11. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs.

    PubMed

    Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun

    2015-12-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8-14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. PMID:26455773

  12. Functional characterization of the Ginkgo biloba chalcone synthase gene promoter in transgenic tobacco.

    PubMed

    Li, L L; Cheng, H; Yuan, H H; Xu, F; Cheng, S Y; Cao, F L

    2014-01-01

    The regulative sequence (2273 bp) of the chalcone synthase gene promoter of biloba was cloned by genomic walking. A 2273-bp promoter 5' upstream translation start site of GbCHS was cloned and designated as GbCHSP. pBI121+CHSP:GUS and pBI121-35S:GUS were constructed and transformed into tobacco by LBA4404. We found that GbCHSP could drive transient expression of GUS in tobacco and differentially expressed in root, stem and leaf tissues of this plant. GUS activity regulated by the CHSP promoter were located in tissues (apical meristems) at the growing points of roots and stems. pBI121+CHSP:GUS could be induced by wounding, copper, UV-B, abscisic acid, and ethephon treatments of transgenic seedlings. This activity was weakly inhibited by gibberellin. Deletion analysis of the CHSP promoter in transgenic tobacco showed that CHSP1 complete promoter conferred a GUS expression and activity similar to that of 35 S(CaMV). GUS activity dropped dramatically when there were CHSP4, CHSP5 constructs and was almost totally absent when the CHSP6 construct was present. We conclude that the upstream sequence -1548 to -306 of GbCHSP is the main region for transcriptional regulation of the CHS gene and that it is activated by hormone and stress factors in G. biloba. These results will help us to understand the transcriptional regulatory mechanisms involved in GbCHS expression and flavonoid accumulation in G. biloba. PMID:24841790

  13. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  14. The latency-associated promoter of herpes simplex virus type 1 requires a region downstream of the transcription start site for long-term expression during latency.

    PubMed Central

    Lokensgard, J R; Berthomme, H; Feldman, L T

    1997-01-01

    The latency-associated transcript (LAT) promoter of herpes simplex virus type 1 (HSV-1) is unique among the many promoters on the viral genome in that it remains active during the latent state. We have previously shown that a DNA fragment comprising the LAT promoter element through the cap site, when moved from the LAT locus to the glycoprotein C gene, is capable of only short-term expression. These and other data suggested that an HSV DNA element from the repeat region, not included in the LAT promoter itself, might be needed to preserve long-term expression. Based on a number of recombinant viruses, we narrowed our search for this putative element to a region 3' of the LAT transcription start site. In the present study, we have shown that a 1.1-kb DNA fragment containing the putative long-term expression element (LTE) is able to restore latent-phase gene expression to the LAT promoter. The element appeared to function best when it was placed in its natural location, which is 3' of the LAT promoter; however, partial function was obtained when the LTE was inserted upstream of the LAT promoter in the reverse direction. These data indicate that the LAT promoter region is more complex than originally anticipated and that in addition to requiring both core promoter and neuronal transcription factor binding sites, the promoter requires a specific region of DNA to prevent its shutoff during a latent infection. PMID:9261395

  15. Superoxide radical-generating compounds activate a predicted promoter site for paraquat-inducible genes of the Chromobacterium violaceum bacterium in a dose-dependent manner.

    PubMed

    Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R

    2015-01-01

    The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner. PMID:26345950

  16. Identification of a promoter motif involved in Curtovirus sense-gene expression in transgenic Arabidopsis.

    PubMed

    Hur, Jingyung; Choi, Eunseok; Buckley, Kenneth J; Lee, Sukchan; Davis, Keith R

    2008-08-31

    Expression of the seven open reading frames (ORFs) of single-stranded DNA Curtoviruses such as Beet curly top virus (BCTV) and Beet severe curly top virus (BSCTV) is driven by a bi-directional promoter. To investigate this bi-directional promoter activity with respect to viral late gene expression, transgenic Arabidopsis plants expressing a GUS reporter gene under the control of either the BCTV or BSCTV bi-directional promoter were constructed. Transgenic plants harboring constructs showed higher expression levels when the promoter of the less virulent BCTV was used than when the promoter of the more virulent BSCTV was used. In transgenic seedlings, the reporter gene constructs were expressed primarily in actively dividing tissues such as root tips and apical meristems. As the transgenic plants matured, reporter gene expression diminished but viral infection of mature transgenic plants restored reporter gene expression, particularly in transgenic plants containing BCTV virion-sense gene promoter constructs. A 30 base pair conserved late element (CLE) motif was identified that was present three times in tandem in the BCTV promoter and once in that of BSCTV. Progressive deletion of these repeats from the BCTV promoter resulted in decreased reporter gene expression, but BSCTV promoters in which one or two extra copies of this motif were inserted did not exhibit increased late gene promoter activity. These results demonstrate that Curtovirus late gene expression by virion-sense promoters depends on the developmental stage of the host plant as well as on the number of CLE motifs present in the promoter. PMID:18596416

  17. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    SciTech Connect

    Depto, A.S.; Stenberg, R.M.

    1989-03-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.

  18. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-05-01

    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  19. CypA, a Gene Downstream of HIF-1α, Promotes the Development of PDAC

    PubMed Central

    Gao, Chuntao; Wang, Xiuchao; Zhao, Tiansuo; Liu, Jingcheng; Gao, Song; Zhao, Xiao; Ren, He; Hao, Jihui

    2014-01-01

    Hypoxia-inducible factor-1α (HIF-1α) is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC). In response to tumor hypoxia, cyclophilin A (CypA) is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE) in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC. PMID:24662981

  20. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy. PMID:18355317

  1. Transcriptional Factor DLX3 Promotes the Gene Expression of Enamel Matrix Proteins during Amelogenesis

    PubMed Central

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease. PMID:25815730

  2. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    PubMed

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease. PMID:25815730

  3. Primary characterization and basal promoter activity of two hexamerin genes of Musca domestica.

    PubMed

    Moreira, C K; Capurro, M de L; Walter, M; Pavlova, E; Biessmann, H; James, A A; deBianchi, A G; Marinotti, O

    2004-01-01

    Hexamerins are high molecular-weight proteins found in the hemolymph of insects and have been proposed to function as storage proteins. In previous studies, two Musca domestica hexamerins, designated Hex-L and Hex-F were characterized. Hex-L is synthesized exclusively by the larval fat bodies, is secreted into the hemolymph and likely provides a source of amino acids and energy during metamorphosis. Hex-F synthesis is induced by a proteinaceous meal and occurs only in the adult insect fat bodies. Hex-F also is secreted into the hemolymph and it has been suggested that in females it may be an amino acid reservoir to be used during the final stages of egg formation. Genomic clones containing full-length copies of the genes MdHexL1 and MdHexF1, encoding subunits of the larval and the adult female hexamerin, respectively, were isolated. Complete nucleotide sequences, including the 5'-end untranscribed regions, were determined and analyzed for each of the genes. Comparisons of the conceptual translation products of the cloned genes indicated that MdHexL1 and MdHexF1 are related to the larval serum proteins (LSP) 1 and 2 of Calliphora vicina and Drosophila melanogaster. DNA fragments containing the putative promoters of the two hexamerin genes were compared and cloned into a plasmid vector so as to drive the expression of the GFP reporter gene. The constructs were assayed in vitro in transfected S2 Drosophila melanogaster cells demonstrating that the cloned M. domestica DNA fragments exhibit promoter activity. PMID:15861218

  4. Molecular Analysis of Promoter and Intergenic Region Attenuator of the Vibrio vulnificus prx1ahpF Operon.

    PubMed

    Lee, Hyun Sung; Lim, Jong Gyu; Han, Kook; Lee, Younghoon; Choi, Sang Ho

    2015-08-01

    Prx1, an AhpF-dependent 2-Cys peroxiredoxin (Prx), was previously identified in Vibrio vulnificus, a facultative aerobic pathogen. In the present study, transcription of the V. vulnificus prx1ahpF genes, which are adjacently located on the chromosome, was evaluated by analyzing the promoter and intergenic region of the two genes. Northern blot analyses revealed that transcription of prx1ahpF results in two transcripts, the prx1 and prx1ahpF transcripts. Primer extension analysis and a point mutational analysis of the promoter region showed that the two transcripts are generated from a single promoter. In addition, the 3' end of the prx1 transcript at the prx1ahpF intergenic region was determined by a 3'RACE assay. These results suggested that the prx1ahpF genes are transcribed as an operon, and the prx1 transcript was produced by transcriptional termination in the intergenic region. RNA secondary structure prediction of the prx1ahpF intergenic region singled out a stem-loop structure without poly(U) tract, and a deletion analysis of the intergenic region showed that the atypical stem-loop structure acts as the transcriptional attenuator to result in the prx1 and prx1ahpF transcripts. The combined results demonstrate that the differential expression of prx1 and ahpF is accomplished by the cis-acting transcriptional attenuator located between the two genes and thereby leads to the production of a high level of Prx1 and a low level of AhpF. PMID:25824432

  5. Cloning and functional analysis of the promoter of a maize starch synthase III gene (ZmDULL1).

    PubMed

    Wu, J D; Jiang, C P; Zhu, H S; Jiang, H Y; Cheng, B J; Zhu, S W

    2015-01-01

    The ZmDULL1 gene encodes a starch synthase and is a determinant of the structure of endosperm starch in maize (Zea mays L.). However, little is known regarding the regulatory mechanism of the ZmDULL1 gene. In this study, we isolated and characterized the ZmDULL1 promoter (PDULL1), which is the 5' flanking region of ZmDULL1 in maize. Sequence analysis showed that several cis-acting elements important for endosperm expression (GCN4_motif and AACA-element) were located within the promoter. A series of PDULL1 deletion derivatives, PDULL1-1-PDULL1-4, from the translation start code (-1676, -1216, -740, and -343) were fused to the β-glucuronidase (GUS) reporter gene. Each deletion construct was transformed into rice using the Agrobacterium-mediated method, and then GUS activity was measured in transgenic plants. The results showed that PDULL1 was an endosperm-specific promoter. Further analysis showed that the promoter sequence (-343 to -1 base pairs) was sufficient for mediating GUS gene expression in endosperm. These results indicate that the region from -343 to -1 base pairs of PDULL1 is valuable for transgenic rice breeding and genetic engineering studies. PMID:26125743

  6. Multiple Independent Retroelement Insertions in the Promoter of a Stress Response Gene Have Variable Molecular and Functional Effects in Drosophila.

    PubMed

    Merenciano, Miriam; Ullastres, Anna; de Cara, M A R; Barrón, Maite G; González, Josefa

    2016-08-01

    Promoters are structurally and functionally diverse gene regulatory regions. The presence or absence of sequence motifs and the spacing between the motifs defines the properties of promoters. Recent alternative promoter usage analyses in Drosophila melanogaster revealed that transposable elements significantly contribute to promote diversity. In this work, we analyzed in detail one of the transposable element insertions, named FBti0019985, that has been co-opted to drive expression of CG18446, a candidate stress response gene. We analyzed strains from different natural populations and we found that besides FBti0019985, there are another eight independent transposable elements inserted in the proximal promoter region of CG18446. All nine insertions are solo-LTRs that belong to the roo family. We analyzed the sequence of the nine roo insertions and we investigated whether the different insertions were functionally equivalent by performing 5'-RACE, gene expression, and cold-stress survival experiments. We found that different insertions have different molecular and functional consequences. The exact position where the transposable elements are inserted matters, as they all showed highly conserved sequences but only two of the analyzed insertions provided alternative transcription start sites, and only the FBti0019985 insertion consistently affects CG18446 expression. The phenotypic consequences of the different insertions also vary: only FBti0019985 was associated with cold-stress tolerance. Interestingly, the only previous report of transposable elements inserting repeatedly and independently in a promoter region in D. melanogaster, were also located upstream of a stress response gene. Our results suggest that functional validation of individual structural variants is needed to resolve the complexity of insertion clusters. PMID:27517860

  7. Multiple Independent Retroelement Insertions in the Promoter of a Stress Response Gene Have Variable Molecular and Functional Effects in Drosophila

    PubMed Central

    Merenciano, Miriam; Ullastres, Anna; González, Josefa

    2016-01-01

    Promoters are structurally and functionally diverse gene regulatory regions. The presence or absence of sequence motifs and the spacing between the motifs defines the properties of promoters. Recent alternative promoter usage analyses in Drosophila melanogaster revealed that transposable elements significantly contribute to promote diversity. In this work, we analyzed in detail one of the transposable element insertions, named FBti0019985, that has been co-opted to drive expression of CG18446, a candidate stress response gene. We analyzed strains from different natural populations and we found that besides FBti0019985, there are another eight independent transposable elements inserted in the proximal promoter region of CG18446. All nine insertions are solo-LTRs that belong to the roo family. We analyzed the sequence of the nine roo insertions and we investigated whether the different insertions were functionally equivalent by performing 5’-RACE, gene expression, and cold-stress survival experiments. We found that different insertions have different molecular and functional consequences. The exact position where the transposable elements are inserted matters, as they all showed highly conserved sequences but only two of the analyzed insertions provided alternative transcription start sites, and only the FBti0019985 insertion consistently affects CG18446 expression. The phenotypic consequences of the different insertions also vary: only FBti0019985 was associated with cold-stress tolerance. Interestingly, the only previous report of transposable elements inserting repeatedly and independently in a promoter region in D. melanogaster, were also located upstream of a stress response gene. Our results suggest that functional validation of individual structural variants is needed to resolve the complexity of insertion clusters. PMID:27517860

  8. Genetic Variants in the STMN1 Transcriptional Regulatory Region Affect Promoter Activity and Fear Behavior in English Springer Spaniels

    PubMed Central

    Zhang, Hanying; Xu, Yinxue

    2016-01-01

    Stathmin 1 (STMN1) is a neuronal growth-associated protein that is involved in microtubule dynamics and plays an important role in synaptic outgrowth and plasticity. Given that STMN1 affects fear behavior, we hypothesized that genetic variations in the STMN1 transcriptional regulatory region affect gene transcription activity and control fear behavior. In this study, two single nucleotide polymorphisms (SNPs), g. -327 A>G and g. -125 C>T, were identified in 317 English Springer Spaniels. A bioinformatics analysis revealed that both were loci located in the canine STMN1 putative promoter region and affected transcription factor binding. A statistical analysis revealed that the TT genotype at g.-125 C>T produced a significantly greater fear level than that of the CC genotype (P < 0.05). Furthermore, the H4H4 (GTGT) haplotype combination was significantly associated with canine fear behavior (P < 0.01). Using serially truncated constructs of the STMN1 promoters and the luciferase reporter, we found that a 395 bp (−312 nt to +83 nt) fragment constituted the core promoter region. The luciferase assay also revealed that the H4 (GT) haplotype promoter had higher activity than that of other haplotypes. Overall, our results suggest that the two SNPs in the canine STMN1 promoter region could affect canine fear behavior by altering STMN1 transcriptional activity. PMID:27390866

  9. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  10. Activation of transcription at divergent urea-dependent promoters by the urease gene regulator UreR.

    PubMed

    D'Orazio, S E; Thomas, V; Collins, C M

    1996-08-01

    The Proteus mirabilis and plasmid-encoded urease loci contain seven contiguous structural and accessory genes (ureDABCEFG) and the divergently transcribed ureR, which codes for an AraC-like transcriptional activator. Previously, it was shown that the plasmid-encoded ureR to ureD intergenic region contained divergent promoters (ureRp and ureDp). Transcription from these promoters required both the effector molecule urea and the activator protein UreR. In this report, we demonstrate that the P. mirabilis urease gene cluster contains similar divergent urea- and UreR-dependent promoters. The ureR gene products from either urease locus were able to activate transcription at both the plasmid-encoded and P. mirabilis promoters. The minimal concentration of urea required to activate transcription at ureRp or ureDp from either gene cluster was approximately 4 mM. The transcriptional start sites for the plasmid-encoded and P. mirabilis divergent promoters were similar in an Escherichia coli DH5 alpha background, as determined by primer-extension analysis. However, in P. mirabilis HI4320, transcription of ureR initiated predominately at an alternative site. Physical mapping and inhibition studies were used to localize the UreR-binding sites within the plasmid-encoded ureRp and ureDp intergenic sequences to regions of 68 bp and 86 bp, respectively. Gel shift analysis demonstrated that UreR bound to a 135 bp fragment in the approximate centre of the plasmid-encoded ureR to ureD intergenic region. The results presented here suggest that the P. mirabilis and plasmid-encoded urease gene clusters utilize similar mechanisms of transcriptional activation in response to urea. PMID:8866486

  11. Characterization of the 5'-flanking region for the human fibrinogen beta gene.

    PubMed Central

    Huber, P; Dalmon, J; Courtois, G; Laurent, M; Assouline, Z; Marguerie, G

    1987-01-01

    To identify the possible regulatory sequences in the genetic expression of fibrinogen, a human genomic DNA library raised in lambda EMBL 4 phage was screened using cDNA probes coding for the A alpha, B beta and gamma chains of human fibrinogen. The entire fibrinogen locus was characterized and its organization analysed by means of hybridization and restriction mapping. Among the clones identified, a single recombinant lambda phage contained the beta gene and its 5'- and 3'-flanking regions. A 1.5 kb fragment of the immediate 5'-flanking region was sequenced and S1 mapping experiments revealed three transcription start points. Comparison of this sequence with that previously reported for the same region upstream from the human gamma gene revealed no significant homology which suggests that the potential promoting sequences of these genes are different. In contrast, comparison of the 5'-flanking regions of human and rat beta genes revealed a 142 bp sequence of 80% homology situated 16 bp upstream from the human beta gene. This highly conserved region may well represents a potential candidate for a regulatory sequence of the human beta gene. Images PMID:3029722

  12. Expression of the human amylase genes: Recent origin of a salivary amylase promoter from an actin pseudogene

    SciTech Connect

    Samuelson, L.C.; Gumucio, D.L.; Meisler, M.H. ); Wiebauer, K. )

    1988-09-12

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. The authors have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5{prime} regions of the five human amylase genes contain a processed {gamma}-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3{prime} untranslated region of {gamma}-actin. In addition, insertion of an endogenous retrovirus has interrupted the {gamma}-actin pseudogene in four of the five amylase genes.

  13. Expression of the human amylase genes: recent origin of a salivary amylase promoter from an actin pseudogene.

    PubMed

    Samuelson, L C; Wiebauer, K; Gumucio, D L; Meisler, M H

    1988-09-12

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. We have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5' regions of the five human amylase genes contain a processed gamma-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3' untranslated region of gamma-actin. In addition, insertion of an endogenous retrovirus has interrupted the gamma-actin pseudogene in four of the five amylase genes. PMID:2458567

  14. Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes.

    PubMed

    Eyal, Y; Curie, C; McCormick, S

    1995-03-01

    Functional analyses previously identified minimal promoter regions required for maintaining high-level expression of the late anther tomato LAT52 and LAT59 genes in tomato pollen. Here, we now define elements that direct pollen specificity. We used a transient assay system consisting of two cell types that differentially express the LAT genes and both "loss-of-function" and "gain-of-function" approaches. Linker substitution mutants analyzed in the transient assay and in transgenic plants identified 30-bp proximal promoter regions of LAT52 and LAT59 that are essential for their expression in pollen and that confer pollen specificity when fused to the heterologous cauliflower mosaic virus 35S core promoter. In vivo competition experiments demonstrated that a common trans-acting factor interacts with the pollen specificity region of both LAT gene promoters and suggested that a common mechanism regulates their coordinate expression. Adjacent upstream elements, the 52/56 box in LAT52 and the 56/59 box in LAT59, are involved in modulating the level of expression in pollen. The 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family. PMID:7734969

  15. Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes.

    PubMed Central

    Eyal, Y; Curie, C; McCormick, S

    1995-01-01

    Functional analyses previously identified minimal promoter regions required for maintaining high-level expression of the late anther tomato LAT52 and LAT59 genes in tomato pollen. Here, we now define elements that direct pollen specificity. We used a transient assay system consisting of two cell types that differentially express the LAT genes and both "loss-of-function" and "gain-of-function" approaches. Linker substitution mutants analyzed in the transient assay and in transgenic plants identified 30-bp proximal promoter regions of LAT52 and LAT59 that are essential for their expression in pollen and that confer pollen specificity when fused to the heterologous cauliflower mosaic virus 35S core promoter. In vivo competition experiments demonstrated that a common trans-acting factor interacts with the pollen specificity region of both LAT gene promoters and suggested that a common mechanism regulates their coordinate expression. Adjacent upstream elements, the 52/56 box in LAT52 and the 56/59 box in LAT59, are involved in modulating the level of expression in pollen. The 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family. PMID:7734969

  16. Regulation of the activities of African cassava mosaic virus promoters by the AC1, AC2, and AC3 gene products.

    PubMed

    Haley, A; Zhan, X; Richardson, K; Head, K; Morris, B

    1992-06-01

    DNA fragments comprising each of the promoter regions from the geminivirus African cassava mosaic virus (ACMV) were cloned into the pUC18-based vector, pG1, producing transcriptional fusions with the beta-glucuronidase gene (GUS) and nopaline synthase terminator sequence. The relative activity of each promoter construct was analyzed by a GUS expression assay of extracts from Nicotiana clevelandii protoplasts coelectroporated with the GUS reporter constructs and constructs in which individual ACMV open reading frames (ORFs) were placed under control of a cauliflower mosaic virus 35 S promoter. Results suggest repression of the AC1 gene by its gene product, which is required for ACMV DNA synthesis. The promoter activity observed for the single promoter for the DNA A genes encoding functions of spread and the regulation of replication (AC2 and AC3 ORFs) was unaffected by coelectroporation with any of the ACMV ORF constructs. Promoters for the AV1 (coat protein) gene and the two DNA B genes (BV1 and BC1) were activated by electroporation of the AC2 ORF construct. To a lesser extent promoters for the AV1 and BV1 genes were activated with the AC3 ORF construct. The same pattern of promoter repression and activation was observed when transgenic N. benthamiana plants expressing the GUS reporter constructions were inoculated with ACMV DNA A. PMID:1585657

  17. New gene coding regions from the horn fly, Haematobia irritans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We used an EST approach to isolate new gene coding regions from the horn fly, Haematobia irritans. Two sources of expressed gene sequences were utilized. First, a subtracted library was synthesized from adult mixed sex fly cDNA of an organophosphate and pyrethroid resistant population of flies subtr...

  18. Genetic diversity, plant adaptation regions, and gene pools of switchgrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Switchgrass is a perennial grass native to the North American tallgrass prairie and broadly adapted to the central and eastern USA. Movement of plant materials throughout this region creates the potential of contaminating local gene pools with genes that are not native to a locale. The objective o...

  19. Molecular cloning and activity analysis of a seed-specific FAD2-1B gene promoter from Glycine max.

    PubMed

    Zhao, Y; Sha, W; Wang, Q Y; Zhai, Y; Zhao, Y; Shao, S L

    2015-01-01

    Microsomal omega-6 fatty acid desaturase (FAD2-1B) is an enzyme that regulates the polyunsaturated fatty acid content in soybeans (Glycine max). In this study, the FAD2-1B gene was determined to be highly expressed in soybean seeds using quantitative real-time PCR(qRT-PCR). To investigate the expression pattern and activity of the FAD2-1B promoter, a 1929 bp 5'-upstream genomic DNA fragment, named PF, was isolated according to the soybean genomic sequence. Sequence analysis revealed the presence of many motifs related to seed-specific promoters in the PF fragment, such as E-box, SEF4, Skn-1 motif, AACACA, AATAAA and so on. Tobacco transgenics carrying the gus reporter gene driven by the PF and/or 35S promoters were confirmed by PCR and RT-PCR. qRT-PCR and histochemical GUS assays showed that the PF promoter could regulate gus gene accumulation in seeds and the expression level was higher than in other organs. In the meantime, it exhibited similar activity to the 35S promoter in seeds, which could be associated with seed-related cis-elements found in the 1-248 bp, 451-932 bp, and 1627-1803 bp regions of the promoter. PMID:26386665

  20. Amplification of TGFβ Induced ITGB6 Gene Transcription May Promote Pulmonary Fibrosis

    PubMed Central

    Tatler, Amanda L.; Goodwin, Amanda T.; Gbolahan, Olumide; Saini, Gauri; Porte, Joanne; John, Alison E.; Clifford, Rachel L.; Violette, Shelia M.; Weinreb, Paul H.; Parfrey, Helen; Wolters, Paul J.; Gauldie, Jack; Kolb, Martin; Jenkins, Gisli

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a devastating, progressive disease with poor survival rates and limited treatment options. Upregulation of αvβ6 integrins within the alveolar epithelial cells is a characteristic feature of IPF and correlates with poor patient survival. The pro-fibrotic cytokine TGFβ1 can upregulate αvβ6 integrin expression but the molecular mechanisms driving this effect have not previously been elucidated. We confirm that stimulation with exogenous TGFβ1 increases expression of the integrin β6 subunit gene (ITGB6) and αvβ6 integrin cell surface expression in a time- and concentration-dependent manner. TGFβ1-induced ITGB6 expression occurs via transcriptional activation of the ITGB6 gene, but does not result from effects on ITGB6 mRNA stability. Basal expression of ITGB6 in, and αvβ6 integrins on, lung epithelial cells occurs via homeostatic αvβ6-mediated TGFβ1 activation in the absence of exogenous stimulation, and can be amplified by TGFβ1 activation. Fundamentally, we show for the first time that TGFβ1-induced ITGB6 expression occurs via canonical Smad signalling since dominant negative constructs directed against Smad3 and 4 inhibit ITGB6 transcriptional activity. Furthermore, disruption of a Smad binding site at -798 in the ITGB6 promoter abolishes TGFβ1-induced ITGB6 transcriptional activity. Using chromatin immunoprecipitation we demonstrate that TGFβ1 stimulation of lung epithelial cells results in direct binding of Smad3, and Smad4, to the ITGB6 gene promoter within this region. Finally, using an adenoviral TGFβ1 over-expression model of pulmonary fibrosis we demonstrate that Smad3 is crucial for TGFβ1-induced αvβ6 integrin expression within the alveolar epithelium in vivo. Together, these data confirm that a homeostatic, autocrine loop of αvβ6 integrin activated TGFβ1-induced ITGB6 gene expression regulates epithelial basal αvβ6 integrin expression, and demonstrates that this occurs via Smad

  1. Four out of eight genes in a mouse chromosome 7 congenic donor region are candidate obesity genes.

    PubMed

    Sarahan, Kari A; Fisler, Janis S; Warden, Craig H

    2011-09-22

    We previously identified a region of mouse chromosome 7 that influences body fat mass in F2 littermates of congenic × background intercrosses. Current analyses revealed that alleles in the donor region of the subcongenic B6.C-D7Mit318 (318) promoted a twofold increase in adiposity in homozygous lines of 318 compared with background C57BL/6ByJ (B6By) mice. Parent-of-origin effects were discounted through cross-fostering studies and an F1 reciprocal cross. Mapping of the donor region revealed that it has a maximal size of 2.8 Mb (minimum 1.8 Mb) and contains a maximum of eight protein coding genes. Quantitative PCR in whole brain, liver, and gonadal white adipose tissue (GWAT) revealed differential expression between genotypes for three genes in females and two genes in males. Alpha-2,8-sialyltransferase 8B (St8sia2) showed reduced 318 mRNA levels in brain for females and males and in GWAT for females only. Both sexes of 318 mice had reduced Repulsive guidance molecule-a (Rgma) expression in GWAT. In brain, Family with sequence similarity 174 member b (Fam174b) had increased expression in 318 females, whereas Chromodomain helicase DNA binding protein 2 (Chd2-2) had reduced expression in 318 males. No donor region genes were differentially expressed in liver. Sequence analysis of coding exons for all genes in the 318 donor region revealed only one single nucleotide polymorphism that produced a nonsynonymous missense mutation, Gln7Pro, in Fam174b. Our findings highlight the difficulty of using expression and sequence to identify quantitative trait genes underlying obesity even in small genomic regions. PMID:21730028

  2. Structural characteristics of two wheat histone H2A genes encoding distinct types of variants and functional differences in their promoter activity.

    PubMed

    Huh, G H; Nakayama, T; Meshi, T; Iwabuchi, M

    1997-03-01

    To investigate the regulation of plant histone H2A gene expression, we isolated two H2A genes (TH254 and TH274) from wheat, which encode two variants of H2A. Both genes had an intron in the coding region. In the promoters, some characteristic sequences, such as Oct and Nona motifs, which are conserved among plant histone genes, were located in a short region (about 120 bp) upstream from the putative TATA box. Transient expression analyses of promoter activity with H2A-GUS fusion genes using tobacco protoplasts revealed novel types of positive cis-acting sequences in the TH254 promoter: a direct repeat of a 13 bp sequence (AGTTACATTATTG) and a stretch composed of an AT-rich sequence (ATATAGAAAATTAAAA) and a G-box (CACGTG). Quantitative S1 assay of the mRNA amounts from the TH254/GUS and TH274/GUS chimeric genes in stably transformed and cell cycle-synchronized tobacco cell lines showed that the promoters of both genes contained at least one cis-acting element responsible for S phase-specific expression. Histochemical analysis of transgenic tobacco plants carrying the chimeric genes showed that the promoters of the two H2A genes were active in developing seedlings and flower organs but were regulated in a different manner. PMID:9106503

  3. Binding of the Lactococcal Drug Dependent Transcriptional Regulator LmrR to Its Ligands and Responsive Promoter Regions

    PubMed Central

    van der Berg, Jan Pieter; Madoori, Pramod Kumar; Komarudin, Amalina Ghaisani; Thunnissen, Andy-Mark; Driessen, Arnold J. M.

    2015-01-01

    The heterodimeric ABC transporter LmrCD from Lactococcus lactis is able to extrude several different toxic compounds from the cell, fulfilling a role in the intrinsic and induced drug resistance. The expression of the lmrCD genes is regulated by the multi-drug binding repressor LmrR, which also binds to its own promoter to autoregulate its own expression. Previously, we reported the crystal structure of LmrR in the presence and absence of the drugs Hoechst 33342 and daunomycin. Analysis of the mechanism how drugs control the repressor activity of LmrR is impeded by the fact that these drugs also bind to DNA. Here we identified, using X-ray crystallography and fluorescence, that riboflavin binds into the drug binding cavity of LmrR, adopting a similar binding mode as Hoechst 33342 and daunomycin. Microscale thermophoresis was employed to quantify the binding affinity of LmrR to its responsive promoter regions and to evaluate the cognate site of LmrR in the lmrCD promoter region. Riboflavin reduces the binding affinity of LmrR for the promoter regions. Our results support a model wherein drug binding to LmrR relieves the LmrR dependent repression of the lmrCD genes. PMID:26267906

  4. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter

    PubMed Central

    Hu, Jiliang; Song, Weijian; Luo, Jie; Jiang, Shan; Yan, Fei; Zhai, Baojin

    2015-01-01

    Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog) promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373). Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk) driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement. PMID:26571389

  5. A similar 5'-flanking region is required for estrogen and progesterone induction of ovalbumin gene expression.

    PubMed

    Dean, D C; Gope, R; Knoll, B J; Riser, M E; O'Malley, B W

    1984-08-25

    We have previously transferred an ovalbumin-beta-globin fusion gene (ovalglobin) into primary cultures of chick oviduct cells and demonstrated that an ovalbumin gene 5'-flanking sequence between -221 and -95 is necessary for progesterone-mediated transcriptional induction (Dean, D. C., Knoll, B. J., Riser, M. E., and O'Malley, B. W. (1983) Nature (Lond.) 305, 551-554). Here we compare 5'-flanking sequences required for induction of the ovalglobin gene by 17 beta-estradiol and progesterone. The early gene of simian virus 40 was inserted into the same plasmid as the ovalbumin fusion gene to serve as an internal control. Since transcription of the viral early gene was unaffected by the presence of steroid hormone or deletions in the ovalbumin gene 5'-flanking region, the level of its transcripts could be monitored as a reference standard for ovalglobin transcription. Ovalglobin transcripts initiated principally from the ovalbumin cap site in the presence or absence of progesterone and 17 beta-estradiol. Deletion of 5'-flanking sequences to -197 had little effect on the induction with either hormone, while successive deletions to -180, -161, and -143 resulted in a gradual decrease in the level of induction. Deletion to -95 eliminated the induction. The results of this study indicate that DNA control elements for regulation of the ovalbumin gene by estrogen and progesterone either overlap directly or are clustered in close proximity in the 5'-flanking region near the ovalbumin gene promoter. PMID:6088508

  6. Isolation and analysis of a novel gene, HXC-26, adjacent to the rab GDP dissociation inhibitor gene located at human chromosome Xq28 region.

    PubMed

    Toyoda, A; Sakai, T; Sugiyama, Y; Kusuda, J; Hashimoto, K; Maeda, H

    1996-10-31

    We screened potential promoter regions from NotI-linking cosmid clones mapped on human chromosome Xq28 region with our constructed trapping vector and isolated six fragments containing transcription activity. Using one of the obtained fragments as a probe, a novel gene was isolated by screening a human skeletal muscle cDNA library. The isolated cDNA, termed HXC-26, contained an open reading frame of 975 nucleotides encoding 325 amino acids (38,848 Da). The HXC-26 gene was composed of 13 exons that span approximately 8 kb. Several potential GC boxes were found in the putative promoter region, but no typical TATA box. The HXC-26 gene associated with a CpG island was located adjacent to the rab GDP dissociation inhibitor (GDI) gene. PMID:9039504

  7. Characterization of a REST-Regulated Internal Promoter in the Schizophrenia Genome-Wide Associated Gene MIR137.

    PubMed

    Warburton, Alix; Breen, Gerome; Rujescu, Dan; Bubb, Vivien J; Quinn, John P

    2015-05-01

    MIR137 has been identified as a candidate gene for schizophrenia from genome-wide association studies via association with an intronic single nucleotide polymorphism (SNP), rs1625579. The location of the SNP suggests one mechanism in which transcriptional or posttranscriptional regulation of miR-137 expression could underlie schizophrenia. We identified and validated a novel promoter of the MIR137 gene adjacent to miR-137 itself which can direct the expression of distinct mRNA isoforms encoding miR-137. Analysis of both endogenous gene expression and reporter gene assays determined that this internal promoter is regulated by repressor element-1 silencing transcription factor (REST), which has previously been associated with pathways linked to schizophrenia. Distinct isoforms of REST mediate differential expression at this locus, suggesting the relative levels of these isoforms are important for miR-137 expression profiles. The internal promoter contains a variable number tandem repeat (VNTR) domain adjacent to the pre-miR-137 sequence. The reporter gene activity directed by this promoter was modified by the genotype of the VNTR. Differential expression was also observed in response to cocaine, which is known to regulate the REST pathway in SH-SY5Y cells. Our data support the hypothesis that a "gene × environment" interaction could modify the level of miR-137 expression via this internal promoter and that the genotype of the VNTR could modulate transcriptional responses. We demonstrate that this promoter region is not in disequilibrium with rs1625579 and therefore would supply a distinct pathway to potentially alter miR-137 levels in response to environmental cues. PMID:25154622

  8. MGMT-B gene promoter hypermethylation in patients with inflammatory bowel disease - a novel finding.

    PubMed

    Mokarram, Pooneh; Kavousipour, Soudabeh; Sarabi, Mostafa Moradi; Mehrabani, Golnosh; Fahmidehkar, Mohammad Ali; Shamsdin, Seyedeh Azra; Alipour, Abbas; Naini, Mahvash Alizade

    2015-01-01

    Inflammatory bowel disease (IBD) is a disease strongly associated with colorectal cancer (CRC) as a well-known precancerous condition. Alterations in DNA methylation and mutation in K-ras are believed to play an early etiopathogenic role in CRC and may also an initiating event through deregulation of molecular signaling. Epigenetic silencing of APC and SFRP2 in the WNT signaling pathway may also be involved in IBD-CRC. The role of aberrant DNA methylation in precancerous state of colorectal cancer (CRC) is under intensive investigation worldwide. The aim of this study was to investigate the status of promoter methylation of MGMT-B, APC1A and SFRP2 genes, in inflamed and normal colon tissues of patients with IBD compared with control normal tissues. A total of 52 IBD tissues as well as corresponding normal tissues and 30 samples from healthy participants were obtained. We determined promoter methylation status of MGMT-B, SFRP2 and APC1A genes by chemical treatment with sodium bisulfite and subsequent MSP. The most frequently methylated locus was MGMT-B (71%; 34 of 48), followed by SFRP2 (66.6 %; 32 of 48), and APC1A (43.7%; 21 of 48). Our study demonstrated for the first time that hypermethylation of the MGMT-B and the SFRP2 gene promoter regions might be involved in IBD development. Methylation of MGMT-B and SFRP2 in IBD patients may provide a method for early detection of IBD-associated neoplasia. PMID:25773792

  9. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  10. Nonessential region of bacteriophage P4: DNA sequence, transcription, gene products, and functions.

    PubMed Central

    Ghisotti, D; Finkel, S; Halling, C; Dehò, G; Sironi, G; Calendar, R

    1990-01-01

    We sequenced the leftmost 2,640 base pairs of bacteriophage P4 DNA, thus completing the sequence of the 11,627-base-pair P4 genome. The newly sequenced region encodes three nonessential genes, which are called gop, beta, and cII (in order, from left to right). The gop gene product kills Escherichia coli when the beta protein is absent; the gop and beta genes are transcribed rightward from the same promoter. The cII gene is transcribed leftward to a rho-independent terminator. Mutation of this terminator creates a temperature-sensitive phenotype, presumably owing to a defect in expression of the beta gene. Images PMID:2403440

  11. Cloning and promoter identification of the iron-regulated cir gene of Escherichia coli.

    PubMed Central

    Griggs, D W; Tharp, B B; Konisky, J

    1987-01-01

    The cir gene, which encodes the colicin I receptor protein and is regulated by both cellular iron content and growth temperature, was cloned into a multicopy-number plasmid. Physical mapping and complementation analysis established the position of cir between mgl and nfo on the Escherichia coli chromosome. A gene encoding a 32,000-dalton polypeptide was located downstream of and adjacent to cir, but did not appear to be part of the same transcriptional unit. A 525-base-pair fragment from the 5' end of the 1.8-kilobase-pair receptor-coding region directed iron-regulated transcription and translation of a hybrid cir-lacZ gene. Two overlapping promoters were identified by determination of the transcriptional start sites and by sequence analysis. A small open reading frame (120 nucleotides) of unknown significance preceded the receptor-coding sequence. Examination of the amino acid sequence of the receptor purified from the outer membrane revealed that the gene product was processed by removal of a signal peptide and that the mature form had an amino acid sequence near its amino terminus which closely resembled that of several other TonB-dependent proteins. Images PMID:3316180

  12. Gain of function mutation in tobacco MADS box promoter switch on the expression of flowering class B genes converting sepals to petals.

    PubMed

    Mahajan, Monika; Yadav, Sudesh Kumar

    2014-02-01

    One mutant transgenic line displaying homeotic conversion of sepals to petals with other phenotypic aberrations was selected and characterized at molecular level. The increased transcript level of gene encoding anthocyanidin synthase and petal specific class B genes, GLOBOSA and DEFECIENS in sepals of mutant line may be responsible for its homeotic conversion to petaloid organs. While characterizing this mutant line for locus identification, T-DNA was found to be inserted in 3' untranslated region of promoter of class B MADS box gene, GLOBOSA. Here, CaMV 35S promoter of T-DNA might be deriving the expression of class B genes. PMID:24362510

  13. Characterization of the gene and promoter for RTI40, a differentiation marker of type I alveolar epithelial cells.

    PubMed

    Vanderbilt, J N; Dobbs, L G

    1998-10-01

    In an effort to understand the processes that establish and maintain the differentiated state of the alveolar epithelium, we have analyzed the gene for rat type I cell 40 kD protein (RTI40), an apical integral plasma membrane protein expressed in type I but not type II alveolar epithelial cells. The RTI40 gene spans 35 kilobase pairs; it contains 6 exons and at least 6 rat Identifier repetitive elements. Three exons encode the predicted RTI40 extracellular domain and one encodes the single transmembrane spanning domain. The final exon encodes one amino acid followed by a stop codon. RTI40 gene transcription starts downstream from a TATA homology, which is immediately adjacent to putative binding sites for thyroid transcription factor 1 and Sp1. In H441 cell transfections, mutagenesis of a 5'-flanking fragment (-2496 to +104) revealed two regions that contribute to promoter activity: -1247 through -795 and -163 through -81. Heterologous promoter fusion experiments suggest that a cooperative interaction between these regions activates transcription. In transfected type II cells, deletion across the proximal region produced a 6-fold drop in promoter activity, whereas deletion across the distal region was without apparent effect. These results provide a foundation to analyze further the factors that govern alveolar epithelial cell phenotype. PMID:9761764

  14. Characterization of the human CD4 gene promoter: transcription from the CD4 gene core promoter is tissue-specific and is activated by Ets proteins.

    PubMed Central

    Salmon, P; Giovane, A; Wasylyk, B; Klatzmann, D

    1993-01-01

    We analyzed the 5' transcription control sequences of the human CD4 gene. We located the transcription initiation site and showed that the CD4 core promoter (positions -40 to +16) lacks a classical "TATA" or initiator positioning consensus sequence but directs precise and efficient transcription when coupled to the ubiquitously active simian virus 40 enhancer. The transcriptional activity of the CD4 gene promoter correlated with CD4 expression in various cell types. Interestingly, the CD4 core promoter also displayed a tissue-specific transcriptional activity. Within this fragment, three nucleic acid sequences are completely conserved in the murine CD4 gene. One of these sequences contains a perfect ETS consensus sequence. Another ETS consensus sequence is located 1060 nt upstream. Electrophoretic-mobility-shift assays showed that the core promoter ETS motif binds an Ets-related protein specifically expressed at high levels in CD4+ cells. Moreover, in CD4- cells, overexpression of Ets-1 or Ets-2 efficiently and specifically activated transcription from the CD4 promoter and core promoter. These data indicate that Ets transcription factors play a central role in controlling CD4 gene expression, by binding to both a classical remote site and an unusual proximal activator sequence. Images Fig. 2 Fig. 4 PMID:8356078

  15. Identification of Promoters for Efficient Gene Expression in Magnetospirillum gryphiswaldense▿ †

    PubMed Central

    Lang, Claus; Pollithy, Anna; Schüler, Dirk

    2009-01-01

    To develop an expression system for the magnetotactic bacterium Magnetospirillum gryphiswaldense, we compared gene expression from the widely used Escherichia coli Plac promoter with that from known and predicted genuine M. gryphiswaldense promoters. With the use of green fluorescent protein as a reporter, the highest expression level was observed with the magnetosomal PmamDC promoter. We demonstrate that this promoter can be used for the expression of modified magnetosome proteins to generate “antibody-binding” magnetosomes. PMID:19395573

  16. Isolation and characterization of an oil palm constitutive promoter derived from a translationally control tumor protein (TCTP) gene.

    PubMed

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ti, Leslie Low Eng

    2011-07-01

    We have characterized an oil palm (Elaeis guineensis Jacq.) constitutive promoter that is derived from a translationally control tumor protein (TCTP) gene. The TCTP promoter was fused transcriptionally with the gusA reporter gene and transferred to monocot and dicot systems in order to study its regulatory role in a transient expression study. It was found that the 5' region of TCTP was capable of driving the gusA expression in all the oil palm tissues tested, including immature embryo, embryogenic callus, embryoid, young leaflet from mature palm, green leaf, mesocarp and stem. It could also be used in dicot systems as it was also capable of driving gusA expression in tobacco leaves. The results indicate that the TCTP promoter could be used for the production of recombinant proteins that require constitutive expression in the plant system. PMID:21549610

  17. Gene expression and promoter analysis of a novel tomato aldo-keto reductase in response to environmental stresses.

    PubMed

    Suekawa, Marina; Fujikawa, Yukichi; Inada, Shuhei; Murano, Asako; Esaka, Muneharu

    2016-08-01

    The functional role of an uncharacterized tomato (Solanum lycopersicum) aldo-keto reductase 4B, denoted as SlAKR4B, was investigated. The gene expression of tomato SlAKR4B was detected at a high level in the senescent leaves and the ripening fruits of tomato. Although d-galacturonic acid reductase activities tended to be higher in tomato SlAKR4B-overexpressing transgenic tobacco BY-2 cell lines than those in control cell lines, SlAKR4B gene expression was not well correlated with l-ascorbic acid content among the cell lines. The analysis of the transgenic cell lines showed that tomato SlAKR4B has enzyme activities toward d-galacturonic acid as well as glyceraldehyde and glyoxal, suggesting that the SlAKR4B gene encodes a functional enzyme in tomato. Gene expression of SlAKR4B was induced by NaCl, H2O2, and plant hormones such as salicylic acid and jasmonic acid, suggesting that SlAKR4B is involved in the stress response. The transient expression assay using protoplasts showed the promoter activity of the SlAKR4B gene was as high as that of the cauliflower mosaic virus 35S promoter. Also, the promoter region of the SlAKR4B gene was suggested to contain cis-element(s) for abiotic stress-inducible expression. PMID:27337067

  18. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the GUS reporter gene...

  19. Trans regulation in the Ultrabithorax gene of Drosophila: alterations in the promoter enhance transvection.

    PubMed Central

    Martínez-Laborda, A; González-Reyes, A; Morata, G

    1992-01-01

    We report a genetic and molecular study of UbxMX6 and Ubx195rx1, two mutations in the Ultrabithorax (Ubx) locus which appear to have a strong effect on the activity of the homologous Ubx gene. These mutations show the characteristic embryonic and adult phenotypes of Ubx null alleles, and also fail to produce any detectable Ubx product. Yet, genetic and phenotypic analyses involving a large number of trans heterozygous combinations of UbxMX6 and Ubx195rx1 with different classes of Ubx mutations, indicate that they hyperactivate the homologous gene. This effect is induced on wildtype or mutant forms of Ubx, provided that the pairing in the bithorax region is normal, i.e. these mutations have a strong positive effect on transvection. We also show that, unlike all the other known cases of transvection in Ubx, this is not zeste-dependent. Southern analyses indicate that UbxMX6 is a 3.4 kb deletion, and Ubx195rx1 is an approximately 11 kb insertion of foreign DNA, both in the promoter region. We speculate that the region altered in the mutations may have a wildtype function to ensure cis-autonomy of the regulation of Ubx transcription. Images PMID:1396564

  20. Expression of the rat liver carnitine palmitoyltransferase I (CPT-Ialpha) gene is regulated by Sp1 and nuclear factor Y: chromosomal localization and promoter characterization.

    PubMed Central

    Steffen, M L; Harrison, W R; Elder, F F; Cook, G A; Park, E A

    1999-01-01

    Carnitine palmitoyltransferase (CPT)-I catalyses the transfer of long-chain fatty acids from CoA to carnitine for translocation across the mitochondrial inner membrane. Expression of the 'liver' isoform of the CPT-I gene (CPT-Ialpha) is subject to developmental, hormonal and tissue-specific regulation. To understand the basis for control of CPT-Ialpha gene expression, we have characterized the proximal promoter of the CPT-Ialpha gene. Here, we report the sequence of 6839 base pairs of the promoter and the localization of the rat CPT-Ialpha gene to region q43 on chromosome 1. Our studies show that the first 200 base pairs of the promoter are sufficient to drive transcription of the CPT-Ialpha gene. Within this region are two sites that bind both Sp1 and Sp3 transcription factors. In addition, nuclear factor Y (NF-Y) binds the proximal promoter. Mutation at the Sp1 or NF-Y sites severely decreases transcription from the CPT-Ialpha promoter. Other protein binding sites were identified within the first 200 base pairs of the promoter by DNase I footprinting, and these elements contribute to CPT-Ialpha gene expression. Our studies demonstrate that CPT-Ialpha is a TATA-less gene which utilizes NF-Y and Sp proteins to drive basal expression. PMID:10333485

  1. Two control regions for eukaryotic tRNA gene transcription.

    PubMed Central

    DeFranco, D; Schmidt, O; Söll, D

    1980-01-01

    Two Drosophila tRNALys genes with identical coding sequences were shown to transcribe with very different efficiences in nuclear extracts from Xenopus oocytes. The use of recombinant plasmids in which the 5'-flanking sequences of these genes were either "switched" or replaced by defined pBR322 sequences revealed two control regions for tRNA gene transcription. An internal control region comprising the mature tRNA coding sequence (and possibly its 3'-flanking sequences) is sufficient for transcription initiation, and an external control region comprising the 5'-flanking sequences represses this transcription. All transcripts have short leader sequences. Altered precursor tRNAs transcribed from truncated tRNALys genes (missing a single base pair in the acceptor stem) are not processed well in vitro. Images PMID:6774336

  2. Large sex differences in chicken behavior and brain gene expression coincide with few differences in promoter DNA-methylation.

    PubMed

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per

    2014-01-01

    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  3. Large Sex Differences in Chicken Behavior and Brain Gene Expression Coincide with Few Differences in Promoter DNA-Methylation

    PubMed Central

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per

    2014-01-01

    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  4. Promoter-trap identification of wheat seed extract-induced genes in the plant-growth-promoting rhizobacterium Azospirillum brasilense Sp245.

    PubMed

    Pothier, Joël F; Wisniewski-Dyé, Florence; Weiss-Gayet, Michèle; Moënne-Loccoz, Yvan; Prigent-Combaret, Claire

    2007-10-01

    Azospirillum strains have been used as plant-growth-promoting rhizobacteria (PGPR) of cereal crops, but their adaptation to the root remains poorly understood. Here, we used a global approach based on differential fluorescence induction (DFI) promoter trapping to identify genes of the wheat isolate Azospirillum brasilense Sp245 that are induced in the presence of spring wheat seed extracts. Fluorescence-based flow cytometry sorting of Sp245 cells was validated using PlacZ, PsbpA and PnifH promoters and egfp. A random promoter library was constructed by cloning 1-3 kb Sp245 fragments upstream of a promoterless version of egfp in the promoter-trap plasmid pOT1e (genome coverage estimated at threefold). Exposure to spring wheat seed extracts obtained using a methanol solution led to the detection of 300 induced DFI clones, and upregulation by seed extracts was confirmed in vitro for 46 clones. Sequencing of 21 clones enabled identification of seven promoter regions. Five of them displayed upregulation once inoculated onto spring wheat seedlings. Their downstream sequence was similar to (i) a predicted transcriptional regulator, (ii) a serine/threonine protein kinase, (iii) two conserved hypothetical proteins, or (iv) the copper-containing dissimilatory nitrite reductase NirK. Two of them were also upregulated when inoculated on winter wheat and pea but not on maize, whereas the three others (including PnirK) were upregulated on the three hosts. The amounts of nitrate and/or nitrite present in spring wheat seed extracts were sufficient for PnirK upregulation. Overall, DFI promoter trapping was useful to reveal Azospirillum genes involved in the interaction with the plant. PMID:17906157

  5. Coexpression of two closely linked avian genes for purine nucleotide synthesis from a bidirectional promoter.

    PubMed Central

    Gavalas, A; Dixon, J E; Brayton, K A; Zalkin, H

    1993-01-01

    Two avian genes encoding essential steps in the purine nucleotide biosynthetic pathway are transcribed divergently from a bidirectional promoter element. The bidirectional promoter, embedded in a CpG island, directs coexpression of GPAT and AIRC genes from distinct transcriptional start sites 229 bp apart. The bidirectional promoter can be divided in half, with each half retaining partial activity towards the cognate gene. GPAT and AIRC genes encode the enzymes that catalyze step 1 and steps 6 plus 7, respectively, in the de novo purine biosynthetic pathway. This is the first report of genes coding for structurally unrelated enzymes of the same pathway that are tightly linked and transcribed divergently from a bidirectional promoter. This arrangement has the potential to provide for regulated coexpression comparable to that in a prokaryotic operon. Images PMID:8336716

  6. Internalin of Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to promote internalization.

    PubMed Central

    Lecuit, M; Ohayon, H; Braun, L; Mengaud, J; Cossart, P

    1997-01-01

    Listeria monocytogenes can use two different surface proteins, internalin (InlA) and InlB, to invade mammalian cells. The exact role of these invasiveness factors in vivo remains to be determined. In cultured cells, InlA is necessary to promote Listeria entry into human epithelial cells, such as Caco-2 cells, whereas InlB is necessary to promote Listeria internalization in several other cell types, including hepatocytes, fibroblasts, and epithelioid cells, such as Vero, HeLa, CHO, or Hep-2 cells. We have recently reported that the InlA receptor on Caco-2 cells is the cell adhesion molecule E-cadherin and demonstrated that nonpermissive fibroblasts become permissive for internalin-mediated entry when transfected with the gene coding for LCAM, the chicken homolog of the human E-cadherin gene. In this study, we demonstrate for the first time that the internalin protein alone is sufficient to promote internalization into cells expressing its receptor. Indeed, internalin confers invasiveness to both Enterococcus faecalis and internalin-coated latex beads. As shown by transmission electron microscopy, these beads were phagocytosed via a "zipper" mechanism similar to that observed during the internalin-E-cadherin-mediated entry of Listeria. Moreover, a functional analysis of internalin demonstrates that its amino-terminal region, encompassing the leucine-rich repeat (LRR) region and the inter-repeat (IR) region, is necessary and sufficient to promote bacterial entry into cells expressing its receptor. Several lines of evidence suggest that the LRR region would interact directly with E-cadherin, whereas the IR region would be required for a proper folding of the LRR region. PMID:9393831

  7. Activation of the black seabream (Acanthopagrus schlegeli) somatolactin-alpha gene promoter by Pit-1c in the Hepa-T1 cell-line.

    PubMed

    Tian, Jing; Chan, King Ming

    2010-03-01

    Somatolactin (SL) is a pituitary hormone of the growth hormone (GH) gene family found only in fish. To understand the regulation of this hormone at the level of gene transcription, we obtained a SLalpha gene from black seabream (bsb), with its 5' flanking promoter region carrying several putative transcription factors including seven binding sites for pituitary-specific transcription factor 1 (Pit-1). To study the actions of Pit-1 on this gene promoter, we cloned three variants of bsbPit-1 (Pit-1a, Pit-1b and Pit-1c) derived from alternative splicing of mRNA or differential transcription start sites from black seabream pituitary. The deduced amino acid sequences of these Pit-1s contained 371 amino acids (aa), 333 and 311aa for the three Pit-1 variants, Pit-1a, Pit-1b and Pit-1c, respectively, with diverse regions of Pit-1 located at the transactivation domain. The actions of bsbPit-1 variants on the bsbSL gene promoter were investigated using a co-transfection assay, with a reporter gene using a transient expression assay in Hepa-T1 cells. The N-terminus truncated isoform bsbPit-1c showed the highest level of activity on SLalpha gene promoter activation in Hepa-T1 cells; however, neither Pit-1a nor Pit-1b activated the bsbSL gene promoter in the same study. PMID:19766121

  8. The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters.

    PubMed

    Zheng, Xuelian; Deng, Wei; Luo, Keming; Duan, Hui; Chen, Yongqin; McAvoy, Richard; Song, Shuiqing; Pei, Yan; Li, Yi

    2007-08-01

    Here we report the effect of the 35S promoter sequence on activities of the tissue- and organ-specific gene promoters in tobacco plants. In the absence of the 35S promoter sequence the AAP2 promoter is active only in vascular tissues as indicated by expression of the AAP2:GUS gene. With the 35S promoter sequence in the same T-plasmid, transgenic plants exhibit twofold to fivefold increase in AAP2 promoter activity and the promoter becomes active in all tissue types. Transgenic plants hosting the ovary-specific AGL5:iaaM gene (iaaM coding an auxin biosynthetic gene) showed a wild-type phenotype except production of seedless fruits, whereas plants hosting the AGL5:iaaM gene along with the 35S promoter sequence showed drastic morphological alterations. RT-PCR analysis confirms that the phenotype was caused by activation of the AGL5:iaaM gene in non-ovary organs including roots, stems and flowers. When the pollen-, ovule- and early embryo-specific PAB5:barnase gene (barnase coding a RNase gene) was transformed, the presence of 35S promoter sequence drastically reduced transformation efficiencies. However, the transformation efficiencies were restored in the absence of 35S promoter, indicating that the 35S promoter might activate the expression of PAB5:barnase in non-reproductive organs such as calli and shoot primordia. Furthermore, if the 35S promoter sequence was replaced with the NOS promoter sequence, no alteration in AAP2, AGL5 or PAB5 promoter activities was observed. Our results demonstrate that the 35S promoter sequence can convert an adjacent tissue- and organ-specific gene promoter into a globally active promoter. PMID:17340093

  9. Human miR223 Promoter as a Novel Myelo-Specific Promoter for Chronic Granulomatous Disease Gene Therapy

    PubMed Central

    Brendel, Christian; Hänseler, Walther; Wohlgensinger, Vital; Bianchi, Matteo; Tokmak, Serap; Chen-Wichmann, Linping; Kuzmenko, Elena; Cesarovic, Nikola; Nicholls, Flora; Reichenbach, Janine; Seger, Reinhard; Grez, Manuel

    2013-01-01

    Abstract Targeting transgene expression to specific hematopoietic cell lineages could contribute to the safety of retroviral vectors in gene therapeutic applications. Chronic granulomatous disease (CGD), a defect of phagocytic cells, can be managed by gene therapy, using retroviral vectors with targeted expression to myeloid cells. In this context, we analyzed the myelospecificity of the human miR223 promoter, which is known to be strongly upregulated during myeloid differentiation, to drive myeloid-restricted expression of p47phox and gp91phox in mouse models of CGD and in primary patient-derived cells. The miR223 promoter restricted the expression of p47phox, gp91phox, and green fluorescent protein (GFP) within self-inactivating (SIN) gamma- and lentiviral vectors to granulocytes and macrophages, with only marginal expression in lymphocytes or hematopoietic stem and progenitor cells. Furthermore, gene transfer into primary CD34+ cells derived from a p47phox patient followed by ex vivo differentiation to neutrophils resulted in restoration of Escherichia coli killing activity by miR223 promoter–mediated p47phox expression. These results indicate that the miR223 promoter as an internal promoter within SIN gene therapy vectors is able to efficiently correct the CGD phenotype with negligible activity in hematopoietic progenitors, thereby limiting the risk of insertional oncogenesis and development of clonal dominance. PMID:23489116

  10. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    PubMed

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. PMID:22389214

  11. Multiobjective H2/H∞ synthetic gene network design based on promoter libraries.

    PubMed

    Wu, Chih-Hung; Zhang, Weihei; Chen, Bor-Sen

    2011-10-01

    Some current promoter libraries have been developed for synthetic gene networks. But an efficient method to engineer a synthetic gene network with some desired behaviors by selecting adequate promoters from these promoter libraries has not been presented. Thus developing a systematic method to efficiently employ promoter libraries to improve the engineering of synthetic gene networks with desired behaviors is appealing for synthetic biologists. In this study, a synthetic gene network with intrinsic parameter fluctuations and environmental disturbances in vivo is modeled by a nonlinear stochastic system. In order to engineer a synthetic gene network with a desired behavior despite intrinsic parameter fluctuations and environmental disturbances in vivo, a multiobjective H(2)/H(∞) reference tracking (H(2) optimal tracking and H(∞) noise filtering) design is introduced. The H(2) optimal tracking can make the tracking errors between the behaviors of a synthetic gene network and the desired behaviors as small as possible from the minimum mean square error point of view, and the H(∞) noise filtering can attenuate all possible noises, from the worst-case noise effect point of view, to achieve a desired noise filtering ability. If the multiobjective H(2)/H(∞) reference tracking design is satisfied, the synthetic gene network can robustly and optimally track the desired behaviors, simultaneously. First, based on the dynamic gene regulation, the existing promoter libraries are redefined by their promoter activities so that they can be efficiently selected in the design procedure. Then a systematic method is developed to select an adequate promoter set from the redefined promoter libraries to synthesize a gene network satisfying these two design objectives. But the multiobjective H(2)/H(∞) reference tracking design problem needs to solve a difficult Hamilton-Jacobi Inequality (HJI)-constrained optimization problem. Therefore, the fuzzy approximation method is

  12. Regulatory region in choline acetyltransferase gene directs developmental and tissue-specific expression in transgenic mice.

    PubMed Central

    Lönnerberg, P; Lendahl, U; Funakoshi, H; Arhlund-Richter, L; Persson, H; Ibáñez, C F

    1995-01-01

    Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons. Images Fig. 1 Fig. 2 PMID:7732028

  13. Convergent transcription initiates from oppositely oriented promoters within the 5 prime end regions of Drosophila melanogaster F elements

    SciTech Connect

    Minchiotti, G. ); Di Nocera, P.P. )

    1991-10-01

    Drosophila melanogaster F elements are mobile, oligo(A)-terminated DNA sequences that likely propagate by the retrotranscription of RNA intermediates. Plasmids bearing DNA segments from the left-hand region of a full-length F element fused to the CAT gene were used as templates for transient expression assays in Drosophila Schneider II cultured cells. Protein and RNA analyses led to the identification of two promoters, F{sub in} and F{sub out}, that transcribe in opposite orientations. Analysis of the template activity of 3{prime} deletion derivatives indicates that the level of accumulation of F{sub in}RNA is also dependent upon the presence of sequences located within the +175 to +218 interval. The F{sub out} promoter drives transcription in the opposite orientation with respect to F{sub in}, F{sub out} transcripts initiate at nearby sites within the +92 to +102 interval. Sequences downstream of these multiple RNA start sites are not required for the activity of the F{sub out} promoter. Deletions knocking out the F{sub in} promoter do not impair F{sub out} transcription; conversely, initiation at the F{sub in} promoter still takes place in templates that lack the F{sub out} promoter. At a low level, both promoters are active in cultured cells.

  14. Epigenetic switch at atp2a2 and myh7 gene promoters in pressure overload-induced heart failure.

    PubMed

    Angrisano, Tiziana; Schiattarella, Gabriele Giacomo; Keller, Simona; Pironti, Gianluigi; Florio, Ermanno; Magliulo, Fabio; Bottino, Roberta; Pero, Raffaela; Lembo, Francesca; Avvedimento, Enrico Vittorio; Esposito, Giovanni; Trimarco, Bruno; Chiariotti, Lorenzo; Perrino, Cinzia

    2014-01-01

    Re-induction of fetal genes and/or re-expression of postnatal genes represent hallmarks of pathological cardiac remodeling, and are considered important in the progression of the normal heart towards heart failure (HF). Whether epigenetic modifications are involved in these processes is currently under investigation. Here we hypothesized that histone chromatin modifications may underlie changes in the gene expression program during pressure overload-induced HF. We evaluated chromatin marks at the promoter regions of the sarcoplasmic reticulum Ca2+ATPase (SERCA-2A) and β-myosin-heavy chain (β-MHC) genes (Atp2a2 and Myh7, respectively) in murine hearts after one or eight weeks of pressure overload induced by transverse aortic constriction (TAC). As expected, all TAC hearts displayed a significant reduction in SERCA-2A and a significant induction of β-MHC mRNA levels. Interestingly, opposite histone H3 modifications were identified in the promoter regions of these genes after TAC, including H3 dimethylation (me2) at lysine (K) 4 (H3K4me2) and K9 (H3K9me2), H3 trimethylation (me3) at K27 (H3K27me3) and dimethylation (me2) at K36 (H3K36me2). Consistently, a significant reduction of lysine-specific demethylase KDM2A could be found after eight weeks of TAC at the Atp2a2 promoter. Moreover, opposite changes in the recruitment of DNA methylation machinery components (DNA methyltransferases DNMT1 and DNMT3b, and methyl CpG binding protein 2 MeCp2) were found at the Atp2a2 or Myh7 promoters after TAC. Taken together, these results suggest that epigenetic modifications may underlie gene expression reprogramming in the adult murine heart under conditions of pressure overload, and might be involved in the progression of the normal heart towards HF. PMID:25181347

  15. Methylation State of the EDA Gene Promoter in Chinese X-Linked Hypohidrotic Ectodermal Dysplasia Carriers

    PubMed Central

    Fan, Huali; Bian, Zhuan

    2013-01-01

    Introduction Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED) which is caused by genetic ectodysplasin A (EDA) deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom. Methods A large Chinese XLHED family was reported and the entire coding region and exon–intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers’ tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system. Results A known frameshift mutation (c.573–574 insT) was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI), 18 (78.26%) carriers were hypermethylated at these 4 sites. Conclusion Chinese XLHED carriers often have a hypermethylated EDA promoter. PMID:23626789

  16. Allelic mutations in noncoding genomic sequences construct novel transcription factor binding sites that promote gene overexpression.

    PubMed

    Tian, Erming; Børset, Magne; Sawyer, Jeffrey R; Brede, Gaute; Våtsveen, Thea K; Hov, Håkon; Waage, Anders; Barlogie, Bart; Shaughnessy, John D; Epstein, Joshua; Sundan, Anders

    2015-11-01

    The growth and survival factor hepatocyte growth factor (HGF) is expressed at high levels in multiple myeloma (MM) cells. We report here that elevated HGF transcription in MM was traced to DNA mutations in the promoter alleles of HGF. Sequence analysis revealed a previously undiscovered single-nucleotide polymorphism (SNP) and crucial single-nucleotide variants (SNVs) in the promoters of myeloma cells that produce large amounts of HGF. The allele-specific mutations functionally reassembled wild-type sequences into the motifs that affiliate with endogenous transcription factors NFKB (nuclear factor kappa-B), MZF1 (myeloid zinc finger 1), and NRF-2 (nuclear factor erythroid 2-related factor 2). In vitro, a mutant allele that gained novel NFKB-binding sites directly responded to transcriptional signaling induced by tumor necrosis factor alpha (TNFα) to promote high levels of luciferase reporter. Given the recent discovery by genome-wide sequencing (GWS) of numerous non-coding mutations in myeloma genomes, our data provide evidence that heterogeneous SNVs in the gene regulatory regions may frequently transform wild-type alleles into novel transcription factor binding properties to aberrantly interact with dysregulated transcriptional signals in MM and other cancer cells. PMID:26220195

  17. Truncated Cotton Subtilase Promoter Directs Guard Cell-Specific Expression of Foreign Genes in Tobacco and Arabidopsis

    PubMed Central

    Han, Lei; Han, Ya-Nan; Xiao, Xing-Guo

    2013-01-01

    A 993-bp regulatory region upstream of the translation start codon of subtilisin-like serine protease gene was isolated from Gossypium barbadense. This (T/A)AAAG-rich region, GbSLSP, and its 5′- and 3′-truncated versions were transferred into tobacco and Arabidopsis after fusing with GUS or GFP. Histochemical and quantitative GUS analysis and confocal GFP fluorescence scanning in the transgenic plants showed that the GbSLSP-driven GUS and GFP expressed preferentially in guard cells, whereas driven by GbSLSPF2 to GbSLSPF4, the 5′-truncated GbSLSP versions with progressively reduced Dof1 elements, both GUS and GFP expressed exclusively in guard cells, and the expression strength declined with (T/A)AAAG copy decrement. Deletion of 5′-untranslated region from GbSLSP markedly weakened the activity of GUS and GFP, while deletion from the strongest guard cell-specific promoter, GbSLSPF2, not only significantly decreased the expression strength, but also completely abolished the guard cell specificity. These results suggested both guard cell specificity and expression strength of the promoters be coordinately controlled by 5′-untranslated region and a cluster of at least 3 (T/A)AAAG elements within a region of about 100 bp relative to transcription start site. Our guard cell-specific promoters will enrich tools to manipulate gene expression in guard cells for scientific research and crop improvement. PMID:23555786

  18. Intragenic Locus in Human PIWIL2 Gene Shares Promoter and Enhancer Functions

    PubMed Central

    Zinovyeva, Marina V.; Nikolaev, Lev G.; Azhikina, Tatyana L.

    2016-01-01

    Recently, more evidence supporting common nature of promoters and enhancers has been accumulated. In this work, we present data on chromatin modifications and non-polyadenylated transcription characteristic for enhancers as well as results of in vitro luciferase reporter assays suggesting that PIWIL2 alternative promoter in exon 7 also functions as an enhancer for gene PHYHIP located 60Kb upstream. This finding of an intragenic enhancer serving as a promoter for a shorter protein isoform implies broader impact on understanding enhancer-promoter networks in regulation of gene expression. PMID:27248499

  19. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  20. Indirubin derivatives alter DNA binding activity of the transcription factor NF-Y and inhibit MDR1 gene promoter.

    PubMed

    Tanaka, Toru; Ohashi, Sachiyo; Saito, Hiroaki; Higuchi, Takashi; Tabata, Keiichi; Kosuge, Yasuhiro; Suzuki, Takashi; Miyairi, Shinichi; Kobayashi, Shunsuke

    2014-10-15

    Indirubin derivatives exert antitumor activity. However, their effects on the expression of multidrug resistance gene 1 (MDR1) have not been investigated. Here we found three derivatives that inhibit the MDR1 gene promoter. To investigate the effects of indirubins on the DNA binding of NF-Y, a major MDR1 gene transcription factor that recognizes an inverted CCAAT element in the promoter, gel mobility shift assay was performed using the element as a probe with nuclear extracts from NG108-15, MCF7, HepG2, C2C12, and SK-N-SH cells. Among 17 compounds, 5-methoxyindirubin inhibited the DNA binding of NF-Y significantly, whereas indirubin-3'-oxime and 7-methoxyindirubin 3'-oxime increased the binding considerably. After evaluating a suitable concentration of each compound for transcription analysis using living tumor cells, we performed a reporter gene assay using a reporter DNA plasmid containing EGFP cDNA fused to the MDR1 gene promoter region. Indirubin-3'-oxime exerted a significant inhibitory effect on the MDR1 promoter activity in MCF7 and HepG2 cells, and 5-methoxyindirubin inhibited the activity only in MCF7 cells; 7-methoxyindirubin 3'-oxime suppressed the activity in all of the cell lines. We further confirmed that the compounds reduced endogenous MDR1 transcription without any inhibitory effect on NF-Y expression. Moreover, each compound increased the doxorubicin sensitivity of MCF7 cells. These results indicate that each indirubin derivative acts on the DNA binding of NF-Y and represses the MDR1 gene promoter with tumor cell-type specificity. PMID:25066113

  1. The regions of sequence variation in caulimovirus gene VI.

    PubMed

    Sanger, M; Daubert, S; Goodman, R M

    1991-06-01

    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes. PMID:2024500

  2. Regulation of alpha o expression by the 5'-flanking region of the alpha o gene.

    PubMed

    Li, Y; Mortensen, R; Neer, E J

    1994-11-01

    Many responses of cells to external signals require activation of the heterotrimeric G proteins. These responses depend on the type and amount of G proteins that are expressed. Each cell has a characteristic complement of G protein subunits. For example, the alpha o subunit is very abundant in neural tissues. Very little is known about the mechanisms that determine cellular levels of G proteins. In the present study, we have isolated a genomic clone for mouse alpha o gene and identified the promoter region. There are multiple transcription initiation sites located about 750 base pairs upstream of the translational start site. The promoter region is GC-rich and contains neither a TATA-box nor a CAAT box. Transient expression assays using a series of constructs containing various lengths of the 5'-flanking region of the alpha o promoter demonstrated that the region 300-700 base pairs upstream of the transcription initiation sites is responsible for the basic promoter activity. The relative activity of alpha o promoter is 8-12-fold higher in cells expressing alpha o than in cells lacking alpha o. The level of alpha o in cells may also be regulated at the level of protein translation because deletions in the 5'-noncoding region of alpha o gene increase reporter enzyme expression without a corresponding increase in reporter enzyme mRNA level. Our results suggest that both transcriptional and post-transcriptional mechanisms are involved in regulating the expression of alpha o in vivo. Transcriptional regulation probably is important for control of tissue-specific expression, while posttranscriptional mechanisms may be used to regulate the alpha o level in cells. PMID:7961675

  3. NELF and GAGA Factor Are Linked to Promoter-Proximal Pausing at Many Genes in Drosophila▿ †

    PubMed Central

    Lee, Chanhyo; Li, Xiaoyong; Hechmer, Aaron; Eisen, Michael; Biggin, Mark D.; Venters, Bryan J.; Jiang, Cizhong; Li, Jian; Pugh, B. Franklin; Gilmour, David S.

    2008-01-01

    Recent analyses of RNA polymerase II (Pol II) revealed that Pol II is concentrated at the promoters of many active and inactive genes. NELF causes Pol II to pause in the promoter-proximal region of the hsp70 gene in Drosophila melanogaster. In this study, genome-wide location analysis (chromatin immunoprecipitation-microarray chip [ChIP-chip] analysis) revealed that NELF is concentrated at the 5′ ends of 2,111 genes in Drosophila cells. Permanganate genomic footprinting was used to determine if paused Pol II colocalized with NELF. Forty-six of 56 genes with NELF were found to have paused Pol II. Pol II pauses 30 to 50 nucleotides downstream from transcription start sites. Analysis of DNA sequences in the vicinity of paused Pol II identified a conserved DNA sequence that probably associates with TFIID but detected no evidence of RNA secondary structures or other conserved sequences that might directly control elongation. ChIP-chip experiments indicate that GAGA factor associates with 39% of the genes that have NELF. Surprisingly, NELF associates with almost one-half of the most highly expressed genes, indicating that NELF is not necessarily a repressor of gene expression. NELF-associated pausing of Pol II might be an obligatory but sometimes transient checkpoint during the transcription cycle. PMID:18332113

  4. Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation

    SciTech Connect

    Burian, D.; Clifton, S.W.; Crabtree, J.

    1995-05-01

    The complete human BCR gene (152j-141 nt) on chromosome 22 and greater than 80% of the human ABL gene (179-512 nt) on chromosome 9 have been sequenced from mapped cosmid and plasmid clones via a shotgun strategy. Because these two chromosomes are translocated with breakpoints within the BCR and ABL genes in Philadelphia chromosome-positive leukemias, knowledge of these sequences also might provide insight into the validity of various theories of chromosomal rearrangements. Comparison of these genes with their cDNA sequences reveal the positions of 23 BCR exons and putative alternative BCR first and second exons, as well as the common ABL exons 2-11, respectively. Additionally, these regions include the alternative ABL first exons 1b and 1a, a new gene 5` to the first ABL exon, and an open reading frame with homology to an EST within the BCR fourth intron. Further analysis reveals an Alu homology of 38.83 and 39.35% for the BCR and ABL genes, respectively, with other repeat elements present to a lesser extent. Four new Philadelphia chromosome translocation breakpoints from chronic myelogenous leukemia patients also were sequenced, and the positions of these and several other previously sequenced breakpoints now have been mapped precisely, although no consistent breakpoint features immediately were apparent. Comparative analysis of genomic sequences encompassing the murine homologues to the human ABL exons 1b and 1a, as well as regions encompassing the ABL exons 2 and 3, reveals that although there is a high degree of homology in their corresponding exons and promoter regions, these two vertebrate species show a striking lack of homology outside these regions. 122 refs., 5 figs., 4 tabs.

  5. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    PubMed

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells. PMID:12810539

  6. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  7. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation.

    PubMed

    Kirov, Julia V; Adkisson, Michael; Nava, A J; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K; Lloyd, K C Kent; de Jong, Pieter; West, David B

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  8. Control of expression by the cellulose synthase (bcsA) promoter region from Acetobacter xylinum BPR 2001.

    PubMed

    Nakai, T; Moriya, A; Tonouchi, N; Tsuchida, T; Yoshinaga, F; Horinouchi, S; Sone, Y; Mori, H; Sakai, F; Hayashi, T

    1998-06-15

    The 5' upstream region (about 3.1kb) of the cellulose synthase operon (bcs operon) has been isolated by cloning from Acetobacter xylinum strain BPR 2001. The expression level of the upstream region was determined using sucrose synthase cDNA as a reporter gene in the shuttle vector pSA19. The expression occurred with the 1.1-kb upstream sequence from the ATG start codon of the bcs operon but not with the 241-bp upstream sequence in A. xylinum, although neither the 1.1-kb nor the 241-bp upstream sequence caused any expression as a promoter in Escherichia coli. The level of expression with the 1. 1-kb upstream sequence in A. aceti was 75% of that in A. xylinum. These results suggest that the upstream region functions as a specific promoter for the Acetobacter genus. The expression was reduced by the introduction of the 241-bp upstream region between the lac promoter and the reporter gene in E. coli and was not detected in A. xylinum. This suggests that the short upstream region composed of 241bp contains the site(s) which causes a negative regulation on the transcription for bcs operon. The production of recombinant protein with the ribosome-binding site (RBS) of A. xylinum obtained from the bcs operon, was reduced to about half in E. coli, and that with the site of the lac promoter was also reduced to about half in A. xylinum. This shows that a species-specific predominance occurs during interaction between mRNA and 16S rRNA in the RBS between A. xylinum and E. coli. PMID:9630539

  9. Dissection of the erythroid-specific transcriptional promoter used by the gene encoding aminolevulinic acid dehydratase (ALAD)

    SciTech Connect

    Bishop, T.R.; Schaffer, T.; Pien, B.

    1994-09-01

    The gene encoding delta-aminolevulinate dehydratase (ALAD), the second enzyme of the heme biosynthetic pathway, exists as a single gene in most mammalian genomes and we have sequenced over 12 kb from overlapping lambda clones containing the murine ALAD gene. The gene has a dual promoter driving expression of two different first exons; exon1A is expressed in all tissues and exon1B only in erythroid cells, where heme production is induced to exceptionally high levels for hemoglobin synthesis. Erythroid-specific expression of the ALAD gene is presumably accomplished by using the exon1B promoter which we hypothesize is responsive to erythroid-specific transcriptional activators. In order to test this, we have used gel mobility shift assays and DNase footprint analyses to dissect and identify the critical upstream regulatory elements. Nuclear extracts, prepared from murine erythroleukemia cells (MELC), human chronic myelogenous leukemia cell line (K562) and human fibroblast cell line (HeLa), were used as sources of proteins to analyze DNA binding sites in the ALAD erythroid-specific promoter from -307 to +1. In this region, there are three potential GATA1 sites, two CACCC boxes, a CCAAT box and a GGTGG box. NF-E2 sites were explored by using in vitro translation products of cloned p18 and p45, the two heterologous components of NF-E2, and successfully gel-shifted a 29 bp double-stranded oligo found at 2.6 kb in front of the ALAD gene. Thus, the ALAD gene utilizes both a housekeeping and a tissue-specific promoter.

  10. Biological Activity of the Alternative Promoters of the Dictyostelium discoideum Adenylyl Cyclase A Gene

    PubMed Central

    Rodriguez-Centeno, Javier; Sastre, Leandro

    2016-01-01

    Amoebae of the Dictyostelium discoideum species form multicellular fruiting bodies upon starvation. Cyclic adenosine monophosphate (cAMP) is used as intercellular signalling molecule in cell-aggregation, cell differentiation and morphogenesis. This molecule is synthesized by three adenylyl cyclases, one of which, ACA, is required for cell aggregation. The gene coding for ACA (acaA) is transcribed from three different promoters that are active at different developmental stages. Promoter 1 is active during cell-aggregation, promoters 2 and 3 are active in prespore and prestalk tip cells at subsequent developmental stages. The biological relevance of acaA expression from each of the promoters has been studied in this article. The acaA gene was expressed in acaA-mutant cells, that do not aggregate, under control of each of the three acaA promoters. acaA expression under promoter 1 control induced cell aggregation although subsequent development was delayed, very small fruiting bodies were formed and cell differentiation genes were expressed at very low levels. Promoter 2-driven acaA expression induced the formation of small aggregates and small fruiting bodies were formed at the same time as in wild-type strains and differentiation genes were also expressed at lower levels. Expression of acaA from promoter 3 induced aggregates and fruiting bodies formation and their size and the expression of differentiation genes were more similar to that of wild-type cells. Expression of acaA from promoters 1 and 2 in AX4 cells also produced smaller structures. In conclusion, the expression of acaA under control of the aggregation-specific Promoter 1 is able to induce cell aggregation in acaA-mutant strains. Expression from promoters 2 and 3 also recovered aggregation and development although promoter 3 induced a more complete recovery of fruiting body formation. PMID:26840347

  11. Biological Activity of the Alternative Promoters of the Dictyostelium discoideum Adenylyl Cyclase A Gene.

    PubMed

    Rodriguez-Centeno, Javier; Sastre, Leandro

    2016-01-01

    Amoebae of the Dictyostelium discoideum species form multicellular fruiting bodies upon starvation. Cyclic adenosine monophosphate (cAMP) is used as intercellular signalling molecule in cell-aggregation, cell differentiation and morphogenesis. This molecule is synthesized by three adenylyl cyclases, one of which, ACA, is required for cell aggregation. The gene coding for ACA (acaA) is transcribed from three different promoters that are active at different developmental stages. Promoter 1 is active during cell-aggregation, promoters 2 and 3 are active in prespore and prestalk tip cells at subsequent developmental stages. The biological relevance of acaA expression from each of the promoters has been studied in this article. The acaA gene was expressed in acaA-mutant cells, that do not aggregate, under control of each of the three acaA promoters. acaA expression under promoter 1 control induced cell aggregation although subsequent development was delayed, very small fruiting bodies were formed and cell differentiation genes were expressed at very low levels. Promoter 2-driven acaA expression induced the formation of small aggregates and small fruiting bodies were formed at the same time as in wild-type strains and differentiation genes were also expressed at lower levels. Expression of acaA from promoter 3 induced aggregates and fruiting bodies formation and their size and the expression of differentiation genes were more similar to that of wild-type cells. Expression of acaA from promoters 1 and 2 in AX4 cells also produced smaller structures. In conclusion, the expression of acaA under control of the aggregation-specific Promoter 1 is able to induce cell aggregation in acaA-mutant strains. Expression from promoters 2 and 3 also recovered aggregation and development although promoter 3 induced a more complete recovery of fruiting body formation. PMID:26840347

  12. The 5' flanking region of human epsilon-globin gene.

    PubMed Central

    Baralle, F E; Shoulders, C C; Goodbourn, S; Jeffreys, A; Proudfoot, N J

    1980-01-01

    The structural analysis of the 2.0 kb region upstream from the epsilon-globin gene has been carried out. A genomic DNA map around the gene was worked out in some detail to ensure that the cloned DNA was representative of the actual chromosomal arrangement. Furthermore, a new technique was developed to precisely map a reiterated DNA sequence present 1.5 kb to the 5' side of the gene. The complete nucleotide sequence of the 2.0 kb 5' flanking region was then determined and overlapped with the gene. The sequence included the reiterated DNA sequence which is homologous to the so-called AluI family of repeats. Unusual stretches of sequence 50 nucleotides long, where A + T represent about 90% of the bases, are present at both the 5' and 3' sides of the repeat. Images PMID:6253916

  13. [Intrinsic prokaryotic promoter activity of SUMO gene and its applications in the protein expression system of Escherichia coli].

    PubMed

    Qi, Yanhong; Zou, Zhurong; Zou, Huaying; Fan, Yunliu; Zhang, Chunyi

    2011-06-01

    Nowadays, SUMO fusion system is important for recombinant protein production in Escherichia coli, yet a few aspects remain to be improved, including the efficacy for vector construction and protein solubility. In this study, we found the SUMO gene Smt3 (Sm) of Saccharomyces cerevisiae conferred an unexpected activity of constitutive prokaryotic promoter during its PCR cloning, and the gene coding regions of SUMOs in most species had a sigma70-dependent prokaryotic promoter embedded, through the prediction via the BPROM program developed by Softberry. By combining the characters of Sm promoter activity and the Stu I site (added at the 3'-terminal of Sm), and introducing a His-tag and a hyper-acidic solubility-enhancing tag, we further constructed a set of versatile vectors for gene cloning and expression on the basis of Sm'-LacZa fusion gene. Experimentally started from these vectors, several target genes were subcloned and expressed through blue-white screening and SDS-PAGE analysis. The results manifest a few of expectable advantages such as rapid vector construction, highly soluble protein expression and feasible co-expression of correlated proteins. Conclusively, our optimized SUMO fusion technology herein could confer a large potential in E. coli protein expression system, and the simultaneously established co-expression vector systems could also be very useful in studying the protein-protein interactions in vivo. PMID:22034825

  14. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    PubMed Central

    Li, Deming; Fan, Jinyu; Li, Ziwei; Xu, Cunshuan

    2014-01-01

    Epidermal growth factor (EGF), a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH) rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration. PMID:25071410

  15. Identification of a stage selector element in the human gamma-globin gene promoter that fosters preferential interaction with the 5' HS2 enhancer when in competition with the beta-promoter.

    PubMed

    Jane, S M; Ney, P A; Vanin, E F; Gumucio, D L; Nienhuis, A W

    1992-08-01

    The erythroid-specific enhancer within hypersensitivity site 2 (HS2) of the human beta-globin locus control region is required for high level globin gene expression. We investigated interaction between HS2 and the gamma- and beta-promoters using reporter constructs in transient assays in human erythroleukemia (K562) cells. The beta-promoter, usually silent in K562 cells, was activated by HS2. This activity was abolished when a gamma-promoter was linked in cis. Analysis of truncation mutants suggested that sequences conveying the competitive advantage of the gamma-promoter for HS2 included those between positions -53 and -35 relative to the transcriptional start site. This sequence, when used to replace the corresponding region of the beta-promoter, increased beta-promoter activity 10-fold when linked to HS2. The modified beta-promoter was also capable of competing with a gamma-promoter modified internally in the -53 to -35 region, when the two promoters were linked to HS2 in a single plasmid. The corresponding sequences from the Galago gamma-promoter, a species which lacks fetal gamma-gene expression, were inactive in analogous assays. We have identified and partially purified a nuclear protein found in human (fetal stage) erythroleukemia cells, but present in much lower concentration in murine (adult stage) erythroleukemia cells, that binds the -53 to -35 sequence of the gamma-promoter. We speculate that this region of the gamma-promoter functions as a stage selector element in the regulation of hemoglobin switching in humans. PMID:1639067

  16. A Novel Binary T-Vector with the GFP Reporter Gene for Promoter Characterization

    PubMed Central

    Jiang, Shu-Ye; Vanitha, Jeevanandam; Bai, Yanan; Ramachandran, Srinivasan

    2014-01-01

    Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR) analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens. PMID:25197968

  17. A Genetic Approach to Promoter Recognition during Trans Induction of Viral Gene Expression

    NASA Astrophysics Data System (ADS)

    Coen, Donald M.; Weinheimer, Steven P.; McKnight, Steven L.

    1986-10-01

    Viral infection of mammalian cells entails the regulated induction of viral gene expression. The induction of many viral genes, including the herpes simplex virus gene encoding thymidine kinase (tk), depends on viral regulatory proteins that act in trans. Because recognition of the tk promoter by cellular transcription factors is well understood, its trans induction by viral regulatory proteins may serve as a useful model for the regulation of eukaryotic gene expression. A comprehensive set of mutations was therefore introduced into the chromosome of herpes simplex virus at the tk promoter to directly analyze the effects of promoter mutations on tk transcription. The promoter domains required for efficient tk expression under conditions of trans induction corresponded to those important for recognition by cellular transcription factors. Thus, trans induction of tk expression may be catalyzed initially by the interaction of viral regulatory proteins with cellular transcription factors.

  18. Divergent MLS1 Promoters Lie on a Fitness Plateau for Gene Expression.

    PubMed

    Bergen, Andrew C; Olsen, Gerilyn M; Fay, Justin C

    2016-05-01

    Qualitative patterns of gene activation and repression are often conserved despite an abundance of quantitative variation in expression levels within and between species. A major challenge to interpreting patterns of expression divergence is knowing which changes in gene expression affect fitness. To characterize the fitness effects of gene expression divergence, we placed orthologous promoters from eight yeast species upstream of malate synthase (MLS1) in Saccharomyces cerevisiae As expected, we found these promoters varied in their expression level under activated and repressed conditions as well as in their dynamic response following loss of glucose repression. Despite these differences, only a single promoter driving near basal levels of expression caused a detectable loss of fitness. We conclude that the MLS1 promoter lies on a fitness plateau whereby even large changes in gene expression can be tolerated without a substantial loss of fitness. PMID:26782997

  19. Divergent MLS1 Promoters Lie on a Fitness Plateau for Gene Expression

    PubMed Central

    Bergen, Andrew C.; Olsen, Gerilyn M.; Fay, Justin C.

    2016-01-01

    Qualitative patterns of gene activation and repression are often conserved despite an abundance of quantitative variation in expression levels within and between species. A major challenge to interpreting patterns of expression divergence is knowing which changes in gene expression affect fitness. To characterize the fitness effects of gene expression divergence, we placed orthologous promoters from eight yeast species upstream of malate synthase (MLS1) in Saccharomyces cerevisiae. As expected, we found these promoters varied in their expression level under activated and repressed conditions as well as in their dynamic response following loss of glucose repression. Despite these differences, only a single promoter driving near basal levels of expression caused a detectable loss of fitness. We conclude that the MLS1 promoter lies on a fitness plateau whereby even large changes in gene expression can be tolerated without a substantial loss of fitness. PMID:26782997

  20. Evaluation of a novel promoter from Populus trichocarpa for mature xylem tissue specific gene delivery.

    PubMed

    Nguyen, Van Phap; Cho, Jin-Seong; Choi, Young-Im; Lee, Sang-Won; Han, Kyung-Hwan; Ko, Jae-Heung

    2016-07-01

    Wood (i.e., secondary xylem) is an important raw material for many industrial applications. Mature xylem (MX) tissue-specific genetic modification offers an effective means to improve the chemical and physical properties of the wood. Here, we describe a promoter that drives strong gene expression in a MX tissue-specific manner. Using whole-transcriptome genechip analyses of different tissue types of poplar, we identified five candidate genes that had strong expression in the MX tissue. The putative promoter sequences of the five MX-specific genes were evaluated for their promoter activity in both transgenic Arabidopsis and poplar. Among them, we found the promoter of Potri.013G007900.1 (called the PtrMX3 promoter) had the strongest activity in MX and thus was further characterized. In the stem and root tissues of transgenic Arabidopsis plants, the PtrMX3 promoter activity was found exclusively in MX tissue. MX-specific activity of the promoter was reproduced in the stem tissue of transgenic poplar plants. The PtrMX3 promoter activity was not influenced by abiotic stresses or exogenously applied growth regulators, indicating the PtrMX3 promoter is bona fide MX tissue-specific. Our study provides a strong MX-specific promoter for MX-specific modifications of woody biomass. PMID:27038601

  1. Genetic region characterization (Gene RECQuest) - software to assist in identification and selection of candidate genes from genomic regions

    PubMed Central

    Sadasivam, Rajani S; Sundar, Gayathri; Vaughan, Laura K; Tanik, Murat M; Arnett, Donna K

    2009-01-01

    Background The availability of research platforms like the web tools of the National Center for Biotechnology Information (NCBI) has transformed the time-consuming task of identifying candidate genes from genetic studies to an interactive process where data from a variety of sources are obtained to select likely genes for follow-up. This process presents its own set of challenges, as the genetic researcher has to interact with several tools in a time-intensive, manual, and cumbersome manner. We developed a method and implemented an effective software system to address these challenges by multidisciplinary efforts of professional software developers with domain experts. The method presented in this paper, Gene RECQuest, simplifies the interaction with existing research platforms through the use of advanced integration technologies. Findings Gene RECQuest is a web-based application that assists in the identification of candidate genes from linkage and association studies using information from Online Mendelian Inheritance in Man (OMIM) and PubMed. To illustrate the utility of Gene RECQuest we used it to identify genes physically located within a linkage region as potential candidate genes for a quantitative trait locus (QTL) for very low density lipoprotein (VLDL) response on chromosome 18. Conclusion Gene RECQuest provides a tool which enables researchers to easily identify and organize literature supporting their own expertise and make informed decisions. It is important to note that Gene RECQuest is a data acquisition and organization software, and not a data analysis method. PMID:19793396

  2. Polymorphisms within the promoter and the intron 2 of the serotonin transporter gene in a population of bulimic patients.

    PubMed

    Lauzurica, N; Hurtado, A; Escartí, A; Delgado, M; Barrios, V; Morandé, G; Soriano, J; Jáuregui, I; González-Valdemoro, M I; García-Camba, E; Fuentes, J A

    2003-12-11

    The serotonin transporter (5-HTT) gene is a firm candidate to explain eating disorders. In this association study, two different polymorphisms were analysed: a variable number of tandem repeat (VNTR) polymorphism in intron 2 and a deletion/insertion polymorphism (5-HTTLPR) in the promoter region. The hypothesis that these gene polymorphisms may be a susceptibility factor in bulimia nervosa (BN) was explored in a female population of 102 purgative bulimics. BN patients who have suffered preceding anorexia nervosa (AN) episodes formed the so-called previous AN bulimic patient group. In our sample of normal-eater controls and purging type bulimics, regardless of whether or not the BN patients had suffered prior AN episodes, no differences were found considering the frequencies of genotypes, alleles or haplotypes of both polymorphic regions of the 5-HTT gene. PMID:14625025

  3. Structural Properties of Gene Promoters Highlight More than Two Phenotypes of Diabetes

    PubMed Central

    Guja, Cristian

    2015-01-01

    Genome-wide association studies (GWAS) published in the last decade raised the number of loci associated with type 1 (T1D) and type 2 diabetes (T2D) to more than 50 for each of these diabetes phenotypes. The environmental factors seem to play an important role in the expression of these genes, acting through transcription factors that bind to promoters. Using the available databases we examined the promoters of various genes classically associated with the two main diabetes phenotypes. Our comparative analyses have revealed significant architectural differences between promoters of genes classically associated with T1D and T2D. Nevertheless, five gene promoters (about 16%) belonging to T1D and six gene promoters (over 19%) belonging to T2D have shown some intermediary structural properties, suggesting a direct relationship to either LADA (Latent Autoimmune Diabetes in Adults) phenotype or to non-autoimmune type 1 phenotype. The distribution of these promoters in at least three separate classes seems to indicate specific pathogenic pathways. The image-based patterns (DNA patterns) generated by promoters of genes associated with these three phenotypes support the clinical observation of a smooth link between specific cases of typical T1D and T2D. In addition, a global distribution of these DNA patterns suggests that promoters of genes associated with T1D appear to be evolutionary more conserved than those associated with T2D. Though, the image based patterns obtained by our method might be a new useful parameter for understanding the pathogenetic mechanism and the diabetogenic gene networks. PMID:26379145

  4. Aberrant Promoter Methylation of p16 and MGMT Genes in Lung Tumors from Smoking and Never-Smoking Lung Cancer Patients1

    PubMed Central

    Liu, Yang; Lan, Qing; Siegfried, Jill M; Luketich, James D; Keohavong, Phouthone

    2006-01-01

    Abstract Aberrant methylation in gene promoter regions leads to transcriptional inactivation of cancer-related genes and plays an integral role in tumorigenesis. This alteration has been investigated in lung tumors primarily from smokers, whereas only a few studies involved never-smokers. Here, we applied methylation-specific polymerase chain reaction to compare the frequencies of the methylated promoter of p16 and O6-methylguanine-DNA methyltransferase (MGMT) genes in lung tumors from 122 patients with non-small cell lung cancer, including 81 smokers and 41 never-smokers. Overall, promoter methylation was detected in 52.5% (64 of 122) and 30.3% (37 of 122) of the p16 and MGMT genes, respectively. Furthermore, the frequency of promoter methylation was significantly higher among smokers, compared with never-smokers, for both the p16 [odds ratio (OR) = 3.28; 95% confidence interval (CI) = 1.28-8.39; P = .013] and MGMT (OR = 3.93; 95% CI = 1.27-12.21; P = .018) genes. The trend for a higher promoter methylation frequency of these genes was also observed among female smokers compared with female never-smokers. Our results suggest an association between tobacco smoking and an increased incidence of aberrant promoter methylation of the p16 and MGMT genes in non-small cell lung cancer. PMID:16533425

  5. Identification and characterization of the human XIST gene promoter: implications for models of X chromosome inactivation.

    PubMed Central

    Hendrich, B D; Plenge, R M; Willard, H F

    1997-01-01

    The XIST gene in both humans and mice is expressed exclusively from the inactive X chromosome and is required for X chromosome inactivation to occur early in development. In order to understand transcriptional regulation of the XIST gene, we have identified and characterized the human XIST promoter and two repeated DNA elements that modulate promoter activity. As determined by reporter gene constructs, the XIST minimal promoter is constitutively active at high levels in human male and female cell lines and in transgenic mice. We demonstrate that this promoter activity is dependent in vitro upon binding of the common transcription factors SP1, YY1 and TBP. We further identify two cis -acting repeated DNA sequences that influence reporter gene activity. First, DNA fragments containing a set of highly conserved repeats located within the 5'-end of XIST stimulate reporter activity 3-fold in transiently transfected cell lines. Second, a 450 bp alternating purine-pyrimidine repeat located 25 kb upstream of the XIST promoter partially suppresses promoter activity by approximately 70% in transient transfection assays. These results indicate that the XIST promoter is constitutively active and that critical steps in the X inactivation process must involve silencing of XIST on the active X chromosome by factors that interact with and/or recognize sequences located outside the minimal promoter. PMID:9185579

  6. Gene recovery microdissection (GRM) a process for producing chromosome region-specific libraries of expressed genes

    SciTech Connect

    Christian, A T; Coleman, M A; Tucker, J D

    2001-02-08

    Gene Recovery Microdissection (GRM) is a unique and cost-effective process for producing chromosome region-specific libraries of expressed genes. It accelerates the pace, reduces the cost, and extends the capabilities of functional genomic research, the means by which scientists will put to life-saving, life-enhancing use their knowledge of any plant or animal genome.

  7. Chromatin immunoprecipitation assays revealed CREB and serine 133 phospho-CREB binding to the CART gene proximal promoter

    PubMed Central

    Rogge, George A; Shen, Li-Ling; Kuhar, Michael J.

    2010-01-01

    Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. PMID:20451507

  8. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels

    PubMed Central

    Steinacher, Arno; Bates, Declan G.; Akman, Ozgur E.; Soyer, Orkun S.

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  9. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    PubMed

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  10. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  11. Gene search in the FSHD region on 4q35

    SciTech Connect

    Deutekom, J.C.T. van; Romberg, S.; Geel, M. van

    1994-09-01

    In the search for the FSHD gene on 4q35, four overlapping cosmids spanning a region of 95 kb including the deletion-prone repeated units were subcloned as well as subjected to cDNA selection and exon trap strategies. A total of 300 selected clones with an average length of 500 bp were mapped back to the cosmids. None of the clones appeared to be single copy. Sequence data of most clones and the related genomic regions were compared. cDNA clones with a high homolgy (>90%) and a low repetitive hybridization pattern were further analyzed by Zoo- and Northern blotting and by sequence analysis programs like GRAIL. Excellent and good exons could be identified and some clones showed evolutionary conservation. With the best cDNA, genomic and exon trap clones, several cDNA libraries were screened. The obtained cDNAs identified different genes, none of which originated from 4q35. 3{prime} RACE experiments were performed using primers derived of predicted exons especially in a 2.2 kb EcoRI fragment about 20 kb centromeric of the repeats. So far, only non-4q35 genes could be identified. Altogether, our results support other recent studies indicating that the FSHD gene is most likely not encoded by the 3.3 kb repeated units. Moreover, the region centromeric of these repeats appeared to contain abundant repetitive sequences and homologies to several other chromosomes, complicating the identification of the FSHD gene.

  12. The regulation of the Oct-1 gene transcription is mediated by two promoters.

    PubMed

    Pankratova, Elizaveta V; Sytina, Elena V; Luchina, Nadejda N; Krivega, Ivan V

    2003-07-01

    The ubiquitous transcription factor Oct-1 is a member of the POU domain family of regulatory proteins. Target genes controlled by Oct-1 include housekeeping genes, e.g. the genes encoding histon H2B or snRNAs, as well as tissue-specific genes, e.g. the genes encoding the light and heavy chains of immunoglobulines, some interleukins, and others. Oct-1 pre-mRNA may be spliced in several ways, resulting in production of several protein isoforms that may differ functionally. The 5'-end of the Oct-1 gene contains two exons-exon 1U and exon 1L that alternatively present in Oct-1 mRNA. We studied regulation of transcription of the Oct-1 gene using reporter gene assays of promoter-luciferase gene-constructs. It was shown that transcription of the Oct-1 gene is regulated by two promoters located upstream of the exon 1U and upstream of the exon 1L. The promoter located upstream of the exon 1U contains G/C-rich sequences and multiple Sp1 sites, while the promoter located upstream of the exon 1L contains A/T-rich motifs and autoregulation-related cis-elements: two octamer sites ATGCAAAT, two octamer related sites and multiple TAAT-core sites. Exons 1U and 1L in the human OTF-1 locus encoding the Oct-1 gene are located at the distance of 108 kbp. In the murine locus otf-1 the distance between exons 1U and 1L is 67 kbp. We suggest that the two promoters can differ functionally. PMID:12853155

  13. Characterization of the 5'-flanking region of the gene for the alpha chain of human fibrinogen.

    PubMed

    Hu, C H; Harris, J E; Davie, E W; Chung, D W

    1995-11-24

    The 5'-flanking region of the gene coding for the alpha chain of human fibrinogen was isolated, sequenced, and characterized. The principal site of transcription initiation was determined by primer extension analysis and the RNase protection assay and shown to be at an adenine residue located 55 nucleotides upstream from the initiator methionine codon, or 13,399 nucleotides down-stream from the polyadenylation site of the gene coding for the gamma chain. Transient expression of constructs containing sequentially deleted 5'-flanking sequences of the alpha chain gene fused to the chloramphenicol acetyltransferase reporter gene showed that the promoter was liver-specific and inducible by interleukin 6 (IL-6). The shortest DNA fragment with significant promoter activity and full response to IL-6 stimulation encompassed the region from -217 to +1 base pairs (bp). Although six potential IL-6 responsive sequences homologous to the type II IL-6 responsive element were present, a single sequence of CTGGGA localized from -122 to -127 bp was shown to be a functional element in IL-6 induction. A hepatocyte nuclear factor 1 (HNF-1) binding site, present from -47 to -59 bp, in combination with other upstream elements, was essential for liver-specific expression of the gene. A functional CCAAT/enhancer binding protein site (C/EBP, -134 to -142 bp) was also identified within 217 bp from the transcription initiation site. An additional positive element (-1393 to -1133 bp) and a negative element (-1133 to -749 bp) were also found in the upstream region of the alpha-fibrinogen gene. PMID:7499335

  14. Identification of differentially methylated regions in new genes associated with knee osteoarthritis.

    PubMed

    Bonin, Carolina A; Lewallen, Eric A; Baheti, Saurabh; Bradley, Elizabeth W; Stuart, Michael J; Berry, Daniel J; van Wijnen, Andre J; Westendorf, Jennifer J

    2016-01-15

    Epigenetic changes in articular chondrocytes are associated with osteoarthritis (OA) disease progression. Numerous studies have identified differentially methylated cytosines in OA tissues; however, the consequences of altered CpG methylation at single nucleotides on gene expression and phenotypes are difficult to predict. With the objective of detecting novel genes relevant to OA, we conducted a genome-wide assessment of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). DNA was extracted from visually damaged and normal appearing, non-damaged human knee articular cartilage from the same joint and then subjected to reduced representation bisulfite sequencing. DMRs were identified using a genome-wide systematic bioinformatics approach. A sliding-window of 500 bp was used for screening the genome for regions with clusters of DMSs. Gene expression levels were assessed and cell culture demethylation experiments were performed to further examine top candidate genes associated with damaged articular cartilage. More than 1000 DMRs were detected in damaged osteoarthritic cartilage. Nineteen of these contained five or more DMSs and were located in gene promoters or first introns and exons. Gene expression assessment revealed that hypermethylated DMRs in damaged samples were more consistently associated with gene repression than hypomethylated DMRs were with gene activation. Accordingly, a demethylation agent induced expression of most hypermethylated genes in chondrocytes. Our study revealed the utility of a systematic DMR search as an alternative to focusing on single nucleotide data. In particular, this approach uncovered promising candidates for functional studies such as the hypermethylated protein-coding genes FOXP4 and SHROOM1, which appear to be linked to OA pathology in humans and warrant further investigation. PMID:26484395

  15. Cloning of the promoter of NDE1, a gene implicated in psychiatric and neurodevelopmental disorders through copy number variation.

    PubMed

    Bradshaw, N J

    2016-06-01

    Copy number variation at 16p13.11 has been associated with a range of neurodevelopmental and psychiatric conditions, with duplication of this region being more common in individuals with schizophrenia. A prominent candidate gene within this locus is NDE1 (Nuclear Distribution Element 1) given its known importance for neurodevelopment, previous associations with mental illness and its well characterized interaction with the Disrupted in Schizophrenia 1 (DISC1) protein. In order to accurately model the effect of NDE1 duplication, it is important to first gain an understanding of how the gene is expressed. The complex promoter system of NDE1, which produces three distinct transcripts, each encoding for the same full-length NDE1 protein (also known as NudE), was therefore cloned and tested in human cell lines. The promoter for the longest of these three NDE1 transcripts was found to be responsible for the majority of expression in these systems, with its extended 5' untranslated region (UTR) having a limiting effect on its expression. These results thus highlight and clone the promoter elements required to generate systems in which the NDE1 protein is exogenously expressed under its native promoter, providing a biologically relevant model of 16p13.11 duplication in major mental illness. PMID:26975893

  16. Chicken ovalbumin upstream promoter transcription factors act as auxiliary cofactors for hepatocyte nuclear factor 4 and enhance hepatic gene expression.

    PubMed Central

    Ktistaki, E; Talianidis, I

    1997-01-01

    Chicken ovalbumin upstream promoter transcription factors (COUP-TFs) strongly inhibit transcriptional activation mediated by nuclear hormone receptors, including hepatocyte nuclear factor 4 (HNF-4). COUP-TFs repress HNF-4-dependent gene expression by competition with HNF-4 for common binding sites found in several regulatory regions. Here we show that promoters, such as the HNF-1 promoter, which are recognized by HNF-4 but not by COUP-TFs are activated by COUP-TFI and COUP-TFII in conjunction with HNF-4 more than 100-fold above basal levels, as opposed to about 8-fold activation by HNF-4 alone. This enhancement was strictly dependent on an intact HNF-4 E domain. In vitro and in vivo evidence suggests that COUP-TFs enhance HNF-4 activity by a mechanism that involves their physical interaction with the amino acid 227 to 271 region of HNF-4. Our results indicate that in certain promoters, COUP-TFs act as auxiliary cofactors for HNF-4, orienting the HNF-4 activation domain in a more efficient configuration to achieve enhanced transcriptional activity. These findings provide new insights into the regulatory functions of COUP-TFs, suggesting their involvement in the initial activation and subsequent high-level expression of hepatic regulators, as well as in the positive and negative modulation of downstream target genes. PMID:9111350

  17. Isolation of AtNUDT5 gene promoter and characterization of its activity in transgenic Arabidopsis thaliana.

    PubMed

    Zhang, Xiu-Chun; Li, Mei-Ying; Ruan, Meng-Bin; Xia, Yi-Ji; Wu, Kun-Xin; Peng, Ming

    2013-03-01

    AtNUDT5 is a cytosol Nudix that catalyzes the hydrolysis of a variety of substrates. In this report, a 1,387-bp 5'-flanking region of the AtNUDT5 gene was isolated from Arabidopsis thaliana. The tissue-specific activity of the 5'-flanking region was investigated by using the GUS gene as a reporter in transgenic A. thaliana plants. Weak GUS activity appeared in vascular tissues of young plants, strong GUS activity appeared in the axial roots, but no GUS activity was observed in the root cap, lateral roots, rosette leaf, mature silique and reproductive tissues such as stamen, pistil, and petal. Furthermore, by using these transgenic A. thaliana plants, results of the histochemical staining and fluorometric assays of GUS activity showed that the AtNUDT5 promoter can be activated by both avirulent Pst avrRpm1 and virulent Pst strains at 5 h post-infiltration and that the activity of AtNUDT5 promoter increased significantly at 24 h post-infiltration. Taken together, our results demonstrated that the AtNUDT5 promoter is pathogen-responsive. The promoter may be used to develop transgenic plants with an increased tolerance to pathogenic stresses. PMID:23322251

  18. Chicken ovalbumin upstream promoter transcription factors act as auxiliary cofactors for hepatocyte nuclear factor 4 and enhance hepatic gene expression.

    PubMed

    Ktistaki, E; Talianidis, I

    1997-05-01

    Chicken ovalbumin upstream promoter transcription factors (COUP-TFs) strongly inhibit transcriptional activation mediated by nuclear hormone receptors, including hepatocyte nuclear factor 4 (HNF-4). COUP-TFs repress HNF-4-dependent gene expression by competition with HNF-4 for common binding sites found in several regulatory regions. Here we show that promoters, such as the HNF-1 promoter, which are recognized by HNF-4 but not by COUP-TFs are activated by COUP-TFI and COUP-TFII in conjunction with HNF-4 more than 100-fold above basal levels, as opposed to about 8-fold activation by HNF-4 alone. This enhancement was strictly dependent on an intact HNF-4 E domain. In vitro and in vivo evidence suggests that COUP-TFs enhance HNF-4 activity by a mechanism that involves their physical interaction with the amino acid 227 to 271 region of HNF-4. Our results indicate that in certain promoters, COUP-TFs act as auxiliary cofactors for HNF-4, orienting the HNF-4 activation domain in a more efficient configuration to achieve enhanced transcriptional activity. These findings provide new insights into the regulatory functions of COUP-TFs, suggesting their involvement in the initial activation and subsequent high-level expression of hepatic regulators, as well as in the positive and negative modulation of downstream target genes. PMID:9111350

  19. A discrete region centered 22 base pairs upstream of the initiation site modulates transcription of Drosophila tRNAAsn genes.

    PubMed Central

    Lofquist, A K; Garcia, A D; Sharp, S J

    1988-01-01

    We have studied the mechanism by which 5'-flanking sequences modulate the in vitro transcription of eucaryotic tRNA genes. Using deletion and linker substitution mutagenesis, we have found that the 5'-flanking sequences responsible for the different in vitro transcription levels of three Drosophila tRNA5Asn genes are contained within a discrete region centered 22 nucleotides upstream from the transcription initiation site. In conjunction with the A-box intragenic control region, this upstream transcription-modulatory region functions in the selection mechanism for the site of transcription initiation. Since the transcription-modulatory region directs the position of the start site and the actual sequence of the transcription-modulatory region determines the level of tRNAAsn