Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

PubMed

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Histone deacetylase inhibition modulates histone acetylation at gene promoter regions and affects genome-wide gene transcription in Schistosoma mansoni

PubMed Central

Anderson, Letícia; Gomes, Monete Rajão; daSilva, Lucas Ferreira; Pereira, Adriana da Silva Andrade; Mourão, Marina M.; Romier, Christophe; Pierce, Raymond

2017-01-01

Background Schistosomiasis is a parasitic disease infecting hundreds of millions of people worldwide. Treatment depends on a single drug, praziquantel, which kills the Schistosoma spp. parasite only at the adult stage. HDAC inhibitors (HDACi) such as Trichostatin A (TSA) induce parasite mortality in vitro (schistosomula and adult worms), however the downstream effects of histone hyperacetylation on the parasite are not known. Methodology/Principal findings TSA treatment of adult worms in vitro increased histone acetylation at H3K9ac and H3K14ac, which are transcription activation marks, not affecting the unrelated transcription repression mark H3K27me3. We investigated the effect of TSA HDACi on schistosomula gene expression at three different time points, finding a marked genome-wide change in the transcriptome profile. Gene transcription activity was correlated with changes on the chromatin acetylation mark at gene promoter regions. Moreover, combining expression data with ChIP-Seq public data for schistosomula, we found that differentially expressed genes having the H3K4me3 mark at their promoter region in general showed transcription activation upon HDACi treatment, compared with those without the mark, which showed transcription down-regulation. Affected genes are enriched for DNA replication processes, most of them being up-regulated. Twenty out of 22 genes encoding proteins involved in reducing reactive oxygen species accumulation were down-regulated. Dozens of genes encoding proteins with histone reader motifs were changed, including SmEED from the PRC2 complex. We targeted SmEZH2 methyltransferase PRC2 component with a new EZH2 inhibitor (GSK343) and showed a synergistic effect with TSA, significantly increasing schistosomula mortality. Conclusions/Significance Genome-wide gene expression analyses have identified important pathways and cellular functions that were affected and may explain the schistosomicidal effect of TSA HDACi. The change in expression

DoOPSearch: a web-based tool for finding and analysing common conserved motifs in the promoter regions of different chordate and plant genes

PubMed Central

Sebestyén, Endre; Nagy, Tibor; Suhai, Sándor; Barta, Endre

2009-01-01

Background The comparative genomic analysis of a large number of orthologous promoter regions of the chordate and plant genes from the DoOP databases shows thousands of conserved motifs. Most of these motifs differ from any known transcription factor binding site (TFBS). To identify common conserved motifs, we need a specific tool to be able to search amongst them. Since conserved motifs from the DoOP databases are linked to genes, the result of such a search can give a list of genes that are potentially regulated by the same transcription factor(s). Results We have developed a new tool called DoOPSearch for the analysis of the conserved motifs in the promoter regions of chordate or plant genes. We used the orthologous promoters of the DoOP database to extract thousands of conserved motifs from different taxonomic groups. The advantage of this approach is that different sets of conserved motifs might be found depending on how broad the taxonomic coverage of the underlying orthologous promoter sequence collection is (consider e.g. primates vs. mammals or Brassicaceae vs. Viridiplantae). The DoOPSearch tool allows the users to search these motif collections or the promoter regions of DoOP with user supplied query sequences or any of the conserved motifs from the DoOP database. To find overrepresented gene ontologies, the gene lists obtained can be analysed further using a modified version of the GeneMerge program. Conclusion We present here a comparative genomics based promoter analysis tool. Our system is based on a unique collection of conserved promoter motifs characteristic of different taxonomic groups. We offer both a command line and a web-based tool for searching in these motif collections using user specified queries. These can be either short promoter sequences or consensus sequences of known transcription factor binding sites. The GeneMerge analysis of the search results allows the user to identify statistically overrepresented Gene Ontology terms that

Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

PubMed

Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

2014-04-01

Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

Fanconi Anemia Core Complex Gene Promoters Harbor Conserved Transcription Regulatory Elements

PubMed Central

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5′ region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3′ regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters. PMID:21826217

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

PubMed

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Tumour specific promoter region methylation of the human homologue of the Drosophila Roundabout gene DUTT1 (ROBO1) in human cancers.

PubMed

Dallol, Ashraf; Forgacs, Eva; Martinez, Alonso; Sekido, Yoshitaka; Walker, Rosemary; Kishida, Takeshi; Rabbitts, Pamela; Maher, Eamonn R; Minna, John D; Latif, Farida

2002-05-02

The human homologue of the Drosophila Roundabout gene DUTT1 (Deleted in U Twenty Twenty) or ROBO1 (Locus Link ID 6091), a member of the NCAM family of receptors, was recently cloned from the lung cancer tumour suppressor gene region 2 (LCTSGR2 or U2020 region) at 3p12. DUTT1 maps within a region of overlapping homozygous deletions characterized in both small cell lung cancer lines (SCLC) and in a breast cancer line. In this report we (a) defined the genomic organization of the DUTT1 gene, (b) performed mutation and expression analysis of DUTT1 in lung, breast and kidney cancers, (c) identified tumour specific promoter region methylation of DUTT1 in human cancers. The gene was found to contain 29 exons and spans at least 240 kb of genomic sequence. The 5' region contains a CpG island, and the poly(A)(+) tail has an atypical 5'-GATAAA-3' signal. We analysed DUTT1 for mutations in lung, breast and kidney cancers, no inactivating mutations were detected by PCR-SSCP. However, seven germline missense changes were found and characterized. DUTT1 expression was not detectable in one out of 18 breast tumour lines analysed by RT-PCR. Bisulfite sequencing of the promoter region of DUTT1 gene in the HTB-19 breast tumour cell line (not expressing DUTT1) showed complete hypermethylation of CpG sites within the promoter region of the DUTT1 gene (-244 to +27 relative to the translation start site). The expression of DUTT1 gene was reactivated in HTB-19 after treatment with the demethylating agent 5-aza-2'-deoxycytidine. The same region was also found to be hypermethylated in six out of 32 (19%) primary invasive breast carcinomas and eight out of 44 (18%) primary clear cell renal cell carcinomas (CC-RCC) and in one out of 26 (4%) primary NSCLC tumours. Furthermore 80% of breast and 75% of CC-RCC tumours showing DUTT1 methylation had allelic losses for 3p12 markers hence obeying Knudson's two hit hypothesis. Our findings suggest that DUTT1 warrants further analysis as a candidate for

Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

ERIC Educational Resources Information Center

Zhang, Jian

2009-01-01

Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

Priming affects the activity of a specific region of the promoter of the human beta interferon gene.

PubMed Central

Dron, M; Lacasa, M; Tovey, M G

1990-01-01

Treatment of Daudi or HeLa cells with human interferon (IFN) alpha 8 before induction with either poly(I)-poly(C) or Sendai virus resulted in an 8- to 100-fold increase in IFN production. The extent of priming in Daudi cells paralleled the increase in the intracellular content of IFN-beta mRNA. IFN-alpha mRNA remained undetectable in poly(I)-poly(C)-treated Daudi cells either before or after priming. An IFN-resistant clone of Daudi cells was found to produce 4- to 20-fold more IFN after priming, indicating that priming was unrelated to the phenotype of IFN sensitivity. IFN treatment of either Daudi or HeLa cells transfected with the human IFN-beta promoter (-282 to -37) linked to the chloramphenicol acetyltransferase (CAT) gene resulted in an increase in CAT activity after induction with poly(I)-poly(C) or Sendai virus. A synthetic double-stranded oligonucleotide corresponding to an authentic 30-base-pair (bp) region of the human IFN-beta promoter between positions -91 and -62 was found to confer virus inducibility upon the reporter CAT gene in HeLa cells. IFN treatment of HeLa cells transfected with this 30-bp region of the IFN-beta promoter in either the correct or reversed orientation also increased CAT activity upon subsequent induction. IFN treatment alone had no detectable effect on the activity of either the 30-bp region or the complete human IFN promoter. Images PMID:2153928

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

PubMed

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

PubMed

Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

2007-01-01

Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p < 0.05) and no significant for premature birth, short-birth height and low-birth weight. This is the first study showing the role of the promoter region of the IGF-I gene polymorphism and the level of plasma IGF-I and body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

Transcription Factor Map Alignment of Promoter Regions

PubMed Central

Blanco, Enrique; Messeguer, Xavier; Smith, Temple F; Guigó, Roderic

2006-01-01

We address the problem of comparing and characterizing the promoter regions of genes with similar expression patterns. This remains a challenging problem in sequence analysis, because often the promoter regions of co-expressed genes do not show discernible sequence conservation. In our approach, thus, we have not directly compared the nucleotide sequence of promoters. Instead, we have obtained predictions of transcription factor binding sites, annotated the predicted sites with the labels of the corresponding binding factors, and aligned the resulting sequences of labels—to which we refer here as transcription factor maps (TF-maps). To obtain the global pairwise alignment of two TF-maps, we have adapted an algorithm initially developed to align restriction enzyme maps. We have optimized the parameters of the algorithm in a small, but well-curated, collection of human–mouse orthologous gene pairs. Results in this dataset, as well as in an independent much larger dataset from the CISRED database, indicate that TF-map alignments are able to uncover conserved regulatory elements, which cannot be detected by the typical sequence alignments. PMID:16733547

Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

PubMed

Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

2014-01-10

Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

Nuclear translocation of Acinetobacter baumannii transposase induces DNA methylation of CpG regions in the promoters of E-cadherin gene.

PubMed

Moon, Dong Chan; Choi, Chul Hee; Lee, Su Man; Lee, Jung Hwa; Kim, Seung Il; Kim, Dong Sun; Lee, Je Chul

2012-01-01

Nuclear targeting of bacterial proteins has emerged as a pathogenic mechanism whereby bacterial proteins induce host cell pathology. In this study, we examined nuclear targeting of Acinetobacter baumannii transposase (Tnp) and subsequent epigenetic changes in host cells. Tnp of A. baumannii ATCC 17978 possesses nuclear localization signals (NLSs), (225)RKRKRK(230). Transient expression of A. baumannii Tnp fused with green fluorescent protein (GFP) resulted in the nuclear localization of these proteins in COS-7 cells, whereas the truncated Tnp without NLSs fused with GFP were exclusively localized in the cytoplasm. A. baumannii Tnp was found in outer membrane vesicles, which delivered this protein to the nucleus of host cells. Nuclear expression of A. baumannii Tnp fused with GFP in A549 cells induced DNA methylation of CpG regions in the promoters of E-cadherin (CDH1) gene, whereas the cytoplasmic localization of the truncated Tnp without NLSs fused with GFP did not induce DNA methylation. DNA methylation in the promoters of E-cadherin gene induced by nuclear targeting of A. baumannii Tnp resulted in down-regulation of gene expression. In conclusion, our data show that nuclear traffic of A. baumannii Tnp induces DNA methylation of CpG regions in the promoters of E-cadherin gene, which subsequently down-regulates gene expression. This study provides a new insight into the epigenetic control of host genes by bacterial proteins.

Ovarian-specific expression of a new gene regulated by the goat PIS region and transcribed by a FOXL2 bidirectional promoter.

PubMed

Pannetier, Maëlle; Renault, Lauriane; Jolivet, Geneviève; Cotinot, Corinne; Pailhoux, Eric

2005-06-01

Studies on XX sex reversal in polled goats (PIS mutation: polled intersex syndrome) have led to the discovery of a female-specific locus crucial for ovarian differentiation. This genomic region is composed of at least two genes, FOXL2 and PISRT1, sharing a common transcriptional regulatory region, PIS. In this paper, we describe a third gene, PFOXic (promoter FOXL2 inverse complementary), located near FOXL2 in the opposite orientation. This gene composed of five exons encodes a 1723-bp cDNA, enclosing two repetitive elements in its 3' end. PFOXic mRNA encodes a putative protein of 163 amino acids with no homologies in any of the databases tested. The transcriptional expression of PFOXic is driven by a bidirectional promoter also enhancing FOXL2 transcription. In goats, PFOXic is expressed in developing ovaries, from 36 days postcoitum until adulthood. Ovarian-specific expression of PFOXic is regulated by the PIS region. PFOXic is found conserved only in Bovidae. But, a human gene located in the opposite orientation relative to FOXL2 can be considered a human PFOXic. Finally, we discuss evidence arguing for regulation of the level of FOXL2 transcription via the bidirectional promoter and the level of transcription of PFOXic.

KLF15 promotes transcription of KLF3 gene in bovine adipocytes.

PubMed

Guo, Hongfang; Khan, Rajwali; Raza, Sayed Haidar Abbas; Ning, Yue; Wei, Dawei; Wu, Sen; Hosseini, Seyed Mahdi; Ullah, Irfan; Garcia, Matthew D; Zan, Linsen

2018-06-15

The Krüppel-like factors (KLF) family plays an important role in adipogenesis, which is subject to internal hierarchical regulation. KLF3 is a member of KLF family, mainly responsible for adipocyte differentiation and fat deposition. However, the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15 gene remains unclear during bovine adipogenesis. Here, we report that the expression pattern of KLF3 and KLF15 genes during bovine adipogenesis, when KLF15 gene was overexpressed through adenoviral vector (Ad-KLF15) in bovine adipocytes the expression level of KLF3 gene was increased, similarly when KLF15 was down regulated through siRNA the expression level of KLF3 was also reduced. To explore the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15, serial deletion constructs of the 5'flanking region of bovine KLF3gene revealed through dual-luciferase reporter assay that the core promoter is located in -264 to -76 regions. The most proximal GGGG element in the promoter of the bovine KLF3 gene (located in -264 to -76 regions) is required for promotion by KLF15. Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays further confirmed that KLF15 gene binds to the KLF3 gene core promoter region in bovine adipocytes. These findings conclude that KLF15 promotes the transcriptional activity of KLF3 in bovine adipocytes. This mechanism to provides a new direction for further study of adipogenesis by internal regulation of members within KLF family. Copyright © 2018 Elsevier B.V. All rights reserved.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

PubMed Central

Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

2009-01-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

A functional SNP in the promoter region of TCOF1 is associated with reduced gene expression and YY1 DNA-protein interaction.

PubMed

Masotti, Cibele; Armelin-Correa, Lucia M; Splendore, Alessandra; Lin, Chin J; Barbosa, Angela; Sogayar, Mari C; Passos-Bueno, Maria Rita

2005-10-10

Treacher Collins syndrome (TCS) is an autosomal dominant craniofacial malformation caused by null mutations in the TCOF1 gene. High inter and intra familial clinical variability, ranging from mild malar hypoplasia to perinatal death due to airway collapse is observed, but, to date, no genotype-phenotype correlation has been reported. Considering haploinsufficiency as the molecular mechanism underlying the disease, we have hypothesized that mutations in the promoter region of the gene, which has never been previously characterized, in trans with a pathogenic mutation, could modulate the phenotype. Therefore, the aims of the present study were to determine the TCOF1 gene's core promoter and to identify mutations in this region that could contribute to the phenotypic variation observed in this syndrome. We have delimitated the minimal promoter to a region of less than 150 bp, with 63% of identity among 5 different species. We screened 1.2 kbp of the TCOF1 5' flanking sequence in the DNA obtained from 21 patients and 51 controls and identified four new single nucleotide polymorphisms (SNPs), one of which (-346C>T), was proved to be functional, as it decreased the promoter activity by 38%. Electrophoretic mobility shift assay (EMSA) analysis demonstrated that the -346T allele impairs DNA-binding to the YY1 transcription factor. This promoter variant represents a candidate allele to explain the clinical variability in patients bearing TCS.

Identification and genetic effect of a variable duplication in the promoter region of the cattle ADIPOQ gene

USDA-ARS?s Scientific Manuscript database

The ADIPOQ gene of cattle, is located in the vicinity of the quantitative trait locus (QTL) wich effects marbling, the rib eye muscle area and fat thickness on BTA1. In our study, a novel variable duplication (NW_003103812.1:g.9232067_9232133 dup) in the bovine ADIPOQ promoter region was identified ...

Regulatory regions in the promoters of the Saccharomyces cerevisiae PYC1 and PYC2 genes encoding isoenzymes of pyruvate carboxylase.

PubMed

Menéndez, J; Gancedo, C

1998-07-15

We have identified regions in the promoters of the PYC1 and PYC2 genes from Saccharomyces cerevisiae involved in their regulation in different culture conditions. In the case of PYC1, a UAS in the region between -330/-297 and three repressing sequences with the common central core CCGCC at positions -457, -432 and -399 were identified. Specific binding of nuclear proteins to the -330/-214 DNA fragment was abolished in rtg mutants suggesting a role for the RTG genes in the control of PYC1 expression. In the case of the PYC2 promoter, elimination of a fragment from -417 to -291 brings about a two-fold decrease in the expression in repressed conditions and a similar increase in derepression.

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

DNA Methylation in Promoter Region as Biomarkers in Prostate Cancer

PubMed Central

Yang, Mihi; Park, Jong Y.

2013-01-01

The prostate gland is the most common site of cancer and the second leading cause of cancer death in American men. Recent emerging molecular biological technologies help us to know that epigenetic alterations such as DNA methylation within the regulatory (promoter) regions of genes are associated with transcriptional silencing in cancer. Promoter hypermethylation of critical pathway genes could be potential biomarkers and therapeutic targets for prostate cancer. In this chapter, we updated current information on methylated genes associated with the development and progression of prostate cancer. Over 40 genes have been investigated for methylation in promoter region in prostate cancer. These methylated genes are involved in critical pathways, such as DNA repair, metabolism, and invasion/metastasis. The role of hypermethylated genes in regulation of critical pathways in prostate cancer is discussed. These findings may provide new information of the pathogenesis, the exciting potential to be predictive and to provide personalized treatment of prostate cancer. Indeed, some epigenetic alterations in prostate tumors are being translated into clinical practice for therapeutic use. PMID:22359288

Structural analysis of the 5{prime} region of mouse and human Huntington disease genes reveals conservation of putative promoter region and Di- and trinucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Biaoyang; Nasir, J.; Kalchman, M.A.

1995-02-10

We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less

Gene Regions Responding to Skeletal Muscle Atrophy

NASA Technical Reports Server (NTRS)

Booth, Frank W.

1997-01-01

Our stated specific aims for this project were: 1) Identify the region(s) of the mouse IIb myosin heavy chain (MHC) promoter necessary for in vivo expression in mouse fast-twitch muscle, and 2) Identify the region(s) of the mouse IIb MHC promoter responsive to immobilization in mouse slow-twitch muscle in vivo. We sought to address these specific aims by introducing various MHC IIb promoter/reporter gene constructs directly into the tibialis anterior and gastrocnemius muscles of living mice. Although the method of somatic gene transfer into skeletal muscle by direct injection has been successfully used in our laboratory to study the regulation of the skeletal alpha actin gene in chicken skeletal muscle, we had many difficulties utilizing this procedure in the mouse. Because of the small size of the mouse soleus and the difficulty in obtaining consistent results, we elected not to study this muscle as first proposed. Rather, our MHC IIb promoter deletion experiments were performed in the gastrocnemius. Further, we decided to use hindlimb unloading via tail suspension to induce an upregulation of the MHC IIb gene, rather than immobilization of the hindlimbs via plaster casts. This change was made because tail suspension more closely mimics spaceflight, and this procedure in our lab results in a smaller loss of overall body mass than the mouse hindlimb immobilization procedure. This suggests that the stress level during tail suspension is less than during immobilization. This research has provided an important beginning point towards understanding the molecular regulation of the MHC lIb gene in response to unweighting of skeletal muscle Future work will focus on the regulation of MHC IIb mRNA stability in response to altered loading of skeletal muscle

Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

PubMed

Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

2014-11-07

Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

Functional characterization of the 5'-flanking and the promoter region of the human UCP3 (hUCP3) gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U

2000-09-22

Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.

Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

NASA Astrophysics Data System (ADS)

Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun

2006-12-01

Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

Insulators form gene loops by interacting with promoters in Drosophila.

PubMed

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

PubMed

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Genetic variants in the promoter region of the KLF3 gene associated with fat deposition in Qinchuan cattle.

PubMed

Guo, Hongfang; Raza, Sayed Haidar Abbas; Schreurs, Nicola M; Khan, Rajwali; Wei, Dawei; Wang, Li; Zhang, Song; Zhang, Le; Wu, Sen; Ullah, Irfan; Hosseini, Seyed Mahdi; Zan, Linsen

2018-06-08

Krüppel-like factor 3 (KLF3), a member of the Krüppel-like factor (KLF) family, plays an important role in adipogenesis and lipid metabolism. The aim of this study was to investigate whether KLF3 could be used as a candidate gene in the breeding of cattle. The expression pattern of bovine KLF3 gene revealed that it was highly expressed in abdominal fat and perirenal fat. Using DNA sequencing, three single nucleotide polymorphisms (SNPs) within the promoter regions of KLF3 gene were identified in 448 Qinchuan cattle, which are located in the recognition sequences of 11 transcription factors and the four haplotypes representing four potential different compositions of polymorphic potential cis-acting elements. Association analysis results indicated that individuals with the Hap7/7 diplotype showed higher (P < 0.05) intramuscular fat content (IFC) than those with H7/8. In addition, the H7 haplotype had much higher (P < 0.05) transcriptional activity than the H8 haplotype, consistent with the association analysis. We speculated that polymorphisms in transcription factor binding sites of the KLF3 promoter region affected transcriptional activity of KLF3, which subsequently influence intramuscular fat content in Qinchuan cattle and KLF3 gene could be used as molecular markers for fat deposition traits using early marker-assisted selection (MAS) of Qinchuan cattle breeding in the future. Copyright © 2017. Published by Elsevier B.V.

Tetramethylpyrazine-Inducible Promoter Region from Rhodococcus jostii TMP1.

PubMed

Stanislauskienė, Rūta; Kutanovas, Simonas; Kalinienė, Laura; Bratchikov, Maksim; Meškys, Rolandas

2018-06-25

An inducible promoter region, P TTMP (tetramethylpyrazine [TTMP]), has been identified upstream of the tpdABC operon, which contains the genes required for the initial degradation of 2,3,5,6-tetramethylpyrazine in Rhodococcus jostii TMP1 bacteria. In this work, the promoter region was fused with the gene for the enhanced green fluorescent protein (EGFP) to investigate the activity of P TTMP by measuring the fluorescence of bacteria. The highest promoter activity was observed when bacteria were grown in a nutrient broth (NB) medium supplemented with 5 mM 2,3,5,6-tetramethylpyrazine for 48 h. Using a primer extension reaction, two transcriptional start sites for tpdA were identified, and the putative −35 and −10 promoter motifs were determined. The minimal promoter along with two 15 bp long direct repeats and two 7 bp inverted sequences were identified. Also, the influence of the promoter elements on the activity of P TTMP were determined using site-directed mutagenesis. Furthermore, P TTMP was shown to be induced by pyrazine derivatives containing methyl groups in the 2- and 5-positions of the heterocyclic ring, in the presence of the LuxR family transcriptional activator TpdR.

The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

PubMed

Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

2011-01-01

Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is <1% the wild-type level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

PubMed

Ogino; Itakura; Kato; Aoki; Sato

1999-07-01

: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

A new genetic variant in the Sp1 binding cis-element of cholecystokinin gene promoter region and relationship to alcoholism.

PubMed

Harada, S; Okubo, T; Tsutsumi, M; Takase, S; Muramatsu, T

1998-05-01

Neuropeptide cholecystokinin (CCK) and the CCK receptors in the central nervous system mediate actions on increasing firings, anxiety, and nociceptions. Furthermore, CCK modulates the release of dopamine and dopamine-related behaviors in the mesolimbic pathway. In our study, genetic variation in the promoter and coding regions of the prepro-CCK gene were analyzed among 66 Japanese, 66 American Whites, 54 Chinese, and 41 Colombian natives. Two nucleotide sequence variants were found: a frequent mutation at nucleotide position -45 C to T involved in core sequence of Sp1 binding cis-element of the promoter region, and a C to T substitution at the 1662 position in intron 2. Analysis for the segregation study in 10 families of twins confirmed codominant heredity of two alleles. Distribution of genotypes and gene frequencies of 66 controls and 108 alcoholics in Japan presented that allelic variant T type in alcoholics was found in higher frequencies than that of controls, and distribution of these genotypes was significantly different between the both groups.

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Identification of a set of genes showing regionally enriched expression in the mouse brain

PubMed Central

D'Souza, Cletus A; Chopra, Vikramjit; Varhol, Richard; Xie, Yuan-Yun; Bohacec, Slavita; Zhao, Yongjun; Lee, Lisa LC; Bilenky, Mikhail; Portales-Casamar, Elodie; He, An; Wasserman, Wyeth W; Goldowitz, Daniel; Marra, Marco A; Holt, Robert A; Simpson, Elizabeth M; Jones, Steven JM

2008-01-01

Background The Pleiades Promoter Project aims to improve gene therapy by designing human mini-promoters (< 4 kb) that drive gene expression in specific brain regions or cell-types of therapeutic interest. Our goal was to first identify genes displaying regionally enriched expression in the mouse brain so that promoters designed from orthologous human genes can then be tested to drive reporter expression in a similar pattern in the mouse brain. Results We have utilized LongSAGE to identify regionally enriched transcripts in the adult mouse brain. As supplemental strategies, we also performed a meta-analysis of published literature and inspected the Allen Brain Atlas in situ hybridization data. From a set of approximately 30,000 mouse genes, 237 were identified as showing specific or enriched expression in 30 target regions of the mouse brain. GO term over-representation among these genes revealed co-involvement in various aspects of central nervous system development and physiology. Conclusion Using a multi-faceted expression validation approach, we have identified mouse genes whose human orthologs are good candidates for design of mini-promoters. These mouse genes represent molecular markers in several discrete brain regions/cell-types, which could potentially provide a mechanistic explanation of unique functions performed by each region. This set of markers may also serve as a resource for further studies of gene regulatory elements influencing brain expression. PMID:18625066

Identification of a set of genes showing regionally enriched expression in the mouse brain.

PubMed

D'Souza, Cletus A; Chopra, Vikramjit; Varhol, Richard; Xie, Yuan-Yun; Bohacec, Slavita; Zhao, Yongjun; Lee, Lisa L C; Bilenky, Mikhail; Portales-Casamar, Elodie; He, An; Wasserman, Wyeth W; Goldowitz, Daniel; Marra, Marco A; Holt, Robert A; Simpson, Elizabeth M; Jones, Steven J M

2008-07-14

The Pleiades Promoter Project aims to improve gene therapy by designing human mini-promoters (< 4 kb) that drive gene expression in specific brain regions or cell-types of therapeutic interest. Our goal was to first identify genes displaying regionally enriched expression in the mouse brain so that promoters designed from orthologous human genes can then be tested to drive reporter expression in a similar pattern in the mouse brain. We have utilized LongSAGE to identify regionally enriched transcripts in the adult mouse brain. As supplemental strategies, we also performed a meta-analysis of published literature and inspected the Allen Brain Atlas in situ hybridization data. From a set of approximately 30,000 mouse genes, 237 were identified as showing specific or enriched expression in 30 target regions of the mouse brain. GO term over-representation among these genes revealed co-involvement in various aspects of central nervous system development and physiology. Using a multi-faceted expression validation approach, we have identified mouse genes whose human orthologs are good candidates for design of mini-promoters. These mouse genes represent molecular markers in several discrete brain regions/cell-types, which could potentially provide a mechanistic explanation of unique functions performed by each region. This set of markers may also serve as a resource for further studies of gene regulatory elements influencing brain expression.

Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

PubMed

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

The human oxytocin gene promoter is regulated by estrogens.

PubMed

Richard, S; Zingg, H H

1990-04-15

Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

In vitro mapping of Myotonic Dystrophy (DM) gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Storbeck, C.J.; Sabourin, L.; Baird, S.

1994-09-01

The Myotonic Dystrophy Kinase (DMK) gene has been cloned and shared homology to serine/threonine protein kinases. Overexpression of this gene in stably transfected mouse myoblasts has been shown to inhibit fusion into myotubes while myoblasts stably transfected with an antisense construct show increased fusion potential. These experiments, along with data showing that the DM gene is highly expressed in muscle have highlighted the possibility of DMK being involved in myogenesis. The promoter region of the DM gene lacks a consensus TATA box and CAAT box, but harbours numerous transcription binding sites. Clones containing extended 5{prime} upstream sequences (UPS) of DMKmore » only weakly drive the reporter gene chloramphenicol acetyl transferase (CAT) when transfected into C2C12 mouse myoblasts. However, four E-boxes are present in the first intron of the DM gene and transient assays show increased expression of the CAT gene when the first intron is present downstream of these 5{prime} UPS in an orientation dependent manner. Comparison between mouse and human sequence reveals that the regions in the first intron where the E-boxes are located are highly conserved. The mapping of the promoter and the importance of the first intron in the control of DMK expression will be presented.« less

Alternative splicing and promoter use in TFII-I genes

PubMed Central

Makeyev, Aleksandr V.; Bayarsaihan, Dashzeveg

2008-01-01

TFII-I proteins are ubiquitously expressed transcriptional factors involved in both basal transcription and signal transduction activation or repression. TFII-I proteins are detected as early as at two-cell stage and exhibit distinct and dynamic expression patterns in developing embryos as well as mark regional variation in the adult mouse brain. Analysis of atypical small and rare chromosomal deletions at 7q11.23 points to TFII-I genes (GTF2I and GTF2IRD1) as the prime candidates responsible for craniofacial and cognitive abnormalities in the Williams-Beuren syndrome. TFII-I genes are often subjected to alternative splicing, which generates isoforms that that show different activities and play distinct biological roles. The coding regions of TFII-I genes are composed of more than 30 exons and are well conserved among vertebrates. However, their 5′ untranslated regions are not as well conserved and all poorly characterized. In the present work, we analyzed promoter regions of TFII-I genes and described their additional exons, as well as tested tissue specificity of both previously reported and novel alternatively spliced isoforms. Our comprehensive analysis leads to further elucidation of the functional heterogeneity of TFII-I proteins, provides hints on search for regulatory pathways governing their expression, and opens up possibilities for examining the effect of different haplotypes on their promoter functions. PMID:19111598

Alternative splicing and promoter use in TFII-I genes.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2009-03-15

TFII-I proteins are ubiquitously expressed transcriptional factors involved in both basal transcription and signal transduction activation or repression. TFII-I proteins are detected as early as at two-cell stage and exhibit distinct and dynamic expression patterns in developing embryos as well as mark regional variation in the adult mouse brain. Analysis of atypical small and rare chromosomal deletions at 7q11.23 points to TFII-I genes (GTF2I and GTF2IRD1) as the prime candidates responsible for craniofacial and cognitive abnormalities in the Williams-Beuren syndrome. TFII-I genes are often subjected to alternative splicing, which generates isoforms that show different activities and play distinct biological roles. The coding regions of TFII-I genes are composed of more than 30 exons and are well conserved among vertebrates. However, their 5' untranslated regions are not as well conserved and all poorly characterized. In the present work, we analyzed promoter regions of TFII-I genes and described their additional exons, as well as tested tissue specificity of both previously reported and novel alternatively spliced isoforms. Our comprehensive analysis leads to further elucidation of the functional heterogeneity of TFII-I proteins, provides hints on search for regulatory pathways governing their expression, and opens up possibilities for examining the effect of different haplotypes on their promoter functions.

The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

PubMed Central

Degl'Innocenti, Andrea

2016-01-01

Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a

The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

PubMed

Degl'Innocenti, Andrea; Parrilla, Marta; Harr, Bettina; Teschke, Meike

2016-01-01

In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings favor Olfr266

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

PubMed

Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

2009-08-01

Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

PubMed

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

PubMed

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

PubMed

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection.

PubMed

Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L

2013-08-01

Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.

Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

PubMed

Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

2005-07-01

Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

ABERRANT PROMOTER METHYLATION OF MULTIPLE GENES IN SPUTUM FROM INDIVIDUALS EXPOSED TO SMOKY COAL EMISSIONS

EPA Science Inventory

Aberrant methylation in the promoter region of cancer-related genes leads to gene transcriptional inactivation and plays an integral role in lung tumorigenesis. Recent studies demonstrated that promoter methylation was detected not only in lung tumors from patients with lung canc...

Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters.

PubMed

Gagniuc, Paul; Ionescu-Tirgoviste, Constantin

2012-09-28

The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three different databases and a

[Gene promoter methylation in glucose-6-phosphate dehydrogenase deficiency].

PubMed

Xu, Dan-Dan; Wen, Fei-Qiu; Lv, Rong-Yu; Zhang, Min; Chen, Yun-Sheng; Chen, Xiao-Wen

2016-05-01

To investigate the features of methylation in the promoter region of glucose-6-phosphate dehydrogenase (G6PD) gene and the association between gene promoter methylation and G6PD deficiency. Fluorescent quantitative PCR was used to measure the mRNA expression of G6PD in 130 children with G6PD deficiency. Sixty-five children without G6PD deficiency served as the control group. The methylation-sensitive high-resolution melting curve analysis and bisulfite PCR sequencing were used to analyze gene promoter methylation in 22 children with G6PD deficiency and low G6PD mRNA expression. The G6PD gene promoter methylation was analyzed in 44 girls with normal G6PD mRNA expression (7 from G6PD deficiency group and 37 from control group). Twenty-two (16.9%) children with G6PD deficiency had relatively low mRNA expression of G6PD; among whom, 16 boys showed no methylation, and 6 girls showed partial methylation. Among the 44 girls with normal G6PD mRNA expression, 40 showed partial methylation, and 4 showed no methylation (1 case in the G6PD group and 3 cases in the control group). Gene promoter methylation is not associated with G6PD deficiency in boys. Girls have partial methylation or no methylation in the G6PD gene, suggesting that the methylation may be related to G6PD deficiency in girls.

Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

PubMed

Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

2015-09-29

Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

Isolation, characterization, and evaluation of three Citrus sinensis-derived constitutive gene promoters.

PubMed

Erpen, L; Tavano, E C R; Harakava, R; Dutt, M; Grosser, J W; Piedade, S M S; Mendes, B M J; Mourão Filho, F A A

2018-05-23

Regulatory sequences from the citrus constitutive genes cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) were isolated, fused to the uidA gene, and qualitatively and quantitatively evaluated in transgenic sweet orange plants. The 5' upstream region of a gene (the promoter) is the most important component for the initiation and regulation of gene transcription of both native genes and transgenes in plants. The isolation and characterization of gene regulatory sequences are essential to the development of intragenic or cisgenic genetic manipulation strategies, which imply the use of genetic material from the same species or from closely related species. We describe herein the isolation and evaluation of the promoter sequence from three constitutively expressed citrus genes: cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1). The functionality of the promoters was confirmed by a histochemical GUS assay in leaves, stems, and roots of stably transformed citrus plants expressing the promoter-uidA construct. Lower uidA mRNA levels were detected when the transgene was under the control of citrus promoters as compared to the expression under the control of the CaMV35S promoter. The association of the uidA gene with the citrus-derived promoters resulted in mRNA levels of up to 60-41.8% of the value obtained with the construct containing CaMV35S driving the uidA gene. Moreover, a lower inter-individual variability in transgene expression was observed amongst the different transgenic lines, where gene constructs containing citrus-derived promoters were used. In silico analysis of the citrus-derived promoter sequences revealed that their activity may be controlled by several putative cis-regulatory elements. These citrus promoters will expand the availability of regulatory sequences for driving gene expression in citrus gene-modification programs.

Lineage-Specific Genome Architecture Links Enhancers and Non-coding Disease Variants to Target Gene Promoters.

PubMed

Javierre, Biola M; Burren, Oliver S; Wilder, Steven P; Kreuzhuber, Roman; Hill, Steven M; Sewitz, Sven; Cairns, Jonathan; Wingett, Steven W; Várnai, Csilla; Thiecke, Michiel J; Burden, Frances; Farrow, Samantha; Cutler, Antony J; Rehnström, Karola; Downes, Kate; Grassi, Luigi; Kostadima, Myrto; Freire-Pritchett, Paula; Wang, Fan; Stunnenberg, Hendrik G; Todd, John A; Zerbino, Daniel R; Stegle, Oliver; Ouwehand, Willem H; Frontini, Mattia; Wallace, Chris; Spivakov, Mikhail; Fraser, Peter

2016-11-17

Long-range interactions between regulatory elements and gene promoters play key roles in transcriptional regulation. The vast majority of interactions are uncharted, constituting a major missing link in understanding genome control. Here, we use promoter capture Hi-C to identify interacting regions of 31,253 promoters in 17 human primary hematopoietic cell types. We show that promoter interactions are highly cell type specific and enriched for links between active promoters and epigenetically marked enhancers. Promoter interactomes reflect lineage relationships of the hematopoietic tree, consistent with dynamic remodeling of nuclear architecture during differentiation. Interacting regions are enriched in genetic variants linked with altered expression of genes they contact, highlighting their functional role. We exploit this rich resource to connect non-coding disease variants to putative target promoters, prioritizing thousands of disease-candidate genes and implicating disease pathways. Our results demonstrate the power of primary cell promoter interactomes to reveal insights into genomic regulatory mechanisms underlying common diseases. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Enhancement of expression of survivin promoter-driven CD/TK double suicide genes by the nuclear matrix attachment region in transgenic gastric cancer cells.

PubMed

Niu, Ying; Li, Jian-Sheng; Luo, Xian-Run

2014-01-25

This work aimed to study a novel transgenic expression system of the CD/TK double suicide genes enhanced by the nuclear matrix attachment region (MAR) for gene therapy. The recombinant vector pMS-CD/TK containing the MAR-survivin promoter-CD/TK cassette was developed and transfected into human gastric cancer SGC-7901 cells. Expression of the CD/TK genes was detected by quantitative real-time PCR (qPCR) and Western blot. Cell viability and apoptosis were measured using the methyl thiazolyl tetrazolium (MTT) assay and flow cytometry. When the MAR fragment was inserted into the upstream of the survivin promoter, the qPCR result showed that the expression of the CD/TK genes significantly increased 7.7-fold in the transgenic SGC-7901 cells with plasmid pMS-CD/TK compared with that without MAR. MTT and flow cytometry analyses indicated that treatment with the prodrugs (5-FC+GCV) significantly decreased the cellular survival rate and enhanced the cellular apoptosis in the SGC-7901 cells. The expression of the CD/TK double suicide genes driven by the survivin promoter can be enhanced by the MAR fragment in human gastric cancer cells. Copyright © 2013 Elsevier B.V. All rights reserved.

Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

PubMed

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

PubMed

Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

2010-05-15

DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.

RNAP-II transcribes two small RNAs at the promoter and terminator regions of the RNAP-I gene in Saccharomyces cerevisiae.

PubMed

Mayán, Maria D

2013-01-01

Three RNA polymerases coexist in the ribosomal DNA of Saccharomyces cerevisiae. RNAP-I transcribes the 35S rRNA, RNAP-III transcribes the 5S rRNA and RNAP-II is found in both intergenic non-coding regions. Previously, we demonstrated that RNAP-II molecules bound to the intergenic non-coding regions (IGS) of the ribosomal locus are mainly found in a stalled conformation, and the stalled polymerase mediates chromatin interactions, which isolate RNAP-I from the RNAP-III transcriptional domain. Besides, RNAP-II transcribes both IGS regions at low levels, using different cryptic promoters. This report demonstrates that RNAP-II also transcribes two sequences located in the 5'- and 3'-ends of the 35S rRNA gene that overlap with the sequences of the 35S rRNA precursor transcribed by RNAP-I. The sequence located at the promoter region of RNAP-I, called the p-RNA transcript, binds to the transcription termination-related protein, Reb1p, while the T-RNA sequence, located in the termination sites of RNAP-I gene, contains the stem-loop recognized by Rtn1p, which is necessary for proper termination of RNAP-I. Because of their location, these small RNAs may play a key role in the initiation and termination of RNAP-I transcription. To correctly synthesize proteins, eukaryotic cells may retain a mechanism that connects the three main polymerases. This report suggests that cryptic transcription by RNAP-II may be required for normal transcription by RNAP-I in the ribosomal locus of S. cerevisiae. Copyright © 2012 John Wiley & Sons, Ltd.

Characterization and Use of Catabolite-Repressed Promoters from Gluconate Genes in Corynebacterium glutamicum†

PubMed Central

Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A.; Mateos, Luís M.

2006-01-01

The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP. PMID:16385030

Characterization and use of catabolite-repressed promoters from gluconate genes in Corynebacterium glutamicum.

PubMed

Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A; Mateos, Luís M

2006-01-01

The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP.

Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

PubMed

Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

2017-11-26

Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

Genetic analysis of the dsz promoter and associated regulatory regions of Rhodococcus erythropolis IGTS8.

PubMed Central

Li, M Z; Squires, C H; Monticello, D J; Childs, J D

1996-01-01

The dsz gene cluster of Rhodococcus erythropolis IGTS8 comprises three genes, dszA, dszB, and dszC, whose products are involved in the conversion of dibenzothiophene (DBT) to 2-hydroxybiphenyl and sulfite. This organism can use DBT as the sole sulfur source but not as a carbon source. Dsz activity is repressed by methionine, cysteine, Casamino Acids, and sulfate but not by DBT or dimethyl sulfoxide. We cloned 385 bp of the DNA immediately 5' to dszA in front of the reporter gene lacZ of Escherichia coli. We showed that this region contains a Rhodococcus promoter and at least three dsz regulatory regions. After hydrazine mutagenesis of this DNA, colonies that were able to express beta-galactosidase in the presence of Casamino Acids were isolated. Sequencing of these mutants revealed two possible regulatory regions. One is at -263 to -244, and the other is at -93 to -38, where -1 is the base preceding the A of the initiation codon ATG of dszA. An S1 nuclease protection assay showed that the start of the dsz promoter is the G at -46 and that transcription is repressed by sulfate and cysteine but not by dimethyl sulfoxide. The promoter encompasses a region of potential diad symmetry that may contain an operator. Immediately upstream of the promoter is a protein-binding domain between -146 and -121. Deletion of this region did not affect repression, but promoter activity appeared to be reduced by threefold. Thus, it could be an activator binding site or an enhancer region. PMID:8932295

Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

PubMed

Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

1996-12-01

The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

Leptin gene promoter DNA methylation in WNIN obese mutant rats

PubMed Central

2014-01-01

Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350

Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

PubMed

Keller, Thomas E; Han, Priscilla; Yi, Soojin V

2016-04-01

Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

PubMed

Lintas, Carla; Sacco, Roberto; Persico, Antonio M

2016-01-01

Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

The FA pathway counteracts oxidative stress through selective protection of antioxidant defense gene promoters.

PubMed

Du, Wei; Rani, Reena; Sipple, Jared; Schick, Jonathan; Myers, Kasiani C; Mehta, Parinda; Andreassen, Paul R; Davies, Stella M; Pang, Qishen

2012-05-03

Oxidative stress has been implicated in the pathogenesis of many human diseases including Fanconi anemia (FA), a genetic disorder associated with BM failure and cancer. Here we show that major antioxidant defense genes are down-regulated in FA patients, and that gene down-regulation is selectively associated with increased oxidative DNA damage in the promoters of the antioxidant defense genes. Assessment of promoter activity and DNA damage repair kinetics shows that increased initial damage, rather than a reduced repair rate, contributes to the augmented oxidative DNA damage. Mechanistically, FA proteins act in concert with the chromatin-remodeling factor BRG1 to protect the promoters of antioxidant defense genes from oxidative damage. Specifically, BRG1 binds to the promoters of the antioxidant defense genes at steady state. On challenge with oxidative stress, FA proteins are recruited to promoter DNA, which correlates with significant increase in the binding of BRG1 within promoter regions. In addition, oxidative stress-induced FANCD2 ubiquitination is required for the formation of a FA-BRG1-promoter complex. Taken together, these data identify a role for the FA pathway in cellular antioxidant defense.

[Promoter hypermethylation status of the mismatch repair gene hMLH1 in patients with sporadic renal cell carcinoma].

PubMed

Salinas-Sánchez, Antonio S; Rubio-del-Campo, Antonio; Sánchez-Sánchez, Francisco; Giménez-Bachs, José M; Donate-Moreno, María J; García-Olmo, Dolores C; Escribano-Martínez, Julio

2006-04-01

Epigenetic inactivation is a gene function abnormality that produces no changes in the DNA sequence, with the most frequent epigenetic alteration being hypermethylation of CpG islands in the promoter regions of the genes. Based on recent indications of a potential relationship between mismatch repair genes and renal cell carcinoma (RCC), we were interested in investigating the existence of promoter hypermethylation of the hMLH1 gene in tumor DNA samples from patients with sporadic RCC. Sixty-five tumor tissue specimens were collected consecutively. The DNA was first obtained and purified, then digested with the restriction enzymes Hpa II and Msp I, followed by polimerase chain reaction amplification of 3 promoter regions of the hMLH1 gene, agarose gel electrophoresis, and densitometric analysis of the images of the amplified bands. Mean patient age was 63.7 years. The most frequent cell type was clear cell carcinoma (67.7%). 73.9% of tumors were diagnosed in stages below pT2, 9.3% had gland involvement and 20%, distant metastasis. No somatic hypermethylation was detected in the promoter region of the hMLH1 gene in any of the patients studied. Our data indicate that promoter hypermethylation of the hMLH1 gene is not implicated in the pathogenesis of sporadic RCC, and therefore the existence of another type of mutation, microsatellite instability and/or loss of heterozygosity should be examined to determine the possible role of this gene in sporadic RCC.

Intrinsically bent DNA in replication origins and gene promoters.

PubMed

Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

2008-06-24

Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

PubMed

Peng, Xian-E; Wu, Yun-Li; Zhu, Yi-Bing; Huang, Rong-Dong; Lu, Qing-Qing; Lin, Xu

2015-01-01

Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

Programming gene expression with combinatorial promoters

PubMed Central

Cox, Robert Sidney; Surette, Michael G; Elowitz, Michael B

2007-01-01

Promoters control the expression of genes in response to one or more transcription factors (TFs). The architecture of a promoter is the arrangement and type of binding sites within it. To understand natural genetic circuits and to design promoters for synthetic biology, it is essential to understand the relationship between promoter function and architecture. We constructed a combinatorial library of random promoter architectures. We characterized 288 promoters in Escherichia coli, each containing up to three inputs from four different TFs. The library design allowed for multiple −10 and −35 boxes, and we observed varied promoter strength over five decades. To further analyze the functional repertoire, we defined a representation of promoter function in terms of regulatory range, logic type, and symmetry. Using these results, we identified heuristic rules for programming gene expression with combinatorial promoters. PMID:18004278

Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

1995-10-09

In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains amore » functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.« less

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

Evaluation of a functional epigenetic approach to identify promoter region methylation in phaeochromocytoma and neuroblastoma

PubMed Central

Margetts, Caroline D E; Morris, Mark; Astuti, Dewi; Gentle, Dean C; Cascon, Alberto; McRonald, Fiona E; Catchpoole, Daniel; Robledo, Mercedes; Neumann, Hartmut P H; Latif, Farida; Maher, Eamonn R

2008-01-01

The molecular genetics of inherited phaeochromocytoma have received considerable attention, but the somatic genetic and epigenetic events that characterise tumourigenesis in sporadic phaeochromocytomas are less well defined. Previously, we found considerable overlap between patterns of promoter region tumour suppressor gene (TSG) hypermethylation in two neural crest tumours, neuroblastoma and phaeochromocytoma. In order to identify candidate biomarkers and epigenetically inactivated TSGs in phaeochromocytoma and neuroblastoma, we characterised changes in gene expression in three neuroblastoma cell lines after treatment with the demethylating agent 5-azacytidine. Promoter region methylation status was then determined for 28 genes that demonstrated increased expression after demethylation. Three genes HSP47, homeobox A9 (HOXA9) and opioid binding protein (OPCML) were methylated in >10% of phaeochromocytomas (52, 17 and 12% respectively). Two of the genes, epithelial membrane protein 3 (EMP3) and HSP47, demonstrated significantly more frequent methylation in neuroblastoma than phaeochromocytoma. These findings extend epigenotype of phaeochromocytoma and identify candidate genes implicated in sporadic phaeochromocytoma tumourigenesis. PMID:18499731

Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

PubMed

Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

2008-01-01

To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

Inhibition of the binding of MSG-intermolt-specific complex, MIC, to the sericin-1 gene promoter and sericin-1 gene expression by POU-M1/SGF-3.

PubMed

Kimoto, Mai; Kitagawa, Tsuyuki; Kobayashi, Isao; Nakata, Tomohiro; Kuroiwa, Asato; Takiya, Shigeharu

2012-11-01

The sericin-1 gene encoding a glue protein is expressed in the middle silk gland (MSG) of the silkworm, Bombyx mori. A member of the class III POU domain transcription factors, POU-M1, was cloned as the factor bound to the SC site of the sericin-1 promoter and has been proposed to be a positive transcription factor. In this study, we analyzed the expression pattern of the POU-M1 gene in fourth and fifth instars in comparison with the pattern of the sericin-1 gene. The POU-M1 gene was expressed strongly in the region anterior to the sericin-1-expressing portion of the silk gland at both feeding stages. As the sericin-1-expressing region expands from the posterior to middle portions of the MSG in the fifth instar, the POU-M1-expressing region retreated from the middle to anterior portion. Introduction of the expression vector of POU-M1 into the silk glands by gene gun technology repressed promoter activity of the sericin-1 gene, suggesting that POU-M1 regulates the sericin-1 gene negatively. An in vitro binding assay showed that POU-M1 bound not only to the SC site but also to other promoter elements newly detected in vivo. Another spatiotemporal specific factor MIC binds to these elements, and POU-M1 competed with MIC to bind at the -70 site essential for promoter activity. These results suggest that POU-M1 is involved in restricting the anterior boundary of the sericin-1-expressing region in the silk gland by inhibiting the binding of the transcriptional activator to the promoter elements.

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Gene expression meta-analysis identifies chromosomal regions and candidate genes involved in breast cancer metastasis.

PubMed

Thomassen, Mads; Tan, Qihua; Kruse, Torben A

2009-01-01

Breast cancer cells exhibit complex karyotypic alterations causing deregulation of numerous genes. Some of these genes are probably causal for cancer formation and local growth whereas others are causal for the various steps of metastasis. In a fraction of tumors deregulation of the same genes might be caused by epigenetic modulations, point mutations or the influence of other genes. We have investigated the relation of gene expression and chromosomal position, using eight datasets including more than 1200 breast tumors, to identify chromosomal regions and candidate genes possibly causal for breast cancer metastasis. By use of "Gene Set Enrichment Analysis" we have ranked chromosomal regions according to their relation to metastasis. Overrepresentation analysis identified regions with increased expression for chromosome 1q41-42, 8q24, 12q14, 16q22, 16q24, 17q12-21.2, 17q21-23, 17q25, 20q11, and 20q13 among metastasizing tumors and reduced gene expression at 1p31-21, 8p22-21, and 14q24. By analysis of genes with extremely imbalanced expression in these regions we identified DIRAS3 at 1p31, PSD3, LPL, EPHX2 at 8p21-22, and FOS at 14q24 as candidate metastasis suppressor genes. Potential metastasis promoting genes includes RECQL4 at 8q24, PRMT7 at 16q22, GINS2 at 16q24, and AURKA at 20q13.

Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.

PubMed

Bao, X; Shorrosh, B S; Ohlrogge, J B

1997-11-01

In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.

Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels

PubMed Central

Zhu, Yi-bing; Huang, Rong-dong; Lu, Qing-Qing; Lin, Xu

2015-01-01

Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = —0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

The pea END1 promoter drives anther-specific gene expression in different plant species.

PubMed

Gómez, María D; Beltrán, José-Pío; Cañas, Luis A

2004-10-01

END1 was isolated by an immunosubtractive approach intended to identify specific proteins present in the different pea (Pisum sativum L.) floral organs and the genes encoding them. Following this strategy we obtained a monoclonal antibody (mAbA1) that specifically recognized a 26-kDa protein (END1) only detected in anther tissues. Northern blot assays showed that END1 is expressed specifically in the anther. In situ hybridization and immunolocalization assays corroborated the specific expression of END1 in the epidermis, connective, endothecium and middle layer cells during the different stages of anther development. END1 is the first anther-specific gene isolated from pea. The absence of a practicable pea transformation method together with the fact that no END1 homologue gene exists in Arabidopsis prevented us from carrying out END1 functional studies. However, we designed functional studies with the END1 promoter in different dicot species, as the specific spatial and temporal expression pattern of END1 suggested, among other things, the possibility of using its promoter region for biotechnological applications. Using different constructs to drive the uidA (beta-glucuronidase) gene controlled by the 2.7-kb isolated promoter sequence we have proven that the END1 promoter is fully functional in the anthers of transgenic Arabidopsis thaliana (L.) Heynh., Nicotiana tabacum L. (tobacco) and Lycopersicon esculentum Mill. (tomato) plants. The presence in the -330-bp region of the promoter sequence of three putative CArG boxes also suggests that END1 could be a target gene of MADS-box proteins and that, subsequently, it would be activated by genes controlling floral organ identity.

The association between runt-related transcription factor 3 gene promoter methylation and gastric cancer: A meta-analysis.

PubMed

Liu, Xu; Wang, Lina; Guo, Yongtie

2016-10-01

To systematically evaluate the relationship of the methylation of the human-runt-related transcription factor 3 (RUNX3) promoter region and gastric cancer risk through meta-analysis. The studies published in PubMed, EMBASE, Ovid, and CNKI were retrieved. The association between RUNX3 gene promoter methylation and gastric cancer was analyzed using Stata 11.0 (http://www.stata.com; Stata Corporation, College Station, TX, USA) and Review Man 5.0 software (http://ims.cochrane.org/revman/download). Seventeen studies are included in the analysis. Meta-analysis reveals that the odds ratio of the methylation of the RUNX3 promoter region in gastric was 7.32 (95% confidence interval: 5.12-10.47), which was significant higher than the normal gastric tissues (P < 0.05). The RUNX3 gene promoter methylation rate was much higher in tumor tissue than that in normal gastric tissue in patient with gastric cancer, which indicates a close association between gastric cancer and RUNX3 gene promoter methylation.

Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

PubMed Central

Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

2014-01-01

Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

Internal control regions for transcription of eukaryotic tRNA genes.

PubMed Central

Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D

1981-01-01

We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245

Universal light-switchable gene promoter system

DOEpatents

Quail, Peter H.; Huq, Enamul; Tepperman, James; Sato, Sae

2005-02-22

An artificial promoter system that can be fused upstream of any desired gene enabling reversible induction or repression of the expression of the gene at will in any suitable host cell or organisms by light is described. The design of the system is such that a molecule of the plant photoreceptor phytochrome is targeted to the specific DNA binding site in the promoter by a protein domain that is fused to the phytochrome and that specifically recognizes this binding site. This bound phytochrome, upon activation by light, recruits a second fusion protein consisting of a protein that binds to phytochrome only upon light activation and a transcriptional activation domain that activates expression of the gene downstream of the promoter.

Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

PubMed

Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

2018-02-01

The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

Choline availability modulates human neuroblastoma cell proliferation and alters the methylation of the promoter region of the cyclin-dependent kinase inhibitor 3 gene

PubMed Central

Niculescu, Mihai D.; Yamamuro, Yutaka; Zeisel, Steven H.

2006-01-01

Choline is an important methyl donor and a component of membrane phospholipids. In this study, we tested the hypothesis that choline availability can modulate cell proliferation and the methylation of genes that regulate cell cycling. In several other model systems, hypomethylation of cytosine bases that are followed by a guanosine (CpG) sites in the promoter region of a gene is associated with increased gene expression. We found that in choline-deficient IMR-32 neuroblastoma cells, the promoter of the cyclin-dependent kinase inhibitor 3 gene (CDKN3) was hypomethylated. This change was associated with increased expression of CDKN3 and increased levels of its gene product, kinase-associated phosphatase (KAP), which inhibits the G1/S transition of the cell cycle by dephosphorylating cyclin-dependent kinases. Choline deficiency also reduced global DNA methylation. The percentage of cells that accumulated bromodeoxyuridine (proportional to cell proliferation) was 1.8 times lower in the choline-deficient cells than in the control cells. Phosphorylated retinoblastoma (p110) levels were 3 times lower in the choline-deficient cells than in control cells. These findings suggest that the mechanism whereby choline deficiency inhibits cell proliferation involves hypomethylation of key genes regulating cell cycling. This may be a mechanism for our previously reported observation that stem cell proliferation in hippocampus neuroepithelium is decreased in choline-deficient rat and mouse fetuses. PMID:15147518

The correlations between DNA methylation and polymorphisms in the promoter region of the human telomerase reverse transcriptase (hTERT) gene with postoperative recurrence in patients with thyroid carcinoma (TC).

PubMed

Li, Jian-Jun; Zheng, Ping Chen Jue-Ru; Wang, Yao-Zong

2017-06-06

This study aims at exploring the correlations between DNA methylation and polymorphisms in the promoter region of the human telomerase reverse transcriptase (hTERT) gene and postoperative recurrence in patients with thyroid carcinoma (TC). A total of 312 patients diagnosed with TC were chosen for the study and categorized into recurrence (n = 75) and non-recurrence (n = 237) groups. The hTERT rs2736100 and rs2736098 polymorphisms were detected by performing polymerase chain reaction-restriction fragment length polymorphism. DNA methylation in the promoter region of hTERT gene was evaluated by pyrosequencing. A telephonic and/or outpatient follow-up was conducted for all patients. The correlations of DNA methylation and polymorphisms in the promoter region of hTERT with postoperative recurrence of TC patients underwent analysis. The patient in the recurrence group showed evidently different pathological types and tumor stages in comparison to the non-recurrence group. The GG genotype of hTERT rs2736100 might increase the recurrence risk of TC patients. No correlations between hTERT rs2736098 polymorphisms and recurrence risk were observed. Compared to the TT + TG genotype frequency, the rs2736100 GG genotype frequency increased in patients without multicentricity, patients with extrathyroidal invasion, patients with lymph node metastasis, patients with undifferentiated carcinoma, and patients in the III + IV stage. The recurrence group showed significantly higher DNA methylation level compared to the non-recurrence group. The DNA methylation level was closely associated to tumor stage and lymph node metastasis of TC patients in the recurrence group. The DNA methylation and rs2736100 polymorphisms in the promoter region of hTERT gene might be in correlation to postoperative recurrence of TC patients.

Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orlov, Sergey V., E-mail: serge@iem.sp.ru; Department of Embryology, St. Petersburg State University, 199034 St. Petersburg; Mogilenko, Denis A.

2010-07-23

Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters inmore » TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.« less

Evaluation of promoter methylation status of MLH1 gene in Iranian patients with colorectal tumors and adenoma polyps.

PubMed

Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid

2017-01-01

The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of  MLH1  promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.

A novel G-quadruplex motif in the Human MET promoter region.

PubMed

Yan, Jing; Zhao, Deming; Dong, Liping; Pan, Shuang; Hao, Fengjin; Guan, Yifu

2017-12-22

It is known that the guanine-rich strands in proto-oncogene promoters can fold into G-quadruplex structures to regulate gene expression. An intramolecular parallel G-quadruplex has been identified in MET promoter. It acts as a repressor in regulating MET expression. However, the full guanine-rich region in MET promoter forms a hybrid parallel/antiparallel G-quadruplex structure under physiological conditions, which means there are some antiparallel and hybrid parallel/antiparallel G-quadruplex structures in this region. In the present study, our data indicate that g3-5 truncation adopts an intramolecular hybrid parallel/antiparallel G-quadruplex under physiological conditions in vitro The g3-5 G-quadruplex structure significantly stops polymerization by Klenow fragment in K + buffer. Furthermore, the results of circular dichroism (CD) spectra and polymerase stop assay directly demonstrate that the G-quadruplex structure in g3-5 fragment can be stabilized by the G-quadruplex ligand TMPyP4 (5,10,15,20-tetra-(N-methyl-4-pyridyl) porphine). But the dual luciferase assay indicates TMPyP4 has no effect on the formation of g3-5 G-quadruplex in HepG2 cells. The findings in the present study will enrich our understanding of the G-quadruplex formation in proto-oncogene promoters and the mechanisms of gene expression regulation. © 2017 The Author(s).

Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

PubMed Central

Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

2007-01-01

Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

The combination of dimethoxycurcumin with DNA methylation inhibitor enhances gene re-expression of promoter-methylated genes and antagonizes their cytotoxic effect

PubMed Central

Hassan, Hazem E.; Keita, Jean-Arnaud; Narayan, Lawrence; Brady, Sean M.; Frederick, Richard; Carlson, Samuel; C. Glass, Karen; Natesan, Senthil; Buttolph, Thomm; Fandy, Tamer E.

2016-01-01

ABSTRACT Curcumin and its analogs exhibited antileukemic activity either as single agent or in combination therapy. Dimethoxycurcumin (DMC) is a more metabolically stable curcumin analog that was shown to induce the expression of promoter-methylated genes without reversing DNA methylation. Accordingly, co-treatment with DMC and DNA methyltransferase (DNMT) inhibitors could hypothetically enhance the re-expression of promoter-methylated tumor suppressor genes. In this study, we investigated the cytotoxic effects and epigenetic changes associated with the combination of DMC and the DNMT inhibitor decitabine (DAC) in primary leukemia samples and cell lines. The combination demonstrated antagonistic cytotoxic effects and was minimally cytotoxic to primary leukemia cells. The combination did not affect the metabolic stability of DMC. Although the combination enhanced the downregulation of nuclear DNMT proteins, the hypomethylating activity of the combination was not increased significantly compared to DAC alone. On the other hand, the combination significantly increased H3K27 acetylation (H3K27Ac) compared to the single agents near the promoter region of promoter-methylated genes. Furthermore, sequential chromatin immunoprecipitation (ChIP) and DNA pyrosequencing of the chromatin-enriched H3K27Ac did not show any significant decrease in DNA methylation compared to other regions. Consequently, the enhanced induction of promoter-methylated genes by the combination compared to DAC alone is mediated by a mechanism that involves increased histone acetylation and not through potentiation of the DNA hypomethylating activity of DAC. Collectively, our results provide the mechanistic basis for further characterization of this combination in leukemia animal models and early phase clinical trials. PMID:27588609

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

PubMed

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

PubMed

Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

2000-06-01

Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

Immunoglobulin kappa light chain gene promoter and enhancer are not responsible for B-cell restricted gene rearrangement.

PubMed Central

Goodhardt, M; Babinet, C; Lutfalla, G; Kallenbach, S; Cavelier, P; Rougeon, F

1989-01-01

We have produced transgenic mice which synthesize chimeric mouse-rabbit immunoglobulin (Ig) kappa light chains following in vivo recombination of an injected unrearranged kappa gene. The exogenous gene construct contained a mouse germ-line kappa variable (V kappa) gene segment, the mouse germ-line joining (J kappa) locus including the enhancer, and the rabbit b9 constant (C kappa) region. A high level of V-J recombination of the kappa transgene was observed in spleen of the transgenic mice. Surprisingly, a particularly high degree of variability in the exact site of recombination and the presence of non germ-line encoded nucleotides (N-regions) were found at the V-J junction of the rearranged kappa transgene. Furthermore, unlike endogenous kappa genes, rearrangement of the exogenous gene occurred in T-cells of the transgenic mice. These results show that additional sequences, other than the heptamer-nonamer signal sequences and the promoter and enhancer elements, are required to obtain stage- and lineage- specific regulation of Ig kappa light chain gene rearrangement in vivo. Images PMID:2508061

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

A functional polymorphism in the promoter region of MAOA gene is associated with daytime sleepiness in healthy subjects.

PubMed

Ojeda, Diego A; Niño, Carmen L; López-León, Sandra; Camargo, Andrés; Adan, Ana; Forero, Diego A

2014-02-15

Excessive daytime sleepiness (EDS) is one of the main causes of car and industrial accidents and it is associated with increased morbidity and alterations in quality of life. Prevalence of EDS in the general population around the world ranges from 6.2 to 32.4%, with a heritability of 38-40%. However, few studies have explored the role of candidate genes in EDS. Monoamine oxidase A (MAOA) gene has an important role in the regulation of neurotransmitter levels and a large number of human behaviors. We hypothesized that a functional VNTR in the promoter region of the MAOA gene might be associated with daytime sleepiness in healthy individuals. The Epworth sleepiness scale (ESS) was applied to 210 Colombian healthy subjects (university students), which were genotyped for MAOA-uVNTR. MAOA-uVNTR showed a significant association with ESS scores (p = 0.01): 3/3 genotype carriers had the lowest scores. These results were supported by differences in MAOA-uVNTR frequencies between diurnal somnolence categories (p = 0.03). Our finding provides evidence for the first time that MAOA-uVNTR has a significant association with EDS in healthy subjects. Finally, these data suggest that functional variations in MAOA gene could have a role in other phenotypes of neuropsychiatric relevance. Copyright © 2013 Elsevier B.V. All rights reserved.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Amplification of the groESL operon in Pseudomonas putida increases siderophore gene promoter activity.

PubMed

Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J

1994-10-17

Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.

The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold.

PubMed

Alonso-Peral, Maria M; Oliver, Sandra N; Casao, M Cristina; Greenup, Aaron A; Trevaskis, Ben

2011-01-01

The VERNALIZATION1 (VRN1) gene of temperate cereals is transcriptionally activated by prolonged cold during winter (vernalization) to promote flowering. To investigate the mechanisms controlling induction of VRN1 by prolonged cold, different regions of the VRN1 gene were fused to the GREEN FLUORESCENT PROTEIN (GFP) reporter and expression of the resulting gene constructs was assayed in transgenic barley (Hordeum vulgare). A 2 kb segment of the promoter of VRN1 was sufficient for GFP expression in the leaves and shoot apex of transgenic barley plants. Fluorescence increased at the shoot apex prior to inflorescence initiation and was subsequently maintained in the developing inflorescence. The promoter was also sufficient for low-temperature induction of GFP expression. A naturally occurring insertion in the proximal promoter, which is associated with elevated VRN1 expression and early flowering in some spring wheats, did not abolish induction of VRN1 transcription by prolonged cold, however. A translational fusion of the promoter and transcribed regions of VRN1 to GFP, VRN1::GFP, was localised to nuclei of cells at the shoot apex of transgenic barley plants. The distribution of VRN1::GFP at the shoot apex was similar to the expression pattern of the VRN1 promoter-GFP reporter gene. Fluorescence from the VRN1::GFP fusion protein increased in the developing leaves after prolonged cold treatment. These observations suggest that the promoter of VRN1 is targeted by mechanisms that trigger vernalization-induced flowering in economically important temperate cereal crops.

Further evidence that the rs1858830 C variant in the promoter region of the MET gene is associated with autistic disorder.

PubMed

Jackson, Pamela B; Boccuto, Luigi; Skinner, Cindy; Collins, Julianne S; Neri, Giovanni; Gurrieri, Fiorella; Schwartz, Charles E

2009-08-01

Previous studies in three independent cohorts have shown that the rs1858830 C allele variant in the promoter region of the MET gene on chromosome 7q31 is associated with autism. Another study has found correlations between other alterations in the MET gene and autism in two unrelated cohorts. This study screened two cohorts, an Autistic Disorder cohort from South Carolina and a Pervasive Developmental Disorder (PDD) cohort from Italy, for the presence of the C allele variant in rs1858830. A significant increase in the C allele variant frequency was found in the South Carolina Autistic Disorder patients as compared to South Carolina Controls (chi(2)=5.8, df=1, P=0.02). In the South Carolina cohort, a significant association with Autistic Disorder was found when comparing the CC and CG genotypes to the GG genotype (odds ratio (OR)=1.64; 95% confidence interval (CI)=1.12-2.40; chi(2)=6.5, df=1, P=0.01) in cases and controls. In the Italian cohort, no significant association with PDD was found when comparing the CC or CG genotype to the GG genotype (OR=1.20; 95% CI=0.56-2.56; chi(2)=0.2, df=1, P=0.64). This study is the third independent study to find the rs1858830 C variant in the MET gene promoter to be associated with autism.

Structural properties of prokaryotic promoter regions correlate with functional features.

PubMed

Meysman, Pieter; Collado-Vides, Julio; Morett, Enrique; Viola, Roberto; Engelen, Kristof; Laukens, Kris

2014-01-01

The structural properties of the DNA molecule are known to play a critical role in transcription. In this paper, the structural profiles of promoter regions were studied within the context of their diversity and their function for eleven prokaryotic species; Escherichia coli, Klebsiella pneumoniae, Salmonella Typhimurium, Pseudomonas auroginosa, Geobacter sulfurreducens Helicobacter pylori, Chlamydophila pneumoniae, Synechocystis sp., Synechoccocus elongates, Bacillus anthracis, and the archaea Sulfolobus solfataricus. The main anchor point for these promoter regions were transcription start sites identified through high-throughput experiments or collected within large curated databases. Prokaryotic promoter regions were found to be less stable and less flexible than the genomic mean across all studied species. However, direct comparison between species revealed differences in their structural profiles that can not solely be explained by the difference in genomic GC content. In addition, comparison with functional data revealed that there are patterns in the promoter structural profiles that can be linked to specific functional loci, such as sigma factor regulation or transcription factor binding. Interestingly, a novel structural element clearly visible near the transcription start site was found in genes associated with essential cellular functions and growth in several species. Our analyses reveals the great diversity in promoter structural profiles both between and within prokaryotic species. We observed relationships between structural diversity and functional features that are interesting prospects for further research to yet uncharacterized functional loci defined by DNA structural properties.

Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

PubMed

Raynard, Steven J; Baker, Mark D

2004-01-01

In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

Promoter methylation assay of SASH1 gene in breast cancer.

PubMed

Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

2013-01-01

To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

Superoxide radical-generating compounds activate a predicted promoter site for paraquat-inducible genes of the Chromobacterium violaceum bacterium in a dose-dependent manner.

PubMed

Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R

2015-08-21

The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner.

Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

DOE Office of Scientific and Technical Information (OSTI.GOV)

Depto, A.S.; Stenberg, R.M.

1989-03-01

To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less

Sp1 upregulates the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes.

PubMed

Watanabe, Keijirou; Hida, Mariko; Sasaki, Takako; Yano, Hiroyuki; Kawano, Kenji; Yoshioka, Hidekatsu; Matsuo, Noritaka

2016-02-01

Type XI collagen is a cartilage-specific extracellular matrix, and is important for collagen fibril formation and skeletal morphogenesis. We have previously reported that NF-Y regulated the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes (Hida et. al. In Vitro Cell. Dev. Biol. Anim. 2014). However, the mechanism of the Col11a1 gene regulation in chondrocytes has not been fully elucidated. In this study, we further characterized the proximal promoter activity of the mouse Col11a1 gene in chondrocytes. Cell transfection experiments with deletion and mutation constructs indicated that the downstream region of the NF-Y binding site (-116 to +1) is also necessary to regulate the proximal promoter activity of the mouse Col11a1 gene. This minimal promoter region has no TATA box and GC-rich sequence; we therefore examined whether the GC-rich sequence (-96 to -67) is necessary for the transcription regulation of the Col11a1 gene. Luciferase assays using a series of mutation constructs exhibited that the GC-rich sequence is a critical element of Col11a1 promoter activity in chondrocytes. Moreover, in silico analysis of this region suggested that one of the most effective candidates was transcription factor Sp1. Consistent with the prediction, overexpression of Sp1 significantly increased the promoter activity. Furthermore, knockdown of Sp1 expression by siRNA transfection suppressed the proximal promoter activity and the expression of endogenous transcript of the mouse Col11a1 gene. Taken together, these results indicate that the transcription factor Sp1 upregulates the proximal promoter activity of the mouse Col11a1 gene in chondrocytes.

Unique Epstein-Barr virus (EBV) latent gene expression, EBNA promoter usage and EBNA promoter methylation status in chronic active EBV infection.

PubMed

Yoshioka, Mikio; Kikuta, Hideaki; Ishiguro, Nobuhisa; Ma, Xiaoming; Kobayashi, Kunihiko

2003-05-01

Chronic active Epstein-Barr virus infection (CAEBV) has been considered to be a non-neoplastic T-cell lymphoproliferative disease associated with Epstein-Barr virus (EBV) infection. In EBV-associated diseases, the cell phenotype-dependent differences in EBV latent gene expression may reflect the strategy of the virus in relation to latent infection. We previously reported that EBV latent gene expression was restricted; EBV nuclear antigen 1 (EBNA1) transcripts were consistently detected in all spleen samples from five CAEBV patients, but EBNA2 transcripts were detected in only one sample. EBV latent gene expression is controlled by distinct usage of three EBNA promoters (Cp, Wp and Qp). In this study, we examined the EBNA promoter usage by RT-PCR and the methylation status in the Cp and Wp regions using bisulfite PCR analysis in spleen samples from CAEBV patients. EBNA1 transcripts were unexpectedly initiated not from Qp but from Cp in all samples in spite of the restricted form of latency. Furthermore, while Cp was active, Cp was heavily methylated, indicating that CAEBV has unique EBV latent gene expression, EBNA promoter usage and EBNA promoter methylation status, in part due to unique splicing of Cp-initiated transcripts and an activation mechanism in hypermethylated Cp.

Sex chromosome loss and the pseudoautosomal region genes in hematological malignancies

PubMed Central

Weng, Stephanie; Stoner, Samuel A.; Zhang, Dong-Er

2016-01-01

Cytogenetic aberrations, such as chromosomal translocations, aneuploidy, and amplifications, are frequently detected in hematological malignancies. For many of the common autosomal aberrations, the mechanisms underlying their roles in cancer development have been well-characterized. On the contrary, although loss of a sex chromosome is observed in a broad range of hematological malignancies, how it cooperates in disease development is less understood. Nevertheless, it has been postulated that tumor suppressor genes reside on the sex chromosomes. Although the X and Y sex chromosomes are highly divergent, the pseudoautosomal regions are homologous between both chromosomes. Here, we review what is currently known about the pseudoautosomal region genes in the hematological system. Additionally, we discuss implications for haploinsufficiency of critical pseudoautosomal region sex chromosome genes, driven by sex chromosome loss, in promoting hematological malignancies. Because mechanistic studies on disease development rely heavily on murine models, we also discuss the challenges and caveats of existing models, and propose alternatives for examining the involvement of pseudoautosomal region genes and loss of a sex chromosome in vivo. With the widespread detection of loss of a sex chromosome in different hematological malignances, the elucidation of the role of pseudoautosomal region genes in the development and progression of these diseases would be invaluable to the field. PMID:27655702

Linking disease-associated genes to regulatory networks via promoter organization

PubMed Central

Döhr, S.; Klingenhoff, A.; Maier, H.; de Angelis, M. Hrabé; Werner, T.; Schneider, R.

2005-01-01

Pathway- or disease-associated genes may participate in more than one transcriptional co-regulation network. Such gene groups can be readily obtained by literature analysis or by high-throughput techniques such as microarrays or protein-interaction mapping. We developed a strategy that defines regulatory networks by in silico promoter analysis, finding potentially co-regulated subgroups without a priori knowledge. Pairs of transcription factor binding sites conserved in orthologous genes (vertically) as well as in promoter sequences of co-regulated genes (horizontally) were used as seeds for the development of promoter models representing potential co-regulation. This approach was applied to a Maturity Onset Diabetes of the Young (MODY)-associated gene list, which yielded two models connecting functionally interacting genes within MODY-related insulin/glucose signaling pathways. Additional genes functionally connected to our initial gene list were identified by database searches with these promoter models. Thus, data-driven in silico promoter analysis allowed integrating molecular mechanisms with biological functions of the cell. PMID:15701758

Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

PubMed

Sawado, T; Igarashi, K; Groudine, M

2001-08-28

The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

A functional promoter shift of a chloroplast gene: a transcriptional fusion between a novel psbA gene copy and the trnK (UUU) gene in Pinus contorta.

PubMed

Lidholm, J; Gustafsson, P

1992-11-01

A comparative transcription analysis of the chloroplast trnK-psbA-trnH region of the two pine species Pinus contorta and Pinus sylvestris is reported. The chloroplast genome of P. contorta has previously been shown to contain a duplicated psbA gene copy integrated closely upstream of the split trnK gene. This rearrangement has resulted in the gene order psbAI-trnK-psbAII-trnH, where psbAII is the ancestral psbA gene copy. In P. sylvestris, a species which lacks the psbA duplication, transcription of the trnK gene originates from a position 291 bp upstream of the trnK 5' exon, adjacent to a canonical promoter structure. In P. contorta, the corresponding promoter structure has been separated from the trnK gene by the insertion of psbAI, and has, in addition, been partially deleted. Analysis of the transcriptional organization of the trnK-psbA-trnH region of the two pine species revealed that the trnK gene in P. contorta is transcriptionally fused to the inserted psbAI gene copy. As a result, trnK is under the control of the psbA promoter in this species and has therefore acquired psbA-like expression characteristics. In P. sylvestris, accumulation of trnK transcripts is not significantly higher in light-grown than in dark-grown seedlings. In contrast, the level of trnK transcripts in P. contorta is approximately 12-fold higher in the light than in the dark. When light-grown seedlings of the two pine species were compared, an approximately 20-fold higher level of trnK RNAs was found in P. contorta. In both pine species, evidence was obtained for trnK-psbA and psbA-trnH co-transcription.

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 mediates environmental stress responses in plants.

PubMed

Hong, Jeum Kyu; Hwang, Byung Kook

2009-01-01

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

Microsatellite polymorphism in the P1 promoter region of the IGF-1 gene is associated with endometrial cancer

PubMed Central

KWASNIEWSKI, WOJCIECH; GOZDZICKA-JOZEFIAK, ANNA; WOLUN-CHOLEWA, MARIA; POLAK, GRZEGORZ; SIEROCINSKA-SAWA, JADWIGA; KWASNIEWSKA, ANNA; KOTARSKI, JAN

2016-01-01

Endometrial carcinoma (EC) is the most common type of gynecological malignancy. Studies have demonstrated that the insulin growth factor (IGF) pathway is implicated in the development of endometrial tumors and that the serum levels of IGF-1 are affected by estrogen. Most EC cells with high microsatellite instability (MSI-H) accumulate mutations at a microsatellite sequence in the IGF-1 gene. The present study investigated the CA repeat polymorphism in the P1 promoter region of the IGF-1 gene among Caucasian females with endometrial hyperplasia, EC and healthy control subjects, whose blood serum and surgical tissue specimens were analyzed. Differences or correlations between the analyzed parameters [serum levels of IGF-1 and IGF binding protein (IGFBP)-1 and IGFBP-3 as well as estrogens among the polymorphisms] were verified using the χ2, Mann-Whitney U, Kruskal-Wallis or Spearman's rank correlation tests. A PCR amplification and DNA sequencing analysis was used for identification of (CA)n repeats in the P1 region of IGF-1. ELISA was used to determine the blood serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrogens. Furthermore, IGF-1 was assessed in endometrial tissues by immunohistochemical analysis. The present study indicated no statistically significant differences between serum levels of IGF-1, IGFBP-1, IGFBP-3 and estrone, estriol and estradiol in the control and study groups. A significant correlation was identified between the IGF-1 levels and estrone levels in the MSI-H polymorphism (r=−0.41, P=0.012) as well as a highly negative correlation between IGF-1 levels and the estradiol levels in the MSI-H polymorphism (r=−0.6, P=0.002). Genotypes without the 19 CA allele were predominantly found in EC. Furthermore, statistical analysis indicated that the number of IGF-1-expressing cells was significantly elevated in MSI-H type 18-20 (P= 0.0072), MSI-L type 19-20 (P=0.025) and microsatellite-stable MSS type 19-19 (P=0.024) compared with those in the MSI-H 20

A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

PubMed

Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

2012-09-01

The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

Autoregulation of transcription of the hupA gene in Escherichia coli: evidence for steric hindrance of the functional promoter domains induced by HU.

PubMed

Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F

1994-06-01

The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.

DNA methylation patterns of behavior-related gene promoter regions dissect the gray wolf from domestic dog breeds.

PubMed

Banlaki, Zsofia; Cimarelli, Giulia; Viranyi, Zsofia; Kubinyi, Eniko; Sasvari-Szekely, Maria; Ronai, Zsolt

2017-06-01

A growing body of evidence highlights the relationship between epigenetics, especially DNA methylation, and population divergence as well as speciation. However, little is known about how general the phenomenon of epigenetics-wise separation of different populations is, or whether population assignment is, possible based on solely epigenetic marks. In the present study, we compared DNA methylation profiles between four different canine populations: three domestic dog breeds and their ancestor the gray wolf. Altogether, 79 CpG sites constituting the 65 so-called CpG units located in the promoter regions of genes affecting behavioral and temperamental traits (COMT, HTR1A, MAOA, OXTR, SLC6A4, TPH1, WFS1)-regions putatively targeted during domestication and breed selection. Methylation status of buccal cells was assessed using EpiTYPER technology. Significant inter-population methylation differences were found in 52.3% of all CpG units investigated. DNA methylation profile-based hierarchical cluster analysis indicated an unambiguous segregation of wolf from domestic dog. In addition, one of the three dog breeds (Golden Retriever) investigated also formed a separate, autonomous group. The findings support that population segregation is interrelated with shifts in DNA methylation patterns, at least in putative selection target regions, and also imply that epigenetic profiles could provide a sufficient basis for population assignment of individuals.

Isolation of a yeast artificial chromosome contig spanning the Greig cephalopolysyndactyly syndrome (GCPS) gene region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vortkamp, A.; Gessler, M.; Le Paslier, D.

1994-08-01

Disruption of the zinc finger gene GLI3 has been shown to be the cause of Greig cephalopolysyndactyly syndrome (GCPS), at least in some GCPS translocation patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GLI3 gene. In this contig the gene itself spans at least 200-250 kb. A CpG island is located in the vicinity of the 5{prime} region of the known GLI3 cDNA, implying a potential promoter region. 28 refs., 3 figs., 1 tab.

Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

PubMed

Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

2017-01-01

Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

PubMed

Lee, S H; Minowa, M T; Mouradian, M M

1996-10-11

The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

PubMed Central

Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

1991-01-01

Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

PubMed

Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

2013-01-01

In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

Association between arginine vasopressin 1a receptor (AVPR1a) promoter region polymorphisms and prepulse inhibition.

PubMed

Levin, Raz; Heresco-Levy, Uriel; Bachner-Melman, Rachel; Israel, Salomon; Shalev, Idan; Ebstein, Richard P

2009-07-01

Arginine vasopressin and the arginine vasopressin 1a (AVPR1a) gene contribute to a range of social behaviors both in lower vertebrates and in humans. Human promoter-region microsatellite repeat regions (RS1 and RS3) in the AVPR1a gene region have been associated with autism spectrum disorders, prosocial behavior and social cognition. Prepulse inhibition (PPI) of the startle response to auditory stimuli is a largely autonomic response that resonates with social cognition in both animal models and humans. Reduced PPI has been observed in disorders including schizophrenia that are distinguished by deficits in social skills. In the current investigation association was examined between PPI and the AVPR1a RS1 and RS repeat regions and PPI in a group of 113 nonclinical subjects. Using a robust family-based strategy, association was observed between AVPR1a promoter-region repeat length, especially RS3) and PPI (30 ms: global p=0.04; 60 ms p=0.006; 120 ms p=0.008). Notably, longer RS3 alleles were associated with greater levels of prepulse inhibition. Using a short/long classification scheme for the repeat regions, significant association was also observed between all three PPI intervals (30, 60 and 120 ms) and both RS1 and RS3 polymorphisms (PBAT: FBAT-PC(2) statistic p=0.047). Tests of within-subject effects (SPSS GLM) showed significant sexxRS3 interactions at 30 ms (p=0.045) and 60 ms (p=0.01). Longer alleles, especially in male subjects, are associated with significantly higher PPI response, consistent with a role for the promoter repeat region in partially molding social behavior in both animals and humans. This is the first report in humans demonstrating a role of the AVPR1a gene in contributing to the PPI response to auditory stimuli.

Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

USDA-ARS?s Scientific Manuscript database

Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

Four out of eight genes in a mouse chromosome 7 congenic donor region are candidate obesity genes.

PubMed

Sarahan, Kari A; Fisler, Janis S; Warden, Craig H

2011-09-22

We previously identified a region of mouse chromosome 7 that influences body fat mass in F2 littermates of congenic × background intercrosses. Current analyses revealed that alleles in the donor region of the subcongenic B6.C-D7Mit318 (318) promoted a twofold increase in adiposity in homozygous lines of 318 compared with background C57BL/6ByJ (B6By) mice. Parent-of-origin effects were discounted through cross-fostering studies and an F1 reciprocal cross. Mapping of the donor region revealed that it has a maximal size of 2.8 Mb (minimum 1.8 Mb) and contains a maximum of eight protein coding genes. Quantitative PCR in whole brain, liver, and gonadal white adipose tissue (GWAT) revealed differential expression between genotypes for three genes in females and two genes in males. Alpha-2,8-sialyltransferase 8B (St8sia2) showed reduced 318 mRNA levels in brain for females and males and in GWAT for females only. Both sexes of 318 mice had reduced Repulsive guidance molecule-a (Rgma) expression in GWAT. In brain, Family with sequence similarity 174 member b (Fam174b) had increased expression in 318 females, whereas Chromodomain helicase DNA binding protein 2 (Chd2-2) had reduced expression in 318 males. No donor region genes were differentially expressed in liver. Sequence analysis of coding exons for all genes in the 318 donor region revealed only one single nucleotide polymorphism that produced a nonsynonymous missense mutation, Gln7Pro, in Fam174b. Our findings highlight the difficulty of using expression and sequence to identify quantitative trait genes underlying obesity even in small genomic regions.

Cloning and functional analysis of the promoter region of the human Disc large gene.

PubMed

Cavatorta, Ana Laura; Giri, Adriana A; Banks, Lawrence; Gardiol, Daniela

2008-11-15

A number of studies have demonstrated the involvement of human Disc large (DLG1) in the control of both cell polarity and maintenance of tissue architecture. However, the mechanisms controlling DLG1 transcription are not fully understood. This is relevant since DLG1 is lost in many tumours during the later stages of malignant progression. Therefore, we performed the cloning and functional analysis of a genomic 5' flanking region of the DLG1 open reading frame with promoter activity. We analyzed the activity of a series of 5' deletion constructs of the DLG1 promoter and determined the minimal essential sequences that are required for promoter activity as well as cis-elements that regulate transcription. We found, within the DLG1 promoter sequences, consensus-binding sites for the Snail family of transcription factors that repress the expression of epithelial markers and are up-regulated in a variety of tumours. Snail transcription factors repress the transcriptional activity of the DLG1 promoter and, ectopically expressed Snail proteins bind to the native DLG1 promoter. These data suggest a role for Snail transcription factors in the control of DLG1 expression and provide a basis for understanding the transcriptional regulation of DLG1.

Hypomethylation of specific CpG sites in the promoter region of steroidogeneic genes (GATA6 and StAR) in prenatally androgenized rats.

PubMed

Jahromi, Marziyeh Salehi; Hill, Jennifer W; Tehrani, Fahimeh Ramezani; Zadeh-Vakili, Azita

2018-05-30

The methylation level of promoters is one of the most studied and well-known epigenetic mechanisms that programs the amount of gene expression. Over expression of steroidogenesis genes via epigenetic control can result in hypetandrogenism, which is the main endocrine aspect of polycystic ovarian syndrome (PCOS). In the present study we aimed to determine and compare the promoter methylation levels of three steroidogenic genes, CYP17, GATA6 and StAR, in theca cells of prenatally androgenized (PNA) rats to those of controls. Pregnant Wistar rats in the PNA group received 5 mg free testosterone, dissolved in 500 mL solvent, subcutaneously injected on day 20 of pregnancy, while controls were injected with 500 mL of solvent only. Theca cell samples, taken from the ovaries of eight to ten female offspring of both the PNA and control groups, were measured for promoter methylation levels of the aforementioned genes, using the bisulfite sequence PCR (BSP) method. Although the promoters of all three genes were slightly hypomethylated in the PNA group, the differences observed were not significant compared to the control group. The methylation of -520 and -822 positions, in the GATA6 and the StAR promoter respectively, were significantly decreased in the PNA group. The results of this study suggest that alterations in the steroidogenesis pathway after exposure to excess androgen may be a result of changes in the pattern of the methylation of the relevant genes. Copyright © 2017. Published by Elsevier Inc.

Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

PubMed

Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

2018-03-16

Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Targeting gene expression selectively in cancer cells by using the progression-elevated gene-3 promoter.

PubMed

Su, Zhao-Zhong; Sarkar, Devanand; Emdad, Luni; Duigou, Gregory J; Young, Charles S H; Ware, Joy; Randolph, Aaron; Valerie, Kristoffer; Fisher, Paul B

2005-01-25

One impediment to effective cancer-specific gene therapy is the rarity of regulatory sequences targeting gene expression selectively in tumor cells. Although many tissue-specific promoters are recognized, few cancer-selective gene promoters are available. Progression-elevated gene-3 (PEG-3) is a rodent gene identified by subtraction hybridization that displays elevated expression as a function of transformation by diversely acting oncogenes, DNA damage, and cancer cell progression. The promoter of PEG-3, PEG-Prom, displays robust expression in a broad spectrum of human cancer cell lines with marginal expression in normal cellular counterparts. Whereas GFP expression, when under the control of a CMV promoter, is detected in both normal and cancer cells, when GFP is expressed under the control of the PEG-Prom, cancer-selective expression is evident. Mutational analysis identifies the AP-1 and PEA-3 transcription factors as primary mediators of selective, cancer-specific expression of the PEG-Prom. Synthesis of apoptosis-inducing genes, under the control of the CMV promoter, inhibits the growth of both normal and cancer cells, whereas PEG-Prom-mediated expression of these genes kills only cancer cells and spares normal cells. The efficacy of the PEG-Prom as part of a cancer gene therapeutic regimen is further documented by in vivo experiments in which PEG-Prom-controlled expression of an apoptosis-inducing gene completely inhibited prostate cancer xenograft growth in nude mice. These compelling observations indicate that the PEG-Prom, with its cancer-specific expression, provides a means of selectively delivering genes to cancer cells, thereby providing a crucial component in developing effective cancer gene therapies.

A new fractionation assay, based on the size of formaldehyde-crosslinked, mildly sheared chromatin, delineates the chromatin structure at promoter regions

PubMed Central

Ishihara, Satoru; Varma, Rajat; Schwartz, Ronald H.

2010-01-01

To explore the higher order structure of transcribable chromatin in vivo, its local configuration was assessed through the accessibility of the chromatin to crosslinking with formaldehyde. The application of crosslinked and mildly sheared chromatin to sedimentation velocity centrifugation followed by size-fractionation of the DNA enabled us to biochemically distinguish between chromatin with heavily versus sparsely crosslinkable structures. The separated fractions showed a good correlation with gene expression profiles. Genes with poor crosslinking around the promoter region were actively transcribed, while transcripts were hardly detected from genes with extensive crosslinking in their promoter regions. For the inducible gene, Il2, the distribution of the promoter shifted in the gradient following T-cell receptor stimulation, consistent with a change in structure at this locus during activation. The kinetics of this switch preceded the chromatin change observed in a DNase I accessibility assay. Thus, this new chromatin fractionation technique has revealed a change in chromatin structure that has not been previously characterized. PMID:20371521

Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

PubMed

Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

2014-12-01

One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.

PubMed

Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K

1989-01-01

The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.

Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

PubMed

Matsunaga, Taichi; Yamashita, Jun K

2014-02-07

Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

Promoter regions of potato vacuolar invertase gene in response to sugars and hormones.

PubMed

Ou, Yongbin; Song, Botao; Liu, Xun; Xie, Conghua; Li, Meng; Lin, Yuan; Zhang, Huiling; Liu, Jun

2013-08-01

Potato vacuolar acid invertase (StvacINV1) (β-fructofuranosidase; EC 3.2.1.26) has been confirmed to play an important role in cold-induced sweetening of potato tubers. However, the transcriptional regulation mechanisms of StvacINV1 are largely unknown. In this study, the 5'-flanking sequence of StvacINV1 was cloned and the cis-acting elements were predicted. Histochemical assay showed that the StvacINV1 promoter governed β-glucuronidase (GUS) expression in potato leaves, stems, roots and tubers. Quantitative analysis of GUS expression suggested that the activity of StvacINV1 promoter was suppressed by sucrose, glucose, fructose, and cold, while enhanced by indole-3-acetic acid (IAA), and gibberellic acid (GA3). Further deletion analysis clarified that the promoter regions from -118 to -551, -551 to -1021, and -1021 to -1521 were required for responding to sucrose/glucose, GA3, and IAA, respectively. These findings provide essential information regarding transcriptional regulation mechanisms of StvacINV1. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Lactoferrin gene promoter variants and their association with clinical and subclinical mastitis in indigenous and crossbred cattle.

PubMed

Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V

2015-01-01

Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (p<0.05) with clinical mastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.

Imperfect Symmetry of Sp1 and Core Promoter Sequences Regulates Early and Late Virus Gene Expression of the Bidirectional BK Polyomavirus Noncoding Control Region.

PubMed

Bethge, Tobias; Ajuh, Elvis; Hirsch, Hans H

2016-11-15

Rearrangements or point mutations in the noncoding control region (NCCR) of BK polyomavirus (BKPyV) have been associated with higher viral loads and more pronounced organ pathology in immunocompromised patients. The respective alterations affect a multitude of transcription factor binding sites (TFBS) but consistently cause increased expression of the early viral gene region (EVGR) at the expense of late viral gene region (LVGR) expression. By mutating TFBS, we identified three phenotypic groups leading to strong, intermediate, or impaired EVGR expression and corresponding BKPyV replication. Unexpectedly, Sp1 TFBS mutants either activated or inhibited EVGR expression when located proximal to the LVGR (sp1-4) or the EVGR (sp1-2), respectively. We now demonstrate that the bidirectional balance of EVGR and LVGR expression is dependent on affinity, strand orientation, and the number of Sp1 sites. Swapping the LVGR-proximal high-affinity SP1-4 with the EVGR-proximal low-affinity SP1-2 in site strand flipping or inserting an additional SP1-2 site caused a rearranged NCCR phenotype of increased EVGR expression and faster BKPyV replication. The 5' rapid amplification of cDNA ends revealed an imperfect symmetry between the EVGR- and LVGR-proximal parts of the NCCR, consisting of TATA and TATA-like elements, initiator elements, and downstream promoter elements. Mutation or deletion of the archetypal LVGR promoter, which is found in activated NCCR variants, abrogated LVGR expression, which could be restored by providing large T antigen (LTag) in trans Thus, whereas Sp1 sites control the initial EVGR-LVGR expression balance, LTag expression can override inactivation of the LVGR promoter and acts as a key driver of LVGR expression independently of the Sp1 sites and core promoter elements. Polyomaviridae currently comprise more than 70 members, including 13 human polyomaviruses (PyVs), all of which share a bidirectional genome organization mediated by the NCCR, which determines

Three enhancer regions regulate gbx2 gene expression in the isthmic region during zebrafish development.

PubMed

Islam, Md Ekramul; Kikuta, Hiroshi; Inoue, Fumitaka; Kanai, Maiko; Kawakami, Atsushi; Parvin, Mst Shahnaj; Takeda, Hiroyuki; Yamasu, Kyo

2006-12-01

In vertebrate embryos, positioning of the boundary between the midbrain and hindbrain (MHB) and subsequent isthmus formation are dependent upon the interaction between the Otx2 and Gbx genes. In zebrafish, sequential expression of gbx1 and gbx2 in the anterior hindbrain contributes to this process, whereas in mouse embryos, a single Gbx gene (Gbx2) is responsible for MHB development. In the present study, to investigate the regulatory mechanism of gbx2 in the MHB/isthmic region of zebrafish embryos, we cloned the gene and showed that its organization is conserved among different vertebrates. Promoter analyses revealed three enhancers that direct reporter gene expression after the end of epiboly in the anterior-most hindbrain, which is a feature of the zebrafish gbx2 gene. One of the enhancers is located upstream of gbx2 (AMH1), while the other two enhancers are located downstream of gbx2 (AMH2 and AMH3). Detailed analysis of the AMH1 enhancer showed that it directs expression in the rhombomere 1 (r1) region and the dorsal thalamus, as has been shown for gbx2, whereas no expression was induced by the AMH1 enhancer in other embryonic regions in which gbx2 is expressed. The AMH1 enhancer is composed of multiple regulatory subregions that share the same spatial specificity. The most active of the regulatory subregions is a 291-bp region that contains at least two Pax2-binding sites, both of which are necessary for the function of the main component (PB1-A region) of the AMH1 enhancer. In accordance with these results, enhancer activity in the PB1-A region, as well as gbx2 expression in r1, was missing in no isthmus mutant embryos that lacked functional pax2a. In addition, we identified an upstream conserved sequence of 227bp that suppresses the enhancer activity of AMH1. Taken together, these findings suggest that gbx2 expression during the somitogenesis stage in zebrafish is regulated by a complex mechanism involving Pax2 as well as activators and suppressors in the

Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

2013-03-29

Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

Methylation in promoter regions of PITX2 and RASSF1A genes in association with clinicopathological features in breast cancer patients.

PubMed

Jezkova, Eva; Kajo, Karol; Zubor, Pavol; Grendar, Marian; Malicherova, Bibiana; Mendelova, Andrea; Dokus, Karol; Lasabova, Zora; Plank, Lukas; Danko, Jan

2016-10-15

Breast cancer is a heterogeneous disease with very different responses to therapy and different length of survival. In many cases, however, the determination of the stage and histopathological characteristics of breast cancer is insufficient to predict prognosis and response to treatment for the vast heterogeneity of the disease. To understand the molecular signature of subtypes of breast cancer, we attempted to identify the methylation status of key tumour suppressor gene Ras association (RalGDS/AF-6) domain family member 1 isoform a (RASSF1A) and a member of the paired-like homeodomain transcription factor family which functions in left-right asymmetry development (PITX2) and to correlate results with known clinicopathological features of breast cancer. Formalin-fixed, paraffin-embedded (FFPE) tissues of breast carcinomas (n = 149) were used for DNA extraction. DNA was modified by bisulphite conversion. Detection of the methylation level of the genes mentioned above was performed by methylation-sensitive high-resolution melting assay (MS-HRM). Based on MS-HRM results for RASSF1A and PITX2, we subdivided the samples into four groups according to methylation level (≤50 % methylated, >50 % methylated, 100 % methylated and completely unmethylated alleles). All degrees of methylation status for both genes underwent analysis of dependence with known clinicopathological features, and we found significant associations. In 134 of 149 (89.9 %) primary breast carcinomas, the RASSF1A promoter was methylated. Total hypermethylation of PITX2 was observed in 60 of 135 (44.4 %) breast cancer cases. RASSF1A hypermethylation had significant association with increased age (p < 0.05), tumour grade (p < 0.0001) and stage (p < 0.0001) in the 100 % methylated group. There was significant association of PITX2 hypermethylation with tumour grade (p < 0.0001) and stage (p < 0.0001). Association between the methylation level of both investigated genes and tumour type was

High level activity of the mouse CCAAT/enhancer binding protein (C/EBP alpha) gene promoter involves autoregulation and several ubiquitous transcription factors.

PubMed Central

Legraverend, C; Antonson, P; Flodby, P; Xanthopoulos, K G

1993-01-01

The promoter region of the mouse CCAAT-Enhancer Binding Protein (C/EBP alpha) gene is capable of directing high levels of expression of reporter constructs in various cell lines, albeit even in cells that do not express their endogenous C/EBP alpha gene. To understand the molecular mechanisms underlying this ubiquitous expression, we have characterized the promoter region of the mouse C/EBP alpha gene by a variety of in vitro and in vivo methods. We show that three sites related in sequence to USF, BTE and C/EBP binding sites and present in promoter region -350/+3, are recognized by proteins from rat liver nuclear extracts. The sequence of the C/EBP alpha promoter that includes the USF binding site is also capable of forming stable complexes with purified Myc+Max heterodimers and mutation of this site drastically reduces transcription of C/EBP alpha promoter luciferase constructs both in liver and non liver cell lines. In addition, we identify three novel protein-binding sites two of which display similarity to NF-1 and a NF kappa B binding sites. The region located between nucleotides -197 and -178 forms several heat-stable complexes with liver nuclear proteins in vitro which are recognized mainly by antibodies specific for C/EBP alpha. Furthermore, transient expression of C/EBP alpha and to a lesser extent C/EBP beta expression vectors, results in transactivation of a cotransfected C/EBP alpha promoter-luciferase reporter construct. These experiments support the notion that the C/EBP alpha gene is regulated by C/EBP alpha but other C/EBP-related proteins may also be involved. Images PMID:8493090

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

PubMed

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

Polymorphisms in the leptin gene promoter in Brazilian beef herds.

PubMed

Guimarães, R C; Azevedo, J S N; Corrêa, S C; Campelo, J E G; Barbosa, E M; Gonçalves, E C; Silva Filho, E

2016-12-02

Brazil is the world's largest producer of beef cattle; however, the quality of its herds needs to be improved. The use of molecular markers as auxiliary tools in selecting animals for reproduction with high pattern for beef production would significantly improve the quality of the final beef product in Brazil. The leptin gene has been demonstrated to be an excellent candidate gene for bovine breeding. The objective of this study was to sequence and compare the leptin gene promoter of Brazil's important cattle breeds in order to identify polymorphisms in it. Blood samples of the Nellore, Guzerat, Tabapuã, and Senepol breeds were collected for genomic DNA extraction. The genomic DNA was used as a template for polymerase chain reaction (PCR) to amplify a 1575-bp fragment, which in turn was sequenced, aligned, and compared between animals of different breeds. Twenty-three single nucleotide polymorphic sites, including transitions and transversions, were detected at positions -1457, -1452, -1446, -1397, -1392, -1361, -1238, -963,-901, -578, -516, -483, -478, -470, -432, -430, -292, -282, -272, -211, -202, -170, and -147. Additionally, two insertion sites at positions -680 and -416 and two deletion sites at positions -1255 and -1059 were detected. As the promoter region of the leptin gene has been demonstrated to vary among breeds, these variations must be tested for their use as potential molecular markers for artificial selection of animals for enhanced beef production in different systems of bovine production in Brazil.

The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

PubMed

Fu, Chunli; Xing, Yingqi; Song, Xiaonan

2011-04-01

To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

Analysis of the putative regulatory region of the gastric inhibitory polypeptide receptor gene in food-dependent Cushing's syndrome.

PubMed

Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A

2004-07-01

Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.

Large Sex Differences in Chicken Behavior and Brain Gene Expression Coincide with Few Differences in Promoter DNA-Methylation

PubMed Central

Nätt, Daniel; Agnvall, Beatrix; Jensen, Per

2014-01-01

While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

Evolution of Drosophila ribosomal protein gene core promoters.

PubMed

Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

2009-03-01

The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module.

Evolution of Drosophila ribosomal protein gene core promoters

PubMed Central

Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

2011-01-01

The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module. PMID:19059316

Cloning and characterization of the promoter of the 9-cis-epoxycarotenoid dioxygenase gene in Arachis hypogaea L.

PubMed

Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu

2009-09-01

We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.

Widespread Enhancer Activity from Core Promoters.

PubMed

Medina-Rivera, Alejandra; Santiago-Algarra, David; Puthier, Denis; Spicuglia, Salvatore

2018-06-01

Gene expression in higher eukaryotes is precisely regulated in time and space through the interplay between promoters and gene-distal regulatory regions, known as enhancers. The original definition of enhancers implies the ability to activate gene expression remotely, while promoters entail the capability to locally induce gene expression. Despite the conventional distinction between them, promoters and enhancers share many genomic and epigenomic features. One intriguing finding in the gene regulation field comes from the observation that many core promoter regions display enhancer activity. Recent high-throughput reporter assays along with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-related approaches have indicated that this phenomenon is common and might have a strong impact on our global understanding of genome organisation and gene expression regulation. Copyright © 2018 Elsevier Ltd. All rights reserved.

Hypermethylation of the TSLC1 Gene Promoter in Primary Gastric Cancers and Gastric Cancer Cell Lines

PubMed Central

Honda, Teiichiro; Waki, Takayoshi; Jin, Zhe; Sato, Kiyoshi; Motoyama, Teiichi; Kawata, Sumio; Kimura, Wataru; Nishizuka, Satoshi; Murakami, Yoshinori

2002-01-01

The TSLC1 (tumor suppressor in lung cancer–1) gene is a novel tumor suppressor gene on chromosomal region 11q23.2, and is frequently inactivated by concordant promoter hypermethylation and loss of heterozygosity (LOH) in non‐small cell lung cancer (NSCLC). Because LOH on 11q has also been observed frequently in other human neoplasms including gastric cancer, we investigated the promoter methylation status of TSLC1 in 10 gastric cancer cell lines and 97 primary gastric cancers, as well as the corresponding non‐cancerous gastric tissues, by bisulfite‐SSCP analysis followed by direct sequencing. Allelic status of the TSLC1 gene was also investigated in these cell lines and primary gastric cancers. The TSLC1 promoter was methylated in two gastric cancer cell lines, KATO‐III and ECC10, and in 15 out of 97 (16%) primary gastric cancers. It was not methylated in non‐cancerous gastric tissues, suggesting that this hypermethylation is a cancer‐specific alteration. KATO‐III and ECC10 cells retained two alleles of TSLC1, both of which showed hypermethylation, associated with complete loss of gene expression. Most of the primary gastric cancers with promoter methylation also retained heterozygosity at the TSLC1 locus on 11q23.2. These data indicate that bi‐allelic hypermethylation of the TSLC1 promoter and resulting gene silencing occur in a subset of primary gastric cancers. PMID:12716461

FOXM1 promotes the progression of prostate cancer by regulating PSA gene transcription.

PubMed

Liu, Youhong; Liu, Yijun; Yuan, Bowen; Yin, Linglong; Peng, Yuchong; Yu, Xiaohui; Zhou, Weibing; Gong, Zhicheng; Liu, Jianye; He, Leye; Li, Xiong

2017-03-07

Androgen/AR is the primary contributor to prostate cancer (PCa) progression by regulating Prostate Specific Antigen (PSA) gene transcription. The disease inevitably evolves to androgen-independent (AI) status. Other mechanisms by which PSA is regulated and develops to AI have not yet been fully determined. FOXM1 is a cell proliferation-specific transcription factor highly expressed in PCa cells compared to non-malignant prostate epithelial cells, suggesting that the aberrant overexpression of FOXM1 contributes to PCa development. In addition to regulating AR gene transcription and cell cycle-regulatory genes, FOXM1 selectively regulates the gene transcription of KLK2 and PSA, typical androgen responsive genes. Screening the potential FOXM1-binding sites by ChIP-PCR, we found that FOXM1 directly binds to the FHK binding motifs in the PSA promoter/enhancer regions. AI C4-2 cells have more FOXM1 binding sites than androgen dependent LNCaP cells. The depletion of FOXM1 by small molecular inhibitors significantly improves the suppression of PSA gene transcription by the anti-AR agent Cadosax. This is the first report showing that FOXM1 promotes PCa progression by regulating PSA gene transcription, particularly in AI PCa cells. The combination of anti-AR agents and FOXM1 inhibitors has the potential to greatly improve therapy for late-stage PCa patients by suppressing PSA levels.

Detection and Preliminary Analysis of Motifs in Promoters of Anaerobically Induced Genes of Different Plant Species

PubMed Central

MOHANTY, BIJAYALAXMI; KRISHNAN, S. P. T.; SWARUP, SANJAY; BAJIC, VLADIMIR B.

2005-01-01

• Background and Aims Plants can suffer from oxygen limitation during flooding or more complete submergence and may therefore switch from Kreb's cycle respiration to fermentation in association with the expression of anaerobically inducible genes coding for enzymes involved in glycolysis and fermentation. The aim of this study was to clarify mechanisms of transcriptional regulation of these anaerobic genes by identifying motifs shared by their promoter regions. • Methods Statistically significant motifs were detected by an in silico method from 13 promoters of anaerobic genes. The selected motifs were common for the majority of analysed promoters. Their significance was evaluated by searching for their presence in transcription factor-binding site databases (TRANSFAC, PlantCARE and PLACE). Using several negative control data sets, it was tested whether the motifs found were specific to the anaerobic group. • Key Results Previously, anaerobic response elements have been identified in maize (Zea mays) and arabidopsis (Arabidopsis thaliana) genes. Known functional motifs were detected, such as GT and GC motifs, but also other motifs shared by most of the genes examined. Five motifs detected have not been found in plants hitherto but are present in the promoters of animal genes with various functions. The consensus sequences of these novel motifs are 5′-AAACAAA-3′, 5′-AGCAGC-3′, 5′-TCATCAC-3′, 5′-GTTT(A/C/T)GCAA-3′ and 5′-TTCCCTGTT-3′. • Conclusions It is believed that the promoter motifs identified could be functional by conferring anaerobic sensitivity to the genes that possess them. This proposal now requires experimental verification. PMID:16027132

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

PubMed

Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

1999-10-28

We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

PubMed

Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

2009-01-01

A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.)

PubMed Central

Yin, Tao; Wu, Hanying; Zhang, Shanglong; Liu, Jingmei; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming

2009-01-01

A 1.8 kb 5′-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from –986 to –959 and from –472 to –424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative β-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were ∼10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves. PMID:19073962

Contribution of the Pmra Promoter to Expression of Genes in the Escherichia coli mra Cluster of Cell Envelope Biosynthesis and Cell Division Genes

PubMed Central

Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi

1998-01-01

Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276

Cis-acting elements in the promoter region of the human aldolase C gene.

PubMed

Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

1993-08-16

We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach

PubMed Central

Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng

2013-01-01

The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146

Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

PubMed Central

Ngô, V; Gourdji, D; Laverrière, J N

1996-01-01

The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

ISOLATION OF THE REGULATORY REGIONS AND GENOMIC ORGANIZATION OF THE PORCINE α1,3-GALACTOSYLTRANSFERASE GENE1

PubMed Central

Koike, Chihiro; Friday, Robert P.; Nakashima, Izumi; Luppi, Patrizia; Fung, John J.; Rao, Abdul S.; Starzl, Thomas E.; Trucco, Massimo

2010-01-01

Background α1,3-galactosyltransferase (α1,3GT) is an enzyme that produces carbohydrate chains termed αGal epitopes found in most mammals, although some species of higher primates, including human, are notable exceptions. The evolutionary origin of the lost α1,3GT enzyme activity is not yet known, although it has been suggested that the promoter activity of this gene in the ancestors of higher primates was inactivated. Methods We used 5′-or 3′-RACE, GenomeWalking, reverse transcriptase polymerase chain reaction (RT-PCR) and dual Luciferase reporter assay for identification of the full-length cDNA, which includes the transcription initiation site and the promoter region of porcine α1,3GT gene. Results The region around exon 1 is guanine and cytosine (GC)-rich (about 70%), comprising a CpG island spanning more than 1.5 kbp. The 5′-flanking region of exon 1 contains multiple transcription factor consensus motifs, including GC-box, SP1, AP2, and GATA-box sites, in the absence of TATA or CAAT-box sequences. The entire gene consists of three 5′ noncoding and six coding region exons spanning more than 52 kbp. Detailed analysis of α1,3GT transcripts revealed two major alternative splicing patterns in the 5′-untranslated region (5′-UTR) and evidence for minor splicing activity that occurs in a tissue-specific manner. Interspecies comparison of 5′-UTR shows minimal homology between porcine and murine sequences except for exon 2, which suggests that the regulatory regions differ among species. Conclusions These observations have important implications for experiments involving genetic manipulation of the α1,3GT gene in transgenic animals in terms of promoter utilization, and particularly in genetically engineering cells for the animal cloning technology by nuclear transfer. PMID:11087141

Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

PubMed

Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

2017-08-01

Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

PubMed Central

Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

2014-01-01

The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

PubMed

Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

2013-03-01

Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line.

PubMed

Yoshino, T P; Wu, X J; Liu, H D

1998-09-01

Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable

Germin-like protein 2 gene promoter from rice is responsive to fungal pathogens in transgenic potato plants.

PubMed

Munir, Faiza; Hayashi, Satomi; Batley, Jacqueline; Naqvi, Syed Muhammad Saqlan; Mahmood, Tariq

2016-01-01

Controlled transgene expression via a promoter is particularly triggered in response to pathogen infiltration. This is significant for eliciting disease-resistant features in crops through genetic engineering. The germins and germin-like proteins (GLPs) are known to be associated with plant and developmental stages. The 1107-bp Oryza sativa root GLP2 (OsRGLP2) gene promoter fused to a β-glucuronidase (GUS) reporter gene was transformed into potato plants through an Agrobacterium-mediated transformation. The OsRGLP2 promoter was activated in response to Fusarium solani (Mart.) Sacc. and Alternaria solani Sorauer. Quantitative real-time PCR results revealed 4-5-fold increase in promoter activity every 24 h following infection. There was a 15-fold increase in OsRGLP2 promoter activity after 72 h of F. solani (Mart.) Sacc. treatment and a 12-fold increase observed with A. solani Sorauer. Our results confirmed that the OsRGLP2 promoter activity was enhanced under fungal stress. Furthermore, a hyperaccumulation of H2O2 in transgenic plants is a clear signal for the involvement of OsRGLP2 promoter region in the activation of specific genes in the potato genome involved in H2O2-mediated defense response. The OsRGLP2 promoter evidently harbors copies of GT-I and Dof transcription factors (AAAG) that act in response to elicitors generated in the wake of pathogen infection.

Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

PubMed

Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

2017-07-01

Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

The -1535 promoter variant of the visfatin gene is associated with serum triglyceride and HDL-cholesterol levels in Japanese subjects.

PubMed

Tokunaga, Ayumi; Miura, Atsuko; Okauchi, Yukiyoshi; Segawa, Katsumori; Fukuhara, Atsunori; Okita, Kohei; Takahashi, Masahiko; Funahashi, Tohru; Miyagawa, Jun-Ichiro; Shimomura, Iichiro; Yamagata, Kazuya

2008-03-01

Visfatin is a novel adipocytokine that is expressed by the visceral fat cells. We investigated the role of genetic variation in the visfatin gene in the pathophysiology of type 2 diabetes and clinical variables in Japanese subjects. The 11 exons, and the promoter region of the visfatin gene were screened for single nucleotide polymorphisms (SNPs) by PCR-direct sequencing. We found SNPs in the promoter region (SNP - 1535T>C), exon 2 (SNP + 131C>G, Thr44Arg), and exon 7 (SNP + 903G>A). The allele and genotype frequencies of these SNPs showed no significant differences between 200-448 diabetic and 200-333 control subjects. However, the -1535T/T genotype was associated with lower serum triglyceride levels (T/T vs. T/C + C/C (p = 0.015) and T/T vs. C/C (p = 0.043)) and higher HDL-cholesterol levels (T/T vs. C/C, p = 0.0496) in the nondiabetic subjects. Reporter gene assay of 3T3-L1 adipocytes revealed that the promoter activity of -1535T and -1535C was similar, suggesting that the observed association may reflect linkage disequilibrium between -1535T>C and causative variations of the visfatin gene.

Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

PubMed

Rosario, Christopher J; Tan, Ming

2016-01-15

Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number

Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

PubMed

Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; Rodríguez de Miguel, Cristina; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni

2010-01-19

Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant difference in any evaluated gene. These results provide

Common variants at the promoter region of the APOM confer a risk of rheumatoid arthritis

PubMed Central

Hu, Hae-Jin; Jin, Eun-Heui; Yim, Seon-Hee; Yang, So-Young; Jung, Seung-Hyun; Shin, Seung-Hun; Kim, Wan-Uk; Shim, Seung-Cheol; Kim, Tai-Gyu

2011-01-01

Although the genetic component in the etiology of rheumatoid arthritis (RA) has been consistently suggested, many novel genetic loci remain to uncover. To identify RA risk loci, we performed a genome-wide association study (GWAS) with 100 RA cases and 600 controls using Affymetrix SNP array 5.0. The candidate risk locus (APOM gene) was re-sequenced to discover novel promoter and coding variants in a group of the subjects. Replication was performed with the independent case-control set comprising of 578 RAs and 711 controls. Through GWAS, we identified a novel SNP associated with RA at the APOM gene in the MHC class III region on 6p21.33 (rs805297, odds ratio (OR) = 2.28, P = 5.20 × 10-7). Three more polymorphisms were identified at the promoter region of the APOM by the re-sequencing. For the replication, we genotyped the four SNP loci in the independent case-control set. The association of rs805297 identified by GWAS was successfully replicated (OR = 1.40, P = 6.65 × 10-5). The association became more significant in the combined analysis of discovery and replication sets (OR = 1.56, P = 2.73 ± 10-10). The individuals with the rs805297 risk allele (A) at the promoter region showed a significantly lower level of APOM expression compared with those with the protective allele (C) homozygote. In the logistic regressions by the phenotype status, the homozygote risk genotype (A/A) consistently showed higher ORs than the heterozygote one (A/C) for the phenotype-positive RAs. These results indicate that APOM promoter polymorphisms are significantly associated with the susceptibility to RA. PMID:21844665

A sequence in the rat Pit-1 gene promoter confers synergistic activation by glucocorticoids and protein kinase-C.

PubMed

Jong, M T; Raaka, B M; Samuels, H H

1994-10-01

The 5'-flanking region of the gene for Pit-1, a pituitary-specific transcription factor, was isolated from a rat liver genomic library and sequenced. Expression of a reporter construct containing Pit-1 promoter sequences linked to the bacterial chloramphenicol acetyltransferase (CAT) gene was assessed by transient transfection in rat pituitary GH4C1 cells. Treatment of transfected cells with either dexamethasone (DEX) for 48 h or the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA) for the final 20 h of the 48-h posttransfection period had minimal effects on CAT expression. However, CAT activity was elevated about 20-fold when transfected cells were treated with both DEX and TPA. This apparent synergistic activation was lost when DEX treatment was also limited to the final 20 h of the 48-h posttransfection period, suggesting that a time-dependent accumulation of a DEX-induced gene product might be involved. This putative DEX-induced product appeared to be relatively stable, because synergistic activation was observed in cells treated with DEX alone for 36 h, followed by a 10-h incubation without DEX before the addition of TPA. The Pit-1 gene promoter region between -210 and -142 from the transcription start site conferred synergistic regulation by DEX and TPA when placed upstream of position -105 in the herpes viral thymidine kinase promoter.(ABSTRACT TRUNCATED AT 250 WORDS)

Decoding a Signature-Based Model of Transcription Cofactor Recruitment Dictated by Cardinal Cis-Regulatory Elements in Proximal Promoter Regions

PubMed Central

Benner, Christopher; Hutt, Kasey R.; Stunnenberg, Rieka; Garcia-Bassets, Ivan

2013-01-01

Genome-wide maps of DNase I hypersensitive sites (DHSs) reveal that most human promoters contain perpetually active cis-regulatory elements between −150 bp and +50 bp (−150/+50 bp) relative to the transcription start site (TSS). Transcription factors (TFs) recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins) to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the −150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed ‘cardinal’ motifs) prefer acting individually, rather than in fixed combinations, within the −150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1) motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A). This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription. PMID:24244184

Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis.

PubMed

Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K

1995-05-20

In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.

Analysis of the promoter of the cudA gene reveals novel mechanisms of Dictyostelium cell type differentiation.

PubMed

Fukuzawa, M; Williams, J G

2000-06-01

The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.

[Health-Promoting Schools Regional Initiative of the Americas].

PubMed

Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

2005-01-01

In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

Analyzing the promoters of two CYP9A genes in the silkworm Bombyx mori by dual-luciferase reporter assay.

PubMed

Zhao, Si-Si; Zhao, Guo-Dong; Di, Tian-Yuan; Ding, Hua; Wan, Xiao-Ling; Li, Bing; Chen, Yu-Hua; Xu, Ya-Xiang; Shen, Wei-De; Wei, Zheng-Guo

2013-02-01

Cytochrome P450s (CYPs) are widespread proteins that interact with exogenous chemicals from the diet or the environment. CYP9A subfamily genes are important in the silkworm Bombyx mori. We previously reported transcriptional levels of two CYP9A genes in different tissues and their responses to sodium fluoride (NaF). In this study, promoter truncation analysis using a dual-luciferase reporter assay in B. mori ovary cells (BmN) showed that the regions -1,496 to -1,102 bp for CYP9A19, and -1,630 to -1,210 bp for CYP9A22 were essential for basal transcriptional activity. Sequence analysis of these regions revealed several transcriptional regulatory elements but no typical promoter elements. Promoter activities were regulated after NaF induction and with an obvious dose effect. Although the dual-luciferase assay has been widely used to determine the activity of a given promoter in cell lines, problems with it still exist. Our results indicate that both plasmid size and construct protocols affect the experimental results.

Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.

PubMed

Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa

2015-01-01

Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.

Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

PubMed

Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

1997-02-07

An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

Human in vitro induced T regulatory cells and memory T cells share common demethylation of specific FOXP3 promoter region.

PubMed

Bégin, Philippe; Schulze, Janika; Baron, Udo; Olek, Sven; Bauer, Rebecca N; Passerini, Laura; Baccheta, Rosa; Nadeau, Kari C

2015-01-01

The FOXP3 gene is the master regulator for T regulatory cells and is under tight DNA methylation control at the Treg specific demethylated region (TSDR) in its first intron. This said, methylation of its promoter region, the significance of which is unknown, has also been associated with various immune-related disease states such as asthma, food allergy, auto-immunity and cancer. Here, we used induced T regulatory cells (iTreg) as a target cell population to identify candidate hypomethylated CpG sites in the FOXP3 gene promoter to design a DNA methylation quantitative assay for this region. Three CpG sites at the promoter region showed clear demethylation pattern associated with high FOXP3 expression after activation in presence of TGFβ and were selected as primary targets to design methylation-dependent RT-PCR primers and probes. We then examined the methylation of this 'inducible-promoter-demethylated-region' (IPDR) in various FOXP3+ T cell subsets. Both naïve and memory thymic-derived Treg cells were found to be fully demethylated at both the IPDR and TSDR. Interestingly, in addition to iTregs, both CD25- and CD25(lo) conventional memory CD4+CD45RA- T cells displayed a high fraction of IPDR demethylated cells in absence of TSDR demethylation. This implies that the fraction of memory T cells should be taken in account when interpreting FOXP3 promoter methylation results from clinical studies. This approach, which is available for testing in clinical samples could have diagnostic and prognostic value in patients with immune or auto-inflammatory diseases.

Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

PubMed Central

Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

2002-01-01

κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

PubMed

Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

2014-01-01

Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

PubMed

Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

2015-06-01

IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

6-mercaptopurine influences TPMT gene transcription in a TPMT gene promoter variable number of tandem repeats-dependent manner.

PubMed

Kotur, Nikola; Stankovic, Biljana; Kassela, Katerina; Georgitsi, Marianthi; Vicha, Anna; Leontari, Iliana; Dokmanovic, Lidija; Janic, Dragana; Krstovski, Nada; Klaassen, Kristel; Radmilovic, Milena; Stojiljkovic, Maja; Nikcevic, Gordana; Simeonidis, Argiris; Sivolapenko, Gregory; Pavlovic, Sonja; Patrinos, George P; Zukic, Branka

2012-02-01

TPMT activity is characterized by a trimodal distribution, namely low, intermediate and high methylator. TPMT gene promoter contains a variable number of GC-rich tandem repeats (VNTRs), namely A, B and C, ranging from three to nine repeats in length in an A(n)B(m)C architecture. We have previously shown that the VNTR architecture in the TPMT gene promoter affects TPMT gene transcription. MATERIALS, METHODS & RESULTS: Here we demonstrate, using reporter assays, that 6-mercaptopurine (6-MP) treatment results in a VNTR architecture-dependent decrease of TPMT gene transcription, mediated by the binding of newly recruited protein complexes to the TPMT gene promoter, upon 6-MP treatment. We also show that acute lymphoblastic leukemia patients undergoing 6-MP treatment display a VNTR architecture-dependent response to 6-MP. These data suggest that the TPMT gene promoter VNTR architecture can be potentially used as a pharmacogenomic marker to predict toxicity due to 6-MP treatment in acute lymphoblastic leukemia patients.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

NASA Astrophysics Data System (ADS)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Identification of a locus control region for quadruplicated green-sensitive opsin genes in zebrafish

PubMed Central

Tsujimura, Taro; Chinen, Akito; Kawamura, Shoji

2007-01-01

Duplication of opsin genes has a crucial role in the evolution of visual system. Zebrafish have four green-sensitive (RH2) opsin genes (RH2–1, RH2–2, RH2–3, and RH2–4) arrayed in tandem. They are expressed in the short member of the double cones (SDC) but differ in expression areas in the retina and absorption spectra of their encoding photopigments. The shortest and the second shortest wavelength subtypes, RH2–1 and RH2–2, are expressed in the central-to-dorsal retina. The longer wavelength subtype, RH2–3, is expressed circumscribing the RH2–1/RH2–2 area, and the longest subtype, RH2–4, is expressed further circumscribing the RH2–3 area and mainly occupying the ventral retina. The present report shows that a 0.5-kb region located 15 kb upstream of the RH2 gene array is an essential regulator for their expression. When the 0.5-kb region was deleted from a P1-artificial chromosome (PAC) clone encompassing the four RH2 genes and when one of these genes was replaced with a reporter GFP gene, the GFP expression in SDCs was abolished in the zebrafish to which a series of the modified PAC clones were introduced. Transgenic studies also showed that the 0.5-kb region conferred the SDC-specific expression for promoters of a non-SDC (UV opsin) and a nonretinal (keratin 8) gene. Changing the location of the 0.5-kb region in the PAC clone conferred the highest expression for its proximal gene. The 0.5-kb region was thus designated as RH2-LCR analogous to the locus control region of the L-M opsin genes of primates. PMID:17646658

Quantitative analysis of DNA methylation in the promoter region of the methylguanine-O(6) -DNA-methyltransferase gene by COBRA and subsequent native capillary gel electrophoresis.

PubMed

Goedecke, Simon; Mühlisch, Jörg; Hempel, Georg; Frühwald, Michael C; Wünsch, Bernhard

2015-12-01

Along with histone modifications, RNA interference and delayed replication timing, DNA methylation belongs to the key processes in epigenetic regulation of gene expression. Therefore, reliable information about the methylation level of particular DNA fragments is of major interest. Herein the methylation level at two positions of the promoter region of the gene methylguanine-O(6) -DNA-Methyltransferase (MGMT) was investigated. Previously, it was demonstrated that the epigenetic status of this DNA region correlates with response to alkylating anticancer agents. An automated CGE method with LIF detection was established to separate the six DNA fragments resulting from combined bisulfite restriction analysis of the methylated and non-methylated MGMT promoter. In COBRA, the DNA was treated with bisulfite converting cytosine into uracil. During PCR uracil pairs with adenine, which changes the original recognition site of the restriction enzyme Taql. Artificial probes generated by mixing appropriate amounts of DNA after bisulfite treatment and PCR amplification were used for validation of the method. The methylation levels of these samples could be determined with high accuracy and precision. DNA samples prepared by mixing the corresponding clones first and then performing PCR amplification led to non-linear correlation between the corrected peak areas and the methylation levels. This effect is explained by slightly different PCR amplification of DNA with different sequences present in the mixture. The superiority of CGE over PAGE was clearly demonstrated. Finally, the established method was used to analyze the methylation levels of human brain tumor tissue samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Targeting G-quadruplex DNA structures in the telomere and oncogene promoter regions by benzimidazole‒carbazole ligands.

PubMed

Kaulage, Mangesh H; Maji, Basudeb; Pasadi, Sanjeev; Ali, Asfa; Bhattacharya, Santanu; Muniyappa, K

2018-03-25

Recent studies support the idea that G-quadruplex structures in the promoter regions of oncogenes and telomere DNA can serve as potential therapeutic targets in the treatment of cancer. Accordingly, several different types of organic small molecules that stabilize G-quadruplex structures and inhibit telomerase activity have been discerned. Here, we describe the binding of benzimidazole-carbazole ligands to G-quadruplex structures formed in G-rich DNA sequences containing the promoter regions of human c-MYC, c-KIT1, c-KIT2, VEGF and BCL2 proto-oncogenes. The fluorescence spectroscopic data indicate that benzimidazole-carbazole ligands bind and stabilize the G-quadruplexes in the promoter region of oncogenes. The molecular docking studies provide insights into the mode and extent of binding of this class of ligands to the G-quadruplexes formed in oncogene promoters. The high stability of these G-quadruplex structures was validated by thermal denaturation and telomerase-catalyzed extension of the 3' end. Notably, benzimidazole-carbazole ligands suppress the expression of oncogenes in cancer cells in a dose-dependent manner. We anticipate that benzimidazole-carbazole ligands, by virtue of their ability to stabilize G-quadruplex structures in the promoter regions of oncogenes, might reduce the risk of cancer through the loss of function in the proteins encoded by these genes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase ɛ B-subunit gene POLE2

PubMed Central

Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.

2001-01-01

The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027

Functional Characterization of Promoter Variants of the Adiponectin Gene Complemented by Epidemiological Data

PubMed Central

Laumen, Helmut; Saningong, Akuma D.; Heid, Iris M.; Hess, Jochen; Herder, Christian; Claussnitzer, Melina; Baumert, Jens; Lamina, Claudia; Rathmann, Wolfgang; Sedlmeier, Eva-Maria; Klopp, Norman; Thorand, Barbara; Wichmann, H.-Erich; Illig, Thomas; Hauner, Hans

2009-01-01

OBJECTIVE Adiponectin (APM1, ACDC) is an adipocyte-derived protein with downregulated expression in obesity and insulin-resistant states. Several potentially regulatory single nucleotide polymorphisms (SNPs) within the APM1 gene promoter region have been associated with circulating adiponectin levels. None of them have been functionally characterized in adiponectin-expressing cells. Hence, we investigated three SNPs (rs16861194, rs17300539, and rs266729) for their influence on adiponectin promoter activity and their association with circulating adiponectin levels. RESEARCH DESIGN AND METHODS Basal and rosiglitazone-induced promoter activity of different SNP combinations (haplotypes) was analyzed in 3T3-L1 adipocytes using luciferase reporter gene assays and DNA binding studies comparing all possible APM1 haplotypes. This functional approach was complemented with analysis of epidemiological population-based data of 1,692 participants of the MONICA/KORA S123 cohort and 696 participants from the KORA S4 cohort for SNP and haplotype association with circulating adiponectin levels. RESULTS Major to minor allele replacements of the three SNPs revealed significant effects on promoter activity in luciferase assays. Particularly, a minor variant in rs16861194 resulted in reduced basal and rosiglitazone-induced promoter activity and hypoadiponectinemia in the epidemiological datasets. The haplotype with the minor allele in all three SNPs showed a complete loss of promoter activity, and no subject carried this haplotype in either of the epidemiological samples (combined P value for statistically significant difference from a random sample was 0.006). CONCLUSIONS Our results clearly demonstrate that promoter variants associated with hypoadiponectinemia in humans substantially affect adiponectin promoter activity in adipocytes. Our combination of functional experiments with epidemiological data overcomes the drawback of each approach alone. PMID:19074982

Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

PubMed Central

Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.

1988-01-01

To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981

SnoN co-repressor binds and represses smad7 gene promoter.

PubMed

Briones-Orta, Marco A; Sosa-Garrocho, Marcela; Moreno-Alvarez, Paola; Fonseca-Sánchez, Miguel A; Macías-Silva, Marina

2006-03-17

SnoN and Ski oncoproteins are co-repressors for Smad proteins and repress TGF-beta-responsive gene expression. The smad7 gene is a TGF-beta target induced by Smad signaling, and its promoter contains the Smad-binding element (SBE) required for a positive regulation by the TGF-beta/Smad pathway. SnoN and Ski co-repressors also bind SBE but regulate negatively smad7 gene. Ski along with Smad4 binds and represses the smad7 promoter, whereas the repression mechanism by SnoN is not clear. Ski and SnoN overexpression inhibits smad7 reporter expression induced through TGF-beta signaling. Using chromatin immunoprecipitation assays, we found that SnoN binds smad7 promoter at the basal condition, whereas after a short TGF-beta treatment for 15-30 min SnoN is downregulated and no longer bound smad7 promoter. Interestingly, after a prolonged TGF-beta treatment SnoN is upregulated and returns to its position on the smad7 promoter, functioning probably as a negative feedback control. Thus, SnoN also seems to regulate negatively the TGF-beta-responsive smad7 gene by binding and repressing its promoter in a similar way to Ski.

A novel polymorphism in the PAI-1 gene promoter enhances gene expression. A novel pro-thrombotic risk factor?

PubMed

Liguori, Renato; Quaranta, Sandro; Di Fiore, Rosanna; Elce, Ausilia; Castaldo, Giuseppe; Amato, Felice

2014-12-01

Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor of tissue-type plasminogen activator in plasma and the most important regulator of the fibrinolytic pathway. The 4G/5G polymorphism (rs1799889) in the PAI-1 promoter is associated with altered PAI-1 transcription. We have identified a new 4G/5G allele, in which a T is inserted near the 4G tract or replaces a G in the 5G tract, forming a T plus 4G (T4G) region. This new variant was first identified in two women, one had experienced juvenile myocardial infarction, the other repeated miscarriage; both had increased PAI-1 plasma activity. In view of the important influence of this promoter region on PAI-1 protein plasma level, we performed in vitro evaluation of the effects of the T4G variant on the transcription activity of the PAI-1 gene promoter. In silico prediction analysis showed that presence of the T4G allele disrupts the E-Box region upstream of the T4G variant, altering the affinity of the target sequence for E-Box binding factors like upstream stimulatory factor-1 (USF-1). Basal T4G promoter activity was 50% higher compared to 4G and 5G variants, but it was less stimulated by USF-1 overexpression. We also analyzed the effects of IL-1β and IL-6 on the PAI-1 promoter activity of our three constructs and showed that the T4G variant was less affected by IL-1β than the other variants. These findings indicate that the T4G variant may be a novel risk factor for thrombotic events. Copyright © 2014 Elsevier Ltd. All rights reserved.

Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer.

PubMed

Marusa Borgonio-Cuadra, Veronica; Miranda-Duarte, Antonio; Rojas-Toledo, Xochitl; Garcia-Hernandez, Normand; Alfredo Sierra-Ramirez, Jose; Cardenas-Garcia, Maura; Elena Hernandez-Caballero, Marta

2018-01-01

Aberrant methylation of CpG islands in the promoter is a hallmark of cancer, leading to transcriptional silencing of tumor suppressor genes. The aim of this work was to evaluate the promoter methylation status of the DACT2 gene in breast cancer (BC) tissue and to analyze its possible effect on tumor type or grade. CpG island from the DACT2 promoter in region -240 to -14 from transcriptional start site (TSS) were obtained. Through the use of sodium bisulfite DNA conversion analysis, followed by detection with MSP (methylation specific PCR), we analyzed 79 BC and 15 adjacent healthy samples. T he c ases a nalyzed w ere i n s tage I ( 2.5%), I I (38%), or III (59.5%). The most frequent tumor type was invasive ductal carcinoma (71.4%). Methylation analysis comparing tumor tissues with adjacent non-cancerous tissues showed statistical significance. Methylation was observed in 32.9% (26/79) of the samples; no methylation was found in adjacent healthy tissue. DACT2 methylation was associated with tumor stage I-II (p=0.03) and stage III (p=0.004). An association was found of DACT2 promoter methylation with advanced tumor stages. This gene has been suggested as a potential biomarker, however, more investigation is required to validate this function.

Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

PubMed

Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

2012-05-01

To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

[Novel bidirectional promoter from human genome].

PubMed

Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

2011-01-01

In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

PubMed

Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

2015-04-01

The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

Promoter analysis of the rabbit POU5F1 gene and its expression in preimplantation stage embryos.

PubMed

Kobolak, Julianna; Kiss, Katalin; Polgar, Zsuzsanna; Mamo, Solomon; Rogel-Gaillard, Claire; Tancos, Zsuzsanna; Bock, Istvan; Baji, Arpad G; Tar, Krisztina; Pirity, Melinda K; Dinnyes, Andras

2009-09-04

The POU5F1 gene encodes the octamer-binding transcription factor-4 (Oct4). It is crucial in the regulation of pluripotency during embryonic development and widely used as molecular marker of embryonic stem cells (ESCs). The objective of this study was to identify and to analyse the promoter region of rabbit POU5F1 gene; furthermore to examine its expression pattern in preimplantation stage rabbit embryos. The upstream region of rabbit POU5F1 was subcloned sequenced and four highly conserved promoter regions (CR1-4) were identified. The highest degree of similarity on sequence level was found among the conserved domains between rabbit and human. Among the enhancers the proximal enhancer region (PE-1A) exhibited the highest degree of homology (96.4%). Furthermore, the CR4 regulator domain containing the distal enhancer (DE-2A) was responsible for stem cell-specific expression. Also, BAC library screen revealed the existence of a processed pseudogene of rabbit POU5F1. The results of quantitative real-time PCR experiments showed that POU5F1 mRNA was abundantly present in oocytes and zygotes, but it was gradually reduced until the activation of the embryonic genome, thereafter a continuous increase in POU5F1 mRNA level was observed until blastocyst stage. By using the XYClone laser system the inner cell mass (ICM) and trophoblast portions of embryos were microdissected and examined separately and POU5F1 mRNA was detected in both cell types. In this study we provide a comparative sequence analysis of the regulatory region of rabbit POU5F1 gene. Our data suggest that the POU5F1 gene is strictly regulated during early mammalian development. We proposed that the well conserved CR4 region containing the DE-2A enhancer is responsible for the highly conserved ESC specific gene expression. Notably, we are the first to report that the rabbit POU5F1 is not restricted to ICM cells only, but it is expressed in trophoblast cells as well. This information may be well applicable to

First Pass Annotation of Promoters on Human Chromosome 22

PubMed Central

Scherf, Matthias; Klingenhoff, Andreas; Frech, Kornelie; Quandt, Kerstin; Schneider, Ralf; Grote, Korbinian; Frisch, Matthias; Gailus-Durner, Valérie; Seidel, Alexander; Brack-Werner, Ruth; Werner, Thomas

2001-01-01

The publication of the first almost complete sequence of a human chromosome (chromosome 22) is a major milestone in human genomics. Together with the sequence, an excellent annotation of genes was published which certainly will serve as an information resource for numerous future projects. We noted that the annotation did not cover regulatory regions; in particular, no promoter annotation has been provided. Here we present an analysis of the complete published chromosome 22 sequence for promoters. A recent breakthrough in specific in silico prediction of promoter regions enabled us to attempt large-scale prediction of promoter regions on chromosome 22. Scanning of sequence databases revealed only 20 experimentally verified promoters, of which 10 were correctly predicted by our approach. Nearly 40% of our 465 predicted promoter regions are supported by the currently available gene annotation. Promoter finding also provides a biologically meaningful method for “chromosomal scaffolding”, by which long genomic sequences can be divided into segments starting with a gene. As one example, the combination of promoter region prediction with exon/intron structure predictions greatly enhances the specificity of de novo gene finding. The present study demonstrates that it is possible to identify promoters in silico on the chromosomal level with sufficient reliability for experimental planning and indicates that a wealth of information about regulatory regions can be extracted from current large-scale (megabase) sequencing projects. Results are available on-line at http://genomatix.gsf.de/chr22/. PMID:11230158

Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

PubMed Central

Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

2001-01-01

The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

c-Myb Binds to a Sequence in the Proximal Region of the RAG-2 Promoter and Is Essential for Promoter Activity in T-Lineage Cells

PubMed Central

Wang, Qian-Fei; Lauring, Josh; Schlissel, Mark S.

2000-01-01

The RAG-2 gene encodes a component of the V(D)J recombinase which is essential for the assembly of antigen receptor genes in B and T lymphocytes. Previously, we reported that the transcription factor BSAP (PAX-5) regulates the murine RAG-2 promoter in B-cell lines. A partially overlapping but distinct region of the proximal RAG-2 promoter was also identified as an important element for promoter activity in T cells; however, the responsible factor was unknown. In this report, we present data demonstrating that c-Myb binds to a Myb consensus site within the proximal promoter and is critical for its activity in T-lineage cells. We show that c-Myb can transactivate a RAG-2 promoter-reporter construct in cotransfection assays and that this transactivation depends on the proximal promoter Myb consensus site. By using a chromatin immunoprecipitation (ChIP) strategy, fractionation of chromatin with anti-c-Myb antibody specifically enriched endogenous RAG-2 promoter DNA sequences. DNase I genomic footprinting revealed that the c-Myb site is occupied in a tissue-specific fashion in vivo. Furthermore, an integrated RAG-2 promoter construct with mutations at the c-Myb site was not enriched in the ChIP assay, while a wild-type integrated promoter construct was enriched. Finally, this lack of binding of c-Myb to a chromosomally integrated mutant RAG-2 promoter construct in vivo was associated with a striking decrease in promoter activity. We conclude that c-Myb regulates the RAG-2 promoter in T cells by binding to this consensus c-Myb binding site. PMID:11094072

Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

PubMed Central

Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

2001-01-01

Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

PubMed Central

Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

2013-01-01

On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

DTIC Science & Technology

2016-08-01

AWARD NUMBER: W81XWH-14-1-0292 TITLE: Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters PRINCIPAL...Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and...29 Jul 2016 4. TITLE AND SUBTITLE Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters 5a. CONTRACT NUMBER

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

PubMed Central

Fauteux, François; Strömvik, Martina V

2009-01-01

Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

Variants in the Dopamine-4-Receptor Gene Promoter Are Not Associated with Sensation Seeking in Skiers

PubMed Central

Thomson, Cynthia J.; Rajala, Amelia K.; Carlson, Scott R.; Rupert, Jim L.

2014-01-01

Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (−1106T/C, −906T/C, −809G/A, −291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population. PMID:24691022

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

Association of the -1082 G/A promoter polymorphism of interleukin-10 gene with the autoantibodies production in patients with rheumatoid arthritis.

PubMed

Nemec, Petr; Pavkova-Goldbergova, Monika; Gatterova, Jindra; Fojtik, Zdenek; Vasku, Anna; Soucek, Miroslav

2009-08-01

Interleukin-10 (IL-10) is an immunoregulatory cytokine, usually considered to mediate the downregulation of the inflammatory response in rheumatoid arthritis (RA). Some effects of IL-10 are not anti-inflammatory; for example, the activation of B cells to promote autoantibody production. Allelic polymorphisms located in the promoter region of the IL-10 gene may contribute to the regulation of autoantibodies production. To examine the putative association between the -1082 G/A polymorphism in the promoter region of the IL-10 gene and the susceptibility to disease onset and severity of RA, a total of 144 patients with RA diagnosed according to the revised criteria of the American College of Rheumatology for RA were consecutively recruited into the study. Radiographic progression of RA was scored according to the Sharp/van der Heijde method. Serum levels of rheumatoid factors (RFs) were measured by enzyme-linked immunosorbent assay. Polymerase chain reaction amplification was used for the analysis of the promoter polymorphism of the IL-10 gene. We observed significant differences in genotype distribution of the -1082 G/A polymorphism between IgM RF, IgA RF, and IgG RF positive/negative subgroups of RA patients, with higher prevalence of the GG genotype within IgM RF (Pg = 0.006), IgA RF (Pg = 0.05), and IgG RF (Pg = 0.007) negative RA patients. Results obtained in this study provide the evidence of an association between the -1082 G/A polymorphism in the IL-10 gene promoter and the production of RFs in RA patients.

Regulation and function of the pepper pectin methylesterase inhibitor (CaPMEI1) gene promoter in defense and ethylene and methyl jasmonate signaling in plants.

PubMed

An, Soo Hyun; Choi, Hyong Woo; Hong, Jeum Kyu; Hwang, Byung Kook

2009-11-01

Analysis of the promoters of defense-related genes is valuable for determining stress signaling and transcriptional activation during pathogen infection. Here, we have isolated and functionally characterized the promoter region of the pepper (Capsicum annuum) pectin methylesterase inhibitor 1 (CaPMEI1) gene in transiently transformed tobacco plants and stably transformed Arabidopsis plants. Among four 5' deletion constructs analyzed, the -958-bp CaPMEI1 promoter induced a high level of GUS reporter activity in tobacco leaf tissue, driven by pathogen infection as well as by ethylene and methyl jasmonate (MeJA) treatment. The 204-bp region from -958 bp to -754 bp of the CaPMEI1 promoter is responsible for the stress-responsive expression. In addition, the pepper transcription factor CARAV1 activated the CaPMEI1 promoter in tobacco leaves, whereas the transcription factor CAbZIP1 did not. In the transgenic Arabidopsis plants, the -958 bp CaPMEI1 promoter was functionally regulated by developmental cues, bacterial and oomycete pathogen infections, and treatment with ethylene and MeJA. Histochemical GUS staining analyses of Arabidopsis tissues revealed that the CaPMEI1 promoter was mainly activated in leaf veins in response to various biotic and abiotic stimuli. Together, these results suggest that CaPMEI1 promoter activation may be a critical molecular event for host defense response and ethylene- and MeJA-mediated CaPMEI1 gene expression.

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

PubMed Central

Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-01-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

PubMed

Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-08-01

The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

Highly conserved proximal promoter element harbouring paired Sox9-binding sites contributes to the tissue- and developmental stage-specific activity of the matrilin-1 gene.

PubMed

Rentsendorj, Otgonchimeg; Nagy, Andrea; Sinkó, Ildikó; Daraba, Andreea; Barta, Endre; Kiss, Ibolya

2005-08-01

The matrilin-1 gene has the unique feature that it is expressed in chondrocytes in a developmental stage-specific manner. Previously, we found that the chicken matrilin-1 long promoter with or without the intronic enhancer and the short promoter with the intronic enhancer restricted the transgene expression to the columnar proliferative chondroblasts and prehypertrophic chondrocytes of growth-plate cartilage in transgenic mice. To study whether the short promoter shared by these transgenes harbours cartilage-specific control elements, we generated transgenic mice expressing the LacZ reporter gene under the control of the matrilin-1 promoter between -338 and +67. Histological analysis of the founder embryos demonstrated relatively weak transgene activity in the developing chondrocranium, axial and appendicular skeleton with highest level of expression in the columnar proliferating chondroblasts and prehypertrophic chondrocytes. Computer analysis of the matrilin-1 genes of amniotes revealed a highly conserved Pe1 (proximal promoter element 1) and two less-conserved sequence blocks in the distal promoter region. The inverted Sox motifs of the Pe1 element interacted with chondrogenic transcription factors Sox9, L-Sox5 and Sox6 in vitro and another factor bound to the spacer region. Point mutations in the Sox motifs or in the spacer region interfered with or altered the formation of nucleoprotein complexes in vitro and significantly decreased the reporter gene activity in transient expression assays in chondrocytes. In vivo occupancy of the Sox motifs in genomic footprinting in the expressing cell type, but not in fibroblasts, also supported the involvement of Pe1 in the tissue-specific regulation of the gene. Our results indicate that interaction of Pe1 with distal DNA elements is required for the high level, cartilage- and developmental stage-specific transgene expression.

Promoter engineering of the Saccharomyces cerevisiae RIM15 gene for improvement of alcoholic fermentation rates under stress conditions.

PubMed

Watanabe, Daisuke; Kaneko, Akie; Sugimoto, Yukiko; Ohnuki, Shinsuke; Takagi, Hiroshi; Ohya, Yoshikazu

2017-02-01

A loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-like protein kinase, is one of the major causes of the high alcoholic fermentation rates in Saccharomyces cerevisiae sake strains closely related to Kyokai no. 7 (K7). However, impairment of Rim15p may not be beneficial under more severe fermentation conditions, such as in the late fermentation stage, as it negatively affects stress responses. To balance stress tolerance and fermentation performance, we inserted the promoter of a gluconeogenic gene, PCK1, into the 5'-untranslated region (5'-UTR) of the RIM15 gene in a laboratory strain to achieve repression of RIM15 gene expression in the glucose-rich early stage with its induction in the stressful late stage of alcoholic fermentation. The promoter-engineered strain exhibited a fermentation rate comparable to that of the RIM15-deleted strain with no decrease in cell viability. The engineered strain achieved better alcoholic fermentation performance than the RIM15-deleted strain under repetitive and high-glucose fermentation conditions. These data demonstrated the validity of promoter engineering of the RIM15 gene that governs inhibitory control of alcoholic fermentation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

PubMed

Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

2015-10-01

The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (p<2.2e-16) than HK gene promoters. The entropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

The ribosomal gene spacer region in archaebacteria

NASA Technical Reports Server (NTRS)

Achenbach-Richter, L.; Woese, C. R.

1988-01-01

Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

A gene-specific non-enhancer sequence is critical for expression from the promoter of the small heat shock protein gene αB-crystallin

PubMed Central

2014-01-01

Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182

Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santhanam, U.; Ray, A.; Sehgal, P.B.

1991-09-01

The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

Changes in the methylation status of DAT, SERT, and MeCP2 gene promoters in the blood cell in families exposed to alcohol during the periconceptional period.

PubMed

Lee, Bom-Yi; Park, So-Yeon; Ryu, Hyun-Mee; Shin, Chan-Young; Ko, Ki-Nam; Han, Jung-Yeol; Koren, Gideon; Cho, Youl-Hee

2015-02-01

Alcohol exposure has been shown to cause devastating effects on neurobehavioral development in numerous animal and human studies. The alteration of DNA methylation levels in gene-specific promoter regions has been investigated in some studies of human alcoholics. This study was aimed to investigate whether social alcohol consumption during periconceptional period is associated with epigenetic alteration and its generational transmission in the blood cells. We investigated patterns of alcohol intake in a prospective cohort of 355 pairs of pregnant women and their spouses who reported alcohol intake during the periconceptional period. A subpopulation of 164 families was established for the epigenetic study based on the availability of peripheral blood and cord blood DNA. The relative methylation changes of dopamine transporter (DAT), serotonin transporter (SERT), and methyl CpG binding protein 2 (MeCP2) gene promoters were analyzed using methylation-specific endonuclease digestion followed by quantitative real-time polymerase chain reaction. The relative methylation level of the DAT gene promoter was decreased in the group of mothers reporting above moderate drinking (p = 0.029) and binge drinking (p = 0.037) during pregnancy. The relative methylation level of the DAT promoter was decreased in the group of fathers reporting heavy binge drinking (p = 0.003). The relative methylation levels of the SERT gene promoter were decreased in the group of newborns of light drinking mothers before pregnancy (p = 0.012) and during pregnancy (p = 0.003). The methylation level in the MeCP2 promoter region of babies whose mothers reported above moderate drinking during pregnancy was increased (p = 0.02). In addition, methylation pattern in the DAT promoter region of babies whose fathers reported heavy binge drinking was decreased (p = 0.049). These findings suggest that periconceptional alcohol intake may cause epigenetic changes in specific locus of parental and

Opioid gene expression changes and post-translational histone modifications at promoter regions in the rat nucleus accumbens after acute and repeated 3,4-methylenedioxy-methamphetamine (MDMA) exposure.

PubMed

Caputi, Francesca Felicia; Palmisano, Martina; Carboni, Lucia; Candeletti, Sanzio; Romualdi, Patrizia

2016-12-01

The recreational drug of abuse 3,4-methylenedioxymethamphetamine (MDMA) has been shown to produce neurotoxic damage and long-lasting changes in several brain areas. In addition to the involvement of serotoninergic and dopaminergic systems, little information exists about the contribution of nociceptin/orphaninFQ (N/OFQ)-NOP and dynorphin (DYN)-KOP systems in neuronal adaptations evoked by MDMA. Here we investigated the behavioral and molecular effects induced by acute (8mg/kg) or repeated (8mg/kg twice daily for seven days) MDMA exposure. MDMA exposure affected body weight gain and induced hyperlocomotion; this latter effect progressively decreased after repeated administration. Gene expression analysis indicated a down-regulation of the N/OFQ system and an up-regulation of the DYN system in the nucleus accumbens (NAc), highlighting an opposite systems regulation in response to MDMA exposure. Since histone modifications have been strongly associated to the addiction-related maladaptive changes, we examined two permissive (acH3K9 and me3H3K4) and two repressive transcription marks (me3H3K27 and me2H3K9) at the pertinent opioid gene promoter regions. Chromatin immunoprecipitation assays revealed that acute MDMA increased me3H3K4 at the pN/OFQ, pDYN and NOP promoters. Following acute and repeated treatment a significant decrease of acH3K9 at the pN/OFQ promoter was observed, which correlated with gene expression results. Acute treatment caused an acH3K9 increase and a me2H3K9 decrease at the pDYN promoter which matched its mRNA up-regulation. Our data indicate that the activation of the DYNergic stress system together with the inactivation of the N/OFQergic anti-stress system contribute to the neuroadaptive actions of MDMA and offer novel epigenetic information associated with MDMA abuse. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genes for psychosis and creativity: a promoter polymorphism of the neuregulin 1 gene is related to creativity in people with high intellectual achievement.

PubMed

Kéri, Szabolcs

2009-09-01

Why are genetic polymorphisms related to severe mental disorders retained in the gene pool of a population? A possible answer is that these genetic variations may have a positive impact on psychological functions. Here, I show that a biologically relevant polymorphism of the promoter region of the neuregulin 1 gene (SNP8NRG243177/rs6994992) is associated with creativity in people with high intellectual and academic performance. Intriguingly, the highest creative achievements and creative-thinking scores were found in people who carried the T/T genotype, which was previously shown to be related to psychosis risk and altered prefrontal activation.

Winter flounder antifreeze protein genes: demonstration of a cold-inducible promoter and gene transfer to other species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, R.C.; Gourlie, B.; Price, J.

1987-05-01

During the late fall and winter, the winter flounder produces a family of unique antifreeze proteins (AFP) to prevent the lethal formation of ice crystals in its blood. They have been able to induce winter flounder AFP mRNA synthesis in vivo by lowering the ambient temperature of the fish from 18/sup 0/C in the summer months when AFP synthesis is at a minimum to 4/sup 0/C. Furthermore, they have demonstrated and thoroughly investigated this cold induction of AFP mRNA synthesis in vitro in isolated liver tissue and in nuclear preparations isolated from liver tissue. A drug selection vector (pRSV/sub gpt/)more » which uses RSV promoter for the expression of xanthine-guanine phosphoribosyltransferase (gpt) gene and contains an AFP gene and 1.7 kb of its 5' upstream control region has been constructed for studies of gene transfer into cells of other fish species. These studies were made using a variety of gene transfer techniques into tissue culture cell lines derived from rainbow trout, bluegill, and salmon. Drug resistant colonies from all three species have been obtained and the presence of AFP DNA has been positively identified by Southern analysis. In addition, Northern blot analysis has shown that both gpt gene and AFP gene are active in these cells since mRNA/sub gpt/ and mRNA/sub AFP/ can be detected by probing with the respective gene sequences.« less

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Duodenal ulcer promoting gene of Helicobacter pylori.

PubMed

Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

2005-04-01

Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

Polymorphisms in the promoter region of the bovine lactoferrin gene influence milk somatic cell score and milk production traits in Chinese Holstein cows.

PubMed

Mao, Yongjiang; Zhu, Xiaorui; Xing, Shiyu; Zhang, Meirong; Zhang, Huimin; Wang, Xiaolong; Karrow, Niel; Yang, Liguo; Yang, Zhangping

2015-12-01

Lactoferrin is an iron-binding protein found in cow's milk that plays an important role in preventing mastitis caused by intramammary infection. In this study, 20 Chinese Holstein cows were selected randomly for PCR amplification and sequencing of the bovine lactoferrin gene promoter region and used for SNP discovery in the region between nucleotide positions -461 to -132. Three SNPs (-270T>C, -190G>A and -156A>G) were identified in bovine lactoferrin, then Chinese Holstein cows (n=866) were genotyped using Sequenom MassARRAY (Sequenom Inc., San Diego, CA) based on the previous SNP information in this study, and the associations between SNPs or haplotype and milk somatic cell score (SCS) and production traits were analyzed by the least squares method in the GLM procedure of SAS. SNPs -270T>C and -156A>G showed close linkage disequilibrium (r(2)=0.76). The SNP -190G>A showed a significant association with SCS, and individuals with genotype GG had higher SCS than genotypes AG and AA. Associations were found between the SNPs -270T>C and -190G>A with SCS and the milk composition. The software MatInspector revealed that these SNPs were located within several potential transcription factor binding sites, including NF-κB p50, KLF7 and SP1, and may alter gene expression, but further investigation will be required to elucidate the biological and practical relevance of these SNPs. Copyright © 2015 Elsevier Ltd. All rights reserved.

The application of powerful promoters to enhance gene expression in industrial microorganisms.

PubMed

Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

2017-02-01

Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

PubMed

Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

2015-01-01

Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

Transcriptional Factor DLX3 Promotes the Gene Expression of Enamel Matrix Proteins during Amelogenesis

PubMed Central

Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

2015-01-01

Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease. PMID:25815730

PPARγ and NF-κB regulate the gene promoter activity of their shared repressor, TNIP1

PubMed Central

Gurevich, Igor; Zhang, Carmen; Encarnacao, Priscilla C.; Struzynski, Charles P.; Livings, Sarah E.; Aneskievich, Brian J.

2011-01-01

Human TNFAIP3 interacting protein 1 (TNIP1) has diverse functions including support of HIV replication through its interaction with viral Nef and matrix proteins, reduction of TNFα-induced signaling through its interaction with NF-κB pathway proteins, and corepression of agonist-bound retinoic acid receptors and peroxisome proliferator-activated receptors (PPAR). The wide tissue distribution of TNIP1 provides the opportunity to influence numerous cellular responses in these roles and defining control of TNIP1 expression would be central to improved understanding of its impact on cell function. We cloned 6kb of the human TNIP1 promoter and performed predictive and functional analyses to identify regulatory elements. The promoter region proximal to the transcription start site is GC-rich without a recognizable TATA box. In contrast to this proximal ~500bp region, 6kb of the promoter increased reporter construct constitutive activity over five-fold. Throughout the 6kb length, in silico analysis identified several potential binding sites for both constitutive and inducible transcription factors; among the latter were candidate NF-κB binding sequences and peroxisome proliferator response elements (PPREs). We tested NF-κB and PPAR regulation of the endogenous TNIP1 gene and cloned promoter by expression studies, electrophoretic mobility shift assays, and chromatin immunoprecipitations. We validated NF-κB sites in the TNIP1 promoter proximal and distal regions as well as one PPRE in the distal region. The ultimate control of the TNIP1 promoter is likely to be a combination of constitutive transcription factors and those subject to activation such as NF-κB and PPAR. PMID:22001530

A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli.

PubMed

Li, Mingji; Wang, Junshu; Geng, Yanping; Li, Yikui; Wang, Qian; Liang, Quanfeng; Qi, Qingsheng

2012-02-06

For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs) in tandem. Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB) production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

Intragenic Locus in Human PIWIL2 Gene Shares Promoter and Enhancer Functions.

PubMed

Skvortsova, Yulia V; Kondratieva, Sofia A; Zinovyeva, Marina V; Nikolaev, Lev G; Azhikina, Tatyana L; Gainetdinov, Ildar V

2016-01-01

Recently, more evidence supporting common nature of promoters and enhancers has been accumulated. In this work, we present data on chromatin modifications and non-polyadenylated transcription characteristic for enhancers as well as results of in vitro luciferase reporter assays suggesting that PIWIL2 alternative promoter in exon 7 also functions as an enhancer for gene PHYHIP located 60Kb upstream. This finding of an intragenic enhancer serving as a promoter for a shorter protein isoform implies broader impact on understanding enhancer-promoter networks in regulation of gene expression.

TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

PubMed

Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

2004-06-23

Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

The rcsA Promoter of Pantoea stewartii subsp. stewartii Features a Low-Level Constitutive Promoter and an EsaR Quorum-Sensing-Regulated Promoter

PubMed Central

Carlier, Aurelien L.; von Bodman, S. B.

2006-01-01

The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966

A study on the influence of different promoter and 5'UTR (URM) cassettes from Arabidopsis thaliana on the expression level of the reporter gene β glucuronidase in tobacco and cotton.

PubMed

Agarwal, Parul; Garg, Varsha; Gautam, Taru; Pillai, Beena; Kanoria, Shaveta; Burma, Pradeep Kumar

2014-04-01

Several reports of promoters from plants, viral and artificial origin that confer high constitutive expression are known. Among these the CaMV 35S promoter is used extensively for transgene expression in plants. We identified candidate promoters from Arabidopsis based on their transcript levels (meta-analysis of available microarray control datasets) to test their activity in comparison to the CaMV 35S promoter. A set of 11 candidate genes were identified which showed high transcript levels in the aerial tissue (i.e. leaf, shoot, flower and stem). In the initial part of the study binary vectors were developed wherein the promoter and 5'UTR region of these candidate genes (Upstream Regulatory Module, URM) were cloned upstream to the reporter gene β glucuronidase (gus). The promoter strengths were tested in transformed callus of Nicotiana tabacum and Gossypium hirsutum. On the basis of the results obtained from the callus, the influence of the URM cassettes on transgene expression was tested in transgenic tobacco. The URM regions of the genes encoding a subunit of photosystem I (PHOTO) and geranyl geranyl reductase (GGR) in A. thaliana genome showed significantly high levels of GUS activity in comparison to the CaMV 35S promoter. Further, when the 5'UTRs of both the genes were placed downstream to the CaMV 35S promoter it led to a substantial increase in GUS activity in transgenic tobacco lines and cotton callus. The enhancement observed was even higher to that observed with the viral leader sequences like Ω and AMV, known translational enhancers. Our results indicate that the two URM cassettes or the 5'UTR regions of PHOTO and GGR when placed downstream to the CaMV 35S promoter can be used to drive high levels of transgene expression in dicotyledons.

The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.

PubMed

Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene

2015-10-15

Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The mRNA cap-binding protein Cbc1 is required for high and timely expression of genes by promoting the accumulation of gene-specific activators at promoters.

PubMed

Li, Tianlu; De Clercq, Nikki; Medina, Daniel A; Garre, Elena; Sunnerhagen, Per; Pérez-Ortín, José E; Alepuz, Paula

2016-02-01

The highly conserved Saccharomyces cerevisiae cap-binding protein Cbc1/Sto1 binds mRNA co-transcriptionally and acts as a key coordinator of mRNA fate. Recently, Cbc1 has also been implicated in transcription elongation and pre-initiation complex (PIC) formation. Previously, we described Cbc1 to be required for cell growth under osmotic stress and to mediate osmostress-induced translation reprogramming. Here, we observe delayed global transcription kinetics in cbc1Δ during osmotic stress that correlates with delayed recruitment of TBP and RNA polymerase II to osmo-induced promoters. Interestingly, we detect an interaction between Cbc1 and the MAPK Hog1, which controls most gene expression changes during osmostress, and observe that deletion of CBC1 delays the accumulation of the activator complex Hot1-Hog1 at osmostress promoters. Additionally, CBC1 deletion specifically reduces transcription rates of highly transcribed genes under non-stress conditions, such as ribosomal protein (RP) genes, while having low impact on transcription of weakly expressed genes. For RP genes, we show that recruitment of the specific activator Rap1, and subsequently TBP, to promoters is Cbc1-dependent. Altogether, our results indicate that binding of Cbc1 to the capped mRNAs is necessary for the accumulation of specific activators as well as PIC components at the promoters of genes whose expression requires high and rapid transcription. Copyright © 2016 Elsevier B.V. All rights reserved.

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

PubMed Central

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

PubMed

Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

1992-03-01

The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.

The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

PubMed Central

Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

1992-01-01

The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

Promoting gene expression in plants by permissive histone lysine methylation

PubMed Central

Millar, Tony; Finnegan, E Jean

2009-01-01

Plants utilize sophisticated epigenetic regulatory mechanisms to coordinate changes in gene expression during development and in response to environmental stimuli. Epigenetics refers to the modification of DNA and chromatin associated proteins, which affect gene expression and cell function, without changing the DNA sequence. Such modifications are inherited through mitosis, and in rare instances through meiosis, although it can be reversible and thus regulatory. Epigenetic modifications are controlled by groups of proteins, such as the family of histone lysine methytransferases (HKMTs). The catalytic core known as the SET domain encodes HKMT activity and either promotes or represses gene expression. A large family of SET domain proteins is present in Arabidopsis where there is growing evidence that two classes of these genes are involved in promoting gene expression in a diverse range of developmental processes. This review will focus on the function of these two classes and the processes that they control, highlighting the huge potential this regulatory mechanism has in plants. PMID:19816124

Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

PubMed

Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

2012-10-01

Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

Large-Scale Chromatin Immunoprecipitation with Promoter Sequence Microarray Analysis of the Interaction of the NSs Protein of Rift Valley Fever Virus with Regulatory DNA Regions of the Host Genome

PubMed Central

Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard

2012-01-01

Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level. PMID:22896612

Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

PubMed

Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

2003-07-01

We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.

PubMed

Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang

2016-06-01

Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. © 2016 Institute of Zoology, Chinese Academy of Sciences.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

PubMed

Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling

2016-01-01

Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.

Duodenal Ulcer Promoting Gene of Helicobacter pylori

PubMed Central

LU, HONG; HSU, PING–I; GRAHAM, DAVID Y.; YAMAOKA, YOSHIO

2011-01-01

Background & Aims Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. Methods We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. Results We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7–5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2–0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA-deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. Conclusions dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries. PMID:15825067

An analysis of the positional distribution of DNA motifs in promoter regions and its biological relevance.

PubMed

Casimiro, Ana C; Vinga, Susana; Freitas, Ana T; Oliveira, Arlindo L

2008-02-07

Motif finding algorithms have developed in their ability to use computationally efficient methods to detect patterns in biological sequences. However the posterior classification of the output still suffers from some limitations, which makes it difficult to assess the biological significance of the motifs found. Previous work has highlighted the existence of positional bias of motifs in the DNA sequences, which might indicate not only that the pattern is important, but also provide hints of the positions where these patterns occur preferentially. We propose to integrate position uniformity tests and over-representation tests to improve the accuracy of the classification of motifs. Using artificial data, we have compared three different statistical tests (Chi-Square, Kolmogorov-Smirnov and a Chi-Square bootstrap) to assess whether a given motif occurs uniformly in the promoter region of a gene. Using the test that performed better in this dataset, we proceeded to study the positional distribution of several well known cis-regulatory elements, in the promoter sequences of different organisms (S. cerevisiae, H. sapiens, D. melanogaster, E. coli and several Dicotyledons plants). The results show that position conservation is relevant for the transcriptional machinery. We conclude that many biologically relevant motifs appear heterogeneously distributed in the promoter region of genes, and therefore, that non-uniformity is a good indicator of biological relevance and can be used to complement over-representation tests commonly used. In this article we present the results obtained for the S. cerevisiae data sets.

Role of promoter element in c-mpl gene expression induced by TPO.

PubMed

Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

2013-01-01

Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

NASA Technical Reports Server (NTRS)

Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

2003-01-01

Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

A Genetic Approach to Promoter Recognition during Trans Induction of Viral Gene Expression

NASA Astrophysics Data System (ADS)

Coen, Donald M.; Weinheimer, Steven P.; McKnight, Steven L.

1986-10-01

Viral infection of mammalian cells entails the regulated induction of viral gene expression. The induction of many viral genes, including the herpes simplex virus gene encoding thymidine kinase (tk), depends on viral regulatory proteins that act in trans. Because recognition of the tk promoter by cellular transcription factors is well understood, its trans induction by viral regulatory proteins may serve as a useful model for the regulation of eukaryotic gene expression. A comprehensive set of mutations was therefore introduced into the chromosome of herpes simplex virus at the tk promoter to directly analyze the effects of promoter mutations on tk transcription. The promoter domains required for efficient tk expression under conditions of trans induction corresponded to those important for recognition by cellular transcription factors. Thus, trans induction of tk expression may be catalyzed initially by the interaction of viral regulatory proteins with cellular transcription factors.

The low-recombining pericentromeric region of barley restricts gene diversity and evolution but not gene expression

PubMed Central

Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J

2014-01-01

The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331

A core functional region of the RFP1 promoter from Chinese wild grapevine is activated by powdery mildew pathogen and heat stress.

PubMed

Yu, Yihe; Xu, Weirong; Wang, Jie; Wang, Lei; Yao, Wenkong; Xu, Yan; Ding, Jiahua; Wang, Yuejin

2013-01-01

RING-finger proteins (RFP) function as ubiquitin ligases and play key roles in plant responses to biotic and abiotic stresses. However, little information is available on the regulation of RFP expression. Here, we isolate and characterize the RFP promoter sequence from the disease-resistant Chinese wild grape Vitis pseudoreticulata accession Baihe-35-1. Promoter-GUS fusion assays revealed that defense signaling molecules, powdery mildew infection, and heat stress induce VpRFP1 promoter activity. By contrast, the RFP1 promoter isolated from Vitis vinifera was only slightly induced by pathogen infection and heat treatment. By promoter deletion analysis, we found that the -148 bp region of the VpRFP1 promoter was the core functional promoter region. We also found that, in Arabidopsis, VpRFP1 expressed under its own promoter activated defense-related gene expression and improved disease resistance, but the same construct using the VvRFP1 promoter slightly improve disease resistance. Our results demonstrated that the -148 bp region of the VpRFP1 promoter plays a key role in response to pathogen and heat stress, and suggested that expression differences between VpRFP1 and VvRFP1 may be key for the differing disease resistance phenotypes of the two Vitis genotypes.

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko

Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicidemore » gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF

Pertussis toxin export genes are regulated by the ptx promoter and may be required for efficient translation of ptx mRNA in Bordetella pertussis.

PubMed Central

Baker, S M; Masi, A; Liu, D F; Novitsky, B K; Deich, R A

1995-01-01

The gene products from an 8-kb region adjacent to the 3' end of the ptx operon are required by Bordetella pertussis for the export of pertussis holotoxin. At least one of these gene products (PtlC) is specifically required for the export of assembled holotoxin from the periplasmic space. ptlC mutants exhibit a 20-fold reduction in the amount of holotoxin present in the culture supernatant but have no effect upon the assembly or steady-state level of holotoxin present in the periplasmic space. Impaired export of holotoxin from the ptlC strain blocks expression of toxin at a posttranscriptional level, and wild-type levels of ptx mRNA are detected in the mutant strain. The transcription of ptl is subject to modulation by MgSO4 in the same manner as ptx is; however, in B. pertussis strains containing an E. coli tac promoter in place of the native ptx promoter, wild-type levels of ptx mRNA are present and holotoxin is synthesized and exported even in the presence of MgSO4. Promoter mapping of the region extending from the ptxS3 coding region to the ptlC coding region failed to detect the ptl transcription initiation site. Additional RNase protection experiments with ptx promoter deletion and substitution strains indicate that the ptl operon is transcribed from the ptx promoter as part of a > 11-kb mRNA. PMID:7558300

Sequences 5' to translation start regulate expression of petunia rbcS genes.

PubMed Central

Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P

1989-01-01

The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

A synthetic promoter library for constitutive gene expression in Lactobacillus plantarum.

PubMed

Rud, Ida; Jensen, Peter Ruhdal; Naterstad, Kristine; Axelsson, Lars

2006-04-01

A synthetic promoter library (SPL) for Lactobacillus plantarum has been developed, which generalizes the approach for obtaining synthetic promoters. The consensus sequence, derived from rRNA promoters extracted from the L. plantarum WCFS1 genome, was kept constant, and the non-consensus sequences were randomized. Construction of the SPL was performed in a vector (pSIP409) previously developed for high-level, inducible gene expression in L. plantarum and Lactobacillus sakei. A wide range of promoter strengths was obtained with the approach, covering 3-4 logs of expression levels in small increments of activity. The SPL was evaluated for the ability to drive beta-glucuronidase (GusA) and aminopeptidase N (PepN) expression. Protein production from the synthetic promoters was constitutive, and the most potent promoters gave high protein production with levels comparable to those of native rRNA promoters, and production of PepN protein corresponding to approximately 10-15 % of the total cellular protein. High correlation was obtained between the activities of promoters when tested in L. sakei and L. plantarum, which indicates the potential of the SPL for other Lactobacillus species. The SPL enables fine-tuning of stable gene expression for various applications in L. plantarum.

Evolutionary change in the structure of the regulatory region that drives tissue and temporally regulated expression of alcohol dehydrogenase gene in Drosophila funebris.

PubMed

Amador, A; Papaceit, M; Juan, E

2001-06-01

The Adh locus of Drosophilidae is organized as a single gene transcribed from two spatially and temporally regulated promoters except in species of the repleta group, which have two single promoter genes. Here we show that in Drosophila funebris the Adh gene is transcribed from a single promoter, in both larva and adult, with qualitative and quantitative species specific-differences in tissue distribution. The gene is expressed in larval fat body but in other tissues such as gastric caeca, midgut and Malpighian tubules its expression is reduced compared to most Drosophilidae species, and in adults it is almost limited to the fat body. The comparative analysis of gene expression of two strains, which differ by a duplication, indicates that the cis elements necessary for this pattern of expression in larvae are included in the region of 1.55 kb upstream of the transcription initiation site. This new organization reveals the evolution of a different regulatory strategy to express the Adh gene in the subgenus Drosophila.

Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

PubMed

Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

2007-08-01

Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

Polymorphism in promoter of SIX4 gene shows association with its transcription and body measurement traits in Qinchuan cattle.

PubMed

Wei, Dawei; Raza, Sayed Haidar Abbas; Zhang, Jiupan; Gui, Linsheng; Rahman, Siddiq Ur; Khan, Rajwali; Hosseini, Seyed Mahdi; Kaleri, Hubdar Ali; Zan, Linsen

2018-05-20

The sine oculis homeobox homolog 4 (SIX4) gene belongs to the SIX gene family, which plays a critical role in muscle regeneration and early stages of ontogeny. This study aimed to detect promoter variations of bovine SIX4 genes in Qinchuan cattle, and to evaluate the effect of transcription regulations and body measurement traits. Quantitative real-time PCR (qPCR) results showed that the mRNA expression levels of SIX4 gene were found significantly highest in longissimus thoracis tissue and individual before attaining the stage of physiological maturity. Using sequencing technology on a total of 428 Qinchuan cattle, seven single nucleotide polymorphisms (SNPs) were identified in the promoter region of SIX4, and seven haplotypes representing 18 potential transcription factor compositions of polymorphic potential cis-acting elements. Association analysis indicated that the H 3 -H 3 diplotype performed greater withers height, chest depth, chest circumference, back fat thickness and ultrasound loin muscle area (P < 0.05) than H 5 -H 6 , which were consistent with the promoter activity of Hap3 haplotype was higher than the Hap5 and Hap6 haplotype in vitro. These potential transcription factor information and combined genotypes H 3 -H 3 of the SIX4 gene can be used as a molecular marker for selection of economic traits in Qinchuan cattle. Copyright © 2018 Elsevier B.V. All rights reserved.

Organization, chromosomal localization and promoter analysis of the gene encoding human acidic fibroblast growth factor intracellular binding protein.

PubMed Central

Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S

2000-01-01

Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667

Genome-wide characterization of mammalian promoters with distal enhancer functions.

PubMed

Dao, Lan T M; Galindo-Albarrán, Ariel O; Castro-Mondragon, Jaime A; Andrieu-Soler, Charlotte; Medina-Rivera, Alejandra; Souaid, Charbel; Charbonnier, Guillaume; Griffon, Aurélien; Vanhille, Laurent; Stephen, Tharshana; Alomairi, Jaafar; Martin, David; Torres, Magali; Fernandez, Nicolas; Soler, Eric; van Helden, Jacques; Puthier, Denis; Spicuglia, Salvatore

2017-07-01

Gene expression in mammals is precisely regulated by the combination of promoters and gene-distal regulatory regions, known as enhancers. Several studies have suggested that some promoters might have enhancer functions. However, the extent of this type of promoters and whether they actually function to regulate the expression of distal genes have remained elusive. Here, by exploiting a high-throughput enhancer reporter assay, we unravel a set of mammalian promoters displaying enhancer activity. These promoters have distinct genomic and epigenomic features and frequently interact with other gene promoters. Extensive CRISPR-Cas9 genomic manipulation demonstrated the involvement of these promoters in the cis regulation of expression of distal genes in their natural loci. Our results have important implications for the understanding of complex gene regulation in normal development and disease.

Interaction between the APOC3 gene promoter polymorphisms, saturated fat intake and plasma lipoproteins.

PubMed

Brown, Sherine; Ordovás, José M; Campos, Hannia

2003-10-01

To test the hypothesis that APOC3 gene polymorphisms modulate the effect of saturated fat (SAT) intake on plasma lipoproteins and LDL size. We studied 336 randomly selected residents from Costa Rica. APOC3 polymorphisms were genotyped in the promoter region (T-455C, T-625del) and the C3238G 3' untranslated region (UTR). Dietary intake was assessed by a validated food-frequency questionnaire (FFQ) and median saturated fat intake (11%) was used to define low and high exposure to saturated fat. Allele frequencies were 0.49, 0.51 and 0.19 for the APOC3-455C, -625de1, and APOC3 3238G alleles, respectively. Significant gene-diet interactions were found for total (P<0.0004) and LDL cholesterol (P<0.01). In homozygotes for the APOC3-455T-625T alleles, saturated fat intake was associated with a 13% increase in total cholesterol (P<0.001) and a 20% increase in LDL cholesterol (P<0.001). In contrast, no association between plasma lipoproteins and saturated fat intake was found among carriers of the APOC3-455C-625del allele. The APOC3 3238G UTR allele did not modify the observed association. Compared to a diet high in saturated fat, a habitually low saturated fat diet is associated with a beneficial lipoprotein profile only among homozygotes of the APOC3 promoter 455T-625T polymorphism.

Promoter-Terminator Gene Loops Affect Alternative 3'-End Processing in Yeast.

PubMed

Lamas-Maceiras, Mónica; Singh, Badri Nath; Hampsey, Michael; Freire-Picos, María A

2016-04-22

Many eukaryotic genes undergo alternative 3'-end poly(A)-site selection producing transcript isoforms with 3'-UTRs of different lengths and post-transcriptional fates. Gene loops are dynamic structures that juxtapose the 3'-ends of genes with their promoters. Several functions have been attributed to looping, including memory of recent transcriptional activity and polarity of transcription initiation. In this study, we investigated the relationship between gene loops and alternative poly(A)-site. Using the KlCYC1 gene of the yeast Kluyveromyces lactis, which includes a single promoter and two poly(A) sites separated by 394 nucleotides, we demonstrate in two yeast species the formation of alternative gene loops (L1 and L2) that juxtapose the KlCYC1 promoter with either proximal or distal 3'-end processing sites, resulting in the synthesis of short and long forms of KlCYC1 mRNA. Furthermore, synthesis of short and long mRNAs and formation of the L1 and L2 loops are growth phase-dependent. Chromatin immunoprecipitation experiments revealed that the Ssu72 RNA polymerase II carboxyl-terminal domain phosphatase, a critical determinant of looping, peaks in early log phase at the proximal poly(A) site, but as growth phase advances, it extends to the distal site. These results define a cause-and-effect relationship between gene loops and alternative poly(A) site selection that responds to different physiological signals manifested by RNA polymerase II carboxyl-terminal domain phosphorylation status. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Engineered promoters enable constant gene expression at any copy number in bacteria.

PubMed

Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

2018-04-01

The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

PubMed

Peng, Liu; Wei, He; Liren, Li

2014-01-01

To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

VraR Binding to the Promoter Region of agr Inhibits Its Function in Vancomycin-Intermediate Staphylococcus aureus (VISA) and Heterogeneous VISA.

PubMed

Dai, Yuanyuan; Chang, Wenjiao; Zhao, Changcheng; Peng, Jing; Xu, Liangfei; Lu, Huaiwei; Zhou, Shusheng; Ma, Xiaoling

2017-05-01

Acquisition of vancomycin resistance in Staphylococcus aureus is often accompanied by a reduction in virulence, but the mechanisms underlying this change remain unclear. The present study was undertaken to investigate this process in a clinical heterogeneous vancomycin-intermediate S. aureus (hVISA) strain, 10827; an hVISA reference strain, Mu3; and a VISA reference strain, Mu50, along with their respective series of vancomycin-induced resistant strains. In these strains, increasing MICs of vancomycin were associated with increased expression of the vancomycin resistance-associated regulator gene ( vraR ) and decreased expression of virulence genes ( hla , hlb , and coa ) and virulence-regulated genes (RNAIII, agrA , and saeR ). These results suggested that VraR might have a direct or indirect effect on virulence in S. aureus In electrophoretic mobility shift assays, VraR did not bind to promoter sequences of hla , hlb , and coa genes, but it did bind to the agr promoter region. In DNase I footprinting assays, VraR protected a 15-nucleotide (nt) sequence in the intergenic region between the agr P2 and P3 promoters. These results indicated that when S. aureus is subject to induction by vancomycin, expression of vraR is upregulated, and VraR binding inhibits the function of the Agr quorum-sensing system, causing reductions in the virulence of VISA/hVISA strains. Our results suggested that VraR in S. aureus is involved not only in the regulation of vancomycin resistance but also in the regulation of virulence. Copyright © 2017 American Society for Microbiology.

Transcription mapping and expression patterns of genes in the major immediate-early region of Kaposi's sarcoma-associated herpesvirus.

PubMed

Saveliev, Alexei; Zhu, Fan; Yuan, Yan

2002-08-01

Viral immediate-early (IE) genes are the first class of viral genes expressed during primary infection or reactivation from latency. They usually encode regulatory proteins that play crucial roles in viral life cycle. In a previous study, four regions in the KSHV genome were found to be actively transcribed in the immediate-early stage of viral reactivation in primary effusion lymphoma cells. Three immediate-early transcripts were characterized in these regions, as follows: mRNAs for ORF50 (KIE-1), ORF-45 (KIE-2), and ORF K4.2 (KIE-3) (F. X. Zhu, T. Cusano, and Y. Yuan, 1999, J. Virol. 73, 5556-5567). In the present study, we further analyzed the expression of genes in these IE regions in BC-1 and BCBL-1 cells. One of the immediate-early regions (KIE-1) that encompasses ORF50 and other genes was intensively studied to establish a detailed transcription map and expression patterns of genes in this region. This study led to identification of several novel IE transcripts in this region. They include a 2.6-kb mRNA which encodes ORF48/ORF29b, a family of transcripts that are complementary to ORF50 mRNA and a novel K8 IE mRNA of 1.5 kb. Together with the IE mRNA for ORF50 which was identified previously, four immediate-early genes have been mapped to KIE-1 region. Therefore, we would designate KIE-1 the major immediate-early region of KSHV. In addition, we showed that transcription of K8 gene is controlled by two promoters, yielding two transcripts, an immediate-early mRNA of 1.5 kb and a delayed-early mRNA of 1.3 kb.

Promoter architecture dictates cell-to-cell variability in gene expression.

PubMed

Jones, Daniel L; Brewster, Robert C; Phillips, Rob

2014-12-19

Variability in gene expression among genetically identical cells has emerged as a central preoccupation in the study of gene regulation; however, a divide exists between the predictions of molecular models of prokaryotic transcriptional regulation and genome-wide experimental studies suggesting that this variability is indifferent to the underlying regulatory architecture. We constructed a set of promoters in Escherichia coli in which promoter strength, transcription factor binding strength, and transcription factor copy numbers are systematically varied, and used messenger RNA (mRNA) fluorescence in situ hybridization to observe how these changes affected variability in gene expression. Our parameter-free models predicted the observed variability; hence, the molecular details of transcription dictate variability in mRNA expression, and transcriptional noise is specifically tunable and thus represents an evolutionarily accessible phenotypic parameter. Copyright © 2014, American Association for the Advancement of Science.

Genome-wide analysis of promoter architecture in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.

2010-10-20

Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysismore » indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.« less

Estrogens and Progesterone Promote Persistent CCND1 Gene Activation during G1 by Inducing Transcriptional Derepression via c-Jun/c-Fos/Estrogen Receptor (Progesterone Receptor) Complex Assembly to a Distal Regulatory Element and Recruitment of Cyclin D1 to Its Own Gene Promoter

PubMed Central

Cicatiello, Luigi; Addeo, Raffaele; Sasso, Annarita; Altucci, Lucia; Petrizzi, Valeria Belsito; Borgo, Raphaelle; Cancemi, Massimo; Caporali, Simona; Caristi, Silvana; Scafoglio, Claudio; Teti, Diana; Bresciani, Francesco; Perillo, Bruno; Weisz, Alessandro

2004-01-01

Transcriptional activation of the cyclin D1 gene (CCND1) plays a pivotal role in G1-phase progression, which is thereby controlled by multiple regulatory factors, including nuclear receptors (NRs). Appropriate CCND1 gene activity is essential for normal development and physiology of the mammary gland, where it is regulated by ovarian steroids through a mechanism(s) that is not fully elucidated. We report here that CCND1 promoter activation by estrogens in human breast cancer cells is mediated by recruitment of a c-Jun/c-Fos/estrogen receptor α complex to the tetradecanoyl phorbol acetate-responsive element of the gene, together with Oct-1 to a site immediately adjacent. This process coincides with the release from the same DNA region of a transcriptional repressor complex including Yin-Yang 1 (YY1) and histone deacetylase 1 and is sufficient to induce the assembly of the basal transcription machinery on the promoter and to lead to initial cyclin D1 accumulation in the cell. Later on in estrogen stimulation, the cyclin D1/Cdk4 holoenzyme associates with the CCND1 promoter, where E2F and pRb can also be found, contributing to the long-lasting gene enhancement required to drive G1-phase completion. Interestingly, progesterone triggers similar regulatory events through its own NRs, suggesting that the gene regulation cascade described here represents a crossroad for the transcriptional control of G1-phase progression by different classes of NRs. PMID:15282324

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

PubMed Central

Coffee, Erin M.; Tolan, Dean R.

2010-01-01

SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

[Prediction of Promoter Motifs in Virophages].

PubMed

Gong, Chaowen; Zhou, Xuewen; Pan, Yingjie; Wang, Yongjie

2015-07-01

Virophages have crucial roles in ecosystems and are the transport vectors of genetic materials. To shed light on regulation and control mechanisms in virophage--host systems as well as evolution between virophages and their hosts, the promoter motifs of virophages were predicted on the upstream regions of start codons using an analytical tool for prediction of promoter motifs: Multiple EM for Motif Elicitation. Seventeen potential promoter motifs were identified based on the E-value, location, number and length of promoters in genomes. Sputnik and zamilon motif 2 with AT-rich regions were distributed widely on genomes, suggesting that these motifs may be associated with regulation of the expression of various genes. Motifs containing the TCTA box were predicted to be late promoter motif in mavirus; motifs containing the ATCT box were the potential late promoter motif in the Ace Lake mavirus . AT-rich regions were identified on motif 2 in the Organic Lake virophage, motif 3 in Yellowstone Lake virophage (YSLV)1 and 2, motif 1 in YSLV3, and motif 1 and 2 in YSLV4, respectively. AT-rich regions were distributed widely on the genomes of virophages. All of these motifs may be promoter motifs of virophages. Our results provide insights into further exploration of temporal expression of genes in virophages as well as associations between virophages and giant viruses.

The TP53 gene promoter is not methylated in families suggestive of Li-Fraumeni syndrome with no germline TP53 mutations.

PubMed

Finkova, Alena; Vazna, Alzbeta; Hrachovina, Ondrej; Bendova, Sarka; Prochazkova, Kamila; Sedlacek, Zdenek

2009-08-01

Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 5' region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene.

Molecular cloning and characterization of the light-regulation and circadian-rhythm of the VDE gene promoter from Zingiber officinale.

PubMed

Zhao, Wenchao; Wang, Shaohui; Li, Xin; Huang, Hongyu; Sui, Xiaolei; Zhang, Zhenxian

2012-08-01

Ginger (Zingiber officinale Rosc.) is prone to photoinhibition under intense sunlight. Excessive light can be dissipated by the xanthophyll cycle, where violaxanthin de-epoxidase (VDE) plays a critical role in protecting the photosynthesis apparatus from the damage of excessive light. We isolated ~2.0 kb of ginger VDE (GVDE) gene promoter, which contained the circadian box, I-box, G-box and GT-1 motif. Histochemical staining of Arabidopsis indicated the GVDE promoter was active in almost all organs, especially green tissues. β-glucuronidase (GUS) activity driven by GVDE promoter was repressed rather than activated by high light. GUS activity was altered by hormones, growth regulators and abiotic stresses, which increased with 2,4-dichlorophenoxyacetic acid and decreased with abscisic acid, salicylic acid, zeatin, salt (sodium chloride) and polyethylene glycol. Interestingly, GUS activities with gibberellin or indole-3-acetic acid increased in the short-term (24 h) and decreased in the long-term (48 and 72 h). Analysis of 5' flank deletion found two crucial functional regions residing in -679 to -833 and -63 to -210. Northern blotting analysis found transcription to be regulated by the endogenous circadian clock. Finally, we found a region necessary for regulating the circadian rhythm and another for the basic promoter activity. Key message A novel promoter, named GVDE promoter, was first isolated and analyzed in this study. We have determined one region crucial for promoter activity and another responsible for keeping circadian rhythms.

Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

PubMed

Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

2018-02-01

R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector.

PubMed

Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo

2016-06-01

Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

PubMed

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

PubMed

Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

2001-12-01

Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

Genes in one megabase of the HLA class I region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, H.; Fan, Wu-Fang; Xu, Hongxia

1993-11-15

To define the gene content of the HLA class I region, cDNA selection was applied to three overlapping yeast artificial chromosomes (YACs) that spanned 1 megabase (Mb) of this region of the human major histocompatibility complex. These YACs extended from the region centromeric to HLA-E to the region telomeric to HLA-F. In additions to the recognized class I genes and pseudogenes and the anonymous non-class-I genes described recently by the authors and others, 20 additional anonymous cDNA clones were identified from this 1-Mb region. They also identified a long repetitive DNA element in the region between HLA-B and HLA-E. Homologuesmore » of this outside of the HLA complex. The portion of the HLA class I region represented by these YACs shows an average gene density as high as the class II and class III regions. Thus, the high gene density portion of the HLA complex is extended to more than 3 Mb.« less

Hybrid promoters directed tBid gene expression to breast cancer cells by transcriptional targeting.

PubMed

Farokhimanesh, Samila; Rahbarizadeh, Fatemeh; Rasaee, Mohammad J; Kamali, Abbas; Mashkani, Baratali

2010-01-01

Developing cancer gene therapy constructs based on transcriptional targeting of genes to cancer cells is a new and promising modality for treatment of cancer. Introducing truncated Bid (tBid), a recently known member of the Bcl-2 family, eradicates cancer cells efficiently. For transcriptional targeting of tBid, two dual-specificity promoters, combining cancer specific core promoters and response modules, were designed. These two core promoter modules contained cancer specific promoters of MUC1 and Survivin genes accompanied by hypoxia-responsive elements and estrogen responsive elements (microenvironment condition of breast cancer cells) which were employed to achieve a higher and more specific level of tBid expression in breast cancer cells. Correlation of the level of tBid expression in normal and cancer cell lines with promoter activity was measured by RT-PCR after treatment with hypoxia and estrogen. The level of tBid expression under control of new hybrid promoters was compared with its expression under control of cytomegalovirus (CMV) promoter as a control. Our data revealed that the level of tBid expression in breast cancer cells were nearly 11 times more than normal cells because of the cancer specific promoters, although tBid expression under control of CMV promoter was almost the same in normal and cancer cell lines. Increased apoptosis was detected in the transfected breast cancer cell lines by the Caspase-3 activity assay. The application of these promoters may prove to have the advantage of tumor selective gene therapy in breast cancer cells and low-potential toxicity for normal tissues.

Transcriptional Coupling of Neighboring Genes and Gene Expression Noise: Evidence that Gene Orientation and Noncoding Transcripts Are Modulators of Noise

PubMed Central

Wang, Guang-Zhong; Lercher, Martin J.; Hurst, Laurence D.

2011-01-01

Abstract How is noise in gene expression modulated? Do mechanisms of noise control impact genome organization? In yeast, the expression of one gene can affect that of a very close neighbor. As the effect is highly regionalized, we hypothesize that genes in different orientations will have differing degrees of coupled expression and, in turn, different noise levels. Divergently organized gene pairs, in particular those with bidirectional promoters, have close promoters, maximizing the likelihood that expression of one gene affects the neighbor. With more distant promoters, the same is less likely to hold for gene pairs in nondivergent orientation. Stochastic models suggest that coupled chromatin dynamics will typically result in low abundance-corrected noise (ACN). Transcription of noncoding RNA (ncRNA) from a bidirectional promoter, we thus hypothesize to be a noise-reduction, expression-priming, mechanism. The hypothesis correctly predicts that protein-coding genes with a bidirectional promoter, including those with a ncRNA partner, have lower ACN than other genes and divergent gene pairs uniquely have correlated ACN. Moreover, as predicted, ACN increases with the distance between promoters. The model also correctly predicts ncRNA transcripts to be often divergently transcribed from genes that a priori would be under selection for low noise (essential genes, protein complex genes) and that the latter genes should commonly reside in divergent orientation. Likewise, that genes with bidirectional promoters are rare subtelomerically, cluster together, and are enriched in essential gene clusters is expected and observed. We conclude that gene orientation and transcription of ncRNAs are candidate modulators of noise. PMID:21402863

Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

PubMed Central

Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

2015-01-01

In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

BLISTER Regulates Polycomb-Target Genes, Represses Stress-Regulated Genes and Promotes Stress Responses in Arabidopsis thaliana.