Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-01-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
NASA Astrophysics Data System (ADS)
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-04-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases
van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel
2004-01-01
Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288
Ethical Perspectives on RNA Interference Therapeutics
Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou
2008-01-01
RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of
HITS-CLIP yields genome-wide insights into brain alternative RNA processing
NASA Astrophysics Data System (ADS)
Licatalosi, Donny D.; Mele, Aldo; Fak, John J.; Ule, Jernej; Kayikci, Melis; Chi, Sung Wook; Clark, Tyson A.; Schweitzer, Anthony C.; Blume, John E.; Wang, Xuning; Darnell, Jennifer C.; Darnell, Robert B.
2008-11-01
Protein-RNA interactions have critical roles in all aspects of gene expression. However, applying biochemical methods to understand such interactions in living tissues has been challenging. Here we develop a genome-wide means of mapping protein-RNA binding sites in vivo, by high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP). HITS-CLIP analysis of the neuron-specific splicing factor Nova revealed extremely reproducible RNA-binding maps in multiple mouse brains. These maps provide genome-wide in vivo biochemical footprints confirming the previous prediction that the position of Nova binding determines the outcome of alternative splicing; moreover, they are sufficiently powerful to predict Nova action de novo. HITS-CLIP revealed a large number of Nova-RNA interactions in 3' untranslated regions, leading to the discovery that Nova regulates alternative polyadenylation in the brain. HITS-CLIP, therefore, provides a robust, unbiased means to identify functional protein-RNA interactions in vivo.
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
Genome-Wide Analysis of Long Noncoding RNA (lncRNA) Expression in Hepatoblastoma Tissues
Xue, Ping; Cui, Ximao; Li, Kai; Zheng, Shan; He, Xianghuo; Dong, Kuiran
2014-01-01
Long noncoding RNAs (lncRNAs) have crucial roles in cancer biology. We performed a genome-wide analysis of lncRNA expression in hepatoblastoma tissues to identify novel targets for further study of hepatoblastoma. Hepatoblastoma and normal liver tissue samples were obtained from hepatoblastoma patients. The genome-wide analysis of lncRNA expression in these tissues was performed using a 4×180 K lncRNA microarray and Sureprint G3 Human lncRNA Chips. Quantitative RT-PCR (qRT-PCR) was performed to confirm these results. The differential expressions of lncRNAs and mRNAs were identified through fold-change filtering. Gene Ontology (GO) and pathway analyses were performed using the standard enrichment computation method. Associations between lncRNAs and adjacent protein-coding genes were determined through complex transcriptional loci analysis. We found that 2736 lncRNAs were differentially expressed in hepatoblastoma tissues. Among these, 1757 lncRNAs were upregulated more than two-fold relative to normal tissues and 979 lncRNAs were downregulated. Moreover, in hepatoblastoma there were 420 matched lncRNA-mRNA pairs for 120 differentially expressed lncRNAs, and 167 differentially expressed mRNAs. The co-expression network analysis predicted 252 network nodes and 420 connections between 120 lncRNAs and 132 coding genes. Within this co-expression network, 369 pairs were positive, and 51 pairs were negative. Lastly, qRT-PCR data verified six upregulated and downregulated lncRNAs in hepatoblastoma, plus endothelial cell-specific molecule 1 (ESM1) mRNA. Our results demonstrated that expression of these aberrant lncRNAs could respond to hepatoblastoma development. Further study of these lncRNAs could provide useful insight into hepatoblastoma biology. PMID:24465615
Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
Jukam, David; Teran, Nicole A; Risca, Viviana I; Smith, Owen K; Johnson, Whitney L; Skotheim, Jan M; Greenleaf, William James
2018-01-01
RNA is a critical component of chromatin in eukaryotes, both as a product of transcription, and as an essential constituent of ribonucleoprotein complexes that regulate both local and global chromatin states. Here, we present a proximity ligation and sequencing method called Chromatin-Associated RNA sequencing (ChAR-seq) that maps all RNA-to-DNA contacts across the genome. Using Drosophila cells, we show that ChAR-seq provides unbiased, de novo identification of targets of chromatin-bound RNAs including nascent transcripts, chromosome-specific dosage compensation ncRNAs, and genome-wide trans-associated RNAs involved in co-transcriptional RNA processing. PMID:29648534
Structure-seq2: sensitive and accurate genome-wide profiling of RNA structure in vivo
Ritchey, Laura E.; Su, Zhao; Tang, Yin; Tack, David C.
2017-01-01
Abstract RNA serves many functions in biology such as splicing, temperature sensing, and innate immunity. These functions are often determined by the structure of RNA. There is thus a pressing need to understand RNA structure and how it changes during diverse biological processes both in vivo and genome-wide. Here, we present Structure-seq2, which provides nucleotide-resolution RNA structural information in vivo and genome-wide. This optimized version of our original Structure-seq method increases sensitivity by at least 4-fold and improves data quality by minimizing formation of a deleterious by-product, reducing ligation bias, and improving read coverage. We also present a variation of Structure-seq2 in which a biotinylated nucleotide is incorporated during reverse transcription, which greatly facilitates the protocol by eliminating two PAGE purification steps. We benchmark Structure-seq2 on both mRNA and rRNA structure in rice (Oryza sativa). We demonstrate that Structure-seq2 can lead to new biological insights. Our Structure-seq2 datasets uncover hidden breaks in chloroplast rRNA and identify a previously unreported N1-methyladenosine (m1A) in a nuclear-encoded Oryza sativa rRNA. Overall, Structure-seq2 is a rapid, sensitive, and unbiased method to probe RNA in vivo and genome-wide that facilitates new insights into RNA biology. PMID:28637286
In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features.
Ding, Yiliang; Tang, Yin; Kwok, Chun Kit; Zhang, Yu; Bevilacqua, Philip C; Assmann, Sarah M
2014-01-30
RNA structure has critical roles in processes ranging from ligand sensing to the regulation of translation, polyadenylation and splicing. However, a lack of genome-wide in vivo RNA structural data has limited our understanding of how RNA structure regulates gene expression in living cells. Here we present a high-throughput, genome-wide in vivo RNA structure probing method, structure-seq, in which dimethyl sulphate methylation of unprotected adenines and cytosines is identified by next-generation sequencing. Application of this method to Arabidopsis thaliana seedlings yielded the first in vivo genome-wide RNA structure map at nucleotide resolution for any organism, with quantitative structural information across more than 10,000 transcripts. Our analysis reveals a three-nucleotide periodic repeat pattern in the structure of coding regions, as well as a less-structured region immediately upstream of the start codon, and shows that these features are strongly correlated with translation efficiency. We also find patterns of strong and weak secondary structure at sites of alternative polyadenylation, as well as strong secondary structure at 5' splice sites that correlates with unspliced events. Notably, in vivo structures of messenger RNAs annotated for stress responses are poorly predicted in silico, whereas mRNA structures of genes related to cell function maintenance are well predicted. Global comparison of several structural features between these two categories shows that the mRNAs associated with stress responses tend to have more single-strandedness, longer maximal loop length and higher free energy per nucleotide, features that may allow these RNAs to undergo conformational changes in response to environmental conditions. Structure-seq allows the RNA structurome and its biological roles to be interrogated on a genome-wide scale and should be applicable to any organism.
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
RNA virus interference via CRISPR/Cas13a system in plants.
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
Genome-Wide Analysis of A-to-I RNA Editing.
Savva, Yiannis A; Laurent, Georges St; Reenan, Robert A
2016-01-01
Adenosine (A)-to-inosine (I) RNA editing is a fundamental posttranscriptional modification that ensures the deamination of A-to-I in double-stranded (ds) RNA molecules. Intriguingly, the A-to-I RNA editing system is particularly active in the nervous system of higher eukaryotes, altering a plethora of noncoding and coding sequences. Abnormal RNA editing is highly associated with many neurological phenotypes and neurodevelopmental disorders. However, the molecular mechanisms underlying RNA editing-mediated pathogenesis still remain enigmatic and have attracted increasing attention from researchers. Over the last decade, methods available to perform genome-wide transcriptome analysis, have evolved rapidly. Within the RNA editing field researchers have adopted next-generation sequencing technologies to identify RNA-editing sites within genomes and to elucidate the underlying process. However, technical challenges associated with editing site discovery have hindered efforts to uncover comprehensive editing site datasets, resulting in the general perception that the collections of annotated editing sites represent only a small minority of the total number of sites in a given organism, tissue, or cell type of interest. Additionally to doubts about sensitivity, existing RNA-editing site lists often contain high percentages of false positives, leading to uncertainty about their validity and usefulness in downstream studies. An accurate investigation of A-to-I editing requires properly validated datasets of editing sites with demonstrated and transparent levels of sensitivity and specificity. Here, we describe a high signal-to-noise method for RNA-editing site detection using single-molecule sequencing (SMS). With this method, authentic RNA-editing sites may be differentiated from artifacts. Machine learning approaches provide a procedure to improve upon and experimentally validate sequencing outcomes through use of computationally predicted, iterative feedback loops
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.
Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K
1995-01-01
We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
Harmon, Brooke; Bird, Sara W; Schudel, Benjamin R; Hatch, Anson V; Rasley, Amy; Negrete, Oscar A
2016-08-15
Rift Valley fever virus (RVFV) is an arbovirus within the Bunyaviridae family capable of causing serious morbidity and mortality in humans and livestock. To identify host factors involved in bunyavirus replication, we employed genome-wide RNA interference (RNAi) screening and identified 381 genes whose knockdown reduced infection. The Wnt pathway was the most represented pathway when gene hits were functionally clustered. With further investigation, we found that RVFV infection activated Wnt signaling, was enhanced when Wnt signaling was preactivated, was reduced with knockdown of β-catenin, and was blocked using Wnt signaling inhibitors. Similar results were found using distantly related bunyaviruses La Crosse virus and California encephalitis virus, suggesting a conserved role for Wnt signaling in bunyaviral infection. We propose a model where bunyaviruses activate Wnt-responsive genes to regulate optimal cell cycle conditions needed to promote efficient viral replication. The findings in this study should aid in the design of efficacious host-directed antiviral therapeutics. RVFV is a mosquito-borne bunyavirus that is endemic to Africa but has demonstrated a capacity for emergence in new territories (e.g., the Arabian Peninsula). As a zoonotic pathogen that primarily affects livestock, RVFV can also cause lethal hemorrhagic fever and encephalitis in humans. Currently, there are no treatments or fully licensed vaccines for this virus. Using high-throughput RNAi screening, we identified canonical Wnt signaling as an important host pathway regulating RVFV infection. The beneficial role of Wnt signaling was observed for RVFV, along with other disparate bunyaviruses, indicating a conserved bunyaviral replication mechanism involving Wnt signaling. These studies supplement our knowledge of the fundamental mechanisms of bunyavirus infection and provide new avenues for countermeasure development against pathogenic bunyaviruses. Copyright © 2016 Harmon et al.
Harmon, Brooke; Bird, Sara W.; Schudel, Benjamin R.; ...
2016-05-25
Rift Valley fever virus (RVFV) is an arbovirus within the Bunyaviridae family capable of causing serious morbidity and mortality in humans and livestock. To identify host factors involved in bunyavirus replication, we employed genome-wide RNA interference (RNAi) screening and identified 381 genes whose knockdown reduced infection. The Wnt pathway was the most represented pathway when gene hits were functionally clustered. With further investigation, we found that RVFV infection activated Wnt signaling, was enhanced when Wnt signaling was preactivated, was reduced with knockdown of β-catenin, and was blocked using Wnt signaling inhibitors. Similar results were found using distantly related bunyaviruses Lamore » Crosse virus and California encephalitis virus, suggesting a conserved role for Wnt signaling in bunyaviral infection. We propose a model where bunyaviruses activate Wnt-responsive genes to regulate optimal cell cycle conditions needed to promote efficient viral replication. The findings in this study should aid in the design of efficacious host-directed antiviral therapeutics. IMPORTANCE RVFV is a mosquito-borne bunyavirus that is endemic to Africa but has demonstrated a capacity for emergence in new territories (e.g., the Arabian Peninsula). As a zoonotic pathogen that primarily affects livestock, RVFV can also cause lethal hemorrhagic fever and encephalitis in humans. Currently, there are no treatments or fully licensed vaccines for this virus. Using high-throughput RNAi screening, we identified canonical Wnt signaling as an important host pathway regulating RVFV infection. The beneficial role of Wnt signaling was observed for RVFV, along with other disparate bunyaviruses, indicating a conserved bunyaviral replication mechanism involving Wnt signaling. Lastly, these studies supplement our knowledge of the fundamental mechanisms of bunyavirus infection and provide new avenues for countermeasure development against pathogenic bunyaviruses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harmon, Brooke; Bird, Sara W.; Schudel, Benjamin R.
Rift Valley fever virus (RVFV) is an arbovirus within the Bunyaviridae family capable of causing serious morbidity and mortality in humans and livestock. To identify host factors involved in bunyavirus replication, we employed genome-wide RNA interference (RNAi) screening and identified 381 genes whose knockdown reduced infection. The Wnt pathway was the most represented pathway when gene hits were functionally clustered. With further investigation, we found that RVFV infection activated Wnt signaling, was enhanced when Wnt signaling was preactivated, was reduced with knockdown of β-catenin, and was blocked using Wnt signaling inhibitors. Similar results were found using distantly related bunyaviruses Lamore » Crosse virus and California encephalitis virus, suggesting a conserved role for Wnt signaling in bunyaviral infection. We propose a model where bunyaviruses activate Wnt-responsive genes to regulate optimal cell cycle conditions needed to promote efficient viral replication. The findings in this study should aid in the design of efficacious host-directed antiviral therapeutics. IMPORTANCE RVFV is a mosquito-borne bunyavirus that is endemic to Africa but has demonstrated a capacity for emergence in new territories (e.g., the Arabian Peninsula). As a zoonotic pathogen that primarily affects livestock, RVFV can also cause lethal hemorrhagic fever and encephalitis in humans. Currently, there are no treatments or fully licensed vaccines for this virus. Using high-throughput RNAi screening, we identified canonical Wnt signaling as an important host pathway regulating RVFV infection. The beneficial role of Wnt signaling was observed for RVFV, along with other disparate bunyaviruses, indicating a conserved bunyaviral replication mechanism involving Wnt signaling. Lastly, these studies supplement our knowledge of the fundamental mechanisms of bunyavirus infection and provide new avenues for countermeasure development against pathogenic bunyaviruses.« less
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.
Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M
2018-05-01
Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke
2014-03-01
Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing
Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom
2015-01-01
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.
Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom
2015-05-14
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.
RNA 3D Modules in Genome-Wide Predictions of RNA 2D Structure
Theis, Corinna; Zirbel, Craig L.; zu Siederdissen, Christian Höner; Anthon, Christian; Hofacker, Ivo L.; Nielsen, Henrik; Gorodkin, Jan
2015-01-01
Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution. These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D module prediction tools and apply them on a 13-way vertebrate sequence-based alignment. We find that RNA 3D modules predicted by metaRNAmodules and JAR3D are significantly enriched in the screened windows compared to their shuffled counterparts. The initially estimated FDR of 47.0% is lowered to below 25% when certain 3D module predictions are present in the window of the 2D prediction. We discuss the implications and prospects for further development of computational strategies for detection of RNA 2D structure in genomic sequence. PMID:26509713
Domain motions of Argonaute, the catalytic engine of RNA interference
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-01-01
Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142
Domain motions of Argonaute, the catalytic engine of RNA interference.
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-11-30
The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard
2013-01-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
Cardiovascular RNA interference therapy: the broadening tool and target spectrum.
Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina
2013-08-16
Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard
2012-04-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].
Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente
2010-01-01
RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.
Genome-wide CRISPR screen identifies HNRNPL as a prostate cancer dependency regulating RNA splicing.
Fei, Teng; Chen, Yiwen; Xiao, Tengfei; Li, Wei; Cato, Laura; Zhang, Peng; Cotter, Maura B; Bowden, Michaela; Lis, Rosina T; Zhao, Shuang G; Wu, Qiu; Feng, Felix Y; Loda, Massimo; He, Housheng Hansen; Liu, X Shirley; Brown, Myles
2017-06-27
Alternative RNA splicing plays an important role in cancer. To determine which factors involved in RNA processing are essential in prostate cancer, we performed a genome-wide CRISPR/Cas9 knockout screen to identify the genes that are required for prostate cancer growth. Functional annotation defined a set of essential spliceosome and RNA binding protein (RBP) genes, including most notably heterogeneous nuclear ribonucleoprotein L (HNRNPL). We defined the HNRNPL-bound RNA landscape by RNA immunoprecipitation coupled with next-generation sequencing and linked these RBP-RNA interactions to changes in RNA processing. HNRNPL directly regulates the alternative splicing of a set of RNAs, including those encoding the androgen receptor, the key lineage-specific prostate cancer oncogene. HNRNPL also regulates circular RNA formation via back splicing. Importantly, both HNRNPL and its RNA targets are aberrantly expressed in human prostate tumors, supporting their clinical relevance. Collectively, our data reveal HNRNPL and its RNA clients as players in prostate cancer growth and potential therapeutic targets.
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
Chemical modification: the key to clinical application of RNA interference?
Corey, David R.
2007-01-01
RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R
2014-01-01
The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
2011-01-01
Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
Smith, Justin D; Suresh, Sundari; Schlecht, Ulrich; Wu, Manhong; Wagih, Omar; Peltz, Gary; Davis, Ronald W; Steinmetz, Lars M; Parts, Leopold; St Onge, Robert P
2016-03-08
Genome-scale CRISPR interference (CRISPRi) has been used in human cell lines; however, the features of effective guide RNAs (gRNAs) in different organisms have not been well characterized. Here, we define rules that determine gRNA effectiveness for transcriptional repression in Saccharomyces cerevisiae. We create an inducible single plasmid CRISPRi system for gene repression in yeast, and use it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identifies previously described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments using gRNA libraries allows us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility are clearly more effective. We also find that the best region to target gRNAs is between the transcription start site (TSS) and 200 bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, the specificity of truncated gRNAs (18 nt of complementarity to the target) is not clearly superior to full-length gRNAs (20 nt of complementarity), as truncated gRNAs are generally less potent against both mismatched and perfectly matched targets. Our results establish a powerful functional and chemical genomics screening method and provide guidelines for designing effective gRNAs, which consider chromatin state and position relative to the target gene TSS. These findings will enable effective library design and genome-wide programmable gene repression in many genetic backgrounds.
Mennigen, Jan A; Zhang, Dapeng
2016-12-01
Rainbow trout represent an important teleost research model and aquaculture species. As such, rainbow trout are employed in diverse areas of biological research, including basic biological disciplines such as comparative physiology, toxicology, and, since rainbow trout have undergone both teleost- and salmonid-specific rounds of genome duplication, molecular evolution. In recent years, microRNAs (miRNAs, small non-protein coding RNAs) have emerged as important posttranscriptional regulators of gene expression in animals. Given the increasingly recognized importance of miRNAs as an additional layer in the regulation of gene expression and hence biological function, recent efforts using RNA- and genome sequencing approaches have resulted in the creation of several resources for the construction of a comprehensive repertoire of rainbow trout miRNAs and isomiRs (variant miRNA sequences that all appear to derive from the same gene but vary in sequence due to post-transcriptional processing). Importantly, through the recent publication of the rainbow trout genome (Berthelot et al., 2014), mRNA 3'UTR information has become available, allowing for the first time the genome-wide prediction of miRNA-target RNA relationships in this species. We here report the creation of the microtrout database, a comprehensive resource for rainbow trout miRNA and annotated 3'UTRs. The comprehensive database was used to implement an algorithm to predict genome-wide rainbow trout-specific miRNA-mRNA target relationships, generating an improved predictive framework over previously published approaches. This work will serve as a useful framework and sequence resource to experimentally address the role of miRNAs in several research areas using the rainbow trout model, examples of which are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Genome-wide analysis of miRNA and mRNA transcriptomes during amelogenesis.
Yin, Kaifeng; Hacia, Joseph G; Zhong, Zhe; Paine, Michael L
2014-11-19
In the rodent incisor during amelogenesis, as ameloblast cells transition from secretory stage to maturation stage, their morphology and transcriptome profiles change dramatically. Prior whole genome transcriptome analysis has given a broad picture of the molecular activities dominating both stages of amelogenesis, but this type of analysis has not included miRNA transcript profiling. In this study, we set out to document which miRNAs and corresponding target genes change significantly as ameloblasts transition from secretory- to maturation-stage amelogenesis. Total RNA samples from both secretory- and maturation-stage rat enamel organs were subjected to genome-wide miRNA and mRNA transcript profiling. We identified 59 miRNAs that were differentially expressed at the maturation stage relative to the secretory stage of enamel development (False Discovery Rate (FDR)<0.05, fold change (FC)≥1.8). In parallel, transcriptome profiling experiments identified 1,729 mRNA transcripts that were differentially expressed in the maturation stage compared to the secretory stage (FDR<0.05, FC≥1.8). Based on bioinformatics analyses, 5.8% (629 total) of these differentially expressed genes (DEGS) were highlighted as being the potential targets of 59 miRNAs that were differentially expressed in the opposite direction, in the same tissue samples. Although the number of predicted target DEGs was not higher than baseline expectations generated by examination of stably expressed miRNAs, Gene Ontology (GO) analysis showed that these 629 DEGS were enriched for ion transport, pH regulation, calcium handling, endocytotic, and apoptotic activities. Seven differentially expressed miRNAs (miR-21, miR-31, miR-488, miR-153, miR-135b, miR-135a and miR298) in secretory- and/or maturation-stage enamel organs were confirmed by in situ hybridization. Further, we used luciferase reporter assays to provide evidence that two of these differentially expressed miRNAs, miR-153 and miR-31, are potential
Pham, John W; Sontheimer, Erik J
2005-11-25
Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo.
Zubradt, Meghan; Gupta, Paromita; Persad, Sitara; Lambowitz, Alan M; Weissman, Jonathan S; Rouskin, Silvi
2017-01-01
Coupling of structure-specific in vivo chemical modification to next-generation sequencing is transforming RNA secondary structure studies in living cells. The dominant strategy for detecting in vivo chemical modifications uses reverse transcriptase truncation products, which introduce biases and necessitate population-average assessments of RNA structure. Here we present dimethyl sulfate (DMS) mutational profiling with sequencing (DMS-MaPseq), which encodes DMS modifications as mismatches using a thermostable group II intron reverse transcriptase. DMS-MaPseq yields a high signal-to-noise ratio, can report multiple structural features per molecule, and allows both genome-wide studies and focused in vivo investigations of even low-abundance RNAs. We apply DMS-MaPseq for the first analysis of RNA structure within an animal tissue and to identify a functional structure involved in noncanonical translation initiation. Additionally, we use DMS-MaPseq to compare the in vivo structure of pre-mRNAs with their mature isoforms. These applications illustrate DMS-MaPseq's capacity to dramatically expand in vivo analysis of RNA structure.
DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Zubradt, Meghan; Gupta, Paromita; Persad, Sitara; Lambowitz, Alan M.; Weissman, Jonathan S.; Rouskin, Silvi
2017-01-01
Coupling structure-specific in vivo chemical modification to next-generation sequencing is transforming RNA secondary structural studies in living cells. The dominant strategy for detecting in vivo chemical modifications uses reverse transcriptase truncation products, which introduces biases and necessitates population-average assessments of RNA structure. Here we present dimethyl sulfate mutational profiling with sequencing (DMS-MaPseq), which encodes DMS modifications as mismatches using a thermostable group II intron reverse transcriptase (TGIRT). DMS-MaPseq yields a high signal-to-noise ratio, can report multiple structural features per molecule, and allows both genome-wide studies and focused in vivo investigations of even low abundance RNAs. We apply DMS-MaPseq for the first analysis of RNA structure within an animal tissue and to identify a functional structure involved in non-canonical translation initiation. Additionally, we use DMS-MaPseq to compare the in vivo structure of pre-mRNAs to their mature isoforms. These applications illustrate DMS-MaPseq’s capacity to dramatically expand in vivo analysis of RNA structure. PMID:27819661
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Genome-wide screen uncovers novel pathways for tRNA processing and nuclear-cytoplasmic dynamics.
Wu, Jingyan; Bao, Alicia; Chatterjee, Kunal; Wan, Yao; Hopper, Anita K
2015-12-15
Transfer ribonucleic acids (tRNAs) are essential for protein synthesis. However, key gene products involved in tRNA biogenesis and subcellular movement remain to be discovered. We conducted the first comprehensive unbiased analysis of the role of nearly an entire proteome in tRNA biology and describe 162 novel and 12 previously known Saccharomyces cerevisiae gene products that function in tRNA processing, turnover, and subcellular movement. tRNA nuclear export is of particular interest because it is essential, but the known tRNA exporters (Los1 [exportin-t] and Msn5 [exportin-5]) are unessential. We report that mutations of CRM1 (Exportin-1), MEX67/MTR2 (TAP/p15), and five nucleoporins cause accumulation of unspliced tRNA, a hallmark of defective tRNA nuclear export. CRM1 mutation genetically interacts with los1Δ and causes altered tRNA nuclear-cytoplasmic distribution. The data implicate roles for the protein and mRNA nuclear export machineries in tRNA nuclear export. Mutations of genes encoding actin cytoskeleton components and mitochondrial outer membrane proteins also cause accumulation of unspliced tRNA, likely due to defective splicing on mitochondria. Additional gene products, such as chromatin modification enzymes, have unanticipated effects on pre-tRNA end processing. Thus, this genome-wide screen uncovered putative novel pathways for tRNA nuclear export and extensive links between tRNA biology and other aspects of cell physiology. © 2015 Wu et al.; Published by Cold Spring Harbor Laboratory Press.
Genome-wide screen uncovers novel pathways for tRNA processing and nuclear–cytoplasmic dynamics
Wu, Jingyan; Bao, Alicia; Chatterjee, Kunal; Wan, Yao; Hopper, Anita K.
2015-01-01
Transfer ribonucleic acids (tRNAs) are essential for protein synthesis. However, key gene products involved in tRNA biogenesis and subcellular movement remain to be discovered. We conducted the first comprehensive unbiased analysis of the role of nearly an entire proteome in tRNA biology and describe 162 novel and 12 previously known Saccharomyces cerevisiae gene products that function in tRNA processing, turnover, and subcellular movement. tRNA nuclear export is of particular interest because it is essential, but the known tRNA exporters (Los1 [exportin-t] and Msn5 [exportin-5]) are unessential. We report that mutations of CRM1 (Exportin-1), MEX67/MTR2 (TAP/p15), and five nucleoporins cause accumulation of unspliced tRNA, a hallmark of defective tRNA nuclear export. CRM1 mutation genetically interacts with los1Δ and causes altered tRNA nuclear–cytoplasmic distribution. The data implicate roles for the protein and mRNA nuclear export machineries in tRNA nuclear export. Mutations of genes encoding actin cytoskeleton components and mitochondrial outer membrane proteins also cause accumulation of unspliced tRNA, likely due to defective splicing on mitochondria. Additional gene products, such as chromatin modification enzymes, have unanticipated effects on pre-tRNA end processing. Thus, this genome-wide screen uncovered putative novel pathways for tRNA nuclear export and extensive links between tRNA biology and other aspects of cell physiology. PMID:26680305
Global effects of the CSR-1 RNA interference pathway on transcriptional landscape
Cecere, Germano; Hoersch, Sebastian; O’Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-01-01
Argonaute proteins and their small RNA co-factors short interfering RNAs (siRNAs) are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) antisense to germline transcripts and associates with chromatin in a siRNA-dependent manner. However, its role in gene expression regulation remains controversial. Here, we used a genome-wide profiling of nascent RNA transcripts to demonstrate that the CSR-1 RNAi pathway promotes sense-oriented Pol II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. Based on these findings, we propose that the CSR-1 pathway has a role in maintaining the directionality of active transcription thereby propagating the distinction between transcriptionally active and silent genomic regions. PMID:24681887
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays.
Johnson, Jason M; Castle, John; Garrett-Engele, Philip; Kan, Zhengyan; Loerch, Patrick M; Armour, Christopher D; Santos, Ralph; Schadt, Eric E; Stoughton, Roland; Shoemaker, Daniel D
2003-12-19
Alternative pre-messenger RNA (pre-mRNA) splicing plays important roles in development, physiology, and disease, and more than half of human genes are alternatively spliced. To understand the biological roles and regulation of alternative splicing across different tissues and stages of development, systematic methods are needed. Here, we demonstrate the use of microarrays to monitor splicing at every exon-exon junction in more than 10,000 multi-exon human genes in 52 tissues and cell lines. These genome-wide data provide experimental evidence and tissue distributions for thousands of known and novel alternative splicing events. Adding to previous studies, the results indicate that at least 74% of human multi-exon genes are alternatively spliced.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Construction of siRNA/miRNA expression vectors based on a one-step PCR process
Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin
2009-01-01
Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
Genome-wide characterization of microRNA in foxtail millet (Setaria italica).
Yi, Fei; Xie, Shaojun; Liu, Yuwei; Qi, Xin; Yu, Jingjuan
2013-12-13
MicroRNAs (miRNAs) are a class of short non-coding, endogenous RNAs that play key roles in many biological processes in both animals and plants. Although many miRNAs have been identified in a large number of organisms, the miRNAs in foxtail millet (Setaria italica) have, until now, been poorly understood. In this study, two replicate small RNA libraries from foxtail millet shoots were sequenced, and 40 million reads representing over 10 million unique sequences were generated. We identified 43 known miRNAs, 172 novel miRNAs and 2 mirtron precursor candidates in foxtail millet. Some miRNA*s of the known and novel miRNAs were detected as well. Further, eight novel miRNAs were validated by stem-loop RT-PCR. Potential targets of the foxtail millet miRNAs were predicted based on our strict criteria. Of the predicted target genes, 79% (351) had functional annotations in InterPro and GO analyses, indicating the targets of the miRNAs were involved in a wide range of regulatory functions and some specific biological processes. A total of 69 pairs of syntenic miRNA precursors that were conserved between foxtail millet and sorghum were found. Additionally, stem-loop RT-PCR was conducted to confirm the tissue-specific expression of some miRNAs in the four tissues identified by deep-sequencing. We predicted, for the first time, 215 miRNAs and 447 miRNA targets in foxtail millet at a genome-wide level. The precursors, expression levels, miRNA* sequences, target functions, conservation, and evolution of miRNAs we identified were investigated. Some of the novel foxtail millet miRNAs and miRNA targets were validated experimentally.
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission
Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.
2016-01-01
ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel
2016-04-26
Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
Microprocessor mediates transcriptional termination in long noncoding microRNA genes
Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.
2015-01-01
MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776
Genome-wide bisulfite sensitivity profiling of yeast suggests bisulfite inhibits transcription.
Segovia, Romulo; Mathew, Veena; Tam, Annie S; Stirling, Peter C
2017-09-01
Bisulfite, in the form of sodium bisulfite or metabisulfite, is used commercially as a food preservative. Bisulfite is used in the laboratory as a single-stranded DNA mutagen in epigenomic analyses of DNA methylation. Recently it has also been used on whole yeast cells to induce mutations in exposed single-stranded regions in vivo. To understand the effects of bisulfite on live cells we conducted a genome-wide screen for bisulfite sensitive mutants in yeast. Screening the deletion mutant array, and collections of essential gene mutants we define a genetic network of bisulfite sensitive mutants. Validation of screen hits revealed hyper-sensitivity of transcription and RNA processing mutants, rather than DNA repair pathways and follow-up analyses support a role in perturbation of RNA transactions. We propose a model in which bisulfite-modified nucleotides may interfere with transcription or RNA metabolism when used in vivo. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
Genome-wide characterization of microRNA in foxtail millet (Setaria italica)
2013-01-01
Background MicroRNAs (miRNAs) are a class of short non-coding, endogenous RNAs that play key roles in many biological processes in both animals and plants. Although many miRNAs have been identified in a large number of organisms, the miRNAs in foxtail millet (Setaria italica) have, until now, been poorly understood. Results In this study, two replicate small RNA libraries from foxtail millet shoots were sequenced, and 40 million reads representing over 10 million unique sequences were generated. We identified 43 known miRNAs, 172 novel miRNAs and 2 mirtron precursor candidates in foxtail millet. Some miRNA*s of the known and novel miRNAs were detected as well. Further, eight novel miRNAs were validated by stem-loop RT-PCR. Potential targets of the foxtail millet miRNAs were predicted based on our strict criteria. Of the predicted target genes, 79% (351) had functional annotations in InterPro and GO analyses, indicating the targets of the miRNAs were involved in a wide range of regulatory functions and some specific biological processes. A total of 69 pairs of syntenic miRNA precursors that were conserved between foxtail millet and sorghum were found. Additionally, stem-loop RT-PCR was conducted to confirm the tissue-specific expression of some miRNAs in the four tissues identified by deep-sequencing. Conclusions We predicted, for the first time, 215 miRNAs and 447 miRNA targets in foxtail millet at a genome-wide level. The precursors, expression levels, miRNA* sequences, target functions, conservation, and evolution of miRNAs we identified were investigated. Some of the novel foxtail millet miRNAs and miRNA targets were validated experimentally. PMID:24330712
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
Genome-wide A-to-I RNA editing in fungi independent of ADAR enzymes
Liu, Huiquan; Wang, Qinhu; He, Yi; Chen, Lingfeng; Hao, Chaofeng; Jiang, Cong; Li, Yang; Dai, Yafeng; Kang, Zhensheng; Xu, Jin-Rong
2016-01-01
Yeasts and filamentous fungi do not have adenosine deaminase acting on RNA (ADAR) orthologs and are believed to lack A-to-I RNA editing, which is the most prevalent editing of mRNA in animals. However, during this study with the PUK1 (FGRRES_01058) pseudokinase gene important for sexual reproduction in Fusarium graminearum, we found that two tandem stop codons, UA1831GUA1834G, in its kinase domain were changed to UG1831GUG1834G by RNA editing in perithecia. To confirm A-to-I editing of PUK1 transcripts, strand-specific RNA-seq data were generated with RNA isolated from conidia, hyphae, and perithecia. PUK1 was almost specifically expressed in perithecia, and 90% of transcripts were edited to UG1831GUG1834G. Genome-wide analysis identified 26,056 perithecium-specific A-to-I editing sites. Unlike those in animals, 70.5% of A-to-I editing sites in F. graminearum occur in coding regions, and more than two-thirds of them result in amino acid changes, including editing of 69 PUK1-like pseudogenes with stop codons in ORFs. PUK1 orthologs and other pseudogenes also displayed stage-specific expression and editing in Neurospora crassa and F. verticillioides. Furthermore, F. graminearum differs from animals in the sequence preference and structure selectivity of A-to-I editing sites. Whereas A's embedded in RNA stems are targeted by ADARs, RNA editing in F. graminearum preferentially targets A's in hairpin loops, which is similar to the anticodon loop of tRNA targeted by adenosine deaminases acting on tRNA (ADATs). Overall, our results showed that A-to-I RNA editing occurs specifically during sexual reproduction and mainly in the coding regions in filamentous ascomycetes, involving adenosine deamination mechanisms distinct from metazoan ADARs. PMID:26934920
Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon
2012-01-01
Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
Special Issue: Gene Therapy with Emphasis on RNA Interference
Lundstrom, Kenneth
2015-01-01
Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255
Genome-Wide Analysis of miRNA targets in Brachypodium and Biomass Energy Crops
DOE Office of Scientific and Technical Information (OSTI.GOV)
Green, Pamela J.
2015-08-11
MicroRNAs (miRNAs) contribute to the control of numerous biological processes through the regulation of specific target mRNAs. Although the identities of these targets are essential to elucidate miRNA function, the targets are much more difficult to identify than the small RNAs themselves. Before this work, we pioneered the genome-wide identification of the targets of Arabidopsis miRNAs using an approach called PARE (German et al., Nature Biotech. 2008; Nature Protocols, 2009). Under this project, we applied PARE to Brachypodium distachyon (Brachypodium), a model plant in the Poaceae family, which includes the major food grain and bioenergy crops. Through in-depth global analysismore » and examination of specific examples, this research greatly expanded our knowledge of miRNAs and target RNAs of Brachypodium. New regulation in response to environmental stress or tissue type was found, and many new miRNAs were discovered. More than 260 targets of new and known miRNAs with PARE sequences at the precise sites of miRNA-guided cleavage were identified and characterized. Combining PARE data with the small RNA data also identified the miRNAs responsible for initiating approximately 500 phased loci, including one of the novel miRNAs. PARE analysis also revealed that differentially expressed miRNAs in the same family guide specific target RNA cleavage in a correspondingly tissue-preferential manner. The project included generation of small RNA and PARE resources for bioenergy crops, to facilitate ongoing discovery of conserved miRNA-target RNA regulation. By associating specific miRNA-target RNA pairs with known physiological functions, the research provides insights about gene regulation in different tissues and in response to environmental stress. This, and release of new PARE and small RNA data sets should contribute basic knowledge to enhance breeding and may suggest new strategies for improvement of biomass energy crops.« less
Deciphering RNA regulatory elements in trypanosomatids: one piece at a time or genome-wide?
Gazestani, Vahid H; Lu, Zhiquan; Salavati, Reza
2014-05-01
Morphological and metabolic changes in the life cycle of Trypanosoma brucei are accomplished by precise regulation of hundreds of genes. In the absence of transcriptional control, RNA-binding proteins (RBPs) shape the structure of gene regulatory maps in this organism, but our knowledge about their target RNAs, binding sites, and mechanisms of action is far from complete. Although recent technological advances have revolutionized the RBP-based approaches, the main framework for the RNA regulatory element (RRE)-based approaches has not changed over the last two decades in T. brucei. In this Opinion, after highlighting the current challenges in RRE inference, we explain some genome-wide solutions that can significantly boost our current understanding about gene regulatory networks in T. brucei. Copyright © 2014 Elsevier Ltd. All rights reserved.
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Nebane, N Miranda; Coric, Tatjana; McKellip, Sara; Woods, LaKeisha; Sosa, Melinda; Rasmussen, Lynn; Bjornsti, Mary-Ann; White, E Lucile
2016-02-01
The development of acoustic droplet ejection (ADE) technology has resulted in many positive changes associated with the operations in a high-throughput screening (HTS) laboratory. Originally, this liquid transfer technology was used to simply transfer DMSO solutions of primarily compounds. With the introduction of Labcyte's Echo 555, which has aqueous dispense capability, the application of this technology has been expanded beyond its original use. This includes the transfer of many biological reagents solubilized in aqueous buffers, including siRNAs. The Echo 555 is ideal for siRNA dispensing because it is accurate at low volumes and a step-down dilution is not necessary. The potential for liquid carryover and cross-contamination is eliminated, as no tips are needed. Herein, we describe the siRNA screening platform at Southern Research's HTS Center using the ADE technology. With this technology, an siRNA library can be dispensed weeks or even months in advance of the assay itself. The protocol has been optimized to achieve assay parameters comparable to small-molecule screening parameters, and exceeding the norm reported for genomewide siRNA screens. © 2015 Society for Laboratory Automation and Screening.
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Jaiswal, Alok; Peddinti, Gopal; Akimov, Yevhen; Wennerberg, Krister; Kuznetsov, Sergey; Tang, Jing; Aittokallio, Tero
2017-06-01
Genome-wide loss-of-function profiling is widely used for systematic identification of genetic dependencies in cancer cells; however, the poor reproducibility of RNA interference (RNAi) screens has been a major concern due to frequent off-target effects. Currently, a detailed understanding of the key factors contributing to the sub-optimal consistency is still a lacking, especially on how to improve the reliability of future RNAi screens by controlling for factors that determine their off-target propensity. We performed a systematic, quantitative analysis of the consistency between two genome-wide shRNA screens conducted on a compendium of cancer cell lines, and also compared several gene summarization methods for inferring gene essentiality from shRNA level data. We then devised novel concepts of seed essentiality and shRNA family, based on seed region sequences of shRNAs, to study in-depth the contribution of seed-mediated off-target effects to the consistency of the two screens. We further investigated two seed-sequence properties, seed pairing stability, and target abundance in terms of their capability to minimize the off-target effects in post-screening data analysis. Finally, we applied this novel methodology to identify genetic interactions and synthetic lethal partners of cancer drivers, and confirmed differential essentiality phenotypes by detailed CRISPR/Cas9 experiments. Using the novel concepts of seed essentiality and shRNA family, we demonstrate how genome-wide loss-of-function profiling of a common set of cancer cell lines can be actually made fairly reproducible when considering seed-mediated off-target effects. Importantly, by excluding shRNAs having higher propensity for off-target effects, based on their seed-sequence properties, one can remove noise from the genome-wide shRNA datasets. As a translational application case, we demonstrate enhanced reproducibility of genetic interaction partners of common cancer drivers, as well as identify novel
Functional genome-wide siRNA screen identifies KIAA0586 as mutated in Joubert syndrome
Roosing, Susanne; Hofree, Matan; Kim, Sehyun; Scott, Eric; Copeland, Brett; Romani, Marta; Silhavy, Jennifer L; Rosti, Rasim O; Schroth, Jana; Mazza, Tommaso; Miccinilli, Elide; Zaki, Maha S; Swoboda, Kathryn J; Milisa-Drautz, Joanne; Dobyns, William B; Mikati, Mohamed A; İncecik, Faruk; Azam, Matloob; Borgatti, Renato; Romaniello, Romina; Boustany, Rose-Mary; Clericuzio, Carol L; D'Arrigo, Stefano; Strømme, Petter; Boltshauser, Eugen; Stanzial, Franco; Mirabelli-Badenier, Marisol; Moroni, Isabella; Bertini, Enrico; Emma, Francesco; Steinlin, Maja; Hildebrandt, Friedhelm; Johnson, Colin A; Freilinger, Michael; Vaux, Keith K; Gabriel, Stacey B; Aza-Blanc, Pedro; Heynen-Genel, Susanne; Ideker, Trey; Dynlacht, Brian D; Lee, Ji Eun; Valente, Enza Maria; Kim, Joon; Gleeson, Joseph G
2015-01-01
Defective primary ciliogenesis or cilium stability forms the basis of human ciliopathies, including Joubert syndrome (JS), with defective cerebellar vermis development. We performed a high-content genome-wide small interfering RNA (siRNA) screen to identify genes regulating ciliogenesis as candidates for JS. We analyzed results with a supervised-learning approach, using SYSCILIA gold standard, Cildb3.0, a centriole siRNA screen and the GTex project, identifying 591 likely candidates. Intersection of this data with whole exome results from 145 individuals with unexplained JS identified six families with predominantly compound heterozygous mutations in KIAA0586. A c.428del base deletion in 0.1% of the general population was found in trans with a second mutation in an additional set of 9 of 163 unexplained JS patients. KIAA0586 is an orthologue of chick Talpid3, required for ciliogenesis and Sonic hedgehog signaling. Our results uncover a relatively high frequency cause for JS and contribute a list of candidates for future gene discoveries in ciliopathies. DOI: http://dx.doi.org/10.7554/eLife.06602.001 PMID:26026149
Role of RNA interference in plant improvement
NASA Astrophysics Data System (ADS)
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
Takata, Nozomu; Sakakura, Eriko; Kasukawa, Takeya; Sakuma, Tetsushi; Yamamoto, Takashi; Sasai, Yoshiki
2016-06-01
The epiblast (foremost embryonic ectoderm) generates all three germ layers and therefore has crucial roles in the formation of all mammalian body cells. However, regulation of epiblast gene expression is poorly understood because of the difficulty of manipulating epiblast tissues in vivo. In the present study, using the self-organizing properties of mouse embryonic stem cell (ESC), we generated and characterized epiblast-like tissue in three-dimensional culture. We identified significant genome-wide gene expression changes in this epiblast-like tissue by transcriptomic analysis. In addition, we identified the particular significance of the Erk/Mapk and integrin-linked kinase pathways, and genes related to ectoderm/epithelial formation, using the bioinformatics resources IPA and DAVID. Here, we focused on Fgf5, which ranked in the top 10 among the discovered genes. To develop a functional analysis of Fgf5, we created an efficient method combining CRISPR/Cas9-mediated genome engineering and RNA interference (RNAi). Notably, we show one-step generation of various Fgf5 reporter lines including heterozygous and homozygous knockins (the GET method). For time- and dose-dependent depletion of fgf5 over the course of development, we generated an ESC line harboring Tol2 transposon-mediated integration of an inducible short hairpin RNA interference system (pdiRNAi). Our findings raised the possibility that Fgf/Erk signaling and apicobasal epithelial integrity are important factors in epiblast development. In addition, our methods provide a framework for a broad array of applications in the areas of mammalian genetics and molecular biology to understand development and to improve future therapeutics.
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
Gilardi, Federica; Liechti, Robin; Martin, Olivier; Harshman, Keith; Delorenzi, Mauro; Desvergne, Béatrice; Herr, Winship; Deplancke, Bart; Schibler, Ueli; Rougemont, Jacques; Guex, Nicolas; Hernandez, Nouria; Naef, Felix
2012-01-01
Interactions of cell-autonomous circadian oscillators with diurnal cycles govern the temporal compartmentalization of cell physiology in mammals. To understand the transcriptional and epigenetic basis of diurnal rhythms in mouse liver genome-wide, we generated temporal DNA occupancy profiles by RNA polymerase II (Pol II) as well as profiles of the histone modifications H3K4me3 and H3K36me3. We used these data to quantify the relationships of phases and amplitudes between different marks. We found that rhythmic Pol II recruitment at promoters rather than rhythmic transition from paused to productive elongation underlies diurnal gene transcription, a conclusion further supported by modeling. Moreover, Pol II occupancy preceded mRNA accumulation by 3 hours, consistent with mRNA half-lives. Both methylation marks showed that the epigenetic landscape is highly dynamic and globally remodeled during the 24-hour cycle. While promoters of transcribed genes had tri-methylated H3K4 even at their trough activity times, tri-methylation levels reached their peak, on average, 1 hour after Pol II. Meanwhile, rhythms in tri-methylation of H3K36 lagged transcription by 3 hours. Finally, modeling profiles of Pol II occupancy and mRNA accumulation identified three classes of genes: one showing rhythmicity both in transcriptional and mRNA accumulation, a second class with rhythmic transcription but flat mRNA levels, and a third with constant transcription but rhythmic mRNAs. The latter class emphasizes widespread temporally gated posttranscriptional regulation in the mouse liver. PMID:23209382
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
Fang, Lingzhao; Sørensen, Peter; Sahana, Goutam; Panitz, Frank; Su, Guosheng; Zhang, Shengli; Yu, Ying; Li, Bingjie; Ma, Li; Liu, George; Lund, Mogens Sandø; Thomsen, Bo
2018-06-19
MicroRNAs (miRNA) are key modulators of gene expression and so act as putative fine-tuners of complex phenotypes. Here, we hypothesized that causal variants of complex traits are enriched in miRNAs and miRNA-target networks. First, we conducted a genome-wide association study (GWAS) for seven functional and milk production traits using imputed sequence variants (13~15 million) and >10,000 animals from three dairy cattle breeds, i.e., Holstein (HOL), Nordic red cattle (RDC) and Jersey (JER). Second, we analyzed for enrichments of association signals in miRNAs and their miRNA-target networks. Our results demonstrated that genomic regions harboring miRNA genes were significantly (P < 0.05) enriched with GWAS signals for milk production traits and mastitis, and that enrichments within miRNA-target gene networks were significantly higher than in random gene-sets for the majority of traits. Furthermore, most between-trait and across-breed correlations of enrichments with miRNA-target networks were significantly greater than with random gene-sets, suggesting pleiotropic effects of miRNAs. Intriguingly, genes that were differentially expressed in response to mammary gland infections were significantly enriched in the miRNA-target networks associated with mastitis. All these findings were consistent across three breeds. Collectively, our observations demonstrate the importance of miRNAs and their targets for the expression of complex traits.
A Herpesvirus Protein Selectively Inhibits Cellular mRNA Nuclear Export.
Gong, Danyang; Kim, Yong Hoon; Xiao, Yuchen; Du, Yushen; Xie, Yafang; Lee, Kevin K; Feng, Jun; Farhat, Nisar; Zhao, Dawei; Shu, Sara; Dai, Xinghong; Chanda, Sumit K; Rana, Tariq M; Krogan, Nevan J; Sun, Ren; Wu, Ting-Ting
2016-11-09
Nuclear mRNA export is highly regulated to ensure accurate cellular gene expression. Viral inhibition of cellular mRNA export can enhance viral access to the cellular translation machinery and prevent anti-viral protein production but is generally thought to be nonselective. We report that ORF10 of Kaposi's sarcoma-associated herpesvirus (KSHV), a nuclear DNA virus, inhibits mRNA export in a transcript-selective manner to control cellular gene expression. Nuclear export inhibition by ORF10 requires an interaction with an RNA export factor, Rae1. Genome-wide analysis reveals a subset of cellular mRNAs whose nuclear export is blocked by ORF10 with the 3' UTRs of ORF10-targeted transcripts conferring sensitivity to export inhibition. The ORF10-Rae1 interaction is important for the virus to express viral genes and produce infectious virions. These results suggest that a nuclear DNA virus can selectively interfere with RNA export to restrict host gene expression for optimal replication. Published by Elsevier Inc.
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Basnet, Sanjay; Kamble, Shripat T
2018-05-01
Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi
2011-09-01
Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.
Short hairpin RNA interference therapy for ischemic heart disease.
Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C
2008-09-30
During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E
2018-05-04
Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
Zhang, Fantao; Luo, Xiangdong; Zhou, Yi; Xie, Jiankun
2016-04-01
To identify drought stress-responsive conserved microRNA (miRNA) from Dongxiang wild rice (Oryza rufipogon Griff., DXWR) on a genome-wide scale, high-throughput sequencing technology was used to sequence libraries of DXWR samples, treated with and without drought stress. 505 conserved miRNAs corresponding to 215 families were identified. 17 were significantly down-regulated and 16 were up-regulated under drought stress. Stem-loop qRT-PCR revealed the same expression patterns as high-throughput sequencing, suggesting the accuracy of the sequencing result was high. Potential target genes of the drought-responsive miRNA were predicted to be involved in diverse biological processes. Furthermore, 16 miRNA families were first identified to be involved in drought stress response from plants. These results present a comprehensive view of the conserved miRNA and their expression patterns under drought stress for DXWR, which will provide valuable information and sequence resources for future basis studies.
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
Zheng, Lianxing; Ding, Sheng
2004-04-01
Extract: RNA interference (RNAi), first discovered in Caenorhabdtitis elegans and now widely found and applied in a variety of organisms such as Drosophila, zebrafish and mammalian systems, has emerged to revolutionize the field of functional genomics by inducing specific and effective post-transcriptional gene silencing for loss-of-function studies. Mechanistic investigations of RNAi suggest that long double-stranded RNAs (dsRNAs) are first cleaved by the RNase III-like enzyme, Dicer, to 21-23 base pair (bp) small interfering RNAs (siRNAs). These siRNAs are resolved by ATP-dependent RNA helicase, and the resulting single-stranded RNAs are then incorporated into the RNA-induced silencing complex (RISC). The antisense strand of the siRNA duplex guides the RISC to the homologous mRNA, where the RISC-associated endoribonuclease cleaves the target mRNA, resulting in silencing of the target gene. The approach of using long dsRNA (up to 1-2 kb) in C. elegans and Drosophila to induce gene silencing cannot be similarly used in mammalian cells, where introduction of long dsRNA activates the dsRNA-dependent protein kinase PKR. PKR phosphorylates and inactivates the translation initiation factor eIF2, resulting in a non-specific gene-silencing effect. Development and implementation of the use of 21 to 23bp siRNAs, which can be prepared by chemical synthesis, in vitro transcription, or expressed in cells using siRNA expression systems, allows specific and effective gene silencing in mammalian cells to occur without activation of PKR.
Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J; Jopling, Catherine L
2015-04-01
MicroRNAs (miRNAs) play a major part in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with cotranscriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. Although most miRNAs are located within introns of protein-coding transcripts, a substantial minority of miRNAs originate from long noncoding (lnc) RNAs, for which transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lncRNA transcripts containing miRNAs (lnc-pri-miRNAs) do not use the canonical cleavage-and-polyadenylation pathway but instead use Microprocessor cleavage to terminate transcription. Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a new RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells.
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral
Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V
2018-06-01
The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.
Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.
2016-01-01
RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Huang, Jinguang; Zheng, Chengchao
2013-01-01
RNA helicases are enzymes that are thought to unwind double-stranded RNA molecules in an energy-dependent fashion through the hydrolysis of NTP. RNA helicases are associated with all processes involving RNA molecules, including nuclear transcription, editing, splicing, ribosome biogenesis, RNA export, and organelle gene expression. The involvement of RNA helicase in response to stress and in plant growth and development has been reported previously. While their importance in Arabidopsis and Oryza sativa has been partially studied, the function of RNA helicase proteins is poorly understood in Zea mays and Glycine max. In this study, we identified a total of RNA helicase genes in Arabidopsis and other crop species genome by genome-wide comparative in silico analysis. We classified the RNA helicase genes into three subfamilies according to the structural features of the motif II region, such as DEAD-box, DEAH-box and DExD/H-box, and different species showed different patterns of alternative splicing. Secondly, chromosome location analysis showed that the RNA helicase protein genes were distributed across all chromosomes with different densities in the four species. Thirdly, phylogenetic tree analyses identified the relevant homologs of DEAD-box, DEAH-box and DExD/H-box RNA helicase proteins in each of the four species. Fourthly, microarray expression data showed that many of these predicted RNA helicase genes were expressed in different developmental stages and different tissues under normal growth conditions. Finally, real-time quantitative PCR analysis showed that the expression levels of 10 genes in Arabidopsis and 13 genes in Zea mays were in close agreement with the microarray expression data. To our knowledge, this is the first report of a comparative genome-wide analysis of the RNA helicase gene family in Arabidopsis, Oryza sativa, Zea mays and Glycine max. This study provides valuable information for understanding the classification and putative functions of
Xu, Ruirui; Zhang, Shizhong; Huang, Jinguang; Zheng, Chengchao
2013-01-01
RNA helicases are enzymes that are thought to unwind double-stranded RNA molecules in an energy-dependent fashion through the hydrolysis of NTP. RNA helicases are associated with all processes involving RNA molecules, including nuclear transcription, editing, splicing, ribosome biogenesis, RNA export, and organelle gene expression. The involvement of RNA helicase in response to stress and in plant growth and development has been reported previously. While their importance in Arabidopsis and Oryza sativa has been partially studied, the function of RNA helicase proteins is poorly understood in Zea mays and Glycine max. In this study, we identified a total of RNA helicase genes in Arabidopsis and other crop species genome by genome-wide comparative in silico analysis. We classified the RNA helicase genes into three subfamilies according to the structural features of the motif II region, such as DEAD-box, DEAH-box and DExD/H-box, and different species showed different patterns of alternative splicing. Secondly, chromosome location analysis showed that the RNA helicase protein genes were distributed across all chromosomes with different densities in the four species. Thirdly, phylogenetic tree analyses identified the relevant homologs of DEAD-box, DEAH-box and DExD/H-box RNA helicase proteins in each of the four species. Fourthly, microarray expression data showed that many of these predicted RNA helicase genes were expressed in different developmental stages and different tissues under normal growth conditions. Finally, real-time quantitative PCR analysis showed that the expression levels of 10 genes in Arabidopsis and 13 genes in Zea mays were in close agreement with the microarray expression data. To our knowledge, this is the first report of a comparative genome-wide analysis of the RNA helicase gene family in Arabidopsis, Oryza sativa, Zea mays and Glycine max. This study provides valuable information for understanding the classification and putative functions of
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
In this study RNA interference (RNAi) screens were performed on 285 cell lines and combined with 216 lines previously screened, which were then analyzed together with DEMETER to discover genetic dependencies across the entire pool of cell lines. Read the abstract
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
RNA interference tools for the western flower thrips, Frankliniella occidentalis.
Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E
2015-05-01
The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced
Genome-wide miRNA response to anacardic acid in breast cancer cells
Schultz, David J.; Muluhngwi, Penn; Alizadeh-Rad, Negin; Green, Madelyn A.; Rouchka, Eric C.; Waigel, Sabine J.
2017-01-01
MicroRNAs are biomarkers and potential therapeutic targets for breast cancer. Anacardic acid (AnAc) is a dietary phenolic lipid that inhibits both MCF-7 estrogen receptor α (ERα) positive and MDA-MB-231 triple negative breast cancer (TNBC) cell proliferation with IC50s of 13.5 and 35 μM, respectively. To identify potential mediators of AnAc action in breast cancer, we profiled the genome-wide microRNA transcriptome (microRNAome) in these two cell lines altered by the AnAc 24:1n5 congener. Whole genome expression profiling (RNA-seq) and subsequent network analysis in MetaCore Gene Ontology (GO) algorithm was used to characterize the biological pathways altered by AnAc. In MCF-7 cells, 69 AnAc-responsive miRNAs were identified, e.g., increased let-7a and reduced miR-584. Fewer, i.e., 37 AnAc-responsive miRNAs were identified in MDA-MB-231 cells, e.g., decreased miR-23b and increased miR-1257. Only two miRNAs were increased by AnAc in both cell lines: miR-612 and miR-20b; however, opposite miRNA arm preference was noted: miR-20b-3p and miR-20b-5p were upregulated in MCF-7 and MDA-MB-231, respectively. miR-20b-5p target EFNB2 transcript levels were reduced by AnAc in MDA-MB-231 cells. AnAc reduced miR-378g that targets VIM (vimentin) and VIM mRNA transcript expression was increased in AnAc-treated MCF-7 cells, suggesting a reciprocal relationship. The top three enriched GO terms for AnAc-treated MCF-7 cells were B cell receptor signaling pathway and ribosomal large subunit biogenesis and S-adenosylmethionine metabolic process for AnAc-treated MDA-MB-231 cells. The pathways modulated by these AnAc-regulated miRNAs suggest that key nodal molecules, e.g., Cyclin D1, MYC, c-FOS, PPARγ, and SIN3, are targets of AnAc activity. PMID:28886127
Castle, John C.; Armour, Christopher D.; Löwer, Martin; Haynor, David; Biery, Matthew; Bouzek, Heather; Chen, Ronghua; Jackson, Stuart; Johnson, Jason M.; Rohl, Carol A.; Raymond, Christopher K.
2010-01-01
Non-coding RNAs (ncRNAs) are an essential class of molecular species that have been difficult to monitor on high throughput platforms due to frequent lack of polyadenylation. Using a polyadenylation-neutral amplification protocol and next-generation sequencing, we explore ncRNA expression in eleven human tissues. ncRNAs 7SL, U2, 7SK, and HBII-52 are expressed at levels far exceeding mRNAs. C/D and H/ACA box snoRNAs are associated with rRNA methylation and pseudouridylation, respectively: spleen expresses both, hypothalamus expresses mainly C/D box snoRNAs, and testes show enriched expression of both H/ACA box snoRNAs and RNA telomerase TERC. Within the snoRNA 14q cluster, 14q(I-6) is expressed at much higher levels than other cluster members. More reads align to mitochondrial than nuclear tRNAs. Many lincRNAs are actively transcribed, particularly those overlapping known ncRNAs. Within the Prader-Willi syndrome loci, the snoRNA HBII-85 (group I) cluster is highly expressed in hypothalamus, greater than in other tissues and greater than group II or III. Additionally, within the disease locus we find novel transcription across a 400,000 nt span in ovaries. This genome-wide polyA-neutral expression compendium demonstrates the richness of ncRNA expression, their high expression patterns, their function-specific expression patterns, and is publicly available. PMID:20668672
Castle, John C; Armour, Christopher D; Löwer, Martin; Haynor, David; Biery, Matthew; Bouzek, Heather; Chen, Ronghua; Jackson, Stuart; Johnson, Jason M; Rohl, Carol A; Raymond, Christopher K
2010-07-26
Non-coding RNAs (ncRNAs) are an essential class of molecular species that have been difficult to monitor on high throughput platforms due to frequent lack of polyadenylation. Using a polyadenylation-neutral amplification protocol and next-generation sequencing, we explore ncRNA expression in eleven human tissues. ncRNAs 7SL, U2, 7SK, and HBII-52 are expressed at levels far exceeding mRNAs. C/D and H/ACA box snoRNAs are associated with rRNA methylation and pseudouridylation, respectively: spleen expresses both, hypothalamus expresses mainly C/D box snoRNAs, and testes show enriched expression of both H/ACA box snoRNAs and RNA telomerase TERC. Within the snoRNA 14q cluster, 14q(I-6) is expressed at much higher levels than other cluster members. More reads align to mitochondrial than nuclear tRNAs. Many lincRNAs are actively transcribed, particularly those overlapping known ncRNAs. Within the Prader-Willi syndrome loci, the snoRNA HBII-85 (group I) cluster is highly expressed in hypothalamus, greater than in other tissues and greater than group II or III. Additionally, within the disease locus we find novel transcription across a 400,000 nt span in ovaries. This genome-wide polyA-neutral expression compendium demonstrates the richness of ncRNA expression, their high expression patterns, their function-specific expression patterns, and is publicly available.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
Meier, Jan; Hovestadt, Volker; Zapatka, Marc; Pscherer, Armin; Lichter, Peter; Seiffert, Martina
2013-01-01
MicroRNAs (miRNAs) are single-stranded, small, non-coding RNAs, which fine-tune protein expression by degrading and/or translationally inhibiting mRNAs. Manipulation of miRNA expression in animal models frequently results in severe phenotypes indicating their relevance in controlling cellular functions, most likely by interacting with multiple targets. To better understand the effect of miRNA activities, genome-wide analysis of their targets are required. MicroRNA profiling as well as transcriptome analysis upon enforced miRNA expression were frequently used to investigate their relevance. However, these approaches often fail to identify relevant miRNAs targets. Therefore, we tested the precision of RNA-interacting protein immunoprecipitation (RIP) using AGO2-specific antibodies, a core component of the “RNA-induced silencing complex” (RISC), followed by RNA sequencing (Seq) in a defined cellular system, the HEK293T cells with stable, ectopic expression of miR-155. Thereby, we identified 100 AGO2-associated mRNAs in miR-155-expressing cells, of which 67 were in silico predicted miR-155 target genes. An integrated analysis of the corresponding expression profiles indicated that these targets were either regulated by mRNA decay or by translational repression. Of the identified miR-155 targets, 17 were related to cell cycle control, suggesting their involvement in the observed increase in cell proliferation of HEK293T cells upon miR-155 expression. Additional, secondary changes within the gene expression profile were detected and might contribute to this phenotype as well. Interestingly, by analyzing RIP-Seq data of HEK-293T cells and two B-cell lines we identified a recurrent disproportional enrichment of several miRNAs, including miR-155 and miRNAs of the miR-17-92 cluster, in the AGO2-associated precipitates, suggesting discrepancies in miRNA expression and activity. PMID:23673373
Park, Jeongbin; Bae, Sangsu
2018-03-15
Following the type II CRISPR-Cas9 system, type V CRISPR-Cpf1 endonucleases have been found to be applicable for genome editing in various organisms in vivo. However, there are as yet no web-based tools capable of optimally selecting guide RNAs (gRNAs) among all possible genome-wide target sites. Here, we present Cpf1-Database, a genome-wide gRNA library design tool for LbCpf1 and AsCpf1, which have DNA recognition sequences of 5'-TTTN-3' at the 5' ends of target sites. Cpf1-Database provides a sophisticated but simple way to design gRNAs for AsCpf1 nucleases on the genome scale. One can easily access the data using a straightforward web interface, and using the powerful collections feature one can easily design gRNAs for thousands of genes in short time. Free access at http://www.rgenome.net/cpf1-database/. sangsubae@hanyang.ac.kr.
Macchiaroli, Natalia; Maldonado, Lucas L; Zarowiecki, Magdalena; Cucher, Marcela; Gismondi, María Inés; Kamenetzky, Laura; Rosenzvit, Mara Cecilia
2017-06-01
MicroRNAs (miRNAs), a class of small non-coding RNAs, are key regulators of gene expression at post-transcriptional level and play essential roles in biological processes such as development. MiRNAs silence target mRNAs by binding to complementary sequences in the 3'untranslated regions (3'UTRs). The parasitic helminths of the genus Echinococcus are the causative agents of echinococcosis, a zoonotic neglected disease. In previous work, we performed a comprehensive identification and characterization of Echinococcus miRNAs. However, current knowledge about their targets is limited. Since target prediction algorithms rely on complementarity between 3'UTRs and miRNA sequences, a major limitation is the lack of accurate sequence information of 3'UTR for most species including parasitic helminths. We performed RNA-seq and developed a pipeline that integrates the transcriptomic data with available genomic data of this parasite in order to identify 3'UTRs of Echinococcus canadensis. The high confidence set of 3'UTRs obtained allowed the prediction of miRNA targets in Echinococcus through a bioinformatic approach. We performed for the first time a comparative analysis of miRNA targets in Echinococcus and Taenia. We found that many evolutionarily conserved target sites in Echinococcus and Taenia may be functional and under selective pressure. Signaling pathways such as MAPK and Wnt were among the most represented pathways indicating miRNA roles in parasite growth and development. Genome-wide identification and characterization of miRNA target genes in Echinococcus provide valuable information to guide experimental studies in order to understand miRNA functions in the parasites biology. miRNAs involved in essential functions, especially those being absent in the host or showing sequence divergence with respect to host orthologs, might be considered as novel therapeutic targets for echinococcosis control. Copyright © 2017 Elsevier B.V. All rights reserved.
Deconvolution of seed and RNA-binding protein crosstalk in RNAi-based functional genomics.
Suzuki, Hiroshi I; Spengler, Ryan M; Grigelioniene, Giedre; Kobayashi, Tatsuya; Sharp, Phillip A
2018-05-01
RNA interference (RNAi) is a major, powerful platform for gene perturbations, but is restricted by off-target mechanisms. Communication between RNAs, small RNAs, and RNA-binding proteins (RBPs) is a pervasive feature of cellular RNA networks. We present a crosstalk scenario, designated as crosstalk with endogenous RBPs' (ceRBP), in which small interfering RNAs or microRNAs with seed sequences that overlap RBP motifs have extended biological effects by perturbing endogenous RBP activity. Systematic analysis of small interfering RNA (siRNA) off-target data and genome-wide RNAi cancer lethality screens using 501 human cancer cell lines, a cancer dependency map, identified that seed-to-RBP crosstalk is widespread, contributes to off-target activity, and affects RNAi performance. Specifically, deconvolution of the interactions between gene knockdown and seed-mediated silencing effects in the cancer dependency map showed widespread contributions of seed-to-RBP crosstalk to growth-phenotype modulation. These findings suggest a novel aspect of microRNA biology and offer a basis for improvement of RNAi agents and RNAi-based functional genomics.
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.
Huang, Mei; Wu, Joseph C
2011-01-01
Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.
Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia
Huang, Mei; Wu, Joseph C.
2011-01-01
Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia
2017-01-01
Abstract Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an ‘all-or-none’ pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. PMID:28520982
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds
Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.
2012-01-01
Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei
2017-04-01
Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.
Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R
2008-11-01
Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.
Genome-wide association of mediator and RNA polymerase II in wild-type and mediator mutant yeast.
Paul, Emily; Zhu, Z Iris; Landsman, David; Morse, Randall H
2015-01-01
Mediator is a large, multisubunit complex that is required for essentially all mRNA transcription in eukaryotes. In spite of the importance of Mediator, the range of its targets and how it is recruited to these is not well understood. Previous work showed that in Saccharomyces cerevisiae, Mediator contributes to transcriptional activation by two distinct mechanisms, one depending on the tail module triad and favoring SAGA-regulated genes, and the second occurring independently of the tail module and favoring TFIID-regulated genes. Here, we use chromatin immunoprecipitation sequencing (ChIP-seq) to show that dependence on tail module subunits for Mediator recruitment and polymerase II (Pol II) association occurs preferentially at SAGA-regulated over TFIID-regulated genes on a genome-wide scale. We also show that recruitment of tail module subunits to active gene promoters continues genome-wide when Mediator integrity is compromised in med17 temperature-sensitive (ts) yeast, demonstrating the modular nature of the Mediator complex in vivo. In addition, our data indicate that promoters exhibiting strong and stable occupancy by Mediator have a wide range of activity and are enriched for targets of the Tup1-Cyc8 repressor complex. We also identify a number of strong Mediator occupancy peaks that overlap dubious open reading frames (ORFs) and are likely to include previously unrecognized upstream activator sequences. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Genome-Wide Association of Mediator and RNA Polymerase II in Wild-Type and Mediator Mutant Yeast
Paul, Emily; Zhu, Z. Iris
2014-01-01
Mediator is a large, multisubunit complex that is required for essentially all mRNA transcription in eukaryotes. In spite of the importance of Mediator, the range of its targets and how it is recruited to these is not well understood. Previous work showed that in Saccharomyces cerevisiae, Mediator contributes to transcriptional activation by two distinct mechanisms, one depending on the tail module triad and favoring SAGA-regulated genes, and the second occurring independently of the tail module and favoring TFIID-regulated genes. Here, we use chromatin immunoprecipitation sequencing (ChIP-seq) to show that dependence on tail module subunits for Mediator recruitment and polymerase II (Pol II) association occurs preferentially at SAGA-regulated over TFIID-regulated genes on a genome-wide scale. We also show that recruitment of tail module subunits to active gene promoters continues genome-wide when Mediator integrity is compromised in med17 temperature-sensitive (ts) yeast, demonstrating the modular nature of the Mediator complex in vivo. In addition, our data indicate that promoters exhibiting strong and stable occupancy by Mediator have a wide range of activity and are enriched for targets of the Tup1-Cyc8 repressor complex. We also identify a number of strong Mediator occupancy peaks that overlap dubious open reading frames (ORFs) and are likely to include previously unrecognized upstream activator sequences. PMID:25368384
Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng
2013-11-01
Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
Huang, Yong-Zhen; Sun, Jia-Jie; Zhang, Liang-Zhi; Li, Cong-Jun; Womack, James E.; Li, Zhuan-Jian; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong
2014-01-01
DNA methylation is a key epigenetic modification in mammals and plays important roles in muscle development. We sampled longissimus dorsi muscle (LDM) from a well-known elite native breed of Chinese Qinchuan cattle living within the same environment but displaying distinct skeletal muscle at the fetal and adult stages. We generated and provided a genome-wide landscape of DNA methylomes and their relationship with mRNA and miRNA for fetal and adult muscle studies. Integration analysis revealed a total of 77 and 1,054 negatively correlated genes with methylation in the promoter and gene body regions, respectively, in both the fetal and adult bovine libraries. Furthermore, we identified expression patterns of high-read genes that exhibit a negative correlation between methylation and expression from nine different tissues at multiple developmental stages of bovine muscle-related tissue or organs. In addition, we validated the MeDIP-Seq results by bisulfite sequencing PCR (BSP) in some of the differentially methylated promoters. Together, these results provide valuable data for future biomedical research and genomic and epigenomic studies of bovine skeletal muscle that may help uncover the molecular basis underlying economically valuable traits in cattle. This comprehensive map also provides a solid basis for exploring the epigenetic mechanisms of muscle growth and development. PMID:25306978
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Andritschke, Daniel; Dilling, Sabrina; Emmenlauer, Mario; Welz, Tobias; Schmich, Fabian; Misselwitz, Benjamin; Rämö, Pauli; Rottner, Klemens; Kerkhoff, Eugen; Wada, Teiji; Penninger, Josef M.; Beerenwinkel, Niko; Horvath, Peter; Dehio, Christoph; Hardt, Wolf-Dietrich
2016-01-01
Salmonella Typhimurium (S. Tm) is a leading cause of diarrhea. The disease is triggered by pathogen invasion into the gut epithelium. Invasion is attributed to the SPI-1 type 3 secretion system (T1). T1 injects effector proteins into epithelial cells and thereby elicits rearrangements of the host cellular actin cytoskeleton and pathogen invasion. The T1 effector proteins SopE, SopB, SopE2 and SipA are contributing to this. However, the host cell factors contributing to invasion are still not completely understood. To address this question comprehensively, we used Hela tissue culture cells, a genome-wide siRNA library, a modified gentamicin protection assay and S. TmSipA, a sopBsopE2sopE mutant which strongly relies on the T1 effector protein SipA to invade host cells. We found that S. TmSipA invasion does not elicit membrane ruffles, nor promote the entry of non-invasive bacteria "in trans". However, SipA-mediated infection involved the SPIRE family of actin nucleators, besides well-established host cell factors (WRC, ARP2/3, RhoGTPases, COPI). Stage-specific follow-up assays and knockout fibroblasts indicated that SPIRE1 and SPIRE2 are involved in different steps of the S. Tm infection process. Whereas SPIRE1 interferes with bacterial binding, SPIRE2 influences intracellular replication of S. Tm. Hence, these two proteins might fulfill non-redundant functions in the pathogen-host interaction. The lack of co-localization hints to a short, direct interaction between S. Tm and SPIRE proteins or to an indirect effect. PMID:27627128
Walker, William B; Allen, Margaret L
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.
Walker, William B.; Allen, Margaret L.
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
MicroRNA-138 is a potential regulator of memory performance in humans
Schröder, Julia; Ansaloni, Sara; Schilling, Marcel; Liu, Tian; Radke, Josefine; Jaedicke, Marian; Schjeide, Brit-Maren M.; Mashychev, Andriy; Tegeler, Christina; Radbruch, Helena; Papenberg, Goran; Düzel, Sandra; Demuth, Ilja; Bucholtz, Nina; Lindenberger, Ulman; Li, Shu-Chen; Steinhagen-Thiessen, Elisabeth; Lill, Christina M.; Bertram, Lars
2014-01-01
Genetic factors underlie a substantial proportion of individual differences in cognitive functions in humans, including processes related to episodic and working memory. While genetic association studies have proposed several candidate “memory genes,” these currently explain only a minor fraction of the phenotypic variance. Here, we performed genome-wide screening on 13 episodic and working memory phenotypes in 1318 participants of the Berlin Aging Study II aged 60 years or older. The analyses highlight a number of novel single nucleotide polymorphisms (SNPs) associated with memory performance, including one located in a putative regulatory region of microRNA (miRNA) hsa-mir-138-5p (rs9882688, P-value = 7.8 × 10−9). Expression quantitative trait locus analyses on next-generation RNA-sequencing data revealed that rs9882688 genotypes show a significant correlation with the expression levels of this miRNA in 309 human lymphoblastoid cell lines (P-value = 5 × 10−4). In silico modeling of other top-ranking GWAS signals identified an additional memory-associated SNP in the 3′ untranslated region (3′ UTR) of DCP1B, a gene encoding a core component of the mRNA decapping complex in humans, predicted to interfere with hsa-mir-138-5p binding. This prediction was confirmed in vitro by luciferase assays showing differential binding of hsa-mir-138-5p to 3′ UTR reporter constructs in two human cell lines (HEK293: P-value = 0.0470; SH-SY5Y: P-value = 0.0866). Finally, expression profiling of hsa-mir-138-5p and DCP1B mRNA in human post-mortem brain tissue revealed that both molecules are expressed simultaneously in frontal cortex and hippocampus, suggesting that the proposed interaction between hsa-mir-138-5p and DCP1B may also take place in vivo. In summary, by combining unbiased genome-wide screening with extensive in silico modeling, in vitro functional assays, and gene expression profiling, our study identified miRNA-138 as a potential molecular regulator of
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
McCAIN, JACK
2004-01-01
Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488
Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.
Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong
2016-01-01
We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.
RNA editing in nascent RNA affects pre-mRNA splicing
Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Yang, Yun; Lin, Xianzhi; Tran, Stephen; Yang, Ei-Wen; Quinones-Valdez, Giovanni
2018-01-01
In eukaryotes, nascent RNA transcripts undergo an intricate series of RNA processing steps to achieve mRNA maturation. RNA editing and alternative splicing are two major RNA processing steps that can introduce significant modifications to the final gene products. By tackling these processes in isolation, recent studies have enabled substantial progress in understanding their global RNA targets and regulatory pathways. However, the interplay between individual steps of RNA processing, an essential aspect of gene regulation, remains poorly understood. By sequencing the RNA of different subcellular fractions, we examined the timing of adenosine-to-inosine (A-to-I) RNA editing and its impact on alternative splicing. We observed that >95% A-to-I RNA editing events occurred in the chromatin-associated RNA prior to polyadenylation. We report about 500 editing sites in the 3′ acceptor sequences that can alter splicing of the associated exons. These exons are highly conserved during evolution and reside in genes with important cellular function. Furthermore, we identified a second class of exons whose splicing is likely modulated by RNA secondary structures that are recognized by the RNA editing machinery. The genome-wide analyses, supported by experimental validations, revealed remarkable interplay between RNA editing and splicing and expanded the repertoire of functional RNA editing sites. PMID:29724793
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
2012-01-01
Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894
Bodemann, Brian; Petersen, Sean; Aruri, Jayavani; Koshy, Shiney; Richardson, Zachary; Le, Lu Q.; Krasieva, Tatiana; Roth, Michael G.; Farmer, Pat; White, Michael A.
2008-01-01
Melanin protects the skin and eyes from the harmful effects of UV irradiation, protects neural cells from toxic insults, and is required for sound conduction in the inner ear. Aberrant regulation of melanogenesis underlies skin disorders (melasma and vitiligo), neurologic disorders (Parkinson's disease), auditory disorders (Waardenburg's syndrome), and opthalmologic disorders (age related macular degeneration). Much of the core synthetic machinery driving melanin production has been identified; however, the spectrum of gene products participating in melanogenesis in different physiological niches is poorly understood. Functional genomics based on RNA-mediated interference (RNAi) provides the opportunity to derive unbiased comprehensive collections of pharmaceutically tractable single gene targets supporting melanin production. In this study, we have combined a high-throughput, cell-based, one-well/one-gene screening platform with a genome-wide arrayed synthetic library of chemically synthesized, small interfering RNAs to identify novel biological pathways that govern melanin biogenesis in human melanocytes. Ninety-two novel genes that support pigment production were identified with a low false discovery rate. Secondary validation and preliminary mechanistic studies identified a large panel of targets that converge on tyrosinase expression and stability. Small molecule inhibition of a family of gene products in this class was sufficient to impair chronic tyrosinase expression in pigmented melanoma cells and UV-induced tyrosinase expression in primary melanocytes. Isolation of molecular machinery known to support autophagosome biosynthesis from this screen, together with in vitro and in vivo validation, exposed a close functional relationship between melanogenesis and autophagy. In summary, these studies illustrate the power of RNAi-based functional genomics to identify novel genes, pathways, and pharmacologic agents that impact a biological phenotype and operate
2013-01-01
Background MicroRNAs (miRNAs) are small non-coding RNAs that play critical roles in regulating post transcriptional gene expression. Gall midges encompass a large group of insects that are of economic importance and also possess fascinating biological traits. The gall midge Mayetiola destructor, commonly known as the Hessian fly, is a destructive pest of wheat and model organism for studying gall midge biology and insect – host plant interactions. Results In this study, we systematically analyzed miRNAs from the Hessian fly. Deep-sequencing a Hessian fly larval transcriptome led to the identification of 89 miRNA species that are either identical or very similar to known miRNAs from other insects, and 184 novel miRNAs that have not been reported from other species. A genome-wide search through a draft Hessian fly genome sequence identified a total of 611 putative miRNA-encoding genes based on sequence similarity and the existence of a stem-loop structure for miRNA precursors. Analysis of the 611 putative genes revealed a striking feature: the dramatic expansion of several miRNA gene families. The largest family contained 91 genes that encoded 20 different miRNAs. Microarray analyses revealed the expression of miRNA genes was strictly regulated during Hessian fly larval development and abundance of many miRNA genes were affected by host genotypes. Conclusion The identification of a large number of miRNAs for the first time from a gall midge provides a foundation for further studies of miRNA functions in gall midge biology and behavior. The dramatic expansion of identical or similar miRNAs provides a unique system to study functional relations among miRNA iso-genes as well as changes in sequence specificity due to small changes in miRNAs and in their mRNA targets. These results may also facilitate the identification of miRNA genes for potential pest control through transgenic approaches. PMID:23496979
Traverse, Charles C.
2017-01-01
ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
RNA editing in nascent RNA affects pre-mRNA splicing.
Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Yang, Yun; Lin, Xianzhi; Tran, Stephen; Yang, Ei-Wen; Quinones-Valdez, Giovanni; Xiao, Xinshu
2018-06-01
In eukaryotes, nascent RNA transcripts undergo an intricate series of RNA processing steps to achieve mRNA maturation. RNA editing and alternative splicing are two major RNA processing steps that can introduce significant modifications to the final gene products. By tackling these processes in isolation, recent studies have enabled substantial progress in understanding their global RNA targets and regulatory pathways. However, the interplay between individual steps of RNA processing, an essential aspect of gene regulation, remains poorly understood. By sequencing the RNA of different subcellular fractions, we examined the timing of adenosine-to-inosine (A-to-I) RNA editing and its impact on alternative splicing. We observed that >95% A-to-I RNA editing events occurred in the chromatin-associated RNA prior to polyadenylation. We report about 500 editing sites in the 3' acceptor sequences that can alter splicing of the associated exons. These exons are highly conserved during evolution and reside in genes with important cellular function. Furthermore, we identified a second class of exons whose splicing is likely modulated by RNA secondary structures that are recognized by the RNA editing machinery. The genome-wide analyses, supported by experimental validations, revealed remarkable interplay between RNA editing and splicing and expanded the repertoire of functional RNA editing sites. © 2018 Hsiao et al.; Published by Cold Spring Harbor Laboratory Press.
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-07-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth
Cheung, Gordon Y C; Villaruz, Amer E; Joo, Hwang-Soo; Duong, Anthony C; Yeh, Anthony J; Nguyen, Thuan H; Sturdevant, Daniel E; Queck, S Y; Otto, M
2014-07-01
Several methicillin resistance (SCCmec) clusters characteristic of hospital-associated methicillin-resistant Staphylococcus aureus (MRSA) strains harbor the psm-mec locus. In addition to encoding the cytolysin, phenol-soluble modulin (PSM)-mec, this locus has been attributed gene regulatory functions. Here we employed genome-wide transcriptional profiling to define the regulatory function of the psm-mec locus. The immune evasion factor protein A emerged as the primary conserved and strongly regulated target of psm-mec, an effect we show is mediated by the psm-mec RNA. Furthermore, the psm-mec locus exerted regulatory effects that were more moderate in extent. For example, expression of PSM-mec limited expression of mecA, thereby decreasing methicillin resistance. Our study shows that the psm-mec locus has a rare dual regulatory RNA and encoded cytolysin function. Furthermore, our findings reveal a specific mechanism underscoring the recently emerging concept that S. aureus strains balance pronounced virulence and high expression of antibiotic resistance. Published by Elsevier GmbH.
Zhang, Yong; Gu, Lianfeng; Hou, Yifeng; Wang, Lulu; Deng, Xian; Hang, Runlai; Chen, Dong; Zhang, Xiansheng; Zhang, Yi; Liu, Chunyan; Cao, Xiaofeng
2015-01-01
Alternative polyadenylation (APA) is a widespread mechanism for gene regulation and has been implicated in flowering, but the molecular basis governing the choice of a specific poly(A) site during the vegetative-to-reproductive growth transition remains unclear. Here we characterize HLP1, an hnRNP A/B protein as a novel regulator for pre-mRNA 3′-end processing in Arabidopsis. Genetic analysis reveals that HLP1 suppresses Flowering Locus C (FLC), a key repressor of flowering in Arabidopsis. Genome-wide mapping of HLP1-RNA interactions indicates that HLP1 binds preferentially to A-rich and U-rich elements around cleavage and polyadenylation sites, implicating its role in 3′-end formation. We show HLP1 is significantly enriched at transcripts involved in RNA metabolism and flowering. Comprehensive profiling of the poly(A) site usage reveals that HLP1 mutations cause thousands of poly(A) site shifts. A distal-to-proximal poly(A) site shift in the flowering regulator FCA, a direct target of HLP1, leads to upregulation of FLC and delayed flowering. Our results elucidate that HLP1 is a novel factor involved in 3′-end processing and controls reproductive timing via targeting APA. PMID:26099751
Yu, Hua; Jiao, Bingke; Lu, Lu; Wang, Pengfei; Chen, Shuangcheng; Liang, Chengzhi; Liu, Wei
2018-01-01
Accurately reconstructing gene co-expression network is of great importance for uncovering the genetic architecture underlying complex and various phenotypes. The recent availability of high-throughput RNA-seq sequencing has made genome-wide detecting and quantifying of the novel, rare and low-abundance transcripts practical. However, its potential merits in reconstructing gene co-expression network have still not been well explored. Using massive-scale RNA-seq samples, we have designed an ensemble pipeline, called NetMiner, for building genome-scale and high-quality Gene Co-expression Network (GCN) by integrating three frequently used inference algorithms. We constructed a RNA-seq-based GCN in one species of monocot rice. The quality of network obtained by our method was verified and evaluated by the curated gene functional association data sets, which obviously outperformed each single method. In addition, the powerful capability of network for associating genes with functions and agronomic traits was shown by enrichment analysis and case studies. In particular, we demonstrated the potential value of our proposed method to predict the biological roles of unknown protein-coding genes, long non-coding RNA (lncRNA) genes and circular RNA (circRNA) genes. Our results provided a valuable and highly reliable data source to select key candidate genes for subsequent experimental validation. To facilitate identification of novel genes regulating important biological processes and phenotypes in other plants or animals, we have published the source code of NetMiner, making it freely available at https://github.com/czllab/NetMiner.
Weiss, Andy; Broach, William H.; Wiemels, Richard E.; Mogen, Austin B.; Rice, Kelly C.
2016-01-01
ABSTRACT In Staphylococcus aureus, hundreds of small regulatory or small RNAs (sRNAs) have been identified, yet this class of molecule remains poorly understood and severely understudied. sRNA genes are typically absent from genome annotation files, and as a consequence, their existence is often overlooked, particularly in global transcriptomic studies. To facilitate improved detection and analysis of sRNAs in S. aureus, we generated updated GenBank files for three commonly used S. aureus strains (MRSA252, NCTC 8325, and USA300), in which we added annotations for >260 previously identified sRNAs. These files, the first to include genome-wide annotation of sRNAs in S. aureus, were then used as a foundation to identify novel sRNAs in the community-associated methicillin-resistant strain USA300. This analysis led to the discovery of 39 previously unidentified sRNAs. Investigating the genomic loci of the newly identified sRNAs revealed a surprising degree of inconsistency in genome annotation in S. aureus, which may be hindering the analysis and functional exploration of these elements. Finally, using our newly created annotation files as a reference, we perform a global analysis of sRNA gene expression in S. aureus and demonstrate that the newly identified tsr25 is the most highly upregulated sRNA in human serum. This study provides an invaluable resource to the S. aureus research community in the form of our newly generated annotation files, while at the same time presenting the first examination of differential sRNA expression in pathophysiologically relevant conditions. PMID:26861020
Genome-wide association between DNA methylation and alternative splicing in an invertebrate
2012-01-01
Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee) and Nasonia vitripennis (jewel wasp) analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq) to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice variants by positively
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
A Genome-Wide siRNA Screen in Mammalian Cells for Regulators of S6 Phosphorylation
Papageorgiou, Angela; Rapley, Joseph; Mesirov, Jill P.; Tamayo, Pablo; Avruch, Joseph
2015-01-01
mTOR complex1, the major regulator of mRNA translation in all eukaryotic cells, is strongly activated in most cancers. We performed a genome-wide RNAi screen in a human cancer cell line, seeking genes that regulate S6 phosphorylation, readout of mTORC1 activity. Applying a stringent selection, we retrieved nearly 600 genes wherein at least two RNAis gave significant reduction in S6-P. This cohort contains known regulators of mTOR complex 1 and is significantly enriched in genes whose depletion affects the proliferation/viability of the large set of cancer cell lines in the Achilles database in a manner paralleling that caused by mTOR depletion. We next examined the effect of RNAi pools directed at 534 of these gene products on S6-P in TSC1 null mouse embryo fibroblasts. 76 RNAis reduced S6 phosphorylation significantly in 2 or 3 replicates. Surprisingly, among this cohort of genes the only elements previously associated with the maintenance of mTORC1 activity are two subunits of the vacuolar ATPase and the CUL4 subunit DDB1. RNAi against a second set of 84 targets reduced S6-P in only one of three replicates. However, an indication that this group also bears attention is the presence of rpS6KB1 itself, Rac1 and MAP4K3, a protein kinase that supports amino acid signaling to rpS6KB1. The finding that S6 phosphorylation requires a previously unidentified, functionally diverse cohort of genes that participate in fundamental cellular processes such as mRNA translation, RNA processing, DNA repair and metabolism suggests the operation of feedback pathways in the regulation of mTORC1 operating through novel mechanisms. PMID:25790369
Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference
Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant
2015-01-01
The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
RNA interference therapy: a new solution for intracranial atherosclerosis?
Tang, Tao; Wong, Ka-Sing
2014-01-01
Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054
Adamia, Sophia; Haibe-Kains, Benjamin; Pilarski, Patrick M; Bar-Natan, Michal; Pevzner, Samuel; Avet-Loiseau, Herve; Lode, Laurence; Verselis, Sigitas; Fox, Edward A; Burke, John; Galinsky, Ilene; Dagogo-Jack, Ibiayi; Wadleigh, Martha; Steensma, David P; Motyckova, Gabriela; Deangelo, Daniel J; Quackenbush, John; Stone, Richard; Griffin, James D
2014-03-01
Despite new treatments, acute myeloid leukemia (AML) remains an incurable disease. More effective drug design requires an expanded view of the molecular complexity that underlies AML. Alternative splicing of RNA is used by normal cells to generate protein diversity. Growing evidence indicates that aberrant splicing of genes plays a key role in cancer. We investigated genome-wide splicing abnormalities in AML and based on these abnormalities, we aimed to identify novel potential biomarkers and therapeutic targets. We used genome-wide alternative splicing screening to investigate alternative splicing abnormalities in two independent AML patient cohorts [Dana-Farber Cancer Institute (DFCI) (Boston, MA) and University Hospital de Nantes (UHN) (Nantes, France)] and normal donors. Selected splicing events were confirmed through cloning and sequencing analysis, and than validated in 193 patients with AML. Our results show that approximately 29% of expressed genes genome-wide were differentially and recurrently spliced in patients with AML compared with normal donors bone marrow CD34(+) cells. Results were reproducible in two independent AML cohorts. In both cohorts, annotation analyses indicated similar proportions of differentially spliced genes encoding several oncogenes, tumor suppressor proteins, splicing factors, and heterogeneous-nuclear-ribonucleoproteins, proteins involved in apoptosis, cell proliferation, and spliceosome assembly. Our findings are consistent with reports for other malignances and indicate that AML-specific aberrations in splicing mechanisms are a hallmark of AML pathogenesis. Overall, our results suggest that aberrant splicing is a common characteristic for AML. Our findings also suggest that splice variant transcripts that are the result of splicing aberrations create novel disease markers and provide potential targets for small molecules or antibody therapeutics for this disease. ©2013 AACR
Gene expression levels as endophenotypes in genome-wide association studies of Alzheimer disease
Zou, F.; Carrasquillo, M. M.; Pankratz, V. S.; Belbin, O.; Morgan, K.; Allen, M.; Wilcox, S. L.; Ma, L.; Walker, L. P.; Kouri, N.; Burgess, J. D.; Younkin, L. H.; Younkin, Samuel G.; Younkin, C. S.; Bisceglio, G. D.; Crook, J. E.; Dickson, D. W.; Petersen, R. C.; Graff-Radford, N.; Younkin, Steven G.; Ertekin-Taner, N.
2010-01-01
Background: Late-onset Alzheimer disease (LOAD) is a common disorder with a substantial genetic component. We postulate that many disease susceptibility variants act by altering gene expression levels. Methods: We measured messenger RNA (mRNA) expression levels of 12 LOAD candidate genes in the cerebella of 200 subjects with LOAD. Using the genotypes from our LOAD genome-wide association study for the cis-single nucleotide polymorphisms (SNPs) (n = 619) of these 12 LOAD candidate genes, we tested for associations with expression levels as endophenotypes. The strongest expression cis-SNP was tested for AD association in 7 independent case-control series (2,280 AD and 2,396 controls). Results: We identified 3 SNPs that associated significantly with IDE (insulin degrading enzyme) expression levels. A single copy of the minor allele for each significant SNP was associated with ∼twofold higher IDE expression levels. The most significant SNP, rs7910977, is 4.2 kb beyond the 3′ end of IDE. The association observed with this SNP was significant even at the genome-wide level (p = 2.7 × 10−8). Furthermore, the minor allele of rs7910977 associated significantly (p = 0.0046) with reduced LOAD risk (OR = 0.81 with a 95% CI of 0.70-0.94), as expected biologically from its association with elevated IDE expression. Conclusions: These results provide strong evidence that IDE is a late-onset Alzheimer disease (LOAD) gene with variants that modify risk of LOAD by influencing IDE expression. They also suggest that the use of expression levels as endophenotypes in genome-wide association studies may provide a powerful approach for the identification of disease susceptibility alleles. GLOSSARY AD = Alzheimer disease; CI = confidence interval; GWAS = genome-wide association study; LOAD = late-onset Alzheimer disease; mRNA = messenger RNA; OR = odds ratio; SNP = single nucleotide polymorphism. PMID:20142614
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J
2015-01-01
MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
New basic approach to treat non-small cell lung cancer based on RNA-interference.
Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias
2014-03-01
To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.
Runo, Steven
2011-01-01
RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.
Carroll, Ronan K; Weiss, Andy; Broach, William H; Wiemels, Richard E; Mogen, Austin B; Rice, Kelly C; Shaw, Lindsey N
2016-02-09
In Staphylococcus aureus, hundreds of small regulatory or small RNAs (sRNAs) have been identified, yet this class of molecule remains poorly understood and severely understudied. sRNA genes are typically absent from genome annotation files, and as a consequence, their existence is often overlooked, particularly in global transcriptomic studies. To facilitate improved detection and analysis of sRNAs in S. aureus, we generated updated GenBank files for three commonly used S. aureus strains (MRSA252, NCTC 8325, and USA300), in which we added annotations for >260 previously identified sRNAs. These files, the first to include genome-wide annotation of sRNAs in S. aureus, were then used as a foundation to identify novel sRNAs in the community-associated methicillin-resistant strain USA300. This analysis led to the discovery of 39 previously unidentified sRNAs. Investigating the genomic loci of the newly identified sRNAs revealed a surprising degree of inconsistency in genome annotation in S. aureus, which may be hindering the analysis and functional exploration of these elements. Finally, using our newly created annotation files as a reference, we perform a global analysis of sRNA gene expression in S. aureus and demonstrate that the newly identified tsr25 is the most highly upregulated sRNA in human serum. This study provides an invaluable resource to the S. aureus research community in the form of our newly generated annotation files, while at the same time presenting the first examination of differential sRNA expression in pathophysiologically relevant conditions. Despite a large number of studies identifying regulatory or small RNA (sRNA) genes in Staphylococcus aureus, their annotation is notably lacking in available genome files. In addition to this, there has been a considerable lack of cross-referencing in the wealth of studies identifying these elements, often leading to the same sRNA being identified multiple times and bearing multiple names. In this work
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
2012-01-01
Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.
Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin
2013-06-01
Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.
Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M
2017-03-27
Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide
Lipchina, Inna; Elkabetz, Yechiel; Hafner, Markus; Sheridan, Robert; Mihailovic, Aleksandra; Tuschl, Thomas; Sander, Chris; Studer, Lorenz; Betel, Doron
2011-01-01
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-β signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area. PMID:22012620
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Genome-wide characterization of Mediator recruitment, function, and regulation.
Grünberg, Sebastian; Zentner, Gabriel E
2017-05-27
Mediator is a conserved and essential coactivator complex broadly required for RNA polymerase II (RNAPII) transcription. Recent genome-wide studies of Mediator binding in budding yeast have revealed new insights into the functions of this critical complex and raised new questions about its role in the regulation of gene expression.
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko
2018-01-01
Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.
Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong
2009-03-01
To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
Genome-wide characterization of Mediator recruitment, function, and regulation
2017-01-01
ABSTRACT Mediator is a conserved and essential coactivator complex broadly required for RNA polymerase II (RNAPII) transcription. Recent genome-wide studies of Mediator binding in budding yeast have revealed new insights into the functions of this critical complex and raised new questions about its role in the regulation of gene expression. PMID:28301289
Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung
2018-05-01
The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-04-01
Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.
Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-01-01
Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493
Dan Cullen
2004-01-01
In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...
Hsu, Shih-Feng; Su, Wen-Chi; Jeng, King-Song
2015-01-01
ABSTRACT Influenza A virus (IAV) depends on cellular factors to complete its replication cycle; thus, investigation of the factors utilized by IAV may facilitate antiviral drug development. To this end, a cellular transcriptional repressor, DR1, was identified from a genome-wide RNA interference (RNAi) screen. Knockdown (KD) of DR1 resulted in reductions of viral RNA and protein production, demonstrating that DR1 acts as a positive host factor in IAV replication. Genome-wide transcriptomic analysis showed that there was a strong induction of interferon-stimulated gene (ISG) expression after prolonged DR1 KD. We found that beta interferon (IFN-β) was induced by DR1 KD, thereby activating the JAK-STAT pathway to turn on ISG expression, which led to a strong inhibition of IAV replication. This result suggests that DR1 in normal cells suppresses IFN induction, probably to prevent undesired cytokine production, but that this suppression may create a milieu that favors IAV replication once cells are infected. Furthermore, biochemical assays of viral RNA replication showed that DR1 KD suppressed viral RNA replication. We also showed that DR1 associated with all three subunits of the viral RNA-dependent RNA polymerase (RdRp) complex, indicating that DR1 may interact with individual components of the viral RdRp complex to enhance viral RNA replication. Thus, DR1 may be considered a novel host susceptibility gene for IAV replication via a dual mechanism, not only suppressing the host defense to indirectly favor IAV replication but also directly facilitating viral RNA replication. IMPORTANCE Investigations of virus-host interactions involved in influenza A virus (IAV) replication are important for understanding viral pathogenesis and host defenses, which may manipulate influenza virus infection or prevent the emergence of drug resistance caused by a high error rate during viral RNA replication. For this purpose, a cellular transcriptional repressor, DR1, was identified from
RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells
Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V
2006-01-01
Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456
New Era of Studying RNA Secondary Structure and Its Influence on Gene Regulation in Plants.
Yang, Xiaofei; Yang, Minglei; Deng, Hongjing; Ding, Yiliang
2018-01-01
The dynamic structure of RNA plays a central role in post-transcriptional regulation of gene expression such as RNA maturation, degradation, and translation. With the rise of next-generation sequencing, the study of RNA structure has been transformed from in vitro low-throughput RNA structure probing methods to in vivo high-throughput RNA structure profiling. The development of these methods enables incremental studies on the function of RNA structure to be performed, revealing new insights of novel regulatory mechanisms of RNA structure in plants. Genome-wide scale RNA structure profiling allows us to investigate general RNA structural features over 10s of 1000s of mRNAs and to compare RNA structuromes between plant species. Here, we provide a comprehensive and up-to-date overview of: (i) RNA structure probing methods; (ii) the biological functions of RNA structure; (iii) genome-wide RNA structural features corresponding to their regulatory mechanisms; and (iv) RNA structurome evolution in plants.
Genome-wide siRNA screen identifies UNC50 as a regulator of Shiga toxin 2 trafficking
Iles, Lakesla R.; Bartholomeusz, Geoffrey
2017-01-01
Shiga toxins 1 and 2 (STx1 and STx2) undergo retrograde trafficking to reach the cytosol. Early endosome-to-Golgi transport allows the toxins to evade degradation in lysosomes. Targeting this trafficking step has therapeutic promise, but the mechanism of trafficking for the more potent toxin STx2 is unclear. To identify host factors required for early endosome-to-Golgi trafficking of STx2, we performed a viability-based genome-wide siRNA screen in HeLa cells. 564, 535, and 196 genes were found to be required for toxicity induced by STx1 only, STx2 only, and both toxins, respectively. We focused on validating endosome/Golgi-localized hits specific for STx2 and found that depletion of UNC50 blocked early endosome-to-Golgi trafficking and induced lysosomal degradation of STx2. UNC50 acted by recruiting GBF1, an ADP ribosylation factor–guanine nucleotide exchange factor (ARF-GEF), to the Golgi. These results provide new information about STx2 trafficking mechanisms and may advance efforts to generate therapeutically viable toxin-trafficking inhibitors. PMID:28883040
Genome-wide siRNA screen identifies UNC50 as a regulator of Shiga toxin 2 trafficking.
Selyunin, Andrey S; Iles, Lakesla R; Bartholomeusz, Geoffrey; Mukhopadhyay, Somshuvra
2017-10-02
Shiga toxins 1 and 2 (STx1 and STx2) undergo retrograde trafficking to reach the cytosol. Early endosome-to-Golgi transport allows the toxins to evade degradation in lysosomes. Targeting this trafficking step has therapeutic promise, but the mechanism of trafficking for the more potent toxin STx2 is unclear. To identify host factors required for early endosome-to-Golgi trafficking of STx2, we performed a viability-based genome-wide siRNA screen in HeLa cells. 564, 535, and 196 genes were found to be required for toxicity induced by STx1 only, STx2 only, and both toxins, respectively. We focused on validating endosome/Golgi-localized hits specific for STx2 and found that depletion of UNC50 blocked early endosome-to-Golgi trafficking and induced lysosomal degradation of STx2. UNC50 acted by recruiting GBF1, an ADP ribosylation factor-guanine nucleotide exchange factor (ARF-GEF), to the Golgi. These results provide new information about STx2 trafficking mechanisms and may advance efforts to generate therapeutically viable toxin-trafficking inhibitors. © 2017 Selyunin et al.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Roy, Sarah H; Tobin, David V; Memar, Nadin; Beltz, Eleanor; Holmen, Jenna; Clayton, Joseph E; Chiu, Daniel J; Young, Laura D; Green, Travis H; Lubin, Isabella; Liu, Yuying; Conradt, Barbara; Saito, R Mako
2014-02-28
The development and homeostasis of multicellular animals requires precise coordination of cell division and differentiation. We performed a genome-wide RNA interference screen in Caenorhabditis elegans to reveal the components of a regulatory network that promotes developmentally programmed cell-cycle quiescence. The 107 identified genes are predicted to constitute regulatory networks that are conserved among higher animals because almost half of the genes are represented by clear human orthologs. Using a series of mutant backgrounds to assess their genetic activities, the RNA interference clones displaying similar properties were clustered to establish potential regulatory relationships within the network. This approach uncovered four distinct genetic pathways controlling cell-cycle entry during intestinal organogenesis. The enhanced phenotypes observed for animals carrying compound mutations attest to the collaboration between distinct mechanisms to ensure strict developmental regulation of cell cycles. Moreover, we characterized ubc-25, a gene encoding an E2 ubiquitin-conjugating enzyme whose human ortholog, UBE2Q2, is deregulated in several cancers. Our genetic analyses suggested that ubc-25 acts in a linear pathway with cul-1/Cul1, in parallel to pathways employing cki-1/p27 and lin-35/pRb to promote cell-cycle quiescence. Further investigation of the potential regulatory mechanism demonstrated that ubc-25 activity negatively regulates CYE-1/cyclin E protein abundance in vivo. Together, our results show that the ubc-25-mediated pathway acts within a complex network that integrates the actions of multiple molecular mechanisms to control cell cycles during development. Copyright © 2014 Roy et al.
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
2016-05-03
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
BioVLAB-MMIA: a cloud environment for microRNA and mRNA integrated analysis (MMIA) on Amazon EC2.
Lee, Hyungro; Yang, Youngik; Chae, Heejoon; Nam, Seungyoon; Choi, Donghoon; Tangchaisin, Patanachai; Herath, Chathura; Marru, Suresh; Nephew, Kenneth P; Kim, Sun
2012-09-01
MicroRNAs, by regulating the expression of hundreds of target genes, play critical roles in developmental biology and the etiology of numerous diseases, including cancer. As a vast amount of microRNA expression profile data are now publicly available, the integration of microRNA expression data sets with gene expression profiles is a key research problem in life science research. However, the ability to conduct genome-wide microRNA-mRNA (gene) integration currently requires sophisticated, high-end informatics tools, significant expertise in bioinformatics and computer science to carry out the complex integration analysis. In addition, increased computing infrastructure capabilities are essential in order to accommodate large data sets. In this study, we have extended the BioVLAB cloud workbench to develop an environment for the integrated analysis of microRNA and mRNA expression data, named BioVLAB-MMIA. The workbench facilitates computations on the Amazon EC2 and S3 resources orchestrated by the XBaya Workflow Suite. The advantages of BioVLAB-MMIA over the web-based MMIA system include: 1) readily expanded as new computational tools become available; 2) easily modifiable by re-configuring graphic icons in the workflow; 3) on-demand cloud computing resources can be used on an "as needed" basis; 4) distributed orchestration supports complex and long running workflows asynchronously. We believe that BioVLAB-MMIA will be an easy-to-use computing environment for researchers who plan to perform genome-wide microRNA-mRNA (gene) integrated analysis tasks.
The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.
Gonzalez-Alegre, Pedro
2007-04-01
RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.
Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha
2015-05-01
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.
X-inactivation: Xist RNA uses chromosome contacts to coat the X.
Leung, Karen N; Panning, Barbara
2014-01-20
The mechanisms by which Xist RNA associates with the X chromosome to mediate alterations in chromatin structure remain mysterious. Recent genome-wide Xist RNA distribution studies suggest that this long noncoding RNA uses 3-dimensional chromosome contacts to move to its sites of action. Copyright © 2014 Elsevier Ltd. All rights reserved.
Sequence determinants of improved CRISPR sgRNA design.
Xu, Han; Xiao, Tengfei; Chen, Chen-Hao; Li, Wei; Meyer, Clifford A; Wu, Qiu; Wu, Di; Cong, Le; Zhang, Feng; Liu, Jun S; Brown, Myles; Liu, X Shirley
2015-08-01
The CRISPR/Cas9 system has revolutionized mammalian somatic cell genetics. Genome-wide functional screens using CRISPR/Cas9-mediated knockout or dCas9 fusion-mediated inhibition/activation (CRISPRi/a) are powerful techniques for discovering phenotype-associated gene function. We systematically assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. Leveraging the information from multiple designs, we derived a new sequence model for predicting sgRNA efficiency in CRISPR/Cas9 knockout experiments. Our model confirmed known features and suggested new features including a preference for cytosine at the cleavage site. The model was experimentally validated for sgRNA-mediated mutation rate and protein knockout efficiency. Tested on independent data sets, the model achieved significant results in both positive and negative selection conditions and outperformed existing models. We also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR/Cas9 knockout and propose a new model for predicting sgRNA efficiency in CRISPRi/a experiments. These results facilitate the genome-wide design of improved sgRNA for both knockout and CRISPRi/a studies. © 2015 Xu et al.; Published by Cold Spring Harbor Laboratory Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
Wong, Hui Hui; Kumar, Pankaj; Tay, Felicia Pei Ling; Moreau, Dimitri
2015-01-01
ABSTRACT Coronaviruses are RNA viruses with a large zoonotic reservoir and propensity for host switching, representing a real threat for public health, as evidenced by severe acute respiratory syndrome (SARS) and the emerging Middle East respiratory syndrome (MERS). Cellular factors required for their replication are poorly understood. Using genome-wide small interfering RNA (siRNA) screening, we identified 83 novel genes supporting infectious bronchitis virus (IBV) replication in human cells. Thirty of these hits can be placed in a network of interactions with viral proteins and are involved in RNA splicing, membrane trafficking, and ubiquitin conjugation. In addition, our screen reveals an unexpected role for valosin-containing protein (VCP/p97) in early steps of infection. Loss of VCP inhibits a previously uncharacterized degradation of the nucleocapsid N protein. This inhibition derives from virus accumulation in early endosomes, suggesting a role for VCP in the maturation of virus-loaded endosomes. The several host factors identified in this study may provide avenues for targeted therapeutics. IMPORTANCE Coronaviruses are RNA viruses representing a real threat for public health, as evidenced by SARS and the emerging MERS. However, cellular factors required for their replication are poorly understood. Using genome-wide siRNA screening, we identified novel genes supporting infectious bronchitis virus (IBV) replication in human cells. The several host factors identified in this study may provide directions for future research on targeted therapeutics. PMID:26311884
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions
Chu, Ci; Qu, Kun; Zhong, Franklin; Artandi, Steven E.; Chang, Howard Y.
2011-01-01
SUMMARY Long intergenic noncoding RNAs (lincRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lincRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lincRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3’ end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lincRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome-wide. PMID:21963238
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying
2016-01-01
RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174
Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte
2014-01-01
Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic
eQTL Mapping Using RNA-seq Data
Hu, Yijuan
2012-01-01
As RNA-seq is replacing gene expression microarrays to assess genome-wide transcription abundance, gene expression Quantitative Trait Locus (eQTL) studies using RNA-seq have emerged. RNA-seq delivers two novel features that are important for eQTL studies. First, it provides information on allele-specific expression (ASE), which is not available from gene expression microarrays. Second, it generates unprecedentedly rich data to study RNA-isoform expression. In this paper, we review current methods for eQTL mapping using ASE and discuss some future directions. We also review existing works that use RNA-seq data to study RNA-isoform expression and we discuss the gaps between these works and isoform-specific eQTL mapping. PMID:23667399
Thiebaut, Flávia; Rojas, Cristian A; Grativol, Clícia; Motta, Mariana Romeiro; Vieira, Tauan; Regulski, Michael; Martienssen, Robert A; Farinelli, Laurent; Hemerly, Adriana S; Ferreira, Paulo C G
2014-09-06
Small RNA (sRNA) has been described as a regulator of gene expression. In order to understand the role of maize sRNA (Zea mays-hybrid UENF 506-8) during association with endophytic nitrogen-fixing bacteria, we analyzed the sRNA regulated by its association with two diazotrophic bacteria, Herbaspirillum seropedicae and Azospirillum brasilense. Deep sequencing analysis was done with RNA extracted from plants inoculated with H. seropedicae, allowing the identification of miRNA and siRNA. A total of 25 conserved miRNA families and 15 novel miRNAs were identified. A dynamic regulation in response to inoculation was also observed. A hypothetical model involving copper-miRNA is proposed, emphasizing the fact that the up-regulation of miR397, miR398, miR408 and miR528, which is followed by inhibition of their targets, can facilitate association with diazotrophic bacteria. Similar expression patterns were observed in samples inoculated with A. brasilense. Moreover, novel miRNA and siRNA were classified in the Transposable Elements (TE) database, and an enrichment of siRNA aligned with TE was observed in the inoculated samples. In addition, an increase in 24-nt siRNA mapping to genes was observed, which was correlated with an increase in methylation of the coding regions and a subsequent reduction in transcription. Our results show that maize has RNA-based silencing mechanisms that can trigger specific responses when plants interact with beneficial endophytic diazotrophic bacteria. Our findings suggest important roles for sRNA regulation in maize, and probably in other plants, during association with diazotrophic bacteria, emphasizing the up-regulation of Cu-miRNA.
Genome-wide analysis of alternative splicing during human heart development
NASA Astrophysics Data System (ADS)
Wang, He; Chen, Yanmei; Li, Xinzhong; Chen, Guojun; Zhong, Lintao; Chen, Gangbing; Liao, Yulin; Liao, Wangjun; Bin, Jianping
2016-10-01
Alternative splicing (AS) drives determinative changes during mouse heart development. Recent high-throughput technological advancements have facilitated genome-wide AS, while its analysis in human foetal heart transition to the adult stage has not been reported. Here, we present a high-resolution global analysis of AS transitions between human foetal and adult hearts. RNA-sequencing data showed extensive AS transitions occurred between human foetal and adult hearts, and AS events occurred more frequently in protein-coding genes than in long non-coding RNA (lncRNA). A significant difference of AS patterns was found between foetal and adult hearts. The predicted difference in AS events was further confirmed using quantitative reverse transcription-polymerase chain reaction analysis of human heart samples. Functional foetal-specific AS event analysis showed enrichment associated with cell proliferation-related pathways including cell cycle, whereas adult-specific AS events were associated with protein synthesis. Furthermore, 42.6% of foetal-specific AS events showed significant changes in gene expression levels between foetal and adult hearts. Genes exhibiting both foetal-specific AS and differential expression were highly enriched in cell cycle-associated functions. In conclusion, we provided a genome-wide profiling of AS transitions between foetal and adult hearts and proposed that AS transitions and deferential gene expression may play determinative roles in human heart development.
Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.
Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli
2014-01-01
The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.
Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs
2015-01-01
Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637
Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1
Barbie, David A.; Tamayo, Pablo; Boehm, Jesse S.; Kim, So Young; Moody, Susan E.; Dunn, Ian F.; Schinzel, Anna C.; Sandy, Peter; Meylan, Etienne; Scholl, Claudia; Fröhling, Stefan; Chan, Edmond M.; Sos, Martin L.; Michel, Kathrin; Mermel, Craig; Silver, Serena J.; Weir, Barbara A.; Reiling, Jan H.; Sheng, Qing; Gupta, Piyush B.; Wadlow, Raymond C.; Le, Hanh; Hoersch, Sebastian; Wittner, Ben S.; Ramaswamy, Sridhar; Livingston, David M.; Sabatini, David M.; Meyerson, Matthew; Thomas, Roman K.; Lander, Eric S.; Mesirov, Jill P.; Root, David E.; Gilliland, D. Gary; Jacks, Tyler; Hahn, William C.
2009-01-01
The proto-oncogene KRAS is mutated in a wide array of human cancers, most of which are aggressive and respond poorly to standard therapies. Although the identification of specific oncogenes has led to the development of clinically effective, molecularly targeted therapies in some cases, KRAS has remained refractory to this approach. A complementary strategy for targeting KRAS is to identify gene products that, when inhibited, result in cell death only in the presence of an oncogenic allele1,2. Here we have used systematic RNA interference (RNAi) to detect synthetic lethal partners of oncogenic KRAS and found that the non-canonical IκB kinase, TBK1, was selectively essential in cells that harbor mutant KRAS. Suppression of TBK1 induced apoptosis specifically in human cancer cell lines that depend on oncogenic KRAS expression. In these cells, TBK1 activated NF-κB anti-apoptotic signals involving cREL and BCL-XL that were essential for survival, providing mechanistic insights into this synthetic lethal interaction. These observations identify TBK1 and NF-κB signaling as essential in KRAS mutant tumors and establish a general approach for the rational identification of co-dependent pathways in cancer. PMID:19847166
Inferring genome-wide interplay landscape between DNA methylation and transcriptional regulation.
Tang, Binhua; Wang, Xin
2015-01-01
DNA methylation and transcriptional regulation play important roles in cancer cell development and differentiation processes. Based on the currently available cell line profiling information from the ENCODE Consortium, we propose a Bayesian inference model to infer and construct genome-wide interaction landscape between DNA methylation and transcriptional regulation, which sheds light on the underlying complex functional mechanisms important within the human cancer and disease context. For the first time, we select all the currently available cell lines (>=20) and transcription factors (>=80) profiling information from the ENCODE Consortium portal. Through the integration of those genome-wide profiling sources, our genome-wide analysis detects multiple functional loci of interest, and indicates that DNA methylation is cell- and region-specific, due to the interplay mechanisms with transcription regulatory activities. We validate our analysis results with the corresponding RNA-sequencing technique for those detected genomic loci. Our results provide novel and meaningful insights for the interplay mechanisms of transcriptional regulation and gene expression for the human cancer and disease studies.
Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.
2010-01-01
The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014
Coordinated action of histone modification and microRNA regulations in human genome.
Wang, Xuan; Zheng, Guantao; Dong, Dong
2015-10-10
Both histone modifications and microRNAs (miRNAs) play pivotal role in gene expression regulation. Although numerous studies have been devoted to explore the gene regulation by miRNA and epigenetic regulations, their coordinated actions have not been comprehensively examined. In this work, we systematically investigated the combinatorial relationship between miRNA and epigenetic regulation by taking advantage of recently published whole genome-wide histone modification data and high quality miRNA targeting data. The results showed that miRNA targets have distinct histone modification patterns compared with non-targets in their promoter regions. Based on this finding, we proposed a machine learning approach to fit predictive models on the task to discern whether a gene is targeted by a specific miRNA. We found a considerable advantage in both sensitivity and specificity in diverse human cell lines. Finally, we found that our predicted miRNA targets are consistently annotated with Gene Ontology terms. Our work is the first genome-wide investigation of the coordinated action of miRNA and histone modification regulations, which provide a guide to deeply understand the complexity of transcriptional regulation. Copyright © 2015 Elsevier B.V. All rights reserved.
Multifunctional RNA Nanoparticles
2015-01-01
Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559
Integrative Analysis of Many RNA-Seq Datasets to Study Alternative Splicing
Li, Wenyuan; Dai, Chao; Kang, Shuli; Zhou, Xianghong Jasmine
2014-01-01
Alternative splicing is an important gene regulatory mechanism that dramatically increases the complexity of the proteome. However, how alternative splicing is regulated and how transcription and splicing are coordinated are still poorly understood, and functions of transcript isoforms have been studied only in a few limited cases. Nowadays, RNA-seq technology provides an exceptional opportunity to study alternative splicing on genome-wide scales and in an unbiased manner. With the rapid accumulation of data in public repositories, new challenges arise from the urgent need to effectively integrate many different RNA-seq datasets for study alterative splicing. This paper discusses a set of advanced computational methods that can integrate and analyze many RNA-seq datasets to systematically identify splicing modules, unravel the coupling of transcription and splicing, and predict the functions of splicing isoforms on a genome-wide scale. PMID:24583115
Rafehi, Haloom; Ververis, Katherine; Balcerczyk, Aneta; Ziemann, Mark; Ooi, Jenny; Hu, Sean; Kwa, Faith A A; Loveridge, Shanon J; Georgiadis, George T; El-Osta, Assam; Karagiannis, Tom C
2012-01-01
The accumulating evidence of the beneficial effects of cinnamon (Cinnamomum burmanni) in type-2 diabetes, a chronic age-associated disease, has prompted the commercialisation of various supplemental forms of the spice. One such supplement, Cinnulin PF(®), represents the water soluble fraction containing relatively high levels of the double-linked procyanidin type-A polymers of flavanoids. The overall aim of this study was to utilize genome-wide mRNA-Seq analysis to characterise the changes in gene expression caused by Cinnulin PF in immortalised human keratinocytes and microvascular endothelial cells, which are relevant with respect to diabetic complications. In summary, our findings provide insights into the mechanisms of action of Cinnulin PF in diabetes and diabetic complications. More generally, we identify relevant candidate genes which could provide the basis for further investigation.
Rafehi, Haloom; Ververis, Katherine; Balcerczyk, Aneta; Ziemann, Mark; Ooi, Jenny; Hu, Sean; Kwa, Faith A. A.; Loveridge, Shanon J.; Georgiadis, George T.; El-Osta, Assam; Karagiannis, Tom C.
2012-01-01
The accumulating evidence of the beneficial effects of cinnamon (Cinnamomum burmanni) in type-2 diabetes, a chronic age-associated disease, has prompted the commercialisation of various supplemental forms of the spice. One such supplement, Cinnulin PF®, represents the water soluble fraction containing relatively high levels of the double-linked procyanidin type-A polymers of flavanoids. The overall aim of this study was to utilize genome-wide mRNA-Seq analysis to characterise the changes in gene expression caused by Cinnulin PF in immortalised human keratinocytes and microvascular endothelial cells, which are relevant with respect to diabetic complications. In summary, our findings provide insights into the mechanisms of action of Cinnulin PF in diabetes and diabetic complications. More generally, we identify relevant candidate genes which could provide the basis for further investigation. PMID:22953038
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi
Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less
Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe
2018-01-01
Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260
Carling, Phillippa J.; Buist, Thomas; Zhang, Chaolin; Grellscheid, Sushma N.; Armstrong, Kelly; Stockley, Jacqueline; Simillion, Cedric; Gaughan, Luke; Kalna, Gabriela; Zhang, Michael Q.; Robson, Craig N.; Leung, Hing Y.; Elliott, David J.
2011-01-01
Androgens drive the onset and progression of prostate cancer (PCa) by modulating androgen receptor (AR) transcriptional activity. Although several microarray-based studies have identified androgen-regulated genes, here we identify in-parallel global androgen-dependent changes in both gene and alternative mRNA isoform expression by exon-level analyses of the LNCaP transcriptome. While genome-wide gene expression changes correlated well with previously-published studies, we additionally uncovered a subset of 226 novel androgen-regulated genes. Gene expression pathway analysis of this subset revealed gene clusters associated with, and including the tyrosine kinase LYN, as well as components of the mTOR (mammalian target of rapamycin) pathway, which is commonly dysregulated in cancer. We also identified 1279 putative androgen-regulated alternative events, of which 325 (∼25%) mapped to known alternative splicing events or alternative first/last exons. We selected 30 androgen-dependent alternative events for RT-PCR validation, including mRNAs derived from genes encoding tumour suppressors and cell cycle regulators. Of seven positively-validating events (∼23%), five events involved transcripts derived from alternative promoters of known AR gene targets. In particular, we found a novel androgen-dependent mRNA isoform derived from an alternative internal promoter within the TSC2 tumour suppressor gene, which is predicted to encode a protein lacking an interaction domain required for mTOR inhibition. We confirmed that expression of this alternative TSC2 mRNA isoform was directly regulated by androgens, and chromatin immunoprecipitation indicated recruitment of AR to the alternative promoter region at early timepoints following androgen stimulation, which correlated with expression of alternative transcripts. Together, our data suggest that alternative mRNA isoform expression might mediate the cellular response to androgens, and may have roles in clinical PCa. PMID
Walko, Gernot; Woodhouse, Samuel; Pisco, Angela Oliveira; Rognoni, Emanuel; Liakath-Ali, Kifayathullah; Lichtenberger, Beate M.; Mishra, Ajay; Telerman, Stephanie B.; Viswanathan, Priyalakshmi; Logtenberg, Meike; Renz, Lisa M.; Donati, Giacomo; Quist, Sven R.; Watt, Fiona M.
2017-01-01
Individual human epidermal cells differ in their self-renewal ability. To uncover the molecular basis for this heterogeneity, we performed genome-wide pooled RNA interference screens and identified genes conferring a clonal growth advantage on normal and neoplastic (cutaneous squamous cell carcinoma, cSCC) human epidermal cells. The Hippo effector YAP was amongst the top positive growth regulators in both screens. By integrating the Hippo network interactome with our data sets, we identify WW-binding protein 2 (WBP2) as an important co-factor of YAP that enhances YAP/TEAD-mediated gene transcription. YAP and WPB2 are upregulated in actively proliferating cells of mouse and human epidermis and cSCC, and downregulated during terminal differentiation. WBP2 deletion in mouse skin results in reduced proliferation in neonatal and wounded adult epidermis. In reconstituted epidermis YAP/WBP2 activity is controlled by intercellular adhesion rather than canonical Hippo signalling. We propose that defective intercellular adhesion contributes to uncontrolled cSCC growth by preventing inhibition of YAP/WBP2. PMID:28332498
Functional RNA structures throughout the Hepatitis C Virus genome.
Adams, Rebecca L; Pirakitikulr, Nathan; Pyle, Anna Marie
2017-06-01
The single-stranded Hepatitis C Virus (HCV) genome adopts a set of elaborate RNA structures that are involved in every stage of the viral lifecycle. Recent advances in chemical probing, sequencing, and structural biology have facilitated analysis of RNA folding on a genome-wide scale, revealing novel structures and networks of interactions. These studies have underscored the active role played by RNA in every function of HCV and they open the door to new types of RNA-targeted therapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.
Factors affecting reproducibility between genome-scale siRNA-based screens
Barrows, Nicholas J.; Le Sommer, Caroline; Garcia-Blanco, Mariano A.; Pearson, James L.
2011-01-01
RNA interference-based screening is a powerful new genomic technology which addresses gene function en masse. To evaluate factors influencing hit list composition and reproducibility, we performed two identically designed small interfering RNA (siRNA)-based, whole genome screens for host factors supporting yellow fever virus infection. These screens represent two separate experiments completed five months apart and allow the direct assessment of the reproducibility of a given siRNA technology when performed in the same environment. Candidate hit lists generated by sum rank, median absolute deviation, z-score, and strictly standardized mean difference were compared within and between whole genome screens. Application of these analysis methodologies within a single screening dataset using a fixed threshold equivalent to a p-value ≤ 0.001 resulted in hit lists ranging from 82 to 1,140 members and highlighted the tremendous impact analysis methodology has on hit list composition. Intra- and inter-screen reproducibility was significantly influenced by the analysis methodology and ranged from 32% to 99%. This study also highlighted the power of testing at least two independent siRNAs for each gene product in primary screens. To facilitate validation we conclude by suggesting methods to reduce false discovery at the primary screening stage. In this study we present the first comprehensive comparison of multiple analysis strategies, and demonstrate the impact of the analysis methodology on the composition of the “hit list”. Therefore, we propose that the entire dataset derived from functional genome-scale screens, especially if publicly funded, should be made available as is done with data derived from gene expression and genome-wide association studies. PMID:20625183
Lehmann, Kjong-Van; Kahles, André; Kandoth, Cyriac; Lee, William; Schultz, Nikolaus; Stegle, Oliver; Rätsch, Gunnar
2015-01-01
We present a genome-wide analysis of splicing patterns of 282 kidney renal clear cell carcinoma patients in which we integrate data from whole-exome sequencing of tumor and normal samples, RNA-seq and copy number variation. We proposed a scoring mechanism to compare splicing patterns in tumor samples to normal samples in order to rank and detect tumor-specific isoforms that have a potential for new biomarkers. We identified a subset of genes that show introns only observable in tumor but not in normal samples, ENCODE and GEUVADIS samples. In order to improve our understanding of the underlying genetic mechanisms of splicing variation we performed a large-scale association analysis to find links between somatic or germline variants with alternative splicing events. We identified 915 cis- and trans-splicing quantitative trait loci (sQTL) associated with changes in splicing patterns. Some of these sQTL have previously been associated with being susceptibility loci for cancer and other diseases. Our analysis also allowed us to identify the function of several COSMIC variants showing significant association with changes in alternative splicing. This demonstrates the potential significance of variants affecting alternative splicing events and yields insights into the mechanisms related to an array of disease phenotypes.
Suppression of Bedbug’s Reproduction by RNA Interference of Vitellogenin
Moriyama, Minoru; Hosokawa, Takahiro; Tanahashi, Masahiko; Nikoh, Naruo; Fukatsu, Takema
2016-01-01
Recent resurgence of the bedbug Cimex lectularius is a global problem on the public health. On account of the worldwide rise of insecticide-resistant bedbug populations, exploration of new approaches to the bedbug control and management is anticipated. In this context, gene silencing by RNA interference (RNAi) has been considered for its potential application to pest control and management, because RNAi enables specific suppression of target genes and thus flexible selection of target traits to be disrupted. In this study, in an attempt to develop a control strategy targeting reproduction of the bedbug, we investigated RNAi-mediated gene silencing of vitellogenin (Vg), a major yolk protein precursor essential for oogenesis. From the bedbug transcriptomes, we identified a typical Vg gene and a truncated Vg gene, which were designated as ClVg and ClVg-like, respectively. ClVg gene was highly expressed mainly in the fat body of adult females, which was more than 100 times higher than the expression level of ClVg-like gene, indicating that ClVg gene is the primary functional Vg gene in the bedbug. RNAi-mediated suppression of ClVg gene expression in adult females resulted in drastically reduced egg production, atrophied ovaries, and inflated abdomen due to hypertrophied fat bodies. These phenotypic consequences are expected not only to suppress the bedbug reproduction directly but also to deteriorate its feeding and survival indirectly via behavioral modifications. These results suggest the potential of ClVg gene as a promising target for RNAi-based population management of the bedbug. PMID:27096422
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2009-11-01
Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.
Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan
2013-01-01
RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.
Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar
2015-01-01
The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.
RNA interference: Applications and advances in insect toxicology and insect pest management.
Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan
2015-05-01
Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.
Li, Yao; Li, Shengjie; Li, Ruimin; Xu, Jiao; Jin, Ping; Chen, Liming; Ma, Fei
2017-03-01
Although innate immunity mediated by Toll signaling has been extensively studied in Drosophila melanogaster, the role of miRNAs in regulating the Toll-mediated immune response remains largely unknown. In this study, following Gram-positive bacterial challenge, we identified 93 differentially expressed miRNAs via genome-wide miRNA screening. These miRNAs were regarded as immune response related (IRR). Eight miRNAs were confirmed to be involved in the Toll-mediated immune response upon Gram-positive bacterial infection through genetic screening of 41 UAS-miRNA lines covering 60 miRNAs of the 93 IRR miRNAs. Interestingly, four out of these eight miRNAs, miR-310, miR-311, miR-312 and miR-313, are clustered miRNAs and belong to the miR-310 family. These miR-310 family members were shown to target and regulate the expression of Drosomycin, an antimicrobial peptide produced by Toll signaling. Taken together, our study implies important regulatory roles of miRNAs in the Toll-mediated innate immune response of Drosophila upon Gram-positive bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.
van Haaften, Gijs; Romeijn, Ron; Pothof, Joris; Koole, Wouter; Mullenders, Leon H F; Pastink, Albert; Plasterk, Ronald H A; Tijsterman, Marcel
2006-07-11
Ionizing radiation is extremely harmful for human cells, and DNA double-strand breaks (DSBs) are considered to be the main cytotoxic lesions induced. Improper processing of DSBs contributes to tumorigenesis, and mutations in DSB response genes underlie several inherited disorders characterized by cancer predisposition. Here, we performed a comprehensive screen for genes that protect animal cells against ionizing radiation. A total of 45 C. elegans genes were identified in a genome-wide RNA interference screen for increased sensitivity to ionizing radiation in germ cells. These genes include orthologs of well-known human cancer predisposition genes as well as novel genes, including human disease genes not previously linked to defective DNA-damage responses. Knockdown of eleven genes also impaired radiation-induced cell-cycle arrest, and seven genes were essential for apoptosis upon exposure to irradiation. The gene set was further clustered on the basis of increased sensitivity to DNA-damaging cancer drugs cisplatin and camptothecin. Almost all genes are conserved across animal phylogeny, and their relevance for humans was directly demonstrated by showing that their knockdown in human cells results in radiation sensitivity, indicating that this set of genes is important for future cancer profiling and drug development.
Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang
2014-01-01
Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Genome-wide identification of RNA editing in hepatocellular carcinoma.
Kang, Lin; Liu, Xiaoqiao; Gong, Zhoulin; Zheng, Hancheng; Wang, Jun; Li, Yingrui; Yang, Huanming; Hardwick, James; Dai, Hongyue; Poon, Ronnie T P; Lee, Nikki P; Mao, Mao; Peng, Zhiyu; Chen, Ronghua
2015-02-01
We did whole-transcriptome sequencing and whole-genome sequencing on nine pairs of Hepatocellular carcinoma (HCC) tumors and matched adjacent tissues to identify RNA editing events. We identified mean 26,982 editing sites with mean 89.5% canonical A→G edits in each sample using an improved bioinformatics pipeline. The editing rate was significantly higher in tumors than adjacent normal tissues. Comparing the difference between tumor and normal tissues of each patient, we found 7 non-synonymous tissue specific editing events including 4 tumor-specific edits and 3 normal-specific edits in the coding region, as well as 292 edits varying in editing degree. The significant expression changes of 150 genes associated with RNA editing were found in tumors, with 3 of the 4 most significant genes being cancer related. Our results show that editing might be related to higher gene expression. These findings indicate that RNA editing modification may play an important role in the development of HCC. Copyright © 2014 Elsevier Inc. All rights reserved.
Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B
2018-06-01
RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes.
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui
2017-09-01
At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.
2014-01-01
RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428
MISSION LentiPlex pooled shRNA library screening in mammalian cells.
Coussens, Matthew J; Corman, Courtney; Fischer, Ashley L; Sago, Jack; Swarthout, John
2011-12-21
RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies. There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library. The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 10(8) TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification. Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we
Solana, Jordi; Kao, Damian; Mihaylova, Yuliana; Jaber-Hijazi, Farah; Malla, Sunir; Wilson, Ray; Aboobaker, Aziz
2012-01-01
Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology.
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Preußer, Christian; Rossbach, Oliver; Hung, Lee-Hsueh; Li, Dan; Bindereif, Albrecht
2014-01-01
Trans-splicing in trypanosomes adds a 39-nucleotide mini-exon from the spliced leader (SL) RNA to the 5′ end of each protein-coding sequence. On the other hand, cis-splicing of the few intron-containing genes requires the U1 small nuclear ribonucleoprotein (snRNP) particle. To search for potential new functions of the U1 snRNP in Trypanosoma brucei, we applied genome-wide individual-nucleotide resolution crosslinking-immunoprecipitation (iCLIP), focusing on the U1 snRNP-specific proteins U1C and U1-70K. Surprisingly, U1C and U1-70K interact not only with the U1, but also with U6 and SL RNAs. In addition, mapping of crosslinks to the cis-spliced PAP [poly(A) polymerase] pre-mRNA indicate an active role of these proteins in 5′ splice site recognition. In sum, our results demonstrate that the iCLIP approach provides insight into stable and transient RNA–protein contacts within the spliceosomal network. We propose that the U1 snRNP may represent an evolutionary link between the cis- and trans-splicing machineries, playing a dual role in 5′ splice site recognition on the trans-spliceosomal SL RNP as well as on pre-mRNA cis-introns. PMID:24748659
Shock, Jennifer L; Fischer, Kael F; DeRisi, Joseph L
2007-01-01
The rate of mRNA decay is an essential element of post-transcriptional regulation in all organisms. Previously, studies in several organisms found that the specific half-life of each mRNA is precisely related to its physiologic role, and plays an important role in determining levels of gene expression. We used a genome-wide approach to characterize mRNA decay in Plasmodium falciparum. We found that, globally, rates of mRNA decay increase dramatically during the asexual intra-erythrocytic developmental cycle. During the ring stage of the cycle, the average mRNA half-life was 9.5 min, but this was extended to an average of 65 min during the late schizont stage of development. Thus, a major determinant of mRNA decay rate appears to be linked to the stage of intra-erythrocytic development. Furthermore, we found specific variations in decay patterns superimposed upon the dominant trend of progressive half-life lengthening. These variations in decay pattern were frequently enriched for genes with specific cellular functions or processes. Elucidation of Plasmodium mRNA decay rates provides a key element for deciphering mechanisms of genetic control in this parasite, by complementing and extending previous mRNA abundance studies. Our results indicate that progressive stage-dependent decreases in mRNA decay rate function are a major determinant of mRNA accumulation during the schizont stage of intra-erythrocytic development. This type of genome-wide change in mRNA decay rate has not been observed in any other organism to date, and indicates that post-transcriptional regulation may be the dominant mechanism of gene regulation in P. falciparum.
Morimoto, Shimpei; Yahara, Koji
2018-03-01
Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound
McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy
2011-02-01
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.
Understanding splicing regulation through RNA splicing maps
Witten, Joshua T.; Ule, Jernej
2011-01-01
Alternative splicing is a highly regulated process that greatly increases the proteome diversity and plays an important role in cellular differentiation and disease. Interactions between RNA-binding proteins (RBPs) and pre-mRNA are the principle regulator of splicing decisions. Findings from recent genome-wide studies of protein–RNA interactions have been combined with assays of the global effects of RBPs on splicing to create RNA splicing maps. These maps integrate information from all pre-mRNAs regulated by single RBPs to identify the global positioning principles guiding splicing regulation. Recent studies using this approach have identified a set of positional principles that are shared between diverse RBPs. Here, we discuss how insights from RNA splicing maps of different RBPs inform the mechanistic models of splicing regulation. PMID:21232811
Blevins, Tana; Aliev, Fazil; Adkins, Amy; Hack, Laura; Bigdeli, Tim; D. van der Vaart, Andrew; Web, Bradley Todd; Bacanu, Silviu-Alin; Kalsi, Gursharan; Kendler, Kenneth S.; Miles, Michael F.; Dick, Danielle; Riley, Brien P.; Dumur, Catherine; Vladimirov, Vladimir I.
2015-01-01
Alcohol consumption is known to lead to gene expression changes in the brain. After performing weighted gene co-expression network analyses (WGCNA) on genome-wide mRNA and microRNA (miRNA) expression in Nucleus Accumbens (NAc) of subjects with alcohol dependence (AD; N = 18) and of matched controls (N = 18), six mRNA and three miRNA modules significantly correlated with AD were identified (Bonferoni-adj. p≤ 0.05). Cell-type-specific transcriptome analyses revealed two of the mRNA modules to be enriched for neuronal specific marker genes and downregulated in AD, whereas the remaining four mRNA modules were enriched for astrocyte and microglial specific marker genes and upregulated in AD. Gene set enrichment analysis demonstrated that neuronal specific modules were enriched for genes involved in oxidative phosphorylation, mitochondrial dysfunction and MAPK signaling. Glial-specific modules were predominantly enriched for genes involved in processes related to immune functions, i.e. cytokine signaling (all adj. p≤ 0.05). In mRNA and miRNA modules, 461 and 25 candidate hub genes were identified, respectively. In contrast to the expected biological functions of miRNAs, correlation analyses between mRNA and miRNA hub genes revealed a higher number of positive than negative correlations (χ2 test p≤ 0.0001). Integration of hub gene expression with genome-wide genotypic data resulted in 591 mRNA cis-eQTLs and 62 miRNA cis-eQTLs. mRNA cis-eQTLs were significantly enriched for AD diagnosis and AD symptom counts (adj. p = 0.014 and p = 0.024, respectively) in AD GWAS signals in a large, independent genetic sample from the Collaborative Study on Genetics of Alcohol (COGA). In conclusion, our study identified putative gene network hubs coordinating mRNA and miRNA co-expression changes in the NAc of AD subjects, and our genetic (cis-eQTL) analysis provides novel insights into the etiological mechanisms of AD. PMID:26381263
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
SUMOylation of TARBP2 regulates miRNA/siRNA efficiency
Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu
2015-01-01
Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi
2009-02-01
The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight
Impacts of Genome-Wide Analyses on Our Understanding of Human Herpesvirus Diversity and Evolution.
Renner, Daniel W; Szpara, Moriah L
2018-01-01
Until fairly recently, genome-wide evolutionary dynamics and within-host diversity were more commonly examined in the context of small viruses than in the context of large double-stranded DNA viruses such as herpesviruses. The high mutation rates and more compact genomes of RNA viruses have inspired the investigation of population dynamics for these species, and recent data now suggest that herpesviruses might also be considered candidates for population modeling. High-throughput sequencing (HTS) and bioinformatics have expanded our understanding of herpesviruses through genome-wide comparisons of sequence diversity, recombination, allele frequency, and selective pressures. Here we discuss recent data on the mechanisms that generate herpesvirus genomic diversity and underlie the evolution of these virus families. We focus on human herpesviruses, with key insights drawn from veterinary herpesviruses and other large DNA virus families. We consider the impacts of cell culture on herpesvirus genomes and how to accurately describe the viral populations under study. The need for a strong foundation of high-quality genomes is also discussed, since it underlies all secondary genomic analyses such as RNA sequencing (RNA-Seq), chromatin immunoprecipitation, and ribosome profiling. Areas where we foresee future progress, such as the linking of viral genetic differences to phenotypic or clinical outcomes, are highlighted as well. Copyright © 2017 Renner and Szpara.
Vishnubalaji, R; Hamam, R; Abdulla, M-H; Mohammed, M A V; Kassem, M; Al-Obeed, O; Aldahmash, A; Alajez, N M
2015-01-01
Despite recent advances in cancer management, colorectal cancer (CRC) remains the third most common cancer and a major health-care problem worldwide. MicroRNAs have recently emerged as key regulators of cancer development and progression by targeting multiple cancer-related genes; however, such regulatory networks are not well characterized in CRC. Thus, the aim of this study was to perform global messenger RNA (mRNA) and microRNA expression profiling in the same CRC samples and adjacent normal tissues and to identify potential miRNA-mRNA regulatory networks. Our data revealed 1273 significantly upregulated and 1902 downregulated genes in CRC. Pathway analysis revealed significant enrichment in cell cycle, integrated cancer, Wnt (wingless-type MMTV integration site family member), matrix metalloproteinase, and TGF-β pathways in CRC. Pharmacological inhibition of Wnt (using XAV939 or IWP-2) or TGF-β (using SB-431542) pathways led to dose- and time-dependent inhibition of CRC cell growth. Similarly, our data revealed up- (42) and downregulated (61) microRNAs in the same matched samples. Using target prediction and bioinformatics, ~77% of the upregulated genes were predicted to be targeted by microRNAs found to be downregulated in CRC. We subsequently focused on EZH2 (enhancer of zeste homolog 2 ), which was found to be regulated by hsa-miR-26a-5p and several members of the let-7 (lethal-7) family in CRC. Significant inverse correlation between EZH2 and hsa-miR-26a-5p (R2=0.56, P=0.0001) and hsa-let-7b-5p (R2=0.19, P=0.02) expression was observed in the same samples, corroborating the belief of EZH2 being a bona fide target for these two miRNAs in CRC. Pharmacological inhibition of EZH2 led to significant reduction in trimethylated histone H3 on lysine 27 (H3K27) methylation, marked reduction in cell proliferation, and migration in vitro. Concordantly, small interfering RNA-mediated knockdown of EZH2 led to similar effects on CRC cell growth in vitro. Therefore, our
Vishnubalaji, R; Hamam, R; Abdulla, M-H; Mohammed, M A V; Kassem, M; Al-Obeed, O; Aldahmash, A; Alajez, N M
2015-01-22
Despite recent advances in cancer management, colorectal cancer (CRC) remains the third most common cancer and a major health-care problem worldwide. MicroRNAs have recently emerged as key regulators of cancer development and progression by targeting multiple cancer-related genes; however, such regulatory networks are not well characterized in CRC. Thus, the aim of this study was to perform global messenger RNA (mRNA) and microRNA expression profiling in the same CRC samples and adjacent normal tissues and to identify potential miRNA-mRNA regulatory networks. Our data revealed 1273 significantly upregulated and 1902 downregulated genes in CRC. Pathway analysis revealed significant enrichment in cell cycle, integrated cancer, Wnt (wingless-type MMTV integration site family member), matrix metalloproteinase, and TGF-β pathways in CRC. Pharmacological inhibition of Wnt (using XAV939 or IWP-2) or TGF-β (using SB-431542) pathways led to dose- and time-dependent inhibition of CRC cell growth. Similarly, our data revealed up- (42) and downregulated (61) microRNAs in the same matched samples. Using target prediction and bioinformatics, ~77% of the upregulated genes were predicted to be targeted by microRNAs found to be downregulated in CRC. We subsequently focused on EZH2 (enhancer of zeste homolog 2 ), which was found to be regulated by hsa-miR-26a-5p and several members of the let-7 (lethal-7) family in CRC. Significant inverse correlation between EZH2 and hsa-miR-26a-5p (R(2)=0.56, P=0.0001) and hsa-let-7b-5p (R(2)=0.19, P=0.02) expression was observed in the same samples, corroborating the belief of EZH2 being a bona fide target for these two miRNAs in CRC. Pharmacological inhibition of EZH2 led to significant reduction in trimethylated histone H3 on lysine 27 (H3K27) methylation, marked reduction in cell proliferation, and migration in vitro. Concordantly, small interfering RNA-mediated knockdown of EZH2 led to similar effects on CRC cell growth in vitro. Therefore
The Human High-Grade Glioma Interactome (HGi) contains a genome-wide complement of molecular interactions that are Glioblastoma Multiforme (GBM)-specific. HGi v3 contains the post-transcriptional layer of the HGi, which includes the miRNA-target (RNA-RNA) layer of the interactome. Read the Abstract
Tu, Ying; Xu, Dan; Feng, Jiaqi; He, Li
2017-01-01
Sensitive skin (SS) is a condition of subjective cutaneous hyper-reactivity. The role of long non-coding RNAs (lncRNAs) in subjects with SS is unclear. Therefore, the aim of the present study was to provide a comprehensive profile of the mRNAs and lncRNAs in subjects with SS. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis presented the characteristics of associated protein-coding genes. In addition, a co-expression network of lncRNA and mRNA was constructed to identify potential underlying regulation targets; the results were verified by quantitative real-time PCR (qRT-PCR) and RNA-seq analyses in patients with SS and normal samples. Compared with the normal skin group, 266 novel lncRNAs and 6750 annotated lncRNAs were identified in the SS group. A total of 71 lncRNA transcripts and 2615 mRNA transcripts were differentially expressed (P < 0.05). The heat signature of the SS samples could be distinguished from the normal skin samples, whereas the majority of the genes that were present in enriched pathways were those that participated in focal adhesion, PI3K-Akt signaling, and cancer-related pathways. Five transcripts were selected for qRT-PCR analysis and the results were consistent with RNA-seq. The results suggested that LNC_000265 may play a role in the epidermal barrier structure of patient with SS. The data suggest novel genes and pathways that may be involved in the pathogenesis of SS and highlight potential targets that could be used for individualized treatment applications. PMID:29383128
High-Throughput RNA Interference Screening: Tricks of the Trade
Nebane, N. Miranda; Coric, Tatjana; Whig, Kanupriya; McKellip, Sara; Woods, LaKeisha; Sosa, Melinda; Sheppard, Russell; Rasmussen, Lynn; Bjornsti, Mary-Ann; White, E. Lucile
2016-01-01
The process of validating an assay for high-throughput screening (HTS) involves identifying sources of variability and developing procedures that minimize the variability at each step in the protocol. The goal is to produce a robust and reproducible assay with good metrics. In all good cell-based assays, this means coefficient of variation (CV) values of less than 10% and a signal window of fivefold or greater. HTS assays are usually evaluated using Z′ factor, which incorporates both standard deviation and signal window. A Z′ factor value of 0.5 or higher is acceptable for HTS. We used a standard HTS validation procedure in developing small interfering RNA (siRNA) screening technology at the HTS center at Southern Research. Initially, our assay performance was similar to published screens, with CV values greater than 10% and Z′ factor values of 0.51 ± 0.16 (average ± standard deviation). After optimizing the siRNA assay, we got CV values averaging 7.2% and a robust Z′ factor value of 0.78 ± 0.06 (average ± standard deviation). We present an overview of the problems encountered in developing this whole-genome siRNA screening program at Southern Research and how equipment optimization led to improved data quality. PMID:23616418
Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.
2009-01-01
Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664
Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K
1999-01-01
We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070
Chen, Y; Redinbaugh, M G; Michel, A P
2015-06-01
Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.
Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José
2017-12-01
Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.
Li, Cheng-Wei; Chen, Bor-Sen
2016-01-01
Epigenetic and microRNA (miRNA) regulation are associated with carcinogenesis and the development of cancer. By using the available omics data, including those from next-generation sequencing (NGS), genome-wide methylation profiling, candidate integrated genetic and epigenetic network (IGEN) analysis, and drug response genome-wide microarray analysis, we constructed an IGEN system based on three coupling regression models that characterize protein-protein interaction networks (PPINs), gene regulatory networks (GRNs), miRNA regulatory networks (MRNs), and epigenetic regulatory networks (ERNs). By applying system identification method and principal genome-wide network projection (PGNP) to IGEN analysis, we identified the core network biomarkers to investigate bladder carcinogenic mechanisms and design multiple drug combinations for treating bladder cancer with minimal side-effects. The progression of DNA repair and cell proliferation in stage 1 bladder cancer ultimately results not only in the derepression of miR-200a and miR-200b but also in the regulation of the TNF pathway to metastasis-related genes or proteins, cell proliferation, and DNA repair in stage 4 bladder cancer. We designed a multiple drug combination comprising gefitinib, estradiol, yohimbine, and fulvestrant for treating stage 1 bladder cancer with minimal side-effects, and another multiple drug combination comprising gefitinib, estradiol, chlorpromazine, and LY294002 for treating stage 4 bladder cancer with minimal side-effects.
Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo
2017-04-01
RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role
Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G
2010-04-01
Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
Singh, Garima; Roy, Jyoti; Rout, Pratiti; Mallick, Bibekanand
2018-01-01
PIWI-interacting (piRNAs), ~23-36 nucleotide-long small non-coding RNAs (sncRNAs), earlier believed to be germline-specific, have now been identified in somatic cells, including cancer cells. These sncRNAs impact critical biological processes by fine-tuning gene expression at post-transcriptional and epigenetic levels. The expression of piRNAs in ovarian cancer, the most lethal gynecologic cancer is largely uncharted. In this study, we investigated the expression of PIWILs by qRT-PCR and western blotting and then identified piRNA transcriptomes in tissues of normal ovary and two most prevalent epithelial ovarian cancer subtypes, serous and endometrioid by small RNA sequencing. We detected 219, 256 and 234 piRNAs in normal ovary, endometrioid and serous ovarian cancer samples respectively. We observed piRNAs are encoded from various genomic regions, among which introns harbor the majority of them. Surprisingly, piRNAs originated from different genomic contexts showed the varied level of conservations across vertebrates. The functional analysis of predicted targets of differentially expressed piRNAs revealed these could modulate key processes and pathways involved in ovarian oncogenesis. Our study provides the first comprehensive piRNA landscape in these samples and a useful resource for further functional studies to decipher new mechanistic views of piRNA-mediated gene regulatory networks affecting ovarian oncogenesis. The RNA-seq data is submitted to GEO database (GSE83794).
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Genome-Wide Association Analysis of Blood Biomarkers in Chronic Obstructive Pulmonary Disease
Kim, Deog Kyeom; Cho, Michael H.; Hersh, Craig P.; Lomas, David A.; Miller, Bruce E.; Kong, Xiangyang; Bakke, Per; Gulsvik, Amund; Agustí, Alvar; Wouters, Emiel; Celli, Bartolome; Coxson, Harvey; Vestbo, Jørgen; MacNee, William; Yates, Julie C.; Rennard, Stephen; Litonjua, Augusto; Qiu, Weiliang; Beaty, Terri H.; Crapo, James D.; Riley, John H.; Tal-Singer, Ruth
2012-01-01
Rationale: A genome-wide association study (GWAS) for circulating chronic obstructive pulmonary disease (COPD) biomarkers could identify genetic determinants of biomarker levels and COPD susceptibility. Objectives: To identify genetic variants of circulating protein biomarkers and novel genetic determinants of COPD. Methods: GWAS was performed for two pneumoproteins, Clara cell secretory protein (CC16) and surfactant protein D (SP-D), and five systemic inflammatory markers (C-reactive protein, fibrinogen, IL-6, IL-8, and tumor necrosis factor-α) in 1,951 subjects with COPD. For genome-wide significant single nucleotide polymorphisms (SNPs) (P < 1 × 10−8), association with COPD susceptibility was tested in 2,939 cases with COPD and 1,380 smoking control subjects. The association of candidate SNPs with mRNA expression in induced sputum was also elucidated. Measurements and Main Results: Genome-wide significant susceptibility loci affecting biomarker levels were found only for the two pneumoproteins. Two discrete loci affecting CC16, one region near the CC16 coding gene (SCGB1A1) on chromosome 11 and another locus approximately 25 Mb away from SCGB1A1, were identified, whereas multiple SNPs on chromosomes 6 and 16, in addition to SNPs near SFTPD, had genome-wide significant associations with SP-D levels. Several SNPs affecting circulating CC16 levels were significantly associated with sputum mRNA expression of SCGB1A1 (P = 0.009–0.03). Several SNPs highly associated with CC16 or SP-D levels were nominally associated with COPD in a collaborative GWAS (P = 0.001–0.049), although these COPD associations were not replicated in two additional cohorts. Conclusions: Distant genetic loci and biomarker-coding genes affect circulating levels of COPD-related pneumoproteins. A subset of these protein quantitative trait loci may influence their gene expression in the lung and/or COPD susceptibility. Clinical trial registered with www.clinicaltrials.gov (NCT 00292552). PMID
Genome-Wide Posttranscriptional Dysregulation by MicroRNAs in Human Asthma as Revealed by Frac-seq.
Martinez-Nunez, Rocio T; Rupani, Hitasha; Platé, Manuela; Niranjan, Mahesan; Chambers, Rachel C; Howarth, Peter H; Sanchez-Elsner, Tilman
2018-05-16
MicroRNAs are small noncoding RNAs that inhibit gene expression posttranscriptionally, implicated in virtually all biological processes. Although the effect of individual microRNAs is generally studied, the genome-wide role of multiple microRNAs is less investigated. We assessed paired genome-wide expression of microRNAs with total (cytoplasmic) and translational (polyribosome-bound) mRNA levels employing subcellular fractionation and RNA sequencing (Frac-seq) in human primary bronchoepithelium from healthy controls and severe asthmatics. Severe asthma is a chronic inflammatory disease of the airways characterized by poor response to therapy. We found genes (i.e., isoforms of a gene) and mRNA isoforms differentially expressed in asthma, with novel inflammatory and structural pathophysiological mechanisms related to bronchoepithelium disclosed solely by polyribosome-bound mRNAs (e.g., IL1A and LTB genes or ITGA6 and ITGA2 alternatively spliced isoforms). Gene expression (i.e., isoforms of a gene) and mRNA expression analysis revealed different molecular candidates and biological pathways, with differentially expressed polyribosome-bound and total mRNAs also showing little overlap. We reveal a hub of six dysregulated microRNAs accounting for ∼90% of all microRNA targeting, displaying preference for polyribosome-bound mRNAs. Transfection of this hub in bronchial epithelial cells from healthy donors mimicked asthma characteristics. Our work demonstrates extensive posttranscriptional gene dysregulation in human asthma, in which microRNAs play a central role, illustrating the feasibility and importance of assessing posttranscriptional gene expression when investigating human disease. Copyright © 2018 by The American Association of Immunologists, Inc.
Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil
2017-11-01
The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin
Determination of in vivo RNA kinetics using RATE-seq.
Neymotin, Benjamin; Athanasiadou, Rodoniki; Gresham, David
2014-10-01
The abundance of a transcript is determined by its rate of synthesis and its rate of degradation; however, global methods for quantifying RNA abundance cannot distinguish variation in these two processes. Here, we introduce RNA approach to equilibrium sequencing (RATE-seq), which uses in vivo metabolic labeling of RNA and approach to equilibrium kinetics, to determine absolute RNA degradation and synthesis rates. RATE-seq does not disturb cellular physiology, uses straightforward normalization with exogenous spike-ins, and can be readily adapted for studies in most organisms. We demonstrate the use of RATE-seq to estimate genome-wide kinetic parameters for coding and noncoding transcripts in Saccharomyces cerevisiae. © 2014 Neymotin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Firmino, Alexandre Augusto Pereira; Fonseca, Fernando Campos de Assis; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; Antonino de Souza, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima
2013-01-01
Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.
Coelho, Roberta Ramos; Antonino de Souza Jr, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas-Jr, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima
2013-01-01
Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families’ data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects. PMID:24386449
Genome-Wide Architecture of Disease Resistance Genes in Lettuce
Christopoulou, Marilena; Wo, Sebastian Reyes-Chin; Kozik, Alex; McHale, Leah K.; Truco, Maria-Jose; Wroblewski, Tadeusz; Michelmore, Richard W.
2015-01-01
Genome-wide motif searches identified 1134 genes in the lettuce reference genome of cv. Salinas that are potentially involved in pathogen recognition, of which 385 were predicted to encode nucleotide binding-leucine rich repeat receptor (NLR) proteins. Using a maximum-likelihood approach, we grouped the NLRs into 25 multigene families and 17 singletons. Forty-one percent of these NLR-encoding genes belong to three families, the largest being RGC16 with 62 genes in cv. Salinas. The majority of NLR-encoding genes are located in five major resistance clusters (MRCs) on chromosomes 1, 2, 3, 4, and 8 and cosegregate with multiple disease resistance phenotypes. Most MRCs contain primarily members of a single NLR gene family but a few are more complex. MRC2 spans 73 Mb and contains 61 NLRs of six different gene families that cosegregate with nine disease resistance phenotypes. MRC3, which is 25 Mb, contains 22 RGC21 genes and colocates with Dm13. A library of 33 transgenic RNA interference tester stocks was generated for functional analysis of NLR-encoding genes that cosegregated with disease resistance phenotypes in each of the MRCs. Members of four NLR-encoding families, RGC1, RGC2, RGC21, and RGC12 were shown to be required for 16 disease resistance phenotypes in lettuce. The general composition of MRCs is conserved across different genotypes; however, the specific repertoire of NLR-encoding genes varied particularly of the rapidly evolving Type I genes. These tester stocks are valuable resources for future analyses of additional resistance phenotypes. PMID:26449254
Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P
2017-01-01
Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.
Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.
Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien
2017-08-01
RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.
Integrative analysis of micro-RNA, gene expression, and survival of glioblastoma multiforme.
Huang, Yen-Tsung; Hsu, Thomas; Kelsey, Karl T; Lin, Chien-Ling
2015-02-01
Glioblastoma multiforme (GBM), the most common type of malignant brain tumor, is highly fatal. Limited understanding of its rapid progression necessitates additional approaches that integrate what is known about the genomics of this cancer. Using a discovery set (n = 348) and a validation set (n = 174) of GBM patients, we performed genome-wide analyses that integrated mRNA and micro-RNA expression data from GBM as well as associated survival information, assessing coordinated variability in each as this reflects their known mechanistic functions. Cox proportional hazards models were used for the survival analyses, and nonparametric permutation tests were performed for the micro-RNAs to investigate the association between the number of associated genes and its prognostication. We also utilized mediation analyses for micro-RNA-gene pairs to identify their mediation effects. Genome-wide analyses revealed a novel pattern: micro-RNAs related to more gene expressions are more likely to be associated with GBM survival (P = 4.8 × 10(-5)). Genome-wide mediation analyses for the 32,660 micro-RNA-gene pairs with strong association (false discovery rate [FDR] < 0.01%) identified 51 validated pairs with significant mediation effect. Of the 51 pairs, miR-223 had 16 mediation genes. These 16 mediation genes of miR-223 were also highly associated with various other micro-RNAs and mediated their prognostic effects as well. We further constructed a gene signature using the 16 genes, which was highly associated with GBM survival in both the discovery and validation sets (P = 9.8 × 10(-6)). This comprehensive study discovered mediation effects of micro-RNA to gene expression and GBM survival and provided a new analytic framework for integrative genomics. © 2014 WILEY PERIODICALS, INC.
Genome-wide Discovery of Circular RNAs in the Leaf and Seedling Tissues of Arabidopsis Thaliana
Dou, Yongchao; Li, Shengjun; Yang, Weilong; Liu, Kan; Du, Qian; Ren, Guodong; Yu, Bin; Zhang, Chi
2017-01-01
Background: Recently, identification and functional studies of circular RNAs, a type of non-coding RNAs arising from a ligation of 3’ and 5’ ends of a linear RNA molecule, were conducted in mammalian cells with the development of RNA-seq technology. Method: Since compared with animals, studies on circular RNAs in plants are less thorough, a genome-wide identification of circular RNA candidates in Arabidopsis was conducted with our own developed bioinformatics tool to several existing RNA-seq datasets specifically for non-coding RNAs. Results: A total of 164 circular RNA candidates were identified from RNA-seq data, and 4 circular RNA transcripts, including both exonic and intronic circular RNAs, were experimentally validated. Interestingly, our results show that circular RNA transcripts are enriched in the photosynthesis system for the leaf tissue and correlated to the higher expression levels of their parent genes. Sixteen out of all 40 genes that have circular RNA candidates are related to the photosynthesis system, and out of the total 146 exonic circular RNA candidates, 63 are found in chloroplast. PMID:29081691
Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei
2016-01-01
This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Duanmin; Su, Cunjin; Jiang, Min
There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs,more » siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.« less
Genome-wide assessment of differential translations with ribosome profiling data.
Xiao, Zhengtao; Zou, Qin; Liu, Yu; Yang, Xuerui
2016-04-04
The closely regulated process of mRNA translation is crucial for precise control of protein abundance and quality. Ribosome profiling, a combination of ribosome foot-printing and RNA deep sequencing, has been used in a large variety of studies to quantify genome-wide mRNA translation. Here, we developed Xtail, an analysis pipeline tailored for ribosome profiling data that comprehensively and accurately identifies differentially translated genes in pairwise comparisons. Applied on simulated and real datasets, Xtail exhibits high sensitivity with minimal false-positive rates, outperforming existing methods in the accuracy of quantifying differential translations. With published ribosome profiling datasets, Xtail does not only reveal differentially translated genes that make biological sense, but also uncovers new events of differential translation in human cancer cells on mTOR signalling perturbation and in human primary macrophages on interferon gamma (IFN-γ) treatment. This demonstrates the value of Xtail in providing novel insights into the molecular mechanisms that involve translational dysregulations.
Genome-wide assessment of differential translations with ribosome profiling data
Xiao, Zhengtao; Zou, Qin; Liu, Yu; Yang, Xuerui
2016-01-01
The closely regulated process of mRNA translation is crucial for precise control of protein abundance and quality. Ribosome profiling, a combination of ribosome foot-printing and RNA deep sequencing, has been used in a large variety of studies to quantify genome-wide mRNA translation. Here, we developed Xtail, an analysis pipeline tailored for ribosome profiling data that comprehensively and accurately identifies differentially translated genes in pairwise comparisons. Applied on simulated and real datasets, Xtail exhibits high sensitivity with minimal false-positive rates, outperforming existing methods in the accuracy of quantifying differential translations. With published ribosome profiling datasets, Xtail does not only reveal differentially translated genes that make biological sense, but also uncovers new events of differential translation in human cancer cells on mTOR signalling perturbation and in human primary macrophages on interferon gamma (IFN-γ) treatment. This demonstrates the value of Xtail in providing novel insights into the molecular mechanisms that involve translational dysregulations. PMID:27041671
Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway
2012-01-01
Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893
2010-01-01
Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical
Fonseca, Bruno D; Zakaria, Chadi; Jia, Jian-Jun; Graber, Tyson E; Svitkin, Yuri; Tahmasebi, Soroush; Healy, Danielle; Hoang, Huy-Dung; Jensen, Jacob M; Diao, Ilo T; Lussier, Alexandre; Dajadian, Christopher; Padmanabhan, Niranjan; Wang, Walter; Matta-Camacho, Edna; Hearnden, Jaclyn; Smith, Ewan M; Tsukumo, Yoshinori; Yanagiya, Akiko; Morita, Masahiro; Petroulakis, Emmanuel; González, Jose L; Hernández, Greco; Alain, Tommy; Damgaard, Christian K
2015-06-26
The mammalian target of rapamycin complex 1 (mTORC1) is a critical regulator of protein synthesis. The best studied targets of mTORC1 in translation are the eukaryotic initiation factor-binding protein 1 (4E-BP1) and ribosomal protein S6 kinase 1 (S6K1). In this study, we identify the La-related protein 1 (LARP1) as a key novel target of mTORC1 with a fundamental role in terminal oligopyrimidine (TOP) mRNA translation. Recent genome-wide studies indicate that TOP and TOP-like mRNAs compose a large portion of the mTORC1 translatome, but the mechanism by which mTORC1 controls TOP mRNA translation is incompletely understood. Here, we report that LARP1 functions as a key repressor of TOP mRNA translation downstream of mTORC1. Our data show the following: (i) LARP1 associates with mTORC1 via RAPTOR; (ii) LARP1 interacts with TOP mRNAs in an mTORC1-dependent manner; (iii) LARP1 binds the 5'TOP motif to repress TOP mRNA translation; and (iv) LARP1 competes with the eukaryotic initiation factor (eIF) 4G for TOP mRNA binding. Importantly, from a drug resistance standpoint, our data also show that reducing LARP1 protein levels by RNA interference attenuates the inhibitory effect of rapamycin, Torin1, and amino acid deprivation on TOP mRNA translation. Collectively, our findings demonstrate that LARP1 functions as an important repressor of TOP mRNA translation downstream of mTORC1. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Fonseca, Bruno D.; Zakaria, Chadi; Jia, Jian-Jun; Graber, Tyson E.; Svitkin, Yuri; Tahmasebi, Soroush; Healy, Danielle; Hoang, Huy-Dung; Jensen, Jacob M.; Diao, Ilo T.; Lussier, Alexandre; Dajadian, Christopher; Padmanabhan, Niranjan; Wang, Walter; Matta-Camacho, Edna; Hearnden, Jaclyn; Smith, Ewan M.; Tsukumo, Yoshinori; Yanagiya, Akiko; Morita, Masahiro; Petroulakis, Emmanuel; González, Jose L.; Hernández, Greco; Alain, Tommy; Damgaard, Christian K.
2015-01-01
The mammalian target of rapamycin complex 1 (mTORC1) is a critical regulator of protein synthesis. The best studied targets of mTORC1 in translation are the eukaryotic initiation factor-binding protein 1 (4E-BP1) and ribosomal protein S6 kinase 1 (S6K1). In this study, we identify the La-related protein 1 (LARP1) as a key novel target of mTORC1 with a fundamental role in terminal oligopyrimidine (TOP) mRNA translation. Recent genome-wide studies indicate that TOP and TOP-like mRNAs compose a large portion of the mTORC1 translatome, but the mechanism by which mTORC1 controls TOP mRNA translation is incompletely understood. Here, we report that LARP1 functions as a key repressor of TOP mRNA translation downstream of mTORC1. Our data show the following: (i) LARP1 associates with mTORC1 via RAPTOR; (ii) LARP1 interacts with TOP mRNAs in an mTORC1-dependent manner; (iii) LARP1 binds the 5′TOP motif to repress TOP mRNA translation; and (iv) LARP1 competes with the eukaryotic initiation factor (eIF) 4G for TOP mRNA binding. Importantly, from a drug resistance standpoint, our data also show that reducing LARP1 protein levels by RNA interference attenuates the inhibitory effect of rapamycin, Torin1, and amino acid deprivation on TOP mRNA translation. Collectively, our findings demonstrate that LARP1 functions as an important repressor of TOP mRNA translation downstream of mTORC1. PMID:25940091
Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S
2011-11-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular
Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen
2011-01-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury
The RNA-induced silencing complex: a versatile gene-silencing machine.
Pratt, Ashley J; MacRae, Ian J
2009-07-03
RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.
Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.
Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F
2018-04-03
High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.
Genome-Wide RNAi Screen Identifies Broadly-Acting Host Factors That Inhibit Arbovirus Infection
Yasunaga, Ari; Hanna, Sheri L.; Li, Jianqing; Cho, Hyelim; Rose, Patrick P.; Spiridigliozzi, Anna; Gold, Beth; Diamond, Michael S.; Cherry, Sara
2014-01-01
Vector-borne viruses are an important class of emerging and re-emerging pathogens; thus, an improved understanding of the cellular factors that modulate infection in their respective vertebrate and insect hosts may aid control efforts. In particular, cell-intrinsic antiviral pathways restrict vector-borne viruses including the type I interferon response in vertebrates and the RNA interference (RNAi) pathway in insects. However, it is likely that additional cell-intrinsic mechanisms exist to limit these viruses. Since insects rely on innate immune mechanisms to inhibit virus infections, we used Drosophila as a model insect to identify cellular factors that restrict West Nile virus (WNV), a flavivirus with a broad and expanding geographical host range. Our genome-wide RNAi screen identified 50 genes that inhibited WNV infection. Further screening revealed that 17 of these genes were antiviral against additional flaviviruses, and seven of these were antiviral against other vector-borne viruses, expanding our knowledge of invertebrate cell-intrinsic immunity. Investigation of two newly identified factors that restrict diverse viruses, dXPO1 and dRUVBL1, in the Tip60 complex, demonstrated they contributed to antiviral defense at the organismal level in adult flies, in mosquito cells, and in mammalian cells. These data suggest the existence of broadly acting and functionally conserved antiviral genes and pathways that restrict virus infections in evolutionarily divergent hosts. PMID:24550726
Traverse, Charles C; Ochman, Howard
2017-08-29
Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions
Yang, Wenbin; Zhao, Xiaoqing; Liang, Ran; Chen, Da
2017-09-01
To investigate the effects of small RNA interference targeting mammalian target of rapamycin (mTOR) expression on paraquat-induced pulmonary fibrosis in rats. Human embryonic kidney cells HEK-293 were cultured in vitro. The mTOR small interfering RNA (mTOR-siRNA) expression plasmid transfection lentivirus was constructed, and non-specific sequence plasmid with no homology to mTOR gene was set as the control. Seventy-two healthy male Sprague-Dawley (SD) rats were randomly divided into normal saline (NS) control group, paraquat model group, mTOR unrelated sequence group, and mTOR-siRNA group, with 18 rats in each group. Paraquat poisoning animal model was reproduced by intraperitoneally injecting 20% paraquat solution 15 mg/kg, while the NS control group was intraperitoneally injected the same volumes of NS. Rats in the mTOR unrelated sequence group and mTOR-siRNA group were injected 1×10 9 TU/mL lentivirus solution 50 μL into the airway, respectively, while in the NS control group and paraquat model group were injected the same volumes of NS. At 7, 14 and 28 days after treatment, 6 rats in each group were sacrificed respectively for lung tissue, the pathological changes and fibrosis of lung tissues were observed under light microscope. The levels of hydroxyproline (HYP) in lung tissues were determined by alkaline hydrolysis. The mRNA and protein expressions of mTOR in lung tissues were determined by reverse transcription-polymerase chain reaction (RT-PCR) and Western Blot. Under light microscope, there was no obvious pathological changes in the lung tissues in the NS control group, while in the paraquat model group and mTOR unrelated sequence group, lung tissue in rats were damaged, there were a lot of inflammatory cell infiltration, a large number of matrix collagen and fibrous tissues hyperplasia, and gradually increased with time, and it was consistent with paraquat-induced lung tissue fibrosis process. The pathological and fibrotic changes in lung tissue of mTOR-siRNA
Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors
Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József
2006-01-01
RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105
Effects of RNA interference therapy against herpes simplex virus type 1 encephalitis.
da Silva, Alexandre S; Raposo, Jéssica V; Pereira, Tiago C; Pinto, Marcelo A; de Paula, Vanessa S
2016-01-01
Herpetic encephalitis (HSE) is caused mainly by herpes simplex virus type 1 (HSV-1) with an annual incidence of 1-4 cases/million inhabitants. Currently, HSE treatment faces difficulties such as the use of antivirals with elevated toxicity, metabolic side effects and HSV-1 resistance. An alternative to antivirals is the use of small interfering RNA (siRNA) as a viral replication inhibitor. In this work, siRNA targeting the UL-39 region was evaluated for HSE treatment in vivo. BALB/c mice were inoculated with HSV-1 and treated with siRNA. The treatment was evaluated through kinetics of HSV-1 replication inhibition, number of siRNA doses administered and treatment with siRNA plus acyclovir. All groups were evaluated for signs of HSE, mortality and HSV-1 replication inhibition. The treated group of the kinetic experiment demonstrated a reduction of HSE signs and an HSV-1 replication inhibition of 43.6-99.9% in the brain and 53-98% in trigeminal ganglia (TG). Animals treated with one or two doses of siRNA had a prolonged survival time, reduced clinical signs of HSE and HSV-1 replication inhibition of 67.7% in brains and 85.7% in TG of animals treated with two doses of siRNA. Also, animals treated with siRNA plus acyclovir demonstrated reduced signs of HSE and mortality, as well as HSV-1 replication inhibition in the brain (83.2%) and TG (74.5%). These findings demonstrated that siRNA was capable of reducing HSE clinical signs, prolonging survival time and inhibiting HSV-1 replication in mice. Thus, siRNA can be a potential alternative to the standard HSE treatment especially to reduce clinical signs and extend survival time in vivo.
DICER-ARGONAUTE2 Complex in Continuous Fluorogenic Assays of RNA Interference Enzymes
Bernard, Mark A.; Wang, Leyu; Tachado, Souvenir D.
2015-01-01
Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC) have been hindered by lack of methods for continuous monitoring of enzymatic activity. “Quencherless” fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS) and hypoxia-inducible factor 1-α subunit (HIF1A). Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (K m=74 nM) with substrate inhibition kinetics (K i=105 nM), demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER) bound in the active site of DICER may undergo direct transfer (as AGO2 substrate) to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29), suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a strong
Neymotin, Benjamin; Ettorre, Victoria; Gresham, David
2016-01-01
Degradation of mRNA contributes to variation in transcript abundance. Studies of individual mRNAs have shown that both cis and trans factors affect mRNA degradation rates. However, the factors underlying transcriptome-wide variation in mRNA degradation rates are poorly understood. We investigated the contribution of different transcript properties to transcriptome-wide degradation rate variation in the budding yeast, Saccharomyces cerevisiae, using multiple regression analysis. We find that multiple transcript properties are significantly associated with variation in mRNA degradation rates, and that a model incorporating these properties explains ∼50% of the genome-wide variance. Predictors of mRNA degradation rates include transcript length, ribosome density, biased codon usage, and GC content of the third position in codons. To experimentally validate these factors, we studied individual transcripts expressed from identical promoters. We find that decreasing ribosome density by mutating the first translational start site of a transcript increases its degradation rate. Using coding sequence variants of green fluorescent protein (GFP) that differ only at synonymous sites, we show that increased GC content of the third position of codons results in decreased rates of mRNA degradation. Thus, in steady-state conditions, a large fraction of genome-wide variation in mRNA degradation rates is determined by inherent properties of transcripts, many of which are related to translation, rather than specific regulatory mechanisms. PMID:27633789
Regulatory RNA-assisted genome engineering in microorganisms.
Si, Tong; HamediRad, Mohammad; Zhao, Huimin
2015-12-01
Regulatory RNAs are increasingly recognized and utilized as key modulators of gene expression in diverse organisms. Thanks to their modular and programmable nature, trans-acting regulatory RNAs are especially attractive in genome-scale applications. Here we discuss the recent examples in microbial genome engineering implementing various trans-acting RNA platforms, including sRNA, RNAi, asRNA and CRISRP-Cas. In particular, we focus on how the scalable and multiplex nature of trans-acting RNAs has been used to tackle the challenges in creating genome-wide and combinatorial diversity for functional genomics and metabolic engineering applications. Advances in computational design and context-dependent regulation are also discussed for their contribution in improving fine-tuning capabilities of trans-acting RNAs. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin
2012-12-01
To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.
Biochemical and Structural Studies of RNA Modification and Repair
ERIC Educational Resources Information Center
Chan, Chio Mui
2009-01-01
RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…
iCLIP: Protein–RNA interactions at nucleotide resolution
Huppertz, Ina; Attig, Jan; D’Ambrogio, Andrea; Easton, Laura E.; Sibley, Christopher R.; Sugimoto, Yoichiro; Tajnik, Mojca; König, Julian; Ule, Jernej
2014-01-01
RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein–RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein–RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs. PMID:24184352
GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases
Nguyen, Nhu T.; Liebers, Matthew; Topkar, Ved V.; Thapar, Vishal; Wyvekens, Nicolas; Khayter, Cyd; Iafrate, A. John; Le, Long P.; Aryee, Martin J.; Joung, J. Keith
2014-01-01
CRISPR RNA-guided nucleases (RGNs) are widely used genome-editing reagents, but methods to delineate their genome-wide off-target cleavage activities have been lacking. Here we describe an approach for global detection of DNA double-stranded breaks (DSBs) introduced by RGNs and potentially other nucleases. This method, called Genome-wide Unbiased Identification of DSBs Enabled by Sequencing (GUIDE-Seq), relies on capture of double-stranded oligodeoxynucleotides into breaks Application of GUIDE-Seq to thirteen RGNs in two human cell lines revealed wide variability in RGN off-target activities and unappreciated characteristics of off-target sequences. The majority of identified sites were not detected by existing computational methods or ChIP-Seq. GUIDE-Seq also identified RGN-independent genomic breakpoint ‘hotspots’. Finally, GUIDE-Seq revealed that truncated guide RNAs exhibit substantially reduced RGN-induced off-target DSBs. Our experiments define the most rigorous framework for genome-wide identification of RGN off-target effects to date and provide a method for evaluating the safety of these nucleases prior to clinical use. PMID:25513782
Li, Yongsheng; Chen, Juan; Zhang, Jinwen; Wang, Zishan; Shao, Tingting; Jiang, Chunjie; Xu, Juan; Li, Xia
2015-09-22
Long non-coding RNAs (lncRNAs) play key roles in diverse biological processes. Moreover, the development and progression of cancer often involves the combined actions of several lncRNAs. Here we propose a multi-step method for constructing lncRNA-lncRNA functional synergistic networks (LFSNs) through co-regulation of functional modules having three features: common coexpressed genes of lncRNA pairs, enrichment in the same functional category and close proximity within protein interaction networks. Applied to three cancers, we constructed cancer-specific LFSNs and found that they exhibit a scale free and modular architecture. In addition, cancer-associated lncRNAs tend to be hubs and are enriched within modules. Although there is little synergistic pairing of lncRNAs across cancers, lncRNA pairs involved in the same cancer hallmarks by regulating same or different biological processes. Finally, we identify prognostic biomarkers within cancer lncRNA expression datasets using modules derived from LFSNs. In summary, this proof-of-principle study indicates synergistic lncRNA pairs can be identified through integrative analysis of genome-wide expression data sets and functional information.
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-01-01
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time
Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq
Stork, Cheryl; Zheng, Sika
2017-01-01
UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977
Evidence for a Role of Connexin 43 in Trigeminal Pain Using RNA Interference In Vivo
Ohara, Peter T.; Vit, Jean-Philippe; Bhargava, Aditi; Jasmin, Luc
2008-01-01
The importance of glial cells in the generation and maintenance of neuropathic pain is becoming widely accepted. We examined the role of glial-specific gap junctions in nociception in the rat trigeminal ganglion in nerve-injured and -uninjured states. The connexin 43 (Cx43) gap-junction subunit was found to be confined to the satellite glial cells (SGCs) that tightly envelop primary sensory neurons in the trigeminal ganglion and we therefore used Cx43 RNA interference (RNAi) to alter gap-junction function in SGCs. Using behavioral evaluation, together with immunocytochemical and Western blot monitoring, we show that Cx43 increased in the trigeminal ganglion in rats with a chronic constriction injury (CCI) of the infraorbital nerve. Reducing Cx43 expression using RNAi in CCI rats reduced painlike behavior, whereas in non-CCI rats, reducing Cx43 expression increased painlike behavior. The degree of painlike behavior in CCI rats and intact, Cx43-silenced rats was similar. Our results support previous suggestions that increases in glial gap junctions after nerve injury increases nociceptive behavior but paradoxically the reduction of gap junctions in normal ganglia also increases nociceptive behavior, possibly a reflection of the multiple functions performed by glia. PMID:18715894
Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.
O'Connell, Mitchell
2018-06-22
Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.
Perkins, Gillian A; Van de Walle, Gerlinde R; Pusterla, Nicola; Erb, Hollis N; Osterrieder, Nikolaus
2013-02-01
To evaluate metaphylactic RNA interference to prevent equine herpesvirus type 1 (EHV-1) infection in experimental herpesvirus myeloencephalopathy in horses and to determine whether horses infected with a neuropathogenic strain of the virus that develop equine herpesvirus myeloencephalopathy (EHM) have differences in viremia. 13 seronegative horses. EHV-1 strain Ab4 was administered intranasally on day 0, and small interfering RNAs (siRNAs [EHV-1 specific siRNAs {n = 7} or an irrelevant siRNA {6}]) were administered intranasally 24 hours before and 12, 24, 36, and 48 hours after infection. Physical and neurologic examinations, nasal swab specimens, and blood samples were collected for virus isolation and quantitative PCR assay. Data from the study were combined with data from a previous study of 14 horses. No significant difference was detected in clinical variables, viremia, or detection of EHV-1 in nasal swab specimens of horses treated with the EHV-1 targeted siRNAs (sigB3-siOri2) versus controls. No significant differences in viremia were detected between horses that developed EHM and those that did not. Administration of siRNAs targeted against EHV-1 around the time of EHV-1 infection was not protective with this experimental design. Horses infected with the neuropathogenic EHV-1 strain Ab4 that developed EHM did not have a more pronounced viremia.
Diederichs, Sven; Haber, Daniel A
2007-12-14
MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.
Current Progress of siRNA/shRNA Therapeutics in Clinical Trials
Burnett, John C.; Rossi, John J.; Tiemann, Katrin
2012-01-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. For some of the drugs, advancements in bioengineering and nanotechnology have led to improved control of delivery and release of the siRNA. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. PMID:21744502
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C
2015-01-29
Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi
Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.
2015-01-01
SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455
Proteomics for understanding miRNA biology
Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh
2013-01-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164
ABCE1 Is a Highly Conserved RNA Silencing Suppressor
Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia
2015-01-01
ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154
In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.
Seema, S; Seenivasagam, R; Hemavathi, K
2013-01-01
Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.
Dysregulation of RNA Interference in Breast Cancer
2007-07-01
of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative
Burroughs, A Maxwell; Ando, Yoshinari; de Hoon, Michiel J L; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O
2010-10-01
Animal microRNA sequences are subject to 3' nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3' adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1-EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3' addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3' adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake.
Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells
NASA Astrophysics Data System (ADS)
Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.
2011-11-01
Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.
Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P
2017-06-01
Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.
Yap, Karen; Makeyev, Eugene V
2013-09-01
Eukaryotic gene expression is orchestrated on a genome-wide scale through several post-transcriptional mechanisms. Of these, alternative pre-mRNA splicing expands the proteome diversity and modulates mRNA stability through downstream RNA quality control (QC) pathways including nonsense-mediated decay (NMD) of mRNAs containing premature termination codons and nuclear retention and elimination (NRE) of intron-containing transcripts. Although originally identified as mechanisms for eliminating aberrant transcripts, a growing body of evidence suggests that NMD and NRE coupled with deliberate changes in pre-mRNA splicing patterns are also used in a number of biological contexts for deterministic control of gene expression. Here we review recent studies elucidating molecular mechanisms and biological significance of these gene regulation strategies with a specific focus on their roles in nervous system development and physiology. This article is part of a Special Issue entitled 'RNA and splicing regulation in neurodegeneration'. Copyright © 2013 Elsevier Inc. All rights reserved.
Zhang, Xiaohua Douglas; Yang, Xiting Cindy; Chung, Namjin; Gates, Adam; Stec, Erica; Kunapuli, Priya; Holder, Dan J; Ferrer, Marc; Espeseth, Amy S
2006-04-01
RNA interference (RNAi) high-throughput screening (HTS) experiments carried out using large (>5000 short interfering [si]RNA) libraries generate a huge amount of data. In order to use these data to identify the most effective siRNAs tested, it is critical to adopt and develop appropriate statistical methods. To address the questions in hit selection of RNAi HTS, we proposed a quartile-based method which is robust to outliers, true hits and nonsymmetrical data. We compared it with the more traditional tests, mean +/- k standard deviation (SD) and median +/- 3 median of absolute deviation (MAD). The results suggested that the quartile-based method selected more hits than mean +/- k SD under the same preset error rate. The number of hits selected by median +/- k MAD was close to that by the quartile-based method. Further analysis suggested that the quartile-based method had the greatest power in detecting true hits, especially weak or moderate true hits. Our investigation also suggested that platewise analysis (determining effective siRNAs on a plate-by-plate basis) can adjust for systematic errors in different plates, while an experimentwise analysis, in which effective siRNAs are identified in an analysis of the entire experiment, cannot. However, experimentwise analysis may detect a cluster of true positive hits placed together in one or several plates, while platewise analysis may not. To display hit selection results, we designed a specific figure called a plate-well series plot. We thus suggest the following strategy for hit selection in RNAi HTS experiments. First, choose the quartile-based method, or median +/- k MAD, for identifying effective siRNAs. Second, perform the chosen method experimentwise on transformed/normalized data, such as percentage inhibition, to check the possibility of hit clusters. If a cluster of selected hits are observed, repeat the analysis based on untransformed data to determine whether the cluster is due to an artifact in the data
O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T
2005-01-01
Background The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. Methods AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Results Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. Conclusion EGFR
Nilsson, Emil K; Boström, Adrian E; Mwinyi, Jessica; Schiöth, Helgi B
2016-06-01
Despite an established link between sleep deprivation and epigenetic processes in humans, it remains unclear to what extent sleep deprivation modulates DNA methylation. We performed a within-subject randomized blinded study with 16 healthy subjects to examine the effect of one night of total sleep deprivation (TSD) on the genome-wide methylation profile in blood compared with that in normal sleep. Genome-wide differences in methylation between both conditions were assessed by applying a paired regression model that corrected for monocyte subpopulations. In addition, the correlations between the methylation of genes detected to be modulated by TSD and gene expression were examined in a separate, publicly available cohort of 10 healthy male donors (E-GEOD-49065). Sleep deprivation significantly affected the DNA methylation profile both independently and in dependency of shifts in monocyte composition. Our study detected differential methylation of 269 probes. Notably, one CpG site was located 69 bp upstream of ING5, which has been shown to be differentially expressed after sleep deprivation. Gene set enrichment analysis detected the Notch and Wnt signaling pathways to be enriched among the differentially methylated genes. These results provide evidence that total acute sleep deprivation alters the methylation profile in healthy human subjects. This is, to our knowledge, the first study that systematically investigated the impact of total acute sleep deprivation on genome-wide DNA methylation profiles in blood and related the epigenomic findings to the expression data.
Non-isotopic Method for In Situ LncRNA Visualization and Quantitation.
Maqsodi, Botoul; Nikoloff, Corina
2016-01-01
In mammals and other eukaryotes, most of the genome is transcribed in a developmentally regulated manner to produce large numbers of long noncoding RNAs (lncRNAs). Genome-wide studies have identified thousands of lncRNAs lacking protein-coding capacity. RNA in situ hybridization technique is especially beneficial for the visualization of RNA (mRNA and lncRNA) expression in a heterogeneous population of cells/tissues; however its utility has been hampered by complicated procedures typically developed and optimized for the detection of a specific gene and therefore not amenable to a wide variety of genes and tissues.Recently, bDNA has revolutionized RNA in situ detection with fully optimized, robust assays for the detection of any mRNA and lncRNA targets in formalin-fixed paraffin-embedded (FFPE) and fresh frozen tissue sections using manual processing.
Ways and means of eukaryotic mRNA decay.
Balagopal, Vidya; Fluch, Lydia; Nissan, Tracy
2012-06-01
Messenger RNA degradation is an important point of control for gene expression. Genome-wide studies on mRNA stability have demonstrated its importance in adaptation and stress response. Most of the key players in mRNA decay appear to have been identified. The study of these proteins brings insight into the mechanism of general and specific targeting of transcripts for degradation. Recruitment and assembly of mRNP complexes enhance and bring specificity to mRNA decay. mRNP complexes can form larger structures that have been found to be ubiquitous in nature. Discovery of P-Bodies, an archetype of this sort of aggregates, has generated interest in the question of where mRNA degrades. This is currently an open question under extensive investigation. This review will discuss in detail the recent developments in the regulation of mRNA decay focusing on yeast as a model system. This article is part of a Special Issue entitled: Nuclear Transport and RNA Processing. Copyright © 2012 Elsevier B.V. All rights reserved.
RNA-Interference Pathways Display High Rates of Adaptive Protein Evolution in Multiple Invertebrates
Palmer, William H.; Hadfield, Jarrod D.; Obbard, Darren J.
2018-01-01
Conflict between organisms can lead to a reciprocal adaptation that manifests as an increased evolutionary rate in genes mediating the conflict. This adaptive signature has been observed in RNA-interference (RNAi) pathway genes involved in the suppression of viruses and transposable elements in Drosophila melanogaster, suggesting that a subset of Drosophila RNAi genes may be locked in an arms race with these parasites. However, it is not known whether rapid evolution of RNAi genes is a general phenomenon across invertebrates, or which RNAi genes generally evolve adaptively. Here we use population genomic data from eight invertebrate species to infer rates of adaptive sequence evolution, and to test for past and ongoing selective sweeps in RNAi genes. We assess rates of adaptive protein evolution across species using a formal meta-analytic framework to combine data across species and by implementing a multispecies generalized linear mixed model of mutation counts. Across species, we find that RNAi genes display a greater rate of adaptive protein substitution than other genes, and that this is primarily mediated by positive selection acting on the genes most likely to defend against viruses and transposable elements. In contrast, evidence for recent selective sweeps is broadly spread across functional classes of RNAi genes and differs substantially among species. Finally, we identify genes that exhibit elevated adaptive evolution across the analyzed insect species, perhaps due to concurrent parasite-mediated arms races. PMID:29437826
Parker, Greg S; Eckert, Debra M; Bass, Brenda L
2006-05-01
In organisms ranging from Arabidopsis to humans, Dicer requires dsRNA-binding proteins (dsRBPs) to carry out its roles in RNA interference (RNAi) and micro-RNA (miRNA) processing. In Caenorhabditis elegans, the dsRBP RDE-4 acts with Dicer during the initiation of RNAi, when long dsRNA is cleaved to small interfering RNAs (siRNAs). RDE-4 is not required in subsequent steps, and how RDE-4 distinguishes between long dsRNA and short siRNA is unclear. We report the first detailed analysis of RDE-4 binding, using purified recombinant RDE-4 and various truncated proteins. We find that, similar to other dsRBPs, RDE-4 is not sequence-specific. However, consistent with its in vivo roles, RDE-4 binds with higher affinity to long dsRNA. We also observe that RDE-4 is a homodimer in solution, and that the C-terminal domain of the protein is required for dimerization. Using extracts from wild-type and rde-4 mutant C. elegans, we show that the C-terminal dimerization domain is required for the production of siRNA. Our findings suggest a model for RDE-4 function during the initiation of RNAi.
Parker, Greg S.; Eckert, Debra M.; Bass, Brenda L.
2006-01-01
In organisms ranging from Arabidopsis to humans, Dicer requires dsRNA-binding proteins (dsRBPs) to carry out its roles in RNA interference (RNAi) and micro-RNA (miRNA) processing. In Caenorhabditis elegans, the dsRBP RDE-4 acts with Dicer during the initiation of RNAi, when long dsRNA is cleaved to small interfering RNAs (siRNAs). RDE-4 is not required in subsequent steps, and how RDE-4 distinguishes between long dsRNA and short siRNA is unclear. We report the first detailed analysis of RDE-4 binding, using purified recombinant RDE-4 and various truncated proteins. We find that, similar to other dsRBPs, RDE-4 is not sequence-specific. However, consistent with its in vivo roles, RDE-4 binds with higher affinity to long dsRNA. We also observe that RDE-4 is a homodimer in solution, and that the C-terminal domain of the protein is required for dimerization. Using extracts from wild-type and rde-4 mutant C. elegans, we show that the C-terminal dimerization domain is required for the production of siRNA. Our findings suggest a model for RDE-4 function during the initiation of RNAi. PMID:16603715
PHOSPHOLIPASE Cβ CONNECTS G PROTEIN SIGNALING WITH RNA INTERFERENCE
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2015-01-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (RISC) (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentration can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. PMID:26746047
Phospholipase Cβ connects G protein signaling with RNA interference.
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2016-05-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentrations can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. Copyright © 2015 Elsevier Ltd. All rights reserved.
iCLIP: protein-RNA interactions at nucleotide resolution.
Huppertz, Ina; Attig, Jan; D'Ambrogio, Andrea; Easton, Laura E; Sibley, Christopher R; Sugimoto, Yoichiro; Tajnik, Mojca; König, Julian; Ule, Jernej
2014-02-01
RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein-RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Genome-Wide Analyses of the Soybean F-Box Gene Family in Response to Salt Stress
Jia, Qi; Xiao, Zhi-Xia; Wong, Fuk-Ling; Sun, Song; Liang, Kang-Jing; Lam, Hon-Ming
2017-01-01
The F-box family is one of the largest gene families in plants that regulate diverse life processes, including salt responses. However, the knowledge of the soybean F-box genes and their roles in salt tolerance remains limited. Here, we conducted a genome-wide survey of the soybean F-box family, and their expression analysis in response to salinity via in silico analysis of online RNA-sequencing (RNA-seq) data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to predict their potential functions. A total of 725 potential F-box proteins encoded by 509 genes were identified and classified into 9 subfamilies. The gene structures, conserved domains and chromosomal distributions were characterized. There are 76 pairs of duplicate genes identified, including genome-wide segmental and tandem duplication events, which lead to the expansion of the number of F-box genes. The in silico expression analysis showed that these genes would be involved in diverse developmental functions and play an important role in salt response. Our qRT-PCR analysis confirmed 12 salt-responding F-box genes. Overall, our results provide useful information on soybean F-box genes, especially their potential roles in salt tolerance. PMID:28417911
Genome-Wide Analyses of the Soybean F-Box Gene Family in Response to Salt Stress.
Jia, Qi; Xiao, Zhi-Xia; Wong, Fuk-Ling; Sun, Song; Liang, Kang-Jing; Lam, Hon-Ming
2017-04-12
The F-box family is one of the largest gene families in plants that regulate diverse life processes, including salt responses. However, the knowledge of the soybean F-box genes and their roles in salt tolerance remains limited. Here, we conducted a genome-wide survey of the soybean F-box family, and their expression analysis in response to salinity via in silico analysis of online RNA-sequencing (RNA-seq) data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to predict their potential functions. A total of 725 potential F-box proteins encoded by 509 genes were identified and classified into 9 subfamilies. The gene structures, conserved domains and chromosomal distributions were characterized. There are 76 pairs of duplicate genes identified, including genome-wide segmental and tandem duplication events, which lead to the expansion of the number of F-box genes. The in silico expression analysis showed that these genes would be involved in diverse developmental functions and play an important role in salt response. Our qRT-PCR analysis confirmed 12 salt-responding F-box genes. Overall, our results provide useful information on soybean F-box genes, especially their potential roles in salt tolerance.
2008-01-01
siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to
Proteomics for understanding miRNA biology.
Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh
2013-02-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Laver, John D; Li, Xiao; Ray, Debashish; Cook, Kate B; Hahn, Noah A; Nabeel-Shah, Syed; Kekis, Mariana; Luo, Hua; Marsolais, Alexander J; Fung, Karen Yy; Hughes, Timothy R; Westwood, J Timothy; Sidhu, Sachdev S; Morris, Quaid; Lipshitz, Howard D; Smibert, Craig A
2015-05-12
Brain tumor (BRAT) is a Drosophila member of the TRIM-NHL protein family. This family is conserved among metazoans and its members function as post-transcriptional regulators. BRAT was thought to be recruited to mRNAs indirectly through interaction with the RNA-binding protein Pumilio (PUM). However, it has recently been demonstrated that BRAT directly binds to RNA. The precise sequence recognized by BRAT, the extent of BRAT-mediated regulation, and the exact roles of PUM and BRAT in post-transcriptional regulation are unknown. Genome-wide identification of transcripts associated with BRAT or with PUM in Drosophila embryos shows that they bind largely non-overlapping sets of mRNAs. BRAT binds mRNAs that encode proteins associated with a variety of functions, many of which are distinct from those implemented by PUM-associated transcripts. Computational analysis of in vitro and in vivo data identified a novel RNA motif recognized by BRAT that confers BRAT-mediated regulation in tissue culture cells. The regulatory status of BRAT-associated mRNAs suggests a prominent role for BRAT in post-transcriptional regulation, including a previously unidentified role in transcript degradation. Transcriptomic analysis of embryos lacking functional BRAT reveals an important role in mediating the decay of hundreds of maternal mRNAs during the maternal-to-zygotic transition. Our results represent the first genome-wide analysis of the mRNAs associated with a TRIM-NHL protein and the first identification of an RNA motif bound by this protein family. BRAT is a prominent post-transcriptional regulator in the early embryo through mechanisms that are largely independent of PUM.
Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes.
Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2016-01-01
Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy.
Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes
Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2016-01-01
ABSTRACT Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy. PMID:27046251
Dou, Yun-De; Huang, Tao; Wang, Qun; Shu, Xin; Zhao, Shi-Gang; Li, Lei; Liu, Tao; Lu, Gang; Chan, Wai-Yee; Liu, Hong-Bin
2018-01-29
Characterization of the genetic landscapes of familial ovarian cancer through integrated analysis of microRNA and mRNA by partial least squares (PLS) and Monte Carlo technique based on genome-wide association studies (GWAS). The miRNA and mRNA transcriptional data in familial ovarian cancer were characterized from the Gene Expression Omnibus (GEO) database. The miRNA and mRNA expression profiles in peripheral blood lymphocytes (PBLs) of 74 familial ovarian cancer patients and 47 control subjects were analyzed with the integration of partial least squares (PLS) and Monte Carlo techniques. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were also performed. Total of 16 miRNA-mRNA pairs were identified with the target gene prediction results of miRNAs and mRNAs. An innovated miRNA-mRNA integrated network was constructed in which 6 downregulated miRNAs and 1 upregulated miRNAs were included. KEGG and GO pathway enrichment analysis revealed over-representation of dysregulated miRNAs in various biological processes especially in cancer pathology. Hsa-miR-34b played a pivotal role in this network and interacted with other miRNAs. Hsa-miR-136 and hsa-miR-335 were associated with p53 and Erk1/2 pathways and tumor suppressors, such as PTEN. The results from this research provide insights on miRNA-mRNA networks and offer new tools for studying transcriptional variants in familial ovarian cancer. Copyright © 2018 Elsevier Inc. All rights reserved.
Current progress of siRNA/shRNA therapeutics in clinical trials.
Burnett, John C; Rossi, John J; Tiemann, Katrin
2011-09-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers, including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. Advancements in bioengineering and nanotechnology have led to improved control of delivery and release of some siRNA therapeutics. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.
Crosswhite, Patrick; Sun, Zhongjie
2010-06-01
The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.
Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome
NASA Astrophysics Data System (ADS)
Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei
2004-11-01
Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity
BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.
Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun
2015-01-15
It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
An RNA isolation system for plant tissues rich in secondary metabolites
2011-01-01
Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M.; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-01-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA–mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection. PMID:22822208
Marovca, Blerim; Vonderheit, Andreas; Grotzer, Michael A.; Eckert, Cornelia; Cario, Gunnar; Wollscheid, Bernd; Horvath, Peter
2014-01-01
Interactions with the bone marrow microenvironment are essential for leukemia survival and disease progression. We developed an imaging-based RNAi platform to identify protective cues from bone marrow derived mesenchymal stromal cells (MSC) that promote survival of primary acute lymphoblastic leukemia (ALL) cells. Using a candidate gene approach, we detected distinct responses of individual ALL cases to RNA interference with stromal targets. The strongest effects were observed when interfering with solute carrier family 3 member 2 (SLC3A2) expression, which forms the cystine transporter xc− when associated with SLC7A11. Import of cystine and metabolism to cysteine by stromal cells provides the limiting substrate to generate and maintain glutathione in ALL. This metabolic interaction reduces oxidative stress in ALL cells that depend on stromal xc−. Indeed, cysteine depletion using cysteine dioxygenase resulted in leukemia cell death. Thus, functional evaluation of intercellular interactions between leukemia cells and their microenvironment identifies a selective dependency of ALL cells on stromal metabolism for a relevant subgroup of cases, providing new opportunities to develop more personalized approaches to leukemia treatment. PMID:25415224
MicroRNA signature of the human developing pancreas.
Rosero, Samuel; Bravo-Egana, Valia; Jiang, Zhijie; Khuri, Sawsan; Tsinoremas, Nicholas; Klein, Dagmar; Sabates, Eduardo; Correa-Medina, Mayrin; Ricordi, Camillo; Domínguez-Bendala, Juan; Diez, Juan; Pastori, Ricardo L
2010-09-22
MicroRNAs are non-coding RNAs that regulate gene expression including differentiation and development by either inhibiting translation or inducing target degradation. The aim of this study is to determine the microRNA expression signature during human pancreatic development and to identify potential microRNA gene targets calculating correlations between the signature microRNAs and their corresponding mRNA targets, predicted by bioinformatics, in genome-wide RNA microarray study. The microRNA signature of human fetal pancreatic samples 10-22 weeks of gestational age (wga), was obtained by PCR-based high throughput screening with Taqman Low Density Arrays. This method led to identification of 212 microRNAs. The microRNAs were classified in 3 groups: Group number I contains 4 microRNAs with the increasing profile; II, 35 microRNAs with decreasing profile and III with 173 microRNAs, which remain unchanged. We calculated Pearson correlations between the expression profile of microRNAs and target mRNAs, predicted by TargetScan 5.1 and miRBase algorithms, using genome-wide mRNA expression data. Group I correlated with the decreasing expression of 142 target mRNAs and Group II with the increasing expression of 876 target mRNAs. Most microRNAs correlate with multiple targets, just as mRNAs are targeted by multiple microRNAs. Among the identified targets are the genes and transcription factors known to play an essential role in pancreatic development. We have determined specific groups of microRNAs in human fetal pancreas that change the degree of their expression throughout the development. A negative correlative analysis suggests an intertwined network of microRNAs and mRNAs collaborating with each other. This study provides information leading to potential two-way level of combinatorial control regulating gene expression through microRNAs targeting multiple mRNAs and, conversely, target mRNAs regulated in parallel by other microRNAs as well. This study may further the
MicroRNA signature of the human developing pancreas
2010-01-01
Background MicroRNAs are non-coding RNAs that regulate gene expression including differentiation and development by either inhibiting translation or inducing target degradation. The aim of this study is to determine the microRNA expression signature during human pancreatic development and to identify potential microRNA gene targets calculating correlations between the signature microRNAs and their corresponding mRNA targets, predicted by bioinformatics, in genome-wide RNA microarray study. Results The microRNA signature of human fetal pancreatic samples 10-22 weeks of gestational age (wga), was obtained by PCR-based high throughput screening with Taqman Low Density Arrays. This method led to identification of 212 microRNAs. The microRNAs were classified in 3 groups: Group number I contains 4 microRNAs with the increasing profile; II, 35 microRNAs with decreasing profile and III with 173 microRNAs, which remain unchanged. We calculated Pearson correlations between the expression profile of microRNAs and target mRNAs, predicted by TargetScan 5.1 and miRBase altgorithms, using genome-wide mRNA expression data. Group I correlated with the decreasing expression of 142 target mRNAs and Group II with the increasing expression of 876 target mRNAs. Most microRNAs correlate with multiple targets, just as mRNAs are targeted by multiple microRNAs. Among the identified targets are the genes and transcription factors known to play an essential role in pancreatic development. Conclusions We have determined specific groups of microRNAs in human fetal pancreas that change the degree of their expression throughout the development. A negative correlative analysis suggests an intertwined network of microRNAs and mRNAs collaborating with each other. This study provides information leading to potential two-way level of combinatorial control regulating gene expression through microRNAs targeting multiple mRNAs and, conversely, target mRNAs regulated in parallel by other microRNAs as well
Peterson, Joseph R.; Thor, ShengShee; Kohler, Lars; ...
2016-11-16
Here, while a few studies on the variations in mRNA expression and half-lives measured under different growth conditions have been used to predict patterns of regulation in bacterial organisms, the extent to which this information can also play a role in defining metabolic phenotypes has yet to be examined systematically. Here we present the first comprehensive study for a model methanogen. As a result, we use expression and half-life data for the methanogen Methanosarcina acetivorans growing on fast- and slow-growth substrates to examine the regulation of its genes. Unlike Escherichia coli where only small shifts in half-lives were observed, wemore » found that most mRNA have significantly longer half-lives for slow growth on acetate compared to fast growth on methanol or trimethylamine. Interestingly, half-life shifts are not uniform across functional classes of enzymes, suggesting the existence of a selective stabilization mechanism for mRNAs. Using the transcriptomics data we determined whether transcription or degradation rate controls the change in transcript abundance. Degradation was found to control abundance for about half of the metabolic genes underscoring its role in regulating metabolism. Genes involved in half of the metabolic reactions were found to be differentially expressed among the substrates suggesting the existence of drastically different metabolic phenotypes that extend beyond just the methanogenesis pathways. By integrating expression data with an updated metabolic model of the organism (iST807) significant differences in pathway flux and production of metabolites were predicted for the three growth substrates. In conclusion, this study provides the first global picture of differential expression and half-lives for a class II methanogen, as well as provides the first evidence in a single organism that drastic genome-wide shifts in RNA half-lives can be modulated by growth substrate. We determined which genes in each metabolic pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peterson, Joseph R.; Thor, ShengShee; Kohler, Lars
Here, while a few studies on the variations in mRNA expression and half-lives measured under different growth conditions have been used to predict patterns of regulation in bacterial organisms, the extent to which this information can also play a role in defining metabolic phenotypes has yet to be examined systematically. Here we present the first comprehensive study for a model methanogen. As a result, we use expression and half-life data for the methanogen Methanosarcina acetivorans growing on fast- and slow-growth substrates to examine the regulation of its genes. Unlike Escherichia coli where only small shifts in half-lives were observed, wemore » found that most mRNA have significantly longer half-lives for slow growth on acetate compared to fast growth on methanol or trimethylamine. Interestingly, half-life shifts are not uniform across functional classes of enzymes, suggesting the existence of a selective stabilization mechanism for mRNAs. Using the transcriptomics data we determined whether transcription or degradation rate controls the change in transcript abundance. Degradation was found to control abundance for about half of the metabolic genes underscoring its role in regulating metabolism. Genes involved in half of the metabolic reactions were found to be differentially expressed among the substrates suggesting the existence of drastically different metabolic phenotypes that extend beyond just the methanogenesis pathways. By integrating expression data with an updated metabolic model of the organism (iST807) significant differences in pathway flux and production of metabolites were predicted for the three growth substrates. In conclusion, this study provides the first global picture of differential expression and half-lives for a class II methanogen, as well as provides the first evidence in a single organism that drastic genome-wide shifts in RNA half-lives can be modulated by growth substrate. We determined which genes in each metabolic pathway
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Genome-wide Mapping of Cellular Protein–RNA Interactions Enabled by Chemical Crosslinking
Li, Xiaoyu; Song, Jinghui; Yi, Chengqi
2014-01-01
RNA–protein interactions influence many biological processes. Identifying the binding sites of RNA-binding proteins (RBPs) remains one of the most fundamental and important challenges to the studies of such interactions. Capturing RNA and RBPs via chemical crosslinking allows stringent purification procedures that significantly remove the non-specific RNA and protein interactions. Two major types of chemical crosslinking strategies have been developed to date, i.e., UV-enabled crosslinking and enzymatic mechanism-based covalent capture. In this review, we compare such strategies and their current applications, with an emphasis on the technologies themselves rather than the biology that has been revealed. We hope such methods could benefit broader audience and also urge for the development of new methods to study RNA−RBP interactions. PMID:24747191
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F
2010-04-08
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.
Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA
2012-01-01
utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito
Ng, Kimberly; Futalan, Diahnn; Shen, Ying; Akers, Johnny C.; Steed, Tyler; Kushwaha, Deepa; Schlabach, Michael; Carter, Bob S.; Kwon, Chang-Hyuk; Furnari, Frank; Cavenee, Webster; Elledge, Stephen; Chen, Clark C.
2014-01-01
Glioblastoma remains one of the deadliest of human cancers, with most patients succumbing to the disease within two years of diagnosis. The available data suggest that simultaneous inactivation of critical nodes within the glioblastoma molecular circuitry will be required for meaningful clinical efficacy. We conducted parallel genome-wide shRNA screens to identify such nodes and uncovered a number of G-Protein Coupled Receptor (GPCR) neurotransmitter pathways, including the Dopamine Receptor D2 (DRD2) signaling pathway. Supporting the importance of DRD2 in glioblastoma, DRD2 mRNA and protein expression were elevated in clinical glioblastoma specimens relative to matched non-neoplastic cerebrum. Treatment with independent si-/shRNAs against DRD2 or with DRD2 antagonists suppressed the growth of patient-derived glioblastoma lines both in vitro and in vivo. Importantly, glioblastoma lines derived from independent genetically engineered mouse models (GEMMs) were more sensitive to haloperidol, an FDA approved DRD2 antagonist, than the premalignant astrocyte lines by approximately an order of magnitude. The pro-proliferative effect of DRD2 was, in part, mediated through a GNAI2/Rap1/Ras/ERK signaling axis. Combined inhibition of DRD2 and Epidermal Growth Factor Receptor (EGFR) led to synergistic tumoricidal activity as well as ERK suppression in independent in vivo and in vitro glioblastoma models. Our results suggest combined EGFR and DRD2 inhibition as a promising strategy for glioblastoma treatment. PMID:24658464
Li, Jie; Zhu, Shan; Kozono, David; Ng, Kimberly; Futalan, Diahnn; Shen, Ying; Akers, Johnny C; Steed, Tyler; Kushwaha, Deepa; Schlabach, Michael; Carter, Bob S; Kwon, Chang-Hyuk; Furnari, Frank; Cavenee, Webster; Elledge, Stephen; Chen, Clark C
2014-02-28
Glioblastoma remains one of the deadliest of human cancers, with most patients succumbing to the disease within two years of diagnosis. The available data suggest that simultaneous inactivation of critical nodes within the glioblastoma molecular circuitry will be required for meaningful clinical efficacy. We conducted parallel genome-wide shRNA screens to identify such nodes and uncovered a number of G-Protein Coupled Receptor (GPCR) neurotransmitter pathways, including the Dopamine Receptor D2 (DRD2) signaling pathway. Supporting the importance of DRD2 in glioblastoma, DRD2 mRNA and protein expression were elevated in clinical glioblastoma specimens relative to matched non-neoplastic cerebrum. Treatment with independent si-/shRNAs against DRD2 or with DRD2 antagonists suppressed the growth of patient-derived glioblastoma lines both in vitro and in vivo. Importantly, glioblastoma lines derived from independent genetically engineered mouse models (GEMMs) were more sensitive to haloperidol, an FDA approved DRD2 antagonist, than the premalignant astrocyte lines by approximately an order of magnitude. The pro-proliferative effect of DRD2 was, in part, mediated through a GNAI2/Rap1/Ras/ERK signaling axis. Combined inhibition of DRD2 and Epidermal Growth Factor Receptor (EGFR) led to synergistic tumoricidal activity as well as ERK suppression in independent in vivo and in vitro glioblastoma models. Our results suggest combined EGFR and DRD2 inhibition as a promising strategy for glioblastoma treatment.
Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.
Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa
2018-03-21
Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.
Chromatin isolation by RNA purification (ChIRP).
Chu, Ci; Quinn, Jeffrey; Chang, Howard Y
2012-03-25
Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression (1,2,3,4,5,6,7). The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion (8,9). While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation (10,11). However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide( 3,12,13), but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex (14); HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex (13). Prior studies mapping RNA occupancy at chromatin have revealed substantial insights (15,16), but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution (17). This method, Chromatin Isolation by
Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K
1978-01-01
A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both
Structural imprints in vivo decode RNA regulatory mechanisms
Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.
2015-01-01
Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993
2013-01-01
Background Cellular senescence can be induced by a variety of extrinsic stimuli, and sustained exposure to sunlight is a key factor in photoaging of the skin. Accordingly, irradiation of skin fibroblasts by UVB light triggers cellular senescence, which is thought to contribute to extrinsic skin aging, although molecular mechanisms are incompletely understood. Here, we addressed molecular mechanisms underlying UVB induced senescence of human diploid fibroblasts. Results We observed a parallel activation of the p53/p21WAF1 and p16INK4a/pRb pathways. Using genome-wide transcriptome analysis, we identified a transcriptional signature of UVB-induced senescence that was conserved in three independent strains of human diploid fibroblasts (HDF) from skin. In parallel, a comprehensive screen for microRNAs regulated during UVB-induced senescence was performed which identified five microRNAs that are significantly regulated during the process. Bioinformatic analysis of miRNA-mRNA networks was performed to identify new functional mRNA targets with high confidence for miR-15a, miR-20a, miR-20b, miR-93, and miR-101. Already known targets of these miRNAs were identified in each case, validating the approach. Several new targets were identified for all of these miRNAs, with the potential to provide new insight in the process of UVB-induced senescence at a genome-wide level. Subsequent analysis was focused on miR-101 and its putative target gene Ezh2. We confirmed that Ezh2 is regulated by miR-101 in human fibroblasts, and found that both overexpression of miR-101 and downregulation of Ezh2 independently induce senescence in the absence of UVB irradiation. However, the downregulation of miR-101 was not sufficient to block the phenotype of UVB-induced senescence, suggesting that other UVB-induced processes induce the senescence response in a pathway redundant with upregulation of miR-101. Conclusion We performed a comprehensive screen for UVB-regulated microRNAs in human diploid
The rough endoplasmatic reticulum is a central nucleation site of siRNA-mediated RNA silencing
Stalder, Lukas; Heusermann, Wolf; Sokol, Lena; Trojer, Dominic; Wirz, Joel; Hean, Justin; Fritzsche, Anja; Aeschimann, Florian; Pfanzagl, Vera; Basselet, Pascal; Weiler, Jan; Hintersteiner, Martin; Morrissey, David V; Meisner-Kober, Nicole C
2013-01-01
Despite progress in mechanistic understanding of the RNA interference (RNAi) pathways, the subcellular sites of RNA silencing remain under debate. Here we show that loading of lipid-transfected siRNAs and endogenous microRNAs (miRNA) into RISC (RNA-induced silencing complexes), encounter of the target mRNA, and Ago2-mediated mRNA slicing in mammalian cells are nucleated at the rough endoplasmic reticulum (rER). Although the major RNAi pathway proteins are found in most subcellular compartments, the miRNA- and siRNA-loaded Ago2 populations co-sediment almost exclusively with the rER membranes, together with the RISC loading complex (RLC) factors Dicer, TAR RNA binding protein (TRBP) and protein activator of the interferon-induced protein kinase (PACT). Fractionation and membrane co-immune precipitations further confirm that siRNA-loaded Ago2 physically associates with the cytosolic side of the rER membrane. Additionally, RLC-associated double-stranded siRNA, diagnostic of RISC loading, and RISC-mediated mRNA cleavage products exclusively co-sediment with rER. Finally, we identify TRBP and PACT as key factors anchoring RISC to ER membranes in an RNA-independent manner. Together, our findings demonstrate that the outer rER membrane is a central nucleation site of siRNA-mediated RNA silencing. PMID:23511973
Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin
2006-04-01
Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.
RNA-Seq-Based Transcript Structure Analysis with TrBorderExt.
Wang, Yejun; Sun, Ming-An; White, Aaron P
2018-01-01
RNA-Seq has become a routine strategy for genome-wide gene expression comparisons in bacteria. Despite lower resolution in transcript border parsing compared with dRNA-Seq, TSS-EMOTE, Cappable-seq, Term-seq, and others, directional RNA-Seq still illustrates its advantages: low cost, quantification and transcript border analysis with a medium resolution (±10-20 nt). To facilitate mining of directional RNA-Seq datasets especially with respect to transcript structure analysis, we developed a tool, TrBorderExt, which can parse transcript start sites and termination sites accurately in bacteria. A detailed protocol is described in this chapter for how to use the software package step by step to identify bacterial transcript borders from raw RNA-Seq data. The package was developed with Perl and R programming languages, and is accessible freely through the website: http://www.szu-bioinf.org/TrBorderExt .
Fabrizio, Paola; Hoon, Shawn; Shamalnasab, Mehrnaz; Galbani, Abdulaye; Wei, Min; Giaever, Guri; Nislow, Corey; Longo, Valter D
2010-07-15
The study of the chronological life span of Saccharomyces cerevisiae, which measures the survival of populations of non-dividing yeast, has resulted in the identification of homologous genes and pathways that promote aging in organisms ranging from yeast to mammals. Using a competitive genome-wide approach, we performed a screen of a complete set of approximately 4,800 viable deletion mutants to identify genes that either increase or decrease chronological life span. Half of the putative short-/long-lived mutants retested from the primary screen were confirmed, demonstrating the utility of our approach. Deletion of genes involved in vacuolar protein sorting, autophagy, and mitochondrial function shortened life span, confirming that respiration and degradation processes are essential for long-term survival. Among the genes whose deletion significantly extended life span are ACB1, CKA2, and TRM9, implicated in fatty acid transport and biosynthesis, cell signaling, and tRNA methylation, respectively. Deletion of these genes conferred heat-shock resistance, supporting the link between life span extension and cellular protection observed in several model organisms. The high degree of conservation of these novel yeast longevity determinants in other species raises the possibility that their role in senescence might be conserved.
Pre-microRNA and Mature microRNA in Human Mitochondria
Barrey, Eric; Saint-Auret, Gaelle; Bonnamy, Blandine; Damas, Dominique; Boyer, Orane; Gidrol, Xavier
2011-01-01
Background Because of the central functions of the mitochondria in providing metabolic energy and initiating apoptosis on one hand and the role that microRNA (miRNA) play in gene expression, we hypothesized that some miRNA could be present in the mitochondria for post-transcriptomic regulation by RNA interference. We intend to identify miRNA localized in the mitochondria isolated from human skeletal primary muscular cells. Methodology/Principal Findings To investigate the potential origin of mitochondrial miRNA, we in-silico searched for microRNA candidates in the mtDNA. Twenty five human pre-miRNA and 33 miRNA aligments (E-value<0.1) were found in the reference mitochondrial sequence and some of the best candidates were chosen for a co-localization test. In situ hybridization of pre-mir-302a, pre-let-7b and mir-365, using specific labelled locked nucleic acids and confocal microscopy, demonstrated that these miRNA were localized in mitochondria of human myoblasts. Total RNA was extracted from enriched mitochondria isolated by an immunomagnetic method from a culture of human myotubes. The detection of 742 human miRNA (miRBase) were monitored by RT-qPCR at three increasing mtRNA inputs. Forty six miRNA were significantly expressed (2nd derivative method Cp>35) for the smallest RNA input concentration and 204 miRNA for the maximum RNA input concentration. In silico analysis predicted 80 putative miRNA target sites in the mitochondrial genome (E-value<0.05). Conclusions/Significance The present study experimentally demonstrated for the first time the presence of pre-miRNA and miRNA in the human mitochondria isolated from skeletal muscular cells. A set of miRNA were significantly detected in mitochondria fraction. The origin of these pre-miRNA and miRNA should be further investigate to determine if they are imported from the cytosol and/or if they are partially processed in the mitochondria. PMID:21637849
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Dissection of K+ currents in Caenorhabditis elegans muscle cells by genetics and RNA interference
Santi, C. M.; Yuan, A.; Fawcett, G.; Wang, Z.-W.; Butler, A.; Nonet, M. L.; Wei, A.; Rojas, P.; Salkoff, L.
2003-01-01
GFP-promoter experiments have previously shown that at least nine genes encoding potassium channel subunits are expressed in Caenorhabditis elegans muscle. By using genetic, RNA interference, and physiological techniques we revealed the molecular identity of the major components of the outward K+ currents in body wall muscle cells in culture. We found that under physiological conditions, outward current is dominated by the products of only two genes, Shaker (Kv1) and Shal (Kv4), both expressing voltage-dependent potassium channels. Other channels may be held in reserve to respond to particular circumstances. Because GFP-promoter experiments indicated that slo-2 expression is prominent, we created a deletion mutant to identify the SLO-2 current in vivo. In both whole-cell and single-channel modes, in vivo SLO-2 channels were active only when intracellular Ca2+ and Cl- were raised above normal physiological conditions, as occurs during hypoxia. Under such conditions, SLO-2 is the largest outward current, contributing up to 87% of the total current. Other channels are present in muscle, but our results suggest that they are unlikely to contribute a large outward component under physiological conditions. However, they, too, may contribute currents conditional on other factors. Hence, the picture that emerges is of a complex membrane with a small number of household conductances functioning under normal circumstances, but with additional conductances that are activated during unusual circumstances. PMID:14612577
The role of Cas8 in type I CRISPR interference.
Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L
2015-05-05
CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.
Allogeneic T cell responses are regulated by a specific miRNA-mRNA network
Sun, Yaping; Tawara, Isao; Zhao, Meng; Qin, Zhaohui S.; Toubai, Tomomi; Mathewson, Nathan; Tamaki, Hiroya; Nieves, Evelyn; Chinnaiyan, Arul M.; Reddy, Pavan
2013-01-01
Donor T cells that respond to host alloantigens following allogeneic bone marrow transplantation (BMT) induce graft-versus-host (GVH) responses, but their molecular landscape is not well understood. MicroRNAs (miRNAs) regulate gene (mRNA) expression and fine-tune the molecular responses of T cells. We stimulated naive T cells with either allogeneic or nonspecific stimuli and used argonaute cross-linked immunoprecipitation (CLIP) with subsequent ChIP microarray analyses to profile miR responses and their direct mRNA targets. We identified a unique expression pattern of miRs and mRNAs following the allostimulation of T cells and a high correlation between the expression of the identified miRs and a reduction of their mRNA targets. miRs and mRNAs that were predicted to be differentially regulated in allogeneic T cells compared with nonspecifically stimulated T cells were validated in vitro. These analyses identified wings apart-like homolog (Wapal) and synaptojanin 1 (Synj1) as potential regulators of allogeneic T cell responses. The expression of these molecular targets in vivo was confirmed in MHC-mismatched experimental BMT. Targeted silencing of either Wapal or Synj1 prevented the development of GVH response, confirming a role for these regulators in allogeneic T cell responses. Thus, this genome-wide analysis of miRNA-mRNA interactions identifies previously unrecognized molecular regulators of T cell responses. PMID:24216511
Lorenzo-Morales, Jacob; Kliescikova, Jarmila; Martinez-Carretero, Enrique; De Pablos, Luis Miguel; Profotova, Bronislava; Nohynkova, Eva; Osuna, Antonio; Valladares, Basilio
2008-03-01
Acanthamoeba infections are difficult to treat due to often late diagnosis and the lack of effective and specific therapeutic agents. The most important reason for unsuccessful therapy seems to be the existence of a double-wall cyst stage that is highly resistant to the available treatments, causing reinfections. The major components of the Acanthamoeba cyst wall are acid-resistant proteins and cellulose. The latter has been reported to be the major component of the inner cyst wall. It has been demonstrated previously that glycogen is the main source of free glucose for the synthesis of cellulose in Acanthamoeba, partly as glycogen levels fall during the encystment process. In other lower eukaryotes (e.g., Dictyostelium discoideum), glycogen phosphorylase has been reported to be the main tool used for glycogen breakdown in order to maintain the free glucose levels during the encystment process. Therefore, it was hypothesized that the regulation of the key processes involved in the Acanthamoeba encystment may be similar to the previously reported regulation mechanisms in other lower eukaryotes. The catalytic domain of the glycogen phosphorylase was silenced using RNA interference methods, and the effect of this phenomenon was assessed by light and electron microscopy analyses, calcofluor staining, expression zymogram assays, and Northern and Western blot analyses of both small interfering RNA-treated and control cells. The present report establishes the role of glycogen phosphorylase during the encystment process of Acanthamoeba. Moreover, the obtained results demonstrate that the enzyme is required for cyst wall assembly, mainly for the formation of the cell wall inner layer.
RNA Structural Analysis by Evolving SHAPE Chemistry
Spitale, Robert C.; Flynn, Ryan A.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.
2017-01-01
RNA is central to the flow of biological information. From transcription to splicing, RNA localization, translation, and decay, RNA is intimately involved in regulating every step of the gene expression program, and is thus essential for health and understanding disease. RNA has the unique ability to base-pair with itself and other nucleic acids to form complex structures. Hence the information content in RNA is not simply its linear sequence of bases, but is also encoded in complex folding of RNA molecules. A general chemical functionality that all RNAs have is a 2’-hydroxyl group in the ribose ring, and the reactivity of the 2'-hydroxyl in RNA is gated by local nucleotide flexibility. In other words, the 2'-hydroxyl is reactive at single-stranded and conformationally flexible positions but is unreactive at nucleotides constrained by base pairing. Recent efforts have been focused on developing reagents that modify RNA as a function of RNA 2’ hydroxyl group flexibility. Such RNA structure probing techniques can be read out by primer extension in experiments termed RNA SHAPE (Selective 2’ Hydroxyl Acylation and Primer Extension). Herein we describe the efforts devoted to the design and utilization of SHAPE probes for characterizing RNA structure. We also describe current technological advances that are being used to utilize SHAPE chemistry with deep sequencing to probe many RNAs in parallel. The merger of chemistry with genomics is sure to open the door to genome-wide exploration of RNA structure and function. PMID:25132067
Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter
2014-01-13
Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.
2014-01-01
Background Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Results Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. Conclusion The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification. PMID:24418292
The small RNA complement of adult Schistosoma haematobium.
Stroehlein, Andreas J; Young, Neil D; Korhonen, Pasi K; Hall, Ross S; Jex, Aaron R; Webster, Bonnie L; Rollinson, David; Brindley, Paul J; Gasser, Robin B
2018-05-01
Blood flukes of the genus Schistosoma cause schistosomiasis-a neglected tropical disease (NTD) that affects more than 200 million people worldwide. Studies of schistosome genomes have improved our understanding of the molecular biology of flatworms, but most of them have focused largely on protein-coding genes. Small non-coding RNAs (sncRNAs) have been explored in selected schistosome species and are suggested to play essential roles in the post-transcriptional regulation of genes, and in modulating flatworm-host interactions. However, genome-wide small RNA data are currently lacking for key schistosomes including Schistosoma haematobium-the causative agent of urogenital schistosomiasis of humans. MicroRNAs (miRNAs) and other sncRNAs of male and female adults of S. haematobium and small RNA transcription levels were explored by deep sequencing, genome mapping and detailed bioinformatic analyses. In total, 89 transcribed miRNAs were identified in S. haematobium-a similar complement to those reported for the congeners S. mansoni and S. japonicum. Of these miRNAs, 34 were novel, with no homologs in other schistosomes. Most miRNAs (n = 64) exhibited sex-biased transcription, suggestive of roles in sexual differentiation, pairing of adult worms and reproductive processes. Of the sncRNAs that were not miRNAs, some related to the spliceosome (n = 21), biogenesis of other RNAs (n = 3) or ribozyme functions (n = 16), whereas most others (n = 3798) were novel ('orphans') with unknown functions. This study provides the first genome-wide sncRNA resource for S. haematobium, extending earlier studies of schistosomes. The present work should facilitate the future curation and experimental validation of sncRNA functions in schistosomes to enhance our understanding of post-transcriptional gene regulation and of the roles that sncRNAs play in schistosome reproduction, development and parasite-host cross-talk.