Sample records for genomic bac library

  1. CONSTRUCTION OF A WATERMELON BAC LIBRARY AND IDENTIFICATION OF SSRS ANCHORED TO MELON OR ARABIDOPSIS GENOMES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A bacterial artificial chromosome (BAC) library was constructed for watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai var. lanatus] with an average insert-size of 106 kb, providing 21 haploid genome equivalents. The library was used to identify BAC clones that are anchored to probes evenly dis...

  2. CONSTRUCTION AND CHARACTERIZATION OF TWO BAC LIBRARIES FROM BRACHYPODIUM DISTACHYPON, A NEW MODEL FOR GRASS GENOMICS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Brachypodium is well suited to be a model system for temperate grasses because of its compact genome and a range of biological features. In an effort to develop resources for genome research in this emerging model species, we constructed two bacterial artificial chromosome (BAC) libraries from the d...

  3. Construction of a BAC library and generation of BAC end sequence-tagged connectors for genome sequencing of the African malaria mosquito Anopheles gambiae

    Microsoft Academic Search

    Y. S. Hong; J. R. Hogan; X. Wang; A. Sarkar; C. Sim; B. J. Loftus; C. Ren; E. R. Huff; J. L. Carlile; K. Black; H.-B. Zhang; M. J. Gardner; F. H. Collins

    2003-01-01

    A Bacterial Artificial Chromosome (BAC) genomic DNA library of Anopheles gambiae, the major human malaria vector in sub-Saharan Africa, was constructed and characterized. This library (ND-TAM) is composed of 30,720 BAC clones in eighty 384-well plates. The estimated average insert size of the library is 133 kb, with an overall genome coverage of approximately 14-fold. The ends of approximately two-thirds

  4. Selection of chromosome 22-specific clones from human genomic BAC library using a chromosome-specific cosmid library pool

    SciTech Connect

    Kim, U.J.; Shizuya, H.; Birren, B. [Lawrence Livermore National Lab., CA (United States)] [and others] [Lawrence Livermore National Lab., CA (United States); and others

    1994-07-15

    A new approach to rapidly identify chromosome-specific subsets of clones from a total human genomic library is described. The authors report here the results of screening a human bacterial artificial chromosome (BAC) library using the total pool of clones from a chromosome 22-specific cosmid library as a composite probe. The human BAC library was gridded on filters at high density and hybridized with DNA from the pooled chromosome 22-specific Lawrist library under suppressive conditions. In a single hybridization, they picked 280 candidates from the BAC library representing over 30,000 clones (or 1.2 x coverage of human genome). This subset contained more than 60% of the chromosome 22-specific BAC clones that were previously found to be present in the original BAC library. In principle, this approach can be applied to select a subset of clones from other global libraries with relatively large inserts using a pool from a regional library as a composite probe. It is important to note that the target and probe libraries must be based on vectors that share no homology with each other. 8 refs., 2 figs., 2 tabs.

  5. Toward an Integrated BAC Library Resource for Genome Sequencing and Analysis

    SciTech Connect

    Simon, M. I.; Kim, U.-J.

    2002-02-26

    We developed a great deal of expertise in building large BAC libraries from a variety of DNA sources including humans, mice, corn, microorganisms, worms, and Arabidopsis. We greatly improved the technology for screening these libraries rapidly and for selecting appropriate BACs and mapping BACs to develop large overlapping contigs. We became involved in supplying BACs and BAC contigs to a variety of sequencing and mapping projects and we began to collaborate with Drs. Adams and Venter at TIGR and with Dr. Leroy Hood and his group at University of Washington to provide BACs for end sequencing and for mapping and sequencing of large fragments of chromosome 16. Together with Dr. Ian Dunham and his co-workers at the Sanger Center we completed the mapping and they completed the sequencing of the first human chromosome, chromosome 22. This was published in Nature in 1999 and our BAC contigs made a major contribution to this sequencing effort. Drs. Shizuya and Ding invented an automated highly accurate BAC mapping technique. We also developed long-term collaborations with Dr. Uli Weier at UCSF in the design of BAC probes for characterization of human tumors and specific chromosome deletions and breakpoints. Finally the contribution of our work to the human genome project has been recognized in the publication both by the international consortium and the NIH of a draft sequence of the human genome in Nature last year. Dr. Shizuya was acknowledged in the authorship of that landmark paper. Dr. Simon was also an author on the Venter/Adams Celera project sequencing the human genome that was published in Science last year.

  6. Tuatara (Sphenodon) Genomics: BAC Library Construction, Sequence Survey,

    E-print Network

    Edwards, Scott

    distinctive surviving reptilian lineage (Rhyncocephalia) in the world. To provide a genomic resource tuatara genomics. The tuataras of New Zealand are the last representatives of a reptilian lineage known

  7. The Drosophila BAC resource The 19 Genomes of Drosophila: a BA C Library Resource for Genus-wide and1

    E-print Network

    Markow, Therese

    -wide and1 Genome Scale Comparative Evolutionary Research2 Xiang Song§1 , Jose Luis Goicoechea§1 , Jetty S biological and41 ecological contexts, and to functionally annotate the D. melanogaster genome, a model42The Drosophila BAC resource 1 The 19 Genomes of Drosophila: a BA C Library Resource for Genus

  8. Characterization of a BAC Library from Channel Catfish Ictalurus punctatus: Indications of High Rates of Evolution Among Teleost Genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The CHORI-212 bacterial artificial chromosome (BAC) library was constructed by cloning EcoRI/EcoRI partially digested DNA into the pTARBAC2.1 vector. The library has an average insert size of 161 kb, and provides 10.6-fold coverage of the channel catfish haploid genome. Screening of 32 genes using o...

  9. New genomic resources for switchgrass: a BAC library and comparative analysis of homoeologous genomic regions harboring bioenergy traits

    PubMed Central

    2011-01-01

    Background Switchgrass, a C4 species and a warm-season grass native to the prairies of North America, has been targeted for development into an herbaceous biomass fuel crop. Genetic improvement of switchgrass feedstock traits through marker-assisted breeding and biotechnology approaches calls for genomic tools development. Establishment of integrated physical and genetic maps for switchgrass will accelerate mapping of value added traits useful to breeding programs and to isolate important target genes using map based cloning. The reported polyploidy series in switchgrass ranges from diploid (2X = 18) to duodecaploid (12X = 108). Like in other large, repeat-rich plant genomes, this genomic complexity will hinder whole genome sequencing efforts. An extensive physical map providing enough information to resolve the homoeologous genomes would provide the necessary framework for accurate assembly of the switchgrass genome. Results A switchgrass BAC library constructed by partial digestion of nuclear DNA with EcoRI contains 147,456 clones covering the effective genome approximately 10 times based on a genome size of 3.2 Gigabases (~1.6 Gb effective). Restriction digestion and PFGE analysis of 234 randomly chosen BACs indicated that 95% of the clones contained inserts, ranging from 60 to 180 kb with an average of 120 kb. Comparative sequence analysis of two homoeologous genomic regions harboring orthologs of the rice OsBRI1 locus, a low-copy gene encoding a putative protein kinase and associated with biomass, revealed that orthologous clones from homoeologous chromosomes can be unambiguously distinguished from each other and correctly assembled to respective fingerprint contigs. Thus, the data obtained not only provide genomic resources for further analysis of switchgrass genome, but also improve efforts for an accurate genome sequencing strategy. Conclusions The construction of the first switchgrass BAC library and comparative analysis of homoeologous harboring OsBRI1 orthologs present a glimpse into the switchgrass genome structure and complexity. Data obtained demonstrate the feasibility of using HICF fingerprinting to resolve the homoeologous chromosomes of the two distinct genomes in switchgrass, providing a robust and accurate BAC-based physical platform for this species. The genomic resources and sequence data generated will lay the foundation for deciphering the switchgrass genome and lead the way for an accurate genome sequencing strategy. PMID:21767393

  10. Construction and characterization of BAC libraries for three fish species; rainbow trout, carp and tilapia

    Microsoft Academic Search

    T. Katagiri; S. Asakawa; S. Minagawa; N. Shimizu; I. Hirono; T. Aoki

    2001-01-01

    Summary Bacterial artificial chromosome (BAC) libraries are important tools for genomic research. We have constructed seven genomic BAC libraries from three fish species, rainbow trout (Oncorhynchus mykiss), carp (Cyprinus carpio) and tilapia (Oreochromis niloticus). The two rainbow trout BAC libraries have average insert sizes of 58 and 110 kb. The average size of inserts in the carp BAC library is

  11. Development of BAC libraries and integrated physical mapping of human chromosome 22 using BACs. Annual report, July 1994--June 1995

    SciTech Connect

    Kim, U.J.; Shizuya, Hiroaki; Simon, M.I.

    1995-12-31

    BACs and fosmids are stable, nonchimeric, and highly representative cloning systems. BACs maintain large-fragment genomic inserts (100 to 300 kb) that are easily prepared for most types of experiments, including DNA sequencing. The authors have improved the methods for generating BACs and developed extensive BAC libraries. They have constructed human BAC libraries with more than 175,000 clones from male fibroblast and sperm, and a mouse BAC library with more than 200,000 clones. The authors are currently expanding human library with the aim of achieving total 50X coverage human genomic library using sperm samples from anonymous donors.

  12. A piggyBac transposon-based genome-wide library of insertionally mutated Blm-deficient murine ES cells

    PubMed Central

    Wang, Wei; Bradley, Allan; Huang, Yue

    2009-01-01

    Cultured mouse or human embryonic stem (ES) cells provide access to all of the genes required to elaborate the fundamental components and physiological systems of a mammalian cell. Chemical or insertional mutagenesis of Blm-deficient mouse ES cells can be used to generate genome-wide libraries of homozygous mutant ES cells, which are the substrates for conducting phenotype-driven loss-of-function genetic screens. However, the existing insertional mutation libraries are limited by incomplete genomic coverage. In this study, we have explored the use of piggyBac (PB) transposon-mediated mutagenesis to extend the genomic coverage of mutation libraries in Blm-deficient ES cells. A library composed of 14,000 individual gene-trap clones was generated and a recessive genetic screen conducted to identify cells with defects in DNA mismatch repair (MMR) genes. Independent mutations in all known genes of the pathway Msh2, Msh6, Pms2, and Mlh1 were recovered in these screens. The genomic coverage in this library confirms its utility as a new genetic resource for conducting recessive genetic screens in mammalian cells. PMID:19233961

  13. Construction of genome-wide physical BAC contigs using mapped cDNA as probes: Toward an integrated BAC library resource for genome sequencing and analysis. Annual report, July 1995--January 1997

    SciTech Connect

    Mitchell, S.C.; Bocskai, D.; Cao, Y. [and others

    1997-12-31

    The goal of human genome project is to characterize and sequence entire genomes of human and several model organisms, thus providing complete sets of information on the entire structure of transcribed, regulatory and other functional regions for these organisms. In the past years, a number of useful genetic and physical markers on human and mouse genomes have been made available along with the advent of BAC library resources for these organisms. The advances in technology and resource development made it feasible to efficiently construct genome-wide physical BAC contigs for human and other genomes. Currently, over 30,000 mapped STSs and 27,000 mapped Unigenes are available for human genome mapping. ESTs and cDNAs are excellent resources for building contig maps for two reasons. Firstly, they exist in two alternative forms--as both sequence information for PCR primer pairs, and cDoreen genomic libraries efficiently for large number of DNA probes by combining over 100 cDNA probes in each hybridization. Second, the linkage and order of genes are rather conserved among human, mouse and other model organisms. Therefore, gene markers have advantages over random anonymous STSs in building maps for comparative genomic studies.

  14. Construction and characterization of a papaya BAC library as a foundation for molecular dissection of a tree-fruit genome

    Microsoft Academic Search

    R. Ming; P. H. Moore; F. Zee; C. A. Abbey; H. Ma; A. H. Paterson

    2001-01-01

    A bacterial artificial chromosome (BAC) library was constructed from high-molecular-weight DNA isolated from young leaves\\u000a of papaya (Carica papaya L.). This BAC library consists of 39168 clones from two separate ligation reactions. The average insert size of the library\\u000a is 132 kb; 96.5% of the 18700 clones from the first ligation contained inserts that averaged 86 kb in size, 95.7%

  15. New genomic resources for the honey bee (Apis mellifera L.): development of a deep-coverage BAC library and a preliminary STC database

    Microsoft Academic Search

    J. P. Tomkins; M. Luo; G. C. Fang; D. Main; J. L. Goicoechea; M. Atkins; D. A. Frisch; E. Guzmán-Novoa; Y. Yu

    We have constructed a bacterial artificial chromosome (BAC) library for a European honey bee strain using the cloning en- zyme HindIII in order to develop resources for structural genomics re- search. The library contains 36,864 clones (ninety-six 384-well plates). A random sampling of 247 clones indicated an average insert size of 113 kb (range = 27 to 213 kb) and

  16. CHARACTERIZATION AND PHYSICAL MAPPING OF MAIZE BAC LIBRARIES USING HIGH DENSITY BAC FILTER HYBRIDIZATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A HindIII and an EcoRI maize BAC library have been constructed from maize inbred line B73. Use of both libraries to make a physical map should minimize the under representation of certain genomic regions caused by the use of a particular restriction enzyme. High-density filter sets from the two libr...

  17. The Oryza bacterial artificial chromosome library resource: Construction and analysis of 12 deep-coverage large-insert BAC libraries that represent the 10 genome types of the genus Oryza

    PubMed Central

    Ammiraju, Jetty S.S.; Luo, Meizhong; Goicoechea, José L.; Wang, Wenming; Kudrna, Dave; Mueller, Christopher; Talag, Jayson; Kim, HyeRan; Sisneros, Nicholas B.; Blackmon, Barbara; Fang, Eric; Tomkins, Jeffery B.; Brar, Darshan; MacKill, David; McCouch, Susan; Kurata, Nori; Lambert, Georgina; Galbraith, David W.; Arumuganathan, K.; Rao, Kiran; Walling, Jason G.; Gill, Navdeep; Yu, Yeisoo; SanMiguel, Phillip; Soderlund, Carol; Jackson, Scott; Wing, Rod A.

    2006-01-01

    Rice (Oryza sativa L.) is the most important food crop in the world and a model system for plant biology. With the completion of a finished genome sequence we must now functionally characterize the rice genome by a variety of methods, including comparative genomic analysis between cereal species and within the genus Oryza. Oryza contains two cultivated and 22 wild species that represent 10 distinct genome types. The wild species contain an essentially untapped reservoir of agriculturally important genes that must be harnessed if we are to maintain a safe and secure food supply for the 21st century. As a first step to functionally characterize the rice genome from a comparative standpoint, we report the construction and analysis of a comprehensive set of 12 BAC libraries that represent the 10 genome types of Oryza. To estimate the number of clones required to generate 10 genome equivalent BAC libraries we determined the genome sizes of nine of the 12 species using flow cytometry. Each library represents a minimum of 10 genome equivalents, has an average insert size range between 123 and 161 kb, an average organellar content of 0.4%–4.1% and nonrecombinant content between 0% and 5%. Genome coverage was estimated mathematically and empirically by hybridization and extensive contig and BAC end sequence analysis. A preliminary analysis of BAC end sequences of clones from these libraries indicated that LTR retrotransposons are the predominant class of repeat elements in Oryza and a roughly linear relationship of these elements with genome size was observed. PMID:16344555

  18. SEQUENCING THE PIG GENOME USING A BAC BY BAC APPROACH

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have generated a highly contiguous physical map covering >98% of the pig genome in just 176 contigs. The map is localized to the genome through integration with the UIVC RH map as well BAC end sequence alignments to the human genome. Over 265k HindIII restriction digest fingerprints totaling 16.2...

  19. Isolation of BAC clones containing conserved genes from libraries of three distantly related moths: a useful resource for comparative genomics of Lepidoptera.

    PubMed

    Yasukochi, Yuji; Tanaka-Okuyama, Makiko; Kamimura, Manabu; Nakano, Ryo; Naito, Yota; Ishikawa, Yukio; Sahara, Ken

    2011-01-01

    Lepidoptera, butterflies and moths, is the second largest animal order and includes numerous agricultural pests. To facilitate comparative genomics in Lepidoptera, we isolated BAC clones containing conserved and putative single-copy genes from libraries of three pests, Heliothis virescens, Ostrinia nubilalis, and Plutella xylostella, harboring the haploid chromosome number, n = 31, which are not closely related with each other or with the silkworm, Bombyx mori, (n = 28), the sequenced model lepidopteran. A total of 108-184 clones representing 101-182 conserved genes were isolated for each species. For 79 genes, clones were isolated from more than two species, which will be useful as common markers for analysis using fluorescence in situ hybridization (FISH), as well as for comparison of genome sequence among multiple species. The PCR-based clone isolation method presented here is applicable to species which lack a sequenced genome but have a significant collection of cDNA or EST sequences. PMID:21127704

  20. Repetitive Genomic Elements in a European Corn Borer, Ostrinia nubilalis, BAC Library were Indicated by BAC End Sequencing and Development of Sequence Tag Site Markers: Implications for Lepidopteran Genomic Research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The European corn borer, Ostrinia nubilalis, is a serious pest of food, fiber, and biofuel crops in Europe, North America, and Asia, and a model system for insect olfaction and speciation. A bacterial artificial chromosome (BAC) library constructed for O. nubilalis contains 36,864 clones with estim...

  1. BAC Resources for the Rat Genome Project Kazutoyo Osoegawa,1,4

    E-print Network

    Seaman, Michael I.

    BAC Resources for the Rat Genome Project Kazutoyo Osoegawa,1,4 Baoli Zhu,1,4 Chung Li Shu,1 Teresa artificial chromosome (BAC) libraries (RPCI-32 and CHORI-230) have been constructed to support the rat genome project. The first library was constructed using a male Brown Norway (BN/SsNHsd) rat as a DNA source long

  2. Library Resources for Bac End Sequencing. Final Technical Report

    SciTech Connect

    Pieter J. de Jong

    2000-10-01

    Studies directed towards the specific aims outlined for this research award are summarized. The RPCI II Human Bac Library has been expanded by the addition of 6.9-fold genomic coverage. This segment has been generated from a MBOI partial digest of the same anonymous donor DNA used for the rest of the library. A new cloning vector, pTARBAC1, has been constructed and used in the construction of RPCI-II segment 5. This new cloning vector provides a new strategy in identifying targeted genomic regions and will greatly facilitate a large-scale analysis for positional cloning. A new maleCS7BC/6J mouse BAC library has been constructed. RPCI-23 contain 576 plates (approx 210,000 clones) and represents approximately 11-fold coverage of the mouse genome.

  3. Generation of BAC-end sequences for rainbow trout genome analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For non-sequenced genomes, BAC end sequences (BES) provide a valuable sample of repetitive elements and gene content. Here we report the results of BAC end sequencing of just over half of the rainbow trout (Oncorhynchus mykiss) Swanson HindIII library. We sequenced 177,860 BAC ends that generated 17...

  4. BAC Libraries from Wheat Chromosome 7D – Efficient Tool for Positional Cloning of Aphid Resistance Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Positional cloning in bread wheat is a tedious task due to its huge genome size (~17 Gbp) and polyploid character. BAC libraries represent an essential tool for positional cloning. However, wheat BAC libraries comprise more than million clones, which make their screening very laborious. Here we pres...

  5. Characterizing the walnut genome through analyses of BAC end sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Persian walnut (Juglans regia L.) is an economically important tree for its nut crop and timber. To gain insight into the structure and evolution of the walnut genome, we constructed two bacterial artificial chromosome (BAC) libraries, containing a total of 129,024 clones, from in vitro-grown shoots...

  6. AN INTEGRATED BAC PHYSICAL MAP OF THE PIG GENOME AND SELECTION OF THE MINIMUM TILEPATH

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have constructed a physical map of the pig genome by integrating restriction fingerprints and BAC end sequences generated from 4 BAC libraries with radiation hybrid markers, and contig alignments to the human genome. The map provides coverage across the 18 pig autosomes and the X chromosome in 17...

  7. SCREENING OF SUNFLOWER BAC LIBRARY FOR THE IDENTIFICATION OF SPECIFIC BAC CLONES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One BAC library and one BIBAC library from an inbred line HA 89 were constructed by using two restriction enzymes (BamH1, HindIII) and two vectors (pECBAC1, pCLD04541). Using the large-insert libraries, we identified a set of sunflower linkage group-specific BAC or BIBAC clones by overgo hybridizati...

  8. End Sequencing and Finger Printing of Human & Mouse BAC Libraries

    SciTech Connect

    Fraser, C.

    2005-09-27

    This project provided for continued end sequencing of existing and new BAC libraries constructed to support human sequencing as well as to initiate BAC end sequencing from the mouse BAC libraries constructed to support mouse sequencing. The clones, the sequences, and the fingerprints are now an available resource for the community at large. Research and development of new metaodologies for BAC end sequencing have reduced costs and increase throughput.

  9. BAC as tools for genome sequencing

    Microsoft Academic Search

    Hong-Bin Zhang; Chengcang Wu

    2001-01-01

    Genome sequencing represents the state-of-the-art technology for large-scale gene discovery, cloning and decoding. Bacteria-based large-insert clones, including bacterial artificial chromosome (BAC), bacteriophage P1-derived artificial chromosome (PAC) and large-insert conventional plasmid-based clone (PBC), are desirable resources and have offered numerous potentials for accelerated sequencing of large, complex genomes. They are not only capable of cloning large DNA fragments of complex genomes

  10. A set of BAC clones spanning the human genome

    Microsoft Academic Search

    Martin Krzywinski; Ian Bosdet; Duane Smailus; Readman Chiu; Carrie Mathewson; Natasja Wye; Sarah Barber; Mabel Brown-John; Susanna Chan; Steve Chand; Alison Cloutier; Noreen Girn; Darlene Lee; Amara Masson; Michael Mayo; Teika Olson; Pawan Pandoh; Anna-Liisa Prabhu; E. F. P. M. Schoenmakers; Miranda Tsai; Donna Albertson; Wan Lam; Chik-On Choy; Kazutoyo Osoegawa; Shaying Zhao; Pieter J. de Jong; Jacqueline Schein; Steven Jones; Marco A. Marra

    2004-01-01

    Using the human bacterial artificial chromosome (BAC) fingerprint-based physical map, genome sequence assembly and BAC end sequences, we have generated a fingerprint-validated set of 32 855 BAC clones spanning the human genome. The clone set provides coverage for at least 98% of the human fingerprint map, 99% of the current assembled sequence and has an effective resolving power of 79

  11. Advanced resources for plant genomics: a BAC library specific for the short arm of wheat chromosome?1B

    Microsoft Academic Search

    Jaroslav Janda; Jan Šafá?; Marie Kubalakova ´; Jan Bartoš; Pavlína Ková?ová; Pavla Suchankova ´; Stephanie Pateyron; Jarmila ?íhalíková; Pierre Sourdille; Hana Šimková; Patricia Faivre-Rampant; Eva Hribova ´; Michel Bernard; Adam Lukaszewski; Jaroslav Doležel; Boulos Chalhoub

    2006-01-01

    Summary Common wheat (Triticum aestivum L., 2n ¼ 6x ¼ 42) is a polyploid species possessing one of the largest genomes among the cultivated crops (1C is approximately 17 000 Mb). The presence of three homoeologous genomes (A, B and D), and the prevalence of repetitive DNA make sequencing the wheat genome a daunting task. We have developed a novel

  12. BACTERIAL ARTIFICIAL CHROMOSOME (BAC) LIBRARIES CONSTRUCTED FROM THE GENETIC STANDARD OF UPLAND COTTONS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two BAC libraries and one plant transformation-competent BIBAC library were developed from the Gossypium hirsutum acc. TM-1 for the development of an integrative cotton physical and genetic map and other genomic applications. TM-1 is the most desirable choice for construction of the physical map of ...

  13. Physical analysis of the complex rye ( Secale cereale L.) Alt4 aluminium (aluminum) tolerance locus using a whole-genome BAC library of rye cv. Blanco

    Microsoft Academic Search

    B.-J. Shi; J. P. Gustafson; J. Button; J. Miyazaki; M. Pallotta; N. Gustafson; H. Zhou; P. Langridge; N. C. Collins

    2009-01-01

    Rye is a diploid crop species with many outstanding qualities, and is important as a source of new traits for wheat and triticale\\u000a improvement. Rye is highly tolerant of aluminum (Al) toxicity, and possesses a complex structure at the Alt4 Al tolerance locus not found at the corresponding locus in wheat. Here we describe a BAC library of rye cv.

  14. A BAC based physical map and genome survey of the rice false smut fungus Villosiclava virens

    PubMed Central

    2013-01-01

    Background Rice false smut caused by Villosiclava virens is a devastating fungal disease that spreads in major rice-growing regions throughout the world. However, the genomic information for this fungal pathogen is limited and the pathogenic mechanism of this disease is still not clear. To facilitate genetic, molecular and genomic studies of this fungal pathogen, we constructed the first BAC-based physical map and performed the first genome survey for this species. Results High molecular weight genomic DNA was isolated from young mycelia of the Villosiclava virens strain UV-8b and a high-quality, large-insert and deep-coverage Bacterial Artificial Chromosome (BAC) library was constructed with the restriction enzyme HindIII. The BAC library consisted of 5,760 clones, which covers 22.7-fold of the UV-8b genome, with an average insert size of 140 kb and an empty clone rate of lower than 1%. BAC fingerprinting generated successful fingerprints for 2,290 BAC clones. Using the fingerprints, a whole genome-wide BAC physical map was constructed that contained 194 contigs (2,035 clones) spanning 51.2 Mb in physical length. Bidirectional-end sequencing of 4,512 BAC clones generated 6,560 high quality BAC end sequences (BESs), with a total length of 3,030,658 bp, representing 8.54% of the genome sequence. Analysis of the BESs revealed general genome information, including 51.52% GC content, 22.51% repetitive sequences, 376.12/Mb simple sequence repeat (SSR) density and approximately 36.01% coding regions. Sequence comparisons to other available fungal genome sequences through BESs showed high similarities to Metarhizium anisopliae, Trichoderma reesei, Nectria haematococca and Cordyceps militaris, which were generally in agreement with the 18S rRNA gene analysis results. Conclusion This study provides the first BAC-based physical map and genome information for the important rice fungal pathogen Villosiclava virens. The BAC clones, physical map and genome information will serve as fundamental resources to accelerate the genetic, molecular and genomic studies of this pathogen, including positional cloning, comparative genomic analysis and whole genome sequencing. The BAC library and physical map have been opened to researchers as public genomic resources (http://gresource.hzau.edu.cn/resource/resource.html). PMID:24341590

  15. CHARACTERIZATION OF THREE MAIZE BAC LIBRARIES AND ANCHORING OF THE PHYSICAL MAP TO THE GENETIC MAP USING HIGH-DENSITY BAC FILTER HYBRIDIZATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Three maize (Zea mays L.) bacterial artificial chromosome (BAC) libraries, HindIII, EcoRI and MboI, were constructed from inbred line B73 to minimize under-representation of certain genomic regions caused by the use of a single restriction enzyme library. High-density filter sets from all three lib...

  16. Construction of a BAC library and identification of Dmrt1 gene of the rice field eel, Monopterus albus

    SciTech Connect

    Jang Songhun [Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Zhou Fang [Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Xia Laixin [Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Zhao Wei [Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Cheng Hanhua [Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072 (China)]. E-mail: hhcheng@whu.edu.cn; Zhou Rongjia [Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072 (China)]. E-mail: rjzhou@whu.edu.cn

    2006-09-22

    A bacterial artificial chromosome (BAC) library was constructed using nuclear DNA from the rice field eel (Monopterus albus). The BAC library consists of a total of 33,000 clones with an average insert size of 115 kb. Based on the rice field eel haploid genome size of 600 Mb, the BAC library is estimated to contain approximately 6.3 genome equivalents and represents 99.8% of the genome of the rice field eel. This is first BAC library constructed from this species. To estimate the possibility of isolating a specific clone, high-density colony hybridization-based library screening was performed using Dmrt1 cDNA of the rice field eel as a probe. Both library screening and PCR identification results revealed three positive BAC clones which were overlapped, and formed a contig covering the Dmrt1 gene of 195 kb. By sequence comparisons with the Dmrt1 cDNA and sequencing of first four intron-exon junctions, Dmrt1 gene of the rice field eel was predicted to contain four introns and five exons. The sizes of first and second intron are 1.5 and 2.6 kb, respectively, and the sizes of last two introns were predicted to be about 20 kb. The Dmrt1 gene structure was conserved in evolution. These results also indicate that the BAC library is a useful resource for BAC contig construction and molecular isolation of functional genes.

  17. Characterizing the walnut genome through analyses of BAC end sequences.

    PubMed

    Wu, Jiajie; Gu, Yong Q; Hu, Yuqin; You, Frank M; Dandekar, Abhaya M; Leslie, Charles A; Aradhya, Mallikarjuna; Dvorak, Jan; Luo, Ming-Cheng

    2012-01-01

    Persian walnut (Juglans regia L.) is an economically important tree for its nut crop and timber. To gain insight into the structure and evolution of the walnut genome, we constructed two bacterial artificial chromosome (BAC) libraries, containing a total of 129,024 clones, from in vitro-grown shoots of J. regia cv. Chandler using the HindIII and MboI cloning sites. A total of 48,218 high-quality BAC end sequences (BESs) were generated, with an accumulated sequence length of 31.2 Mb, representing approximately 5.1% of the walnut genome. Analysis of repeat DNA content in BESs revealed that approximately 15.42% of the genome consists of known repetitive DNA, while walnut-unique repetitive DNA identified in this study constitutes 13.5% of the genome. Among the walnut-unique repetitive DNA, Julia SINE and JrTRIM elements represent the first identified walnut short interspersed element (SINE) and terminal-repeat retrotransposon in miniature (TRIM) element, respectively; both types of elements are abundant in the genome. As in other species, these SINEs and TRIM elements could be exploited for developing repeat DNA-based molecular markers in walnut. Simple sequence repeats (SSR) from BESs were analyzed and found to be more abundant in BESs than in expressed sequence tags. The density of SSR in the walnut genome analyzed was also slightly higher than that in poplar and papaya. Sequence analysis of BESs indicated that approximately 11.5% of the walnut genome represents a coding sequence. This study is an initial characterization of the walnut genome and provides the largest genomic resource currently available; as such, it will be a valuable tool in studies aimed at genetically improving walnut. PMID:22101470

  18. The European sea bass Dicentrarchus labrax genome puzzle: comparative BAC-mapping and low coverage shotgun sequencing

    PubMed Central

    2010-01-01

    Background Food supply from the ocean is constrained by the shortage of domesticated and selected fish. Development of genomic models of economically important fishes should assist with the removal of this bottleneck. European sea bass Dicentrarchus labrax L. (Moronidae, Perciformes, Teleostei) is one of the most important fishes in European marine aquaculture; growing genomic resources put it on its way to serve as an economic model. Results End sequencing of a sea bass genomic BAC-library enabled the comparative mapping of the sea bass genome using the three-spined stickleback Gasterosteus aculeatus genome as a reference. BAC-end sequences (102,690) were aligned to the stickleback genome. The number of mappable BACs was improved using a two-fold coverage WGS dataset of sea bass resulting in a comparative BAC-map covering 87% of stickleback chromosomes with 588 BAC-contigs. The minimum size of 83 contigs covering 50% of the reference was 1.2 Mbp; the largest BAC-contig comprised 8.86 Mbp. More than 22,000 BAC-clones aligned with both ends to the reference genome. Intra-chromosomal rearrangements between sea bass and stickleback were identified. Size distributions of mapped BACs were used to calculate that the genome of sea bass may be only 1.3 fold larger than the 460 Mbp stickleback genome. Conclusions The BAC map is used for sequencing single BACs or BAC-pools covering defined genomic entities by second generation sequencing technologies. Together with the WGS dataset it initiates a sea bass genome sequencing project. This will allow the quantification of polymorphisms through resequencing, which is important for selecting highly performing domesticated fish. PMID:20105308

  19. Sequencing the Pig Genome Using a Mapped BAC by BAC Approach

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have generated a highly contiguous physical map covering >98% of the pig genome in just 176 contigs. The map is localised to the genome through integration with the UIUC RH map as well BAC end sequence alignments to the human genome. Over 265k HindIII restriction digest fingerprints totalling 1...

  20. A BAC-based physical map of the Drosophila buzzatii genome

    SciTech Connect

    Gonzalez, Josefa; Nefedov, Michael; Bosdet, Ian; Casals, Ferran; Calvete, Oriol; Delprat, Alejandra; Shin, Heesun; Chiu, Readman; Mathewson, Carrie; Wye, Natasja; Hoskins, Roger A.; Schein, JacquelineE.; de Jong, Pieter; Ruiz, Alfredo

    2005-03-18

    Large-insert genomic libraries facilitate cloning of large genomic regions, allow the construction of clone-based physical maps and provide useful resources for sequencing entire genomes. Drosophilabuzzatii is a representative species of the repleta group in the Drosophila subgenus, which is being widely used as a model in studies of genome evolution, ecological adaptation and speciation. We constructed a Bacterial Artificial Chromosome (BAC) genomic library of D. buzzatii using the shuttle vector pTARBAC2.1. The library comprises 18,353 clones with an average insert size of 152 kb and a {approx}18X expected representation of the D. buzzatii euchromatic genome. We screened the entire library with six euchromatic gene probes and estimated the actual genome representation to be {approx}23X. In addition, we fingerprinted by restriction digestion and agarose gel electrophoresis a sample of 9,555 clones, and assembled them using Finger Printed Contigs (FPC) software and manual editing into 345 contigs (mean of 26 clones per contig) and 670singletons. Finally, we anchored 181 large contigs (containing 7,788clones) to the D. buzzatii salivary gland polytene chromosomes by in situ hybridization of 427 representative clones. The BAC library and a database with all the information regarding the high coverage BAC-based physical map described in this paper are available to the research community.

  1. Versatile P(acman) BAC Libraries for Transgenesis Studies in Drosophila melanogaster

    SciTech Connect

    Venken, Koen J.T.; Carlson, Joseph W.; Schulze, Karen L.; Pan, Hongling; He, Yuchun; Spokony, Rebecca; Wan, Kenneth H.; Koriabine, Maxim; de Jong, Pieter J.; White, Kevin P.; Bellen, Hugo J.; Hoskins, Roger A.

    2009-04-21

    We constructed Drosophila melanogaster BAC libraries with 21-kb and 83-kb inserts in the P(acman) system. Clones representing 12-fold coverage and encompassing more than 95percent of annotated genes were mapped onto the reference genome. These clones can be integrated into predetermined attP sites in the genome using Phi C31 integrase to rescue mutations. They can be modified through recombineering, for example to incorporate protein tags and assess expression patterns.

  2. Use of a Mycobacterium tuberculosis H37Rv Bacterial Artificial Chromosome Library for Genome Mapping, Sequencing, and Comparative Genomics

    Microsoft Academic Search

    ROLAND BROSCH; STEPHEN V. GORDON; ALAIN BILLAULT; THIERRY GARNIER; KARIN EIGLMEIER; CATHERINE SORAVITO; BART G. BARRELL; STEWART T. COLE

    1998-01-01

    The bacterial artificial chromosome (BAC) cloning system is capable of stably propagating large, complex DNA inserts in Escherichia coli. As part of the Mycobacterium tuberculosis H37Rv genome sequencing project, a BAC library was constructed in the pBeloBAC11 vector and used for genome mapping, confirmation of sequence assembly, and sequencing. The library contains about 5,000 BAC clones, with inserts ranging in

  3. A First Generation BAC Physical Map of the Rainbow Trout Genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The physical map was constructed using the high-information content fingerprinting (HICF) method of Luo et al. (2003; Genomics, 82, 378-389). All the clones from the Swanson YY doubled haploid male BAC library (10X coverage; 184,704 clones) were fingerprinted and edited using FPMiner software. App...

  4. Construction and characterization of the BAC library for common carp Cyprinus carpio L. and establishment of microsynteny with zebrafish Danio rerio.

    PubMed

    Li, Yan; Xu, Peng; Zhao, Zixia; Wang, Jian; Zhang, Yan; Sun, Xiao-Wen

    2011-08-01

    A bacterial artificial chromosome (BAC) library of common carp Cyprinus carpio L. was constructed as a part of ongoing common carp genome project, which is aiming assembly of common carp genome. The library, containing a total of 92,160 BAC clones with an average insert size of 141 kb, was constructed into the restriction site of Hind III on BAC vector CopyControl pCC1BAC, covering 7.7 X haploid genome equivalents. Three dimension pools and superpools of the BAC library were established and 23 positive clones of 14 targets were identified from one-fifth of the BAC library. Pilot project of BAC end sequencing was conducted on 2,688 BAC ends from 1,344 clones and harvested 2,522 high-quality Q20 sequences with average length of 677 bp. The sequencing success rate was 93.8% and pair-end success rate was 92.3%. A total of 212 microsyntenies had been established between common carp and zebrafish genomes as a trial for genome-wide comparative genomics in these two closely related species. PMID:21088980

  5. Genomic tools development for Aquilegia: construction of a BAC-based physical map

    PubMed Central

    2010-01-01

    Background The genus Aquilegia, consisting of approximately 70 taxa, is a member of the basal eudicot lineage, Ranuculales, which is evolutionarily intermediate between monocots and core eudicots, and represents a relatively unstudied clade in the angiosperm phylogenetic tree that bridges the gap between these two major plant groups. Aquilegia species are closely related and their distribution covers highly diverse habitats. These provide rich resources to better understand the genetic basis of adaptation to different pollinators and habitats that in turn leads to rapid speciation. To gain insights into the genome structure and facilitate gene identification, comparative genomics and whole-genome shotgun sequencing assembly, BAC-based genomics resources are of crucial importance. Results BAC-based genomic resources, including two BAC libraries, a physical map with anchored markers and BAC end sequences, were established from A. formosa. The physical map was composed of a total of 50,155 BAC clones in 832 contigs and 3939 singletons, covering 21X genome equivalents. These contigs spanned a physical length of 689.8 Mb (~2.3X of the genome) suggesting the complex heterozygosity of the genome. A set of 197 markers was developed from ESTs induced by drought-stress, or involved in anthocyanin biosynthesis or floral development, and was integrated into the physical map. Among these were 87 genetically mapped markers that anchored 54 contigs, spanning 76.4 Mb (25.5%) across the genome. Analysis of a selection of 12,086 BAC end sequences (BESs) from the minimal tiling path (MTP) allowed a preview of the Aquilegia genome organization, including identification of transposable elements, simple sequence repeats and gene content. Common repetitive elements previously reported in both monocots and core eudicots were identified in Aquilegia suggesting the value of this genome in connecting the two major plant clades. Comparison with sequenced plant genomes indicated a higher similarity to grapevine (Vitis vinifera) than to rice and Arabidopsis in the transcriptomes. Conclusions The A. formosa BAC-based genomic resources provide valuable tools to study Aquilegia genome. Further integration of other existing genomics resources, such as ESTs, into the physical map should enable better understanding of the molecular mechanisms underlying adaptive radiation and elaboration of floral morphology. PMID:21059242

  6. BAC library development, and clone characterization for dormancy-responsive DREB4A, DAM, and FT from leafy spurge (Euphorbia esula L.) identifies differential splicing and conserved promoter motifs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed two leafy spurge BAC libraries that together represent approximately 5X coverage of the leafy spurge genome. The BAC libraries have an average insert size of approximately 143 kb, and copies of the library and filters for hybridization-based screening are publicly available through the ...

  7. Construction and characterization of a half million clone BAC library of durum wheat ( Triticum turgidum ssp. durum )

    Microsoft Academic Search

    A. Cenci; N. Chantret; X. Kong; Y. Gu; O. D. Anderson; T. Fahima; A. Distelfeld; J. Dubcovsky

    2003-01-01

    Durum wheat ( Triticum turgidum ssp. durum, 2 n = 4 x = 28, genomes AB) is an economically important cereal used as the raw material to make pasta and semolina. In this paper we present the construction and characterization of a bacterial artificial chromosome (BAC) library of tetraploid durum wheat cv. Langdon. This variety was selected because of the

  8. A bacterial artificial chromosome (BAC) library of Malus floribunda 821 and contig construction for positional cloning of the apple scab resistance gene Vf.

    PubMed

    Xu, M; Song, J; Cheng, Z; Jiang, J; Korban, S S

    2001-12-01

    The apple scab resistance gene Vf, originating from the wild species Malus floribunda 821, has been incorporated into a wide variety of apple cultivars through a classical breeding program. With the aim of isolating the Vf gene, a bacterial artificial chromosome (BAC) library consisting of 31 584 clones has been constructed from M. floribunda 821. From the analysis of 88 randomly selected BAC clones, the average insert size is estimated at 125 kb. If it is assumed that the genome size of M. floribunda 821 is 769 Mb/haploid, the library represents about 5x haploid genome equivalents. This provides a 99% probability of finding any specific sequence from this library. PCR-based screening of the library has been carried out using eight random genomic sequence-characterized amplified regions (SCARs), chloroplast- and mitochondria-specific SCARs, and 13 high-density Vf-linked SCAR markers. An average of five positive BAC clones per random SCAR has been obtained, whereas less than 1% of BAC clones are derived from the chloroplast or mitochondrial genomes. Most BAC clones identified with Vf-linked SCAR markers are physically linked. Three BAC contigs along the Vf region have been obtained by assembling physically linked BAC clones based on their fingerprints. The overlapping relatedness of BAC clones has been further confirmed by cytogenetic mapping using fiber fluorescence in situ hybridization (fiber-FISH). The M. floribunda 821 BAC library provides a valuable genetic resource not only for map-based cloning of the Vf gene, but also for finding many other important genes for improving the cultivated apple. PMID:11768214

  9. Construction of a bacterial artificial chromosome library containing large Eco RI and Hin dIII genomic fragments of lettuce

    Microsoft Academic Search

    A. C. J. Frijters; Z. Zhang; M. van Damme; G.-L. Wang; P. C. Ronald; R. W. Michelmore

    1997-01-01

    Existing bacterial artificial chromosome (BAC) vectors were modified to have unique EcoRI cloning sites. This provided an additional site for generating representative libraries from genomic DNA digested with\\u000a a variety of enzymes. A BAC library of lettuce was constructed following the partial digestion of genomic DNA with HindIII or EcoRI. Several experimental parameters were investigated and optimized. The BAC library

  10. Construction, characterization, and preliminary BAC-end sequencing analysis of a bacterial artificial chromosome library of white clover (Trifolium repens L.).

    PubMed

    Febrer, Melanie; Cheung, Foo; Town, Christopher D; Cannon, Steven B; Young, Nevin D; Abberton, Michael T; Jenkins, Glyn; Milbourne, Dan

    2007-04-01

    White clover (Trifolium repens L.) is a forage legume widely used in combination with grass in pastures because of its ability to fix nitrogen. We have constructed a bacterial artificial chromosome (BAC) library of an advanced breeding line of white clover. The library contains 37 248 clones with an average insert size of approximately 85 kb, representing an approximate 3-fold coverage of the white clover genome based on an estimated genome size of 960 Mb. The BAC library was pooled and screened by polymerase chain reaction (PCR) amplification using both white clover microsatellites and PCR-based markers derived from Medicago truncatula, resulting in an average of 6 hits per marker; this supports the estimated 3-fold genome coverage in this allotetraploid species. PCR-based screening of 766 clones with a multiplex set of chloroplast primers showed that only 0.5% of BAC clones contained chloroplast-derived inserts. The library was further evaluated by sequencing both ends of 724 of the clover BACs. These were analysed with respect to their sequence content and their homology to the contents of a range of plant gene, expressed sequence tag, and repeat element databases. Forty-three microsatellites were discovered in the BAC-end sequences (BESs) and investigated as potential genetic markers in white clover. The BESs were also compared with the partially sequenced genome of the model legume M. truncatula with the specific intention of identifying putative comparative-tile BACs, which represent potential regions of microsynteny between the 2 species; 14 such BACs were discovered. The results suggest that a large-scale BAC-end sequencing strategy has the potential to anchor a significant proportion of the genome of white clover onto the gene-space sequence of M. truncatula. PMID:17546099

  11. CHARACTERIZATION AND PHYSICAL MAPPING OF MAIZE BAC LIBRARIES USING HIGH DENSITY BAC FILTER HYBRIDIZATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-density filter sets from two maize B73 libraries containing 6X (HindIII) and 7X (EcoRI) haploid genome equivalents, respectively, were evaluated with a set of complex probes. The complex probes will provide information on chromosome architecture and organellar DNA content. A second set of pro...

  12. Genome evolution in Reptilia: in silico chicken mapping of 12,000 BAC-end sequences from two reptiles and a basal bird

    Microsoft Academic Search

    Charles Chapus; Scott V Edwards

    2009-01-01

    BACKGROUND: With the publication of the draft chicken genome and the recent production of several BAC clone libraries from non-avian reptiles and birds, it is now possible to undertake more detailed comparative genomic studies in Reptilia. Of interest in particular are the genomic events that transformed the large, repeat-rich genomes of mammals and non-avian reptiles into the minimalist chicken genome.

  13. Mapping of genes using a bovine BAC Library to determine their effects on economically important traits in cattle 

    E-print Network

    Herring, Kimberly Lynn

    1995-01-01

    Five genes, growth hormone (GH), insulin-like growth factor I receptor (IGF-1R), somatostatin (SS), prolactin (PRL) and placental lactogen (PLL) were isolated from a bovine bacterial artificial chromosome (BAC) Library. The BAC clones containing GH...

  14. A FISH approach for mapping the human genome using Bacterial Artificial Chromosomes (BACs)

    SciTech Connect

    Hubert, R.S.; Chen, X.N.; Mitchell, S. [Univ. of Los Angeles, CA (United States)] [and others

    1994-09-01

    As the Human Genome Project progresses, large insert cloning vectors such as BACs, P1, and P1 Artificial Chromosomes (PACs) will be required to complement the YAC mapping efforts. The value of the BAC vector for physical mapping lies in the stability of the inserts, the lack of chimerism, the length of inserts (up to 300 kb), the ability to obtain large amounts of pure clone DNA and the ease of BAC manipulation. These features helped us design two approaches for generating physical mapping reagents for human genetic studies. The first approach is a whole genome strategy in which randomly selected BACs are mapped, using FISH, to specific chromosomal bands. To date, 700 BACs have been mapped to single chromosome bands at a resolution of 2-5 Mb in addition to BACs mapped to 14 different centromeres. These BACs represent more than 90 Mb of the genome and include >70% of all human chromosome bands at the 350-band level. These data revealed that >97% of the BACs were non-chimeric and have a genomic distribution covering most gaps in the existing YAC map with excellent coverage of gene-rich regions. In the second approach, we used YACs to identify BACs on chromosome 21. A 1.5 Mb contig between D21S339 and D21S220 nears completion within the Down syndrome congenital heart disease (DS-CHD) region. Seventeen BACs ranging in size from 80 kb to 240 kb were ordered using 14 STSs with FISH confirmation. We have also used 40 YACs spanning 21q to identify, on average, >1 BAC/Mb to provide molecular cytogenetic reagents and anchor points for further mapping. The contig generated on chromosome 21 will be helpful in isolating the genes for DS-CHD. The physical mapping reagents generated using the whole genome approach will provide cytogenetic markers and mapped genomic fragments that will facilitate positional cloning efforts and the identification of genes within most chromosomal bands.

  15. Construction and analysis of Siberian tiger bacterial artificial chromosome library with approximately 6.5-fold genome equivalent coverage.

    PubMed

    Liu, Changqing; Bai, Chunyu; Guo, Yu; Liu, Dan; Lu, Taofeng; Li, Xiangchen; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2014-01-01

    Bacterial artificial chromosome (BAC) libraries are extremely valuable for the genome-wide genetic dissection of complex organisms. The Siberian tiger, one of the most well-known wild primitive carnivores in China, is an endangered animal. In order to promote research on its genome, a high-redundancy BAC library of the Siberian tiger was constructed and characterized. The library is divided into two sub-libraries prepared from blood cells and two sub-libraries prepared from fibroblasts. This BAC library contains 153,600 individually archived clones; for PCR-based screening of the library, BACs were placed into 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 116.5 kb, representing approximately 6.46 genome equivalents of the haploid genome and affording a 98.86% statistical probability of obtaining at least one clone containing a unique DNA sequence. Screening the library with 19 microsatellite markers and a SRY sequence revealed that each of these markers were present in the library; the average number of positive clones per marker was 6.74 (range 2 to 12), consistent with 6.46 coverage of the tiger genome. Additionally, we identified 72 microsatellite markers that could potentially be used as genetic markers. This BAC library will serve as a valuable resource for physical mapping, comparative genomic study and large-scale genome sequencing in the tiger. PMID:24608928

  16. CONSTRUCTION OF BAC AND BIBAC LIBRARIES FROM SUNFLOWER AND IDENTIFICATION OF LINKAGE GROUP-SPECIFIC CLONES BY OVERGO HYBRIDIZATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two complementary BAC and BIBAC libraries were constructed from nuclear DNA of sunflower cultivar HA 89. The BAC library was constructed with BamHI in the pECBAC1 vector. It contains 107,136 clones and has an average insert size of 140 kb. The BIBAC library was constructed with HindIII in the plant-...

  17. An integrated BAC/BIBAC-based physical and genetic map of the cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Integrated genome-wide genetic and physical maps are crucial to many aspects of cotton genome research. We report a genome-wide BAC/BIBAC-based physical and genetic map of the upland cotton genome using a high-resolution and high-throughput capillary-based fingerprinting method. The map was constr...

  18. Construction and Preliminary Characterization Analysis of Wuzhishan Miniature Pig Bacterial Artificial Chromosome Library with Approximately 8-Fold Genome Equivalent Coverage

    PubMed Central

    Liu, Changqing; Guo, Yuo; Lu, Taofeng; Wu, Hongmei; Na, Risu; Li, Xiangchen; Guan, Weijun; Ma, Yuehui

    2013-01-01

    Bacterial artificial chromosome (BAC) libraries have been invaluable tools for the genome-wide genetic dissection of complex organisms. Here, we report the construction and characterization of a high-redundancy BAC library from a very valuable pig breed in China, Wuzhishan miniature pig (Sus scrofa), using its blood cells and fibroblasts, respectively. The library contains approximately 153,600 clones ordered in 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 152.3?kb, representing approximately 7.68 genome equivalents of the porcine haploid genome and a 99.93% statistical probability of obtaining at least one clone containing a unique DNA sequence in the library. 19 pairs of microsatellite marker primers covering porcine chromosomes were used for screening the BAC library, which showed that each of these markers was positive in the library; the positive clone number was 2 to 9, and the average number was 7.89, which was consistent with 7.68-fold coverage of the porcine genome. And there were no significant differences of genomic BAC library from blood cells and fibroblast cells. Therefore, we identified 19 microsatellite markers that could potentially be used as genetic markers. As a result, this BAC library will serve as a valuable resource for gene identification, physical mapping, and comparative genomics and large-scale genome sequencing in the porcine. PMID:23691508

  19. Generation and Screening of a BAC Library from a Diploid Potato Clone to Unravel Durable Late Blight Resistance on Linkage Group IV

    PubMed Central

    Hein, Ingo; McLean, Karen; Chalhoub, Boulos; Bryan, Glenn J.

    2007-01-01

    We describe the construction and screening of a large insert genomic library from the diploid potato clone HB171(13) that has been shown to express durable quantitative field resistance to Phytophthora infestans, the causal agent of potato late blight disease. Integrated genetic mapping of the field resistance quantitative trait locus with markers developed from populations segregating for Rpi-blb3, Rpi-abpt, R2, and R2-like resistance, all located on linkage group IV, has positioned the field resistance QTL within the proximity of this R gene cluster. The library has been successfully screened with resistance gene analogues (RGA) potentially linked to the R gene cluster. Over 30 positive BAC clones were identified and confirmed by PCR and Southern hybridisations to harbour RGA-like sequences. In addition, BAC end sequencing of positive clones has corroborated two BAC clones with a very high level of nucleotide similarity to the RGA probes utilised. PMID:18273389

  20. Bacterial artificial chromosome (BAC) library resource for positional cloning of pest and disease resistance genes in cassava (Manihot esculenta Crantz).

    PubMed

    Tomkins, J; Fregene, M; Main, D; Kim, H; Wing, R; Tohme, J

    2004-11-01

    Pest and disease problems are important constraints of cassava production and host plant resistance is the most efficient method of combating them. Breeding for host plant resistance is considerably slowed down by the crop's biological constraints of a long growth cycle, high levels of heterozygosity and a large genetic load. More efficient methods such as gene cloning and transgenesis are required to deploy resistance genes. To facilitate the cloning of resistance genes, bacterial artificial chromosome (BAC) library resources have been developed for cassava. Two libraries were constructed from the cassava clones, TMS 30001, resistant to the cassava mosaic disease (CMD) and the cassava bacterial blight (CBB), and MECU72, resistant to cassava white fly. The TMS30001 library has 55, 296 clones with an insert size range of 40-150 kb with an average of 80 kb, while the MECU72 library consists of 92 160 clones and an insert size range of 25-250 kb average of 93 kb. Based on a genome size of 772 Mb, the TMS30001 and MECU72 libraries have a 5 and 11.3 haploid genome equivalents and a 95 and 99 chance of finding any sequence, respectively. To demonstrate the potential of the libraries, the TMS30001 library was screened by southern hybridization using a cassava analog (CBB1) of the Xa21 gene from rice that maps to a region containing a QTL for resistance to CBB as probe. Five BAC clones that hybridized to CBB1 were isolated and a Hind III fingerprint revealed 2-3 copies of the gene in individual BAC clones. A larger scale analysis of resistance gene analogs (RGAs) in cassava has also been conducted in order to understand the number and organization of RGAs. To scan for gene and repeat DNA content in the libraries, end-sequencing was performed on 2,301 clones from the MECU72 library. A total of 1705 unique sequences were obtained with an average size of 715 bp. Database homology searches using BLAST revealed that 458 sequences had significant homology with known proteins and 321 with transposable elements. The use of the library in positional cloning of pest and disease resistance genes is discussed. PMID:15630619

  1. A hybrid BAC physical map of potato: a framework for sequencing a heterozygous genome

    PubMed Central

    2011-01-01

    Background Potato is the world's third most important food crop, yet cultivar improvement and genomic research in general remain difficult because of the heterozygous and tetraploid nature of its genome. The development of physical map resources that can facilitate genomic analyses in potato has so far been very limited. Here we present the methods of construction and the general statistics of the first two genome-wide BAC physical maps of potato, which were made from the heterozygous diploid clone RH89-039-16 (RH). Results First, a gel electrophoresis-based physical map was made by AFLP fingerprinting of 64478 BAC clones, which were aligned into 4150 contigs with an estimated total length of 1361 Mb. Screening of BAC pools, followed by the KeyMaps in silico anchoring procedure, identified 1725 AFLP markers in the physical map, and 1252 BAC contigs were anchored the ultradense potato genetic map. A second, sequence-tag-based physical map was constructed from 65919 whole genome profiling (WGP) BAC fingerprints and these were aligned into 3601 BAC contigs spanning 1396 Mb. The 39733 BAC clones that overlap between both physical maps provided anchors to 1127 contigs in the WGP physical map, and reduced the number of contigs to around 2800 in each map separately. Both physical maps were 1.64 times longer than the 850 Mb potato genome. Genome heterozygosity and incomplete merging of BAC contigs are two factors that can explain this map inflation. The contig information of both physical maps was united in a single table that describes hybrid potato physical map. Conclusions The AFLP physical map has already been used by the Potato Genome Sequencing Consortium for sequencing 10% of the heterozygous genome of clone RH on a BAC-by-BAC basis. By layering a new WGP physical map on top of the AFLP physical map, a genetically anchored genome-wide framework of 322434 sequence tags has been created. This reference framework can be used for anchoring and ordering of genomic sequences of clone RH (and other potato genotypes), and opens the possibility to finish sequencing of the RH genome in a more efficient way via high throughput next generation approaches. PMID:22142254

  2. Comparative analysis of catfish BAC end sequences with the zebrafish genome

    Microsoft Academic Search

    Hong Liu; Yanliang Jiang; Shaolin Wang; Parichart Ninwichian; Benjaporn Somridhivej; Peng Xu; Jason Abernathy; Huseyin Kucuktas; Zhanjiang Liu

    2009-01-01

    BACKGROUND: Comparative mapping is a powerful tool to transfer genomic information from sequenced genomes to closely related species for which whole genome sequence data are not yet available. However, such an approach is still very limited in catfish, the most important aquaculture species in the United States. This project was initiated to generate additional BAC end sequences and demonstrate their

  3. Genomic insight into the common carp ( Cyprinus carpio ) genome by sequencing analysis of BAC-end sequences

    Microsoft Academic Search

    Peng Xu; Jiongtang Li; Yan Li; Runzi Cui; Jintu Wang; Jian Wang; Yan Zhang; Zixia Zhao; Xiaowen Sun

    2011-01-01

    Background  Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae\\u000a species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively\\u000a underdeveloped. BAC end sequences (BES) are important resources for genome research on BAC-anchored genetic marker development,\\u000a linkage map and physical map integration,

  4. Insights into the Loblolly Pine Genome: Characterization of BAC and Fosmid Sequences

    PubMed Central

    Dougherty, William M.; Martínez-García, Pedro J.; Koriabine, Maxim; Holtz-Morris, Ann; deJong, Pieter; Crepeau, Marc; Langley, Charles H.; Puiu, Daniela; Salzberg, Steven L.; Neale, David B.; Stevens, Kristian A.

    2013-01-01

    Despite their prevalence and importance, the genome sequences of loblolly pine, Norway spruce, and white spruce, three ecologically and economically important conifer species, are just becoming available to the research community. Following the completion of these large assemblies, annotation efforts will be undertaken to characterize the reference sequences. Accurate annotation of these ancient genomes would be aided by a comprehensive repeat library; however, few studies have generated enough sequence to fully evaluate and catalog their non-genic content. In this paper, two sets of loblolly pine genomic sequence, 103 previously assembled BACs and 90,954 newly sequenced and assembled fosmid scaffolds, were analyzed. Together, this sequence represents 280 Mbp (roughly 1% of the loblolly pine genome) and one of the most comprehensive studies of repetitive elements and genes in a gymnosperm species. A combination of homology and de novo methodologies were applied to identify both conserved and novel repeats. Similarity analysis estimated a repetitive content of 27% that included both full and partial elements. When combined with the de novo investigation, the estimate increased to almost 86%. Over 60% of the repetitive sequence consists of full or partial LTR (long terminal repeat) retrotransposons. Through de novo approaches, 6,270 novel, full-length transposable element families and 9,415 sub-families were identified. Among those 6,270 families, 82% were annotated as single-copy. Several of the novel, high-copy families are described here, with the largest, PtPiedmont, comprising 133 full-length copies. In addition to repeats, analysis of the coding region reported 23 full-length eukaryotic orthologous proteins (KOGS) and another 29 novel or orthologous genes. These discoveries, along with other genomic resources, will be used to annotate conifer genomes and address long-standing questions about gymnosperm evolution. PMID:24023741

  5. Insights into the loblolly pine genome: characterization of BAC and fosmid sequences.

    PubMed

    Wegrzyn, Jill L; Lin, Brian Y; Zieve, Jacob J; Dougherty, William M; Martínez-García, Pedro J; Koriabine, Maxim; Holtz-Morris, Ann; deJong, Pieter; Crepeau, Marc; Langley, Charles H; Puiu, Daniela; Salzberg, Steven L; Neale, David B; Stevens, Kristian A

    2013-01-01

    Despite their prevalence and importance, the genome sequences of loblolly pine, Norway spruce, and white spruce, three ecologically and economically important conifer species, are just becoming available to the research community. Following the completion of these large assemblies, annotation efforts will be undertaken to characterize the reference sequences. Accurate annotation of these ancient genomes would be aided by a comprehensive repeat library; however, few studies have generated enough sequence to fully evaluate and catalog their non-genic content. In this paper, two sets of loblolly pine genomic sequence, 103 previously assembled BACs and 90,954 newly sequenced and assembled fosmid scaffolds, were analyzed. Together, this sequence represents 280 Mbp (roughly 1% of the loblolly pine genome) and one of the most comprehensive studies of repetitive elements and genes in a gymnosperm species. A combination of homology and de novo methodologies were applied to identify both conserved and novel repeats. Similarity analysis estimated a repetitive content of 27% that included both full and partial elements. When combined with the de novo investigation, the estimate increased to almost 86%. Over 60% of the repetitive sequence consists of full or partial LTR (long terminal repeat) retrotransposons. Through de novo approaches, 6,270 novel, full-length transposable element families and 9,415 sub-families were identified. Among those 6,270 families, 82% were annotated as single-copy. Several of the novel, high-copy families are described here, with the largest, PtPiedmont, comprising 133 full-length copies. In addition to repeats, analysis of the coding region reported 23 full-length eukaryotic orthologous proteins (KOGS) and another 29 novel or orthologous genes. These discoveries, along with other genomic resources, will be used to annotate conifer genomes and address long-standing questions about gymnosperm evolution. PMID:24023741

  6. Construction of BAC and BIBAC libraries from sunflower and identification of linkage group-specific clones by overgo hybridization

    Microsoft Academic Search

    Jiuhuan Feng; Brady A. Vick; Mi-Kyung Lee; Hong-Bin Zhang; C. C. Jan

    2006-01-01

    Complementary BAC and BIBAC libraries were constructed from nuclear DNA of sunflower cultivar HA 89. The BAC library, constructed with BamHI in the pECBAC1 vector, contains 107,136 clones and has an average insert size of 140 kb. The BIBAC library was constructed with HindIII in the plant-transformation-competent binary vector pCLD04541 and contains 84,864 clones, with an average insert size of 137 kb.

  7. Assembly and sorting of homologous BAC contigs in allotetraploid cotton genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Upland cotton (G. hirsutum) is a diploidized allopolyploid species containing At and Dt sub-genomes that have partial homology. Assembly and sorting of homologous BAC contigs into their subgenomes and further to individual chromosomes are of both great interest and great challenge for genome-wide i...

  8. A BAC-based physical map of the Nile tilapia genome

    Microsoft Academic Search

    Takayuki Katagiri; Celeste Kidd; Elizabeth Tomasino; Jesse T Davis; Cassandra Wishon; Justin E Stern; Karen L Carleton; Aimee E Howe; Thomas D Kocher

    2005-01-01

    BACKGROUND: Cichlid fishes, particularly tilapias, are an important source of animal protein in tropical countries around the world. To support selective breeding of these species we are constructing genetic and physical maps of the tilapia genome. Physical maps linking collections of BAC clones are a critical resource for both positional cloning and assembly of whole genome sequences. RESULTS: We constructed

  9. Construction and Characterization of a Human Bacterial Artificial Chromosome Library

    Microsoft Academic Search

    Ung-Jin Kim; Bruce W. Birren; Tatiana Slepak; Valeria Mancino; Cecilie Boysen; Hyung-Lyun Kang; Melvin I. Simon; Hiroaki Shizuya

    1996-01-01

    We have constructed an arrayed human genomic BAC library with approximately 4× coverage that is represented by 96,000 BAC clones with average insert size of nearly 140 kb. A new BAC vector that allows color-based positive screening to identify transformants with inserts has increased BAC cloning efficiency. The library was gridded onto hybridization filters at high density for efficient identification

  10. Bacterial delivery of large intact genomic-DNA-containing BACs into mammalian cells

    PubMed Central

    Cheung, Wing; Kotzamanis, George; Abdulrazzak, Hassan; Goussard, Sylvie; Kaname, Tadashi; Kotsinas, Athanassios; Gorgoulis, Vassilis G.; Grillot-Courvalin, Catherine; Huxley, Clare

    2012-01-01

    Efficient delivery of large intact vectors into mammalian cells remains problematical. Here we evaluate delivery by bacterial invasion of two large BACs of more than 150 kb in size into various cells. First, we determined the effect of several drugs on bacterial delivery of a small plasmid into different cell lines. Most drugs tested resulted in a marginal increase of the overall efficiency of delivery in only some cell lines, except the lysosomotropic drug chloroquine, which was found to increase the efficiency of delivery by 6-fold in B16F10 cells. Bacterial invasion was found to be significantly advantageous compared with lipofection in delivering large intact BACs into mouse cells, resulting in 100% of clones containing intact DNA. Furthermore, evaluation of expression of the human hypoxanthine phosphoribosyltransferase (HPRT) gene from its genomic locus, which was present in one of the BACs, showed that single copy integrations of the HPRT-containing BAC had occurred in mouse B16F10 cells and that expression of HPRT from each human copy was 0.33 times as much as from each endogenous mouse copy. These data provide new evidence that bacterial delivery is a convenient and efficient method to transfer large intact therapeutic genes into mammalian cells. PMID:22095052

  11. Bacterial delivery of large intact genomic-DNA-containing BACs into mammalian cells.

    PubMed

    Cheung, Wing; Kotzamanis, George; Abdulrazzak, Hassan; Goussard, Sylvie; Kaname, Tadashi; Kotsinas, Athanassios; Gorgoulis, Vassilis G; Grillot-Courvalin, Catherine; Huxley, Clare

    2012-01-01

    Efficient delivery of large intact vectors into mammalian cells remains problematical. Here we evaluate delivery by bacterial invasion of two large BACs of more than 150 kb in size into various cells. First, we determined the effect of several drugs on bacterial delivery of a small plasmid into different cell lines. Most drugs tested resulted in a marginal increase of the overall efficiency of delivery in only some cell lines, except the lysosomotropic drug chloroquine, which was found to increase the efficiency of delivery by 6-fold in B16F10 cells. Bacterial invasion was found to be significantly advantageous compared with lipofection in delivering large intact BACs into mouse cells, resulting in 100% of clones containing intact DNA. Furthermore, evaluation of expression of the human hypoxanthine phosphoribosyltransferase (HPRT) gene from its genomic locus, which was present in one of the BACs, showed that single copy integrations of the HPRT-containing BAC had occurred in mouse B16F10 cells and that expression of HPRT from each human copy was 0.33 times as much as from each endogenous mouse copy. These data provide new evidence that bacterial delivery is a convenient and efficient method to transfer large intact therapeutic genes into mammalian cells. PMID:22095052

  12. Using comparative genomics to reorder the human genome sequence into a virtual sheep genome

    Microsoft Academic Search

    Brian P Dalrymple; Ewen F Kirkness; Mikhail Nefedov; Sean McWilliam; Abhirami Ratnakumar; Wes Barris; Shaying Zhao; Jyoti Shetty; Jillian F Maddox; Margaret O'Grady; Frank Nicholas; Allan M Crawford; Tim Smith; Pieter J de Jong; John McEwan; V Hutton Oddy; Noelle E Cockett

    2007-01-01

    BACKGROUND: Is it possible to construct an accurate and detailed subgene-level map of a genome using bacterial artificial chromosome (BAC) end sequences, a sparse marker map, and the sequences of other genomes? RESULTS: A sheep BAC library, CHORI-243, was constructed and the BAC end sequences were determined and mapped with high sensitivity and low specificity onto the frameworks of the

  13. The wheat D-genome HMW-glutenin locus: BAC sequencing, gene distribution, and retrotransposon clusters

    Microsoft Academic Search

    O. D. Anderson; C. Rausch; O. Moullet; E. S. Lagudah

    2003-01-01

    .   A bacterial-artificial-chromosome (BAC) clone from the genome of Triticum tauschii, the D-genome ancestor of hexaploid bread wheat, was sequenced and the presence of the two paralogous x- and y-type high-molecular-weight\\u000a (HMW) glutenin genes of the Glu-D1 locus was confirmed. These two genes occur in the same orientation, are 51,893 bp apart, and the separating DNA includes\\u000a a 31,000-bp cluster of

  14. Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library

    PubMed Central

    2009-01-01

    Background Polyphenol oxidase (PPO) activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC) library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover), a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO) genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3). Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate functional studies and provide genetic markers for plant breeding. PMID:19619287

  15. A Bacterial Artificial Chromosome Library for Sequencing the Complete Human Genome

    Microsoft Academic Search

    Kazutoyo Osoegawa; Aaron G. Mammoser; Chenyan Wu; Eirik Frengen; Changjiang Zeng; Joseph J. Catanese; Pieter J. de Jong

    2007-01-01

    A 30-fold redundant human bacterial artificial chromosome (BAC) library with a large average insert size (178 kb) has been constructed to provide the intermediate substrate for the international genome sequencing effort. The DNA was obtained from a single anonymous volunteer, whose identity was protected through a double-blind donor selection protocol. DNA fragments were generated by partial digestion with EcoRI (library

  16. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: BAC-based physical maps provide for sequencing across an entire genome or selected sub-genome regions of biological interest. Using the minimum tiling path as a guide, it is possible to select specific BAC clones from prioritized genome sections such as a genetically defined QTL interv...

  17. BAC-VAC, a Novel Generation of (DNA) Vaccines: A Bacterial Artificial Chromosome (BAC) Containing a Replication-Competent, Packaging-Defective Virus Genome Induces Protective Immunity against Herpes Simplex Virus 1

    Microsoft Academic Search

    Mark Suter; Andrew M. Lew; Philipp Grob; Gosse J. Adema; Mathias Ackermann; Ken Shortman; Cornel Fraefel

    1999-01-01

    This study aimed to exploit bacterial artificial chromosomes (BAC) as large antigen-capacity DNA vaccines (BAC-VAC) against complex pathogens, such as herpes simplex virus 1 (HSV-1). The 152-kbp HSV-1 genome recently has been cloned as an F-plasmid-based BAC in Escherichia coli (fHSV), which can efficiently produce infectious virus progeny upon transfection into mammalian cells. A safe modification of fHSV, fHSVDelta pac,

  18. Construction of a Llama Bacterial Artificial Chromosome Library with Approximately 9-Fold Genome Equivalent Coverage

    PubMed Central

    Airmet, K. W.; Hinckley, J. D.; Tree, L. T.; Moss, M.; Blumell, S.; Ulicny, K.; Gustafson, A. K.; Weed, M.; Theodosis, R.; Lehnardt, M.; Genho, J.; Stevens, M. R.; Kooyman, D. L.

    2012-01-01

    The Ilama is an important agricultural livestock in much of South America. The llama is increasing in popularity in the United States as a companion animal. Little work has been done to improve llama production using modern technology. A paucity of information is available regarding the llama genome. We report the construction of a llama bacterial artificial chromosome (BAC) library of about 196,224 clones in the vector pECBAC1. Using flow cytometry and bovine, human, mouse, and chicken as controls, we determined the llama genome size to be 2.4 × 109?bp. The average insert size of the library is 137.8?kb corresponding to approximately 9-fold genome coverage. Further studies are needed to further characterize the library and llama genome. We anticipate that this new library will help facilitate future genomic studies in the llama. PMID:22811594

  19. Detecting single DNA copy number variations in complex genomes using one nanogram of starting DNA and BAC-array CGH

    Microsoft Academic Search

    Marine Guillaud-Bataille; Alexander Valent; Pascal Soularue; Christine Perot; Maria-del-Mar Inda; Aline Receveur; Sadek Smaili; Hugues Roest Crollius; Jean Benard; Alain Bernheim; Xavier Gidrol; Gisele Danglot

    2004-01-01

    Comparative genomic hybridization to bacterial artificial chromosome (BAC)-arrays (array-CGH) is a highly efficient technique, allowing the simultaneous measurement of genomic DNA copy number at hundreds or thousands of loci, and the reliable detec- tion of local one-copy-level variations. We report a genome-wide amplification method allowing the same measurement sensitivity, using 1 ng of starting genomic DNA, instead of the classical

  20. Construction of a genome-wide human BAC-Unigene resource. Final progress report, 1989--1996

    SciTech Connect

    Lim, C.S.; Xu, R.X.; Wang, M. [and others

    1996-12-31

    Currently, over 30,000 mapped STSs and 27,000 mapped Unigenes (non-redundant, unigene sets of cDNA representing EST clusters) are available for human alone. A total of 44,000 Unigene cDNA clones have been supplied by Research Genetics. Unigenes, or cDNAs are excellent resource for map building for two reasons. Firstly, they exist in two alternative forms -- as both sequence information for PCR primer pairs, and cDNA clones -- thus making library screening by colony hybridization as well as pooled library PCR possible. The authors have developed an efficient and robust procedure to screen genomic libraries with large number of DNA probes. Secondly, the linkage and order of expressed sequences, or genes are highly conserved among human, mouse and other mammalian species. Therefore, mapping with cDNA markers rather than random anonymous STSs will greatly facilitate comparative, evolutionary studies as well as physical map building. They have currently deconvoluted over 10,000 Unigene probes against a 4X coverage human BAC clones from the approved library D by high density colony hybridization method. 10,000 batches of Unigenes are arrayed in an imaginary 100 X 100 matrix from which 100 row pools and 100 column pools are obtained. Library filters are hybridized with pooled probes, thus reducing the number of hybridization required for addressing the positives for each Unigene from 10,000 to 200. Details on the experimental scheme as well as daily progress report is posted on the Web site (http://www.tree.caltech.edu).

  1. Isolation of BAC clones: Occasionally, more than one BAC clone may be represented in a single well of the BAC library. It is recommended that the following procedure for the

    E-print Network

    Oliver, Douglas L.

    Isolation of BAC clones: Occasionally, more than one BAC clone may be represented in a single well of BAC clones. 1. Streak some of the BAC culture from the stab tube to a LB plate containing 12.5 µg at 4ºC. Verification of clones: All cones should be verified after isolation using Southern blot

  2. GenMapDB: a database of mapped human BAC clones

    Microsoft Academic Search

    Michael Morley; Melissa Arcaro; Joshua Burdick; Raluca Yonescu; Thomas Reid; Ilan R. Kirsch; Vivian G. Cheung

    2001-01-01

    GenMapDB (http:\\/\\/genomics.med.upenn.edu\\/genmapdb) is a repository of human bacterial artificial chromo- some (BAC) clones mapped by our laboratory to sequence-tagged site markers. Currently, GenMapDB contains over 3000 mapped clones that span 19 chromosomes, chromosomes 2, 4, 5, 9-22, X and Y. This database provides positional information about human BAC clones from the RPCI-11 human male BAC library. It also contains restriction

  3. Construction of a 550 kb BAC contig spanning the genomic region containing the apple scab resistance gene Vf.

    PubMed

    Patocchi, A; Vinatzer, B A; Gianfranceschi, L; Tartarini, S; Zhang, H B; Sansavini, S; Gessler, C

    1999-12-01

    A positional cloning project was started in apple with the aim of isolating the Vf resistance gene of Malus floribunda 821. Vf confers resistance against apple scab, the most important disease in apple orchards. A chromosome walk starting from two molecular markers (M18-CAPS and AM19-SCAR) flanking Vf was performed, using a bacterial artificial chromosome (BAC) library containing inserts of the cultivar Florina, which is heterozygous for Vf. Thirteen BAC clones spanning the region between the two markers were identified in nine chromosome walking steps. The size of the resulting contig is approximately 550 kb. In order to map the Vf region in more detail, we analyzed over 2000 plants from different populations segregating for Vf with markers produced from BAC end sequences. In this way, we were able to restrict the possible location of the Vf gene to a minimum of five clones spanning an interval of approximately 350 kb. PMID:10628874

  4. Yeast Genomic Library Genomic DNA Sau3AI partial digestion

    E-print Network

    Odorizzi, Greg

    Yeast Genomic Library Concept: Genomic DNA ­ Sau3AI partial digestion Vector DNA ­ BamHI full digestion partial Ligate and transform above products Vector Information: · use centromeric plasmid to avoid of the mcs Preparing Vector: 1) digest 3-4ug of library vector with BamHI for 2-4hrs in a total volume of 20

  5. Hemi-nested touchdown PCR combined with primer-template mismatch PCR for rapid isolation and sequencing of low molecular weight glutenin subunit gene family from a hexaploid wheat BAC library

    PubMed Central

    Huang, Xiu-Qiang; Cloutier, Sylvie

    2007-01-01

    Background Hexaploid wheat (Triticum aestivum L.) possesses a large genome that contains 1.6 × 1010 bp of DNA. Isolation of a large number of gene sequences from complex gene families with a high level of gene sequence identity from genomic DNA is therefore difficult and time-consuming. Bacterial artificial chromosome (BAC) libraries can be useful for such work. Here we report on an efficient approach for rapid isolation and sequencing of the low molecular weight glutenin subunit gene family from the 'Glenlea' wheat BAC library via primer-template mismatch PCR using universal primers, primer walking using hemi-nested touchdown (TD) PCR, and followed by direct sequencing of PCR products. Results For the primer-template mismatch PCR, the universal primers were designed based on conserved gene coding regions of consensus sequences. The effects of the universal primer-template mismatches on the efficiency of standard PCR amplification were investigated after assembly of sequences from different primers amplifying the same BAC clones. Single or multiple mismatches were observed at 5' terminal, internal and the penultimate position, respectively. These mismatches included the transition mispairs G:T, T:G, A:C and the transversion mispairs A:A, A:G, G:G, G:A. Two or more primer-template mismatches reduced PCR product yield approximately from 2-fold to 10-fold compared to PCR product yield without the primer-template mismatch. For the hemi-nested TD PCR, primers were designed based on the known sequences obtained and/or published. The hemi-nested TD PCR increased both specificity and yield by high and low annealing temperatures in two consecutive amplifications. Comparison of two methods for purifying PCR products prior to sequencing showed that purification using MultiScreen384-PCR filter plates had an advantage over ethanol purification because greater numbers of sequencing reactions could be performed from comparable volumes of PCR reactions. Conclusion This approach was fast, easy and cost-effective for isolation and sequencing of genes from complex gene families. It may be suitable for (i) isolation of other complex gene families and/or gene homologues from BAC libraries, (ii) for characterization of multi-copy repetitive elements pending availability of BAC libraries, and (iii) for filling in gaps in shotgun BAC sequencing. PMID:17480230

  6. Genome-wide target profiling of piggyBac and Tol2 in HEK 293: pros and cons for gene discovery and gene therapy

    PubMed Central

    2011-01-01

    Background DNA transposons have emerged as indispensible tools for manipulating vertebrate genomes with applications ranging from insertional mutagenesis and transgenesis to gene therapy. To fully explore the potential of two highly active DNA transposons, piggyBac and Tol2, as mammalian genetic tools, we have conducted a side-by-side comparison of the two transposon systems in the same setting to evaluate their advantages and disadvantages for use in gene therapy and gene discovery. Results We have observed that (1) the Tol2 transposase (but not piggyBac) is highly sensitive to molecular engineering; (2) the piggyBac donor with only the 40 bp 3'-and 67 bp 5'-terminal repeat domain is sufficient for effective transposition; and (3) a small amount of piggyBac transposases results in robust transposition suggesting the piggyBac transpospase is highly active. Performing genome-wide target profiling on data sets obtained by retrieving chromosomal targeting sequences from individual clones, we have identified several piggyBac and Tol2 hotspots and observed that (4) piggyBac and Tol2 display a clear difference in targeting preferences in the human genome. Finally, we have observed that (5) only sites with a particular sequence context can be targeted by either piggyBac or Tol2. Conclusions The non-overlapping targeting preference of piggyBac and Tol2 makes them complementary research tools for manipulating mammalian genomes. PiggyBac is the most promising transposon-based vector system for achieving site-specific targeting of therapeutic genes due to the flexibility of its transposase for being molecularly engineered. Insights from this study will provide a basis for engineering piggyBac transposases to achieve site-specific therapeutic gene targeting. PMID:21447194

  7. A first generation bovine BAC-based physical map

    PubMed Central

    Schibler, Laurent; Roig, Anne; Mahé, Marie-Françoise; Save, Jean-Claude; Gautier, Mathieu; Taourit, Sead; Boichard, Didier; Eggen, André; Cribiu, Edmond P

    2004-01-01

    A first generation clone-based physical map for the bovine genome was constructed combining, fluorescent double digestion fingerprinting and sequence tagged site (STS) marker screening. The BAC clones were selected from an Inra BAC library (105 984 clones) and a part of the CHORI-240 BAC library (26 500 clones). The contigs were anchored using the screening information for a total of 1303 markers (451 microsatellites, 471 genes, 127 EST, and 254 BAC ends). The final map, which consists of 6615 contigs assembled from 100 923 clones, will be a valuable tool for genomic research in ruminants, including targeted marker production, positional cloning or targeted sequencing of regions of specific interest. PMID:14713413

  8. Multicolor chromosome banding (MCB) with YAC/BAC-based probes and region-specific microdissection DNA libraries

    SciTech Connect

    Liehr, T.; Weise, A.; Heller, A.; Starke, H.; Mrasek, K.; Kuechler, A.; Weier, H.-U.G.; Claussen, U.

    2003-06-23

    Multicolor chromosome banding (MCB) allows the delineation of chromosomal regions with a resolution of a few mega base pairs, i.e., slightly below the size of most visible chromosome bands. Based on the hybridization of over lapping region-specific probe libraries, chromosomal subregions are hybridized with probes that fluoresce in distinct wave length intervals, so they can be assigned predefined pseudo-colors during the digital imaging and visualization process. The present study demonstrates how MCB patterns can be produced by region-specific micro dissection derived (mcd) libraries as well as collections of yeast or bacterial artificial chromosomes (YACs and BACs, respectively). We compared the efficiency of an mcd library based approach with the hybridization of collections of locus-specific probes (LSP) for fluorescent banding of three rather differently sized human chromosomes, i.e., chromosomes 2, 13, and 22. The LSP sets were comprised of 107 probes specific for chromosome 2, 82 probes for chromosome 13, and 31 probes for chromosome 22. The results demonstrated a more homogeneous coverage of chromosomes and thus, more desirable banding patterns using the microdissection library-based MCB. This may be related to the observation that chromosomes are difficult to cover completely with YAC and/or BAC clones as single-color fluorescence in situ hybridization (FISH) experiments showed. Mcd libraries, on the other hand, provide high complexity probes that work well as region specific paints, but do not readily allow positioning of break points on genetic or physical maps as required for the positional cloning of genes. Thus, combinations of mcd libraries and locus-specific large insert DNA probes appear to be the most efficient tools for high-resolution cytogenetic analyses.

  9. High throughput genome-specific and gene-specific molecular markers for erucic acid genes in Brassica napus (L.) for marker-assisted selection in plant breeding

    Microsoft Academic Search

    Mukhlesur Rahman; Zudong Sun; Peter B. E. McVetty; Genyi Li

    2008-01-01

    A single base change in the Bn-FAE1.1 gene in the A genome and a two-base deletion in the Bn-FAE1.2 gene in the C genome produce the nearly zero content of erucic acid observed in canola. A BAC clone anchoring Bn-FAE1.1 from a B. rapa BAC library and a BAC clone anchoring Bn-FAE1.2 from a B. oleracea BAC library were used

  10. Utilization of Super BAC Pools and Fluidigm Access Array Platform for High-Throughput BAC Clone Identification: Proof of Concept

    PubMed Central

    Maughan, Peter J.; Smith, Scott M.; Raney, Joshua A.

    2012-01-01

    Bacterial artificial chromosome (BAC) libraries are critical for identifying full-length genomic sequences, correlating genetic and physical maps, and comparative genomics. Here we describe the utilization of the Fluidigm access array genotyping system in conjunction with KASPar genotyping technology to identify individual BAC clones corresponding to specific single-nucleotide polymorphisms (SNPs) from an Amplicon Express seven-plate super pooled Amaranthus hypochondriacus BAC library. Ninety-six SNP loci, spanning the length of A. hypochondriacus linkage groups 1, 2, and 15, were simultaneously tested for clone identification from four BAC super pools, corresponding to 28 384-well plates, using a single Fluidigm integrated fluidic chip (IFC). Forty-six percent of the SNPs were associated with a single unambiguous identified BAC clone. PCR amplification and next-generation sequencing of individual BAC clones confirmed the IFC clone identification. Utilization of the Fluidigm Dynamic array platform allowed for the simultaneous PCR screening of 10,752?BAC pools for 96?SNP tag sites in less than three hours at a cost of ~$0.05 per reaction. PMID:22910714

  11. Zebrafish genomic library in yeast artificial chromosomes.

    PubMed

    Zhong, T P; Kaphingst, K; Akella, U; Haldi, M; Lander, E S; Fishman, M C

    1998-02-15

    We have constructed a zebrafish yeast artificial chromosome (YAC) library using genomic DNA isolated from the inbred AB zebrafish strain. The average insert size is 470 kb, estimated from analysis of 155 random selected YACs. The library consists of 17,000 clones, providing about a 4.7-fold coverage of zebrafish genome. The YAC clones have been arrayed in individual wells of 96-well microplates and also pooled to permit rapid polymerase chain reaction screening of the entire library. We have also found that the YAC ends can be easily rescued and sequenced from pRML1/pRML2-based mini-YAC clones. PMID:9503028

  12. Construction and characterization of a bacterial artificial chromosome library for hexaploid wheat line 92R137

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For map-based cloning of genes conferring important traits in the hexaploid wheat line 92R137, a bacterial artificial chromosome (BAC) library, including two sub libraries, was constructed using the genomic DNA of 92R137 digested with restriction enzymes HindIII and BamHI. The BAC library was compos...

  13. BAC-derived diagnostic markers for sex determination in asparagus.

    PubMed

    Jamsari, A; Nitz, I; Reamon-Büttner, S M; Jung, C

    2004-04-01

    A HindIII BAC (bacterial artificial chromosome) library of asparagus ( Asparagus officinalis L.) was established from a single male plant homozygous for the male flowering gene ( MM). The library represents approximately 5.5 haploid genome equivalents with an average insert size of 82 kb. A subset of the library (2.6 haploid genome equivalents) was arranged into DNA pools. Using nine sex-linked amplified fragment length polymorphism (AFLP) and two sequence-tagged site (STS) markers, 13 different BAC clones were identified from this part of the library. The BACs were arranged into a first-generation physical map around the sex locus. Four PCR-derived markers were developed from the BAC ends, one of which could be scored in a co-dominant way. Using a mapping population of 802 plants we mapped the BAC-derived markers to the same position close to the M gene as the corresponding AFLP and STS markers. The markers are useful for further chromosome walking studies and as diagnostic markers for selecting male plants homozygous for the M gene. PMID:15067401

  14. Cryptic loxP sites in mammalian genomes: genome-wide distribution and relevance for the efficiency of BAC\\/PAC recombineering techniques

    Microsoft Academic Search

    S. Semprini; T. J. Troup; N. Kotelevtseva; K. King; J. R. E. Davis; L. J. Mullins; K. E. Chapman; D. R. Dunbar; J. J. Mullins

    2007-01-01

    Cre is widely used for DNA tailoring and, in combination with recombineering techniques, to modify BAC\\/PAC sequences for generating transgenic animals. However, mammalian genomes contain recombinase recognition sites (cryptic loxP sites) that can promote illegitimate DNA recombina- tion and damage when cells express the Cre recombinase gene. We have created a new bioinfor- matic tool, FuzznucComparator, which searches for cryptic

  15. Counter-selection recombineering of the baculovirus genome: a strategy for seamless modification of repeat-containing BACs

    PubMed Central

    Westenberg, Marcel; Soedling, Helen M.; Mann, Derek A.; Nicholson, Linda J.; Dolphin, Colin T.

    2010-01-01

    Recombineering is employed to modify large DNA clones such as fosmids, BACs and PACs. Subtle and seamless modifications can be achieved using counter-selection strategies in which a donor cassette carrying both positive and negative markers inserted in the target clone is replaced by the desired sequence change. We are applying counter-selection recombineering to modify bacmid bMON14272, a recombinant baculoviral genome, as we wish to engineer the virus into a therapeutically useful gene delivery vector with cell targeting characteristics. Initial attempts to replace gp64 with Fusion (F) genes from other baculoviruses resulted in many rearranged clones in which the counter-selection cassette had been deleted. Bacmid bMON14272 contains nine highly homologous regions (hrs) and deletions were mapped to recombination between hr pairs. Recombineering modifications were attempted to decrease intramolecular recombination and/or increase recombineering efficiency. Of these only the use of longer homology arms on the donor molecule proved effective permitting seamless modification. bMON14272, because of the presence of the hr sequences, can be considered equivalent to a highly repetitive BAC and, as such, the optimized method detailed here should prove useful to others applying counter-selection recombineering to modify BACs or PACs containing similar regions of significant repeating homologies. PMID:20621982

  16. Construction of two BAC libraries from cucumber ( Cucumis sativus L.) and identification of clones linked to yield component quantitative trait loci

    Microsoft Academic Search

    Y.-W. Nam; J.-R. Lee; K.-H. Song; M.-K. Lee; M. D. Robbins; S.-M. Chung; J. E. Staub; H.-B. Zhang

    2005-01-01

    Two bacterial artificial chromosome (BAC) libraries were constructed from an inbred line derived from a cultivar of cucumber (Cucumis sativus L.). Intact nuclei were isolated and embedded in agarose plugs, and high-molecular-weight DNA was subsequently partially digested with BamHI or EcoRI. Ligation of double size-selected DNA fragments with the pECBAC1 vector yielded two libraries containing 23,040 BamHI and 18,432 EcoRI

  17. Comparative Mapping of the Alpaca Genome 

    E-print Network

    Fagundes De Avila, Felipe

    2014-08-06

    genome by fluorescence in situ hybridization (FISH) of large insert clones from the alpaca CHORI-246 genomic BAC library. The BACs were selected based on the available Zoo-FISH, RH and sequence map data to target evolutionarily conserved genes and to get...

  18. Zebrafish Genomic Library in Yeast Artificial Chromosomes

    PubMed

    Zhong; Kaphingst; Akella; Haldi; Lander; Fishman

    1998-02-15

    We have constructed a zebrafish yeast artificial chromosome (YAC) library using genomic DNA isolated from the inbred AB zebrafish strain. The average insert size is 470 kb, estimated from analysis of 155 random selected YACs. The library consists of 17,000 clones, providing about a 4.7-fold coverage of zebrafish genome. The YAC clones have been arrayed in individual wells of 96-well microplates and also pooled to permit rapid polymerase chain reaction screening of the entire library. We have also found that the YAC ends can be easily rescued and sequenced from pRML1/pRML2-based mini-YAC clones. Copyright 1998 Academic Press. PMID:9514818

  19. Evaluating the potential for undesired genomic effects of the piggyBac transposon system in human cells

    PubMed Central

    Saha, Sunandan; Woodard, Lauren E.; Charron, Elizabeth M.; Welch, Richard C.; Rooney, Cliona M.; Wilson, Matthew H.

    2015-01-01

    Non-viral transposons have been used successfully for genetic modification of clinically relevant cells including embryonic stem, induced pluripotent stem, hematopoietic stem and primary human T cell types. However, there has been limited evaluation of undesired genomic effects when using transposons for human genome modification. The prevalence of piggyBac(PB)-like terminal repeat (TR) elements in the human genome raises concerns. We evaluated if there were undesired genomic effects of the PB transposon system to modify human cells. Expression of the transposase alone revealed no mobilization of endogenous PB-like sequences in the human genome and no increase in DNA double-strand breaks. The use of PB in a plasmid containing both transposase and transposon greatly increased the probability of transposase integration; however, using transposon and transposase from separate vectors circumvented this. Placing a eGFP transgene within transposon vector backbone allowed isolation of cells free from vector backbone DNA. We confirmed observable directional promoter activity within the 5?TR element of PB but found no significant enhancer effects from the transposon DNA sequence. Long-term culture of primary human cells modified with eGFP-transposons revealed no selective growth advantage of transposon-harboring cells. PB represents a promising vector system for genetic modification of human cells with limited undesired genomic effects. PMID:25605795

  20. Evaluating the potential for undesired genomic effects of the piggyBac transposon system in human cells.

    PubMed

    Saha, Sunandan; Woodard, Lauren E; Charron, Elizabeth M; Welch, Richard C; Rooney, Cliona M; Wilson, Matthew H

    2015-02-18

    Non-viral transposons have been used successfully for genetic modification of clinically relevant cells including embryonic stem, induced pluripotent stem, hematopoietic stem and primary human T cell types. However, there has been limited evaluation of undesired genomic effects when using transposons for human genome modification. The prevalence of piggyBac(PB)-like terminal repeat (TR) elements in the human genome raises concerns. We evaluated if there were undesired genomic effects of the PB transposon system to modify human cells. Expression of the transposase alone revealed no mobilization of endogenous PB-like sequences in the human genome and no increase in DNA double-strand breaks. The use of PB in a plasmid containing both transposase and transposon greatly increased the probability of transposase integration; however, using transposon and transposase from separate vectors circumvented this. Placing a eGFP transgene within transposon vector backbone allowed isolation of cells free from vector backbone DNA. We confirmed observable directional promoter activity within the 5'TR element of PB but found no significant enhancer effects from the transposon DNA sequence. Long-term culture of primary human cells modified with eGFP-transposons revealed no selective growth advantage of transposon-harboring cells. PB represents a promising vector system for genetic modification of human cells with limited undesired genomic effects. PMID:25605795

  1. Aquaculture Genomics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genomics chapter covers the basics of genome mapping and sequencing and the current status of several relevant species. The chapter briefly describes the development and use of (cDNA, BAC, etc.) libraries for mapping and obtaining specific sequence information. Other topics include comparative ...

  2. Recombining overlapping BACs into a single larger BAC

    PubMed Central

    Kotzamanis, George; Huxley, Clare

    2004-01-01

    Background BAC clones containing entire mammalian genes including all the transcribed region and long range controlling elements are very useful for functional analysis. Sequenced BACs are available for most of the human and mouse genomes and in many cases these contain intact genes. However, large genes often span more than one BAC, and single BACs covering the entire region of interest are not available. Here we describe a system for linking two or more overlapping BACs into a single clone by homologous recombination. Results The method was used to link a 61-kb insert carrying the final 5 exons of the human CFTR gene onto a 160-kb BAC carrying the first 22 exons. Two rounds of homologous recombination were carried out in the EL350 strain of bacteria which can be induced for the Red genes. In the first round, the inserts of the two overlapping BACs were subcloned into modified BAC vectors using homologous recombination. In the second round, the BAC to be added was linearised with the very rare-cutting enzyme I-PpoI and electroporated into recombination efficient EL350 bacteria carrying the other BAC. Recombined BACs were identified by antibiotic selection and PCR screening and 10% of clones contained the correctly recombined 220-kb BAC. Conclusion The system can be used to link the inserts from any overlapping BAC or PAC clones. The original orientation of the inserts is not important and desired regions of the inserts can be selected. The size limit for the fragments recombined may be larger than the 61 kb used here and multiple BACs in a contig could be combined by alternating use of the two pBACLink vectors. This system should be of use to many investigators wishing to carry out functional analysis on large mammalian genes which are not available in single BAC clones. PMID:14709179

  3. A new implementation of high-throughput five-dimensional clone pooling strategy for BAC library screening

    Microsoft Academic Search

    Frank M You; Ming-Cheng Luo; Kenong Xu; Karin R Deal; Olin D Anderson; Jan Dvorak

    2010-01-01

    BACKGROUND: A five-dimensional (5-D) clone pooling strategy for screening of bacterial artificial chromosome (BAC) clones with molecular markers utilizing highly-parallel Illumina GoldenGate assays and PCR facilitates high-throughput BAC clone and BAC contig anchoring on a genetic map. However, this strategy occasionally needs manual PCR to deconvolute pools and identify truly positive clones. RESULTS: A new implementation is reported here for

  4. Mapping the chromosomes of Poncirus trifoliata Raf. by BAC-FISH.

    PubMed

    Moraes, A P; Mirkov, T E; Guerra, M

    2008-01-01

    In spite of the importance of Citrus in agriculture and recent progress in genetic mapping and cytogenetics of this group, chromosome mapping of Citrus species is still limited to rDNA probes. In order to obtain a better chromosome characterization of one species from this group, CMA/DAPI double staining followed by in situ hybridization using 45S rDNA and 24 BACs (BAC-FISH) were used on Poncirus trifoliata. The BACs used were obtained from a genomic library of this species and were selected by membrane hybridization using genomic DNA. Four of them were isolated from the Citrus tristeza virus (Ctv) resistance gene region. The P. trifoliata karyotype is composed of two chromosome pairs with one terminal and one proximal CMA(+) band (B type chromosomes), four chromosome pairs with a single CMA(+) band (D type) and three chromosome pairs without bands (F type). In situ hybridization with 13 of the BACs gave single copy signals on seven chromosome pairs. At least one BAC was mapped on each arm of the two B chromosome pairs. Among the four D chromosome pairs, two were identified by BACs mapped on the long arms, one has a 45S rDNA site and the other had no signal. Six BACs allowed identification of the three F chromosome pairs, with one pair hybridizing with four BACs from the Ctv resistance gene region. In summary, all nine chromosome pairs could be differentiated, seven of them by BAC-FISH, while the other two chromosomes could be recognized by the CMA(+) band pattern and 45S rDNA sites. This first BAC-FISH map gives a general framework for comparative genome structure and evolutionary studies in Citrus and Poncirus, allowing the integration of genetic and physical maps when these BACs are included. PMID:18758171

  5. Making BAC transgene constructs with lambda-red recombineering system for transgenic animals or cell lines.

    PubMed

    Holmes, Scott; Lyman, Suzanne; Hsu, Jen-Kang; Cheng, JrGang

    2015-01-01

    The genomic DNA libraries based on Bacteria Artificial Chromosomes (BAC) are the foundation of whole genomic mapping, sequencing, and annotation for many species like mice and humans. With their large insert size, BACs harbor the gene-of-interest and nearby transcriptional regulatory elements necessary to direct the expression of the gene-of-interest in a temporal and cell-type specific manner. When replacing a gene-of-interest with a transgene in vivo, the transgene can be expressed with the same patterns and machinery as that of the endogenous gene. This chapter describes in detail a method of using lambda-red recombineering to make BAC transgene constructs with the integration of a transgene into a designated location within a BAC. As the final BAC construct will be used for transfection in cell lines or making transgenic animals, specific considerations with BAC transgenes such as genotyping, BAC coverage and integrity as well as quality of BAC DNA will be addressed. Not only does this approach provide a practical and effective way to modify large DNA constructs, the same recombineering principles can apply to smaller high copy plasmids as well as to chromosome engineering. PMID:25239742

  6. piggyBac

    PubMed Central

    Lok, James

    2013-01-01

    In addition to their natural role in eukaryotic genome evolution, transposons can be powerful tools for functional genomics in diverse taxa. The piggyBac transposon has been applied as such in eukaryotic parasites, both protozoa and helminths, and in several important vector mosquitoes. piggyBac is advantageous for functional genomics because of its ability to transduce a wide range of taxa, its capacity to integrate large DNA ‘cargoes’ relative to other mobile genetic elements, its propensity to target transcriptional units and its ability to re-mobilize without leaving a pattern of non-excised sequences or ‘footprint’ in the genome. We recently demonstrated that piggyBac can integrate transgenes into the genome of the parasitic nematode Strongyloides ratti, an important model for parasitic nematode biology and a close relative of the significant human pathogen S. stercoralis. Unlike transgenes encoded in conventional plasmid vectors, which we assume are assembled into multi-copy episomal arrays as they are in Caenorhabditis elegans, transgenes integrated via piggyBac are not only stably inherited in S. ratti, they are also continuously expressed. This has allowed derivation of the first stable transgene expressing lines in any parasitic nematode, a significant advance in the development of functional genomic tools for these important pathogens. PMID:23914309

  7. Metagenomic analysis of Candidatus Liberibacter asiaticus in naturally populated psyllids (Diaphorina citri) using BAC libraries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Candidatus Liberibacter asiaticus (Las) is the most prevalent species of three species of Ca. Liberibacter causing citrus huanglongbing (HLB) in the world. The Las genome sequence published in 2009 was obtained from a single Las-infected psyllid using metagenomic approach. Studies of genetic divers...

  8. Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

    PubMed Central

    Saini, Navinder; Shultz, Jeffry; Lightfoot, David A

    2008-01-01

    Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max) genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS). Here the aim was to use BAC end sequences (BES) derived from three minimum tile paths (MTP) to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs) were single nucleotide polymorphisms (SNPs; 89%) and single nucleotide indels (SNIs 10%). Larger indels were rare but present (1%). Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de-convolution and positioning of sequence scaffolds (see BES_scaffolds section of SoyGD). This approach will assist genome annotation for paleopolyploid and true polyploid genomes such as soybean and many important cereal and fruit crops. PMID:18606011

  9. CONSTRUCTION OF CONTIGS OF AEGILOPS TAUSCHII GENOMIC DNA FRAGMENTS CLONED IN BAC AND BIBAC VECTORS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A high-throughput, fully automated, multi-color fluorescent fingerprinting technique for large-insert genomic DNA clones was developed. The technique was used to fingerprint 200,000 genomic DNA fragments of Aegilops tauschii line genetically closely related to the D genome of Chinese Spring wheat. T...

  10. Dissecting large and complex genomes: flow sorting and BAC cloning of individual chromosomes from bread wheat

    Microsoft Academic Search

    Jan Šafá?; Jan Bartoš; Jaroslav Janda; Arnaud Bellec; Marie Kubalakova ´; Miroslav Valárik; Stéphanie Pateyron; Jitka Weiserova ´; Radka Tuskova ´; Jarmila ?íhalíková; Jan Vrána; Hana Šimková; Patricia Faivre-Rampant; Pierre Sourdille; Michel Caboche; Michel Bernard; Jaroslav Doležel; Boulos Chalhoub

    2004-01-01

    Summary The analysis of the complex genome of common wheat (Triticum aestivum ,2 n ¼ 6x ¼ 42, genome formula AABBDD) is hampered by its large size (? 17 000 Mbp) and allohexaploid nature. In order to simplify its analysis, we developed a generic strategy for dissecting such large and complex genomes into individual chromosomes. Chromosome 3B was successfully sorted

  11. A BAC-based physical map of the Hessian fly genome anchored to polytene chromosomes

    Microsoft Academic Search

    Rajat Aggarwal; Thiago R Benatti; Navdeep Gill; Chaoyang Zhao; Ming-Shun Chen; John P Fellers; Brandon J Schemerhorn; Jeff J Stuart

    2009-01-01

    BACKGROUND: The Hessian fly (Mayetiola destructor) is an important insect pest of wheat. It has tractable genetics, polytene chromosomes, and a small genome (158 Mb). Investigation of the Hessian fly presents excellent opportunities to study plant-insect interactions and the molecular mechanisms underlying genome imprinting and chromosome elimination. A physical map is needed to improve the ability to perform both positional

  12. Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

    Microsoft Academic Search

    Inês C. Conceição; Anthony D. Long; Jonathan D. Gruber; Patrícia Beldade

    2011-01-01

    BackgroundAnalysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available

  13. Genome-wide target profiling of piggyBac and Tol2 in HEK 293: pros and cons for gene discovery and gene therapy

    Microsoft Academic Search

    Yaa-Jyuhn J Meir; Matthew T Weirauch; Herng-Shing Yang; Pei-Cheng Chung; Robert K Yu; Sareina C-Y Wu

    2011-01-01

    Background  DNA transposons have emerged as indispensible tools for manipulating vertebrate genomes with applications ranging from insertional\\u000a mutagenesis and transgenesis to gene therapy. To fully explore the potential of two highly active DNA transposons, piggyBac and Tol2, as mammalian genetic tools, we have conducted a side-by-side comparison of the two transposon systems in the same setting\\u000a to evaluate their advantages and

  14. Chromosome region-specific libraries for human genome analysis. Final progress report, 1 March 1991--28 February 1994

    SciTech Connect

    Kao, F.T.

    1994-04-01

    The objectives of this grant proposal include (1) development of a chromosome microdissection and PCR-mediated microcloning technology, (2) application of this microtechnology to the construction of region-specific libraries for human genome analysis. During this grant period, the authors have successfully developed this microtechnology and have applied it to the construction of microdissection libraries for the following chromosome regions: a whole chromosome 21 (21E), 2 region-specific libraries for the long arm of chromosome 2, 2q35-q37 (2Q1) and 2q33-q35 (2Q2), and 4 region-specific libraries for the entire short arm of chromosome 2, 2p23-p25 (2P1), 2p21-p23 (2P2), 2p14-p16 (wP3) and 2p11-p13 (2P4). In addition, 20--40 unique sequence microclones have been isolated and characterized for genomic studies. These region-specific libraries and the single-copy microclones from the library have been used as valuable resources for (1) isolating microsatellite probes in linkage analysis to further refine the disease locus; (2) isolating corresponding clones with large inserts, e.g. YAC, BAC, P1, cosmid and phage, to facilitate construction of contigs for high resolution physical mapping; and (3) isolating region-specific cDNA clones for use as candidate genes. These libraries are being deposited in the American Type Culture Collection (ATCC) for general distribution.

  15. GENOMIC TECHNOLOGIES FACILITY: Custom Library Preparation USER/BILLING AGREEMENT

    E-print Network

    Wurtele, Eve Syrkin

    GENOMIC TECHNOLOGIES FACILITY: Custom Library Preparation USER/BILLING AGREEMENT FOR ON-CAMPUS USERS Please fill out completely, and email, fax or mail to: Genomic Technologies Facility Manager 2025 Roy J. Carver Co-Laboratory Center for Plant Genomics Iowa State University Ames, Iowa 50011-3650 515

  16. GENOMIC TECHNOLOGIES FACILITY: Custom Library Preparation USER/BILLING AGREEMENT

    E-print Network

    Wurtele, Eve Syrkin

    GENOMIC TECHNOLOGIES FACILITY: Custom Library Preparation USER/BILLING AGREEMENT FOR OFF-CAMPUS USERS Please fill out completely, and email, fax or mail to: Genomic Technologies Facility Manager 2025 Roy J. Carver Co-Laboratory Center for Plant Genomics Iowa State University Ames, Iowa 50011-3650 515

  17. A first generation BAC-based physical map of the rainbow trout genome

    Microsoft Academic Search

    Yniv Palti; Ming-Cheng Luo; Yuqin Hu; Carine Genet; Frank M You; Roger L Vallejo; Gary H Thorgaard; Paul A Wheeler; Caird E Rexroad

    2009-01-01

    BACKGROUND: Rainbow trout (Oncorhynchus mykiss) are the most-widely cultivated cold freshwater fish in the world and an important model species for many research areas. Coupling great interest in this species as a research model with the need for genetic improvement of aquaculture production efficiency traits justifies the continued development of genomics research resources. Many quantitative trait loci (QTL) have been

  18. Complete Genomic Sequence and an Infectious BAC Clone of Feline Herpesvirus-1 (FHV-1)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Feline herpesvirus type 1 (FHV-1) is classified under the genus Varicellovirus within the Alphaherpesvirinae subfamily, and is a major cause of upper respiratory infection in cats. In this report, we present the first complete genomic sequence of FHV-1, as well as a bacterial artificial chromosome (...

  19. A first generation BAC-based physical map of the channel catfish genome

    Microsoft Academic Search

    Sylvie M-A Quiniou; Geoffrey C Waldbieser; Mary V Duke

    2007-01-01

    BACKGROUND: Channel catfish, Ictalurus punctatus, is the leading species in North American aquaculture. Genetic improvement of catfish is performed through selective breeding, and genomic tools will help improve selection efficiency. A physical map is needed to integrate the genetic map with the karyotype and to support fine mapping of phenotypic trait alleles such as Quantitative Trait Loci (QTL) and the

  20. High-Resolution BAC-Based Map of the Central Portion of Mouse Chromosome 5

    PubMed Central

    Crabtree, Jonathan; Wiltshire, Tim; Brunk, Brian; Zhao, Shaying; Schug, Jonathan; Stoeckert, Christian J.; Bucan, Maja

    2001-01-01

    The current strategy for sequencing the mouse genome involves the combination of a whole-genome shotgun approach with clone-based sequencing. High-resolution physical maps will provide a foundation for assembling contiguous segments of sequence. We have established a bacterial artificial chromosome (BAC)-based map of a 5-Mb region on mouse Chromosome 5, encompassing three gene families: receptor tyrosine kinases (PdgfraKit-Kdr), nonreceptor protein-tyrosine type kinases (Tec–Txk), and type-A receptors for the neurotransmitter GABA (Gabra2, Gabrb1, Gabrg1, and Gabra4). The construction of a BAC contig was initiated by hybridization screening the C57BL/6J (RPCI-23) BAC library, using known genes and sequence tagged sites (STSs). Additional overlapping clones were identified by searching the database of available restriction fingerprints for the RPCI-23 and RPCI-24 libraries. This effort resulted in the selection of >600 BAC clones, 251 kb of BAC-end sequences, and the placement of 40 known and/or predicted genes within this 5-Mb region. We use this high-resolution map to illustrate the integration of the BAC fingerprint map with a radiation-hybrid map via assembled expressed sequence tags (ESTs). From annotation of three representative BAC clones we demonstrate that up to 98% of the draft sequence for each contig could be ordered and oriented using known genes, BAC ends, consensus sequences for transcript assemblies, and comparisons with orthologous human sequence. For functional studies, annotation of sequence fragments as they are assembled into 50–200-kb stretches will be remarkably valuable. PMID:11591652

  1. Serial assembly of Thermus megaplasmid DNA in the genome of Bacillus subtilis 168: a BAC-based domino method applied to DNA with a high GC content.

    PubMed

    Ohtani, Naoto; Hasegawa, Miki; Sato, Mitsuru; Tomita, Masaru; Kaneko, Shinya; Itaya, Mitsuhiro

    2012-07-01

    Bacillus subtilis is the only bacterium-based host able to clone giant DNA above 1000 kbp. DNA previously handled by this host was limited to that with GC content similar to or lower than that of the B. subtilis genome. To expand the target DNA range to higher GC content, we tried to clone a pTT27 megaplasmid (257 kbp, 69% of G+C) from Thermus thermophilus. To facilitate the reconstruction process, we subcloned pTT27 in a bacterial artificial chromosome (BAC) vector of Escherichia coli. Owing to the ability of BAC to carry around 100 kbp DNA, only 4 clones were needed to cover the pTT27 and conduct step-by-step assembly in the B. subtilis genome. The full length of 257 kbp was reconstructed through 3 intermediary lengths (108, 153, and 226 kbp), despite an unexpected difficulty in the maintenance of DNA >200 kbp. Retrieval of these four pTT27 segments from the B. subtilis genome by genetic transfer to a plasmid pLS20 was attempted. A stable plasmid clone was obtained only for the 108 and 153 kbp intermediates. The B. subtilis genome was demonstrated to accommodate large DNA with a high GC content, but may be restricted to less than 200 kbp by unidentified mechanisms. PMID:22553167

  2. Characterization of novel and complex genomic aberrations in glioblastoma using a 32K BAC array

    PubMed Central

    Nord, Helena; Hartmann, Christian; Andersson, Robin; Menzel, Uwe; Pfeifer, Susan; Piotrowski, Arkadiusz; Bogdan, Adam; Kloc, Wojciech; Sandgren, Johanna; Olofsson, Tommie; Hesselager, Göran; Blomquist, Erik; Komorowski, Jan; von Deimling, Andreas; Bruder, Carl E.G.; Dumanski, Jan P.; de Ståhl, Teresita Díaz

    2009-01-01

    Glioblastomas (GBs) are malignant CNS tumors often associated with devastating symptoms. Patients with GB have a very poor prognosis, and despite treatment, most of them die within 12 months from diagnosis. Several pathways, such as the RAS, tumor protein 53 (TP53), and phosphoinositide kinase 3 (PIK3) pathways, as well as the cell cycle control pathway, have been identified to be disrupted in this tumor. However, emerging data suggest that these aberrations represent only a fraction of the genetic changes involved in gliomagenesis. In this study, we have applied a 32K clone-based genomic array, covering 99% of the current assembly of the human genome, to the detailed genetic profiling of a set of 78 GBs. Complex patterns of aberrations, including high and narrow copy number amplicons, as well as a number of homozygously deleted loci, were identified. Amplicons that varied both in number (three on average) and in size (1.4 Mb on average) were frequently detected (81% of the samples). The loci encompassed not only previously reported oncogenes (EGFR, PDGFRA, MDM2, and CDK4) but also numerous novel oncogenes as GRB10, MKLN1, PPARGC1A, HGF, NAV3, CNTN1, SYT1, and ADAMTSL3. BNC2, PTPLAD2, and PTPRE, on the other hand, represent novel candidate tumor suppressor genes encompassed within homozygously deleted loci. Many of these genes are already linked to several forms of cancer; others represent new candidate genes that may serve as prognostic markers or even as therapeutic targets in the future. The large individual variation observed between the samples demonstrates the underlying complexity of the disease and strengthens the demand for an individualized therapy based on the genetic profile of the patient. PMID:19304958

  3. TECHNIQUE FOR SCREENING AND MAINTAINING SMALLER GENOMIC LIBRARIES

    EPA Science Inventory

    A technique for screening and simultaneously maintaining individual clones of the gene library for long-term storage is described. his method is particularly useful for identification and cloning of genes from cosmid-based genomic libraries of prokaryotes that constitute a smalle...

  4. Adaptation of a commercial robot for genome library replication

    SciTech Connect

    Uber, D.C.; Searles, W.L.

    1994-01-01

    This report describes tools and fixtures developed at the Human Genome Center at Lawrence Berkeley Laboratory for the Hewlett-Packard ORCA{trademark} (Optimized Robot for Chemical Analysis) to replicate large genome libraries. Photographs and engineering drawings of the various custom-designed components are included.

  5. Directing enhancer-traps and iTol2 end-sequences to deleted BAC ends with loxP- and lox511-Tn10 transposons.

    PubMed

    Chatterjee, Pradeep K

    2015-01-01

    A step-by-step detailed procedure is presented to progressively truncate genomic DNA inserts from either end in BACs. The bacterial transposon Tn10 carrying a loxP or a lox511 site is inserted at random into BAC DNA inside the bacterial cell. The cells are then infected with bacteriophage P1. The Cre protein expressed by phage P1 generates end-deletions by specifically recombining the inserted loxP (or lox511) with the loxP (or lox511) endogenous to and flanking insert DNA in BACs from the respective end. The Cre protein also helps phage P1 transduce the BAC DNA by packaging it in P1 heads. This packaging by P1 not only recovers the rare BAC clones containing Tn10 insertions efficiently but also selects end-truncated BACs from those containing inversions of portions of their DNA caused by transposition of Tn10 in the opposite orientation. The libraries of end-deleted BACs generated by this procedure are suitable for numerous mapping studies. Because DNA in front of the loxP (or lox511) arrowheads in the Tn10 transposon is retained at the newly created BAC end, exogenous DNA cassettes such as enhancer-traps and iTol2 ends can be efficiently introduced into BAC ends for germline expression in zebrafish or mice. The methodology should facilitate functional mapping studies of long-range cis-acting gene regulatory sequences in these organisms. PMID:25239743

  6. BAC-End Microsatellites from Intra and Inter-Genic Regions of the Common Bean Genome and Their Correlation with Cytogenetic Features

    PubMed Central

    Blair, Matthew Wohlgemuth; Córdoba, Juana Marcela; Muñóz, Claritza; Yuyó, Deissy K.

    2014-01-01

    Highly polymorphic markers such as simple sequence repeats (SSRs) or microsatellites are very useful for genetic mapping. In this study novel SSRs were identified in BAC-end sequences (BES) from non-contigged, non-overlapping bacterial artificial clones (BACs) in common bean (Phaseolus vulgaris L.). These so called “singleton” BACs were from the G19833 Andean gene pool physical map and the new BES-SSR markers were used for the saturation of the inter-gene pool, DOR364×G19833 genetic map. A total of 899 SSR loci were found among the singleton BES, but only 346 loci corresponded to the single di- or tri-nucleotide motifs that were likely to be polymorphic (ATT or AG motifs, principally) and useful for primer design and individual marker mapping. When these novel SSR markers were evaluated in the DOR364×G19833 population parents, 136 markers revealed polymorphism and 106 were mapped. Genetic mapping resulted in a map length of 2291 cM with an average distance between markers of 5.2 cM. The new genetic map was compared to the most recent cytogenetic analysis of common bean chromosomes. We found that the new singleton BES-SSR were helpful in filling peri-centromeric spaces on the cytogenetic map. Short genetic distances between some new singleton-derived BES-SSR markers was common showing suppressed recombination in these regions compared to other parts of the genome. The correlation of singleton-derived SSR marker distribution with other cytogenetic features of the bean genome is discussed. PMID:25254501

  7. Screening of an E. coli O157:H7 Bacterial Artificial Chromosome Library by Comparative Genomic Hybridization to Identify Genomic Regions Contributing to Growth in Bovine Gastrointestinal Mucus and Epithelial Cell Colonization

    PubMed Central

    Bai, Jianing; McAteer, Sean P.; Paxton, Edith; Mahajan, Arvind; Gally, David L.; Tree, Jai J.

    2011-01-01

    Enterohemorrhagic E. coli (EHEC) O157:H7 can cause serious gastrointestinal and systemic disease in humans following direct or indirect exposure to ruminant feces containing the bacterium. The main colonization site of EHEC O157:H7 in cattle is the terminal rectum where the bacteria intimately attach to the epithelium and multiply in the intestinal mucus. This study aimed to identify genomic regions of EHEC O157:H7 that contribute to colonization and multiplication at this site. A bacterial artificial chromosome (BAC) library was generated from a derivative of the sequenced E. coli O157:H7 Sakai strain. The library contains 1152 clones averaging 150?kbp. To verify the library, clones containing a complete locus of enterocyte effacement (LEE) were identified by DNA hybridization. In line with a previous report, these did not confer a type III secretion (T3S) capacity to the K-12 host strain. However, conjugation of one of the BAC clones into a strain containing a partial LEE deletion restored T3S. Three hundred eighty-four clones from the library were subjected to two different selective screens; one involved three rounds of adherence assays to bovine primary rectal epithelial cells while the other competed the clones over three rounds of growth in bovine rectal mucus. The input strain DNA was then compared with the selected strains using comparative genomic hybridization (CGH) on an E. coli microarray. The adherence assay enriched for pO157 DNA indicating the importance of this plasmid for colonization of rectal epithelial cells. The mucus assay enriched for multiple regions involved in carbohydrate utilization, including hexuronate uptake, indicating that these regions provide a competitive growth advantage in bovine mucus. This BAC-CGH approach provides a positive selection screen that complements negative selection transposon-based screens. As demonstrated, this may be of particular use for identifying genes with redundant functions such as adhesion and carbon metabolism. PMID:21887152

  8. Python Materials Genomics (pymatgen): A robust, open-source python library for materials analysis

    E-print Network

    Ceder, Gerbrand

    Python Materials Genomics (pymatgen): A robust, open-source python library for materials analysis-throughput a b s t r a c t We present the Python Materials Genomics (pymatgen) library, a robust, open

  9. Transposon-mediated BAC transgenesis in zebrafish and mice

    PubMed Central

    Suster, Maximiliano L; Sumiyama, Kenta; Kawakami, Koichi

    2009-01-01

    Background Bacterial artificial chromosomes (BACs) are among the most widely used tools for studies of gene regulation and function in model vertebrates, yet methods for predictable delivery of BAC transgenes to the genome are currently limited. This is because BAC transgenes are usually microinjected as naked DNA into fertilized eggs and are known to integrate as multi-copy concatamers in the genome. Although conventional methods for BAC transgenesis have been very fruitful, complementary methods for generating single copy BAC integrations would be desirable for many applications. Results We took advantage of the precise cut-and-paste behavior of a natural transposon, Tol2, to develop a new method for BAC transgenesis. In this new method, the minimal sequences of the Tol2 transposon were used to deliver precisely single copies of a ~70 kb BAC transgene to the zebrafish and mouse genomes. We mapped the BAC insertion sites in the genome by standard PCR methods and confirmed transposase-mediated integrations. Conclusion The Tol2 transposon has a surprisingly large cargo capacity that can be harnessed for BAC transgenesis. The precise delivery of single-copy BAC transgenes by Tol2 represents a useful complement to conventional BAC transgenesis, and could aid greatly in the production of transgenic fish and mice for genomics projects, especially those in which single-copy integrations are desired. PMID:19832998

  10. Construction of a 1.2Mb BAC\\/PAC Contig of the Porcine Gene RYR1 Region on SSC 6q1.2 and Comparative Analysis with HSA 19q13.13

    Microsoft Academic Search

    Flávia Martins-Wess; Rodja Voß-Nemitz; Cord Drögemüller; Bertram Brenig; Tosso Leeb

    2002-01-01

    We screened a porcine bacterial artificial chromosome (BAC) and a P1 derived artificial chromosome (PAC) library to construct a sequence-ready ? 1.2-Mb BAC\\/PAC contig of the ryanodine receptor-1 gene (RYR1) region on porcine chromosome (SSC) 6q1.2. This genomic segment is of special interest because it harbors the locus for stress susceptibility in pigs and a putative quantitative trait locus for

  11. Libraries of Large-Insert Genomic Clones as a Tool for Molecular Cytogenetic Analysis of Avian Genome

    Microsoft Academic Search

    A. A. Sazanov; M. N. Romanov; A. F. Smirnov

    2005-01-01

    Integration of molecular and cytegenetic levels of investigation results in complex understanding of structural and functional genome organization. Gridded libraries of large-insert genomic clones represent a powerful tool of the genome analysis. Their utilization provides coordination of data on molecular organization of nucleic acids with cytogenetic data on the chromosome structure. These libraries played an important role in sequencing of

  12. Multiplexed direct genomic selection (MDiGS): a pooled BAC capture approach for highly accurate CNV and SNP/INDEL detection

    PubMed Central

    Alvarado, David M.; Yang, Ping; Druley, Todd E.; Lovett, Michael; Gurnett, Christina A.

    2014-01-01

    Despite declining sequencing costs, few methods are available for cost-effective single-nucleotide polymorphism (SNP), insertion/deletion (INDEL) and copy number variation (CNV) discovery in a single assay. Commercially available methods require a high investment to a specific region and are only cost-effective for large samples. Here, we introduce a novel, flexible approach for multiplexed targeted sequencing and CNV analysis of large genomic regions called multiplexed direct genomic selection (MDiGS). MDiGS combines biotinylated bacterial artificial chromosome (BAC) capture and multiplexed pooled capture for SNP/INDEL and CNV detection of 96 multiplexed samples on a single MiSeq run. MDiGS is advantageous over other methods for CNV detection because pooled sample capture and hybridization to large contiguous BAC baits reduces sample and probe hybridization variability inherent in other methods. We performed MDiGS capture for three chromosomal regions consisting of ?550 kb of coding and non-coding sequence with DNA from 253 patients with congenital lower limb disorders. PITX1 nonsense and HOXC11 S191F missense mutations were identified that segregate in clubfoot families. Using a novel pooled-capture reference strategy, we identified recurrent chromosome chr17q23.1q23.2 duplications and small HOXC 5? cluster deletions (51 kb and 12 kb). Given the current interest in coding and non-coding variants in human disease, MDiGS fulfills a niche for comprehensive and low-cost evaluation of CNVs, coding, and non-coding variants across candidate regions of interest. PMID:24682816

  13. Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

    PubMed Central

    Paredes, Anne M.; Yu, Dong

    2011-01-01

    Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  14. MultiBac turns sweet

    PubMed Central

    Palmberger, Dieter; Klausberger, Miriam; Berger, Imre; Grabherr, Reingard

    2013-01-01

    The baculovirus/insect cell system has proven to be a powerful tool for the expression of eukaryotic proteins. Therapeutics, especially in the field of vaccinology, are often composed of several different protein subunits. Conventional baculoviral expression schemes largely lack efficient strategies for simultaneous multi-gene expression. The MultiBac technology which is based on an engineered genome of Autographa californica nuclear polyhedrosis virus in combination with specially designed transfer vectors is an elegant way for flexible generation of multi-subunit proteins in insect cells. Yet, the glycosylation pattern of insect cell-derived products is not favorable for many applications. Therefore, a modified version of MultiBac, SweetBac, was generated allowing for a flexible glycosylation of target proteins in insect cells. Beyond the SweetBac technology MultiBac can further be designed for bridging the gap between cell engineering and transient modulation of host genes for improved and product tailored expression of recombinant proteins. PMID:23018636

  15. MultiBac turns sweet.

    PubMed

    Palmberger, Dieter; Klausberger, Miriam; Berger, Imre; Grabherr, Reingard

    2013-01-01

    The baculovirus/insect cell system has proven to be a powerful tool for the expression of eukaryotic proteins. Therapeutics, especially in the field of vaccinology, are often composed of several different protein subunits. Conventional baculoviral expression schemes largely lack efficient strategies for simultaneous multi-gene expression. The MultiBac technology which is based on an engineered genome of Autographa californica nuclear polyhedrosis virus in combination with specially designed transfer vectors is an elegant way for flexible generation of multi-subunit proteins in insect cells. Yet, the glycosylation pattern of insect cell-derived products is not favorable for many applications. Therefore, a modified version of MultiBac, SweetBac, was generated allowing for a flexible glycosylation of target proteins in insect cells. Beyond the SweetBac technology MultiBac can further be designed for bridging the gap between cell engineering and transient modulation of host genes for improved and product tailored expression of recombinant proteins. PMID:23018636

  16. Hyper-expansion of large DNA segments in the genome of kuruma shrimp, Marsupenaeus japonicus

    Microsoft Academic Search

    Takashi Koyama; Shuichi Asakawa; Takayuki Katagiri; Atsushi Shimizu; Fernand F Fagutao; Rapeepat Mavichak; Mudjekeewis D Santos; Kanako Fuji; Takashi Sakamoto; Toshihide Kitakado; Hidehiro Kondo; Nobuyoshi Shimizu; Takashi Aoki; Ikuo Hirono

    2010-01-01

    BACKGROUND: Higher crustaceans (class Malacostraca) represent the most species-rich and morphologically diverse group of non-insect arthropods and many of its members are commercially important. Although the crustacean DNA sequence information is growing exponentially, little is known about the genome organization of Malacostraca. Here, we constructed a bacterial artificial chromosome (BAC) library and performed BAC-end sequencing to provide genomic information for

  17. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    SciTech Connect

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  18. INTEGRATED GENETIC, PHYSICAL, AND COMPARATIVE MAPPING OF THE COTTON GENOME

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Integrated genetic, physical, and comparative maps of the cotton genome are important to cotton functional genomics and other advanced biological studies. We are using the BAC libraries, developed from an Upland cotton genetic standard TM-1, to construct physical contigs and isolate SSR markers tha...

  19. Construction of a contig of BAC clones spanning the region of the apple scab avirulence gene AvrVg.

    PubMed

    Broggini, G A L; Le Cam, B; Parisi, L; Wu, C; Zhang, H-B; Gessler, C; Patocchi, A

    2007-01-01

    The ascomycete Venturia inaequalis, causal pathogen of apple scab, underlies a gene-for-gene relationship with its host plant apple (Malus spp.). 'Golden Delicious', one of the most common cultivated apples in the world, carries the ephemeral resistance gene Vg. Avirulence gene AvrVg, matching resistance gene Vg has recently been mapped on the V. inaequalis genome. In this paper, we present the construction of a BAC library from a V. inaequalis AvrVg isolate. The library is composed of 7680 clones, with an average insert size of 80kb. By hybridization, it has been estimated that the library contains six haploid genome equivalents. Thus the V. inaequalis genome can be predicted to be approximately 100Mb in size. A chromosome walk, starting from the marker VirQ5 co-segregating with AvrVg, has been performed using the BAC library. Twelve BAC clones were identified during four steps of the chromosome walking. The size of the resulting contig is approximately 330kb. PMID:16904351

  20. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1991-01-01

    We have made important progress since the beginning of the current grant year. We have further developed the microdissection and PCR- assisted microcloning techniques using the linker-adaptor method. We have critically evaluated the microdissection libraries constructed by this microtechnology and proved that they are of high quality. We further demonstrated that these microdissection clones are useful in identifying corresponding YAC clones for a thousand-fold expansion of the genomic coverage and for contig construction. We are also improving the technique of cloning the dissected fragments in test tube by the TDT method. We are applying both of these PCR cloning technique to human chromosomes 2 and 5 to construct region-specific libraries for physical mapping purposes of LLNL and LANL. Finally, we are exploring efficient procedures to use unique sequence microclones to isolate cDNA clones from defined chromosomal regions as valuable resources for identifying expressed gene sequences in the human genome. We believe that we are making important progress under the auspices of this DOE human genome program grant and we will continue to make significant contributions in the coming year. 4 refs., 4 figs.

  1. Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas

    PubMed Central

    Mohapatra, Gayatry; Engler, David A.; Starbuck, Kristen D.; Kim, James C.; Bernay, Derek C.; Scangas, George A.; Rousseau, Audrey; Batchelor, Tracy T.; Betensky, Rebecca A.; Louis, David N.

    2010-01-01

    Molecular genetic analysis of cancer is rapidly evolving as a result of improvement in genomic technologies and the growing applicability of such analyses to clinical oncology. Array based comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA), particularly in solid tumors, and has been applied to the study of malignant gliomas. In the clinical setting, however, gliomas are often sampled by small biopsies and thus formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis, especially for rare types of gliomas. Moreover, the biological basis for the marked intratumoral heterogeneity in gliomas is most readily addressed in FFPE material. Therefore, for gliomas, the ability to use DNA from FFPE tissue is essential for both clinical and research applications. In this study, we have constructed a custom bacterial artificial chromosome (BAC) array and show excellent sensitivity and specificity for detecting CNAs in a panel of paired frozen and FFPE glioma samples. Our study demonstrates a high concordance rate between CNAs detected in FFPE compared to frozen DNA. We have also developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. This labeling technique was applied to a panel of biphasic anaplastic oligoastrocytomas (AOA) to identify genetic changes unique to each component. Together, results from these studies suggest that BAC and oligonucleotide aCGH are sensitive tools for detecting CNAs in FFPE DNA, and can enable genome-wide analysis of rare, small and/or histologically heterogeneous gliomas. PMID:21080181

  2. The Neurospora crassa genome: cosmid libraries sorted by chromosome.

    PubMed Central

    Kelkar, H S; Griffith, J; Case, M E; Covert, S F; Hall, R D; Keith, C H; Oliver, J S; Orbach, M J; Sachs, M S; Wagner, J R; Weise, M J; Wunderlich, J K; Arnold, J

    2001-01-01

    A Neurospora crassa cosmid library of 12,000 clones (at least nine genome equivalents) has been created using an improved cosmid vector pLorist6Xh, which contains a bacteriophage lambda origin of replication for low-copy-number replication in bacteria and the hygromycin phosphotransferase marker for direct selection in fungi. The electrophoretic karyotype of the seven chromosomes comprising the 42.9-Mb N. crassa genome was resolved using two translocation strains. Using gel-purified chromosomal DNAs as probes against the new cosmid library and the commonly used medium-copy-number pMOcosX N. crassa cosmid library in two independent screenings, the cosmids were assigned to chromosomes. Assignments of cosmids to linkage groups on the basis of the genetic map vs. the electrophoretic karyotype are 93 +/- 3% concordant. The size of each chromosome-specific subcollection of cosmids was found to be linearly proportional to the size of the particular chromosome. Sequencing of an entire cosmid containing the qa gene cluster indicated a gene density of 1 gene per 4 kbp; by extrapolation, 11,000 genes would be expected to be present in the N. crassa genome. By hybridizing 79 nonoverlapping cosmids with an average insert size of 34 kbp against cDNA arrays, the density of previously characterized expressed sequence tags (ESTs) was found to be slightly <1 per cosmid (i.e., 1 per 40 kbp), and most cosmids, on average, contained an identified N. crassa gene sequence as a starting point for gene identification. PMID:11238388

  3. HIGH DENSITY ESTS BASED BOVINE PHYSICAL MAPS AND THEIR USE TO CONSTRUCT COMPARATIVE MAPS AND INFORM THE BOVINE GENOME SEQUENCE ASSEMBLY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 3000 rad bovine whole genome radiation hybrid panel and bovine BAC libraries have been used to construct an integrated physical map of the bovine genome, which will contribute to the final assembly of the bovine genome sequence. The RH map now contains more than 4000 markers, the majority of whi...

  4. Physical mapping of a large plant genome using global high-information content fingerprinting: a distal region of wheat chromosome 3DS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Physical maps employing libraries of bacterial artificial chromosome (BAC) clones are essential for comparative genomics and sequencing of large and repetitive genomes such as those of wheat. We report the use of the Ae. tauschii, the diploid ancestor of the wheat D genome, for the construction of t...

  5. Physical mapping of a large plant genome using global high-information-content-fingerprinting: the distal region of the wheat ancestor Aegilops tauschii chromosome 3DS.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Physical maps employing libraries of bacterial artificial chromosome (BAC) clones are essential for comparative genomics and sequencing of large and repetitive genomes such as those of the hexaploid bread wheat. The diploid ancestor of wheat genome, Aegilops tauschii, is used as a resource for wheat...

  6. BAC-DERIVED SSR CHROMOSOME LOCATIONS IN COTTON

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial artificial chromosome (BAC) libraries with large DNA inserts have rapidly become the preferred choice for physical mapping. BAC-derived microsatellite or simple sequence repeats (SSRs) markers facilitate integration of physical maps with genetic maps. The objective of this research was to ...

  7. Physical Mapping in a Triplicated Genome: Mapping the Downy Mildew Resistance Locus Pp523 in Brassica oleracea L.

    PubMed Central

    Carlier, Jorge D.; Alabaça, Claudia S.; Sousa, Nelson H.; Coelho, Paula S.; Monteiro, António A.; Paterson, Andrew H.; Leitão, José M.

    2011-01-01

    We describe the construction of a BAC contig and identification of a minimal tiling path that encompass the dominant and monogenically inherited downy mildew resistance locus Pp523 of Brassica oleracea L. The selection of BAC clones for construction of the physical map was carried out by screening gridded BAC libraries with DNA overgo probes derived from both genetically mapped DNA markers flanking the locus of interest and BAC-end sequences that align to Arabidopsis thaliana sequences within the previously identified syntenic region. The selected BAC clones consistently mapped to three different genomic regions of B. oleracea. Although 83 BAC clones were accurately mapped within a ?4.6 cM region surrounding the downy mildew resistance locus Pp523, a subset of 33 BAC clones mapped to another region on chromosome C8 that was ?60 cM away from the resistance gene, and a subset of 63 BAC clones mapped to chromosome C5. These results reflect the triplication of the Brassica genomes since their divergence from a common ancestor shared with A. thaliana, and they are consonant with recent analyses of the C genome of Brassica napus. The assembly of a minimal tiling path constituted by 13 (BoT01) BAC clones that span the Pp523 locus sets the stage for map-based cloning of this resistance gene. PMID:22384370

  8. Random sheared fosmid library as a new genomic tool to accelerate complete finishing of rice ( Oryza sativa spp. Nipponbare) genome sequence: sequencing of gap-specific fosmid clones uncovers new euchromatic portions of the genome

    Microsoft Academic Search

    Jetty S. S. Ammiraju; Yeisoo Yu; Meizhong Luo; Dave Kudrna; HyeRan Kim; Jose L. Goicoechea; Yuichi Katayose; Takashi Matsumoto; Jianzhong Wu; Takuji Sasaki; Rod A. Wing

    2005-01-01

    The International Rice Genome Sequencing Project has recently announced the high-quality finished sequence that covers nearly\\u000a 95% of the japonica rice genome representing 370 Mbp. Nevertheless, the current physical map of japonica rice contains 62 physical gaps corresponding to approximately 5% of the genome, that have not been identified\\/represented\\u000a in the comprehensive array of publicly available BAC, PAC and other genomic

  9. SSW Library: An SIMD Smith-Waterman C/C++ Library for Use in Genomic Applications

    PubMed Central

    Zhao, Mengyao; Lee, Wan-Ping; Garrison, Erik P.; Marth, Gabor T.

    2013-01-01

    Background The Smith-Waterman algorithm, which produces the optimal pairwise alignment between two sequences, is frequently used as a key component of fast heuristic read mapping and variation detection tools for next-generation sequencing data. Though various fast Smith-Waterman implementations are developed, they are either designed as monolithic protein database searching tools, which do not return detailed alignment, or are embedded into other tools. These issues make reusing these efficient Smith-Waterman implementations impractical. Results To facilitate easy integration of the fast Single-Instruction-Multiple-Data Smith-Waterman algorithm into third-party software, we wrote a C/C++ library, which extends Farrar’s Striped Smith-Waterman (SSW) to return alignment information in addition to the optimal Smith-Waterman score. In this library we developed a new method to generate the full optimal alignment results and a suboptimal score in linear space at little cost of efficiency. This improvement makes the fast Single-Instruction-Multiple-Data Smith-Waterman become really useful in genomic applications. SSW is available both as a C/C++ software library, as well as a stand-alone alignment tool at: https://github.com/mengyao/Complete-Striped-Smith-Waterman-Library. Conclusions The SSW library has been used in the primary read mapping tool MOSAIK, the split-read mapping program SCISSORS, the MEI detector TANGRAM, and the read-overlap graph generation program RZMBLR. The speeds of the mentioned software are improved significantly by replacing their ordinary Smith-Waterman or banded Smith-Waterman module with the SSW Library. PMID:24324759

  10. Genome-scale loss-of-function screening with a lentiviral RNAi library

    E-print Network

    Sabatini, David M.

    Genome-scale loss-of-function screening with a lentiviral RNAi library David E Root1, Nir Hacohen1 (RNAi) is functional in mammalian cells led us to form The RNAi Consortium (TRC) with the goal of enabling large-scale loss-of-function screens through the development of genome-scale RNAi libraries

  11. BAC-FISH in wheat identifies chromosome landmarks consisting of different types of transposable elements

    Microsoft Academic Search

    Peng Zhang; Wanlong Li; John Fellers; Bernd Friebe; Bikram S. Gill

    2004-01-01

    Fluorescence in situ hybridization (FISH) has been widely used in the physical mapping of genes and chromosome landmarks in plants and animals. Bacterial artificial chromosomes (BACs) contain large inserts making them amenable for FISH mapping. We used BAC-FISH to study genome organization and evolution in hexaploid wheat and its relatives. We selected 56 restriction fragment length polymorphism (RFLP) locus-specific BAC

  12. BAC transgenic mice and the GENSAT database of engineered mouse strains.

    PubMed

    Schmidt, Eric F; Kus, Laura; Gong, Shiaoching; Heintz, Nathaniel

    2013-03-01

    The brain is a complex tissue comprising hundreds of distinct cell types, each of which has unique circuitry and plays a discrete role in nervous system function. Large-scale studies mapping gene-expression patterns throughout the nervous system have revealed that many genes are exclusively expressed in specific cell populations. The GENSAT (Gene Expression Nervous System Atlas) Project created a library of engineered mice utilizing bacterial artificial chromosomes (BACs) to drive the expression of enhanced green fluorescent protein (eGFP) in genetically defined cell populations. BACs contain large segments of genomic DNA and retain most of the transcriptional regulatory elements directing the expression of a given gene, resulting in more faithful reproduction of endogenous expression patterns. BAC transgenic mice offer a robust solution to the challenging task of stably and reproducibly accessing specific cell types from a heterogeneous tissue such as the brain. A significant advantage of utilizing eGFP as a reporter is the fact that it can fill entire cells, including neuronal dendrites and axons as well as glial processes, making GENSAT reporter mice a powerful tool for neuroimaging studies. This article provides a primer on the generation of BAC transgenic mice and advantages for their use in labeling genetically defined cell types. It also provides an overview of searching the GENSAT database and ordering engineered mouse lines. PMID:23457350

  13. Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

    SciTech Connect

    Nierman, William C.

    2000-02-14

    At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phred Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.

  14. Rapid BAC selection for tol2-mediated transgenesis in zebrafish.

    PubMed

    Bussmann, Jeroen; Schulte-Merker, Stefan

    2011-10-01

    The generation of zebrafish transgenic lines that express specific fluorophores in a cell- or tissue-specific manner is an important technique that takes full advantage of the optical clarity of the embryo. Identifying promoter fragments that faithfully recapitulate endogenous expression patterns and levels is often difficult and using large genomic DNA fragments, such as bacterial artificial chromosomes (BACs), makes the process of transgenesis less reliable. Here we provide a detailed protocol that allows for BAC selection and subsequent rapid modification through recombineering in Escherichia coli, resulting in BACs that can be injected into zebrafish embryos and, aided by tol2-mediated transgenesis, reliably yield stable transgenic lines. A number of BACs can be prepared in parallel, and injection of the BACs containing CFP/YFP/RFP or Gal4 cassettes allows for immediate testing of whether a particular BAC will yield the desired result. Furthermore, since injected embryos often show widespread expression, recombineered BACs provide an alternative to two-color in situ hybridizations: BACs injected into embryos of a different transgenic reporter line thus enable in vivo colocalization studies. Using this protocol, we have generated 66 stable lines for 23 different genes, with an average transgenesis rate above 10%. Importantly, we provide evidence that BAC size shows no apparent correlation to the transgenesis rate achieved and that there are no severe position effects. PMID:21865323

  15. A second generation integrated map of the rainbow trout (Oncorhynchus mykiss) genome: analysis of synteny with model fish genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this paper we generated DNA fingerprints and end sequences from bacterial artificial chromosomes (BACs) from two new libraries to improve the first generation integrated physical and genetic map of the rainbow trout (Oncorhynchus mykiss) genome. The current version of the physical map is compose...

  16. The construction and characterization of three genomic libraries of trichoderma virens strain Tv29-8 

    E-print Network

    Grzegorski, Darlene

    2001-01-01

    partially digested with Mbo I and cloned into LambdaGem11®. Three ligation conditions yielded titers ranging from 10? to 10? plaques per packaging extract. The cosmid library was constructed with genomic DNA partially digested with Mbo I...

  17. Size-selected genomic libraries: the distribution and size-fractionation of restricted genomic DNA fragments by gel electrophoresis.

    PubMed

    Gondo, Y

    1995-02-01

    By using one-dimensional genome scanning, it is possible to directly identify the restricted genomic DNA fragment that reflects the site of genetic change. The subsequent strategies to obtain the molecular clones of the corresponding restriction fragment are usually as follows: (i) the restriction of a mass quantity of an appropriate genomic DNA, (ii) the size-fractionation of the restricted DNA on a preparative electrophoresis gel in order to enrich the corresponding restriction fragment, (iii) the construction of the size-selected libraries from the fractionated genomic DNA, and (iv) the screening of the library to obtain an objective clone which is identified on the analytical genome scanning gel. A knowledge of the size distribution pattern of restriction fragments of the genomic DNA makes it possible to calculate the heterogeneity or complexity of the restriction fragment in each size-fraction. This manuscript first describes the distribution of the restriction fragments with respect to their length. Some examples of the practical application of this theory to genome scanning is then discussed using presumptive genome scanning gels. The way to calculate such DNA complexities in the prepared size-fractionated samples is also demonstrated. Such information should greatly facilitate the design of experimental strategies for the cloning of a certain size of genomic DNA after digestion with restriction enzyme(s) as is the case with genome scanning. PMID:7774556

  18. Separation of homologous BAC contigs in the tetraploid Upland cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Upland cotton has an allotetraploid genome. Separation of homologous BAC contigs to their sub-genomes and further to individual chromosomes is a great challenge for genome-wide integrated genetic and physical mapping. As a pilot experiment to test the feasibility of separating the contigs in sub-g...

  19. A bacterial artificial chromosome library for barley (Hordeum vulgare L.) and the identification of clones containing putative resistance genes

    Microsoft Academic Search

    Y. Yu; J. P. Tomkins; R. Waugh; D. A. Frisch; D. Kudrna; A. Kleinhofs; R. S. Brueggeman; G. J. Muehlbauer; R. P. Wise; R. A. Wing

    2000-01-01

    Modern cultivated barley is an important cereal crop with an estimated genome size of 5000 Mb. To develop the resources for\\u000a positional cloning and structural genomic analyses in barley, we constructed a bacterial artificial chromosome (BAC) library\\u000a for the cultivar Morex using the cloning enzyme HindIII. The library contains 313344 clones (816 384-well plates). A random sampling of 504 clones

  20. Expression of heterologous sigma factors enables functional screening of metagenomic and heterologous genomic libraries

    PubMed Central

    Gaida, Stefan M.; Sandoval, Nicholas R.; Nicolaou, Sergios A.; Chen, Yili; Venkataramanan, Keerthi P.; Papoutsakis, Eleftherios T.

    2015-01-01

    A key limitation in using heterologous genomic or metagenomic libraries in functional genomics and genome engineering is the low expression of heterologous genes in screening hosts, such as Escherichia coli. To overcome this limitation, here we generate E. coli strains capable of recognizing heterologous promoters by expressing heterologous sigma factors. Among seven sigma factors tested, RpoD from Lactobacillus plantarum (Lpl) appears to be able of initiating transcription from all sources of DNA. Using the promoter GFP-trap concept, we successfully screen several heterologous and metagenomic DNA libraries, thus enlarging the genomic space that can be functionally sampled in E. coli. For an application, we show that screening fosmid-based Lpl genomic libraries in an E. coli strain with a chromosomally integrated Lpl rpoD enables the identification of Lpl genetic determinants imparting strong ethanol tolerance in E. coli. Transcriptome analysis confirms increased expression of heterologous genes in the engineered strain. PMID:25944046

  1. Expression of heterologous sigma factors enables functional screening of metagenomic and heterologous genomic libraries.

    PubMed

    Gaida, Stefan M; Sandoval, Nicholas R; Nicolaou, Sergios A; Chen, Yili; Venkataramanan, Keerthi P; Papoutsakis, Eleftherios T

    2015-01-01

    A key limitation in using heterologous genomic or metagenomic libraries in functional genomics and genome engineering is the low expression of heterologous genes in screening hosts, such as Escherichia coli. To overcome this limitation, here we generate E. coli strains capable of recognizing heterologous promoters by expressing heterologous sigma factors. Among seven sigma factors tested, RpoD from Lactobacillus plantarum (Lpl) appears to be able of initiating transcription from all sources of DNA. Using the promoter GFP-trap concept, we successfully screen several heterologous and metagenomic DNA libraries, thus enlarging the genomic space that can be functionally sampled in E. coli. For an application, we show that screening fosmid-based Lpl genomic libraries in an E. coli strain with a chromosomally integrated Lpl rpoD enables the identification of Lpl genetic determinants imparting strong ethanol tolerance in E. coli. Transcriptome analysis confirms increased expression of heterologous genes in the engineered strain. PMID:25944046

  2. Integration of the draft sequence and physical map as a framework for genomic research in soybean (Glycine max (L.) Merr.) and wild soybean (Glycine soja Sieb. and Zucc.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean is a model for the legume research community due to its importance as a crop, a well populated genetic map, and the availability of a genome sequence. Even though a whole genome shotgun sequence and Bacterial Artificial Chromosome (BAC) libraries are available, a high-resolution chromosome-b...

  3. Democratizing Human Genome Project Information: A Model Program for Education, Information and Debate in Public Libraries.

    ERIC Educational Resources Information Center

    Pollack, Miriam

    The "Mapping the Human Genome" project demonstrated that librarians can help whomever they serve in accessing information resources in the areas of biological and health information, whether it is the scientists who are developing the information or a member of the public who is using the information. Public libraries can guide library users…

  4. Human genome libraries. Final progress report, February 1, 1994--August 31, 1997

    SciTech Connect

    Kao, Fa-Ten

    1998-01-01

    The goal of this program is to use a novel technology of chromosome microdissection and microcloning to construct chromosome region-specific libraries as resources for various human genome program studies. Region specific libraries have been constructed for the entire human chromosomes 2 and 18.

  5. Interpreting a Sequenced Genome: Toward a Cosmid Transgenic Library of Caenorhabditis elegans

    Microsoft Academic Search

    Diana L. Janke; Jacqueline E. Schein; Norman W. Franz; Nigel J. O'Neil; Greg P. Vatcher; Helen I. Stewart; Lynnette M. Kuervers; David L. Baillie; Ann M. Rose

    2007-01-01

    We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8

  6. Assignment of Homology to Genome Sequences using a Library of Hidden Markov Models that

    E-print Network

    Karplus, Kevin

    Assignment of Homology to Genome Sequences using a Library of Hidden Markov Models that Represent pairwise comparisons. Of the pro®le methods, hidden Markov models (HMMs) are apparently the best. The ®rst Academic Press Keywords: genome; superfamily; hidden Markov model; structure; homology*Corresponding author

  7. Genomic analysis using a yeast artificial chromosome library with mouse DNA inserts.

    PubMed Central

    Rossi, J M; Burke, D T; Leung, J C; Koos, D S; Chen, H; Tilghman, S M

    1992-01-01

    A yeast artificial chromosome library with mouse genomic DNA inserts has been constructed. The library encompasses a 2.5-fold coverage of the mouse genome, with an average insert size of 250 kilobases. The screening strategy uses the polymerase chain reaction on pooled DNAs prepared from individually stored clones. The usefulness of the library for chromosome walking was illustrated by constructing a 600-kilobase-long contig of DNA surrounding Hba-ps4, a DNA marker that is tightly linked to the fused (Fu) locus on chromosome 17. Images PMID:1347950

  8. Pybedtools: a flexible Python library for manipulating genomic datasets and annotations

    PubMed Central

    Dale, Ryan K.; Pedersen, Brent S.; Quinlan, Aaron R.

    2011-01-01

    Summary: pybedtools is a flexible Python software library for manipulating and exploring genomic datasets in many common formats. It provides an intuitive Python interface that extends upon the popular BEDTools genome arithmetic tools. The library is well documented and efficient, and allows researchers to quickly develop simple, yet powerful scripts that enable complex genomic analyses. Availability: pybedtools is maintained under the GPL license. Stable versions of pybedtools as well as documentation are available on the Python Package Index at http://pypi.python.org/pypi/pybedtools. Contact: dalerr@niddk.nih.gov; arq5x@virginia.edu Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:21949271

  9. Marked improvement of PAC and BAC cloning is achieved using electroelution of pulsed-field gel-separated partial digests of genomic DNA

    Microsoft Academic Search

    Scott J. Strong; Yuko Ohta; Gary W. Litman; Chris T. Amemiya

    1997-01-01

    We describe a simple electroelution method for purify- ing large, gel-fractionated DNA molecules that allevi- ates the need for melting of the agarose and subsequent enzymatic agarose digestion. The method yields DNA that is visibly more intact than that purified from a standard agarose-digestion protocol and is more amenable to large-fragment cloning with PAC and BAC vectors. These findings are

  10. Alignment of the Genomes of Brachypodium distachyon and Temperate Cereals and Grasses Using Bacterial Artificial Chromosome Landing With Fluorescence in Situ Hybridization

    PubMed Central

    Hasterok, Robert; Marasek, Agnieszka; Donnison, Iain S.; Armstead, Ian; Thomas, Ann; King, Ian P.; Wolny, Elzbieta; Idziak, Dominika; Draper, John; Jenkins, Glyn

    2006-01-01

    As part of an initiative to develop Brachypodium distachyon as a genomic “bridge” species between rice and the temperate cereals and grasses, a BAC library has been constructed for the two diploid (2n = 2x = 10) genotypes, ABR1 and ABR5. The library consists of 9100 clones, with an approximate average insert size of 88 kb, representing 2.22 genome equivalents. To validate the usefulness of this species for comparative genomics and gene discovery in its larger genome relatives, the library was screened by PCR using primers designed on previously mapped rice and Poaceae sequences. Screening indicated a degree of synteny between these species and B. distachyon, which was confirmed by fluorescent in situ hybridization of the marker-selected BACs (BAC landing) to the 10 chromosome arms of the karyotype, with most of the BACs hybridizing as single loci on known chromosomes. Contiguous BACs colocalized on individual chromosomes, thereby confirming the conservation of genome synteny and proving that B. distachyon has utility as a temperate grass model species alternative to rice. PMID:16489232

  11. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences, and Perspectives for Genetic Mapping.

    PubMed

    Hulse-Kemp, Amanda M; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A; Scheffler, Brian E; Fang, David D; Chen, Z Jeffrey; Van Deynze, Allen; Stelly, David M

    2015-01-01

    A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. PMID:25858960

  12. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences, and Perspectives for Genetic Mapping

    PubMed Central

    Hulse-Kemp, Amanda M.; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A.; Scheffler, Brian E.; Fang, David D.; Chen, Z. Jeffrey; Van Deynze, Allen; Stelly, David M.

    2015-01-01

    A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. PMID:25858960

  13. RepARK--de novo creation of repeat libraries from whole-genome NGS reads.

    PubMed

    Koch, Philipp; Platzer, Matthias; Downie, Bryan R

    2014-05-01

    Generation of repeat libraries is a critical step for analysis of complex genomes. In the era of next-generation sequencing (NGS), such libraries are usually produced using a whole-genome shotgun (WGS) derived reference sequence whose completeness greatly influences the quality of derived repeat libraries. We describe here a de novo repeat assembly method--RepARK (Repetitive motif detection by Assembly of Repetitive K-mers)--which avoids potential biases by using abundant k-mers of NGS WGS reads without requiring a reference genome. For validation, repeat consensuses derived from simulated and real Drosophila melanogaster NGS WGS reads were compared to repeat libraries generated by four established methods. RepARK is orders of magnitude faster than the other methods and generates libraries that are: (i) composed almost entirely of repetitive motifs, (ii) more comprehensive and (iii) almost completely annotated by TEclass. Additionally, we show that the RepARK method is applicable to complex genomes like human and can even serve as a diagnostic tool to identify repetitive sequences contaminating NGS datasets. PMID:24634442

  14. RepARK—de novo creation of repeat libraries from whole-genome NGS reads

    PubMed Central

    Koch, Philipp; Platzer, Matthias; Downie, Bryan R.

    2014-01-01

    Generation of repeat libraries is a critical step for analysis of complex genomes. In the era of next-generation sequencing (NGS), such libraries are usually produced using a whole-genome shotgun (WGS) derived reference sequence whose completeness greatly influences the quality of derived repeat libraries. We describe here a de novo repeat assembly method—RepARK (Repetitive motif detection by Assembly of Repetitive K-mers)—which avoids potential biases by using abundant k-mers of NGS WGS reads without requiring a reference genome. For validation, repeat consensuses derived from simulated and real Drosophila melanogaster NGS WGS reads were compared to repeat libraries generated by four established methods. RepARK is orders of magnitude faster than the other methods and generates libraries that are: (i) composed almost entirely of repetitive motifs, (ii) more comprehensive and (iii) almost completely annotated by TEclass. Additionally, we show that the RepARK method is applicable to complex genomes like human and can even serve as a diagnostic tool to identify repetitive sequences contaminating NGS datasets. PMID:24634442

  15. Direct sequencing of small genomes on the Pacific Biosciences RS without library preparation.

    PubMed

    Coupland, Paul; Chandra, Tamir; Quail, Mike; Reik, Wolf; Swerdlow, Harold

    2012-12-01

    We have developed a sequencing method on the Pacific Biosciences RS sequencer (the PacBio) for small DNA molecules that avoids the need for a standard library preparation. To date this approach has been applied toward sequencing single-stranded and double-stranded viral genomes, bacterial plasmids, plasmid vector models for DNA-modification analysis, and linear DNA fragments covering an entire bacterial genome. Using direct sequencing it is possible to generate sequence data from as little as 1 ng of DNA, offering a significant advantage over current protocols which typically require 400-500 ng of sheared DNA for the library preparation. PMID:23227987

  16. Direct sequencing of small genomes on the Pacific Biosciences RS without library preparation

    PubMed Central

    Coupland, Paul; Chandra, Tamir; Quail, Mike; Reik, Wolf; Swerdlow, Harold

    2013-01-01

    We have developed a sequencing method on the Pacific Biosciences RS sequencer (the PacBio) for small DNA molecules that avoids the need for a standard library preparation. To date this approach has been applied toward sequencing single-stranded and double-stranded viral genomes, bacterial plasmids, plasmid vector models for DNA-modification analysis, and linear DNA fragments covering an entire bacterial genome. Using direct sequencing it is possible to generate sequence data from as little as 1 ng of DNA, offering a significant advantage over current protocols which typically require 400–500 ng of sheared DNA for the library preparation. PMID:23227987

  17. Construction and characterization of a 10-genome equivalent yeast artificial chromosome library for the laboratory rat, Rattus norvegicus

    Microsoft Academic Search

    Li Cai; Leonard C. Schalkwyk; Andreina Schoeberlein-Stehli; Robert Y. L. Zee; Avrial Smith; Thomas Haaf; Michel Georges; Hans Lehrach; Klaus Lindpaintner

    1997-01-01

    Increasing attention has been focused in recent years on the rat as a model organism for genetic studies, in particular for the investigation of complex traits, but progress has been limited by the lack of availability of large-insert genomic libraries, Here, we report the construction and characterization of an arrayed yeast artificial chromosome (YAC) library for the rat genome containing

  18. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1992-08-01

    During the grant period progress has been made in the successful demonstration of regional mapping of microclones derived from microdissection libraries; successful demonstration of the feasibility of converting microclones with short inserts into yeast artificial chromosome clones with very large inserts for high resolution physical mapping of the dissected region; Successful demonstration of the usefulness of region-specific microclones to isolate region-specific cDNA clones as candidate genes to facilitate search for the crucial genes underlying genetic diseases assigned to the dissected region; and the successful construction of four region-specific microdissection libraries for human chromosome 2, including 2q35-q37, 2q33-q35, 2p23-p25 and 2p2l-p23. The 2q35-q37 library has been characterized in detail. The characterization of the other three libraries is in progress. These region-specific microdissection libraries and the unique sequence microclones derived from the libraries will be valuable resources for investigators engaged in high resolution physical mapping and isolation of disease-related genes residing in these chromosomal regions.

  19. Contribution of Asian mouse subspecies Mus musculus molossinus to genomic constitution of strain C57BL\\/6J, as defined by BAC-end sequence-SNP analysis

    Microsoft Academic Search

    Kuniya Abe; Hideki Noguchi; Keiko Tagawa; Misako Yuzuriha; Atsushi Toyoda; Toshio Kojima; Kiyoshi Ezawa; Naruya Saitou; Masahira Hattori; Yoshiyuki Sakaki; Kazuo Moriwaki; Toshihiko Shiroishi

    2004-01-01

    MSM\\/Ms is an inbred strain derived from the Japanese wild mouse, Mus musculus molossinus. It is believed that subspecies molossinus has contributed substantially to the genome constitution of common laboratory strains of mice, although the majority of their genome is derived from the west European M. m. domesticus. Information on the molossinus genome is thus essential not only for genetic

  20. The BAC resource: tools for array CGH and FISH.

    PubMed

    Nowak, Norma J; Snijders, Antoine M; Conroy, Jeffrey M; Albertson, Donna G

    2005-08-01

    Bacterial Artificial Chromosome (BAC) vector clones carrying human DNA were chosen as the intermediate templates for the sequencing of the human genome due to their inherent stability and fidelity to the genome sequence from which they were derived. In this unit, we describe a set of protocols for BAC-based array comparative genomic hybridization (aCGH) that comprise the generation of targets for printing solutions onto glass slides, the subsequent hybridization steps, and CGH analysis of a test sample compared to a reference normal sample. The BAC clones through their sequence allow the extent and gene content of numerical aberrations to be delineated by aCGH, and also provide cytogeneticists with tools for subsequent validation or fine mapping studies. PMID:18428377

  1. SORGHUM BICOLOR-AN IMPORTANT SPECIES FOR COMPARATIVE GRASS GENOMICS AND A SOURCE OF BENEFICIAL GENES FOR AGRICULTURE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A high resolution genetic, physical and cytological map of the sorghum genome is being assembled using Amplified Fragment Length polymorphic DNA marker technology, six dimensional pooling of BAC libraries, cDNA mapping technology, and cytogenetic analysis. Recent advances in sorghum comparative gen...

  2. Rapid Construction of a Random Genomic Library from Date-Palm (Phoenix Dactylifera L.)

    Microsoft Academic Search

    Sakka Hela; Ould Mohamed Salem Ali; Trifi Mokhtar; Rhouma Abdelmajid; Marrakchi Mohamed

    1999-01-01

    A random genomic library of Tunisian date-palm varieties has been built from total cellular DNA, previously amplified according to an RAPD procedure. The resultant recombinant DNA is characterised by a size ranging from 200 to 1600 bp inserts. This DNA would constitute a large number of anonymous probes useful in Southern hybridisation experiments. It would also provide potential markers aimed

  3. Transpositional transgenesis with piggyBac

    PubMed Central

    Urschitz, Johann; Moisyadi, Stefan

    2013-01-01

    Transposons are mobile genetic elements that are capable of self-directed excision and subsequent reintegration within the host genome. Transposase such as piggyBac, Sleeping Beauty and Tol2 catalyze these reactions and have shown potential as tools for the stable integration of transgenes when used in the binary plasmid mode. Recent modifications to the transposase and/or the terminal repeats of the transposon have increased their integration efficiency and/or specificity. We recently described the development of a piggyBac transposase system, the helper independent, single construct self-inactivating plasmid called GENIE. Here we describe the structure, safety and function of these transpositional vectors and their use in animal transgenesis and cell transfection. PMID:23956948

  4. Rapid Communication Stable transformation of a Mamestra brassicae (lepidoptera) cell line with the lepidopteran-derived transposon piggyBac

    Microsoft Academic Search

    Mauro Mandrioli; Ernst A. Wimmer

    Cabbage moth cells were transfected with the vector pBac{3xP3-EGFPafm} and helper phsp-pBac. Seventeen percent of the transfected cells showed stable EGFP-expression. This indicates successful and stable transformation of M. brassicae cells with a piggyBac-derived vector. Genomic integration of Bac{3xP3-EGFPafm}in stably transformed cells was confirmed by Southern blots and inverse PCR. Since the integrations are stable, and transfection with pBac{3xP3-EGFPafm} alone

  5. AFLP-based study of genetic difference and mega-base DNA isolation for BAC library construction from greenbug Schizaphis graminum (Rondani) (Homoptera:Aphididae) 

    E-print Network

    Li, Haiwen

    2002-01-01

    biotypes, rDNA intergenic spacer (IGS) regions (Black, 1993), mitochondria DNA (mtDNA) sequences (Aikhionbare and Mayo 2000; Shufran et al. 2000) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) (Black et al. 1992; Aikhionbare et...; Shufran et al. 2000). Contradictory conclusions are most likely due to the limitations of the methodologies applied. For example, rDNA IGS regions or mtDNA sequences usually represent only very small genomic regions, and RAPD-PCR, although it can detect...

  6. Construction and characterization of a 10-genome equivalent yeast artificial chromosome library for the laboratory rat, Rattus norvegicus

    SciTech Connect

    Cai, L.; Zee, R.Y.L. [Harvard Medical School, Boston, MA (United States)] [Harvard Medical School, Boston, MA (United States); Schalkwyk, L.C. [Max Planck Institute for Molecular Genetics, Berlin (Germany)] [and others] [Max Planck Institute for Molecular Genetics, Berlin (Germany); and others

    1997-02-01

    Increasing attention has been focused in recent years on the rat as a model organism for genetic studies, in particular for the investigation of complex traits, but progress has been limited by the lack of availability of large-insert genomic libraries. Here, we report the construction and characterization of an arrayed yeast artificial chromosome (YAC) library for the rat genome containing approximately 40,000 clones in the AB1380 host using the pCGS966 vector. An average size of 736 kb was estimated from 166 randomly chosen clones; thus the library provides 10-fold coverage of the genome, with a 99.99% probability of containing a unique sequence. Eight of 39 YACs analyzed by fluorescence in situ hybridization were found to be chimeric, indicating a proportion of about 20-30% of chimeric clones. The library was spotted on high-density filters to allow the identification of YAC clones by hybridization and was pooled using a 3-dimensional scheme for screening by PCR. Among 48 probes used to screen the library, an average of 9.3 positive clones were found, consistent with the calculated 10-fold genomic coverage of the library. This YAC library represents the first large-insert genomic library for the rat. It will be made available to the research community at large as an important new resource for complex genome analysis in this species. 35 refs., 4 figs.

  7. SVGenes: a library for rendering genomic features in scalable vector graphic format

    PubMed Central

    Etherington, Graham J.; MacLean, Daniel

    2013-01-01

    Motivation: Drawing genomic features in attractive and informative ways is a key task in visualization of genomics data. Scalable Vector Graphics (SVG) format is a modern and flexible open standard that provides advanced features including modular graphic design, advanced web interactivity and animation within a suitable client. SVGs do not suffer from loss of image quality on re-scaling and provide the ability to edit individual elements of a graphic on the whole object level independent of the whole image. These features make SVG a potentially useful format for the preparation of publication quality figures including genomic objects such as genes or sequencing coverage and for web applications that require rich user-interaction with the graphical elements. Results: SVGenes is a Ruby-language library that uses SVG primitives to render typical genomic glyphs through a simple and flexible Ruby interface. The library implements a simple Page object that spaces and contains horizontal Track objects that in turn style, colour and positions features within them. Tracks are the level at which visual information is supplied providing the full styling capability of the SVG standard. Genomic entities like genes, transcripts and histograms are modelled in Glyph objects that are attached to a track and take advantage of SVG primitives to render the genomic features in a track as any of a selection of defined glyphs. The feature model within SVGenes is simple but flexible and not dependent on particular existing gene feature formats meaning graphics for any existing datasets can easily be created without need for conversion. Availability: The library is provided as a Ruby Gem from https://rubygems.org/gems/bio-svgenes under the MIT license, and open source code is available at https://github.com/danmaclean/bioruby-svgenes also under the MIT License. Contact: dan.maclean@tsl.ac.uk PMID:23749959

  8. Efficient construction of plant genomic libraries requires the use of mcr host strains and packaging mixes

    Microsoft Academic Search

    Michael W. Graham; Judith P. Doherty; David M. Woodcock

    1990-01-01

    It has recently become apparent that many strains ofE. coli contain nucleases encoded by themcrA andmcrB loci that, recognize the modified base 5-methylcytosine in DNA. Plant DNAs have particularly high levels of this modification\\u000a and the activity of these 5-methylcytosine-specific nucleases is particularly relevant to cloning plant genomic DNAs. We show\\u000a here that for preparing libraries in a ? replacement

  9. Design and evaluation of genome-wide libraries for RNA interference screens

    PubMed Central

    2010-01-01

    RNA interference (RNAi) screens have enabled the systematic analysis of many biological processes in cultured cells and whole organisms. The success of such screens and the interpretation of the data depend on the stringent design of RNAi libraries. We describe and validate NEXT-RNAi, a software for the automated design and evaluation of RNAi sequences on a genome-wide scale. NEXT-RNAi is implemented as open-source software and is accessible at http://www.nextrnai.org/. PMID:20550664

  10. Analysis of genomic regions of Trichoderma harzianum IOC-3844 related to biomass degradation.

    PubMed

    Crucello, Aline; Sforça, Danilo Augusto; Horta, Maria Augusta Crivelente; dos Santos, Clelton Aparecido; Viana, Américo José Carvalho; Beloti, Lilian Luzia; de Toledo, Marcelo Augusto Szymanski; Vincentz, Michel; Kuroshu, Reginaldo Massanobu; de Souza, Anete Pereira

    2015-01-01

    Trichoderma harzianum IOC-3844 secretes high levels of cellulolytic-active enzymes and is therefore a promising strain for use in biotechnological applications in second-generation bioethanol production. However, the T. harzianum biomass degradation mechanism has not been well explored at the genetic level. The present work investigates six genomic regions (~150 kbp each) in this fungus that are enriched with genes related to biomass conversion. A BAC library consisting of 5,760 clones was constructed, with an average insert length of 90 kbp. The assembled BAC sequences revealed 232 predicted genes, 31.5% of which were related to catabolic pathways, including those involved in biomass degradation. An expression profile analysis based on RNA-Seq data demonstrated that putative regulatory elements, such as membrane transport proteins and transcription factors, are located in the same genomic regions as genes related to carbohydrate metabolism and exhibit similar expression profiles. Thus, we demonstrate a rapid and efficient tool that focuses on specific genomic regions by combining a BAC library with transcriptomic data. This is the first BAC-based structural genomic study of the cellulolytic fungus T. harzianum, and its findings provide new perspectives regarding the use of this species in biomass degradation processes. PMID:25836973

  11. Analysis of BAC-end sequences in rainbow trout: content characterization and assessment of synteny between trout and other fish genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Rainbow trout (Oncorhynchus mykiss) are cultivated worldwide for aquaculture production and used as a model species to gain knowledge of many aspects of fish biology. As a salmonid, the species experienced recent whole genome duplication, making it a model for studying the evolution of t...

  12. Genome-Wide Sequence Comparison of Centromeric Regions and BAC-Landing on Chromosomes Provide New Insights into Centromere Evolution Among Wheat, Brachypodium, and Rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As an emerging model system, the nearly finished sequence of Brachypodium distachyon will provide new insights into comparative and functional genomics of grass species. However, centromeres of B. distachyon are unlikely to be sequenced and assembled precisely similar to many other sequenced organis...

  13. The first insight into the Taxus genome via fosmid library construction and end sequencing.

    PubMed

    Hao, DaCheng; Yang, Ling; Xiao, PeiGen

    2011-03-01

    Taxus mairei is a critically endangered and commercially important cultured medicinal gymnosperm in China and forms an important medicinal resource, but the research of its genome is absent. In this study, we constructed a T. mairei fosmid library and analyzed the fosmid end sequences to provide a preliminary assessment of the genome. The library consists of one million clones with an average insert size of about 39 kb, amounting to 3.9 genome equivalents. Fosmid stability assays indicate that T. mairei DNA was stable during propagation in the fosmid system. End sequencing of both 5' and 3' ends of 968 individual clones generated 1,923 sequences after trimming, with an average sequence length of 839 bp. BLASTN searches of the nr and EST databases of GenBank and BLASTX searches of the nr database resulted in 560 (29.1%) significant hits (E < e(-5)). Repetitive sequences analysis revealed that 20.8% of end sequences are repetitive elements, which were composed of retroelements, DNA transposons, satellites, simple repeats, and low complexity sequences. The distribution pattern of various repeat types was found to be more similar to the gymnosperm Pinus and Picea than to the monocot and dicot. The satellites of T. mairei were significantly longer than those of P. taeda and P. glauca. The tetra-nucleotide repeats of T. mairei were much longer than those of P. glauca and P. taeda. The fosmid library and the fosmid end sequences, for the first time, will serve as a useful resource for large-scale genome sequencing, physical mapping, SSR marker development and positional cloning, and provide a better understanding of the Taxus genome. PMID:21207064

  14. Analysis of BAC-end sequences in rainbow trout: Content characterization and assessment of synteny between trout and other fish genomes

    Microsoft Academic Search

    Carine Genet; Patrice Dehais; Yniv Palti; Guangtu Gao; Frederick Gavory; Patrick Wincker; Edwige Quillet; Mekki Boussaha

    2011-01-01

    Background  Rainbow trout (Oncorhynchus mykiss) are cultivated worldwide for aquaculture production and are widely used as a model species to gain knowledge of many aspects\\u000a of fish biology. The common ancestor of the salmonids experienced a whole genome duplication event, making extant salmonids\\u000a such as the rainbow trout an excellent model for studying the evolution of tetraploidization and re-diploidization in vertebrates.

  15. Scribl: an HTML5 Canvas-based graphics library for visualizing genomic data over the web

    PubMed Central

    Miller, Chase A.; Anthony, Jon; Meyer, Michelle M.; Marth, Gabor

    2013-01-01

    Motivation: High-throughput biological research requires simultaneous visualization as well as analysis of genomic data, e.g. read alignments, variant calls and genomic annotations. Traditionally, such integrative analysis required desktop applications operating on locally stored data. Many current terabyte-size datasets generated by large public consortia projects, however, are already only feasibly stored at specialist genome analysis centers. As even small laboratories can afford very large datasets, local storage and analysis are becoming increasingly limiting, and it is likely that most such datasets will soon be stored remotely, e.g. in the cloud. These developments will require web-based tools that enable users to access, analyze and view vast remotely stored data with a level of sophistication and interactivity that approximates desktop applications. As rapidly dropping cost enables researchers to collect data intended to answer questions in very specialized contexts, developers must also provide software libraries that empower users to implement customized data analyses and data views for their particular application. Such specialized, yet lightweight, applications would empower scientists to better answer specific biological questions than possible with general-purpose genome browsers currently available. Results: Using recent advances in core web technologies (HTML5), we developed Scribl, a flexible genomic visualization library specifically targeting coordinate-based data such as genomic features, DNA sequence and genetic variants. Scribl simplifies the development of sophisticated web-based graphical tools that approach the dynamism and interactivity of desktop applications. Availability and implementation: Software is freely available online at http://chmille4.github.com/Scribl/ and is implemented in JavaScript with all modern browsers supported. Contact: gabor.marth@bc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23172864

  16. NINDS GENSAT BAC Transgenic Project

    NSDL National Science Digital Library

    This website from Rockefeller University in New York contains "a gene expression atlas of the central nervous system of the mouse based on bacterial artificial chromosomes (BACs)." GENSAT, or the Gene Expression Nervous System Atlas, contains brain slice images of BAC transgenic mice at the embryonic, postnatal (7 days old), and adult stages, stained to show areas of gene activity. The website comes with a detailed and helpful tutorial that recreates GENSAT's user interface and demonstrates how to manipulate search results.

  17. Pig genome sequence - analysis and publication strategy

    Microsoft Academic Search

    Alan L Archibald; Lars Bolund; Carol Churcher; Merete Fredholm; Martien AM Groenen; Barbara Harlizius; Kyung-Tai Lee; Denis Milan; Jane Rogers; Max F Rothschild; Hirohide Uenishi; Jun Wang; Lawrence B Schook

    2010-01-01

    BACKGROUND: The pig genome is being sequenced and characterised under the auspices of the Swine Genome Sequencing Consortium. The sequencing strategy followed a hybrid approach combining hierarchical shotgun sequencing of BAC clones and whole genome shotgun sequencing. RESULTS: Assemblies of the BAC clone derived genome sequence have been annotated using the Pre-Ensembl and Ensembl automated pipelines and made accessible through

  18. Microcollinearity between autopolyploid sugarcane and diploid sorghum genomes

    PubMed Central

    2010-01-01

    Background Sugarcane (Saccharum spp.) has become an increasingly important crop for its leading role in biofuel production. The high sugar content species S. officinarum is an octoploid without known diploid or tetraploid progenitors. Commercial sugarcane cultivars are hybrids between S. officinarum and wild species S. spontaneum with ploidy at ~12×. The complex autopolyploid sugarcane genome has not been characterized at the DNA sequence level. Results The microsynteny between sugarcane and sorghum was assessed by comparing 454 pyrosequences of 20 sugarcane bacterial artificial chromosomes (BACs) with sorghum sequences. These 20 BACs were selected by hybridization of 1961 single copy sorghum overgo probes to the sugarcane BAC library with one sugarcane BAC corresponding to each of the 20 sorghum chromosome arms. The genic regions of the sugarcane BACs shared an average of 95.2% sequence identity with sorghum, and the sorghum genome was used as a template to order sequence contigs covering 78.2% of the 20 BAC sequences. About 53.1% of the sugarcane BAC sequences are aligned with sorghum sequence. The unaligned regions contain non-coding and repetitive sequences. Within the aligned sequences, 209 genes were annotated in sugarcane and 202 in sorghum. Seventeen genes appeared to be sugarcane-specific and all validated by sugarcane ESTs, while 12 appeared sorghum-specific but only one validated by sorghum ESTs. Twelve of the 17 sugarcane-specific genes have no match in the non-redundant protein database in GenBank, perhaps encoding proteins for sugarcane-specific processes. The sorghum orthologous regions appeared to have expanded relative to sugarcane, mostly by the increase of retrotransposons. Conclusions The sugarcane and sorghum genomes are mostly collinear in the genic regions, and the sorghum genome can be used as a template for assembling much of the genic DNA of the autopolyploid sugarcane genome. The comparable gene density between sugarcane BACs and corresponding sorghum sequences defied the notion that polyploidy species might have faster pace of gene loss due to the redundancy of multiple alleles at each locus. PMID:20416060

  19. Fosmid library end sequencing reveals a rarely known genome structure of marine shrimp Penaeus monodon

    PubMed Central

    2011-01-01

    Background The black tiger shrimp (Penaeus monodon) is one of the most important aquaculture species in the world, representing the crustacean lineage which possesses the greatest species diversity among marine invertebrates. Yet, we barely know anything about their genomic structure. To understand the organization and evolution of the P. monodon genome, a fosmid library consisting of 288,000 colonies and was constructed, equivalent to 5.3-fold coverage of the 2.17 Gb genome. Approximately 11.1 Mb of fosmid end sequences (FESs) from 20,926 non-redundant reads representing 0.45% of the P. monodon genome were obtained for repetitive and protein-coding sequence analyses. Results We found that microsatellite sequences were highly abundant in the P. monodon genome, comprising 8.3% of the total length. The density and the average length of microsatellites were evidently higher in comparison to those of other taxa. AT-rich microsatellite motifs, especially poly (AT) and poly (AAT), were the most abundant. High abundance of microsatellite sequences were also found in the transcribed regions. Furthermore, via self-BlastN analysis we identified 103 novel repetitive element families which were categorized into four groups, i.e., 33 WSSV-like repeats, 14 retrotransposons, 5 gene-like repeats, and 51 unannotated repeats. Overall, various types of repeats comprise 51.18% of the P. monodon genome in length. Approximately 7.4% of the FESs contained protein-coding sequences, and the Inhibitor of Apoptosis Protein (IAP) gene and the Innexin 3 gene homologues appear to be present in high abundance in the P. monodon genome. Conclusions The redundancy of various repeat types in the P. monodon genome illustrates its highly repetitive nature. In particular, long and dense microsatellite sequences as well as abundant WSSV-like sequences highlight the uniqueness of genome organization of penaeid shrimp from those of other taxa. These results provide substantial improvement to our current knowledge not only for shrimp but also for marine crustaceans of large genome size. PMID:21575266

  20. The Jackson Laboratory: The Mouse Genome Sequence Project

    NSDL National Science Digital Library

    Part of the Mouse Genome Informatics program (last reported on in the NSDL Scout Report for the Life Sciences on March 19, 2004) at the Jackson Laboratory, this website presents The Mouse Genome Sequence (MGS) project. MGS is designed "to integrate emerging mouse genomic sequence data with the genetic and biological data available in MGD and GXD." The site links to Eukaryotic Genome Annotation Projects, as well as Sequence Analysis Tools including MouseBlast and Genome Analysis. The site also offers basic background information about the Mouse Genome Sequencing Initiative, and provides site users with access to groups involved in mouse genome sequencing, the BAC clone library, request forms for targeted sequencing, and more.

  1. Rapid editing and evolution of bacterial genomes using libraries of synthetic DNA.

    PubMed

    Gallagher, Ryan R; Li, Zhe; Lewis, Aaron O; Isaacs, Farren J

    2014-10-01

    Multiplex automated genome engineering (MAGE) is a powerful technology for in vivo genome editing that uses synthetic single-stranded DNA (ssDNA) to introduce targeted modifications directly into the Escherichia coli chromosome. MAGE is a cyclical process that involves transformation of ssDNA (by electroporation) followed by outgrowth, during which bacteriophage homologous recombination proteins mediate annealing of ssDNAs to their genomic targets. By iteratively introducing libraries of mutagenic ssDNAs targeting multiple sites, MAGE can generate combinatorial genetic diversity in a cell population. Alternatively, MAGE can introduce precise mutant alleles at many loci for genome-wide editing or for recoding projects that are not possible with other methods. In recent technological advances, MAGE has been improved by strain modifications and selection techniques that enhance allelic replacement. This protocol describes the manual execution of MAGE wherein each cycle takes ? 2.5 h, which, if carried out by two people, allows ? 10 continuous cycles of MAGE-based mutagenesis per day. PMID:25188632

  2. Identifying microbial fitness determinants by Insertion Sequencing (INSeq) using genome-wide transposon mutant libraries

    PubMed Central

    Goodman, Andrew L.; Wu, Meng; Gordon, Jeffrey I.

    2012-01-01

    Insertion Sequencing (INSeq) is a method for determining the insertion site and relative abundance of large numbers of transposon mutants in a mixed population of isogenic mutants of a sequenced microbial species. INSeq is based on a modified mariner transposon containing MmeI sites at its ends, allowing cleavage at chromosomal sites 16–17bp from the inserted transposon. Genomic regions adjacent to the transposons are amplified by linear PCR with a biotinylated primer. Products are bound to magnetic beads, digested with MmeI, and barcoded with sample-specific linkers appended to each restriction fragment. After limited PCR amplification, fragments are sequenced using a high-throughput instrument. The sequence of each read can be used to map the location of a transposon in the genome. Read count measures the relative abundance of that mutant in the population. Solid-phase library preparation makes this protocol rapid (18h), easy to scale-up, amenable to automation, and useful for a variety of samples. A protocol for characterizing libraries of transposon mutant strains clonally arrayed in multi-well format is provided. PMID:22094732

  3. Integrating cytogenetics and genomics in comparative evolutionary studies of cichlid fish

    PubMed Central

    2012-01-01

    Background The availability of a large number of recently sequenced vertebrate genomes opens new avenues to integrate cytogenetics and genomics in comparative and evolutionary studies. Cytogenetic mapping can offer alternative means to identify conserved synteny shared by distinct genomes and also to define genome regions that are still not fine characterized even after wide-ranging nucleotide sequence efforts. An efficient way to perform comparative cytogenetic mapping is based on BAC clones mapping by fluorescence in situ hybridization. In this report, to address the knowledge gap on the genome evolution in cichlid fishes, BAC clones of an Oreochromis niloticus library covering the linkage groups (LG) 1, 3, 5, and 7 were mapped onto the chromosomes of 9 African cichlid species. The cytogenetic mapping data were also integrated with BAC-end sequences information of O. niloticus and comparatively analyzed against the genome of other fish species and vertebrates. Results The location of BACs from LG1, 3, 5, and 7 revealed a strong chromosomal conservation among the analyzed cichlid species genomes, which evidenced a synteny of the markers of each LG. Comparative in silico analysis also identified large genomic blocks that were conserved in distantly related fish groups and also in other vertebrates. Conclusions Although it has been suggested that fishes contain plastic genomes with high rates of chromosomal rearrangements and probably low rates of synteny conservation, our results evidence that large syntenic chromosome segments have been maintained conserved during evolution, at least for the considered markers. Additionally, our current cytogenetic mapping efforts integrated with genomic approaches conduct to a new perspective to address important questions involving chromosome evolution in fishes. PMID:22958299

  4. Effects of Blood-Alcohol Concentration (BAC) Feedback on BAC Estimates Over Time

    ERIC Educational Resources Information Center

    Bullers, Susan; Ennis, Melissa

    2006-01-01

    This study examines the effects of self-tested blood alcohol concentration (BAC) feedback, from personal hand-held breathalyzers, on the accuracy of BAC estimation. Using an e-mail prompted web-based questionnaire, 19 participants were asked to report both BAC estimates and subsequently measured BAC levels over the course of 27 days. Results from…

  5. Diversity of microsatellites derived from genomic libraries and GenBank sequences in rice ( Oryza sativa L.)

    Microsoft Academic Search

    Y. G. Cho; T. Ishii; S. Temnykh; X. Chen; L. Lipovich; S. R. McCouch; W. D. Park; N. Ayres; S. Cartinhour

    2000-01-01

    The growing number of rice microsatellite markers warrants a comprehensive comparison of allelic variability between the markers\\u000a developed using different methods, with various sequence repeat motifs, and from coding and non-coding portions of the genome.\\u000a We have performed such a comparison over a set of 323 microsatellite markers; 194 were derived from genomic library screening\\u000a and 129 were derived from

  6. Pre-Nursing Post-Bac Info

    E-print Network

    Pre-Nursing Post-Bac Info Session Rachel Small Co-Director, SFSU Pre- Nursing Post-Bac Program January 31, 2013 #12;SFSU Pre-Nursing Post-Bac Program ! Highly structured program intended for students with a bachelor's degree ! Provides prerequisite and elective coursework for pre-nursing students ! Strong

  7. A BAC POOLING STRATEGY: POWERFUL TOOL FOR THE MAIZE INTEGRATED GENETIC AND PHYSICAL MAP CONSTRUCTION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The construction of an integrated genetic and physical map of the maize genome (2500 Mbp) is the primary goal of our ongoing maize genome project. To accomplish this goal, we have used a BAC pooling strategy combined with a high-throughput PCR-based screening method to facilitate anchoring of the m...

  8. Ligation Bias in Illumina Next-Generation DNA Libraries: Implications for Sequencing Ancient Genomes

    PubMed Central

    Seguin-Orlando, Andaine; Schubert, Mikkel; Clary, Joel; Stagegaard, Julia; Alberdi, Maria T.; Prado, José Luis; Prieto, Alfredo; Willerslev, Eske; Orlando, Ludovic

    2013-01-01

    Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries. PMID:24205269

  9. Functional Screening of Metagenome and Genome Libraries for Detection of Novel Flavonoid-Modifying Enzymes

    PubMed Central

    Rabausch, U.; Juergensen, J.; Ilmberger, N.; Böhnke, S.; Fischer, S.; Schubach, B.; Schulte, M.

    2013-01-01

    The functional detection of novel enzymes other than hydrolases from metagenomes is limited since only a very few reliable screening procedures are available that allow the rapid screening of large clone libraries. For the discovery of flavonoid-modifying enzymes in genome and metagenome clone libraries, we have developed a new screening system based on high-performance thin-layer chromatography (HPTLC). This metagenome extract thin-layer chromatography analysis (META) allows the rapid detection of glycosyltransferase (GT) and also other flavonoid-modifying activities. The developed screening method is highly sensitive, and an amount of 4 ng of modified flavonoid molecules can be detected. This novel technology was validated against a control library of 1,920 fosmid clones generated from a single Bacillus cereus isolate and then used to analyze more than 38,000 clones derived from two different metagenomic preparations. Thereby we identified two novel UDP glycosyltransferase (UGT) genes. The metagenome-derived gtfC gene encoded a 52-kDa protein, and the deduced amino acid sequence was weakly similar to sequences of putative UGTs from Fibrisoma and Dyadobacter. GtfC mediated the transfer of different hexose moieties and exhibited high activities on flavones, flavonols, flavanones, and stilbenes and also accepted isoflavones and chalcones. From the control library we identified a novel macroside glycosyltransferase (MGT) with a calculated molecular mass of 46 kDa. The deduced amino acid sequence was highly similar to sequences of MGTs from Bacillus thuringiensis. Recombinant MgtB transferred the sugar residue from UDP-glucose effectively to flavones, flavonols, isoflavones, and flavanones. Moreover, MgtB exhibited high activity on larger flavonoid molecules such as tiliroside. PMID:23686272

  10. Construction of DNA libraries from flow sorted human chromosomes

    SciTech Connect

    Deaven, L.L.; McCormick, M.K.; Grady, D.L. [Los Alamos National Lab., NM (United States)] [and others

    1994-09-01

    We have constructed a series of DNA libraries from flow-sorted chromosomes. Small insert, complete digest libraries cloned into the EcoRI insertion site of Charon 21A are available from the American Type Culture Collection, Rockville, MD. Partial digest libraries cloned into cosmid (sCos1) or phage (Charon 40) vectors have been constructed for chromosomes 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, X and Y. Purity estimates by in situ analysis of sorted chromosomes, flow karyotype analysis, and plaque or colony hybridization indicate that most of these libraries are 90-95% pure. Additional cosmid library constructions, 5-10X arrays of libraries into microtiter plates, and high density membrane arrays of libraries are in progress. Recently, we have completed YAC libraries for chromosomes 5, 9, 16, and 21. These libraries are made from complete DNA digests using the rare cutters Clal, SacII, EagI, or NotI/NheI. The average insert size is {similar_to}200 kb, and chimera frequencies are low (1-10%). Libraries have also been constructed using M13 or bluescript vectors (chromosomes 5, 7, 17) to generate STS markers for the selection of chromosome-specific inserts from total genomic AC libraries. Because of the advantages of insert size and stability associated with BAC and PAC cloning systems, we are currently attempting to adapt pBAC108L and pCYPAC1 vectors for use with flow-sorted chromosomal DNA.

  11. In recent years, large-scale RNA interference (RNAi) libraries that are designed to target complete genomes

    E-print Network

    Cai, Long

    In recent years, large-scale RNA interference (RNAi) libraries that are designed to target complete well containing reagents that are, in theory, directed to only one gene, genome-scale RNAi screens-throughput RNAi screening data with guidance on choice and application of relevant statistical methods. Most

  12. Barcoding-free BAC Pooling Enables Combinatorial Selective Sequencing of the Barley Gene Space

    E-print Network

    Lonardi, Stefano; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Close, Timothy J

    2011-01-01

    We propose a new sequencing protocol that combines recent advances in combinatorial pooling design and second-generation sequencing technology to efficiently approach de novo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when dealing with hundreds or thousands of DNA samples, such as genome-tiling gene-rich BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundreds of million of short reads and assign them to the correct BAC clones so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is extremely accurate (99.57% of the deconvoluted reads are assigned to the correct BAC), and the resulting BAC assemblies have very high quality (BACs are covered by contigs over about 77% of their length, on average). Experimental results on real data for a gene-rich subset of the barley genome confir...

  13. Recent advances in recombinant protein production: BAC-based expression vectors, the bigger the better.

    PubMed

    Kunert, Renate; Casanova, Emilio

    2013-01-01

    Designing appropriate expression vectors is one of the critical steps in the generation of stable cell lines for recombinant protein production. Conventional expression vectors are severely affected by the chromatin environment surrounding their integration site into the host genome, resulting in low expression levels and transgene silencing. In the past, a new generation of expression vectors and different strategies was developed to overcome the chromatin effects. Bacterial artificial chromosomes (BACs) are cloning vectors capable of accommodating up to 350 Kb. Thus, BACs can carry a whole eukaryotic locus with all the elements controlling the expression of a gene; therefore, BACs harbor their own chromatin environment. Expression vectors based on BACs containing open/permissive chromatin loci are not affected by the chromatin surrounding their integration site in the host cell genome. Consequently, BAC-based expression vectors containing the appropriate loci confer predictable and high levels of expression over time. These properties make BAC-based expression vectors a very attractive tool applied to the recombinant protein production field. PMID:23680894

  14. Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137

    PubMed Central

    Yuan, Fengping; Xu, Xin; Shi, Xue; Zhuang, Hua; Wang, Zhonghua; Huang, Lili; Han, Dejun; Kang, Zhensheng

    2014-01-01

    For map-based cloning of genes conferring important traits in the hexaploid wheat line 92R137, a bacterial artificial chromosome (BAC) library, including two sublibraries, was constructed using the genomic DNA of 92R137 digested with restriction enzymes HindIII and BamHI. The BAC library was composed of total 765,696 clones, of which 390,144 were from the HindIII digestion and 375,552 from the BamHI digestion. Through pulsed-field gel electrophoresis (PFGE) analysis of 453 clones randomly selected from the HindIII sublibrary and 573 clones from the BamHI sublibrary, the average insert sizes were estimated as 129 and 113?kb, respectively. Thus, the HindIII sublibrary was estimated to have a 3.01-fold coverage and the BamHI sublibrary a 2.53-fold coverage based on the estimated hexaploid wheat genome size of 16,700?Mb. The 765,696 clones were arrayed in 1,994 384-well plates. All clones were also arranged into plate pools and further arranged into 5-dimensional (5D) pools. The probability of identifying a clone corresponding to any wheat DNA sequence (such as gene Yr26 for stripe rust resistance) from the library was estimated to be more than 99.6%. Through polymerase chain reaction screening the 5D pools with Xwe173, a marker tightly linked to Yr26, six BAC clones were successfully obtained. These results demonstrate that the BAC library is a valuable genomic resource for positional cloning of Yr26 and other genes of interest. PMID:24895618

  15. SiRNA sequence model: redesign algorithm based on available genome-wide libraries.

    PubMed

    Kozak, Karol

    2013-12-01

    The evolution of RNA interference (RNAi) and the development of technologies exploiting its biology have enabled scientists to rapidly examine the consequences of depleting a particular gene product in cells. Design tools have been developed based on experimental data to increase the knockdown efficiency of siRNAs. Not all siRNAs that are developed to a given target mRNA are equally effective. Currently available design algorithms take an accession, identify conserved regions among their transcript space, find accessible regions within the mRNA, design all possible siRNAs for these regions, filter them based on multi-scores thresholds, and then perform off-target filtration. These different criteria are used by commercial suppliers to produce siRNA genome-wide libraries for different organisms. In this article, we analyze existing siRNA design algorithms and evaluate weight of design parameters for libraries produced in the last decade. We proved that not all essential parameters are currently applied by siRNA vendors. Based on our evaluation results, we were able to suggest an siRNA sequence pattern. The findings in our study can be useful for commercial vendors improving the design of RNAi constructs, by addressing both the issue of potency and the issue of specificity. PMID:23252789

  16. Comparative sequence and genetic analyses of asparagus BACs reveal no microsynteny with onion or rice.

    PubMed

    Jakse, Jernej; Telgmann, Alexa; Jung, Christian; Khar, Anil; Melgar, Sergio; Cheung, Foo; Town, Christopher D; Havey, Michael J

    2006-12-01

    The Poales (includes the grasses) and Asparagales [includes onion (Allium cepa L.) and asparagus (Asparagus officinalis L.)] are the two most economically important monocot orders. The Poales are a member of the commelinoid monocots, a group of orders sister to the Asparagales. Comparative genomic analyses have revealed a high degree of synteny among the grasses; however, it is not known if this synteny extends to other major monocot groups such as the Asparagales. Although we previously reported no evidence for synteny at the recombinational level between onion and rice, microsynteny may exist across shorter genomic regions in the grasses and Asparagales. We sequenced nine asparagus BACs to reveal physically linked genic-like sequences and determined their most similar positions in the onion and rice genomes. Four of the asparagus BACs were selected using molecular markers tightly linked to the sex-determining M locus on chromosome 5 of asparagus. These BACs possessed only two putative coding regions and had long tracts of degenerated retroviral elements and transposons. Five asparagus BACs were selected after hybridization of three onion cDNAs that mapped to three different onion chromosomes. Genic-like sequences that were physically linked on the cDNA-selected BACs or genetically linked on the M-linked BACs showed significant similarities (e < -20) to expressed sequences on different rice chromosomes, revealing no evidence for microsynteny between asparagus and rice across these regions. Genic-like sequences that were linked in asparagus were used to identify highly similar (e < -20) expressed sequence tags (ESTs) of onion. These onion ESTs mapped to different onion chromosomes and no relationship was observed between physical or genetic linkages in asparagus and genetic linkages in onion. These results further indicate that synteny among grass genomes does not extend to a sister order in the monocots and that asparagus may not be an appropriate smaller genome model for plants in the Asparagales with enormous nuclear genomes. PMID:17016688

  17. Genetic transformation of the codling moth, Cydia pomonella L., with piggyBac EGFP.

    PubMed

    Ferguson, Holly J; Neven, Lisa G; Thibault, Stephen T; Mohammed, Ahmed; Fraser, Malcolm

    2011-02-01

    Genetic transformation of the codling moth, Cydia pomonella, was accomplished through embryo microinjection with a plasmid-based piggyBac vector containing the enhanced green fluorescent protein (EGFP) gene. Sequencing of the flanking regions around the inserted construct resulted in identification of insect genomic sequences, not plasmid sequences, thus providing evidence that the piggyBac EGFP cassette had integrated into the codling moth genome. EGFP-positive moths were confirmed in the 28th and earlier generations post injection through PCR and Southern blot analyses, indicating heritability of the transgene. PMID:20386982

  18. Post-integration silencing of piggyBac transposable elements in Aedes aegypti.

    PubMed

    Palavesam, Azhahianambi; Esnault, Caroline; O'Brochta, David A

    2013-01-01

    The piggyBac transposon, originating in the genome of the Lepidoptera Trichoplusia ni, has a broad host range, making it useful for the development of a number of transposon-based functional genomic technologies including gene vectors, enhancer-, gene- and protein-traps. While capable of being used as a vector for the creation of transgenic insects and insect cell lines, piggyBac has very limited mobility once integrated into the genome of the yellow fever mosquito, Aedes aegypti. A transgenic Aedes aegypti cell line (AagPB8) was created containing three integrated piggyBac elements and the remobilization potential of the elements was tested. The integrated piggyBac elements in AagPB8 were transpositionally silent in the presence of functional transposase, which was shown to be capable of catalyzing the movement of plasmid-borne piggyBac elements in the same cells. The structural integrity of one of the integrated elements along with the quality of element-flanking DNA, which is known to influence transposition rates, were tested in D. melanogaster. The element was found to be structurally intact, capable of transposition and excision in the soma and germ-line of Drosophila melanogaster, and in a DNA sequence context highly conducive to element movement in Drosophila melanogaster. These data show that transpositional silencing of integrated piggyBac elements in the genome of Aedes aegypti appears to be a function of higher scale genome organization or perhaps epigenetic factors, and not due to structural defects or suboptimal integration sites. PMID:23861905

  19. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

    NASA Astrophysics Data System (ADS)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

    1998-03-01

    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  20. Rhipicephalus (Boophilus) microplus strain Deutsch, 5 BAC clone sequencing, including two encoding Cytochrome P450s and one encoding CzEst9 carboxylesterase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. BAC clones give insight into the genome struct...

  1. Hybrid nonviral/viral vector systems for improved piggyBac DNA transposon in vivo delivery.

    PubMed

    Cooney, Ashley L; Singh, Brajesh K; Sinn, Patrick L

    2015-04-01

    The DNA transposon piggyBac is a potential therapeutic agent for multiple genetic diseases such as cystic fibrosis (CF). Recombinant piggyBac transposon and transposase are typically codelivered by plasmid transfection; however, plasmid delivery is inefficient in somatic cells in vivo and is a barrier to the therapeutic application of transposon-based vector systems. Here, we investigate the potential for hybrid piggyBac/viral vectors to transduce cells and support transposase-mediated genomic integration of the transposon. We tested both adenovirus (Ad) and adeno-associated virus (AAV) as transposon delivery vehicles. An Ad vector expressing hyperactive insect piggyBac transposase (iPB7) was codelivered. We show transposase-dependent transposition activity and mapped integrations in mammalian cells in vitro and in vivo from each viral vector platform. We also demonstrate efficient and persistent transgene expression following nasal delivery of piggyBac/viral vectors to mice. Furthermore, using piggyBac/Ad expressing Cystic Fibrosis transmembrane Conductance Regulator (CFTR), we show persistent correction of chloride current in well-differentiated primary cultures of human airway epithelial cells derived from CF patients. Combining the emerging technologies of DNA transposon-based vectors with well-studied adenoviral and AAV delivery provides new tools for in vivo gene transfer and presents an exciting opportunity to increase the delivery efficiency for therapeutic genes such as CFTR. PMID:25557623

  2. CFTR expression from a BAC carrying the complete human gene and associated regulatory elements.

    PubMed

    Kotzamanis, George; Abdulrazzak, Hassan; Gifford-Garner, Jennifer; Haussecker, Pei Ling; Cheung, Wing; Grillot-Courvalin, Catherine; Harris, Ann; Kittas, Christos; Kotsinas, Athanasios; Gorgoulis, Vassilis G; Huxley, Clare

    2009-09-01

    The use of genomic DNA rather than cDNA or mini-gene constructs in gene therapy might be advantageous as these contain intronic and long-range control elements vital for accurate expression. For gene therapy of cystic fibrosis though, no bacterial artificial chromosome (BAC), containing the whole CFTR gene is available. We have used Red homologous recombination to add a to a previously described vector to construct a new BAC vector with a 250.3-kb insert containing the whole coding region of the CFTR gene along with 40.1 kb of DNA 5' to the gene and 25 kb 3' to the gene. This includes all the known control elements of the gene. We evaluated expression by RT-PCR in CMT-93 cells and showed that the gene is expressed both from integrated copies of the BAC and also from episomes carrying the oriP/EBNA-1 element. Sequencing of the human CFTR mRNA from one clone showed that the BAC is functional and can generate correctly spliced mRNA in the mouse background. The BAC described here is the only CFTR genomic construct available on a convenient vector that can be readily used for gene expression studies or in vivo studies to test its potential application in gene therapy for cystic fibrosis. PMID:18657227

  3. A CYTOGENETIC MAP OF MAIZE IN OAT ADDITION LINES USING SORGHUM BACS AS FISH PROBES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We are developing a pachytene cytogenetic FISH map of the maize genome using sorghum BACs corresponding to the 90 maize Core Bin Marker (CBM) loci. These loci were chosen because they are uniformly distributed and they delineate the genetic bins derived from the UMC98 (Genetic 2005) maize linkage ma...

  4. Sequence for BAC OSJNBa0044D15 from Rice Variety Nipponbare GenBank

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The complete DNA sequence of BAC OSJNa0044D15 from chromosome 11 of rice variety Nipponbare was deposited in Genbank as part of the International Rice Sequencing Project. The DNA sequence with syntenic (corresponding) region of the rice genome associated with disease resistance to rice blast has be...

  5. Comparative physical maps derived from BAC end sequences of tilapia (Oreochromis niloticus)

    Microsoft Academic Search

    Lucile Soler; Matthew A. Conte; Takayuki Katagiri; Aimee E. Howe; Bo-Young Lee; Chris Amemiya; Andrew Stuart; Carole Dossat; Julie Poulain; Jeremy Johnson; Federica Di Palma; Kerstin Lindblad-Toh; Jean-Francois Baroiller; Helena D'Cotta; Catherine Ozouf-Costaz; Thomas D Kocher

    2010-01-01

    BACKGROUND: The Nile tilapia is the second most important fish in aquaculture. It is an excellent laboratory model, and is closely related to the African lake cichlids famous for their rapid rates of speciation. A suite of genomic resources has been developed for this species, including genetic maps and ESTs. Here we analyze BAC end-sequences to develop comparative physical maps,

  6. Development of microsatellite markers from an enriched genomic library for genetic analysis of melon (Cucumis melo L.)

    PubMed Central

    Ritschel, Patricia Silva; Lins, Tulio Cesar de Lima; Tristan, Rodrigo Lourenço; Buso, Gláucia Salles Cortopassi; Buso, José Amauri; Ferreira, Márcio Elias

    2004-01-01

    Background Despite the great advances in genomic technology observed in several crop species, the availability of molecular tools such as microsatellite markers has been limited in melon (Cucumis melo L.) and cucurbit species. The development of microsatellite markers will have a major impact on genetic analysis and breeding of melon, especially on the generation of marker saturated genetic maps and implementation of marker assisted breeding programs. Genomic microsatellite enriched libraries can be an efficient alternative for marker development in such species. Results Seven hundred clones containing microsatellite sequences from a Tsp-AG/TC microsatellite enriched library were identified and one-hundred and forty-four primer pairs designed and synthesized. When 67 microsatellite markers were tested on a panel of melon and other cucurbit accessions, 65 revealed DNA polymorphisms among the melon accessions. For some cucurbit species, such as Cucumis sativus, up to 50% of the melon microsatellite markers could be readily used for DNA polymophism assessment, representing a significant reduction of marker development costs. A random sample of 25 microsatellite markers was extracted from the new microsatellite marker set and characterized on 40 accessions of melon, generating an allelic frequency database for the species. The average expected heterozygosity was 0.52, varying from 0.45 to 0.70, indicating that a small set of selected markers should be sufficient to solve questions regarding genotype identity and variety protection. Genetic distances based on microsatellite polymorphism were congruent with data obtained from RAPD marker analysis. Mapping analysis was initiated with 55 newly developed markers and most primers showed segregation according to Mendelian expectations. Linkage analysis detected linkage between 56% of the markers, distributed in nine linkage groups. Conclusions Genomic library microsatellite enrichment is an efficient procedure for marker development in melon. One-hundred and forty-four new markers were developed from Tsp-AG/TC genomic library. This is the first reported attempt of successfully using enriched library for microsatellite marker development in the species. A sample of the microsatellite markers tested proved efficient for genetic analysis of melon, including genetic distance estimates and identity tests. Linkage analysis indicated that the markers developed are dispersed throughout the genome and should be very useful for genetic analysis of melon. PMID:15149552

  7. Introduction of large DNA inserts into the barley pathogenic fungus, Ustilago hordei , via recombined binary BAC vectors and Agrobacterium -mediated transformation

    Microsoft Academic Search

    Shawkat Ali; Guus Bakkeren

    2011-01-01

    Genetic transformation of organisms with large genome fragments containing complete genes, with regulatory elements or clusters\\u000a of genes, can contribute to the functional analysis of such genes. However, large inserts, such as those found on bacterial\\u000a artificial chromosome (BAC) clones, are often not easy to transfer. We exploited an existing technique to convert BAC clones,\\u000a containing genomic DNA fragments from

  8. Intra- and interchromosomal rearrangements between cowpea [Vigna unguiculata (L.) Walp.] and common bean (Phaseolus vulgaris L.) revealed by BAC-FISH.

    PubMed

    Vasconcelos, Emanuelle Varão; de Andrade Fonsêca, Artur Fellipe; Pedrosa-Harand, Andrea; de Andrade Bortoleti, Kyria Cilene; Benko-Iseppon, Ana Maria; da Costa, Antônio Félix; Brasileiro-Vidal, Ana Christina

    2015-06-01

    Cowpea (Vigna unguiculata) is an annual legume grown in tropical and subtropical regions, which is economically relevant due to high protein content in dried beans, green pods, and leaves. In this work, a comparative cytogenetic study between V. unguiculata and Phaseolus vulgaris (common bean) was conducted using BAC-FISH. Sequences previously mapped in P. vulgaris chromosomes (Pv) were used as probes in V. unguiculata chromosomes (Vu), contributing to the analysis of macrosynteny between both legumes. Thirty-seven clones from P. vulgaris 'BAT93' BAC library, corresponding to its 11 linkage groups, were hybridized in situ. Several chromosomal rearrangements were identified, such as translocations (between BACs from Pv1 and Pv8; Pv2 and Pv3; as well as Pv2 and Pv11), duplications (BAC from Pv3), as well as paracentric and pericentric inversions (BACs from Pv3, and Pv4, respectively). Two BACs (from Pv2 and Pv7), which hybridized at terminal regions in almost all P. vulgaris chromosomes, showed single-copy signal in Vu. Additionally, 17 BACs showed no signal in V. unguiculata chromosomes. The present results demonstrate the feasibility of using BAC libraries in comparative chromosomal mapping and karyotype evolution studies between Phaseolus and Vigna species, and revealed several macrosynteny and collinearity breaks among both legumes. PMID:25634499

  9. Use of in vitro OmniPlex libraries for high-throughput comparative genomics and molecular haplotyping

    NASA Astrophysics Data System (ADS)

    Kamberov, Emmanuel; Sleptsova, Irina; Suchyta, Stephen; Bruening, Eric D.; Ziehler, William; Seward Nagel, Julie; Langmore, John P.; Makarov, Vladimir

    2002-06-01

    OmniPlex Technology is a new approach to genome amplification and targeted analysis. Initially the entire genome is reformatted into small, amplifiable molecules called Plexisomes, which represent the entire genome as an OmniPlex Library. The whole genome can be amplified en masse using universal primers; using locus-specific primers, regions as large as 50 kb can be amplified. Amplified Plexisomes can be analyzed using conventional methods such as capillary sequencing and microarray hybridization. The advantages to using OmniPlex as the 'front-end' for conventional analytical instruments are that a) the initial copy number of the analytes can be increased to achieve better signal-to-noire ratio, b) only a single priming site is used and c) up to 20 times fewer biochemical reactions and oligonucleotides are necessary to amplify a large region, compared to conventional PCR. These factors make OmniPlex more flexible, faster, and less expensive than conventional technologies. OmniPlex has been applied to targeted sequencing of human, animal, plant, and microorganism genomes. In addition, OmniPlex is inherently able to haplotype large regions of human DNA to accelerate target discovery and pharmacogenomics. OmniPlex will be a key tool for delivery of improved crops and livestock, new pharmaceutical products, and personalized medicine.

  10. Defining Binge Drinking Quantities through Resulting BACs

    PubMed Central

    Lange, James E.; Voas, Robert B.

    2000-01-01

    Binge drinking as a researchable construct has generally been defined as 5 or more drinks on one occasion. However, no study has been conducted to determine if the binge concept that implies “excessive drunkenness” is being optimally captured within that level. Random interviews with breath tests of drinkers returning from visiting bars in Tijuana provide both blood alcohol concentration (BAC) measurements and the self-reported number of drinks consumed. Results indicate that currently used definitions of binge drinking predict relatively low BACs and may not be capturing the “excessive drunkenness” quality of the term. Consumption duration may explain the lower BACs. PMID:11558097

  11. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.

    PubMed

    Zhou, Yuexin; Zhu, Shiyou; Cai, Changzu; Yuan, Pengfei; Li, Chunmei; Huang, Yanyi; Wei, Wensheng

    2014-05-22

    Targeted genome editing technologies are powerful tools for studying biology and disease, and have a broad range of research applications. In contrast to the rapid development of toolkits to manipulate individual genes, large-scale screening methods based on the complete loss of gene expression are only now beginning to be developed. Here we report the development of a focused CRISPR/Cas-based (clustered regularly interspaced short palindromic repeats/CRISPR-associated) lentiviral library in human cells and a method of gene identification based on functional screening and high-throughput sequencing analysis. Using knockout library screens, we successfully identified the host genes essential for the intoxication of cells by anthrax and diphtheria toxins, which were confirmed by functional validation. The broad application of this powerful genetic screening strategy will not only facilitate the rapid identification of genes important for bacterial toxicity but will also enable the discovery of genes that participate in other biological processes. PMID:24717434

  12. PiggyBac transposon mutagenesis: a tool for cancer gene discovery in mice.

    PubMed

    Rad, Roland; Rad, Lena; Wang, Wei; Cadinanos, Juan; Vassiliou, George; Rice, Stephen; Campos, Lia S; Yusa, Kosuke; Banerjee, Ruby; Li, Meng Amy; de la Rosa, Jorge; Strong, Alexander; Lu, Dong; Ellis, Peter; Conte, Nathalie; Yang, Fang Tang; Liu, Pentao; Bradley, Allan

    2010-11-19

    Transposons are mobile DNA segments that can disrupt gene function by inserting in or near genes. Here, we show that insertional mutagenesis by the PiggyBac transposon can be used for cancer gene discovery in mice. PiggyBac transposition in genetically engineered transposon-transposase mice induced cancers whose type (hematopoietic versus solid) and latency were dependent on the regulatory elements introduced into transposons. Analysis of 63 hematopoietic tumors revealed that PiggyBac is capable of genome-wide mutagenesis. The PiggyBac screen uncovered many cancer genes not identified in previous retroviral or Sleeping Beauty transposon screens, including Spic, which encodes a PU.1-related transcription factor, and Hdac7, a histone deacetylase gene. PiggyBac and Sleeping Beauty have different integration preferences. To maximize the utility of the tool, we engineered 21 mouse lines to be compatible with both transposon systems in constitutive, tissue- or temporal-specific mutagenesis. Mice with different transposon types, copy numbers, and chromosomal locations support wide applicability. PMID:20947725

  13. BacDive—the Bacterial Diversity Metadatabase

    PubMed Central

    Söhngen, Carola; Bunk, Boyke; Podstawka, Adam; Gleim, Dorothea; Overmann, Jörg

    2014-01-01

    BacDive—the Bacterial Diversity Metadatabase (http://bacdive.dsmz.de) merges detailed strain-linked information on the different aspects of bacterial and archaeal biodiversity. Currently (release 9/2013), BacDive contains entries for 23 458 strains and provides information on their taxonomy, morphology, physiology, sampling and concomitant environmental conditions as well as molecular biology. Where available, links to access the respective biological resources are given. The majority of the BacDive data is manually annotated and curated. The BacDive portal offers an easy-to-use simple search and in addition powerful advanced search functionalities allowing to combine more than 30 search fields for text and numerical data. The user can compile individual sets of strains to a download selection that can easily be imported into nearly all spreadsheet applications. PMID:24214959

  14. Abstract Rice was transformed with either long DNA-segments of random genomic DNA from

    E-print Network

    Parrott, Wayne

    and behavior of plants transgenic for BACs with random genomic DNA inserts, as compared to those to engineer plants with LDSs. Stable transgenic cell lines have B. H. Phan Æ C. N. Topp Æ C. X. Zhong Æ W. A lines transgenic for BACs with inserts up to 230 kb in size, and plants with a 150-kb BAC insert

  15. Genomics of compositae weeds: EST libraries, microarrays, and evidence of introgression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    • Premise of Study: Weeds cause considerable environmental and economic damage. However, genomic characterization of weeds has lagged behind that of model plants and crop species. Here we report on the development of genomic tools and resources for 11 weeds from the Compositae family that can serve ...

  16. A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila

    Microsoft Academic Search

    Georg Dietzl; Doris Chen; Frank Schnorrer; Kuan-Chung Su; Yulia Barinova; Michaela Fellner; Beate Gasser; Kaolin Kinsey; Silvia Oppel; Susanne Scheiblauer; Africa Couto; Vincent Marra; Krystyna Keleman; Barry J. Dickson

    2007-01-01

    Forward genetic screens in model organisms have provided important insights into numerous aspects of development, physiology and pathology. With the availability of complete genome sequences and the introduction of RNA-mediated gene interference (RNAi), systematic reverse genetic screens are now also possible. Until now, such genome-wide RNAi screens have mostly been restricted to cultured cells and ubiquitous gene inactivation in Caenorhabditis

  17. piggyBac Transposon-Mediated Transgenesis in the Apicomplexan Parasite Eimeria tenella

    PubMed Central

    Su, Huali; Liu, Xianyong; Yan, Wenchao; Shi, Tuanyuan; Zhao, Xinxin; Blake, Damer P.; Tomley, Fiona M.; Suo, Xun

    2012-01-01

    piggyBac, a type II transposon that is useful for efficient transgenesis and insertional mutagenesis, has been used for effective and stable transfection in a wide variety of organisms. In this study we investigate the potential use of the piggyBac transposon system for forward genetics studies in the apicomplexan parasite Eimeria tenella. Using the restriction enzyme-mediated integration (REMI) method, E. tenella sporozoites were electroporated with a donor plasmid containing the enhanced yellow fluorescent protein (EYFP) gene flanked by piggyBac inverted terminal repeats (ITRs), an Asc I-linearized helper plasmid containing the transposase gene and the restriction enzyme Asc I. Subsequently, electroporated sporozoites were inoculated into chickens via the cloacal route and transfected progeny oocysts expressing EYFP were sorted by flow cytometry. A transgenic E. tenella population was selected by successive in vivo passage. Southern-blotting analysis showed that exogenous DNA containing the EYFP gene was integrated into the parasite genome at a limited number of integration sites and that the inserted part of the donor plasmid was the fragment located between the 5? and 3? ITRs as indicated by primer-specific PCR screening. Genome walking revealed that the insertion sites were TTAA-specific, which is consistent with the transposition characteristics of piggyBac. PMID:22768223

  18. An object-oriented framework to organize genomic data 

    E-print Network

    Wei, Ning

    2009-05-15

    Bioinformatics resources should provide simple and flexible support for genomics research. A huge amount of gene mapping data, micro-array expression data, expressed sequence tags (EST), BAC sequence data and genome sequence data are already...

  19. Large Gap Size Paired-end Library Construction for Second Generation Sequencing

    SciTech Connect

    Peng, Ze; Hamilton, Matthew; Froula, Jeff; Ewing, Aren; Foster, Brian; Cheng, Jan-Fang

    2010-05-28

    Fosmid or BAC end sequencing plays an important role in de novo assembly of large genomes like fungi and plants. However construction and Sanger sequencing of fosmid or BAC libraries are laborious and costly. The current 454 Paired-End (PE) Library and Illumina Jumping Library construction protocols are limited with the gap sizes of approximately 20 kb and 8 kb, respectively. In the attempt to understand the limitations of constructing PE libraries with greater than 30Kb gaps, we have purified 18, 28, 45, and 65Kb sheared DNA fragments from yeast and circularized the ends using the Cre-loxP approach described in the 454 PE Library protocol. With the increasing fragment sizes, we found a general trend of decreasing library quality in several areas. First, redundant reads and reads containing multiple loxP linkers increase when the average fragment size increases. Second, the contamination of short distance pairs (<10Kb) increases as the fragment size increases. Third, chimeric rate increases with the increasing fragment sizes. We have modified several steps to improve the quality of the long span PE libraries. The modification includes (1) the use of special PFGE program to reduce small fragment contamination; (2) the increase of DNA samples in the circularization step and prior to the PCR to reduce redundant reads; and (3) the decrease of fragment size in the double SPRI size selection to get a higher frequency of LoxP linker containing reads. With these modifications we have generated large gap size PE libraries with a much better quality.

  20. Microarray-based genomic selection for high-

    E-print Network

    Cai, Long

    artificial chromosome (BAC)-based genomic selection. We demonstrate that large human genomic regions, is in isolating the target DNA to be sequenced. Complex eukaryotic genomes, such as the human genome, are too and selec- tion8, transformation-associated recombination (TAR) cloning9,10, selector technology11

  1. Single haplotype assembly of the human genome from a hydatidiform mole

    PubMed Central

    Steinberg, Karyn Meltz; Schneider, Valerie A.; Graves-Lindsay, Tina A.; Fulton, Robert S.; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A.; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C.; Church, Deanna M.; Eichler, Evan E.; Wilson, Richard K.

    2014-01-01

    A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. PMID:25373144

  2. Single haplotype assembly of the human genome from a hydatidiform mole.

    PubMed

    Steinberg, Karyn Meltz; Schneider, Valerie A; Graves-Lindsay, Tina A; Fulton, Robert S; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C; Church, Deanna M; Eichler, Evan E; Wilson, Richard K

    2014-12-01

    A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. PMID:25373144

  3. Microsatellite Discovery from BAC End Sequences and Genetic Mapping to Anchor the Soybean Physical and Genetic Maps

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Physical maps can be an invaluable resource for improving and assessing the quality of a whole-genome sequence assembly. Here we report the identification and screening of 3,290 microsatellites (SSRs) identified from BAC end sequences of clones comprising the physical map of the cultivar Williams 8...

  4. CONSTRUCTING A CYTOGENETIC MAP OF MAIZE CORE BIN MARKERS IN OAT ADDITION LINES USING SORGHUM BACS AS FISH PROBES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We are developing a pachytene cytogenetic FISH map of the maize genome using sorghum BACs corresponding to the 90 maize Core Bin Marker (CBM) loci. These loci were chosen because they are uniformly distributed and they delineate the genetic bins derived from the UMC98 (Genetic 2005) maize linkage ma...

  5. GENOMICS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genomics is the science of taking a holistic approach to studying the genome. A useful analogy of genomics is that it is like looking at the entire forest, rather than individual trees. Genomics is more a thought process than a science and truly came to fruition when high throughput genetic technolo...

  6. Genomic Libraries and a Host Strain Designed for Highly Efficient Two-Hybrid Selection in Yeast

    Microsoft Academic Search

    Philip James; John Halladay; Elizabeth A. Craig

    1996-01-01

    The twehybrid system is a powerful technique for detecting protein-protein interactions that utilizes the well-developed molecular genetics of the yeast Saccharomyces cermisiae. However, the full potential of this technique has not been realized due to limitations imposed by the components available for use in the system. These limitations include unwieldy plasmid vectors, incomplete or poorly designed two- hybrid libraries, and

  7. Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents

    Microsoft Academic Search

    H. M. Albertsen; H. Abderrahim; H. M. Cann; J. Dausset; D. Le Paslier; D. Cohen

    1990-01-01

    Prior to constructing a library of yeast artificial chromosomes (YACs) containing very large human DNA fragments, the authors performed a series of preliminary experiments aimed at developing a suitable protocol. They found an inverse relationship between YAC insert size and transformation efficiency. Evidence of occasional rearrangement within YAC inserts was found resulting in clonally stable internal deletions or clonally unstable

  8. Final report. Human artificial episomal chromosome (HAEC) for building large genomic libraries

    SciTech Connect

    Jean-Michael H. Vos

    1999-12-09

    Collections of human DNA fragments are maintained for research purposes as clones in bacterial host cells. However for unknown reasons, some regions of the human genome appear to be unclonable or unstable in bacteria. Their team has developed a system using episomes (extrachromosomal, autonomously replication DNA) that maintains large DNA fragments in human cells. This human artificial episomal chromosomal (HAEC) system may prove useful for coverage of these especially difficult regions. In the broader biomedical community, the HAEC system also shows promise for use in functional genomics and gene therapy. Recent improvements to the HAEC system and its application to mapping, sequencing, and functionally studying human and mouse DNA are summarized. Mapping and sequencing the human genome and model organisms are only the first steps in determining the function of various genetic units critical for gene regulation, DNA replication, chromatin packaging, chromosomal stability, and chromatid segregation. Such studies will require the ability to transfer and manipulate entire functional units into mammalian cells.

  9. DEVELOPMENT OF PCR-BASED MARKERS FROM FIBER ESTS AND BAC-END SEQUENCES FOR THE CONSTRUCTION OF A CONSENSUS COTTON GENETIC MAP.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new set of molecular markers known as microsatellites or SSRs were developed from cotton fiber genes (EST) and genomic DNA inserted in bacteria artificial chromosomes (BAC-end sequences). Cotton genomics is in its infancy in that a high density PCR-based molecular map to facilitate marker-assisted...

  10. Development of a pooled probe method for locating small gene families in a physical map of soybean using stress related paralogues and a BAC minimum tile path

    Microsoft Academic Search

    Kay L Shopinski; Muhammad J Iqbal; Jeffry L Shultz; Dheepakkumaran Jayaraman; David A Lightfoot

    2006-01-01

    BACKGROUND: Genome analysis of soybean (Glycine max L.) has been complicated by its paleo-autopolyploid nature and conserved homeologous regions. Landmarks of expressed sequence tags (ESTs) located within a minimum tile path (MTP) of contiguous (contig) bacterial artificial chromosome (BAC) clones or radiation hybrid set can identify stress and defense related gene rich regions in the genome. A physical map of

  11. SplinkBES - A Splinkerette-Based Method for Generating Long End Sequences From Large Insert DNA Libraries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report on the development of a novel splinkerette-based method for generating long end-sequences from large insert library clones, using a carrot (Daucus carota L.) BAC library as a model. The procedure involves digestion of the BAC DNA with a 6-bp restriction enzyme, followed by ligation of spli...

  12. GENOMIC DNA ISOLATION FROM GREEN AND BROWN ALGAE (CAULERPALES AND FUCALES) FOR MICROSATELLITE LIBRARY CONSTRUCTION1

    E-print Network

    Teixeira, Sara

    NOTE GENOMIC DNA ISOLATION FROM GREEN AND BROWN ALGAE (CAULERPALES AND FUCALES) FOR MICROSATELLITE A method for isolating high-quality DNA is pre- sented for the green algae Caulerpa sp. (C. racemosa, C. prolifera, and C. taxifolia) and the brown alga Sargassum muticum. These are introduced, and in- vasive

  13. Screening of Metagenomic and Genomic Libraries Reveals Three Classes of Bacterial Enzymes That Overcome the Toxicity of Acrylate

    PubMed Central

    Curson, Andrew R. J.; Burns, Oliver J.; Voget, Sonja; Daniel, Rolf; Todd, Jonathan D.; McInnis, Kathryn; Wexler, Margaret; Johnston, Andrew W. B.

    2014-01-01

    Acrylate is produced in significant quantities through the microbial cleavage of the highly abundant marine osmoprotectant dimethylsulfoniopropionate, an important process in the marine sulfur cycle. Acrylate can inhibit bacterial growth, likely through its conversion to the highly toxic molecule acrylyl-CoA. Previous work identified an acrylyl-CoA reductase, encoded by the gene acuI, as being important for conferring on bacteria the ability to grow in the presence of acrylate. However, some bacteria lack acuI, and, conversely, many bacteria that may not encounter acrylate in their regular environments do contain this gene. We therefore sought to identify new genes that might confer tolerance to acrylate. To do this, we used functional screening of metagenomic and genomic libraries to identify novel genes that corrected an E. coli mutant that was defective in acuI, and was therefore hyper-sensitive to acrylate. The metagenomic libraries yielded two types of genes that overcame this toxicity. The majority encoded enzymes resembling AcuI, but with significant sequence divergence among each other and previously ratified AcuI enzymes. One other metagenomic gene, arkA, had very close relatives in Bacillus and related bacteria, and is predicted to encode an enoyl-acyl carrier protein reductase, in the same family as FabK, which catalyses the final step in fatty-acid biosynthesis in some pathogenic Firmicute bacteria. A genomic library of Novosphingobium, a metabolically versatile alphaproteobacterium that lacks both acuI and arkA, yielded vutD and vutE, two genes that, together, conferred acrylate resistance. These encode sequential steps in the oxidative catabolism of valine in a pathway in which, significantly, methacrylyl-CoA is a toxic intermediate. These findings expand the range of bacteria for which the acuI gene encodes a functional acrylyl-CoA reductase, and also identify novel enzymes that can similarly function in conferring acrylate resistance, likely, again, through the removal of the toxic product acrylyl-CoA. PMID:24848004

  14. Exploiting Chemical Libraries, Structure, and Genomics in the Search for Kinase Inhibitors

    Microsoft Academic Search

    David J. Lockhart; Sung-Hou Kim; Laurent Meijer; Sophie LeClerc; Georjana Barnes; David O. Morgan; F. Hernan Espinoza; Soojin Kwon; Andy-Mark W. H. Thunnissen; Lisa Wodicka; Nathanael S. Gray; Peter G. Schultz; Thea C. Norman

    1998-01-01

    Selective protein kinase inhibitors were developed on the basis of the unexpected binding mode of 2,6,9-trisubstituted purines to the adenosine triphosphate-binding site of the human cyclin-dependent kinase 2 (CDK2). By iterating chemical library synthesis and biological screening, potent inhibitors of the human CDK2-cyclin A kinase complex and of Saccharomyces cerevisiae Cdc28p were identified. The structural basis for the binding affinity

  15. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    Microsoft Academic Search

    Andrew J Sharp; Sierra Hansen; Rebecca R Selzer; Ze Cheng; Regina Regan; Jane A Hurst; Helen Stewart; Sue M Price; Edward Blair; Raoul C Hennekam; Carrie A Fitzpatrick; Rick Segraves; Todd A Richmond; Cheryl Guiver; Donna G Albertson; Daniel Pinkel; Peggy S Eis; Stuart Schwartz; Samantha J L Knight; Evan E Eichler

    2006-01-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders(1). We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de

  16. Genome Clone Libraries and Data from the Integrated Molecular Analysis of Genomes and their Expression (I.M.A.G.E.) Consortium

    DOE Data Explorer

    The I.M.A.G.E. Consortium was initiated in 1993 by four academic groups on a collaborative basis after informal discussions led to a common vision of how to achieve an important goal in the study of the human genome: the Integrated Molecular Analysis of Genomes and their Expression Consortium's primary goal is to create arrayed cDNA libraries and associated bioinformatics tools, and make them publicly available to the research community. The primary organisms of interest include intensively studied mammalian species, including human, mouse, rat and non-human primate species. The Consortium has also focused on several commonly studied model organisms; as part of this effort it has arrayed cDNAs from zebrafish, and Fugu (pufferfish) as well as Xenopus laevis and X. tropicalis (frog). Utilizing high speed robotics, over nine million individual cDNA clones have been arrayed into 384-well microtiter plates, and sufficient replicas have been created to distribute copies both to sequencing centers and to a network of five distributors located worldwide. The I.M.A.G.E. Consortium represents the world's largest public cDNA collection, and works closely with the National Institutes of Health's Mammalian Gene Collection(MGC) to help it achieve its goal of creating a full-length cDNA clone for every human and mouse gene. I.M.A.G.E. is also a member of the ORFeome Collaboration, working to generate a complete set of expression-ready open reading frame clones representing each human gene. Custom informatics tools have been developed in support of these projects to better allow the research community to select clones of interest and track and collect all data deposited into public databases about those clones and their related sequences. I.M.A.G.E. clones are publicly available, free of any royalties, and may be used by anyone agreeing with the Consortium's guidelines.

  17. New resources inform study of genome size, content, and organization in nonavian reptiles.

    PubMed

    Janes, Daniel E; Organ, Christopher; Valenzuela, Nicole

    2008-10-01

    Genomic resources for studies of nonavian reptiles have recently improved and will reach a new level of access once the genomes of the painted turtle (Chrysemys picta) and the green anole (Anolis carolinensis) have been published. Eleven speakers gathered for a symposium on reptilian genomics and evolutionary genetics at the 2008 meeting of the Society for Integrative and Comparative Biology in San Antonio, Texas. Presentations described results of reptilian genetic studies concerning molecular evolution, chromosomal evolution, genomic architecture, population dynamics, endocrinology and endocrine disruption, and the evolution of developmental mechanisms. The presented studies took advantage of the recent generation of genetic and genomic tools and resources. Novel findings demonstrated the positive impact made by the improved availability of resources like genome annotations and bacterial artificial chromosomes (BACs). The symposium was timely and important because it provided a vehicle for the dissemination of novel findings that advance the field. Moreover, this meeting fostered the synergistic interaction of the participants as a group, which is anticipated to encourage the funding and creation of further resources such as additional BAC libraries and genomic projects. Novel data have already been collected and studies like those presented in this symposium promise to shape and improve our understanding of overall amniote evolution. Additional reptilian taxa such as the American alligator (Alligator mississippiensis), tuatara (Sphenodon punctatus), and garter snake (Thamnophis sirtalis) should be the foci of future genomic projects. We hope that the following articles in this volume will help promote these efforts by describing the conclusions and the potential that the improvement of genomic resources for nonavian reptiles can continue having in this important area of integrative and comparative biology. PMID:21669805

  18. Rapid genomic DNA changes in allotetraploid fish hybrids

    PubMed Central

    Wang, J; Ye, L H; Liu, Q Z; Peng, L Y; Liu, W; Yi, X G; Wang, Y D; Xiao, J; Xu, K; Hu, F Z; Ren, L; Tao, M; Zhang, C; Liu, Y; Hong, Y H; Liu, S J

    2015-01-01

    Rapid genomic change has been demonstrated in several allopolyploid plant systems; however, few studies focused on animals. We addressed this issue using an allotetraploid lineage (4nAT) of freshwater fish originally derived from the interspecific hybridization of red crucian carp (Carassius auratus red var., ?, 2n=100) × common carp (Cyprinus carpio L., ?, 2n=100). We constructed a bacterial artificial chromosome (BAC) library from allotetraploid hybrids in the 20th generation (F20) and sequenced 14 BAC clones representing a total of 592.126?kb, identified 11 functional genes and estimated the guanine–cytosine content (37.10%) and the proportion of repetitive elements (17.46%). The analysis of intron evolution using nine orthologous genes across a number of selected fish species detected a gain of 39 introns and a loss of 30 introns in the 4nAT lineage. A comparative study based on seven functional genes among 4nAT, diploid F1 hybrids (2nF1) (first generation of hybrids) and their original parents revealed that both hybrid types (2nF1 and 4nAT) not only inherited genomic DNA from their parents, but also demonstrated rapid genomic DNA changes (homoeologous recombination, parental DNA fragments loss and formation of novel genes). However, 4nAT presented more genomic variations compared with their parents than 2nF1. Interestingly, novel gene fragments were found for the iqca1 gene in both hybrid types. This study provided a preliminary genomic characterization of allotetraploid F20 hybrids and revealed evolutionary and functional genomic significance of allopolyploid animals. PMID:25669608

  19. Translating the genetic library: the goals, methods, and applications of the Human Genome Project.

    PubMed Central

    Keleher, C

    1993-01-01

    The information produced by the Human Genome Project will have profound effects on the medical community, biotechnology companies, research scientists, and others. The ultimate goal of the project is to locate the approximately 100,000 genes that contain the instructions for creating a human being. Once these genes are found, they can be studied to increase understanding of their role in health and disease. Information about the location of a gene, its function, and its connection to disease will be stored in a variety of computer databases. Medical librarians can help assure that this information reaches the people who need it. To aid in this effort, this paper provides an introduction to the Human Genome Project: its goals, examples of methods used to achieve these goals, the types of information produced, and examples of how this information can be used in medicine and basic research. Because rapid research progress makes it difficult to predict the exact course of the project, this paper will focus on the first five years, 1990-1995. PMID:8374581

  20. Functional Genomics with a Comprehensive Library of Transposon Mutants for the Sulfate-Reducing Bacterium Desulfovibrio alaskensis G20

    PubMed Central

    Kuehl, Jennifer V.; Price, Morgan N.; Ray, Jayashree; Wetmore, Kelly M.; Esquivel, Zuelma; Kazakov, Alexey E.; Nguyen, Michelle; Kuehn, Raquel; Davis, Ronald W.; Hazen, Terry C.; Arkin, Adam P.

    2014-01-01

    ABSTRACT The genomes of sulfate-reducing bacteria remain poorly characterized, largely due to a paucity of experimental data and genetic tools. To meet this challenge, we generated an archived library of 15,477 mapped transposon insertion mutants in the sulfate-reducing bacterium Desulfovibrio alaskensis G20. To demonstrate the utility of the individual mutants, we profiled gene expression in mutants of six regulatory genes and used these data, together with 1,313 high-confidence transcription start sites identified by tiling microarrays and transcriptome sequencing (5? RNA-Seq), to update the regulons of Fur and Rex and to confirm the predicted regulons of LysX, PhnF, PerR, and Dde_3000, a histidine kinase. In addition to enabling single mutant investigations, the D. alaskensis G20 transposon mutants also contain DNA bar codes, which enables the pooling and analysis of mutant fitness for thousands of strains simultaneously. Using two pools of mutants that represent insertions in 2,369 unique protein-coding genes, we demonstrate that the hypothetical gene Dde_3007 is required for methionine biosynthesis. Using comparative genomics, we propose that Dde_3007 performs a missing step in methionine biosynthesis by transferring a sulfur group to O-phosphohomoserine to form homocysteine. Additionally, we show that the entire choline utilization cluster is important for fitness in choline sulfate medium, which confirms that a functional microcompartment is required for choline oxidation. Finally, we demonstrate that Dde_3291, a MerR-like transcription factor, is a choline-dependent activator of the choline utilization cluster. Taken together, our data set and genetic resources provide a foundation for systems-level investigation of a poorly studied group of bacteria of environmental and industrial importance. PMID:24865553

  1. National Library of Medicine

    MedlinePLUS

    ... Catalog & Services History of Medicine Online Exhibitions & Digital Projects Information for Publishers Visit the Library Research at NLM Human Genome Resources Biomedical Research & Informatics Environmental Health & Toxicology Health ...

  2. The MICHR Genomic DNA BioLibrary: An Empirical Study of the Ethics of Biorepository Development.

    PubMed

    Roessler, Blake J; Steneck, Nicholas H; Connally, Lisa

    2015-02-01

    In this article, we report on an effort to study the development and usefulness of a large, broad-use, opt-in biorepository for genomic research, focusing on three ethical issues: providing appropriate understanding, recruiting in ways that do not comprise autonomous decisions, and assessing costs versus benefits. We conclude the following: (a) Understanding can be improved by separating the task of informing subjects from documenting informed consent (Common Rule) and permission to use personal health information and samples for research (Health Insurance Portability and Accountability Act [HIPAA]); however, regulations might have to be changed to accommodate this approach. (b) Changing recruiting methods increases efficiency but can interfere with subject autonomy. (c) Finally, we propose a framework for the objective evaluation of the utility of biorepositories and suggest that more attention needs to be paid to use and sustainability. PMID:25742665

  3. Development of a Genomic Microsatellite Library in Perennial Ryegrass (Lolium perenne) and its Use in Trait Mapping

    PubMed Central

    King, J.; Thorogood, D.; Edwards, K. J.; Armstead, I. P.; Roberts, L.; Skøt, K.; Hanley, Z.; King, I. P.

    2008-01-01

    Background and Aims Perennial ryegrass (Lolium perenne) is one of the key forage and amenity grasses throughout the world. In the UK it accounts for 70 % of all agricultural land use with an estimated farm gate value of £6 billion per annum. However, in terms of the genetic resources available, L. perenne has lagged behind other major crops in Poaceae. The aim of this project was therefore the construction of a microsatellite-enriched genomic library for L. perenne to increase the number of genetic markers available for both marker-assisted selection in breeding programmes and gene isolation. Methods Primers for 229 non-redundant microsatellite markers were designed and used to screen two L. perenne genotypes, one amenity and one forage. Of the 229 microsatellites, 95 were found to show polymorphism between amenity and forage genotypes. A selection of microsatellite primers was selected from these 95 and used to screen two mapping populations derived from intercrossing and backcrossing the two forage and amenity grass genotypes. Key Results and Conclusions The utility of the resulting genetic maps for analysis of the genetic control of target traits was demonstrated by the mapping of genes associated with heading date to linkage groups 4 and 7. PMID:18281692

  4. Generation of a Complete Single-Gene Knockout Bacterial Artificial Chromosome Library of Cowpox Virus and Identification of Its Essential Genes

    PubMed Central

    Xu, Zhiyong; Zikos, Dimitrios; Osterrieder, Nikolaus

    2014-01-01

    Cowpox virus (CPXV) belongs to the genus Orthopoxvirus in the Poxviridae family. It infects a broad range of vertebrates and can cause zoonotic infections. CPXV has the largest genome among the orthopoxviruses and is therefore considered to have the most complete set of genes of all members of the genus. Since CPXV has also become a model for studying poxvirus genetics and pathogenesis, we created and characterized a complete set of single gene knockout bacterial artificial chromosome (BAC) clones of the CPXV strain Brighton Red. These mutants allow a systematic assessment of the contribution of single CPXV genes to the outcome of virus infection and replication, as well as to the virus host range. A full-length BAC clone of CPXV strain Brighton Red (pBRF) harboring the gene expressing the enhanced green fluorescent protein under the control of a viral late promoter was modified by introducing the mrfp1 gene encoding the monomeric red fluorescent protein driven by a synthetic early vaccinia virus promoter. Based on the modified BAC (pBRFseR), a library of targeted knockout mutants for each single viral open reading frame (ORF) was generated. Reconstitution of infectious virus was successful for 109 of the 183 mutant BAC clones, indicating that the deleted genes are not essential for virus replication. In contrast, 74 ORFs were identified as essential because no virus progeny was obtained upon transfection of the mutant BAC clones and in the presence of a helper virus. More than 70% of all late CPXV genes belonged to this latter group of essential genes. PMID:24155400

  5. Modification of bacterial artificial chromosomes (BACs) and preparation of intact BAC DNA for generation of transgenic mice.

    PubMed

    Gong, Shiaoching; Yang, X William

    2005-05-01

    BAC transgenesis is a powerful tool for the study of gene expression and gene function in the mouse in vivo. In this unit, detailed protocols are provided for modification (i.e., marker gene insertion, deletion, or point mutation) of BACs by homologous recombination in E. coli. This method utilizes a shuttle vector that allows transient expression of the E. coli RecA gene to support homologous recombination in the BAC host bacteria. In addition, two protocols are provided for purification of BAC DNA for microinjection to generate transgenic mice. Since BAC DNA is prone to degradation, which may introduce positional effects in transgenic mice, two methods are given for purification of intact BAC DNA for subsequent microinjection. PMID:18428623

  6. Efficient transformation of the yellow fever mosquito Aedes aegypti using the piggyBac transposable element vector pBac[3xP3-EGFP afm].

    PubMed

    Kokoza, V; Ahmed, A; Wimmer, E A; Raikhel, A S

    2001-11-01

    We report efficient germ-line transformation in the yellow fever mosquito Aedes aegypti accomplished using the piggyBac transposable element vector pBac[3xP3-EGFP afm]. Two transgenic lines were established and characterized; each contained the Vg-Defensin A transgene with strong eye-specific expression of the enhanced green fluorescent protein (EGFP) marker gene regulated by the artificial 3xP3 promoter. Southern blot hybridization and inverse PCR analyses of genomic DNA demonstrated a precise piggyBac-mediated, single copy insertion of the pBac[3xP3-EGFP afm,Vg-DefA] transposon in each transgenic line. For each line, genetic analysis confirmed stability and integrity of the entire transposon construct in the mosquito genome through the G2-G6 generations. Successful establishment of homozygous transgenic lines indicated that in both cases a non-lethal integration of the transposon into the mosquito genome had occurred. The 3xP3-EGFP marker was tested in mosquitoes with different genetic backgrounds. In white-eyed transgenic mosquitoes, the strong eye-specific expression of GFP was observed throughout all stages of development, starting from newly hatched first instar larvae to adults. A similar level and pattern of fluorescence was observed in red-eyed mosquitoes that were generated by crossing the 3xP3-EGFP transformants with the kh(w) white-eye mosquitoes transformed with the Drosophila cinnabar gene. Importantly, the utility of the 3xP3-EGFP, as marker gene for transformation of wild type mosquitoes, was demonstrated by strong eye-specific GFP expression in larval and pupal stages of black-eyed hybrids of the 3xP3-EGFP white-eye transformants and the wild type Rockefeller/UGAL strain. Finally, analysis of the Vg-DefA transgene expression in transformants from two established lines demonstrated strong blood-meal activation and fat-body-specific expression regulated by the Vg 1.8-kb 5' upstream region. PMID:11583926

  7. piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice

    PubMed Central

    Li, Rongbo; Zhuang, Yuan; Han, Min; Xu, Tian; Wu, Xiaohui

    2013-01-01

    SUMMARY The stable genomic integration and expression of a large transgene is a major hurdle in gene therapy. We show that the modified piggyBac (PB) transposon system can be used to introduce a 207 kb genomic DNA fragment containing the ROR?/?t locus into human cells and mice. PB-mediated transgenesis results in a single copy of a stably inherited and expressed transgene. These results indicate that PB could serve as an effective high-capacity vector for functional analysis of the mammalian genome and for gene therapy in human cells. PMID:23519027

  8. Sugarcane genome sequencing by methylation filtration provides tools for genomic research in the genus Saccharum.

    PubMed

    Grativol, Clícia; Regulski, Michael; Bertalan, Marcelo; McCombie, W Richard; da Silva, Felipe Rodrigues; Zerlotini Neto, Adhemar; Vicentini, Renato; Farinelli, Laurent; Hemerly, Adriana Silva; Martienssen, Robert A; Ferreira, Paulo Cavalcanti Gomes

    2014-07-01

    Many economically important crops have large and complex genomes that hamper their sequencing by standard methods such as whole genome shotgun (WGS). Large tracts of methylated repeats occur in plant genomes that are interspersed by hypomethylated gene-rich regions. Gene-enrichment strategies based on methylation profiles offer an alternative to sequencing repetitive genomes. Here, we have applied methyl filtration with McrBC endonuclease digestion to enrich for euchromatic regions in the sugarcane genome. To verify the efficiency of methylation filtration and the assembly quality of sequences submitted to gene-enrichment strategy, we have compared assemblies using methyl-filtered (MF) and unfiltered (UF) libraries. The use of methy filtration allowed a better assembly by filtering out 35% of the sugarcane genome and by producing 1.5× more scaffolds and 1.7× more assembled Mb in length compared with unfiltered dataset. The coverage of sorghum coding sequences (CDS) by MF scaffolds was at least 36% higher than by the use of UF scaffolds. Using MF technology, we increased by 134× the coverage of gene regions of the monoploid sugarcane genome. The MF reads assembled into scaffolds that covered all genes of the sugarcane bacterial artificial chromosomes (BACs), 97.2% of sugarcane expressed sequence tags (ESTs), 92.7% of sugarcane RNA-seq reads and 98.4% of sorghum protein sequences. Analysis of MF scaffolds from encoded enzymes of the sucrose/starch pathway discovered 291 single-nucleotide polymorphisms (SNPs) in the wild sugarcane species, S. spontaneum and S. officinarum. A large number of microRNA genes was also identified in the MF scaffolds. The information achieved by the MF dataset provides a valuable tool for genomic research in the genus Saccharum and for improvement of sugarcane as a biofuel crop. PMID:24773339

  9. Research review paper Genome-scale genetic engineering in Escherichia coli

    E-print Network

    Bang, Duhee

    Research review paper Genome-scale genetic engineering in Escherichia coli Jaehwan Jeong 1 , Namjin cells. Escherichia coli has been a particularly good model organism for bac- terial genome engineering Keywords: Genome engineering Red recombination Multiplex automated genome engineering Genome engineering

  10. Novel sequencing strategy for repetitive DNA in a Drosophila BAC clone reveals that the centromeric region of the Y chromosome evolved from a telomerey

    Microsoft Academic Search

    Jadwiga Wild; Siobhan L. Whitehead; Alan Tracey; Beatriz de Pablos; Jane Rogers; Waclaw Szybalski; Alfredo Villasante

    The centromeric and telomeric heterochromatin of eukaryotic chromosomes is mainly composed of middle-repetitive elements, such as transposable elements and tandemly repeated DNA sequences. Because of this repetitive nature, Whole Genome Shotgun Projects have failed in sequencing these regions. We describe a novel kind of transposon- based approach for sequencing highly repetitive DNA sequences in BAC clones. The key to this

  11. High throughput genome-specific and gene-specific molecular markers for erucic acid genes in Brassica napus (L.) for marker-assisted selection in plant breeding.

    PubMed

    Rahman, Mukhlesur; Sun, Zudong; McVetty, Peter B E; Li, Genyi

    2008-10-01

    A single base change in the Bn-FAE1.1 gene in the A genome and a two-base deletion in the Bn-FAE1.2 gene in the C genome produce the nearly zero content of erucic acid observed in canola. A BAC clone anchoring Bn-FAE1.1 from a B. rapa BAC library and a BAC clone anchoring Bn-FAE1.2 from a B. oleracea BAC library were used in this research. After sequencing the gene flanking regions, it was found that the dissimilarity of the flanking sequences of these two FAE1 homologs facilitated the design of genome-specific primers that could amplify the corresponding genome in allotetraploid B. napus. The two-base deletion in the C genome gene was detected as a sequence-characterized amplified region (SCAR) marker. To increase the throughput, one genome-specific primer was labeled with four fluorescence dyes and combined with 20 different primers to produce PCR products with different fragment sizes. Eventually, a super pool of 80 samples was detected simultaneously. This dramatically reduces the cost of marker detection. The single base change in the Bn-FAE1.1 gene was detected as single nucleotide polymorphic (SNP) marker with an ABI SNaPshot kit. A multiplexing primer set was designed by adding a polyT to the 5' primer end to increase SNP detection throughput through sample pooling. Furthermore, the Bn-FAE1.1 and Bn-FAE1.2 were integrated into the N8 and N13 linkage groups of our previously reported high-density sequence-related amplified polymorphism (SRAP) map, respectively. There were 124 SRAP markers in a N8 bin in which the Bn-FAE1.1 gene-specific SCAR marker was located and 46 SRAP markers in a N13 bin into which the Bn-FAE1.2 SNP marker was integrated. These three kinds of high throughput molecular markers have been successfully implemented in our canola/rapeseed breeding programs. PMID:18633592

  12. High resolution microarray comparative genomic hybridisation analysis using spotted oligonucleotides

    Microsoft Academic Search

    B Carvalho; E Ouwerkerk; G. A. Meijer; B. Ylstra

    2004-01-01

    BACKGROUND: Currently, comparative genomic hybridisation array (array CGH) is the method of choice for studying genome wide DNA copy number changes. To date, either amplified representations of bacterial artificial chromosomes (BACs)\\/phage artificial chromosomes (PACs) or cDNAs have been spotted as probes. The production of BAC\\/PAC and cDNA arrays is time consuming and expensive. AIM: To evaluate the use of spotted

  13. A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells

    PubMed Central

    Ku, Amy T.; Fan, Hsiang-Hsuan; Lee, Tung-Lung; Huang, Yung-Hsin; Yang, Tsung-Lin; Su, I-Chang; Yu, I-Shing; Lin, Shu-Wha; Chien, Chung-Liang; Ho, Hong-Nerng; Chen, You-Tzung

    2014-01-01

    PiggyBac is a prevalent transposon system used to deliver transgenes and functionally explore the mammalian untouched genomic territory. The important features of piggyBac transposon are the relatively low insertion site preference and the ability of seamless removal from genome, which allow its potential uses in functional genomics and regenerative medicine. Efforts to increase its transposition efficiency in mammals were made through engineering the corresponding transposase (PBase) codon usage to enhance its expression level and through screening for mutant PBase variants with increased enzyme activity. To improve the safety for its potential use in regenerative medicine applications, site-specific transposition was achieved by using engineered zinc finger- and Gal4-fused PBases. An excision-prone PBase variant has also been successfully developed. Here we describe the construction of a nucleolus-predominant PBase, NP-mPB, by adding a nucleolus-predominant (NP) signal peptide from HIV-1 TAT protein to a mammalian codon-optimized PBase (mPB). Although there is a predominant fraction of the NP-mPB-tGFP fusion proteins concentrated in the nucleoli, an insertion site preference toward nucleolar organizer regions is not detected. Instead a 3–4 fold increase in piggyBac transposition efficiency is reproducibly observed in mouse and human cells. PMID:24586748

  14. Physical mapping of the rice genome with BACs

    Microsoft Academic Search

    Hong-Bin Zhang; Rod A. Wing

    1997-01-01

    The development of genetics in this century has been catapulted forward by several milestones: rediscovery of Mendel's laws, determination of DNA as the genetic material, discovery of the double-helix structure of DNA and its implications for genetic behavior, and most recently, analysis of restriction fragment length polymorphisms (RFLPs). Each of these milestones has generated a huge wave of progress in

  15. PLE-wu, a new member of piggyBac transposon family from insect, is active in mammalian cells.

    PubMed

    Wu, Chunxiao; Wang, Shu

    2014-10-01

    piggyBac, a highly active transposon in insect and mammalian cells, is a very useful tool in genome manipulation. A new piggyBac-like element (PLE), named PLE-wu, was identified from a mutant baculovirus cultured in sf9 insect cells. This new transposon is 2931 bp in length and encodes two active forms of transposase, a 708-amino acid-long transposase and a short 576-residue-long transposase translated from a downstream in-frame initiation codon. PLE-wu has asymmetric terminal structures, containing 6-bp inverted terminal repeats, 32-bp imperfect inverted and direct sub-terminal repeats. Similar to piggyBac, PLE-wu exhibits traceless excision activity in both insect and mammalian cells, restoring the original TTAA target sequence upon excision. It also retains the insertion activity in mammalian cells with a plasmid to chromosome transposition rate about 10-fold higher than random integration. Plasmid rescue assays revealed that the TTAA target sequence was duplicated at the junctions of the insertion site. Deletion of the terminal sequences including the sub-terminal repeats decreased the transposition activity of the 708-residue-long transposase, while the transposition activity of the short form of transposase was not affected. With its low sequence similarity to piggyBac, PLE-wu will contribute to the understanding the mechanism of PLE transposition, as well as design of new transposon systems with higher activity. PMID:24751435

  16. Illuminating choices for library prep: a comparison of library preparation methods for whole genome sequencing of Cryptococcus neoformans using Illumina HiSeq.

    PubMed

    Rhodes, Johanna; Beale, Mathew A; Fisher, Matthew C

    2014-01-01

    The industry of next-generation sequencing is constantly evolving, with novel library preparation methods and new sequencing machines being released by the major sequencing technology companies annually. The Illumina TruSeq v2 library preparation method was the most widely used kit and the market leader; however, it has now been discontinued, and in 2013 was replaced by the TruSeq Nano and TruSeq PCR-free methods, leaving a gap in knowledge regarding which is the most appropriate library preparation method to use. Here, we used isolates from the pathogenic fungi Cryptococcus neoformans var. grubii and sequenced them using the existing TruSeq DNA v2 kit (Illumina), along with two new kits: the TruSeq Nano DNA kit (Illumina) and the NEBNext Ultra DNA kit (New England Biolabs) to provide a comparison. Compared to the original TruSeq DNA v2 kit, both newer kits gave equivalent or better sequencing data, with increased coverage. When comparing the two newer kits, we found little difference in cost and workflow, with the NEBNext Ultra both slightly cheaper and faster than the TruSeq Nano. However, the quality of data generated using the TruSeq Nano DNA kit was superior due to higher coverage at regions of low GC content, and more SNPs identified. Researchers should therefore evaluate their resources and the type of application (and hence data quality) being considered when ultimately deciding on which library prep method to use. PMID:25409295

  17. Second-generation genetic linkage map of catfish and its integration with the BAC-based physical map.

    PubMed

    Ninwichian, Parichart; Peatman, Eric; Liu, Hong; Kucuktas, Huseyin; Somridhivej, Benjaporn; Liu, Shikai; Li, Ping; Jiang, Yanliang; Sha, Zhenxia; Kaltenboeck, Ludmilla; Abernathy, Jason W; Wang, Wenqi; Chen, Fei; Lee, Yoona; Wong, Lilian; Wang, Shaolin; Lu, Jianguo; Liu, Zhanjiang

    2012-10-01

    Construction of high-density genetic linkage maps is crucially important for quantitative trait loci (QTL) studies, and they are more useful when integrated with physical maps. Such integrated maps are valuable genome resources for fine mapping of QTL, comparative genomics, and accurate and efficient whole-genome assembly. Previously, we established both linkage maps and a physical map for channel catfish, Ictalurus punctatus, the dominant aquaculture species in the United States. Here we added 2030 BAC end sequence (BES)-derived microsatellites from 1481 physical map contigs, as well as markers from singleton BES, ESTs, anonymous microsatellites, and SNPs, to construct a second-generation linkage map. Average marker density across the 29 linkage groups reached 1.4 cM/marker. The increased marker density highlighted variations in recombination rates within and among catfish chromosomes. This work effectively anchored 44.8% of the catfish BAC physical map contigs, covering ~52.8% of the genome. The genome size was estimated to be 2546 cM on the linkage map, and the calculated physical distance per centimorgan was 393 Kb. This integrated map should enable comparative studies with teleost model species as well as provide a framework for ordering and assembling whole-genome scaffolds. PMID:23050234

  18. Two large-insert soybean genomic libraries constructed in a binary vector: applications in chromosome walking and genome wide physical mapping

    Microsoft Academic Search

    K. Meksem; K. Zobrist; E. Ruben; D. Hyten; T. Quanzhou; H. B. Zhang; D. A. Lightfoot

    2000-01-01

    Large DNA insert libraries in binary T-DNA vectors can assist in the isolation of the gene(s) underlying a quantitative trait\\u000a locus (QTL). Binary vectors facilitate the transfer of large-insert DNA fragments containing a QTL from E. coli to Agrobacterium sp. and then to plants. We constructed two soybean large-insert libraries from cv. Forrest in the pCLD04541 (V41) binary\\u000a vector after

  19. Availability of birth defects and genetic disease information in public libraries -- implications for the Human Genome Project

    Microsoft Academic Search

    S. Sell; E. Gettig; J. J. Mulvihill

    1994-01-01

    In order to better educate the public about birth defects and genetic diseases\\/testing, access to information is critical. The public library system of the United States is extensive and serves as an invaluable resource to citizens. We surveyed reference librarians at each of 87 public libraries in Allegheny and Westmoreland Counties, Pennsylvania. The study design included a questionnaire to ascertain

  20. Whole genome linkage disequilibrium maps in cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bovine whole genome linkage disequilibrium maps were constructed for eight breeds of cattle. These data provide fundamental information concerning bovine genome organization which will allow the design of studies to associate genetic variation with economically important traits and also provides bac...

  1. Retrofitting BACs with G418 resistance, luciferase, and oriP and EBNA-1 – new vectors for in vitro and in vivo delivery

    PubMed Central

    Magin-Lachmann, Christine; Kotzamanis, George; D'Aiuto, Leonardo; Wagner, Ernst; Huxley, Clare

    2003-01-01

    Background Bacterial artificial chromosomes (BACs) have been used extensively for sequencing the human and mouse genomes and are thus readily available for most genes. The large size of BACs means that they can generally carry intact genes with all the long range controlling elements that drive full levels of tissue-specific expression. For gene expression studies and gene therapy applications it is useful to be able to retrofit the BACs with selectable genes such as G418 resistance, reporter genes such as luciferase, and oriP/EBNA-1 from Epstein Barr virus which allows long term episomal maintenance in mammalian cells. Results We describe a series of retrofitting plasmids and a protocol for in vivo loxP/Cre recombination. The vector pRetroNeo carries a G418 resistance cassette, pRetroNeoLuc carries G418 resistance and a luciferase expression cassette, pRetroNeoLucOE carries G418 resistance, luciferase and an oriP/EBNA-1 cassette and pRetroNeoOE carries G418 resistance and oriP/EBNA-1. These vectors can be efficiently retrofitted onto BACs without rearrangement of the BAC clone. The luciferase cassette is expressed efficiently from the retrofitting plasmids and from retrofitted BACs after transient transfection of B16F10 cells in tissue culture and after electroporation into muscles of BALB/c mice in vivo. We also show that a BAC carrying GFP, oriP and EBNA-1 can be transfected into B16F10 cells with Lipofectamine 2000 and can be rescued intact after 5 weeks. Conclusion The pRetro vectors allow efficient retrofitting of BACs with G418 resistance, luciferase and/or oriP/EBNA-1 using in vivo expression of Cre. The luciferase reporter gene is expressed after transient transfection of retrofitted BACs into cells in tissue culture and after electroporation into mouse muscle in vivo. OriP/EBNA-1 allows stable maintenance of a 150-kb BAC without rearrangement for at least 5 weeks. PMID:12609052

  2. [The improvement and application of piggyBac transposon system in mammals].

    PubMed

    Qian, Qiujie; Che, Jiaqian; Ye, Lupeng; Zhong, Boxiong

    2014-10-01

    The piggyBac (PB) transposon system is a useful genomic engineering tool due to its high transposition efficiency, precise excision, semi-random insertion and large cargo capacity. But, it still needs to further improve the transgenic efficiency and reduce the risk of endogenous disruption caused by the random insertion of exogenous gene, especially in transgenic experiments of individual mammals. In recent studies, the PB transposase is fused with a DNA binding protein as a chimeric protein, which can guide the transposon to pre-designed loci. Besides, PB transposases obtained by mutagenesis have dramatically enhanced transposition activity and generated a novel function which is excision competent and integration defective. Furthermore, PB transposon system can carry large exogenous DNA fragments up to 207 kb when combining with the bacterial artificial chromosome vector. So far, these modified transposon systems have been widely applied in genome studies, gene therapy and induced pluripotent stem cells (iPS cells). In this study, we review the latest studies on piggyBac transposon system and its application prospect. PMID:25406244

  3. Isolation and sequence analysis of the wheat B genome subtelomeric DNA

    PubMed Central

    Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

    2009-01-01

    Background Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. Results The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119 737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11 666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Conclusion Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time that Spelt52 sequences were involved in the evolution of terminal regions of common wheat chromosomes. Our research provides new insights into the microcollinearity in the terminal regions of wheat chromosomes 4BL and rice chromosome 3S. PMID:19732459

  4. Sample sequencing of a Salmonella typhimurium LT2 lambda library: comparison to the Escherichia coli K12 genome

    Microsoft Academic Search

    Rita M.-Y. Wong; K. K. Wong; Nicholas R. Benson; Michael McClelland

    1999-01-01

    As part of the ongoing sequencing of the complete Salmonella typhimurium LT2 genome, a partly ordered set of 416 lambda clones has been developed, representing over 90% of the genome. The average insert size is 17 kb. Sequences were obtained from both ends of each clone in this set. A total of over 600 kb of sequence has been deposited

  5. Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assay

    Microsoft Academic Search

    Shirin Khambata-Ford; Yueyi Liu; Christopher Gleason; Mark Dickson; Russ B. Altman; Serafim Batzoglou; Richard M. Myers

    2003-01-01

    Attempts to identify regulatory sequences in the human genome have involved experimental and computational methods such as cross-species sequence comparisons and the detection of transcription factor binding-site motifs in coexpressed genes. Although these strategies provide information on which genomic regions are likely to be involved in gene regulation, they do not give information on their functions. We have developed a

  6. Abstract Rice was transformed with either long DNA-segments of random genomic DNA from

    E-print Network

    and behavior of plants transgenic for BACs with random genomic DNA inserts, as compared to those to engineer plants with LDSs. Stable transgenic cell lines have B. H. Phan Æ C. N. Topp Æ C. X. Zhong Æ W. A border junctions in transgenic plants (Choi et al. 2000). Most recently, a BAC with a 45-kb insert from

  7. Germline transformation of the sawfly, Athalia rosae (Hymenoptera: Symphyta), mediated by a piggyBac-derived vector.

    PubMed

    Sumitani, M; Yamamoto, D S; Oishi, K; Lee, J M; Hatakeyama, M

    2003-04-01

    A piggyBac construct carrying two green fluorescent protein (GFP)-coding sequences one driven by Bombyx mori actin gene promoter and the other by Drosophila melanogaster heat-shock protein 70 (hsp70) promoter were injected together with a nonautonomous helper plasmid containing an active piggyBac transposase gene into the posterior end of mature unfertilized eggs dissected from the ovaries of Athalia rosae (Hymenoptera: Symphyta). These injected eggs, which developed as haploid male embryos upon artificial activation, were cultured to adulthood. Of 278 injected eggs, 61 grew to G(0) haploid adult males. These G(0) haploid males were individually mated to diploid females. The progeny embryos (G(1) generation) were examined for GFP expression. Four GFP-positive embryos (from three independent G(0) matings) were obtained. Two eclosed as diploid adult G(1) females. Mature unfertilized eggs dissected from the GFP-positive G(1) diploid females were activated artificially, and the resultant embryos were examined for GFP expression, separated and cultured to adulthood (G(2) generation). The G(2) haploid embryos segregated to GFP-positive and -negative individuals. By mating the G(2) adult haploid males individually to diploid females, stocks were established in which the piggyBac construct was stably integrated into the genome, as evidenced by GFP expression and Southern blot hybridization. The piggyBac transposition occurred at its canonical target TTAA sequence. These results, which demonstrate the first successful stable transposon-mediated germline transformation in Hymenoptera, will expand the usefulness of the piggyBac vector. PMID:12650693

  8. Optimization of the piggyBac Transposon Using mRNA and Insulators: Toward a More Reliable Gene Delivery System

    PubMed Central

    Bire, Solenne; Ley, Déborah; Casteret, Sophie; Mermod, Nicolas; Bigot, Yves; Rouleux-Bonnin, Florence

    2013-01-01

    Integrating and expressing stably a transgene into the cellular genome remain major challenges for gene-based therapies and for bioproduction purposes. While transposon vectors mediate efficient transgene integration, expression may be limited by epigenetic silencing, and persistent transposase expression may mediate multiple transposition cycles. Here, we evaluated the delivery of the piggyBac transposase messenger RNA combined with genetically insulated transposons to isolate the transgene from neighboring regulatory elements and stabilize expression. A comparison of piggyBac transposase expression from messenger RNA and DNA vectors was carried out in terms of expression levels, transposition efficiency, transgene expression and genotoxic effects, in order to calibrate and secure the transposition-based delivery system. Messenger RNA reduced the persistence of the transposase to a narrow window, thus decreasing side effects such as superfluous genomic DNA cleavage. Both the CTF/NF1 and the D4Z4 insulators were found to mediate more efficient expression from a few transposition events. We conclude that the use of engineered piggyBac transposase mRNA and insulated transposons offer promising ways of improving the quality of the integration process and sustaining the expression of transposon vectors. PMID:24312663

  9. From raw materials to validated system: the construction of a genomic library and microarray to interpret systemic perturbations in Northern bobwhite.

    PubMed

    Rawat, Arun; Gust, Kurt A; Deng, Youping; Garcia-Reyero, Natàlia; Quinn, Michael J; Johnson, Mark S; Indest, Karl J; Elasri, Mohamed O; Perkins, Edward J

    2010-07-01

    The limited availability of genomic tools and data for nonmodel species impedes computational and systems biology approaches in nonmodel organisms. Here we describe the development, functional annotation, and utilization of genomic tools for the avian wildlife species Northern bobwhite (Colinus virginianus) to determine the molecular impacts of exposure to 2,6-dinitrotoluene (2,6-DNT), a field contaminant of military concern. Massively parallel pyrosequencing of a normalized multitissue library of Northern bobwhite cDNAs yielded 71,384 unique transcripts that were annotated with gene ontology (GO), pathway information, and protein domain analysis. Comparative genome analyses with model organisms revealed functional homologies in 8,825 unique Northern bobwhite genes that are orthologous to 48% of Gallus gallus protein-coding genes. Pathway analysis and GO enrichment of genes differentially expressed in livers of birds exposed for 60 days (d) to 10 and 60 mg/kg/d 2,6-DNT revealed several impacts validated by RT-qPCR including: prostaglandin pathway-mediated inflammation, increased expression of a heme synthesis pathway in response to anemia, and a shift in energy metabolism toward protein catabolism via inhibition of control points for glucose and lipid metabolic pathways, PCK1 and PPARGC1, respectively. This research effort provides the first comprehensive annotated gene library for Northern bobwhite. Transcript expression analysis provided insights into the metabolic perturbations underlying several observed toxicological phenotypes in a 2,6-DNT exposure case study. Furthermore, the systemic impact of dinitrotoluenes on liver function appears conserved across species as PPAR signaling is similarly affected in fathead minnow liver tissue after exposure to 2,4-DNT. PMID:20406850

  10. From raw materials to validated system: the construction of a genomic library and microarray to interpret systemic perturbations in Northern bobwhite

    PubMed Central

    Rawat, Arun; Deng, Youping; Garcia-Reyero, Natàlia; Quinn, Michael J.; Johnson, Mark S.; Indest, Karl J.; Elasri, Mohamed O.; Perkins, Edward J.

    2010-01-01

    The limited availability of genomic tools and data for nonmodel species impedes computational and systems biology approaches in nonmodel organisms. Here we describe the development, functional annotation, and utilization of genomic tools for the avian wildlife species Northern bobwhite (Colinus virginianus) to determine the molecular impacts of exposure to 2,6-dinitrotoluene (2,6-DNT), a field contaminant of military concern. Massively parallel pyrosequencing of a normalized multitissue library of Northern bobwhite cDNAs yielded 71,384 unique transcripts that were annotated with gene ontology (GO), pathway information, and protein domain analysis. Comparative genome analyses with model organisms revealed functional homologies in 8,825 unique Northern bobwhite genes that are orthologous to 48% of Gallus gallus protein-coding genes. Pathway analysis and GO enrichment of genes differentially expressed in livers of birds exposed for 60 days (d) to 10 and 60 mg/kg/d 2,6-DNT revealed several impacts validated by RT-qPCR including: prostaglandin pathway-mediated inflammation, increased expression of a heme synthesis pathway in response to anemia, and a shift in energy metabolism toward protein catabolism via inhibition of control points for glucose and lipid metabolic pathways, PCK1 and PPARGC1, respectively. This research effort provides the first comprehensive annotated gene library for Northern bobwhite. Transcript expression analysis provided insights into the metabolic perturbations underlying several observed toxicological phenotypes in a 2,6-DNT exposure case study. Furthermore, the systemic impact of dinitrotoluenes on liver function appears conserved across species as PPAR signaling is similarly affected in fathead minnow liver tissue after exposure to 2,4-DNT. PMID:20406850

  11. Chromosome region-specific libraries for human genome analysis. Progress report, September 1, 1991--August 31, 1992

    SciTech Connect

    Kao, Fa-Ten

    1992-08-01

    During the grant period progress has been made in the successful demonstration of regional mapping of microclones derived from microdissection libraries; successful demonstration of the feasibility of converting microclones with short inserts into yeast artificial chromosome clones with very large inserts for high resolution physical mapping of the dissected region; Successful demonstration of the usefulness of region-specific microclones to isolate region-specific cDNA clones as candidate genes to facilitate search for the crucial genes underlying genetic diseases assigned to the dissected region; and the successful construction of four region-specific microdissection libraries for human chromosome 2, including 2q35-q37, 2q33-q35, 2p23-p25 and 2p2l-p23. The 2q35-q37 library has been characterized in detail. The characterization of the other three libraries is in progress. These region-specific microdissection libraries and the unique sequence microclones derived from the libraries will be valuable resources for investigators engaged in high resolution physical mapping and isolation of disease-related genes residing in these chromosomal regions.

  12. A Genomic-Scale Artificial MicroRNA Library as a Tool to Investigate the Functionally Redundant Gene Space in Arabidopsis[W

    PubMed Central

    Hauser, Felix; Chen, Wenxiao; Deinlein, Ulrich; Chang, Kenneth; Ossowski, Stephan; Fitz, Joffrey; Hannon, Gregory J.; Schroeder, Julian I.

    2013-01-01

    Traditional forward genetic screens are limited in the identification of homologous genes with overlapping functions. Here, we report the analyses and assembly of genome-wide protein family definitions that comprise the largest estimate for the potentially redundant gene space in Arabidopsis thaliana. On this basis, a computational design of genome-wide family-specific artificial microRNAs (amiRNAs) was performed using high-performance computing resources. The amiRNA designs are searchable online (http://phantomdb.ucsd.edu). A computationally derived library of 22,000 amiRNAs was synthesized in 10 sublibraries of 1505 to 4082 amiRNAs, each targeting defined functional protein classes. For example, 2964 amiRNAs target annotated DNA and RNA binding protein families and 1777 target transporter proteins, and another sublibrary targets proteins of unknown function. To evaluate the potential of an amiRNA-based screen, we tested 122 amiRNAs targeting transcription factor, protein kinase, and protein phosphatase families. Several amiRNA lines showed morphological phenotypes, either comparable to known phenotypes of single and double/triple mutants or caused by overexpression of microRNAs. Moreover, novel morphological and abscisic acid–insensitive seed germination mutants were identified for amiRNAs targeting zinc finger homeodomain transcription factors and mitogen-activated protein kinase kinase kinases, respectively. These resources provide an approach for genome-wide genetic screens of the functionally redundant gene space in Arabidopsis. PMID:23956262

  13. Framework for a physical map of the human 22q13 region using bacterial artificial chromosomes (BACs)

    SciTech Connect

    Schmitt, H.; Kim, Ung-Jin; Slepak, T. [California Institute of Technology, Pasadena, CA (United States)] [and others] [California Institute of Technology, Pasadena, CA (United States); and others

    1996-04-01

    Detailed physical maps of entire chromosomes based on combined genetic, cytogenetic, and structural information are essential components for positional cloning and genomic sequencing. Despite the wealth of genetic information of the known diseases in the chromosome 22q13 region, the construction of a detailed physical map of the terminal region is difficult due to the sparsity of the genetic markers. We present here a map of bacterial artificial chromosome (BAC) contigs that cover a number of genetic loci in the 22q13 region. One hundred thirty-six BACs with an average insert size of 140 kb are assembled into 35 contigs defined by 64 markers in 22q13-qter. Twenty-three anonymous markers are now linked to the previously mapped genetic anchor points. 55 refs., 4 figs., 3 tabs.

  14. LIBRARY SERVICES LIBRARY HOURS

    E-print Network

    Royer, Dana

    LIBRARY SERVICES LIBRARY HOURS Up-to-date library hours are posted at http Wesleyan ID that is linked to the library circulation database is needed to charge out library materials to visit the Circulation Office in Olin Library 115 to set up their borrowing privileges. If you have

  15. Application of BAC-probes to visualize copy number variants (CNVs).

    PubMed

    Weise, Anja; Othman, Moneeb A K; Bhatt, Samarth; Löhmer, Sharon; Liehr, Thomas

    2015-01-01

    Copy number variations (CNVs) are structural variations of the human genome. These alterations result in variant copy numbers of certain stretches of DNA. In other words, some regions may be present in more or less copies than in a reference genome; however, these copy number changes do not have any impact on the phenotype. Also, CNVs may be extremely large and cytogenetically detectable or submicroscopic but still spanning several megabasepairs (Mb). In the recent years, array technology has identified especially the latter ones as so-called copy number variant (CNV) polymorphisms. These CNVs are detected in ~12 % of the human genome sequences and may comprise several hundred kilobasepairs. CNVs contribute significantly to the inter-individual differences in humans, and can range between 0.5 and 1.5 Mb amongst different genomes, well within the level of detection using cytogenetics techniques. Thus, they can be visualized by FISH using bacterial artificial chromosomes (BACs) as probes. Here we describe a method that enables discrimination of individual homologous chromosomes at the single cell level based on CNVs in the genome, called parental origin determination fluorescence in situ hybridization (POD-FISH). Possible fields of applications of this single cell-directed approach are in analyses of the parental origin of single chromosomes in inherited and acquired chromosomal aberrations. PMID:25239754

  16. Development and validation of a Xanthomonas axonopodis pv. citri DNA microarray platform (XACarray) generated from the shotgun libraries previously used in the sequencing of this bacterial genome

    PubMed Central

    2010-01-01

    Background From shotgun libraries used for the genomic sequencing of the phytopathogenic bacterium Xanthomonas axonopodis pv. citri (XAC), clones that were representative of the largest possible number of coding sequences (CDSs) were selected to create a DNA microarray platform on glass slides (XACarray). The creation of the XACarray allowed for the establishment of a tool that is capable of providing data for the analysis of global genome expression in this organism. Findings The inserts from the selected clones were amplified by PCR with the universal oligonucleotide primers M13R and M13F. The obtained products were purified and fixed in duplicate on glass slides specific for use in DNA microarrays. The number of spots on the microarray totaled 6,144 and included 768 positive controls and 624 negative controls per slide. Validation of the platform was performed through hybridization of total DNA probes from XAC labeled with different fluorophores, Cy3 and Cy5. In this validation assay, 86% of all PCR products fixed on the glass slides were confirmed to present a hybridization signal greater than twice the standard deviation of the deviation of the global median signal-to-noise ration. Conclusions Our validation of the XACArray platform using DNA-DNA hybridization revealed that it can be used to evaluate the expression of 2,365 individual CDSs from all major functional categories, which corresponds to 52.7% of the annotated CDSs of the XAC genome. As a proof of concept, we used this platform in a previously work to verify the absence of genomic regions that could not be detected by sequencing in related strains of Xanthomonas. PMID:20507617

  17. High-throughput SNP discovery through deep resequencing of a reduced representation library to anchor and orient scaffolds in the soybean whole genome sequence

    PubMed Central

    2010-01-01

    Background The Soybean Consensus Map 4.0 facilitated the anchoring of 95.6% of the soybean whole genome sequence developed by the Joint Genome Institute, Department of Energy, but its marker density was only sufficient to properly orient 66% of the sequence scaffolds. The discovery and genetic mapping of more single nucleotide polymorphism (SNP) markers were needed to anchor and orient the remaining genome sequence. To that end, next generation sequencing and high-throughput genotyping were combined to obtain a much higher resolution genetic map that could be used to anchor and orient most of the remaining sequence and to help validate the integrity of the existing scaffold builds. Results A total of 7,108 to 25,047 predicted SNPs were discovered using a reduced representation library that was subsequently sequenced by the Illumina sequence-by-synthesis method on the clonal single molecule array platform. Using multiple SNP prediction methods, the validation rate of these SNPs ranged from 79% to 92.5%. A high resolution genetic map using 444 recombinant inbred lines was created with 1,790 SNP markers. Of the 1,790 mapped SNP markers, 1,240 markers had been selectively chosen to target existing unanchored or un-oriented sequence scaffolds, thereby increasing the amount of anchored sequence to 97%. Conclusion We have demonstrated how next generation sequencing was combined with high-throughput SNP detection assays to quickly discover large numbers of SNPs. Those SNPs were then used to create a high resolution genetic map that assisted in the assembly of scaffolds from the 8× whole genome shotgun sequences into pseudomolecules corresponding to chromosomes of the organism. PMID:20078886

  18. Genome Improvement at JGI-HAGSC

    SciTech Connect

    Grimwood, Jane: Schmutz, Jeremy, J.: Myers, Richard, M.

    2012-03-03

    Since the completion of the sequencing of the human genome, the JGI has rapidly expanded its scientific goals in several DOE mission-relevant areas. At the JGI-HAGSC, we have kept pace with this rapid expansion of projects with our focus on assessing, assembling, improving and finishing eukaryotic whole genome shotgun (WGS) projects for which the shotgun sequence is generated at the Production Genomic Facility (JGI-PGF). We follow this by combining the draft WGS with genomic resources generated at JGI-HAGSC or in collaborator laboratories (including BAC end sequences, genetic maps and FLcDNA sequences) to produce an improved draft sequence. For eukaryotic genomes important to the DOE mission, we then add further information from directed experiments to produce reference genomic sequences that are publicly available for any scientific researcher. Also, we have continued our program for producing BAC-based finished sequence, both for adding information to JGI genome projects and for small BAC-based sequencing projects proposed through any of the JGI sequencing programs. We have now built our computational expertise in WGS assembly and analysis and have moved eukaryotic genome assembly from the JGI-PGF to JGI-HAGSC. We have concentrated our assembly development work on large plant genomes and complex fungal and algal genomes.

  19. Pigeonpea genomics initiative (PGI): an international effort to improve crop productivity of pigeonpea (Cajanus cajan L.).

    PubMed

    Varshney, R K; Penmetsa, R V; Dutta, S; Kulwal, P L; Saxena, R K; Datta, S; Sharma, T R; Rosen, B; Carrasquilla-Garcia, N; Farmer, A D; Dubey, A; Saxena, K B; Gao, J; Fakrudin, B; Singh, M N; Singh, B P; Wanjari, K B; Yuan, M; Srivastava, R K; Kilian, A; Upadhyaya, H D; Mallikarjuna, N; Town, C D; Bruening, G E; He, G; May, G D; McCombie, R; Jackson, S A; Singh, N K; Cook, D R

    2010-10-01

    Pigeonpea (Cajanus cajan), an important food legume crop in the semi-arid regions of the world and the second most important pulse crop in India, has an average crop productivity of 780 kg/ha. The relatively low crop yields may be attributed to non-availability of improved cultivars, poor crop husbandry and exposure to a number of biotic and abiotic stresses in pigeonpea growing regions. Narrow genetic diversity in cultivated germplasm has further hampered the effective utilization of conventional breeding as well as development and utilization of genomic tools, resulting in pigeonpea being often referred to as an 'orphan crop legume'. To enable genomics-assisted breeding in this crop, the pigeonpea genomics initiative (PGI) was initiated in late 2006 with funding from Indian Council of Agricultural Research under the umbrella of Indo-US agricultural knowledge initiative, which was further expanded with financial support from the US National Science Foundation's Plant Genome Research Program and the Generation Challenge Program. As a result of the PGI, the last 3 years have witnessed significant progress in development of both genetic as well as genomic resources in this crop through effective collaborations and coordination of genomics activities across several institutes and countries. For instance, 25 mapping populations segregating for a number of biotic and abiotic stresses have been developed or are under development. An 11X-genome coverage bacterial artificial chromosome (BAC) library comprising of 69,120 clones have been developed of which 50,000 clones were end sequenced to generate 87,590 BAC-end sequences (BESs). About 10,000 expressed sequence tags (ESTs) from Sanger sequencing and ca. 2 million short ESTs by 454/FLX sequencing have been generated. A variety of molecular markers have been developed from BESs, microsatellite or simple sequence repeat (SSR)-enriched libraries and mining of ESTs and genomic amplicon sequencing. Of about 21,000 SSRs identified, 6,698 SSRs are under analysis along with 670 orthologous genes using a GoldenGate SNP (single nucleotide polymorphism) genotyping platform, with large scale SNP discovery using Solexa, a next generation sequencing technology, is in progress. Similarly a diversity array technology array comprising of ca. 15,000 features has been developed. In addition, >600 unique nucleotide binding site (NBS) domain containing members of the NBS-leucine rich repeat disease resistance homologs were cloned in pigeonpea; 960 BACs containing these sequences were identified by filter hybridization, BES physical maps developed using high information content fingerprinting. To enrich the genomic resources further, sequenced soybean genome is being analyzed to establish the anchor points between pigeonpea and soybean genomes. In addition, Solexa sequencing is being used to explore the feasibility of generating whole genome sequence. In summary, the collaborative efforts of several research groups under the umbrella of PGI are making significant progress in improving molecular tools in pigeonpea and should significantly benefit pigeonpea genetics and breeding. As these efforts come to fruition, and expanded (depending on funding), pigeonpea would move from an 'orphan legume crop' to one where genomics-assisted breeding approaches for a sustainable crop improvement are routine. PMID:20976284

  20. Prokaryotic Genomes Eurkaryotic Genomes

    E-print Network

    Qiu, Weigang

    Prokaryotic Genomes Eurkaryotic Genomes Chapter 6. Genomics and Gene Identification Weigang Qiu Weigang Qiu Chapter 6. Genomics and Gene Identification #12;Prokaryotic Genomes Eurkaryotic Genomes Outline 1 Prokaryotic Genomes 2 Eurkaryotic Genomes Weigang Qiu Chapter 6. Genomics and Gene

  1. Library Regulations Library Regulations

    E-print Network

    Birmingham, University of

    REGULATIONS Preamble: The Library Regulations apply to all users of library facilities managed on behalf by the Director of Library Services. All use of computing and network facilities within those facilities managed-13 Library Regulations `Service' is deemed to include any system whereby Library Services provides access

  2. Library System Library System

    E-print Network

    Cinabro, David

    Library System #12;Library System 5150 Anthony Wayne Drive David Adamany Undergraduate Library that for the current fiscal year, we've been given an additional $600,000 for our library materials budget. We're very subscriptions. The Wayne State University Libraries are deeply committed to providing our faculty and students

  3. BAC end sequences corresponding to the B4 resistance gene cluster in common bean: a resource for markers and synteny analyses

    Microsoft Academic Search

    Perrine David; Mireille Sévignac; Vincent Thareau; Yann Catillon; Jim Kami; Paul Gepts; Thierry Langin; Valérie Geffroy

    2008-01-01

    In common bean, a complex disease resistance (R) gene cluster, harboring many specific R genes against various pathogens, is located at the end of the linkage group B4. A BAC library of the Meso-american bean genotype\\u000a BAT93 was screened with PRLJ1, a probe previously shown to be specific to the B4 R gene cluster, leading to the identification of 73

  4. Genomic analysis of sorghum by fluorescence in situ hybridization

    E-print Network

    Kim, Jeong-Soon

    2004-11-15

    of genetics and cell biology, e.g., aneuploid identification (Ji et al. 1997, 1999a), polyploid genome evolution (Hanson et al. 1998), meiotic recombination (Ji et al. 1999b), recombination analysis (Reyes-Valdes et al. 1996), karyotyping (Chen et al. 2000... of identification. The utility of BACs as molecular cytogenetic probes in plants became evident through early studies using marker-selected BACs for FISH (Hanson et al. 1995; Jiang et al. 1995). Utilizing marker-selected BACs from euchromatin in the distal...

  5. BaC: a thermodynamically stable layered superconductor.

    PubMed

    Wang, Dian-Hui; Zhou, Huai-Ying; Hu, Chao-Hao; Oganov, Artem R; Zhong, Yan; Rao, Guang-Hui

    2014-10-14

    To predict all stable compounds in the Ba-C system, we perform a comprehensive study using first-principles variable-composition evolutionary algorithm USPEX. We find that at 0 K the well-known compound BaC2 is metastable in the whole pressure range 0-40 GPa, while intercalated graphite phase BaC6 is stable at 0-19 GPa. A hitherto unknown layered orthorhombic Pbam phase of BaC has structure consisting of alternating layers of Ba atoms and layers of stoichiometry Ba2C3 containing linear C3 groups and is predicted to be stable in the pressure range 3-32 GPa. From our electron-phonon coupling calculations, the newly found BaC compound is a phonon-mediated superconductor and has a critical superconductivity temperature Tc of 4.32 K at 5 GPa. This compound is dynamically stable at 0 GPa and therefore may be quenchable under normal conditions. PMID:25163859

  6. piggyBac transposon-mediated cellular transgenesis in mammalian forebrain by in utero electroporation.

    PubMed

    Chen, Fuyi; Maher, Brady J; LoTurco, Joseph J

    2014-07-01

    In utero electroporation (IUE) is an effective transfection method for delivering plasmid DNA into neural progenitor cells and neurons of mammalian neocortex in vivo. Although IUE is effective at delivering multiple DNA plasmids into populations of cells, unfortunately plasmids delivered into neural progenitor cells remain largely episomal and often get inactivated or lost after cell division. This results in a form of "birthdate" labeling in which only the cell types that do not undergo a second cell division continue to express the transfected plasmids. This limits the application of IUE with standard plasmids and precludes its use in experiments where manipulating or labeling the complete cell lineage of a progenitor is desired. To circumvent this episomal loss of plasmid in IUE, we have used a binary piggyBac transposon system to induce nonviral genomic integration of transgenes. These transgenes do not appear to inactivate after cell division, and this results in stable somatic cellular transgenesis of neurons and glia. Like standard IUE, the system can be used with multiple combinations of plasmids to achieve multicolor labeling and both loss-of-function and gain-of-function manipulations. In this protocol, we describe the method for delivering a binary piggyBac transposon plasmid system by IUE. PMID:24987137

  7. Development of microsatellite markers from an enriched genomic library for genetic analysis of melon (Cucumis melo L.)

    Microsoft Academic Search

    Patricia Silva Ritschel; Tulio Cesar de Lima Lins; Rodrigo Lourenço Tristan; Gláucia Salles Cortopassi Buso; José Amauri Buso; Márcio Ferreira

    2004-01-01

    BACKGROUND: Despite the great advances in genomic technology observed in several crop species, the availability of molecular tools such as microsatellite markers has been limited in melon (Cucumis melo L.) and cucurbit species. The development of microsatellite markers will have a major impact on genetic analysis and breeding of melon, especially on the generation of marker saturated genetic maps and

  8. A re-assigned American mink (Neovison vison) map optimal for genome-wide studies.

    PubMed

    Anistoroaei, Razvan; Nielsen, Vivi; Markakis, Marios Nektarios; Karlskov-Mortensen, Peter; Jørgensen, Claus B; Christensen, Knud; Fredholm, Merete

    2012-12-10

    Our previously published second generation genetic map for the American mink (Neovison vison) has been used and redesigned in its best for genome-wide studies with maximum of efficiency. A number of 114 selected markers, including 33 newly developed microsatellite markers from the CHORI-231 mink Bacterial Artificial Chromosome (BAC) library, have been genotyped in a two generation population composed of 1200 individuals. The outcome reassigns the position of some markers on the chromosomes and it produces a more reliable map with a convenient distance between markers. A total of 104 markers mapped to 14 linkage groups corresponding to the mink autosomes. Six markers are unlinked and four markers are allocated to the X chromosome by homology but no linkage was detected. The sex-average linkage map spans 1192 centiMorgans (cM) with an average intermarker distance of 11.4cM and 1648cM when the ends of the linkage groups and the autosomal unlinked markers are added. Sex-specific genetic linkage maps were also generated. The male sex-specific map had a total length of 1014.6cM between the linked markers and an average inter-marker interval of 9.7cM. The female map has a corresponding length of 1378.6cM and an average inter-marker interval of 13.3cM. The study is complemented with additional anchorage for most of the chromosomes of the map by BAC in situ hybridization with clones containing microsatellites strategically selected from the various parts of the genome. This map provides an improved tool for genetic mapping and comparative genomics in mink, also useful for the future assembly of the mink genome sequence when this will be taken forward. PMID:22982743

  9. Characterization of genome-wide ordered sequence-tagged Mycobacterium mutant libraries by Cartesian Pooling-Coordinate Sequencing.

    PubMed

    Vandewalle, Kristof; Festjens, Nele; Plets, Evelyn; Vuylsteke, Marnik; Saeys, Yvan; Callewaert, Nico

    2015-01-01

    Reverse genetics research approaches require the availability of methods to rapidly generate specific mutants. Alternatively, where these methods are lacking, the construction of pre-characterized libraries of mutants can be extremely valuable. However, this can be complex, expensive and time consuming. Here, we describe a robust, easy to implement parallel sequencing-based method (Cartesian Pooling-Coordinate Sequencing or CP-CSeq) that reports both on the identity as well as on the location of sequence-tagged biological entities in well-plate archived clone collections. We demonstrate this approach using a transposon insertion mutant library of the Mycobacterium bovis BCG vaccine strain, providing the largest resource of mutants in any strain of the M. tuberculosis complex. The method is applicable to any entity for which sequence-tagged identification is possible. PMID:25960123

  10. Characterization of genome-wide ordered sequence-tagged Mycobacterium mutant libraries by Cartesian Pooling-Coordinate Sequencing

    PubMed Central

    Vandewalle, Kristof; Festjens, Nele; Plets, Evelyn; Vuylsteke, Marnik; Saeys, Yvan; Callewaert, Nico

    2015-01-01

    Reverse genetics research approaches require the availability of methods to rapidly generate specific mutants. Alternatively, where these methods are lacking, the construction of pre-characterized libraries of mutants can be extremely valuable. However, this can be complex, expensive and time consuming. Here, we describe a robust, easy to implement parallel sequencing-based method (Cartesian Pooling-Coordinate Sequencing or CP-CSeq) that reports both on the identity as well as on the location of sequence-tagged biological entities in well-plate archived clone collections. We demonstrate this approach using a transposon insertion mutant library of the Mycobacterium bovis BCG vaccine strain, providing the largest resource of mutants in any strain of the M. tuberculosis complex. The method is applicable to any entity for which sequence-tagged identification is possible. PMID:25960123

  11. Suicidal autointegration of sleeping beauty and piggyBac transposons in eukaryotic cells.

    PubMed

    Wang, Yongming; Wang, Jichang; Devaraj, Anatharam; Singh, Manvendra; Jimenez Orgaz, Ana; Chen, Jia-Xuan; Selbach, Matthias; Ivics, Zoltán; Izsvák, Zsuzsanna

    2014-03-01

    Transposons are discrete segments of DNA that have the distinctive ability to move and replicate within genomes across the tree of life. 'Cut and paste' DNA transposition involves excision from a donor locus and reintegration into a new locus in the genome. We studied molecular events following the excision steps of two eukaryotic DNA transposons, Sleeping Beauty (SB) and piggyBac (PB) that are widely used for genome manipulation in vertebrate species. SB originates from fish and PB from insects; thus, by introducing these transposons to human cells we aimed to monitor the process of establishing a transposon-host relationship in a naïve cellular environment. Similarly to retroviruses, neither SB nor PB is capable of self-avoidance because a significant portion of the excised transposons integrated back into its own genome in a suicidal process called autointegration. Barrier-to-autointegration factor (BANF1), a cellular co-factor of certain retroviruses, inhibited transposon autointegration, and was detected in higher-order protein complexes containing the SB transposase. Increasing size sensitized transposition for autointegration, consistent with elevated vulnerability of larger transposons. Both SB and PB were affected similarly by the size of the transposon in three different assays: excision, autointegration and productive transposition. Prior to reintegration, SB is completely separated from the donor molecule and followed an unbiased autointegration pattern, not associated with local hopping. Self-disruptive autointegration occurred at similar frequency for both transposons, while aberrant, pseudo-transposition events were more frequently observed for PB. PMID:24625543

  12. Suicidal Autointegration of Sleeping Beauty and piggyBac Transposons in Eukaryotic Cells

    PubMed Central

    Devaraj, Anatharam; Singh, Manvendra; Jimenez Orgaz, Ana; Chen, Jia-Xuan; Selbach, Matthias; Ivics, Zoltán; Izsvák, Zsuzsanna

    2014-01-01

    Transposons are discrete segments of DNA that have the distinctive ability to move and replicate within genomes across the tree of life. ‘Cut and paste’ DNA transposition involves excision from a donor locus and reintegration into a new locus in the genome. We studied molecular events following the excision steps of two eukaryotic DNA transposons, Sleeping Beauty (SB) and piggyBac (PB) that are widely used for genome manipulation in vertebrate species. SB originates from fish and PB from insects; thus, by introducing these transposons to human cells we aimed to monitor the process of establishing a transposon-host relationship in a naïve cellular environment. Similarly to retroviruses, neither SB nor PB is capable of self-avoidance because a significant portion of the excised transposons integrated back into its own genome in a suicidal process called autointegration. Barrier-to-autointegration factor (BANF1), a cellular co-factor of certain retroviruses, inhibited transposon autointegration, and was detected in higher-order protein complexes containing the SB transposase. Increasing size sensitized transposition for autointegration, consistent with elevated vulnerability of larger transposons. Both SB and PB were affected similarly by the size of the transposon in three different assays: excision, autointegration and productive transposition. Prior to reintegration, SB is completely separated from the donor molecule and followed an unbiased autointegration pattern, not associated with local hopping. Self-disruptive autointegration occurred at similar frequency for both transposons, while aberrant, pseudo-transposition events were more frequently observed for PB. PMID:24625543

  13. Aerobic biological activated carbon (BAC) treatment of a phenolic wastewater

    SciTech Connect

    Wei Lin; Weber, A.S. (State Univ. of New York, Buffalo (United States))

    1992-05-01

    Organic removal rates achieved in the aerobic BAC process were comparable to rates typically reported for traditional aerobic fixed-film systems. When operated at organic loading rates lower than 0.03 g COD/g GAC-d and air as the oxygen source, greater than 90% COD removal and 99% phenol removal was achieved. At higher organic loading rates, oxygen limitations resulted in less than optimal performance. Observed oxygen limitations were mitigated by the use of pure oxygen. Long-term stability of operation of the BAC process was excellent with one aerobic BAC column operated under the same conditions in excess of 260 days. During that time, consistent column performance was achieved without the need to provide supplemental carbon or carbon regeneration. System biomass yields ranged from 0.05 to 0.30 g VSS/g COD removed and increased with effluent COD concentration.

  14. Characterizing a novel strain of Bacillus amyloliquefaciens BAC03 for potential biological control application

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aims: Identify and characterize a bacterial strain from suppressive soil, BAC03, evaluate its antimicrobial activity against Streptomyces scabies and other microorganisms, and characterize an antimicrobial substance produced by this strain. Methods and Results: Bacterial strain BAC03 (isolated from ...

  15. Action and Timing of BacC and BacD in the Late Stages of Biosynthesis of the Dipeptide Antibiotic Bacilysin

    PubMed Central

    Parker, Jared B.; Walsh, Christopher T.

    2013-01-01

    Biosynthesis of the dipeptide antibiotic bacilysin, encoded by the seven B. subtilis genes bacA-G, involves diversion of flux from prephenate to the noncognate amino acid anticapsin. The anticapsin warhead is then ligated to the C-terminus of l-alanine to produce mature bacilysin. We have previously noted the formation of two diastereomers of tetrahydrotyrosine (4S- and 4R-H4Tyr) by tandem action of the four purified enzymes BacABGF. BacC (oxidase) and BacD (ligase) have been hypothesized to be remaining late stage enzymes in bacilysin biosynthesis. Using a combination of BacCD in vitro studies, B. subtilis deletion mutants, and isotopic feeding studies, we were able to determine that the H4Tyr diastereomers are actually shunt products that are not on-pathway to bacilysin biosynthesis. Dihydroanticapsin and dihydrobacilysin accumulate in extracts of a ?bacC strain and are processed to anticapsin and then bacilysin on addition of BacC and BacD, respectively. These results suggest the epoxide group in bacilysin is installed in an earlier step of bacilysin biosynthesis, while BacC oxidation of the C7-hydroxyl followed by BacD ligation of anticapsin to l-Ala are the penultimate and ultimate steps of bacilysin biosynthesis. PMID:23317005

  16. [Developing a physical map of human chromosome 22 using Pace electrophoresis and large fragment cloning]. Annual report, October 1, 1991--July 1, 1994

    SciTech Connect

    Simon, M.I.

    1994-12-31

    In the past two years, the authors have made a great deal of progress in establishing Fosmid and BAC libraries and in using large BAC libraries for gene mapping. In addition, they initiated work on the application of BAC clones to long range genome sequencing. They continue to increase the ability to rapidly generate large BAC libraries and to efficiently apply these libraries to genome mapping. The BACs provide a very effective means of developing physical maps. The current work suggests that BAC contigs will be extremely useful as source material for genome sequencing.

  17. SweetBac: A New Approach for the Production of Mammalianised Glycoproteins in Insect Cells

    PubMed Central

    Palmberger, Dieter; Wilson, Iain B. H.; Berger, Imre; Grabherr, Reingard; Rendic, Dubravko

    2012-01-01

    Recombinant production of therapeutically active proteins has become a central focus of contemporary life science research. These proteins are often produced in mammalian cells, in order to obtain products with post-translational modifications similar to their natural counterparts. However, in cases where a fast and flexible system for recombinant production of proteins is needed, the use of mammalian cells is limited. The baculoviral insect cell system has proven to be a powerful alternative for the expression of a wide range of recombinant proteins in short time frames. The major drawback of baculoviral systems lies in the inability to perform mammalian-like glycosylation required for the production of therapeutic glycoproteins. In this study we integrated sequences encoding Caenorhabditis elegans N-acetylglucosaminyltransferase II and bovine ?1,4-galactosyltransferase I into the backbone of a baculovirus genome. The thereby generated SweetBac virus was subsequently used for the production of the human HIV anti-gp41 antibody 3D6 by integrating heavy and light chain open reading frames into the SweetBac genome. The parallel expression of target genes and glycosyltransferases reduced the yield of secreted antibody. However, the overall expression rate, especially in the recently established Tnao38 cell line, was comparable to that of transient expression in mammalian cells. In order to evaluate the ability of SweetBac to generate mammalian-like N-glycan structures on 3D6 antibody, we performed SDS-PAGE and tested for the presence of terminal galactose using Riccinus communis agglutinin I. The mammalianised variants of 3D6 showed highly specific binding to the lectin, indicating proper functionality. To confirm these results, PNGase A released N-glycans were analyzed by MALDI-TOF-MS and shown to contain structures with mainly one or two terminal galactose residues. Since the presence of specific N-glycans has an impact on antibodies ability to exert different effector functions, we tested the binding to human Fc gamma receptor I present on U937 cells. PMID:22485160

  18. Analysis of the Shotgun Expression Library of the Mycobacterium tuberculosis Genome for Immunodominant Polypeptides: Potential Use in Serodiagnosis

    PubMed Central

    Bisen, Prakash S.; Garg, Sanjay K.; Tiwari, Ram P.; Tagore, P. Ravindra Nath; Chandra, Ramesh; Karnik, Rucha; Thaker, Nimesh; Desai, Nirav; Ghosh, P. K.; Fraziano, Maurizio; Colizzi, Vittorio

    2003-01-01

    A recombinant DNA strategy was applied to analyze and screen the shotgun expression library from a clinically confirmed local virulent isolate of Mycobacterium tuberculosis with sera from tuberculosis patients, which led to expression and purification of highly immunoreactive and specific mycobacterial antigens expressed during the course of active disease which could be of diagnostic significance. An enzyme-linked immunoassay for diagnosis of tuberculosis was devised by using a shotgun immunoexpression library in the ?gt11 vector. DNA from a virulent M. tuberculosis patient isolate (TBW-33) confirmed with the BACTEC 460 system was sheared and expressed to generate shotgun polypeptides. ?-Galactosidase fusion proteins capable of demarcating active tuberculosis infections from Mycobacterium bovis BCG-vaccinated healthy subjects or people harboring environmental mycobacteria were selected by comparative immunoreactivity studies. Promising mycobacterial DNA cassettes were subcloned and expressed into the glutathione S-transferase (GST) fusion vector pGEX-5X-1 with a strong tac promoter and were expressed in Escherichia coli BL21. These fusion proteins were severed at a built-in factor Xa recognition site to separate the GST tags and were utilized in an indirect enzyme-linked immunoassay for serodiagnosis of patients with active tuberculosis. The system offered a clear demarcation between BCG-vaccinated healthy subjects and patients with active tuberculosis and proved to be effective in detecting pulmonary as well as extrapulmonary tuberculosis, with an overall sensitivity of 84.33% and an overall specificity of 93.62%. PMID:14607866

  19. Gene discovery within the planctomycete division of the domain Bacteria using sequence tags from genomic DNA libraries

    PubMed Central

    Jenkins, Cheryl; Kedar, Vishram; Fuerst, John A

    2002-01-01

    Background The planctomycetes comprise a distinct group of the domain Bacteria, forming a separate division by phylogenetic analysis. The organization of their cells into membrane-defined compartments including membrane-bounded nucleoids, their budding reproduction and complete absence of peptidoglycan distinguish them from most other Bacteria. A random sequencing approach was applied to the genomes of two planctomycete species, Gemmata obscuriglobus and Pirellula marina, to discover genes relevant to their cell biology and physiology. Results Genes with a wide variety of functions were identified in G. obscuriglobus and Pi. marina, including those of metabolism and biosynthesis, transport, regulation, translation and DNA replication, consistent with established phenotypic characters for these species. The genes sequenced were predominantly homologous to those in members of other divisions of the Bacteria, but there were also matches with nuclear genomic genes of the domain Eukarya, genes that may have appeared in the planctomycetes via horizontal gene transfer events. Significant among these matches are those with two genes atypical for Bacteria and with significant cell-biology implications - integrin alpha-V and inter-alpha-trypsin inhibitor protein - with homologs in G. obscuriglobus and Pi. marina respectively. Conclusions The random-sequence-tag approach applied here to G. obscuriglobus and Pi. marina is the first report of gene recovery and analysis from members of the planctomycetes using genome-based methods. Gene homologs identified were predominantly similar to genes of Bacteria, but some significant best matches to genes from Eukarya suggest that lateral gene transfer events between domains may have involved this division at some time during its evolution. PMID:12093378

  20. A tiling resolution DNA microarray with complete coverage of the human genome

    Microsoft Academic Search

    Adrian S Ishkanian; Chad A Malloff; Spencer K Watson; Ronald J deLeeuw; Bryan Chi; Bradley P Coe; Antoine Snijders; Donna G Albertson; Daniel Pinkel; Marco A Marra; Victor Ling; Calum MacAulay; Wan L Lam

    2004-01-01

    We constructed a tiling resolution array consisting of 32,433 overlapping BAC clones covering the entire human genome. This increases our ability to identify genetic alterations and their boundaries throughout the genome in a single comparative genomic hybridization (CGH) experiment. At this tiling resolution, we identified minute DNA alterations not previously reported. These alterations include microamplifications and deletions containing oncogenes, tumor-suppressor

  1. Test Generation from Security Policies Specified in Or-BAC

    Microsoft Academic Search

    Keqin Li; Laurent Mounier; Roland Groz

    2007-01-01

    Security policy testing is a practical way to ensure security policies are correctly implemented in information or networking systems with a certain level of confidence. In this paper, we adapt model based testing techniques for formal models of security policies, and propose a two stage approach to produce test cases from a security policy specified in Or-BAC, i.e., test purpose

  2. The Library The Public Library

    E-print Network

    The Library The Public Library The Library Mission The library Function Acquisition Section of information and public library services to contribute in achieving the university's goals in education of the library The library holdings Distribution of the library collections Organzation of Konwledge The library

  3. Toward simpler and faster genome-wide mutagenesis Sen Wu1, Guoxin Ying2, Qiang Wu2 & Mario R Capecchi1,2

    E-print Network

    Capecchi, Mario R.

    R Capecchi1,2 Here we describe a practical Cre-loxP and piggyBac transposon­based mutagenesisToward simpler and faster genome-wide mutagenesis in mice Sen Wu1, Guoxin Ying2, Qiang Wu2 & Mario chromosomes at unexpected frequencies of greater than 1%. By incorporating a piggyBac transposon to insert

  4. 70 FR 52111 - National Library of Medicine; Request for Nominations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2005-09-01

    ...Information (NCBI), National Library of Medicine (NLM), to advise...Roadmap called the Molecular Libraries initiative. This includes...Genomics Center, the Molecular Libraries Screening Center Network...principles of publicly funded science. NLM has had extensive...

  5. Differential screening of mitochondrial cDNA libraries from male-fertile and cytoplasmic male-sterile sugar-beet reveals genome rearrangements at atp6 and atpA loci

    Microsoft Academic Search

    Yongbiao Xue; Sylvie Collin; D. Roy Davies; Colwyn M. Thomas

    1994-01-01

    As part of a strategy to define differences in genome organization and expression between cytoplasmic male-sterile (CMS) and male-fertile (MF) sugar-beet mitochondria, cDNA libraries from both mitochondrial genotypes were constructed. Preliminary screening with ribosomal RNA gene probes identified candidate cDNA clones corresponding to structural genes. In addition, reciprocal hybridization experiments were performed using labelled first-strand cDNA to identify uniquely transcribed

  6. Music Library Research Library Collections,

    E-print Network

    Jalali. Bahram

    Management Gary Thompson Digital Library Development Henry Chiong Operations and Services Lisa Kemp Jones Digital Library Program Stephen Davison Music Library Research Library Collections, Research Gloria Robledo Development and Project Management Gary Thompson Digital Library Development Henry Chiong

  7. Somatic transformation efficiencies and expression patterns using the JcDNV and piggyBac transposon gene vectors in insects.

    PubMed

    Bossin, H; Furlong, R B; Gillett, J L; Bergoin, M; Shirk, P D

    2007-02-01

    A somatic transformation gene vector that exploits the genomic integration properties of Junonia coenia lepidopteran densovirus (JcDNV) sequences in vivo has been developed. JcDNV somatic transformation vectors are derivatives of plasmids containing an interrupted genome of JcDNV that provide efficient, robust vectors that can be used to examine regulation of chromosomally integrated transgenes in insects. Microinjection of JcDNV plasmids into syncytial embryos of Drosophila melanogaster or the lepidopterans Plodia interpunctella, Ephestia kuehniella or Trichoplusia ni resulted in persistent transgene expression throughout development. Inclusion of transgenes with tissue-specific promoters resulted in expression patterns canonical with phenotypes of piggyBac germline transformants. Somatic transformation required the presence of the viral inverted terminal repeat in cis only and did not depend upon non-structural viral proteins. PMID:17257207

  8. The MultiBac Protein Complex Production Platform at the EMBL

    PubMed Central

    Berger, Imre; Garzoni, Frederic; Chaillet, Maxime; Haffke, Matthias; Gupta, Kapil; Aubert, Alice

    2013-01-01

    Proteomics research revealed the impressive complexity of eukaryotic proteomes in unprecedented detail. It is now a commonly accepted notion that proteins in cells mostly exist not as isolated entities but exert their biological activity in association with many other proteins, in humans ten or more, forming assembly lines in the cell for most if not all vital functions.1,2 Knowledge of the function and architecture of these multiprotein assemblies requires their provision in superior quality and sufficient quantity for detailed analysis. The paucity of many protein complexes in cells, in particular in eukaryotes, prohibits their extraction from native sources, and necessitates recombinant production. The baculovirus expression vector system (BEVS) has proven to be particularly useful for producing eukaryotic proteins, the activity of which often relies on post-translational processing that other commonly used expression systems often cannot support.3 BEVS use a recombinant baculovirus into which the gene of interest was inserted to infect insect cell cultures which in turn produce the protein of choice. MultiBac is a BEVS that has been particularly tailored for the production of eukaryotic protein complexes that contain many subunits.4 A vital prerequisite for efficient production of proteins and their complexes are robust protocols for all steps involved in an expression experiment that ideally can be implemented as standard operating procedures (SOPs) and followed also by non-specialist users with comparative ease. The MultiBac platform at the European Molecular Biology Laboratory (EMBL) uses SOPs for all steps involved in a multiprotein complex expression experiment, starting from insertion of the genes into an engineered baculoviral genome optimized for heterologous protein production properties to small-scale analysis of the protein specimens produced.5-8 The platform is installed in an open-access mode at EMBL Grenoble and has supported many scientists from academia and industry to accelerate protein complex research projects. PMID:23892976

  9. BAC-based sequencing of behaviorally-relevant genes in the prairie vole.

    PubMed

    McGraw, Lisa A; Davis, Jamie K; Thomas, Pamela J; Young, Larry J; Thomas, James W

    2012-01-01

    The prairie vole (Microtus ochrogaster) is an important model organism for the study of social behavior, yet our ability to correlate genes and behavior in this species has been limited due to a lack of genetic and genomic resources. Here we report the BAC-based targeted sequencing of behaviorally-relevant genes and flanking regions in the prairie vole. A total of 6.4 Mb of non-redundant or haplotype-specific sequence assemblies were generated that span the partial or complete sequence of 21 behaviorally-relevant genes as well as an additional 55 flanking genes. Estimates of nucleotide diversity from 13 loci based on alignments of 1.7 Mb of haplotype-specific assemblies revealed an average pair-wise heterozygosity (8.4×10(-3)). Comparative analyses of the prairie vole proteins encoded by the behaviorally-relevant genes identified >100 substitutions specific to the prairie vole lineage. Finally, our sequencing data indicate that a duplication of the prairie vole AVPR1A locus likely originated from a recent segmental duplication spanning a minimum of 105 kb. In summary, the results of our study provide the genomic resources necessary for the molecular and genetic characterization of a high-priority set of candidate genes for regulating social behavior in the prairie vole. PMID:22238603

  10. Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition

    PubMed Central

    Zhu, Wei; Ouyang, Shu; Iovene, Marina; O'Brien, Kimberly; Vuong, Hue; Jiang, Jiming; Buell, C Robin

    2008-01-01

    Background The Solanaceae family contains a number of important crop species including potato (Solanum tuberosum) which is grown for its underground storage organ known as a tuber. Albeit the 4th most important food crop in the world, other than a collection of ~220,000 Expressed Sequence Tags, limited genomic sequence information is currently available for potato and advances in potato yield and nutrition content would be greatly assisted through access to a complete genome sequence. While morphologically diverse, Solanaceae species such as potato, tomato, pepper, and eggplant share not only genes but also gene order thereby permitting highly informative comparative genomic analyses. Results In this study, we report on analysis 89.9 Mb of potato genomic sequence representing 10.2% of the genome generated through end sequencing of a potato bacterial artificial chromosome (BAC) clone library (87 Mb) and sequencing of 22 potato BAC clones (2.9 Mb). The GC content of potato is very similar to Solanum lycopersicon (tomato) and other dicotyledonous species yet distinct from the monocotyledonous grass species, Oryza sativa. Parallel analyses of repetitive sequences in potato and tomato revealed substantial differences in their abundance, 34.2% in potato versus 46.3% in tomato, which is consistent with the increased genome size per haploid genome of these two Solanum species. Specific classes and types of repetitive sequences were also differentially represented between these two species including a telomeric-related repetitive sequence, ribosomal DNA, and a number of unclassified repetitive sequences. Comparative analyses between tomato and potato at the gene level revealed a high level of conservation of gene content, genic feature, and gene order although discordances in synteny were observed. Conclusion Genomic level analyses of potato and tomato confirm that gene sequence and gene order are conserved between these solanaceous species and that this conservation can be leveraged in genomic applications including cross-species annotation and genome sequencing initiatives. While tomato and potato share genic features, they differ in their repetitive sequence content and composition suggesting that repetitive sequences may have a more significant role in shaping speciation than previously reported. PMID:18554403

  11. A Contiguous 3-Mb Sequence-Ready Map in the S3–MX Region on 21q22.2 Based on High- Throughput Nonisotopic Library Screenings

    PubMed Central

    Hildmann, Thomas; Kong, Xianging; O’Brien, John; Riesselman, Lisa; Christensen, Hoang-My; Dagand, Emilie; Lehrach, Hans; Yaspo, Marie-Laure

    1999-01-01

    Progress in complete genomic sequencing of human chromosome 21 relies on the construction of high-quality bacterial clone maps spanning large chromosomal regions. To achieve this goal, we have applied a strategy based on nonradioactive hybridizations to contig building. A contiguous sequence-ready map was constructed in the Down syndrome congenital heart disease (DS-CHD) region in 21q22.2, as a framework for large-scale genomic sequencing and positional candidate gene approach. Contig assembly was performed essentially by high throughput nonisotopic screenings of genomic libraries, prior to clone validation by (1) restriction digest fingerprinting, (2) STS analysis, (3) Southern hybridizations, and (4) FISH analysis. The contig contains a total of 50 STSs, of which 13 were newly isolated. A minimum tiling path (MTP) was subsequently defined that consists of 20 PACs, 2 BACs, and 5 cosmids covering 3 Mb between D21S3 and MX1. Gene distribution in the region includes 9 known genes (c21–LRP, WRB, SH3BGR, HMG14, PCP4, DSCAM, MX2, MX1, and TMPRSS2) and 14 new additional gene signatures consisting of cDNA selection products and ESTs. Forthcoming genomic sequence information will unravel the structural organization of potential candidate genes involved in specific features of Down syndrome pathogenesis. PMID:10207158

  12. bac genes for recombinant bacilysin and anticapsin production in Bacillus host strains

    Microsoft Academic Search

    Gerhard Steinborn; Mohammad-Reza Hajirezaei; Jürgen Hofemeister

    2005-01-01

    The genes encoding the biosynthesis of the dipeptide bacilysin and its antibiotic constituent anticapsin were isolated from several strains of Bacillus subtilis as well as B. amyloliquefaciens and B. pumilus. The ywfBCDEF genes of B. subtilis 168 were shown to carry the biosynthetic core functions and were renamed bacABCDE. Mutation of the bacD gene or transformation of the bacABC genes

  13. Genomics Glossary

    NSDL National Science Digital Library

    Chitty, Mary Glen.

    Because genomics is an interdisciplinary science that unites biology, chemistry, physics, and mathematics, its language is diverse and includes terms not always found in dictionaries. This site from Cambridge Healthtech Institute of Massachusetts was designed to help scientists keep on top of this complex language. Loads of terms in categories such as basic genetics, functional and structural genomics, informatics, and genomic-related technology are defined here. Users can access the glossary terms either through a short index of major subject headings or by a longer alphabetically-arranged subject list. The Genomics Glossary deserves bonus points for including links to related resources in the text of its definitions. For example, within the definition of "polymerase chain reaction" are links to sites at Yale Medical School and the National Library of Medicine. In addition, links to pages on nomenclature, a bibliography of Web and print resources, and a FAQ page are available at this fantastic Website.

  14. Sequence-Tagged Connectors: A Sequence Approach to Mapping and Scanning the Human Genome

    Microsoft Academic Search

    Gregory G. Mahairas; James C. Wallace; Kim Smith; Steven Swartzell; Ted Holzman; Andrew Keller; Ron Shaker; Jepf Furlong; Janet Young; Shaying Zhao; Mark D. Adams; Leroy Hood

    1999-01-01

    The sequence-tagged connector (STC) strategy proposes to generate sequence tags densely scattered (every 3.3 kilobases) across the human genome by arraying 450,000 bacterial artificial chromosomes (BACs) with randomly cleaved inserts, sequencing both ends of each, and preparing a restriction enzyme fingerprint of each. The STC resource, containing end sequences, fingerprints, and arrayed BACs, creates a map where the interrelationships of

  15. RiBAC: Role Interaction Based Access Control Model for Community Computing

    NASA Astrophysics Data System (ADS)

    Jung, Youna; Masoumzadeh, Amirreza; Joshi, James B. D.; Kim, Minkoo

    Community computing is an agent-based development paradigm for ubiquitous computing systems. In a community computing system, ubiquitous services are provided by cooperation among agents. While agents cooperate, they interact with each other continuously to access data of other agents and/or to execute other agent’s actions. However, in cases of security-critical ubiquitous services such as medical or military services, an access control mechanism is necessary to prevent unauthorized access to critical data or action. In this paper, we propose a family of Role interaction Based Access Control (RiBAC) models for Community Computing, by extending the existing RBAC model to consider role interactions. As a basic model, we propose the core RiBAC model. For the convenience of management and to provide more fine-grained access control, we propose Hierarchical RiBAC (H-RiBAC), Constrained RiBAC (C-RiBAC), and Constrained Hierarchical RiBAC (CH-RiBAC) models. Finally, we extend the existing community computing framework to accommodate the specification and enforcement of RiBAC policies.

  16. The Genome Sequence of the Fungal Pathogen Fusarium virguliforme That Causes Sudden Death Syndrome in Soybean

    PubMed Central

    Srivastava, Subodh K.; Huang, Xiaoqiu; Brar, Hargeet K.; Fakhoury, Ahmad M.; Bluhm, Burton H.; Bhattacharyya, Madan K.

    2014-01-01

    Fusarium virguliforme causes sudden death syndrome (SDS) of soybean, a disease of serious concern throughout most of the soybean producing regions of the world. Despite the global importance, little is known about the pathogenesis mechanisms of F. virguliforme. Thus, we applied Next-Generation DNA Sequencing to reveal the draft F. virguliforme genome sequence and identified putative pathogenicity genes to facilitate discovering the mechanisms used by the pathogen to cause this disease. Methodology/Principal Findings We have generated the draft genome sequence of F. virguliforme by conducting whole-genome shotgun sequencing on a 454 GS-FLX Titanium sequencer. Initially, single-end reads of a 400-bp shotgun library were assembled using the PCAP program. Paired end sequences from 3 and 20 Kb DNA fragments and approximately 100 Kb inserts of 1,400 BAC clones were used to generate the assembled genome. The assembled genome sequence was 51 Mb. The N50 scaffold number was 11 with an N50 Scaffold length of 1,263 Kb. The AUGUSTUS gene prediction program predicted 14,845 putative genes, which were annotated with Pfam and GO databases. Gene distributions were uniform in all but one of the major scaffolds. Phylogenic analyses revealed that F. virguliforme was closely related to the pea pathogen, Nectria haematococca. Of the 14,845 F. virguliforme genes, 11,043 were conserved among five Fusarium species: F. virguliforme, F. graminearum, F. verticillioides, F. oxysporum and N. haematococca; and 1,332 F. virguliforme-specific genes, which may include pathogenicity genes. Additionally, searches for candidate F. virguliforme pathogenicity genes using gene sequences of the pathogen-host interaction database identified 358 genes. Conclusions The F. virguliforme genome sequence and putative pathogenicity genes presented here will facilitate identification of pathogenicity mechanisms involved in SDS development. Together, these resources will expedite our efforts towards discovering pathogenicity mechanisms in F. virguliforme. This will ultimately lead to improvement of SDS resistance in soybean. PMID:24454689

  17. Exogenous mRNA delivery and bioavailability in gene transfer mediated by piggyBac transposition

    PubMed Central

    2013-01-01

    Background Up to now, the different uptake pathways and the subsequent intracellular trafficking of plasmid DNA have been largely explored. By contrast, the mode of internalization and the intracellular routing of an exogenous mRNA in transfected cells are poorly investigated and remain to be elucidated. The bioavailability of internalized mRNA depends on its intracellular routing and its potential accumulation in dynamic sorting sites for storage: stress granules and processing bodies. This question is of particular significance when a secure transposon-based system able to integrate a therapeutic transgene into the genome is used. Transposon vectors usually require two components: a plasmid DNA, carrying the gene of interest, and a source of transposase allowing the integration of the transgene. The principal drawback is the lasting presence of the transposase, which could remobilize the transgene once it has been inserted. Our study focused on the pharmacokinetics of the transposition process mediated by the piggyBac transposase mRNA transfection. Exogenous mRNA internalization and trafficking were investigated towards a better apprehension and fine control of the piggyBac transposase bioavailability. Results The mRNA prototype designed in this study provides a very narrow expression window of transposase, which allows high efficiency transposition with no cytotoxicity. Our data reveal that exogenous transposase mRNA enters cells by clathrin and caveolae-mediated endocytosis, before finishing in late endosomes 3 h after transfection. At this point, the mRNA is dissociated from its carrier and localized in stress granules, but not in cytoplasmic processing bodies. Some weaker signals have been observed in stress granules at 18 h and 48 h without causing prolonged production of the transposase. So, we designed an mRNA that is efficiently translated with a peak of transposase production 18 h post-transfection without additional release of the molecule. This confines the integration of the transgene in a very small time window. Conclusion Our results shed light on processes of exogenous mRNA trafficking, which are crucial to estimate the mRNA bioavailability, and increase the biosafety of transgene integration mediated by transposition. This approach provides a new way for limiting the transgene copy in the genome and their remobilization by mRNA engineering and trafficking. PMID:24070093

  18. Paucity and preferential suppression of transgenes in late replication domains of the D. melanogaster genome

    Microsoft Academic Search

    Vladimir N Babenko; Igor V Makunin; Irina V Brusentsova; Elena S Belyaeva; Daniil A Maksimov; Stepan N Belyakin; Peter Maroy; Lyubov A Vasil'eva; Igor F Zhimulev

    2010-01-01

    BACKGROUND: Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. RESULTS: Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions

  19. Microcolinearity and genome evolution in the AdhA region of diploid and polyploid cotton (Gossypium)

    E-print Network

    Wendel, Jonathan F.

    Microcolinearity and genome evolution in the AdhA region of diploid and polyploid cotton (Gossypium. Prior analysis of the CesA region in two cotton genomes that diverged 5­10 million years ago (Ma to include BAC sequences surrounding the gene encoding alcohol dehydrogenase A (AdhA) from four cotton

  20. A preliminary analysis of genome structure and composition in Gossypium hirsutum

    Microsoft Academic Search

    Wangzhen Guo; Caiping Cai; Changbiao Wang; Liang Zhao; Lei Wang; Tianzhen Zhang

    2008-01-01

    BACKGROUND: Upland cotton has the highest yield, and accounts for > 95% of world cotton production. Decoding upland cotton genomes will undoubtedly provide the ultimate reference and resource for structural, functional, and evolutionary studies of the species. Here, we employed GeneTrek and BAC tagging information approaches to predict the general composition and structure of the allotetraploid cotton genome. RESULTS: 142

  1. Discover your Library Medical Library

    E-print Network

    ) Computers for walk in public access. Use Findit@Flinders to search the library catalogue. No wider internetDiscover your Library Medical Library Welcome to the Gus Fraenkel Medical Library. The Library is a branch of the Flinders University Libraries including: Central (on the Plaza of the north ridge precinct

  2. Role of Bacillus subtilis BacB in the Synthesis of Bacilysin*

    PubMed Central

    Rajavel, Malligarjunan; Mitra, Ashima; Gopal, Balasubramanian

    2009-01-01

    Bacilysin is a non-ribosomally synthesized dipeptide antibiotic that is active against a wide range of bacteria and some fungi. Synthesis of bacilysin (l-alanine-[2,3-epoxycyclohexano-4]-l-alanine) is achieved by proteins in the bac operon, also referred to as the bacABCDE (ywfBCDEF) gene cluster in B. subtilis. Extensive genetic analysis from several strains of B. subtilis suggests that the bacABC gene cluster encodes all the proteins that synthesize the epoxyhexanone ring of l-anticapsin. These data, however, were not consistent with the putative functional annotation for these proteins whereby BacA, a prephenate dehydratase along with a potential isomerase/guanylyl transferase, BacB and an oxidoreductase, BacC, could synthesize l-anticapsin. Here we demonstrate that BacA is a decarboxylase that acts on prephenate. Further, based on the biochemical characterization and the crystal structure of BacB, we show that BacB is an oxidase that catalyzes the synthesis of 2-oxo-3-(4-oxocyclohexa-2,5-dienyl)propanoic acid, a precursor to l-anticapsin. This protein is a bi-cupin, with two putative active sites each containing a bound metal ion. Additional electron density at the active site of the C-terminal domain of BacB could be interpreted as a bound phenylpyruvic acid. A significant decrease in the catalytic activity of a point variant of BacB with a mutation at the N-terminal domain suggests that the N-terminal cupin domain is involved in catalysis. PMID:19776011

  3. Genomic and metagenomic approaches to natural product chemistry

    E-print Network

    Angell, Scott Edward

    2009-05-15

    insert genomic libraries and tested with a computer simulation. This indicated that even large pathways could be cloned intact in large insert libraries, provided there was an adequate size difference between the target pathway and the library inserts...

  4. A physical map of the highly heterozygous Populus genome: integration with the genome sequence and genetic map and analysis of haplotype variation

    SciTech Connect

    Kelleher, Colin [University of British Columbia, Vancouver; Chiu, Readman [Genome Sciences Centre, Vancouver, BC, Canada; Shin, Heesun [Genome Sciences Centre, Vancouver, BC, Canada; Bosdet, Ian [Genome Sciences Centre, Vancouver, BC, Canada; Krywinski, Martin [Genome Sciences Centre, Vancouver, BC, Canada; Fjell, Chris [Genome Sciences Centre, Vancouver, BC, Canada; Wilkin, Jennifer [University of British Columbia, Vancouver; Yin, Tongming [ORNL; DiFazio, Stephen P [ORNL; Ali, Johar [Genome Sciences Centre, Vancouver, BC, Canada; Asano, Jennifer [Genome Sciences Centre, Vancouver, BC, Canada; Chan, Susanna [Genome Sciences Centre, Vancouver, BC, Canada; Cloutier, Alison [Genome Sciences Centre, Vancouver, BC, Canada; Girn, Noreen [Genome Sciences Centre, Vancouver, BC, Canada; Leach, Stephen [Genome Sciences Centre, Vancouver, BC, Canada; Lee, Darlene [Genome Sciences Centre, Vancouver, BC, Canada; Mathewson, Carrie [Genome Sciences Centre, Vancouver, BC, Canada; Olson, Teika [Genome Sciences Centre, Vancouver, BC, Canada; O'Connor, Katie [Genome Sciences Centre, Vancouver, BC, Canada; Prabhu, Anna-Liisa [Genome Sciences Centre, Vancouver, BC, Canada; Smailus, Duane [Genome Sciences Centre, Vancouver, BC, Canada; Stott, Jeffery [Genome Sciences Centre, Vancouver, BC, Canada; Tsai, Miranda [Genome Sciences Centre, Vancouver, BC, Canada; Wye, Natasaja [Genome Sciences Centre, Vancouver, BC, Canada; Yang, George [Genome Sciences Centre, Vancouver, BC, Canada; Zhuang, Jun [Genome Sciences Centre, Vancouver, BC, Canada; Holt, Robert A. [Genome Sciences Centre, Vancouver, BC, Canada; Putnam, Nicholas [Genome Sciences Centre, Vancouver, BC, Canada; Vrebalov, Julia [Cornell University; Giovannoni, James [Cornell University; Grimwood, Jane [Stanford University; Schmutz, Jeremy [Stanford University; Rokhsar, Daniel [U.S. Department of Energy, Joint Genome Institute; Jones, Steven [Genome Sciences Centre, Vancouver, BC, Canada; Marra, Marco [Genome Sciences Centre, Vancouver, BC, Canada; Tuskan, Gerald A [ORNL; Bohlmann, J. [University of British Columbia, Vancouver; Ellis, Brian [University of British Columbia, Vancouver; Ritland, Kermit [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver; Schein, Jacqueline [Genome Sciences Centre, Vancouver, BC, Canada

    2007-01-01

    As part of a larger project to sequence the Populus genome and generate genomic resources for this emerging model tree, we constructed a physical map of the Populus genome, representing one of the first maps of an undomesticated, highly heterozygous plant species. The physical map, consisting of 2,802 contigs, was constructed from fingerprinted bacterial artificial chromosome (BAC) clones. The map represents approximately 9.4-fold coverage of the 485+10 Mb Populus genome, as estimated from the genome sequence assembly. BAC ends were sequenced to aid in long-range assembly of whole genome shotgun sequence scaffolds and to anchor the physical map to the genome sequence. Simple sequence repeat (SSR)-based markers were derived from the end sequences and used to initiate integration of the BAC and genetic maps. 2,411 physical map contigs, representing 97% of all clones assigned to contigs, were aligned to the sequence assembly (JGI Populus trichocarpa v1.0). These alignments represent a total coverage of 384 Mb (79%) of the entire poplar sequence assembly and 295 Mb (96%) of linkage group sequence assemblies. A striking result of the physical map contig alignments to the sequence assembly was the co-localization of multiple contigs across numerous regions of the 19 linkage groups. Targeted sequencing of BAC clones and genetic analysis in a small number of representative regions showed that these co-aligning contigs represent distinct haplotypes in the heterozygous individual sequenced, and revealed the nature of these haplotype sequence differences.

  5. Highly Efficient Modification of Bacterial Artificial Chromosomes (BACs) Using Novel Shuttle Vectors

    E-print Network

    Chait, Brian T.

    Highly Efficient Modification of Bacterial Artificial Chromosomes (BACs) Using Novel Shuttle of this technology to characterize large numbers of genes has been the process with which BACs can be modified by using a novel set of shuttle vectors that contain the R6K origin for DNA replication, the E. coli Rec

  6. Sperm-mediated transgenesis in chicken using a PiggyBac transposon system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Towards development of transgenic chickens without the use of viral vectors, factors affecting sperm mediated gene transfer (SMGT) using a piggyBac vector are being studied. The piggyBac pPBCAG-LacZ contains 13bp terminal inverted repeats flanking a LacZ gene driven by the CAG promoter. A helper pla...

  7. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond

    PubMed Central

    Ting, Jonathan T.; Feng, Guoping

    2014-01-01

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more “extra” genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines. PMID:24772073

  8. A non-autonomous insect piggyBac trasposable element is mobile in tobacco

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The piggyBac transposable element, originally isolated from a virus in an insect cell line, is a valuable molecular tool for transgenesis and mutagenesis of invertebrates. For heterologous transgenesis in a variety of mammals, transfer of the piggyBac transposable element from an ectopic plasmid onl...

  9. Optical Mapping of BAC Clones from the Human Y Chromosome DAZ Locus

    E-print Network

    Mishra, Bud

    Optical Mapping of BAC Clones from the Human Y Chromosome DAZ Locus Joseph Giacalone,1 Stephanie a set of 16 BAC clones derived from the DAZ locus of the human Y chromosome long arm, a locus in which­Biotechnology Center, University of Wisconsin­Madison, Madison, Wisconsin 53706, USA The accurate mapping of clones

  10. Construction of a 1.2Mb contig including the citrus tristeza virus resistance gene locus using a bacterial artificial chromosome library of Poncirus trifoliata (L.) Raf

    Microsoft Academic Search

    Zhong-Nan Yang; Xin-Rong Ye; Sandong Choi; Joe Molina; Francis Moonan; Rod A. Wing; Mikeal L. Roose; T. Erik Mirkov

    2001-01-01

    The citrus tristeza virus resistance gene ( Ctv) is a single dominant gene in Poncirus trifoliata, a sexually compatible relative of citrus. To clone this gene, a bacterial artificial chromosome (BAC) library has been constructed from an individual plant that was homozygous for Ctv. This library contains 45 696 clones with an average insert size of 80 kb, corresponding to

  11. The Genome Database Organism-centered listing of available genomic sequence records and projects

    E-print Network

    Levin, Judith G.

    The Genome Database Organism-centered listing of available genomic sequence records and projects http://www.ncbi.nlm.nih.gov/genome National Center for Biotechnology Information · National Library | NCBI Genome | Last Update August 19, 2013 Contact: info@ncbi.nlm.nih.gov Scope Since 2011, the Genome

  12. Constructing a Cytogenetic Map of the Maize Genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We are developing a pachytene cytogenetic FISH (Fluorescence in situ Hybridization) map of the maize (Zea mays L.) genome using maize marker-selected sorghum BACs (Bacterial Artificial Chromosome) as described by Koumbaris and Bass (2003, Plant J. 35:647). The two main projects are the production of...

  13. Efficient transformation of the yellow fever mosquito Aedes aegypti using the piggyBac transposable element vector pBac[3xP3-EGFP afm

    Microsoft Academic Search

    V. Kokoza; A. Ahmed; E. A. Wimmer; A. S. Raikhel

    2001-01-01

    We report efficient germ-line transformation in the yellow fever mosquito Aedes aegypti accomplished using the piggyBac transposable element vector pBac[3xP3-EGFP afm]. Two transgenic lines were established and characterized; each contained the Vg-Defensin A transgene with strong eye-specific expression of the enhanced green fluorescent protein (EGFP) marker gene regulated by the artificial 3xP3 promoter. Southern blot hybridization and inverse PCR analyses

  14. British Library Newspaper Library

    NSDL National Science Digital Library

    The British Library Newspaper Library in Colindale has its catalog of over 50,000 newspaper and periodical title holdings online. Researchers planning a trip to Colindale can now look up titles and dates held in advance. Reservations for materials can even be made by telephone or email. The catalog is searchable by keyword and sorted by title, date, or place. Entries include place, main title, numbers, dates, shelfmark, dates held on microfilm, and other notes. The British Library Newspaper Library's holdings include "all UK national daily and Sunday newspapers from 1801 to the present; most UK and Irish provincial newspapers, some from the early 18th century onwards; [and] selected newspapers from around the world in western and Slavonic languages dating from the 17th century onwards."

  15. Rapid recombinant protein production from piggyBac transposon-mediated stable CHO cell pools.

    PubMed

    Balasubramanian, Sowmya; Matasci, Mattia; Kadlecova, Zuzana; Baldi, Lucia; Hacker, David L; Wurm, Florian M

    2015-04-20

    Heterogeneous populations of stably transfected cells (cell pools) can serve for the rapid production of moderate amounts of recombinant proteins. Here, we propose the use of the piggyBac (PB) transposon system to improve the productivity and long-term stability of cell pools derived from Chinese hamster ovary (CHO) cells. PB is a naturally occurring genetic element that has been engineered to facilitate the integration of a transgene into the genome of the host cell. In this report PB-derived cell pools were generated after 10 days of selection with puromycin. The resulting cell pools had volumetric productivities that were 3-4 times higher than those achieved with cell pools generated by conventional plasmid transfection even though the number of integrated transgene copies per cell was similar in the two populations. In 14-day batch cultures, protein levels up to 600 and 800 mg/L were obtained for an Fc-fusion protein and a monoclonal antibody, respectively, at volumetric scales up to 1L. In general, the volumetric protein yield from cell pools remained constant for up to 3 months in the absence of selection. In conclusion, transfection of CHO cells with the PB transposon system is a simple, efficient, and reproducible approach to the generation of cell pools for the rapid production of recombinant proteins. PMID:25758242

  16. DNA transposition by protein transduction of the piggyBac transposase from lentiviral Gag precursors

    PubMed Central

    Cai, Yujia; Bak, Rasmus O.; Krogh, Louise Bechmann; Staunstrup, Nicklas H.; Moldt, Brian; Corydon, Thomas J.; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

    2014-01-01

    DNA transposon-based vectors have emerged as gene vehicles with a wide biomedical and therapeutic potential. So far, genomic insertion of such vectors has relied on the co-delivery of genetic material encoding the gene-inserting transposase protein, raising concerns related to persistent expression, insertional mutagenesis and cytotoxicity. This report describes potent DNA transposition achieved by direct delivery of transposase protein. By adapting integrase-deficient lentiviral particles (LPs) as carriers of the hyperactive piggyBac transposase protein (hyPBase), we demonstrate rates of DNA transposition that are comparable with the efficiency of a conventional plasmid-based strategy. Embedded in the Gag polypeptide, hyPBase is robustly incorporated into LPs and liberated from the viral proteins by the viral protease during particle maturation. We demonstrate lentiviral co-delivery of the transposase protein and vector RNA carrying the transposon sequence, allowing robust DNA transposition in a variety of cell types. Importantly, this novel delivery method facilitates a balanced cellular uptake of hyPBase, as shown by confocal microscopy, and allows high-efficiency production of clones harboring a single transposon insertion. Our findings establish engineered LPs as a new tool for transposase delivery. We believe that protein transduction methods will increase applicability and safety of DNA transposon-based vector technologies. PMID:24270790

  17. piggyBac transposon-based insertional mutagenesis in mouse haploid embryonic stem cells.

    PubMed

    Pettitt, Stephen J; Tan, E-Pien; Yusa, Kosuke

    2015-01-01

    Forward genetic screening is a powerful non-hypothesis-driven approach to unveil the molecular mechanisms and pathways underlying phenotypes of interest. In this approach, a genome-wide mutant library is first generated and then screened for a phenotype of interest. Subsequently, genes responsible for the phenotype are identified. There have been a number of successful screens in yeasts, Caenorhabditis elegans and Drosophila. These model organisms all allow loss-of-function mutants to be generated easily on a genome-wide scale: yeasts have a haploid stage in their reproductive cycles and the latter two organisms have short generation times, allowing mutations to be systematically bred to homozygosity. However, in mammals, the diploid genome and long generation time have always hampered rapid and efficient production of homozygous mutant cells and animals. The recent discovery of several haploid mammalian cell lines promises to revolutionize recessive genetic screens in mammalian cells. In this protocol, we describe an overview of insertional mutagenesis, focusing on DNA transposons, and provide a method for an efficient generation of genome-wide mutant libraries using mouse haploid embryonic stem cells. PMID:25408399

  18. Red-Mediated Transposition and Final Release of the Mini-F Vector of a Cloned Infectious Herpesvirus Genome

    Microsoft Academic Search

    Felix Wussow; Helmut Fickenscher; B. Karsten Tischer; Brett Lindenbach

    2009-01-01

    Bacterial artificial chromosomes (BACs) are well-established cloning vehicles for functional genomics and for constructing targeting vectors and infectious viral DNA clones. Red-recombination-based mutagenesis techniques have enabled the manipulation of BACs in Escherichia coli without any remaining operational sequences. Here, we describe that the F-factor-derived vector sequences can be inserted into a novel position and seamlessly removed from the present location

  19. Rhipicephalus microplus strain Deutsch, 10 BAC clone sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. We used labeled DNA probes from the coding reg...

  20. Parish Libraries.

    ERIC Educational Resources Information Center

    Bingham, Anne

    1997-01-01

    Describes how to develop a cost- and time-efficient parish library. Discusses ongoing promotion of the library; leadership; costs; staffing; shelving and classification systems; location; nonprint media; library policy; and ways to increase visibility. (AEF)

  1. Multimedia Library

    Cancer.gov

    Home News and Events Multimedia Library Multimedia Library Learn more about TCGA, its researchers, components and how it works from our multimedia library. Images Image: TCGA Pipeline for Comprehensive Characterization 72 DPI | 300 DPIThe path of TCGA

  2. Digital Libraries

    NSDL National Science Digital Library

    Heather

    2008-09-29

    This projects introduces digital libraries, digital initiatives, search techniques, and the Instructional Architect Review Rubric. Digital Library Information : The Scope of the Digital Library D-Lib Journal article, 1998 2008 Joint Conference on Digital Libraries (JCDL) Annual meeting devoted to Digital Libraries Initiatives : Digital Libraries Initiative The Initiative's focus is to dramatically advance the means to collect, store, and organize information in digital forms, and make it available for searching, retrieval, and processing via communication networks -- all in ...

  3. Status and opportunities for genomics research with rainbow trout

    USGS Publications Warehouse

    Thorgaard, G.H.; Bailey, G.S.; Williams, D.; Buhler, D.R.; Kaattari, S.L.; Ristow, S.S.; Hansen, J.D.; Winton, J.R.; Bartholomew, J.L.; Nagler, J.J.; Walsh, P.J.; Vijayan, M.M.; Devlin, R.H.; Hardy, R.W.; Overturf, K.E.; Young, W.P.; Robison, B.D.; Rexroad, C.; Palti, Y.

    2002-01-01

    The rainbow trout (Oncorhynchus mykiss) is one of the most widely studied of model fish species. Extensive basic biological information has been collected for this species, which because of their large size relative to other model fish species are particularly suitable for studies requiring ample quantities of specific cells and tissue types. Rainbow trout have been widely utilized for research in carcinogenesis, toxicology, comparative immunology, disease ecology, physiology and nutrition. They are distinctive in having evolved from a relatively recent tetraploid event, resulting in a high incidence of duplicated genes. Natural populations are available and have been well characterized for chromosomal, protein, molecular and quantitative genetic variation. Their ease of culture, and experimental and aquacultural significance has led to the development of clonal lines and the widespread application of transgenic technology to this species. Numerous microsatellites have been isolated and two relatively detailed genetic maps have been developed. Extensive sequencing of expressed sequence tags has begun and four BAC libraries have been developed. The development and analysis of additional genomic sequence data will provide distinctive opportunities to address problems in areas such as evolution of the immune system and duplicate genes. ?? 2002 Elsevier Science Inc. All rights reserved.

  4. Genome-Wide Interrogation of Mammalian Stem Cell Fate Determinants by Nested Chromosome Deletions

    PubMed Central

    MacRae, Tara; Laverdure, Jean-Philippe; Azcoitia, Valeria; Girard, Simon; Chagraoui, Jalila; Ringuette, Nancy; Hébert, Josée; Krosl, Jana; Mayotte, Nadine; Sauvageau, Guy

    2010-01-01

    Understanding the function of important DNA elements in mammalian stem cell genomes would be enhanced by the availability of deletion collections in which segmental haploidies are precisely characterized. Using a modified Cre-loxP–based system, we now report the creation and characterization of a collection of ?1,300 independent embryonic stem cell (ESC) clones enriched for nested chromosomal deletions. Mapping experiments indicate that this collection spans over 25% of the mouse genome with good representative coverage of protein-coding genes, regulatory RNAs, and other non-coding sequences. This collection of clones was screened for in vitro defects in differentiation of ESC into embryoid bodies (EB). Several putative novel haploinsufficient regions, critical for EB development, were identified. Functional characterization of one of these regions, through BAC complementation, identified the ribosomal gene Rps14 as a novel haploinsufficient determinant of embryoid body formation. This new library of chromosomal deletions in ESC (DelES: http://bioinfo.iric.ca/deles) will serve as a unique resource for elucidation of novel protein-coding and non-coding regulators of ESC activity. PMID:21170304

  5. Superconductivity in the Graphite Intercalation Compound BaC 6

    NASA Astrophysics Data System (ADS)

    Heguri, Satoshi; Kawade, Naoya; Fujisawa, Takumi; Yamaguchi, Akira; Sumiyama, Akihiko; Tanigaki, Katsumi; Kobayashi, Mototada

    2015-06-01

    Among many two-dimensional (2D) high TC superconductors, graphite intercalation compounds (GICs) are the most famous intercalation family, which are classified as typical electron-phonon mediated superconductors. We show unambiguous experimental facts that BaC 6 , the superconductivity of which has been missing for many years so far among various alkaline earth metal (Ca, Sr, and Ba) intercalted GICs, exhibits superconductivity at TC=65 mK . By adding this finding as the additional experimental point, a complete figure displaying the relationship between TC and interlayer distance (d ) for GICs is now provided, and their possible superconducting mechanisms raised so far are revisited. The present study settles a long-running debate between theories and experiments on the superconductivity in the first stage GICs.

  6. Comparative DNA Sequence Analysis of Wheat and Rice Genomes

    PubMed Central

    Sorrells, Mark E.; La Rota, Mauricio; Bermudez-Kandianis, Catherine E.; Greene, Robert A.; Kantety, Ramesh; Munkvold, Jesse D.; Miftahudin; Mahmoud, Ahmed; Ma, Xuefeng; Gustafson, Perry J.; Qi, Lili L.; Echalier, Benjamin; Gill, Bikram S.; Matthews, David E.; Lazo, Gerard R.; Chao, Shiaoman; Anderson, Olin D.; Edwards, Hugh; Linkiewicz, Anna M.; Dubcovsky, Jorge; Akhunov, Eduard D.; Dvorak, Jan; Zhang, Deshui; Nguyen, Henry T.; Peng, Junhua; Lapitan, Nora L.V.; Gonzalez-Hernandez, Jose L.; Anderson, James A.; Hossain, Khwaja; Kalavacharla, Venu; Kianian, Shahryar F.; Choi, Dong-Woog; Close, Timothy J.; Dilbirligi, Muharrem; Gill, Kulvinder S.; Steber, Camille; Walker-Simmons, Mary K.; McGuire, Patrick E.; Qualset, Calvin O.

    2003-01-01

    The use of DNA sequence-based comparative genomics for evolutionary studies and for transferring information from model species to crop species has revolutionized molecular genetics and crop improvement strategies. This study compared 4485 expressed sequence tags (ESTs) that were physically mapped in wheat chromosome bins, to the public rice genome sequence data from 2251 ordered BAC/PAC clones using BLAST. A rice genome view of homologous wheat genome locations based on comparative sequence analysis revealed numerous chromosomal rearrangements that will significantly complicate the use of rice as a model for cross-species transfer of information in nonconserved regions. PMID:12902377

  7. Comparative DNA sequence analysis of wheat and rice genomes.

    PubMed

    Sorrells, Mark E; La Rota, Mauricio; Bermudez-Kandianis, Catherine E; Greene, Robert A; Kantety, Ramesh; Munkvold, Jesse D; Miftahudin; Mahmoud, Ahmed; Ma, Xuefeng; Gustafson, Perry J; Qi, Lili L; Echalier, Benjamin; Gill, Bikram S; Matthews, David E; Lazo, Gerard R; Chao, Shiaoman; Anderson, Olin D; Edwards, Hugh; Linkiewicz, Anna M; Dubcovsky, Jorge; Akhunov, Eduard D; Dvorak, Jan; Zhang, Deshui; Nguyen, Henry T; Peng, Junhua; Lapitan, Nora L V; Gonzalez-Hernandez, Jose L; Anderson, James A; Hossain, Khwaja; Kalavacharla, Venu; Kianian, Shahryar F; Choi, Dong-Woog; Close, Timothy J; Dilbirligi, Muharrem; Gill, Kulvinder S; Steber, Camille; Walker-Simmons, Mary K; McGuire, Patrick E; Qualset, Calvin O

    2003-08-01

    The use of DNA sequence-based comparative genomics for evolutionary studies and for transferring information from model species to crop species has revolutionized molecular genetics and crop improvement strategies. This study compared 4485 expressed sequence tags (ESTs) that were physically mapped in wheat chromosome bins, to the public rice genome sequence data from 2251 ordered BAC/PAC clones using BLAST. A rice genome view of homologous wheat genome locations based on comparative sequence analysis revealed numerous chromosomal rearrangements that will significantly complicate the use of rice as a model for cross-species transfer of information in nonconserved regions. PMID:12902377

  8. A physical map of the highly heterozygous Populus genome: integration with the genome sequence and genetic map

    SciTech Connect

    Kelleher, Colin [University of British Columbia, Vancouver; CHIU, Dr. R. [Genome Sciences Centre, Vancouver, BC, Canada; Shin, Dr. H. [Genome Sciences Centre, Vancouver, BC, Canada; Krywinski, Martin [Genome Sciences Centre, Vancouver, BC, Canada; Fjell, Chris [Genome Sciences Centre, Vancouver, BC, Canada; Wilkin, Jennifer [University of British Columbia, Vancouver; Yin, Tongming [ORNL; Difazio, Stephen P. [West Virginia University

    2007-01-01

    As part of a larger project to sequence the Populus genome and generate genomic resources for this emerging model tree, we constructed a physical map of the Populus genome, representing one of the few such maps of an undomesticated, highly heterozygous plant species. The physical map, consisting of 2802 contigs, was constructed from fingerprinted bacterial artificial chromosome (BAC) clones. The map represents approximately 9.4-fold coverage of the Populus genome, which has been estimated from the genome sequence assembly to be 485 {+-} 10 Mb in size. BAC ends were sequenced to assist long-range assembly of whole-genome shotgun sequence scaffolds and to anchor the physical map to the genome sequence. Simple sequence repeat-based markers were derived from the end sequences and used to initiate integration of the BAC and genetic maps. A total of 2411 physical map contigs, representing 97% of all clones assigned to contigs, were aligned to the sequence assembly (JGI Populus trichocarpa, version 1.0). These alignments represent a total coverage of 384 Mb (79%) of the entire poplar sequence assembly and 295 Mb (96%) of linkage group sequence assemblies. A striking result of the physical map contig alignments to the sequence assembly was the co-localization of multiple contigs across numerous regions of the 19 linkage groups. Targeted sequencing of BAC clones and genetic analysis in a small number of representative regions showed that these co-aligning contigs represent distinct haplotypes in the heterozygous individual sequenced, and revealed the nature of these haplotype sequence differences.

  9. Human Genome Resources

    NSDL National Science Digital Library

    In an effort to track the progress of and provide access to the work of the Human Genome Project (see the October 14, 1998 Scout Report for Science & Engineering), the National Center for Biotechnology Information (NCBI) of the National Library of Medicine (NLM) has expanded their Web resource. An international research program "designed to construct detailed genetic and physical maps of the human genome." The Human Genome Resources page provides a wealth of relevant resources, from background information on the project, to specific sequences for each human chromosome (click on the desired chromosome), to Genome Maps of other organisms.

  10. Library Site Finder MAIN LIBRARY

    E-print Network

    Sidorov, Nikita

    Library Site Finder MAIN LIBRARY Burlington Street Tel: 0161 275 3751 THE ALAN GILBERT LEARNING COMMONS Oxford Road Tel: 0161 306 4306 ART & ARCHAEOLOGY LIBRARY Mansfield Cooper Building Tel: 0161 275 3657 BRADDICK LIBRARY School of Physics & Astronomy Brunswick Street Tel: 0161 275 4078 EDDIE DAVIES

  11. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond

    E-print Network

    Feng, Guoping

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic ...

  12. Design and validation of a pericentromeric BAC clone set aimed at improving diagnosis and phenotype prediction of supernumerary marker chromosomes

    PubMed Central

    2013-01-01

    Background Small supernumerary marker chromosomes (sSMCs) are additional, structurally abnormal chromosomes, generally smaller than chromosome 20 of the same metaphase spread. Due to their small size, they are difficult to characterize by conventional cytogenetics alone. In regard to their clinical effects, sSMCs are a heterogeneous group: in particular, sSMCs containing pericentromeric euchromatin are likely to be associated with abnormal outcomes, although exceptions have been reported. To improve characterization of the genetic content of sSMCs, several approaches might be applied based on different molecular and molecular-cytogenetic assays, e.g., fluorescent in situ hybridization (FISH), array-based comparative genomic hybridization (array CGH), and multiplex ligation-dependent probe amplification (MLPA). To provide a complementary tool for the characterization of sSMCs, we constructed and validated a new, FISH-based, pericentromeric Bacterial Artificial Chromosome (BAC) clone set that with a high resolution spans the most proximal euchromatic sequences of all human chromosome arms, excluding the acrocentric short arms. Results By FISH analysis, we assayed 561 pericentromeric BAC probes and excluded 75 that showed a wrong chromosomal localization. The remaining 486 probes were used to establish 43 BAC-based pericentromeric panels. Each panel consists of a core, which with a high resolution covers the most proximal euchromatic ~0.7 Mb (on average) of each chromosome arm and generally bridges the heterochromatin/euchromatin junction, as well as clones located proximally and distally to the core. The pericentromeric clone set was subsequently validated by the characterization of 19 sSMCs. Using the core probes, we could rapidly distinguish between heterochromatic (1/19) and euchromatic (11/19) sSMCs, and estimate the euchromatic DNA content, which ranged from approximately 0.13 to more than 10 Mb. The characterization was not completed for seven sSMCs due to a lack of information about the covered region in the reference sequence (1/19) or sample insufficiency (6/19). Conclusions Our results demonstrate that this pericentromeric clone set is useful as an alternative tool for sSMC characterization, primarily in cases of very small SMCs that contain either heterochromatin exclusively or a tiny amount of euchromatic sequence, and also in cases of low-level or cryptic mosaicism. The resulting data will foster knowledge of human proximal euchromatic regions involved in chromosomal imbalances, thereby improving genotype–phenotype correlations. PMID:24171812

  13. Initial and Continuous Commissioning of Building Automation and Control Systems (BACS) -Preview EN ISO 16484- 

    E-print Network

    Kranz, H. R.

    2008-01-01

    Forst 0 04 91 72/ 2 92 60 21 hans@kranz.com INITIAL AND CONTINUOUS COMMISSIONING OF BUILDING AUTOMATION AND CONTROL SYSTEMS (BACS) - PREVIEW EN ISO 16484 - Did you ever think about: ?why are our buildings so dumb?? The simple answer might be... integrated building management comprising building automation and control (BAC) along with fire safety and/or security. Those solutions require coordinated procedures during the design phase as well as during the execution phase. For energy performance...

  14. A rapid technique to develop CA repeats and STSs from BACs by direct cycle-sequencing

    Microsoft Academic Search

    T. Liang; S. Dandekar; H. Yang; R. Gatti

    1994-01-01

    CA microsatellites and sequence-tag-sites (STSs) are crucial to mapping strategies employed in many laboratories. Described here is a method to quickly generate CA repeats and STSs by cycle-sequencing from bacterial artificial chromosomes (BACs). Commonly, cosmids have been used as templates for cycle-sequencing, but an individual cosmid may not be large enough to contain a CA repeat. However, BACs contain human

  15. Region-specific deficits in dopamine, but not norepinephrine, signaling in a novel A30P ?-synuclein BAC transgenic mouse?

    PubMed Central

    Taylor, Tonya N.; Potgieter, Dawid; Anwar, Sabina; Senior, Steven L.; Janezic, Stephanie; Threlfell, Sarah; Ryan, Brent; Parkkinen, Laura; Deltheil, Thierry; Cioroch, Milena; Livieratos, Achilleas; Oliver, Peter L.; Jennings, Katie A.; Davies, Kay E.; Ansorge, Olaf; Bannerman, David M.; Cragg, Stephanie J.; Wade-Martins, Richard

    2014-01-01

    Parkinson's disease (PD) is a neurodegenerative disorder classically characterized by the death of dopamine (DA) neurons in the substantia nigra pars compacta and by intracellular Lewy bodies composed largely of ?-synuclein. Approximately 5–10% of PD patients have a familial form of Parkinsonism, including mutations in ?-synuclein. To better understand the cell-type specific role of ?-synuclein on DA neurotransmission, and the effects of the disease-associated A30P mutation, we generated and studied a novel transgenic model of PD. We expressed the A30P mutant form of human ?-synuclein in a spatially-relevant manner from the 111 kb SNCA genomic DNA locus on a bacterial artificial chromosome (BAC) insert on a mouse null (Snca ?/?) background. The BAC transgenic mice expressed ?-synuclein in tyrosine hydroxylase-positive neurons and expression of either A30P ?-synuclein or wildtype ?-synuclein restored the sensitivity of DA neurons to MPTP in resistant Snca ?/? animals. A30P ?-synuclein mice showed no Lewy body-like aggregation, and did not lose catecholamine neurons in substantia nigra or locus coeruleus. However, using cyclic voltammetry at carbon-fiber microelectrodes we identified a deficit in evoked DA release in the caudate putamen, but not in the nucleus accumbens, of SNCA-A30P Snca ?/? mice but no changes to release of another catecholamine, norepinephrine (NE), in the NE-rich ventral bed nucleus of stria terminalis. SNCA-A30P Snca ?/? mice had no overt behavioral impairments but exhibited a mild increase in wheel-running. In summary, this refined PD mouse model shows that A30P ?-synuclein preferentially perturbs the dopaminergic system in the dorsal striatum, reflecting the region-specific change seen in PD. PMID:24121116

  16. Expression of green fluorescent protein in the chicken using in vivo transfection of the piggyBac transposon.

    PubMed

    Jordan, Brian J; Vogel, Seth; Stark, Michael R; Beckstead, Robert B

    2014-03-10

    The chicken is a well-established model system for studying developmental biology and is recognized as one of the top food production animals in the world. For this reason the chicken is an excellent candidate for transgenic applications, as the technology can be applied to both areas of research. Transgenic technology has not been broadly utilized in the chicken model, however, primarily due to difficulties in targeting germ cells and establishing germ line transmission. Transgenic technologies using non-replicating viral particles have been used in the chick, but are unsuitable for many applications because of size and sequence restraints and low efficiency. To create a more versatile method to target chick germ line stem cells, we utilized the transposable element system piggyBac paired with an in vivo transfection reagent, JetPEI. piggyBac has been previously shown to be highly active in mammalian cells and will transpose into the chicken genome. Here, we show that JetPEI can transfect multiple chick cell types, most notably germline stem cells. We also show that pairing these two reagents is a viable and reproducible method for long-term expression of a transgene in the chicken. Stable expression of the green fluorescent protein (GFP) transgene was seen in multiple tissue types including heart, brain, liver, intestine, kidney and gonad. Combining an in vivo transfection strategy with the PB system provides a simple and flexible method for efficiently producing stable chimeric birds and could be used for production of germ line transgenics. PMID:24452099

  17. A functional genomics resource for Brassica napus: development of an EMS mutagenized population and discovery of FAE1 point mutations by TILLING.

    PubMed

    Wang, Nian; Wang, Yajie; Tian, Fang; King, Graham J; Zhang, Chunyu; Long, Yan; Shi, Lei; Meng, Jinling

    2008-01-01

    Two ethylmethanesulfonate (EMS) mutant populations of the semi-winter rapeseed cv. Ningyou7 were constructed with high mutant load, to provide a TILLING platform for functional genomics in Brassica napus, and for introduction of novel allelic variation in rapeseed breeding. Forward genetic screening of mutants from the M2 populations resulted in identification of a large number of novel phenotypes. Reverse genetic screening focused on the potentially multi-paralogous gene FAE1 (fatty acid elongase1), which controls seed erucic acid synthesis in rapeseed. A B. napus BAC library was screened, and loci in a reference mapping population (TNDH) were mapped to conclude that there are two paralogous copies of FAE1, one on each of the B. napus A and C genomes. A new procedure is demonstrated to identify novel mutations in situations where two or more very similar paralogous gene copies exist in a genome. The procedure involves TILLING of single plants, using existing SNPs as a positive control, and is able to distinguish novel mutations based on primer pairs designed to amplify both FAE1 paralogues simultaneously. The procedure was applied to 1344 M2 plants, with 19 mutations identified, of which three were functionally compromised with reduced seed erucic acid content. PMID:18811617

  18. Exploration of BAC versus plasmid expression vectors in recombinant CHO cells.

    PubMed

    Mader, Alexander; Prewein, Bernhard; Zboray, Katalin; Casanova, Emilio; Kunert, Renate

    2013-05-01

    Vector engineering approaches are commonly used to increase recombinant protein production in mammalian cells, and among various concepts, bacterial artificial chromosomes (BAC) have been proposed to serve as open chromatin regions to omit chromosome positional effects. For proof of concept, we developed stable recombinant Chinese hamster ovary (CHO) cell lines using different expression vector systems: the plasmid vectors contained the identical expression cassette as the BAC constructs. Two anti-HIV1 antibody derivates served as model proteins (3D6scFc and 2F5scFc) for generation of four stable recombinant CHO cell lines. The BAC-derived clones showed three to four times higher specific productivity, and therefore, gene copy numbers and transcript level were quantified. The active chromatin region provided with the BAC environment significantly improved transcription evidenced with both model proteins. Specific transcription was approximately six times higher from BAC-based vectors compared to the corresponding plasmid vectors for both single-chain fragment crystallizable (scFc) proteins. Our accurate investigations elucidated also differences between translational activities related to the protein of choice. 3D6scFc expressed specifically three to four times more product than 2F5scFc indicating that the product by itself also contributes to enhanced productivity. This study indicated comparable increase of transcription level for both scFc proteins when using the BAC system, but translation, maturation, and secretion of individual proteins seem to be protein specific. PMID:23081777

  19. BacA, an ABC Transporter Involved in Maintenance of Chronic Murine Infections with Mycobacterium tuberculosis?

    PubMed Central

    Domenech, Pilar; Kobayashi, Hajime; LeVier, Kristin; Walker, Graham C.; Barry, Clifton E.

    2009-01-01

    BacA is an inner membrane protein associated with maintenance of chronic infections in several diverse host-pathogen interactions. To understand the function of the bacA gene in Mycobacterium tuberculosis (Rv1819c), we insertionally inactivated this gene and analyzed the resulting mutant for a variety of phenotypes. BacA deficiency in M. tuberculosis did not affect sensitivity to detergents, acidic pH, and zinc, indicating that there was no global compromise in membrane integrity, and a comprehensive evaluation of the major lipid constituents of the cell envelope failed to reveal any significant differences. Infection of mice with this mutant revealed no impact on establishment of infection but a profound effect on maintenance of extended chronic infection and ultimate outcome. As in alphaproteobacteria, deletion of BacA in M. tuberculosis led to increased bleomycin resistance, and heterologous expression of the M. tuberculosis BacA homolog in Escherichia coli conferred sensitivity to antimicrobial peptides. These results suggest a striking conservation of function for BacA-related proteins in transport of a critical molecule that determines the outcome of the host-pathogen interaction. PMID:18996991

  20. Generation of Transgenic Pigs by Cytoplasmic Injection of piggyBac Transposase-Based pmGENIE-3 Plasmids1

    PubMed Central

    Li, Zicong; Zeng, Fang; Meng, Fanming; Xu, Zhiqian; Zhang, Xianwei; Huang, Xiaoling; Tang, Fei; Gao, Wenchao; Shi, Junsong; He, Xiaoyan; Liu, Dewu; Wang, Chong; Urschitz, Johann; Moisyadi, Stefan; Wu, Zhenfang

    2014-01-01

    ABSTRACT The process of transgenesis involves the introduction of a foreign gene, the transgene, into the genome of an animal. Gene transfer by pronuclear microinjection (PNI) is the predominant method used to produce transgenic animals. However, this technique does not always result in germline transgenic offspring and has a low success rate for livestock. Alternate approaches, such as somatic cell nuclear transfer using transgenic fibroblasts, do not show an increase in efficiency compared to PNI, while viral-based transgenesis is hampered by issues regarding transgene size and biosafety considerations. We have recently described highly successful transgenesis experiments with mice using a piggyBac transposase-based vector, pmhyGENIE-3. This construct, a single and self-inactivating plasmid, contains all the transpositional elements necessary for successful gene transfer. In this series of experiments, our laboratories have implemented cytoplasmic injection (CTI) of pmGENIE-3 for transgene delivery into in vivo-fertilized pig zygotes. More than 8.00% of the injected embryos developed into transgenic animals containing monogenic and often single transgenes in their genome. However, the CTI technique was unsuccessful during the injection of in vitro-fertilized pig zygotes. In summary, here we have described a method that is not only easy to implement, but also demonstrated the highest efficiency rate for nonviral livestock transgenesis. PMID:24671876

  1. Preparation of PAC libraries. Final technical report

    SciTech Connect

    Pieter J. de Jong

    1997-12-31

    The goals of this project were to create P1 Artificial Chromosome (PAC) cloning vectors and use these vectors to generate, characterize, and distribute both human and mouse genomic PAC libraries to the scientific community.

  2. A comprehensive library of DNA-binding site matrices for 55 proteins applied to the complete Escherichia coli K-12 genome1

    Microsoft Academic Search

    Keith Robison; Abigail Manson McGuire; George M. Church

    1998-01-01

    A major mode of gene regulation occurs via the binding of specific pro- teins to specific DNA sequences. The availability of complete bacterial genome sequences offers an unprecedented opportunity to describe net- works of such interactions by correlating existing experimental data with computational predictions. Of the 240 candidate Escherichia coli DNA- binding proteins, about 55 have DNA-binding sites identified by

  3. Abundance and characterization of simple-sequence repeats (SSRs) isolated from a size-fractionated genomic library of Brassica napus L. (rapeseed)

    Microsoft Academic Search

    S. Kresovich; A. K. Szewc-McFadden; S. M. Bliek; J. R. McFerson

    1995-01-01

    A size-fractionated library of Brassica napus L. (rapeseed), composed of 15000 clones, was screened for the presence of GA-, CA-, and GATA-simple-sequence repeats (SSRs). GA-SSRs were four- and five-fold more abundant than CA- and GATA-SSRs, respectively, and present at a frequency of approximately one SSR for every 100 kb of DNA. Following the sequencing of 124 positive clones, primer pairs

  4. Engineering large viral DNA genomes using the CRISPR-Cas9 system.

    PubMed

    Suenaga, Tadahiro; Kohyama, Masako; Hirayasu, Kouyuki; Arase, Hisashi

    2014-09-01

    Manipulation of viral genomes is essential for studying viral gene function and utilizing viruses for therapy. Several techniques for viral genome engineering have been developed. Homologous recombination in virus-infected cells has traditionally been used to edit viral genomes; however, the frequency of the expected recombination is quite low. Alternatively, large viral genomes have been edited using a bacterial artificial chromosome (BAC) plasmid system. However, cloning of large viral genomes into BAC plasmids is both laborious and time-consuming. In addition, because it is possible for insertion into the viral genome of drug selection markers or parts of BAC plasmids to affect viral function, artificial genes sometimes need to be removed from edited viruses. Herpes simplex virus (HSV), a common DNA virus with a genome length of 152?kbp, causes labialis, genital herpes and encephalitis. Mutant HSV is a candidate for oncotherapy, in which HSV is used to kill tumor cells. In this study, the clustered regularly interspaced short palindromic repeat-Cas9 system was used to very efficiently engineer HSV without inserting artificial genes into viral genomes. Not only gene-ablated HSV but also gene knock-in HSV were generated using this method. Furthermore, selection with phenotypes of edited genes promotes the isolation efficiencies of expectedly mutated viral clones. Because our method can be applied to other DNA viruses such as Epstein-Barr virus, cytomegaloviruses, vaccinia virus and baculovirus, our system will be useful for studying various types of viruses, including clinical isolates. PMID:25040500

  5. Ataxin-2 Regulates RGS8 Translation in a New BAC-SCA2 Transgenic Mouse Model

    PubMed Central

    Figueroa, Karla P.; Rinehart, Marc D.; Wiest, Shaina; Pflieger, Lance T.; Scoles, Daniel R.; Pulst, Stefan M.

    2015-01-01

    Spinocerebellar ataxia type 2 (SCA2) is an autosomal dominant disorder with progressive degeneration of cerebellar Purkinje cells (PCs) and other neurons caused by expansion of a glutamine (Q) tract in the ATXN2 protein. We generated BAC transgenic lines in which the full-length human ATXN2 gene was transcribed using its endogenous regulatory machinery. Mice with the ATXN2 BAC transgene with an expanded CAG repeat (BAC-Q72) developed a progressive cellular and motor phenotype, whereas BAC mice expressing wild-type human ATXN2 (BAC-Q22) were indistinguishable from control mice. Expression analysis of laser-capture microdissected (LCM) fractions and regional expression confirmed that the BAC transgene was expressed in PCs and in other neuronal groups such as granule cells (GCs) and neurons in deep cerebellar nuclei as well as in spinal cord. Transcriptome analysis by deep RNA-sequencing revealed that BAC-Q72 mice had progressive changes in steady-state levels of specific mRNAs including Rgs8, one of the earliest down-regulated transcripts in the Pcp2-ATXN2[Q127] mouse line. Consistent with LCM analysis, transcriptome changes analyzed by deep RNA-sequencing were not restricted to PCs, but were also seen in transcripts enriched in GCs such as Neurod1. BAC-Q72, but not BAC-Q22 mice had reduced Rgs8 mRNA levels and even more severely reduced steady-state protein levels. Using RNA immunoprecipitation we showed that ATXN2 interacted selectively with RGS8 mRNA. This interaction was impaired when ATXN2 harbored an expanded polyglutamine. Mutant ATXN2 also reduced RGS8 expression in an in vitro coupled translation assay when compared with equal expression of wild-type ATXN2-Q22. Reduced abundance of Rgs8 in Pcp2-ATXN2[Q127] and BAC-Q72 mice supports our observations of a hyper-excitable mGluR1-ITPR1 signaling axis in SCA2, as RGS proteins are linked to attenuating mGluR1 signaling. PMID:25902068

  6. Sequencing a Genome by Walking With Clone-end Sequences

    E-print Network

    Batzoglou, Serafim

    genome is (i) to sequence a collection of non- overlapping 'seeds' chosen from a genomic library of large of seed clones and the depth of the genomic library used for walking, affect the cost and time, Massachusetts lnsmute of Technology, Cambridge MA 02139. * To whom correspondence should be addressed. 45 #12;

  7. Use of bioinformatics to investigate and analyze transposable element insertions in the genomes of caenorhabditis elegans and drosophila melanogaster, and into the target plasmid pGDV1 

    E-print Network

    Julian, Andrea Marian

    2005-02-17

    datasets of insertions of the P element in the Drosophila melanogaster genome, the Tc1 element in the Caenorhabditis elegans genome, and insertions of the Mos1, piggyBac and Hermes transposons into the target plasmid pGDV1. Analysis of the DNA structural...

  8. Library Skills.

    ERIC Educational Resources Information Center

    Paul, Karin; Kuhlthau, Carol C.; Branch, Jennifer L.; Solowan, Diane Galloway; Case, Roland; Abilock, Debbie; Eisenberg, Michael B.; Koechlin, Carol; Zwaan, Sandi; Hughes, Sandra; Low, Ann; Litch, Margaret; Lowry, Cindy; Irvine, Linda; Stimson, Margaret; Schlarb, Irene; Wilson, Janet; Warriner, Emily; Parsons, Les; Luongo-Orlando, Katherine; Hamilton, Donald

    2003-01-01

    Includes 19 articles that address issues related to library skills and Canadian school libraries. Topics include information literacy; inquiry learning; critical thinking and electronic research; collaborative inquiry; information skills and the Big 6 approach to problem solving; student use of online databases; library skills; Internet accuracy;…

  9. The effectiveness of a 0.05 blood alcohol concentration (BAC) limit for driving in the United States

    PubMed Central

    Fell, James C.; Voas, Robert B.

    2015-01-01

    The National Transportation Safety Board recently recommended that states establish a per se blood alcohol concentration (BAC) limit of 0.05 or lower for all drivers who are not already required to adhere to lower BAC limits in a national effort to reduce alcohol-impaired driving. There is strong evidence for adopting this recommendation. A comprehensive review of the literature on BAC limits was conducted. The research indicates that virtually all drivers are impaired regarding at least some driving performance measures at a 0.05 BAC. The risk of being involved in a crash increases significantly at 0.05 BAC and above. The relative risk of being killed in a single-vehicle crash with BACs of 0.05–0.079 is 7–21 times higher than for drivers at 0.00 BAC. Lowering the BAC limit from 0.08 to 0.05 has been a proven effective countermeasure in numerous countries around the world. Most Americans do not believe a person should drive after having two or three drinks in 2 hours. It takes at least four drinks for the average 170-pound male to exceed 0.05 BAC in 2 hours (three drinks for the 137-pound female). Most industrialized nations have established a 0.05 BAC limit or lower for driving. Progress in reducing the proportion of drivers in fatal crashes with illegal BACs has stalled over the past 15 years. Lowering the BAC limit for driving from the current 0.08 to 0.05 has substantial potential to reduce the number of people who drink and drive in the United States and get involved in fatal crashes. PMID:24898061

  10. PA2. Neutron stars "PA2. NSs" http://vega.bac.pku.edu.cn/rxxu R. X. Xu

    E-print Network

    Xu, Ren-Xin

    PA2. Neutron stars "PA2. NSs" http://vega.bac.pku.edu.cn/rxxu R. X. Xu #12;... **** ... "" "" "PA2. NSs" http://vega.bac.pku.edu.cn/rxxu R. X. Xu #12;Alford et al. RMP 80 (2008) 1455 Quark Star ·1968BellHewish"" ·1968 Gold" = " 1 "PA2. NSs" http://vega.bac.pku.edu.cn/rxxu R. X. Xu #12;Fermi ·1969

  11. Mouse and Human BAC Transgenes Recapitulate Tissue-Specific Expression of the Vitamin D Receptor in Mice and Rescue the VDR-Null Phenotype

    PubMed Central

    Lee, Seong Min; Bishop, Kathleen A.; Goellner, Joseph J.; O'Brien, Charles A.

    2014-01-01

    The biological actions of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) are mediated by the vitamin D receptor (VDR), which is expressed in numerous target tissues in a cell type-selective manner. Recent studies using genomic analyses and recombineered bacterial artificial chromosomes (BACs) have defined the specific features of mouse and human VDR gene loci in vitro. In the current study, we introduced recombineered mouse and human VDR BACs as transgenes into mice and explored their expression capabilities in vivo. Individual transgenic mouse strains selectively expressed BAC-derived mouse or human VDR proteins in appropriate vitamin D target tissues, thereby recapitulating the tissue-specific expression of endogenous mouse VDR. The mouse VDR transgene was also regulated by 1,25(OH)2D3 and dibutyryl-cAMP. When crossed into a VDR-null mouse background, both transgenes restored wild-type basal as well as 1,25(OH)2D3-inducible gene expression patterns in the appropriate tissues. This maneuver resulted in the complete rescue of the aberrant phenotype noted in the VDR-null mouse, including systemic features associated with altered calcium and phosphorus homeostasis and disrupted production of parathyroid hormone and fibroblast growth factor 23, and abnormalities associated with the skeleton, kidney, parathyroid gland, and the skin. This study suggests that both mouse and human VDR transgenes are capable of recapitulating basal and regulated expression of the VDR in the appropriate mouse tissues and restore 1,25(OH)2D3 function. These results provide a baseline for further dissection of mechanisms integral to mouse and human VDR gene expression and offer the potential to explore the consequence of selective mutations in VDR proteins in vivo. PMID:24693968

  12. Survey of 42,000 Gossypium hirsutum cv. Maxxa BAC-End Sequences and Frequency, Type, and Annotation of BAC-derived SSRs.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The quest for more molecular markers is a major initiative in cotton, which lags behind crops such as soybean, maize, and rice in this type of research. In an effort to increase the number of microsatellite markers in Gossypium, BAC-end sequences from a publicly available Gossypium hirsutum cv. Maxx...

  13. Germ-line transformation of the Queensland fruit fly, Bactrocera tryoni, using a piggyBac vector in the presence of endogenous piggyBac elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the stable genetic transformation of the Queensland fruit fly Bactrocera tryoni using a piggyBac vector marked with either the fluorescent protein DsRed or EGFP.A transformation frequency of 5–10% was obtained.Inheritance of the transgenes has remained stable over eight generations despite...

  14. Après le bac professionnel ou technologique : la poursuite d'études jusqu'à bac + 2 et sa rentabilité salariale en début de vie active

    Microsoft Academic Search

    Stéphanie Moullet

    2005-01-01

    [fre] Le rendement salarial que les bacheliers professionnels et technologiques peuvent attendre de la poursuite de leurs études dépend de leur réussite, incertaine, au diplôme de niveau bac + 2. Le calcul de ce rendement est fondé sur le supplément de salaire que pourraient escompter ces bacheliers, compte tenu de leurs caractéristiques individuelles, s'ils poursuivaient leurs études en cas de

  15. Expression of human CAR splicing variants in BAC-transgenic mice.

    PubMed

    Zhang, Yu-Kun Jennifer; Lu, Hong; Klaassen, Curtis D

    2013-03-01

    The nuclear receptor constitutive androstane receptor (CAR) is a key regulator for drug metabolism in liver. Human CAR (hCAR) transcripts are subjected to alternative splicing. Some hCAR splicing variants (SVs) have been shown to encode functional proteins by reporter assays. However, in vivo research on the activity of these hCAR SVs has been impeded by the absence of a valid model. This study engineered an hCAR-BAC-transgenic (hCAR-TG) mouse model by integrating the 8.5-kbp hCAR gene as well as 73-kbp upstream and 91-kbp downstream human genomic DNA into the genome of CAR-null mice. A series of experiments demonstrate that (1) the expression of major hCAR mRNA SVs, SV0-4, in livers of hCAR-TG mice is comparable to that in human livers; (2) the hCAR SVs are predominantly expressed in liver, which resembles the tissue distribution of CAR in humans, but diverges from that in mice; and (3) major hCAR mRNA SVs increase markedly in postnatal livers of hCAR-TG mice, which mimics the ontogeny of CAR mRNA in humans. Thus, the transgene likely contains all the functional regulatory elements controlling proper spatial and temporal expression of the hCAR gene. Moreover, hCAR-TG mice respond to the hCAR-specific agonist 6-(4-chlorophenyl)imidazo[2,1-b] [1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime instead of the mouse CAR agonist 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, as well as the common CAR activator, phenobarbital, suggesting that hCAR is fully functional in livers of transgenic mice. In summary, the hCAR-TG mice developed by this study represent a valid model for studying in vivo function and regulation of hCAR and its splicing variants. PMID:23152187

  16. Mapping The Icelandic Genome

    NSDL National Science Digital Library

    The Berkeley Digital Library SunSITE (see the February 9, 1996 Scout Report) has recently a new digital collection. Mapping The Icelandic Genome is an anthropological forum that examines and debates the "scientific, political, economic, religious, and ethical issues surrounding the deCode Project," a controversial project begun by a biotech company, deCode Genetics, "to produce a comprehensive genomic map of the Icelandic people."

  17. Comparative genomics: the key to understanding the human genome project

    Microsoft Academic Search

    M. S. Clark

    1999-01-01

    Summary The sequencing of the human genome is well underway. Technology has ad- vanced, such that the total genomic sequence is possible, along with an extensive catalogue of genes via comprehensive cDNA libraries. With the recent completion of the Saccharomyces cerevisiae sequencing project and the imminent comple- tion of that of Caenorhabditis elegans, the most frequently asked question is how

  18. High-resolution genomic profiling of male breast cancer reveals differences hidden behind the similarities with female breast cancer

    Microsoft Academic Search

    Ida Johansson; Cecilia Nilsson; Pontus Berglund; Carina Strand; Göran Jönsson; Johan Staaf; Markus Ringnér; Heli Nevanlinna; Rosa B. Barkardottir; Åke Borg; Håkan Olsson; Lena Luts; Marie-Louise Fjällskog; Ingrid Hedenfalk

    Male breast cancer (MBC) is extremely rare and poorly characterized on the molecular level. Using high-resolution genomic\\u000a data, we aimed to characterize MBC by genomic imbalances and to compare it with female breast cancer (FBC), and further to\\u000a investigate whether the genomic profiles hold any prognostic information. Fifty-six fresh frozen MBC tumors were analyzed\\u000a using high-resolution tiling BAC arrays. Significant

  19. Cancer Genome Anatomy Project

    NSDL National Science Digital Library

    The National Cancer Institute has launched the Cancer Genome Anatomy Project to "achieve a comprehensive molecular characterization of normal, precancerous, and malignant cells." Sequenced genes are held as library entries in a database and are available for downloading (fasta format). Each cDNA library entry may include biological source, number of sequences, and library construction detail information. Thousands of gene sequences are available for over 15 cancers, including breast, colon, and prostrate. Contact information for donating or obtaining tissue samples for research purposes is provided.

  20. A systematic library for comprehensive

    E-print Network

    Cai, Long

    systematically instead of relying on the random occurrence of new mutations1. Impressive applications. Random libraries in 2m plasmid­ based vectors4 are frequently incomplete and are biased ligated partially MboI- digested yeast genomic DNA into a newly designed vector (Supple- mentary Fig. 1

  1. Comparison of the chromosome maps around a resistance hot spot on chromosome 5 of potato and tomato using BAC-FISH painting.

    PubMed

    Achenbach, Ute C; Tang, Xiaomin; Ballvora, Agim; de Jong, Hans; Gebhardt, Christiane

    2010-02-01

    Potato chromosome 5 harbours numerous genes for important qualitative and quantitative traits, such as resistance to the root cyst nematode Globodera pallida and the late blight fungus, Phytophthora infestans. The genes make up part of a "hot spot" for resistances to various pathogens covering a genetic map length of 3 cM between markers GP21 and GP179. We established the physical size and position of this region on chromosome 5 in potato and tomato using fluorescence in situ hybridization (FISH) on pachytene chromosomes. Five potato bacterial artificial chromosome (BAC) clones with the genetically anchored markers GP21, R1-contig (proximal end), CosA, GP179, and StPto were selected, labeled with different fluorophores, and hybridized in a five-colour FISH experiment. Our results showed the location of the BAC clones in the middle of the long arm of chromosome 5 in both potato and tomato. Based on chromosome measurements, we estimate the physical size of the GP21-GP179 interval at 0.85 Mb and 1.2 Mb in potato and tomato, respectively. The GP21-GP179 interval is part of a genome segment known to have inverted map positions between potato and tomato. PMID:20140028

  2. Databases and information integration for the Medicago truncatula genome and transcriptome.

    PubMed

    Cannon, Steven B; Crow, John A; Heuer, Michael L; Wang, Xiaohong; Cannon, Ethalinda K S; Dwan, Christopher; Lamblin, Anne-Francoise; Vasdewani, Jayprakash; Mudge, Joann; Cook, Andrew; Gish, John; Cheung, Foo; Kenton, Steve; Kunau, Timothy M; Brown, Douglas; May, Gregory D; Kim, Dongjin; Cook, Douglas R; Roe, Bruce A; Town, Chris D; Young, Nevin D; Retzel, Ernest F

    2005-05-01

    An international consortium is sequencing the euchromatic genespace of Medicago truncatula. Extensive bioinformatic and database resources support the marker-anchored bacterial artificial chromosome (BAC) sequencing strategy. Existing physical and genetic maps and deep BAC-end sequencing help to guide the sequencing effort, while EST databases provide essential resources for genome annotation as well as transcriptome characterization and microarray design. Finished BAC sequences are joined into overlapping sequence assemblies and undergo an automated annotation process that integrates ab initio predictions with EST, protein, and other recognizable features. Because of the sequencing project's international and collaborative nature, data production, storage, and visualization tools are broadly distributed. This paper describes databases and Web resources for the project, which provide support for physical and genetic maps, genome sequence assembly, gene prediction, and integration of EST data. A central project Web site at medicago.org/genome provides access to genome viewers and other resources project-wide, including an Ensembl implementation at medicago.org, physical map and marker resources at mtgenome.ucdavis.edu, and genome viewers at the University of Oklahoma (www.genome.ou.edu), the Institute for Genomic Research (www.tigr.org), and Munich Information for Protein Sequences Center (mips.gsf.de). PMID:15888676

  3. A Simple and Effective Procedure for Discovering Microsatellites from Small Insert Libraries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microsatellite loci are useful markers for studying genetic diversity and for creating linkage maps in plants and animals. However, microsatellite discovery from a genomic library is tedious and costly. We have constructed a small insert genomic library and six repeats-enriched libraries. Instead of...

  4. A first generation BAC-based physical map of the Rainbow trout genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND: Rainbow trout (Oncorhynchus mykiss) are the most-widely cultivated cold freshwater fish in the world and an important model species for many research areas. Coupling great interest in this species as a research model with the need for genetic improvement of aquaculture production effici...

  5. Genomic tools development for Aquilegia: construction of a BAC-based physical map

    Microsoft Academic Search

    Guang-Chen Fang; Barbara P Blackmon; David C Henry; Margaret E Staton; Christopher A Saski; Scott A Hodges; Jeff P Tomkins; Hong Luo

    2010-01-01

    BACKGROUND: The genus Aquilegia, consisting of approximately 70 taxa, is a member of the basal eudicot lineage, Ranuculales, which is evolutionarily intermediate between monocots and core eudicots, and represents a relatively unstudied clade in the angiosperm phylogenetic tree that bridges the gap between these two major plant groups. Aquilegia species are closely related and their distribution covers highly diverse habitats.

  6. Construction and Characterization of New piggyBac Vectors for Constitutive or Inducible Expression of Heterologous Gene Pairs and the Identification of a Previously Unrecognized Activator Sequence in piggyBac

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The piggyBac transposable element was first identified when it inserted itself into baculovirus genes during infection, causing a mutant plaque morphology phenotype. Since then, piggyBac has been developed into a germline tranformation vector usable with a wide variety of organisms. In this study...

  7. Microbial Genomics

    NSDL National Science Digital Library

    Web page with links to microbes in the Joint Genome Institute (JGI) system than have finished genomes and draft genomes. There are also links to JGI home page, genome portal home, and the human genome project.

  8. Libraries program

    USGS Publications Warehouse

    2011-01-01

    The U.S. Congress authorized a library for the U.S. Geological Survey (USGS) in 1879. The library was formally established in 1882 with the naming of the first librarian and began with a staff of three and a collection of 1,400 books. Today, the USGS Libraries Program is one of the world's largest Earth and natural science repositories and a resource of national significance used by researchers and the public worldwide.

  9. Evaluation of the Lytic Origins of Replication of Kaposi's Sarcoma-Associated Virus/Human Herpesvirus 8 in the Context of the Viral Genome

    PubMed Central

    Xu, Yiyang; Rodriguez-Huete, Alicia; Pari, Gregory S.

    2006-01-01

    The lytic origins of DNA replication for human herpesvirus 8 (HHV8), oriLyt-L and oriLyt-R, are located between open reading frames K4.2 and K5 and ORF69 and vFLIP, respectively. These lytic origins were elucidated using a transient replication assay. Although this assay is a powerful tool for identifying many herpesvirus lytic origins, it is limited in its ability to evaluate the activity of replication origins in the context of the viral genome. To this end, we investigated the ability of a recombinant HHV8 bacterial artificial chromosome (BAC) to replicate in the absence of oriLyt-R, oriLyt-L, or both oriLyt regions. We generated the HHV8 BAC recombinants (BAC36-?Ori-R, BAC36-?Ori-L, and BAC36-?Ori-RL), which removed one or all of the identified lytic origins. An evaluation of these recombinant BACs revealed that oriLyt-L was sufficient to propagate the viral genome, whereas oriLyt-R alone failed to direct the amplification of viral DNA. PMID:16973596

  10. Evaluation of the lytic origins of replication of Kaposi's sarcoma-associated virus/human herpesvirus 8 in the context of the viral genome.

    PubMed

    Xu, Yiyang; Rodriguez-Huete, Alicia; Pari, Gregory S

    2006-10-01

    The lytic origins of DNA replication for human herpesvirus 8 (HHV8), oriLyt-L and oriLyt-R, are located between open reading frames K4.2 and K5 and ORF69 and vFLIP, respectively. These lytic origins were elucidated using a transient replication assay. Although this assay is a powerful tool for identifying many herpesvirus lytic origins, it is limited in its ability to evaluate the activity of replication origins in the context of the viral genome. To this end, we investigated the ability of a recombinant HHV8 bacterial artificial chromosome (BAC) to replicate in the absence of oriLyt-R, oriLyt-L, or both oriLyt regions. We generated the HHV8 BAC recombinants (BAC36-DeltaOri-R, BAC36-DeltaOri-L, and BAC36-DeltaOri-RL), which removed one or all of the identified lytic origins. An evaluation of these recombinant BACs revealed that oriLyt-L was sufficient to propagate the viral genome, whereas oriLyt-R alone failed to direct the amplification of viral DNA. PMID:16973596

  11. BacM, an N-terminally processed bactofilin of Myxococcus xanthus, is crucial for proper cell shape

    PubMed Central

    Koch, Matthias K.; McHugh, Colleen A.; Hoiczyk, Egbert

    2011-01-01

    Summary Bactofilins are fibre-forming bacterial cytoskeletal proteins. Here, we report the structural and biochemical characterization of MXAN_7475 (BacM), one of the four bactofilins of Myxococcus xanthus. Absence of BacM leads to a characteristic ‘crooked’ cell morphology and an increased sensitivity to antibiotics targeting cell wall biosynthesis. The absence of the other three bactofilins MXAN_4637–4635 (BacN-P) has no obvious phenotype. In M. xanthus, BacM exists as a 150-amino-acid full-length version and as a version cleaved before Ser28. In the cell, native BacM forms 3 nm wide fibres, which assemble into bundles forming helix-like cytoplasmic cables throughout the cell, and in a subset of cells additionally a polarly arranged lateral rod-like structure. Isolated fibres consist almost completely of the N-terminally truncated version, suggesting that the proteolytic cleavage occurs before or during fibre formation. Fusion of BacM to mCherry perturbs BacM function and cellular fibre arrangement, resulting for example in the formation of one prominent polar corkscrew-like structure per cell. Immunofluorescence staining of BacM and MreB shows that their cellular distributions are not matching. Taken together, these data suggest that rod-shaped bacteria like M. xanthus use bactofilin fibres to achieve and maintain their characteristic cell morphology and cell wall stability. PMID:21414039

  12. A Hybrid Adenoviral Vector System Achieves Efficient Long-Term Gene Expression in the Liver via piggyBac Transposition.

    PubMed

    Smith, Ryan P; Riordan, Jesse D; Feddersen, Charlotte R; Dupuy, Adam J

    2015-06-01

    Much research has gone into the development of hybrid gene delivery systems that combine the broad tropism and efficient transduction of adenoviral vectors with the ability to achieve stable expression of cargo genes. In addition to gene therapy applications, such a system has considerable advantages for studies of gene function in vivo, permitting fine-tuned genetic manipulation with higher throughput than can be achieved using standard transgenic and DNA targeting techniques. Existing strategies are limited, however, by low integration efficiencies, small cargo capacity, and/or a dependence on target cell division. The utility of this approach could be enhanced by a system that provides all of the following: (1) efficient delivery, (2) stable expression in a high percentage of target cells (whether mitotic or not), (3) large cargo capacity, (4) flexibility to use with a wide range of additional experimental conditions, and (5) simple experimental technique. Here we report the initial characterization of a hybrid system that meets these criteria by utilizing piggyBac (PB) transposition to achieve genomic integration from adenoviral vectors. We demonstrate stable expression of an adenovirus (Ad)-PB-delivered reporter gene in ?20-40% of hepatocytes following standard tail vein injection. Its high efficiency and flexibility relative to existing hybrid adenoviral gene delivery approaches indicate a considerable potential utility of the Ad-PB system for therapeutic gene delivery and in vivo studies of gene function. PMID:25808258

  13. Library Advocacy

    ERIC Educational Resources Information Center

    Plunkett, Kate

    2010-01-01

    This paper is about the issue of advocacy. Standing at the vanguard of literacy, library media specialists have a unique role. However, it is time for media specialists to advocate their services in a proactive way. If library media specialists cannot, both individually and collectively, put advocacy at the forefront, then students will suffer the…

  14. Macintoshed Libraries.

    ERIC Educational Resources Information Center

    Valauskas, Edward J., Ed.; John, Nancy R., Ed.

    Contributed by librarians from public, academic, school, and special libraries, the 17 essays in this collection describe ways in which the Apple Macintosh is used in their libraries: (1) "Workstations and the Apple Macintosh" (Edward J. Valauskas); (2) "The Macintosh Experience at Chesapeake College" (Liz Cooper); (3) "ANSEL Character Set for the…

  15. Library Research.

    ERIC Educational Resources Information Center

    Wright, Nancy Kirkpatrick

    This workbook, designed for a Library Research course at Yavapai College, provides 15 lessons in advanced library reference skills. Each lesson provides explanatory text and reinforcement exercises. After Lesson I introduces specialized dictionaries and encyclopedias (e.g., for foreign languages, medicine, music, economics, social sciences, and…

  16. Privatizing Libraries

    ERIC Educational Resources Information Center

    Jerrard, Jane; Bolt, Nancy; Strege, Karen

    2012-01-01

    This timely special report from ALA Editions provides a succinct but comprehensive overview of the "privatization" of public libraries. It provides a history of the trend of local and state governments privatizing public services and assets, and then examines the history of public library privatization right up to the California legislation…

  17. BACs-on-Beads™ (BoBs™) assay for the genetic evaluation of prenatal samples and products of conception.

    PubMed

    Grati, Francesca Romana; Vialard, François; Gross, Susan

    2015-01-01

    BACs-on-Beads™ (BoBs™) is a new emerging technology, a modification of comparative genomic hybridization that can be used to detect DNA copy number gains and losses. Here, we describe the application of two different types of BoBs™ assays: (1) Prenatal BoBs (CE-IVD) to detect the most frequent syndromes associated with chromosome microdeletions, as well as the trisomy 13, 18 and 21, and (2) KaryoLite BoBs (RUO) which can detect aneuploidy in all chromosomes by quantifying proximal and terminal regions of each chromosomal arm. The interpretation of the results by BoBsoft™ software is also described. Although BoBs™ may not have the breadth and scope to replace chromosomal microarrays (array comparative genomic hybridization and single nucleotide polymorphism array) in the prenatal setting, particularly when a fetal anomaly has been detected, it is a well suited alternative for FISH or QF-PCR because BoBs™ is comparable, if not superior in terms of cost, turnaround time (TAT) and throughput and accuracy. BoBs™ also has the ability to detect significant fetal mosaicism (?30% with Prenatal BoBs and ?50% with KaryoLite BoBs). However, perhaps the greatest strength of this new technology is the fact that unlike FISH or QF-PCR, it has the ability to detect common microdeletion syndromes or additional aneuploidies, both of which may be easily missed despite excellent prenatal sonography. Thus, when BoBs™ is applied in the correct clinical setting and run and analyzed in appropriate laboratories this technique can improve and augment best practices with a personalization of prenatal care. PMID:25239751

  18. Engineering Library Guidance

    E-print Network

    Kaji, Hajime

    Science & Engineering Library Library Guidance April 2014 1 #12;Contents 1 Overview of Waseda University Library 2 Science & Engineering Library and the Student Reading Room 3 WINE: Waseda's Library Catalog3 WINE: Waseda's Library Catalog 4 Library Services 5 Notes 2 #12;How many libraries

  19. INTEGRATED PLANNING: UNIVERSITY LIBRARY your library

    E-print Network

    Peak, Derek

    INTEGRATED PLANNING: UNIVERSITY LIBRARY your library engage, enlighten, explore at library.usask.ca Transforming Library Services, Collections and Facilities: The University Library People Plan SUMMARY VERSION OVERVIEW Central themes in the library strategic plan highlight the critical importance which our people

  20. The Garden of Ulysses: Ferdinand Bac, modernism and the afterlife of myth

    Microsoft Academic Search

    Lawrence Joseph

    2000-01-01

    Ferdinand Bac's three Mediterranean gardens constructed between 1913 and 1925 are more than a chapter in the history of horticultural design. They are the product of an existential conflict that reflects one of the central cultural dilemmas of the age for designers of all sorts as well as for writers: the problem of epigonism. How was one to create in

  1. Differential CT features of infectious pneumonia versus bronchioloalveolar carcinoma (BAC) mimicking pneumonia.

    PubMed

    Kim, Tae Hoon; Kim, Sang Jin; Ryu, Young Hoon; Chung, Soo Yoon; Seo, Jae Seung; Kim, Young Jin; Choi, Byoung Wook; Lee, Sun Hwa; Cho, Sang Ho

    2006-08-01

    The purpose of this study was to evaluate retrospectively the differential CT features of bronchioloalveolar carcinoma (BAC) mimicking pneumonia and infectious pneumonia at the lung periphery. CT images were reviewed in 47 patients with focal areas of parenchymal opacification at the lung periphery. We evaluated the presence of ground-glass attenuation, marginal conspicuity of the lesion, CT angiogram sign, air-bronchogram sign, a bubble-like low-attenuation area within the lesion, presence of pleural thickening and retraction associated with the lesion, presence of pleural effusion and extra-pleural fatty hypertrophy, presence of bronchial wall thickening proximal to the lesion, and air-trapping in the normal lung near the lesion. BAC (n=18) depicted the presence of a bubble-like low-attenuation area within the lesion, whereas infectious pneumonia (n=29) represented the pleural thickening associated with the lesion and bronchial wall thickening proximal to the lesion (P<0.05). The other CT findings showed no significant differences (P>0.05). The focal areas of the parenchymal opacification on the CT images may suggest infectious pneumonia rather than BAC when they show bronchial wall thickening proximal to the lesion and pleural thickening associated with the lesion, whereas BAC is characterized as the presence of a bubble-like low attenuation area within the tumor. PMID:16418864

  2. Functional Complementation and Genetic Deletion Studies of KirBac Channels

    E-print Network

    Tucker, Stephen J.

    and genetic complementation in K -aux- otrophic Escherichia coli and Saccharomyces cerevisiae to iden- tify as a region close to the selectivity filter of KirBac3.1 that may have an effect on gating. In particular- tidylinositol 4,5-bisphosphate, ATP, and intracellular pH, and are therefore able to couple channel activity

  3. A CamKIIalpha iCre BAC allows brain-specific gene inactivation.

    PubMed

    Casanova, E; Fehsenfeld, S; Mantamadiotis, T; Lemberger, T; Greiner, E; Stewart, A F; Schütz, G

    2001-09-01

    We describe the generation of transgenic mouse lines expressing the Cre recombinase enzyme in brain under control of the CamKIIalpha gene present in a BAC expression vector. The CamKIIalpha BAC transgene gave a faithful expression pattern resembling the pattern of the endogenous CamKIIalpha gene. Specifically, high levels of CamKIIalpha Cre were detected in hippocampus, cortex, and amygdala, and lower levels were detected in striatum, thalamus, and hypothalamus. As expected, no expression was detected in the cerebellum or outside of the brain. The expression level of the BAC CamKIIalpha driven Cre was shown to be copy number dependent. To test the activity of the Cre recombinase, the transgenic mice were crossed with mice harbouring the CREB (cAMP response element binding protein) allele with the 10th exon flanked by two loxP sites, and recombination was monitored by the disappearance of the CREB protein. Finally, evaluation of the developmental postnatal expression of the CamKIIalpha Cre BAC revealed the expression of the Cre recombinase as early as P3. PMID:11668676

  4. PiggyBac Mediated Multiplex Gene Transfer in Mouse Embryonic Stem Cell

    PubMed Central

    Lu, Xibin; Huang, Wei

    2014-01-01

    PiggyBac system has been shown to have a high efficiency to mediate gene transfer. However, there are no reports on its efficiency to mediate multiplex transgenes in mouse embryonic stem cells. Here we first established an immortalized feeder cell line by introducing four antibiotic resistance genes simultaneously into the original SNL 76/7 feeder cell line utilizing the PiggyBac system. This is the feeder cell line with the most diverse types of antibiotic resistance genes reported so far, which will enable researchers to perform simultaneous multiplex gene transfer or gene targeting experiments in ES cells. With such feeder cell line, we were able to quantitatively characterize the transposition efficiency of PiggyBac system in mouse ES cells using five transposons carrying different inducible fluorescence proteins and antibiotic resistance genes, and the efficiency ranged from about 2% for one transposon to 0.5% for five transposons. The highly efficient multiplex gene transfer mediated by PiggyBac will no doubt provide researchers with more choices in biomedical research and development. PMID:25517991

  5. As Blood Alcohol Content (BAC) Increases, So Does Impairment | NIH MedlinePlus the Magazine

    MedlinePLUS

    ... Content (BAC) 0.0 - 0.05% Mild Impairment – 0.0 - 0.05% Mild speech, memory, attention, coordination, balance impairments ... can begin 0.06 - 0.15% Increased Impairment – 0.06 - 0.15% Perceived beneficial effects of alcohol, ...

  6. ANCHORING 9371 MAIZE EST UNIGENES TO THE BAC CONTIG MAP BY TWO-DIMENSIONAL OVERGO HYBRIDIZATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To construct a robust physical map that can be comprehensively integrated with the genetic map, we have used a two-dimensional 24 x 24 overgo pooling strategy to anchor maize EST unigenes to BACs on high-density filters. A set of 70,716 maize ESTs has been used to derive 10,723 "cornsensus" EST uni...

  7. Development of a database system for mapping insertional mutations onto the mouse genome with large-scale experimental data

    Microsoft Academic Search

    Wenwei Yang; Ke Jin; Xing Xie; Dongsheng Li; Jigang Yang; Li Wang; Ning Gu; Yang Zhong; Ling V Sun

    2009-01-01

    BACKGROUND: Insertional mutagenesis is an effective method for functional genomic studies in various organisms. It can rapidly generate easily tractable mutations. A large-scale insertional mutagenesis with the piggyBac (PB) transposon is currently performed in mice at the Institute of Developmental Biology and Molecular Medicine (IDM), Fudan University in Shanghai, China. This project is carried out via collaborations among multiple groups

  8. Fractionation of Synteny in a Genomic Region Containing Tandemly Duplicated Genes Across Glycine max, Medicago truncatula and Arabidopsis thaliana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Extended comparison of gene sequences found on homeologous soybean BACs to Medicago truncatula and Arabidopsis thaliana genomic sequences demonstrated a network of synteny within conserved regions interrupted by gene addition and/or deletions. Consolidation of gene order among all three species prov...

  9. Insight into the genome of Aspergillus fumigatus: analysis of a 922 kb region encompassing the nitrate assimilation gene cluster

    Microsoft Academic Search

    Arnab Pain; John Woodward; Michael A Quail; Michael J Anderson; Richard Clark; Matthew Collins; Nigel Fosker; Audrey Fraser; David Harris; Natasha Larke; Lee Murphy; Sean Humphray; Susan O’Neil; Mihaela Pertea; Claire Price; Ester Rabbinowitsch; Marie-Adele Rajandream; Steven Salzberg; David Saunders; Kathy Seeger; Sarah Sharp; Tim Warren; David W Denning; Bart Barrell; Neil Hall

    2004-01-01

    Aspergillus fumigatus is the most ubiquitous opportunistic filamentous fungal pathogen of human. As an initial step toward sequencing the entire genome of A. fumigatus, which is estimated to be ?30Mb in size, we have sequenced a 922kb region, contained within 16 overlapping bacterial artificial chromosome (BAC) clones. Fifty-four percent of the DNA is predicted to be coding with 341 putative

  10. Sequence-Based Analysis of Structural Organization and Composition of the Cultivated Sunflower (Helianthus annuus L.) Genome.

    PubMed

    Gill, Navdeep; Buti, Matteo; Kane, Nolan; Bellec, Arnaud; Helmstetter, Nicolas; Berges, Hélène; Rieseberg, Loren H

    2014-01-01

    Sunflower is an important oilseed crop, as well as a model system for evolutionary studies, but its 3.6 gigabase genome has proven difficult to assemble, in part because of the high repeat content of its genome. Here we report on the sequencing, assembly, and analyses of 96 randomly chosen BACs from sunflower to provide additional information on the repeat content of the sunflower genome, assess how repetitive elements in the sunflower genome are organized relative to genes, and compare the genomic distribution of these repeats to that found in other food crops and model species. We also examine the expression of transposable element-related transcripts in EST databases for sunflower to determine the representation of repeats in the transcriptome and to measure their transcriptional activity. Our data confirm previous reports in suggesting that the sunflower genome is >78% repetitive. Sunflower repeats share very little similarity to other plant repeats such as those of Arabidopsis, rice, maize and wheat; overall 28% of repeats are "novel" to sunflower. The repetitive sequences appear to be randomly distributed within the sequenced BACs. Assuming the 96 BACs are representative of the genome as a whole, then approximately 5.2% of the sunflower genome comprises non TE-related genic sequence, with an average gene density of 18kbp/gene. Expression levels of these transposable elements indicate tissue specificity and differential expression in vegetative and reproductive tissues, suggesting that expressed TEs might contribute to sunflower development. The assembled BACs will also be useful for assessing the quality of several different draft assemblies of the sunflower genome and for annotating the reference sequence. PMID:24833511

  11. Synteny conservation between the Prunus genome and both the present and ancestral Arabidopsis genomes

    PubMed Central

    Jung, Sook; Main, Dorrie; Staton, Margaret; Cho, Ilhyung; Zhebentyayeva, Tatyana; Arús, Pere; Abbott, Albert

    2006-01-01

    Background Due to the lack of availability of large genomic sequences for peach or other Prunus species, the degree of synteny conservation between the Prunus species and Arabidopsis has not been systematically assessed. Using the recently available peach EST sequences that are anchored to Prunus genetic maps and to peach physical map, we analyzed the extent of conserved synteny between the Prunus and the Arabidopsis genomes. The reconstructed pseudo-ancestral Arabidopsis genome, existed prior to the proposed recent polyploidy event, was also utilized in our analysis to further elucidate the evolutionary relationship. Results We analyzed the synteny conservation between the Prunus and the Arabidopsis genomes by comparing 475 peach ESTs that are anchored to Prunus genetic maps and their Arabidopsis homologs detected by sequence similarity. Microsyntenic regions were detected between all five Arabidopsis chromosomes and seven of the eight linkage groups of the Prunus reference map. An additional 1097 peach ESTs that are anchored to 431 BAC contigs of the peach physical map and their Arabidopsis homologs were also analyzed. Microsyntenic regions were detected in 77 BAC contigs. The syntenic regions from both data sets were short and contained only a couple of conserved gene pairs. The synteny between peach and Arabidopsis was fragmentary; all the Prunus linkage groups containing syntenic regions matched to more than two different Arabidopsis chromosomes, and most BAC contigs with multiple conserved syntenic regions corresponded to multiple Arabidopsis chromosomes. Using the same peach EST datasets and their Arabidopsis homologs, we also detected conserved syntenic regions in the pseudo-ancestral Arabidopsis genome. In many cases, the gene order and content of peach regions was more conserved in the ancestral genome than in the present Arabidopsis region. Statistical significance of each syntenic group was calculated using simulated Arabidopsis genome. Conclusion We report here the result of the first extensive analysis of the conserved microsynteny using DNA sequences across the Prunus genome and their Arabidopsis homologs. Our study also illustrates that both the ancestral and present Arabidopsis genomes can provide a useful resource for marker saturation and candidate gene search, as well as elucidating evolutionary relationships between species. PMID:16615871

  12. Open Library

    NSDL National Science Digital Library

    2008-04-09

    Open Library is an open, editable library catalog with an attractive facade and a lofty mission. The mission? To build an online catalog with a web page for every book ever published. The best part? You can help. From the homepage, click Sign Up, then create a free Open Library account in two simple steps. From there, add new books, write descriptions, manage lists, and generally enjoy contributing to one of the most exciting library projects on the web. Of course, you donâ??t need an account to browse the site, with its 20 million records (and counting). Simply click Authors, Subjects, Recently, or Lists to search the site by category, or type a keyword into the general search function.

  13. Telecommunications Library

    NSDL National Science Digital Library

    The Telecommunications Library at WilTel, includes resources such as the Long Distance Digest, Telecom Digest, Telecom Glossary, the working papers from The Research Institute for Telecommunications and Information Marketing, among others.

  14. Sustained high level transgene expression in mammalian cells mediated by the optimized piggyBac transposon system

    PubMed Central

    Chen, Xiang; Cui, Jing; Yan, Zhengjian; Zhang, Hongmei; Chen, Xian; Wang, Ning; Shah, Palak; Deng, Fang; Zhao, Chen; Geng, Nisha; Li, Melissa; Denduluri, Sahitya K.; Haydon, Rex C.; Luu, Hue H.; Reid, Russell R.; He, Tong-Chuan

    2015-01-01

    Sustained, high level transgene expression in mammalian cells, especially stem cells, may be desired in many cases for studying gene functions. Traditionally, stable transgene expression has been accomplished by using retroviral or lentiviral vectors. However, such viral vector-mediated transgene expression is often at low levels and can be reduced over time due to low copy numbers and/or chromatin remodeling repression. The piggyBac transposon has emerged as a promising non-viral vector system for efficient gene transfer into mammalian cells. Despite its inherent advantages over lentiviral and retroviral systems, piggyBac system has not been widely used, at least in part due to the limited availability of piggyBac vectors with manipulation flexibilities. Here, we seek to optimize piggyBac-mediated transgene expression and generate a more efficient, user-friendly piggyBac system. By engineering a panel of versatile piggyBac vectors and constructing recombinant adenoviruses expressing piggyBac transposase (PBase), we demonstrate that adenovirus-mediated PBase expression significantly enhances the integration efficiency and expression level of transgenes in mesenchymal stem cells and osteosarcoma cells, compared to that obtained from co-transfection of the CMV-PBase plasmid. We further determine the drug selection timeline to achieve optimal stable transgene expression. Moreover, we demonstrate that the transgene copy number of piggyBac-mediated integration is approximately 10 times higher than that mediated by retroviral vectors. Using the engineered tandem expression vector, we show that three transgenes can be simultaneously expressed in a single vector with high efficiency. Thus, these results strongly suggest that the optimized piggyBac system is a valuable tool for making stable cell lines with sustained, high transgene expression. PMID:25815368

  15. The impact of Ty3-gypsy group LTR retrotransposons Fatima on B-genome specificity of polyploid wheats

    PubMed Central

    2011-01-01

    Background Transposable elements (TEs) are a rapidly evolving fraction of the eukaryotic genomes and the main contributors to genome plasticity and divergence. Recently, occupation of the A- and D-genomes of allopolyploid wheat by specific TE families was demonstrated. Here, we investigated the impact of the well-represented family of gypsy LTR-retrotransposons, Fatima, on B-genome divergence of allopolyploid wheat using the fluorescent in situ hybridisation (FISH) method and phylogenetic analysis. Results FISH analysis of a BAC clone (BAC_2383A24) initially screened with Spelt1 repeats demonstrated its predominant localisation to chromosomes of the B-genome and its putative diploid progenitor Aegilops speltoides in hexaploid (genomic formula, BBAADD) and tetraploid (genomic formula, BBAA) wheats as well as their diploid progenitors. Analysis of the complete BAC_2383A24 nucleotide sequence (113 605 bp) demonstrated that it contains 55.6% TEs, 0.9% subtelomeric tandem repeats (Spelt1), and five genes. LTR retrotransposons are predominant, representing 50.7% of the total nucleotide sequence. Three elements of the gypsy LTR retrotransposon family Fatima make up 47.2% of all the LTR retrotransposons in this BAC. In situ hybridisation of the Fatima_2383A24-3 subclone suggests that individual representatives of the Fatima family contribute to the majority of the B-genome specific FISH pattern for BAC_2383A24. Phylogenetic analysis of various Fatima elements available from databases in combination with the data on their insertion dates demonstrated that the Fatima elements fall into several groups. One of these groups, containing Fatima_2383A24-3, is more specific to the B-genome and proliferated around 0.5-2.5 MYA, prior to allopolyploid wheat formation. Conclusion The B-genome specificity of the gypsy-like Fatima, as determined by FISH, is explained to a great degree by the appearance of a genome-specific element within this family for Ae. speltoides. Moreover, its proliferation mainly occurred in this diploid species before it entered into allopolyploidy. Most likely, this scenario of emergence and proliferation of the genome-specific variants of retroelements, mainly in the diploid species, is characteristic of the evolution of all three genomes of hexaploid wheat. PMID:21635794

  16. Library Locations Locations other than Main Library

    E-print Network

    Library Locations Locations other than Main Library Example: Feminist Studies HQ1410 .U54 2009 Andelson Collection: 2 South, Ethnic & Gender Studies Library (EGSL) Annex: Off campus storage. See www.library.ucsb.edu/depts/access/annex.html Arts Library: 1st Floor, Music Building Asian American Studies: 2 South, Ethnic & Gender Studies

  17. Library Locations Locations other than Main Library

    E-print Network

    Library Locations Locations other than Main Library Example: Feminist Studies HQ1410 .U54 2009 University of California, Santa Barbara Library www.library.ucsb.edu Updated 3-2014 A - B.......................................6 Central M - N..................................................Arts Library (Music Building) P

  18. UNBC Library External Review 2012 Library Response

    E-print Network

    Northern British Columbia, University of

    UNBC Library External Review 2012 Library Response November 2, 2012 An external review was conducted of the UNBC Library services in April 2012 by Dr. Vicki Williamson of University of Saskatchewan is available at https://library.unbc.ca/external- review/ . Below is the Library's planned followup

  19. Euchromatin and Pericentromeric Heterochromatin: Comparative Composition in the Tomato Genome

    PubMed Central

    Wang, Ying; Tang, Xiaomin; Cheng, Zhukuan; Mueller, Lukas; Giovannoni, Jim; Tanksley, Steve D.

    2006-01-01

    Eleven sequenced BACs were annotated and localized via FISH to tomato pachytene chromosomes providing the first global insights into the compositional differences of euchromatin and pericentromeric heterochromatin in this model dicot species. The results indicate that tomato euchromatin has a gene density (6.7 kb/gene) similar to that of Arabidopsis and rice. Thus, while the euchromatin comprises only 25% of the tomato nuclear DNA, it is sufficient to account for ?90% of the estimated 38,000 nontransposon genes that compose the tomato genome. Moreover, euchromatic BACs were largely devoid of transposons or other repetitive elements. In contrast, BACs assigned to the pericentromeric heterochromatin had a gene density 10–100 times lower than that of the euchromatin and are heavily populated by retrotransposons preferential to the heterochromatin—the most abundant transposons belonging to the Jinling Ty3/gypsy-like retrotransposon family. Jinling elements are highly methylated and rarely transcribed. Nonetheless, they have spread throughout the pericentromeric heterochromatin in tomato and wild tomato species fairly recently—well after tomato diverged from potato and other related solanaceous species. The implications of these findings on evolution and on sequencing the genomes of tomato and other solanaceous species are discussed. PMID:16489216

  20. The Context and the SitBAC Models for Privacy Preservation—An Experimental Comparison of Model Comprehension and Synthesis

    Microsoft Academic Search

    Dizza Beimel; Mor Peleg

    2010-01-01

    Situation-Based Access Control (SitBAC) is a conceptual model for representing access control policies of healthcare organizations by characterizing situations of access to patient data. The SitBAC model enables formal representation of access situations as an ontology of concepts (Patient, Data Requestor, EHR, Task, and Response) along with their attributes and relationships. A competing access control model is the Contextual Role-Based

  1. GENSAT BAC Cre-recombinase driver lines to study the functional organization of cerebral cortical and basal ganglia circuits

    PubMed Central

    Gerfen, Charles R.; Paletzki, Ronald; Heintz, Nathaniel

    2013-01-01

    Summary Recent development of molecular genetic techniques are rapidly advancing understanding of the functional role of brain circuits in behavior. Critical to this approach is the ability to target specific neuron populations and circuits. The collection of over 250 BAC Cre-recombinase driver lines produced by the GENSAT project provides a resource for such studies. Here we provide characterization of GENSAT BAC-Cre driver lines with expression in specific neuroanatomical pathways within the cerebral cortex and basal ganglia. PMID:24360541

  2. Oil-Refinery Wastewater Treatment Aiming Reuse by Advanced Oxidation Processes (AOPs) Combined with Biological Activated Carbon (BAC)

    Microsoft Academic Search

    Bianca M. Souza; Ana C. Cerqueira; Geraldo L. SantAnna Jr; Marcia Dezotti

    2011-01-01

    The treatment of a refinery wastewater by Advanced Oxidation Processes (AOP) coupled with Biological Activated Carbon (BAC) was investigated aiming to generate water for reuse. O3\\/UV and H2O2\\/UV processes were employed to oxidize the organic matter and the BAC process to remove residual organic matter from the AOP effluent. AOP promoted oxidation of recalcitrant organic matter as observed by moderate

  3. Cloning genomic sequences using long-range PCR

    Microsoft Academic Search

    John Mundy; Raphael Mayer; Nam-Hai Chua

    1995-01-01

    Protocols are presented for preparing DNA from a genomic library in ? phage and for synthesizing genomic fragments using PCR\\u000a with nested vector- and gene-specific primers and linker-primers. Library DNA, isolated fromE. coli liquid lysates by a simple protocol, is used as template in PCR following a commercial protocol. The method produces library\\u000a DNA sufficient for several hundred PCRs, incorporates

  4. BacMam immunization partially protects pigs against sublethal challenge with African swine fever virus.

    PubMed

    Argilaguet, Jordi M; Pérez-Martín, Eva; López, Sergio; Goethe, Martin; Escribano, J M; Giesow, Katrin; Keil, Günther M; Rodríguez, Fernando

    2013-04-01

    Lack of vaccines and efficient control measures complicate the control and eradication of African swine fever (ASF). Limitations of conventional inactivated and attenuated virus-based vaccines against African swine fever virus (ASFV) highlight the need to use new technologies to develop efficient and safe vaccines against this virus. With this aim in mind, in this study we have constructed BacMam-sHAPQ, a baculovirus based vector for gene transfer into mammalian cells, expressing a fusion protein comprising three in tandem ASFV antigens: p54, p30 and the extracellular domain of the viral hemagglutinin (secretory hemagglutinin, sHA), under the control of the human cytomegalovirus immediate early promoter (CMVie). Confirming its correct in vitro expression, BacMam-sHAPQ induced specific T-cell responses directly after in vivo immunization. Conversely, no specific antibody responses were detectable prior to ASFV challenge. The protective potential of this recombinant vaccine candidate was tested by a homologous sublethal challenge with ASFV following immunization. Four out of six immunized pigs remained viremia-free after ASFV infection, while the other two pigs showed similar viremic titres to control animals. The protection afforded correlated with the presence of a large number of virus-specific IFN?-secreting T-cells in blood at 17 days post-infection. In contrast, the specific antibody levels observed after ASFV challenge in sera from BacMam-sHAPQ immunized pigs were indistinguishable from those found in control pigs. These results highlight the importance of the cellular responses in protection against ASFV and point towards BacMam vectors as potential tools for future vaccine development. PMID:23428670

  5. Identification of nitrifiers and nitrification performance in drinking water biological activated carbon (BAC) filtration

    Microsoft Academic Search

    Kozet Yapsakli; Bulent Mertoglu; Ferhan Çeçen

    2010-01-01

    In this study laboratory scale biological activated carbon (BAC) columns were operated with water taken from a surface water reservoir in Istanbul. The aim was to evaluate the efficiency of nitrification in columns packed with two different granular activated carbon grades (open superstructure\\/chemically activated and closed superstructure\\/steam activated carbon) and to examine the probable beneficial effect of pre-ozonation. The occurrence

  6. Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo

    PubMed Central

    Doherty, Joseph E.; Huye, Leslie E.; Yusa, Kosuke; Zhou, Liqin; Craig, Nancy L.

    2012-01-01

    Abstract We characterized a recently developed hyperactive piggyBac (pB) transposase enzyme [containing seven mutations (7pB)] for gene transfer in human cells in vitro and to somatic cells in mice in vivo. Despite a protein level expression similar to that of native pB, 7pB significantly increased the gene transfer efficiency of a neomycin resistance cassette transposon in both HEK293 and HeLa cultured human cells. Native pB and SB100X, the most active transposase of the Sleeping Beauty transposon system, exhibited similar transposition efficiency in cultured human cell lines. When delivered to primary human T cells ex vivo, 7pB increased gene delivery two- to threefold compared with piggyBac and SB100X. The activity of hyperactive 7pB transposase was not affected by the addition of a 24-kDa N-terminal tag, whereas SB100X manifested a 50% reduction in transposition. Hyperactive 7pB was compared with native pB and SB100X in vivo in mice using hydrodynamic tail-vein injection of a limiting dose of transposase DNA combined with luciferase reporter transposons. We followed transgene expression for up to 6 months and observed approximately 10-fold greater long-term gene expression in mice injected with a codon-optimized version of 7pB compared with mice injected with native pB or SB100X. We conclude that hyperactive piggyBac elements can increase gene transfer in human cells and in vivo and should enable improved gene delivery using the piggyBac transposon system in a variety of cell and gene-therapy applications. PMID:21992617

  7. Extracting gene function from protein–protein interactions using Quantitative BAC InteraCtomics (QUBIC)

    Microsoft Academic Search

    Nina C. Hubner; Matthias Mann

    2011-01-01

    Large-scale proteomic screens are increasingly employed for placing genes into specific pathways. Therefore generic methods providing a physiological context for protein–protein interaction studies are of great interest. In recent years many protein–protein interactions have been determined by affinity purification followed by mass spectrometry (AP–MS). Among many different AP–MS approaches, the recently developed Quantitative BAC InteraCtomics (QUBIC) approach is particularly attractive

  8. Size matters: versatile use of PiggyBac transposons as a genetic manipulation tool

    Microsoft Academic Search

    Adele Kim; Ilmari Pyykko

    2011-01-01

    Transposons have been promising elements for gene integration, and the Sleeping\\u000a Beauty (SB) system has been the major one for many years, although there have been several other transposon systems available, for\\u000a example, Tol2. However, recently another system known as PiggyBac (PB) has been introduced and developed for fulfilling the same purposes, for example, mutagenesis, transgenesis and gene\\u000a therapy and

  9. Enhanced biodegradation of petrochemical wastewater using ozonation and bac advanced treatment system

    Microsoft Academic Search

    Chi-Kang Lin; Tsung-Yueh Tsai; Jiunn-Ching Liu; Mei-Chih Chen

    2001-01-01

    The characteristics of degradation\\/conversion of bio-refractory and the growth of a biofilm are investigated in laboratory-scale pre-ozonation and lifted moving-bed biological activated carbon (BAC) advanced treatment processes treating phenol, benzoic acid, aminobenzoic acid and petrochemical industry wastewater which contains acrylonitrile butadiene styrene (ABS). The optimal reaction time and ozone dosage of pre-ozonation for bio-refractory conversion were determined to be 30min

  10. Enforcement following 0.08% BAC law change: Sex-specific consequences of changing arrest practices?

    PubMed Central

    Schwartz, Jennifer; Davaran, Ardavan

    2013-01-01

    This research evaluated effects of stricter 0.08% BAC drunken driving law on changes in sex-specific DUI arrest rates, controlling for increased law enforcement resources and shifts in DUI-related behaviors. Another main purpose, the study assessed female/male differences in arrest increases due to broader enforcement standards and efforts. Panel data was assembled for 24 states over 1990–2007 on DUI arrests, alcohol policy, law enforcement resources, drinking and drunken driving prevalence. Two-way fixed-effects seemingly unrelated regression models predicted female versus male changes in DUI arrests following implementation of lower legal limits of intoxication, net controls. Findings suggest, first, a broader legal definition of drunken driving intending to officially sanction less serious offenders (0.08% vs. 0.10% BAC) was associated with increased DUI arrests for both sexes. Second, growth in specialized DUI-enforcement units also was related to increased arrests. Whereas male and female arrest trends were equally affected by the direct net-widening effects of 0.08% BAC alcohol-policy, specialized DUI-enforcement efforts to dig deeper into the offender-pool had stronger arrest-producing effects on females, particularly prior to law change. Specifying how changes in law and enforcement resources affect arrest outcomes is an important precursor to alcohol-policy analyses of effectiveness. A potential unintended consequence, effects of law and enforcement may differ across population segments. PMID:23773958

  11. Public Libraries

    ERIC Educational Resources Information Center

    Library Journal, 1972

    1972-01-01

    Building data is given for the following public libraries: New York, New York; Blue Island, Illinois; Corte Madera, California; Muskogee, Oklahoma: Charlotte, North Carolina; Washington, D.C.; Houston, Texas; Albermarle, North Carolina; Spokane, Washington; and Hemet, California. (Author/NH)

  12. Genomic aberrations associated with outcome in anaplastic oligodendroglial tumors treated within the EORTC phase III trial 26951.

    PubMed

    Idbaih, Ahmed; Dalmasso, Cyril; Kouwenhoven, Mathilde; Jeuken, Judith; Carpentier, Catherine; Gorlia, Thierry; Kros, Johan M; French, Pim; Teepen, Johannes; Broët, Philippe; Delattre, Olivier; Mokhtari, Karima; Sanson, Marc; Delattre, Jean-Yves; van den Bent, Martin; Hoang-Xuan, Khê

    2011-06-01

    Despite similar morphological aspects, anaplastic oligodendroglial tumors (AOTs) form a heterogeneous clinical subgroup of gliomas. The chromosome arms 1p/19q codeletion has been shown to be a relevant biomarker in AOTs and to be perfectly exclusive from EGFR amplification in gliomas. To identify new genomic regions associated with prognosis, 60 AOTs from the EORTC trial 26951 were analyzed retrospectively using BAC-array-based comparative genomic hybridization. The data were processed using a binary tree method. Thirty-three BACs with prognostic value were identified distinguishing four genomic subgroups of AOTs with different prognosis (p < 0.0001). Type I tumors (25%) were characterized by: (1) an EGFR amplification, (2) a poor prognosis, (3) a higher rate of necrosis, and (4) an older age of patients. Type II tumors (21.7%) had: (1) loss of prognostic BACs located on 1p tightly associated with 19q deletion, (2) a longer survival, (3) an oligodendroglioma phenotype, and (4) a frontal location in brain. Type III AOTs (11.7%) exhibited: (1) a deletion of prognostic BACs located on 21q, and (2) a short survival. Finally, type IV tumors (41.7%) had different genomic patterns and prognosis than type I, II and III AOTs. Multivariate analysis showed that genomic type provides additional prognostic data to clinical, imaging and pathological features. Similar results were obtained in the cohort of 45 centrally reviewed-validated cases of AOTs. Whole genome analysis appears useful to screen the numerous genomic abnormalities observed in AOTs and to propose new biomarkers particularly in the non-1p/19q codeleted AOTs. PMID:20820870

  13. Modification of the GS LT Paired-end Library Protocol for Constructing Longer Insert Size Libraries

    SciTech Connect

    Peng, Ze; Peng, Ze; Hamilton, Matthew; Ting, Sara; Tu, Hank; Goltsman, Eugene; Lapidus, Alla; Lucas, Susan; Cheng, Jan-Fang

    2008-05-22

    Paired-end library sequencing has been proven useful in scaffold construction during de novo assembly of genomic sequences. The ability of generating mate pairs with 8 Kb or greater insert sizes is especially important for genomes containing long repeats. While the current 454 GS LT Paired-end library preparation protocol can successfully construct libraries with 3 Kb insert size, it fails to generate longer insert sizes because the protocol is optimized to purify shorter fragments. We have made several changes in the protocol in order to increase the fragment length. These changes include the use of Promega column to increase the yield of large size DNA fragments, two gel purification steps to remove contaminated short fragments, and a large reaction volume in the circularization step to decrease the formation of chimeras. We have also made additional changes in the protocol to increase the overall quality of the libraries. The quality of the libraries are measured by a set of metrics, which include levels of redundant reads, linker positive, linker negative, half linker reads, and driver DNA contamination, and read length distribution, were used to measure the primary quality of these libraries. We have also assessed the quality of the resulted mate pairs including levels of chimera, distribution of insert sizes, and genome coverage after the assemblies are completed. Our data indicated that all these changes have improved the quality of the longer insert size libraries.

  14. Genomic Testing

    MedlinePLUS

    ... About CDC.gov . Public Health Genomics Share Compartir Genomic Testing Fact Sheet: Identifying Opportunities to Improve Health and Transform Healthcare [PDF 139.91 KB] Genomic Tests by Levels of Evidence Guidelines, Policies and ...

  15. Library Buildings and Equipment.

    ERIC Educational Resources Information Center

    Oringdulph, Robert E.; And Others

    1990-01-01

    Six articles discuss library buildings and construction: (1) library buildings and their parts; (2) the North Campus Library of California State University at Long Beach in 1995; (3) new structures for teaching libraries; (4) construction standards for California public libraries; (5) Sick (Library) Building Syndrome; and (6) using focus-group…

  16. 3 Library Regulations Definitions

    E-print Network

    Mottram, Nigel

    3 Library Regulations Definitions In Regulation 3: 'Library' means the University Library as defined in Regulation 3.1; 'Library staff' means the staff of the University Library; 'Librarian' means the University Librarian and Head of Information Resources Directorate or nominee; `Library Committee' means

  17. Articledoi:10.1006/geno.2001.6616, available online at http://www.idealibrary.com on IDEAL INTRODUCTION

    E-print Network

    Cross, George

    sequences of bacte- ria, yeast, fruit fly, worm (Caenorhabditis elegans), mouse, and human genomes chromo- some (BAC) cloning system and the construction of repre- sentative genomic BAC libraries [1 of random clones. Furthermore, the routine gene-cloning strategy cannot be applied to the study

  18. An exploration of the sequence of a 2.9-Mb region of the genome of Drosophila melanogaster: the Adh region.

    PubMed Central

    Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S

    1999-01-01

    A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707

  19. Use of Genome Sequence Information for Meat Quality Trait QTL Mining for Causal Genes and Mutations on Pig Chromosome 17

    PubMed Central

    Hu, Zhi-Liang; Ramos, Antonio M.; Humphray, Sean J.; Rogers, Jane; Reecy, James M.; Rothschild, Max F.

    2011-01-01

    The newly available pig genome sequence has provided new information to fine map quantitative trait loci (QTL) in order to eventually identify causal variants. With targeted genomic sequencing efforts, we were able to obtain high quality BAC sequences that cover a region on pig chromosome 17 where a number of meat quality QTL have been previously discovered. Sequences from 70 BAC clones were assembled to form an 8-Mbp contig. Subsequently, we successfully mapped five previously identified QTL, three for meat color and two for lactate related traits, to the contig. With an additional 25 genetic markers that were identified by sequence comparison, we were able to carry out further linkage disequilibrium analysis to narrow down the genomic locations of these QTL, which allowed identification of the chromosomal regions that likely contain the causative variants. This research has provided one practical approach to combine genetic and molecular information for QTL mining. PMID:22303339

  20. Computational Molecular Biology Biochem 218 BioMedical Informatics 231

    E-print Network

    .edu/ Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy) The Human Genome Project #12 Gibson & Muse, A Primer of Genome Science http://www.sinauer.com/genomics/ #12;The Human Genome Project?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=3294162 #12;Public Genome Assembly Process #12;BAC and PAC Libraries in Public Human Genome Project http

  1. Mining for single nucleotide polymorphisms in pig genome sequence data

    PubMed Central

    Kerstens, Hindrik HD; Kollers, Sonja; Kommadath, Arun; del Rosario, Marisol; Dibbits, Bert; Kinders, Sylvia M; Crooijmans, Richard P; Groenen, Martien AM

    2009-01-01

    Background Single nucleotide polymorphisms (SNPs) are ideal genetic markers due to their high abundance and the highly automated way in which SNPs are detected and SNP assays are performed. The number of SNPs identified in the pig thus far is still limited. Results A total of 4.8 million whole genome shotgun sequences obtained from the NCBI trace-repository with center name "SDJVP", and project name "Sino-Danish Pig Genome Project" were analysed for the presence of SNPs. Available BAC and BAC-end sequences and their naming and mapping information, all obtained from SangerInstitute FTP site, served as a rough assembly of a reference genome. In 1.2 Gb of pig genome sequence, we identified 98,151 SNPs in which one of the sequences in the alignment represented the polymorphism and 6,374 SNPs in which two sequences represent an identical polymorphism. To benchmark the SNP identification method, 163 SNPs, in which the polymorphism was represented twice in the sequence alignment, were selected and tested on a panel of three purebred boar lines and wild boar. Of these 163 in silico identified SNPs, 134 were shown to be polymorphic in our animal panel. Conclusion This SNP identification method, which mines for SNPs in publicly available porcine shotgun sequences repositories, provides thousands of high quality SNPs. Benchmarking in an animal panel showed that more than 80% of the predicted SNPs represented true genetic variation. PMID:19126189

  2. Comparison of Sample Sequences of the Salmonella typhi Genome to the Sequence of the Complete Escherichia coli K-12 Genome

    Microsoft Academic Search

    MICHAEL MCCLELLAND; RICHARD K. WILSON

    1998-01-01

    Raw sequence data representing the majority of a bacterial genome can be obtained at a tiny fraction of the cost of a completed sequence. To demonstrate the utility of such a resource, 870 single-stranded M13 clones were sequenced from a shotgun library of the Salmonella typhi Ty2 genome. The sequence reads averaged over 400 bases and sampled the genome with

  3. Library Journal

    NSDL National Science Digital Library

    Founded in 1876, Library Journal has brought a new "look & feel" to its digital version. Items in this e-zine include LJ's Hot Picks, News (divided into This Week, People and Calendar), View, Infotech (which covers industry news), Multimedia (covering the web, CD-ROMs, audiobooks and video), BestSellers and Job Search. This site contains a fair amount of coverage and is well organized; at no point will the reader feel lost.

  4. Regulation 28: Library REGULATION 28: LIBRARY

    E-print Network

    Sussex, University of

    consideration. 16. The Library is a public building. Do not leave personal belongings unattended at any time. WeRegulation 28: Library 180 REGULATION 28: LIBRARY The purpose of this Regulation is to safeguard the common interests of all Library users. All persons are admitted on the understanding that they have read

  5. University of Tsukuba Library Welcome to Library

    E-print Network

    Tanaka, Jiro

    . 2 3How to find library materials OPAC : Online Public Access Catalog How to find books University of Tsukuba Library #12; Welcome to Library PC For safety, always carry your valuables with you or use lockers. No smoking, no foods or drinks are allowed in the Library. Do not talk

  6. Library Instruction Assessment in Academic Libraries

    ERIC Educational Resources Information Center

    Tancheva, Kornelia; Andrews, Camille; Steinhart, Gail

    2007-01-01

    Determining the best methods of assessment for a library instruction program in a large research university can be a challenging task. Albert R. Mann Library at Cornell University Library has pilot-tested three methods of formative and summative assessment for its library instruction program--attitudinal, outcomes-based, and gap-measure--and…

  7. The Library UBC LIBRARY CARD APPLICATION FORM

    E-print Network

    Michelson, David G.

    The Library UBC LIBRARY CARD APPLICATION FORM For Faculty Authorized Users UBC FACULTY MEMBER to the following person so that s/he may borrow Library materials and access services in my name for my UBC September 15th , 2014 Faculty member's statement: I understand that this is a separate library card from my

  8. Correlating Protein Phosphorylation With Genomic Alterations in Cancer - Jianjiong Gao, TCGA Scientific Symposium 2011

    Cancer.gov

    Home News and Events Multimedia Library Videos Correlating Protein Phosphorylation With Genomic Alterations in Cancer - Jianjiong Gao Correlating Protein Phosphorylation With Genomic Alterations in Cancer - Jianjiong Gao, TCGA Scientific Symposium

  9. Integrated Genomic Characterization of Endometrial Carcinoma - Douglas Levine, TCGA Scientific Symposium 2012

    Cancer.gov

    Home News and Events Multimedia Library Videos Integrated Genomic Characterization of Endometrial Carcinoma - Douglas Levine Integrated Genomic Characterization of Endometrial Carcinoma - Douglas Levine, TCGA Scientific Symposium 2012 You will need

  10. Integrated Genomic Characterization of Papillary Thyroid Carcinoma - Thomas J. Giordano, TCGA Scientific Symposium 2014

    Cancer.gov

    Home News and Events Multimedia Library Videos Integrated Genomic Characterization of Papillary Thyroid Carcinoma - Thomas J. Giordano Integrated Genomic Characterization of Papillary Thyroid Carcinoma - Thomas J. Giordano, TCGA Scientific Symposium

  11. Lessons Learned From 24 Completely Sequenced AML Genomes - Timothy Ley, TCGA Scientific Symposium 2011

    Cancer.gov

    Home News and Events Multimedia Library Videos Lessons Learned From 24 Completely Sequenced AML Genomes - Timothy Ley Lessons Learned From 24 Completely Sequenced AML Genomes - Timothy Ley, TCGA Scientific Symposium 2011 You will need Adobe Flash

  12. Optimized construction of microsatellite-enriched libraries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The construction of simple sequence repeat (SSR) libraries is an indispensable tool to search for molecular markers as complete genome sequences are still not available for the majority of species of interest. Numerous protocols are available in the literature for the construction of SSR-enriched l...

  13. Scaling up the 454 Titanium Library Construction and Pooling of Barcoded Libraries

    SciTech Connect

    Phung, Wilson; Hack, Christopher; Shapiro, Harris; Lucas, Susan; Cheng, Jan-Fang

    2009-03-23

    We have been developing a high throughput 454 library construction process at the Joint Genome Institute to meet the needs of de novo sequencing a large number of microbial and eukaryote genomes, EST, and metagenome projects. We have been focusing efforts in three areas: (1) modifying the current process to allow the construction of 454 standard libraries on a 96-well format; (2) developing a robotic platform to perform the 454 library construction; and (3) designing molecular barcodes to allow pooling and sorting of many different samples. In the development of a high throughput process to scale up the number of libraries by adapting the process to a 96-well plate format, the key process change involves the replacement of gel electrophoresis for size selection with Solid Phase Reversible Immobilization (SPRI) beads. Although the standard deviation of the insert sizes increases, the overall quality sequence and distribution of the reads in the genome has not changed. The manual process of constructing 454 shotgun libraries on 96-well plates is a time-consuming, labor-intensive, and ergonomically hazardous process; we have been experimenting to program a BioMek robot to perform the library construction. This will not only enable library construction to be completed in a single day, but will also minimize any ergonomic risk. In addition, we have implemented a set of molecular barcodes (AKA Multiple Identifiers or MID) and a pooling process that allows us to sequence many targets simultaneously. Here we will present the testing of pooling a set of selected fosmids derived from the endomycorrhizal fungus Glomus intraradices. By combining the robotic library construction process and the use of molecular barcodes, it is now possible to sequence hundreds of fosmids that represent a minimal tiling path of this genome. Here we present the progress and the challenges of developing these scaled-up processes.

  14. Major repeat components covering one-third of the ginseng (Panax ginseng C.A. Meyer) genome and evidence for allotetraploidy.

    PubMed

    Choi, Hong-Il; Waminal, Nomar E; Park, Hye Mi; Kim, Nam-Hoon; Choi, Beom Soon; Park, Minkyu; Choi, Doil; Lim, Yong Pyo; Kwon, Soo-Jin; Park, Beom-Seok; Kim, Hyun Hee; Yang, Tae-Jin

    2014-03-01

    Ginseng (Panax ginseng) is a famous medicinal herb, but the composition and structure of its genome are largely unknown. Here we characterized the major repeat components and inspected their distribution in the ginseng genome. By analyzing three repeat-rich bacterial artificial chromosome (BAC) sequences from ginseng, we identified complex insertion patterns of 34 long terminal repeat retrotransposons (LTR-RTs) and 11 LTR-RT derivatives accounting for more than 80% of the BAC sequences. The LTR-RTs were classified into three Ty3/gypsy (PgDel, PgTat and PgAthila) and two Ty1/Copia (PgTork and PgOryco) families. Mapping of 30-Gbp Illumina whole-genome shotgun reads to the BAC sequences revealed that these five LTR-RT families occupy at least 34% of the ginseng genome. The Ty3/Gypsy families were predominant, comprising 74 and 33% of the BAC sequences and the genome, respectively. In particular, the PgDel family accounted for 29% of the genome and presumably played major roles in enlargement of the size of the ginseng genome. Fluorescence in situ hybridization (FISH) revealed that the PgDel1 elements are distributed throughout the chromosomes along dispersed heterochromatic regions except for ribosomal DNA blocks. The intensity of the PgDel2 FISH signals was biased toward 24 out of 48 chromosomes. Unique gene probes showed two pairs of signals with different locations, one pair in subtelomeric regions on PgDel2-rich chromosomes and the other in interstitial regions on PgDel2-poor chromosomes, demonstrating allotetraploidy in ginseng. Our findings promote understanding of the evolution of the ginseng genome and of that of related species in the Araliaceae. PMID:24456463

  15. Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific markers

    Microsoft Academic Search

    R. P. Kandpal; G. Kandpal; S. M. Weissman

    1994-01-01

    The authors describe a simple and rapid method for constructing small-insert genomic libraries highly enriched for dimeric, trimeric, and tetrameric nucleotide repeat motifs. The approach involves use of DNA inserts recovered by PCR amplification of a small-insert sonicated genomic phage library or by a single-primer PCR amplification of Mbo I-digested and adaptor-ligated genomic DNA. The genomic DNA inserts are heat

  16. Tumor genomic profiling and TP53 germline mutation analysis of first-degree relative familial gliomas

    Microsoft Academic Search

    Ahmed Idbaih; Blandine Boisselier; Marc Sanson; Emmanuelle Crinière; Stéphane Liva; Yannick Marie; Catherine Carpentier; Sophie Paris; Florence Laigle-Donadey; Karima Mokhtari; Michèle Kujas; Khê Hoang-Xuan; Olivier Delattre; Jean-Yves Delattre

    2007-01-01

    About 5% of gliomas occur in a familial context, which suggests a genetic origin, but the predisposing molecular factors remain unknown in most cases. A series of nine familial gliomas were characterized with 1-megabase resolution BAC array–based comparative genomic hybridization (aCGH) together with germline sequence analysis of TP53. This series was compared with a literature series of familial gliomas and

  17. Genome Research

    NSDL National Science Digital Library

    Genome Research, the Web version of Cold Spring Harbor Laboratory's printed journal, focuses on "genome studies in all species, including genetic and physical mapping, DNA sequencing, genome-based analyses of biological processes, gene discovery, comparative genome analyses, evolution studies, forensics, informatics, statistical and mathematical methods, genome structure and function, and technological innovations and applications." Online issues are available from April 1997; tables of contents and abstracts begin August 1995. The free access period for Genome Research ends December 31, 1998. Genome Research is made available through Stanford University's HighWire Press.

  18. Molecular Dynamics Simulations of KirBac1.1 Mutants Reveal Global Gating Changes of Kir Channels

    PubMed Central

    2015-01-01

    Prokaryotic inwardly rectifying (KirBac) potassium channels are homologous to mammalian Kir channels. Their activity is controlled by dynamical conformational changes that regulate ion flow through a central pore. Understanding the dynamical rearrangements of Kir channels during gating requires high-resolution structure information from channels crystallized in different conformations and insight into the transition steps, which are difficult to access experimentally. In this study, we use MD simulations on wild type KirBac1.1 and an activatory mutant to investigate activation gating of KirBac channels. Full atomistic MD simulations revealed that introducing glutamate in position 143 causes significant widening at the helix bundle crossing gate, enabling water flux into the cavity. Further, global rearrangements including a twisting motion as well as local rearrangements at the subunit interface in the cytoplasmic domain were observed. These structural rearrangements are similar to recently reported KirBac3.1 crystal structures in closed and open conformation, suggesting that our simulations capture major conformational changes during KirBac1.1 opening. In addition, an important role of protein–lipid interactions during gating was observed. Slide-helix and C-linker interactions with lipids were strengthened during activation gating. PMID:25794351

  19. Toward positional cloning of everblooming gene (evb) in plants: a BAC library of Rosa chinensis cv. old blush 

    E-print Network

    Hess, Gregory

    2006-10-30

    of the genes cloned to date controlling vernalization and flower development from Arabidopsis thaliana, Brassica rapa, Lycopersicon esculentum, Triticum monococcum, and Rosa rugosa then designed primer pairs specific for each of the genes (Table 3... TTGAAAAGGCCACTGGAAAC 57.6 60.1 50 45 2007 AF284501 vernalization 2 protein (VRN2) AATTTAGGGGAGGCCTCAGA AAAAGCCGGAGATTTTCCTA 60 58 50 40 1452 Brassica rapa AY356368 reduced vernalization response 1 (VRN1) AGGAAAGCTGACAACAACAACA...

  20. Toward positional cloning of everblooming gene (evb) in plants: a BAC library of Rosa chinensis cv. old blush

    E-print Network

    Hess, Gregory

    2006-10-30

    tip. After completely solidifying, the agarose plugs containing rose nuclei were transferred into 5-10 volumes of the nuclei lysis buffer containing 0.5 M EDTA, pH 9-9.3, 1% sodium lauryl sarcosine, and 0.3 mg/ml proteinase K and incubated at 50o...

  1. Construction of a quinoa ( Chenopodium quinoa Willd.) BAC library and its use in identifying genes encoding seed storage proteins

    Microsoft Academic Search

    M. R. Stevens; C. E. Coleman; S. E. Parkinson; P. J. Maughan; H.-B. Zhang; M. R. Balzotti; D. L. Kooyman; K. Arumuganathan; A. Bonifacio; D. J. Fairbanks; E. N. Jellen; J. J. Stevens

    2006-01-01

    Quinoa (Chenopodium quinoa Willd.) is adapted to the harsh environments of the Andean Altiplano region. Its seeds have a well-balanced amino acid composition and exceptionally high protein content with respect to human nutrition. Quinoa grain is a staple in the diet of some of the most impoverished people in the world. The plant is an allotetraploid displaying disomic inheritance (2n=4x=36)

  2. CONSTRUCTION OF A RYE CV. BLANCO BAC LIBRARY, AND PROGRESS TOWARDS CLONING THE RYE ALT3 ALUMINUM TOLERANCE GENE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In addition to being an important cereal crop, rye (Secale cereale L.) provides valuable traits for other crops, as a parent of the amphidiploid triticale, and as a donor of translocated chromosome segments in wheat. Rye possesses excellent tolerance to many biotic and abiotic stresses that could p...

  3. Comparative Physical Mapping Between Oryza sativa (AA Genome Type) and O. punctata (BB Genome Type)

    PubMed Central

    Kim, HyeRan; Miguel, Phillip San; Nelson, William; Collura, Kristi; Wissotski, Marina; Walling, Jason G.; Kim, Jun Pyo; Jackson, Scott A.; Soderlund, Carol; Wing, Rod A.

    2007-01-01

    A comparative physical map of the AA genome (Oryza sativa) and the BB genome (O. punctata) was constructed by aligning a physical map of O. punctata, deduced from 63,942 BAC end sequences (BESs) and 34,224 fingerprints, onto the O. sativa genome sequence. The level of conservation of each chromosome between the two species was determined by calculating a ratio of BES alignments. The alignment result suggests more divergence of intergenic and repeat regions in comparison to gene-rich regions. Further, this characteristic enabled localization of heterochromatic and euchromatic regions for each chromosome of both species. The alignment identified 16 locations containing expansions, contractions, inversions, and transpositions. By aligning 40% of the punctata BES on the map, 87% of the punctata FPC map covered 98% of the O. sativa genome sequence. The genome size of O. punctata was estimated to be 8% larger than that of O. sativa with individual chromosome differences of 1.5–16.5%. The sum of expansions and contractions observed in regions >500 kb were similar, suggesting that most of the contractions/expansions contributing to the genome size difference between the two species are small, thus preserving the macro-collinearity between these species, which diverged ?2 million years ago. PMID:17339227

  4. Cell Libraries

    NASA Technical Reports Server (NTRS)

    1994-01-01

    A NASA contract led to the development of faster and more energy efficient semiconductor materials for digital integrated circuits. Gallium arsenide (GaAs) conducts electrons 4-6 times faster than silicon and uses less power at frequencies above 100-150 megahertz. However, the material is expensive, brittle, fragile and has lacked computer automated engineering tools to solve this problem. Systems & Processes Engineering Corporation (SPEC) developed a series of GaAs cell libraries for cell layout, design rule checking, logic synthesis, placement and routing, simulation and chip assembly. The system is marketed by Compare Design Automation.

  5. Enhanced biodegradation of petrochemical wastewater using ozonation and BAC advanced treatment system.

    PubMed

    Lin, C K; Tsai, T Y; Liu, J C; Chen, M C

    2001-03-01

    The characteristics of degradation/conversion of bio-refractory and the growth of a biofilm are investigated in laboratory-scale pre-ozonation and lifted moving-bed biological activated carbon (BAC) advanced treatment processes treating phenol, benzoic acid, aminobenzoic acid and petrochemical industry wastewater which contains acrylonitrile butadiene styrene (ABS). The optimal reaction time and ozone dosage of pre-ozonation for bio-refractory conversion were determined to be 30 min and 100-200 mg O3/hr, respectively. After pre-ozonation of 30 min treatment, BOD5/COD ratio of influent and effluent increased apparently from 20 to 35%, approximately. However, the change of pH in pre-ozonation was inconspicuous. The optimal flow rate of influent and air were controlled at 1.6 l/h and 120-150 nl/min in lifted moving-bed BAC advanced treatment reactor. A COD removal efficiency of 85-95% and 70-90% may be maintained by using an organic loading of 3.2-6.3 kg COD/m3 day and 0.6-1.6 kg-COD/m3 day with an HRT of 6.0 h as secondary and advanced treatment system, respectively. The time required for the BAC bed is be regenerated by a thermal regeneration is prolonged 4-5 times more than that of GAC system. It can be estimated that the enhanced COD removal capability of the biofilm was not only due to the increase in the COD removal capability of acclimated bacteria, but also due to species succession of bacteria in bio-film ecosystem. PMID:11228967

  6. UNIVERSITY OF BERGEN LIBRARY

    E-print Network

    Fomin, Fedor V.

    . Science Library Biomedicine, health and dentistry. Medical Library, Dental Library Psychology and education, health sciences and child care. Psychology, Education and Health Library Legal literature, publications and documents published by the EU. Law library Rare books and pictures. Department of Special

  7. Genealogy and Libraries.

    ERIC Educational Resources Information Center

    Carothers, Diane Foxhill; And Others

    1983-01-01

    Ten articles describe genealogical collections of the National Archives and Library of Congress, state archives programs, academic research libraries, Allen County Public Library (Indiana), Newberry Library, Church of Jesus Christ of Latter-Day Saints genealogical library, and New England Historic Genealogical Society, and approaches to Black…

  8. Public Library in Thailand.

    ERIC Educational Resources Information Center

    Lerdsuriyakul, Kulthorn

    This paper on public libraries in Thailand begins with a section that provides background on public libraries in the past, lists the functions of the public library, and describes three size classifications of public libraries. The second section outlines the tasks of the current public library in three areas: informal education; nonformal…

  9. Helpful Websites Ebling Library

    E-print Network

    Bohnhoff, David

    Helpful Websites · Ebling Library o http://ebling.library.wisc.edu/ · Ebling Library NIH Public Help with NIH Public Access Policy Compliance? · nihpolicy@library.wisc.edu · Trisha Adamus, Ebling Access Policy Help o http://ebling.library.wisc.edu/help/nih.cfm · PubMed o http://www.pubmed.gov · NIH

  10. Circadian Abnormalities in Motor Activity in a BAC Transgenic Mouse Model of Huntington’s Disease

    PubMed Central

    Oakeshott, Stephen; Balci, Fuat; Filippov, Igor; Murphy, Carol; Port, Russell; Connor, David; Paintdakhi, Ahmad; LeSauter, Joseph; Menalled, Liliana; Ramboz, Sylvie; Kwak, Seung; Howland, David; Silver, Rae; Brunner, Dani

    2011-01-01

    Huntington’s disease (HD) is a progressive neurodegenerative disease marked by psychiatric and motor problems. Recently, these findings have been extended to deficits in sleep and circadian function that can be observed in HD patients and in HD mouse models, with abnormal sleep patterns correlating with symptom severity in patients. Here, we studied the behavior of the BAC HD mouse model using an 24/7 automated system; the results indicate significant lengthening of the circadian period in the mutant mice. These results reinforce previous findings in HD models and symptomatic HD patients, indicating that circadian dysfunction is a core feature of HD. PMID:21479110

  11. The Whole Library Handbook 3: Current Data, Professional Advice, and Curiosa about Libraries and Library Services.

    ERIC Educational Resources Information Center

    Eberhart, George M., Comp.

    This handbook contains articles, guidelines, and other information from the field of library science organized into the following chapters: (1) "Libraries," including some basic figures, academic libraries, public libraries, school libraries, special libraries, national libraries, state libraries, small libraries, facilities, the past, and the…

  12. A genetic screen using the PiggyBac transposon in haploid cells identifies Parp1 as a mediator of olaparib toxicity.

    PubMed

    Pettitt, Stephen J; Rehman, Farah L; Bajrami, Ilirjana; Brough, Rachel; Wallberg, Fredrik; Kozarewa, Iwanka; Fenwick, Kerry; Assiotis, Ioannis; Chen, Lina; Campbell, James; Lord, Christopher J; Ashworth, Alan

    2013-01-01

    Genetic perturbation screens have the potential to dissect a wide range of cellular phenotypes. Such screens have historically been difficult in diploid mammalian cells. The recent derivation of haploid embryonic stem cells provides an opportunity to cause loss of function mutants with a random mutagen in a mammalian cell with a normal genetic background. We describe an approach to genetic screens that exploits the highly active piggyBac transposon in haploid mammalian cells. As an example of haploid transposon (HTP) screening, we apply this approach to identifying determinants of cancer drug toxicity and resistance. In a screen for 6-thioguanine resistance we recovered components of the DNA mismatch repair pathway, a known requirement for toxicity. In a further screen for resistance to the clinical poly(ADP-ribose) polymerase (PARP) inhibitor olaparib we recovered multiple Parp1 mutants. Our results show that olaparib toxicity to normal cells is mediated predominantly via Parp1, and suggest that the clinical side effects of olaparib may be on target. The transposon mutant libraries are stable and can be readily reused to screen other drugs. The screening protocol described has several advantages over other methods such as RNA interference: it is rapid and low cost, and mutations can be easily reverted to establish causality. PMID:23634208

  13. A Genetic Screen Using the PiggyBac Transposon in Haploid Cells Identifies Parp1 as a Mediator of Olaparib Toxicity

    PubMed Central

    Pettitt, Stephen J.; Rehman, Farah L.; Bajrami, Ilirjana; Brough, Rachel; Wallberg, Fredrik; Kozarewa, Iwanka; Fenwick, Kerry; Assiotis, Ioannis; Chen, Lina; Campbell, James; Lord, Christopher J.; Ashworth, Alan

    2013-01-01

    Genetic perturbation screens have the potential to dissect a wide range of cellular phenotypes. Such screens have historically been difficult in diploid mammalian cells. The recent derivation of haploid embryonic stem cells provides an opportunity to cause loss of function mutants with a random mutagen in a mammalian cell with a normal genetic background. We describe an approach to genetic screens that exploits the highly active piggyBac transposon in haploid mammalian cells. As an example of haploid transposon (HTP) screening, we apply this approach to identifying determinants of cancer drug toxicity and resistance. In a screen for 6-thioguanine resistance we recovered components of the DNA mismatch repair pathway, a known requirement for toxicity. In a further screen for resistance to the clinical poly(ADP-ribose) polymerase (PARP) inhibitor olaparib we recovered multiple Parp1 mutants. Our results show that olaparib toxicity to normal cells is mediated predominantly via Parp1, and suggest that the clinical side effects of olaparib may be on target. The transposon mutant libraries are stable and can be readily reused to screen other drugs. The screening protocol described has several advantages over other methods such as RNA interference: it is rapid and low cost, and mutations can be easily reverted to establish causality. PMID:23634208

  14. Efficacy of a BAC clone of a recombinant strain of Marek’s disease virus containing reticuloendotheliosis virus LTR following in ovo Vaccination at 18 days of embryonation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have previously reported on the pathogenicity of various passage levels of a bacterial artificial chromosome (BAC) clone of a recombinant Marek’s disease virus (MDV) strain rMd5 containing reticuloendotheliosis virus (REV) long terminal repeat (LTR) termed rMd5 REV LTR BAC. In this study, we eval...

  15. Analysis of genome-specific sequences in Phleum species: Identification and use for study of genomic relationships

    Microsoft Academic Search

    Q. Cai; M. R. Bullen

    1994-01-01

    Sau3AI “shot gun” cloning and colony hybridization with total genomic probes were used to isolate genome-specific sequences inPhleum species. The total DNA isolated from diploid speciesP. alpinum andP. bertolonii was partially digested withSau3AI and cloned using pUC19 as a vector to anE. coli strain DH5amcr. A partial genomic DNA library consisting of 3030 colonies for the genome ofP. alpinum and

  16. Homecoming for Library Symbol.

    ERIC Educational Resources Information Center

    Egan, Bessie

    1987-01-01

    Discusses the significance and development of the library symbol and the history of its acceptance by the American Library Association (ALA) and the Canadian Library Association (CLA). Suggestions are made for its use. (CLB)

  17. Templeman Library Journal loan

    E-print Network

    Banaji,. Murad

    Templeman Library Journal loan Only postgraduate students or academic staff can borrow journals ............................................................................ * Initials ............................................................................ * Library card number ............................................................................ Fields marked * are required The item will be issued to your Library account for one week, normally

  18. Medfly transposable elements: diversity, evolution, genomic impact and possible applications.

    PubMed

    Gomulski, Ludvik M; Torti, Cristina; Murelli, Valentina; Bonizzoni, Mariangela; Gasperi, Giuliano; Malacrida, Anna R

    2004-02-01

    The medfly genome has been shown to contain a rich assortment of transposable elements from the mariner, Tc1, hAT and gypsy/Ty3 families. These elements display different levels of diversity, abundance and distribution in the genome. The presence of actively transposing elements in the medfly genome is revealed by hybrid dysgenesis phenomena, insertion site polymorphisms and other genetic instabilities. The medfly has been a target of transformation studies involving the exogenous elements Minos, Hermes and piggyBac from three families. The presence of active endogenous homologous elements can have important implications for the stability of such transgenic lines. The potential applications of endogenous elements for medfly population analysis and control are discussed. PMID:14871610

  19. Library Technicians in Ontario Academic Libraries

    ERIC Educational Resources Information Center

    Pantazis, Fotoula

    1978-01-01

    This survey of the status of library technicians covers the degree to which they are employed, their job classification and salary, qualifications desired, and training needed. General attitudes towards technicians and present utilization in various library departments are discussed. (JAB)

  20. Extracting gene function from protein-protein interactions using Quantitative BAC InteraCtomics (QUBIC).

    PubMed

    Hubner, Nina C; Mann, Matthias

    2011-04-01

    Large-scale proteomic screens are increasingly employed for placing genes into specific pathways. Therefore generic methods providing a physiological context for protein-protein interaction studies are of great interest. In recent years many protein-protein interactions have been determined by affinity purification followed by mass spectrometry (AP-MS). Among many different AP-MS approaches, the recently developed Quantitative BAC InteraCtomics (QUBIC) approach is particularly attractive as it uses tagged, full-length baits that are expressed under endogenous control. For QUBIC large cell line collections expressing tagged proteins from BAC transgenes or gene trap loci have been developed and are freely available. Here we describe detailed workflows on how to obtain specific protein binding partners with high confidence under physiological conditions. The methods are based on fast, streamlined and generic purification procedures followed by single run liquid chromatography-mass spectrometric analysis. Quantification is achieved either by the stable isotope labeling of amino acids in cell culture (SILAC) method or by a 'label-free' procedure. In either case data analysis is performed by using the freely available MaxQuant environment. The QUBIC approach enables biologists with access to high resolution mass spectrometry to perform small and large-scale protein interactome mappings. PMID:21184827