Sample records for glur2 glutamate receptor

  1. Long-term exposure to endogenous levels of tributyltin decreases GluR2 expression and increases neuronal vulnerability to glutamate.

    PubMed

    Nakatsu, Yusuke; Kotake, Yaichiro; Takishita, Tomoko; Ohta, Shigeru

    2009-10-15

    Tributyltin (TBT), an endocrine-disrupting chemical, has been used commercially as a heat stabilizer, agricultural pesticide and component of antifouling paints. In this study, we investigated the effect of long-term exposure to endogenous levels of TBT on neuronal glutamate receptors. Cultured rat cortical neurons were exposed to 1-50 nM TBT for 9 days (from day 2 to day 10 in vitro). The number of neurons was reduced by long-term exposure to 50 nM TBT, but not to 1-20 nM TBT. Long-term exposure to 20 nM TBT decreased the mRNA expression of glutamate receptors NR1, NR2A, GluR1 and GluR2, and increased that of NR2B, GluR3 and GluR4. GluR2 protein was also reduced by long-term exposure to TBT. Because AMPA receptor lacking GluR2 exhibits Ca2+ permeability, we investigated whether Ca2+ influx or glutamate toxicity was affected. Indeed, glutamate-induced Ca2+ influx was increased in TBT-treated neurons. Consistent with this, neurons became more susceptible to glutamate toxicity as a result of long-term exposure to TBT and this susceptibility was abolished by an antagonist of GluR2-lacking AMPA receptor. Thus, it is suggested that long-term exposure to endogenous levels of TBT induces a decrease of GluR2 protein, causing neurons become more susceptible to glutamate toxicity.

  2. Alterations in GluR2 AMPA receptor phosphorylation at serine 880 following group I metabotropic glutamate receptor stimulation in the rat dorsal striatum.

    PubMed

    Ahn, Sung Min; Choe, Eun Sang

    2010-04-01

    Phosphorylation of ionotropic glutamate receptors in the brain plays a crucial role in the regulation of synaptic plasticity. In this study, we investigated the regulation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor phosphorylation by the stimulation of group I metabotropic glutamate receptors (mGluRs) in the dorsal striatum in vivo. The results showed that intrastriatal infusion of the group I mGluR agonist, (RS)-3,5-dihydroxyphenylglycine (DHPG, 250 nmol), enhanced the sensitivity of GluR2 subunit in its phosphorylation at serine 880 (S880) in the dorsal striatum. This enhancement of the sensitivity of GluR2-S880 phosphorylation was reduced by blocking group I mGluRs and N-methyl-D-aspartate (NMDA) receptors. Similar reduction of the enhancement was also induced by inhibiting phospholipase C (PLC), calcium/calmodulin-dependent protein kinase (CaMK), c-Jun N-terminal kinase (JNK), and protein kinase C (PKC). Inhibition of protein phosphatase (PP) 1/2A and calcineurin (PP2B) alone enhanced GluR2-S880 phosphorylation in the dorsal striatum, whereas inhibition of these phosphatases did not further enhance the S880 phosphorylation by DHPG stimulation. In addition, inhibition of PP1/2A or PP2B also enhanced the phosphorylation of CaMKII, JNK and PKC. These data suggest that the phosphorylation of AMPA receptor GluR2 subunit at S880 is subject to the upregulation by the stimulation of group I mGluRs. Interactions among glutamate receptors, protein kinases, and PPs participate in this upregulation. (c) 2009 Wiley-Liss, Inc.

  3. Immunocytochemical localization of metabotropic (mGluR2/3 and mGluR4a) and ionotropic (GluR2/3) glutamate receptors in adrenal medullary ganglion cells.

    PubMed

    Sarría, R; Díez, J; Losada, J; Doñate-Oliver, F; Kuhn, R; Grandes, P

    2006-02-01

    The localization of metabotropic glutamate receptors of groups II (mGluR2/3) and III (mGluR4a) and the subunits 2 and 3 of alfa-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptors (GluR2/3) was investigated with immunocytochemical methods in the rat adrenal gland. MGluR2/3, mGluR4a and GluR2/3 immunoreactivities were observed in large-sized, centrally located type I adrenal medullary ganglion neurons. Furthermore, the small-sized type II adrenal ganglion neurons identified by their immunoreactivity to brain nitric oxide synthase (bNOS), also expressed mGluR2/3, mGluR4a and GluR2/3. These cells were disposed in the peripheral portion of the adrenal medulla. None of the type I neurons were positively labeled for bNOS. These morphological observations suggest that activation of glutamate receptors in ganglion neurons may be instrumental in the control of adrenal endocrine systems as well as blood regulation.

  4. Ionotropic glutamate receptor GluR2/3-immunoreactive neurons in the cat, rabbit, and hamster superficial superior colliculus.

    PubMed

    Park, Won-Mee; Kim, Min-Jeong; Jeon, Chang-Jin

    2004-06-01

    Ionotropic glutamate receptor (GluR) subtypes occur in various types of cells in the central nervous system. We studied the distribution of AMPA glutamate receptor subtype GluR2/3 in the superficial layers of cat, rabbit, and hamster superior colliculus (SC) with antibody immunocytochemistry and the effect of enucleation on this distribution. Furthermore, we compared this labeling to that of calbindin D28K and parvalbumin. Anti-GluR2/3-immunoreactive (IR) cells formed a dense band of labeled cells within the lower superficial gray layer (SGL) and upper optic layer (OL) in the cat SC. By contrast, GluR2/3-IR cells formed a dense band within the upper OL in the rabbit and within the OL in the hamster SC. Calbindin D28K-IR cells are located in three layers in the SC: one within the zonal layer (ZL) and the upper SGL in all three animals, a second within the lower OL and upper IGL in the cat, within the IGL in the rabbit and within the OL in the hamster, and a third within the deep gray layer (DGL) in all three animals. Many parvalbumin-IR neurons were found within the lower SGL and upper OL. Thus, the GluR2/3-IR band was sandwiched between the first and second layers of calbindin D28K-IR cells in the cat and rabbit SC while the distribution of GluR2/3-IR cells in the hamster matches the second layer of calbindin D28K-IR cells. The patterned distribution of GluR2/3-IR cells overlapped the tier of parvalbumin-IR neurons in cat, but only partially overlapped in hamster and rabbit. Two-color immunofluorescence revealed that more than half (55.1%) of the GluR2/3-IR cells in the hamster SC expressed calbindin D28K. By contrast, only 9.9% of GluR2/3-IR cells expressed calbindin D28K in the cat. Double-labeled cells were not found in the rabbit SC. Some (4.8%) GluR2/3-IR cells in the cat SC also expressed parvalbumin, while no GluR2/3-IR cells in rabbit and hamster SC expressed parvalbumin. In this dense band of GluR2/3, the majority of labeled cells were small to medium

  5. The N-terminal domain of GluR6-subtype glutamate receptor ion channels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Janesh; Schuck, Peter; Jin, Rongsheng

    2009-09-25

    The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less

  6. Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

    PubMed Central

    Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

    2007-01-01

    Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

  7. Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.

    PubMed

    Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

    2007-09-25

    Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.

  8. Glutamate receptor antibodies directed against AMPA receptors subunit 3 peptide B (GluR3B) can be produced in DBA/2J mice, lower seizure threshold and induce abnormal behavior.

    PubMed

    Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia

    2014-04-01

    Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Regulation of Fear Extinction in the Basolateral Amygdala by Dopamine D2 Receptors Accompanied by Altered GluR1, GluR1-Ser845 and NR2B Levels.

    PubMed

    Shi, Yan-Wei; Fan, Bu-Fang; Xue, Li; Wen, Jia-Ling; Zhao, Hu

    2017-01-01

    The amygdala, a critical structure for both Pavlovian fear conditioning and fear extinction, receives sparse but comprehensive dopamine innervation and contains dopamine D1 and D2 receptors. Fear extinction, which involves learning to suppress the expression of a previously learned fear, appears to require the dopaminergic system. The specific roles of D2 receptors in mediating associative learning underlying fear extinction require further study. Intra-basolateral amygdala (BLA) infusions of a D2 receptor agonist, quinpirole, and a D2 receptor antagonist, sulpiride, prior to fear extinction and extinction retention were tested 24 h after fear extinction training for long-term memory (LTM). LTM was facilitated by quinpirole and attenuated by sulpiride. In addition, A-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor glutamate receptor 1 (GluR1) subunit, GluR1 phospho-Ser845, and N -methyl-D-aspartic acid receptor NR2B subunit levels in the BLA were generally increased by quinpirole and down-regulated by sulpiride. The present study suggests that activation of D2 receptors facilitates fear extinction and that blockade of D2 receptors impairs fear extinction, accompanied by changes in GluR1, GluR1-Ser845 and NR2B levels in the amygdala.

  10. Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

    PubMed

    Tsuzuki, K; Takeuchi, T; Ozawa, S

    1992-11-01

    GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

  11. A desensitization-selective potentiator of AMPA-type glutamate receptors

    PubMed Central

    Sekiguchi, Masayuki; Nishikawa, Kaori; Aoki, Shunsuke; Wada, Keiji

    2002-01-01

    We examined the effects of PEPA, an allosteric potentiator of AMPA receptors, on AMPA receptor kinetics. PEPA did not affect the deactivation of glutamate responses but potently attenuated the extent of receptor desensitization without slowing the onset of desensitization in most of the recombinant AMPA receptors (GluR1-flip, GluR1-flop, GluR3-flip, GluR3-flip + GluR2-flip, and GluR3-flop + GluR2-flop) expressed in Xenopus oocytes. For the GluR3-flop subunit, PEPA attenuated the extent of desensitization and only weakly prolonged deactivation (1.3 fold). PEPA did not significantly affect recovery from desensitization in oocytes expressing GluR3-flip, GluR1-flop, and GluR1-flop, but weakly accelerated (2.6 fold) recovery from desensitization in oocytes expressing GluR3-flop. PEPA's effect on desensitization of GluR3-flop-containing receptors is unique in that onset is very slow. Simulation studies using simplified kinetic models for AMPA receptors are utilized to explore the differential effects of PEPA on GluR3-flip and -flop. It is possible to simulate the action on GluR3-flip by modulating two rate constants in a 12-state kinetic model. For simulation of the action on GluR3-flop, the 12-state kinetic model is not enough, and it is necessary to invoke a 13th state, a PEPA-bound receptor to which glutamate cannot bind. These results suggest that attenuation of extent of desensitization represents the principal mechanism underlying the potentiation of AMPA receptors by PEPA, and that PEPA exhibits different mechanisms with respect to GluR3-flip and GluR3-flop. PMID:12145103

  12. Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

    PubMed

    Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

    1993-12-15

    Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.

  13. Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

    PubMed Central

    Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

    1993-01-01

    Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445

  14. Prenatal Exposure to Tributyltin Decreases GluR2 Expression in the Mouse Brain.

    PubMed

    Ishida, Keishi; Saiki, Takashi; Umeda, Kanae; Miyara, Masatsugu; Sanoh, Seigo; Ohta, Shigeru; Kotake, Yaichiro

    2017-01-01

    Tributyltin (TBT), a common environmental contaminant, is widely used as an antifouling agent in paint. We previously reported that exposure of primary cortical neurons to TBT in vitro decreased the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 2 (GluR2) expression and subsequently increased neuronal vulnerability to glutamate. Therefore, to identify whether GluR2 expression also decreases after TBT exposure in vivo, we evaluated the changes in GluR2 expression in the mouse brain after prenatal or postnatal exposure to 10 and 25 ppm TBT through pellet diets. Although the mean feed intake and body weight did not decrease in TBT-exposed mice compared with that in control mice, GluR2 expression in the cerebral cortex and hippocampus decreased after TBT exposure during the prenatal period. These results indicate that a decrease in neuronal GluR2 may be involved in TBT-induced neurotoxicity, especially during the fetal period.

  15. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  16. Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

    PubMed Central

    Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

    2014-01-01

    Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

  17. Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

    PubMed

    Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

    2014-01-01

    Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

  18. Expression of messenger RNAs encoding ionotropic glutamate receptors in rat brain: regulation by haloperidol.

    PubMed

    Brené, S; Messer, C; Nestler, E J

    1998-06-01

    In situ hybridization was used to study the regional distribution of messenger RNAs encoding ionotropic glutamate receptor subtypes in the rat brain's dopaminergic cell body regions and their forebrain projection areas. Short oligonucleotide probes specific for the messenger RNAs encoding the flip or flop splice forms of the GluR1 and GluR2 AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate) receptor subunits, or for the messenger RNAs encoding the N-methyl-D-aspartate R1 subunit, were used. Significant differences were seen in the relative messenger RNA levels, and the distribution of the flip and flop splice forms, of GluR1 and GluR2. In the dopaminergic cell groups of the substantia nigra pars compacta and the ventral tegmental area, the flip form of both GluR1 and GluR2 dominated over the flop form. Similarly, in the core division of the nucleus accumbens, GluR1 and GluR2 flip forms dominated over the flop forms. In contrast, in the accumbens shell, the GluR1 and GluR2 flop forms dominated over the flip forms. As a comparison to the AMPA receptor subunits, N-methyl-D-aspartate R1 messenger RNA was relatively evenly distributed in all the regions analysed. The results demonstrate a heterogeneous distribution of the flip and flop splice forms of GluR1 and GluR2 in the brain's dopaminergic pathways, which could contribute to physiological differences in regulation of the pathways by glutamatergic neurotransmission. We also studied regulation of glutamate receptor subunit expression in these regions by antipsychotic drugs, based on previous reports of altered levels of subunit immunoreactivity after drug treatment. Chronic administration of the typical antipsychotic drug, haloperidol, caused a small but significant induction of GluR2 flip messenger RNA in the dorsolateral caudate putamen. This effect was not seen after chronic administration of the atypical antipsychotic drug, clozapine. Significant drug regulation of the other glutamate receptor subunits

  19. Endocytosis and recycling of AMPA receptors lacking GluR2/3.

    PubMed

    Biou, Virginie; Bhattacharyya, Samarjit; Malenka, Robert C

    2008-01-22

    Excitatory synapses in the mammalian brain contain two types of ligand-gated ion channels: AMPA receptors (AMPARs) and NMDA receptors (NMDARs). AMPARs are responsible for generating excitatory synaptic responses, whereas NMDAR activation triggers long-lasting changes in these responses by modulating the trafficking of AMPARs toward and away from synapses. AMPARs are tetramers composed of four subunits (GluR1-GluR4), which current models suggest govern distinct AMPAR trafficking behavior during synaptic plasticity. Here, we address the roles of GluR2 and GluR3 in controlling the recycling- and activity-dependent endocytosis of AMPARs by using cultured hippocampal neurons prepared from knockout (KO) mice lacking these subunits. We find that synapses and dendritic spines form normally in cells lacking GluR2/3 and that upon NMDAR activation, GluR2/3-lacking AMPARs are endocytosed in a manner indistinguishable from GluR2-containing AMPARs in wild-type (WT) neurons. AMPARs lacking GluR2/3 also recycle to the plasma membrane identically to WT AMPARs. However, because of their permeability to calcium, GluR2-lacking but not WT AMPARs exhibited robust internalization throughout the dendritic tree in response to AMPA application. Dendritic endocytosis of AMPARs also was observed in GABAergic neurons, which express a high proportion of GluR2-lacking AMPARs. These results demonstrate that GluR2 and GluR3 are not required for activity-dependent endocytosis of AMPARs and suggest that the most important property of GluR2 in the context of AMPAR trafficking may be its influence on calcium permeability.

  20. Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

    PubMed Central

    Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

    2015-01-01

    In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into

  1. Crystal structure and association behaviour of the GluR2 amino-terminal domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan

    2009-09-02

    Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less

  2. Glutamate mediates platelet activation through the AMPA receptor

    PubMed Central

    Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.

    2008-01-01

    Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118

  3. Type II and III Taste Bud Cells Preferentially Expressed Kainate Glutamate Receptors in Rats.

    PubMed

    Lee, Sang-Bok; Lee, Cil-Han; Kim, Se-Nyun; Chung, Ki-Myung; Cho, Young-Kyung; Kim, Kyung-Nyun

    2009-12-01

    Glutamate-induced cobalt uptake reveals that non-NMDA glutamate receptors (GluRs) are present in rat taste bud cells. Previous studies involving glutamate induced cobalt staining suggest this uptake mainly occurs via kainate type GluRs. It is not known which of the 4 types of taste bud cells express subunits of kainate GluR. Circumvallate and foliate papillae of Sprague-Dawley rats (45~60 days old) were used to search for the mRNAs of subunits of non-NMDA GluRs using RT-PCR with specific primers for GluR1-7, KA1 and KA2. We also performed RT-PCR for GluR5, KA1, PLCbeta2, and NCAM/SNAP 25 in isolated single cells from taste buds. Taste epithelium, including circumvallate or foliate papilla, express mRNAs of GluR5 and KA1. However, non-taste tongue epithelium expresses no subunits of non-NMDA GluRs. Isolated single cell RT-PCR reveals that the mRNAs of GluR5 and KA1 are preferentially expressed in Type II and Type III cells over Type I cells.

  4. Glutamate increases pancreatic cancer cell invasion and migration via AMPA receptor activation and Kras-MAPK signaling.

    PubMed

    Herner, Alexander; Sauliunaite, Danguole; Michalski, Christoph W; Erkan, Mert; De Oliveira, Tiago; Abiatari, Ivane; Kong, Bo; Esposito, Irene; Friess, Helmut; Kleeff, Jörg

    2011-11-15

    Glutamate has been implicated in tumorigenesis through activation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors (AMPAR). However, the function of a glutamate-to-AMPAR signal in pancreatic ductal adenocarcinoma (PDAC) has remained elusive. We now show that glutamate-mediated AMPA receptor activation increases invasion and migration of pancreatic cancer cells via activation of the classical MAPK pathway. Glutamate levels were increased in pancreatic cancer accompanied by downregulation of GluR subunits 1, 2, and 4. In pancreatic cancer precursor lesions, pancreatic intraepithelial neoplasia (PanIN), GluR1 subunit levels were strikingly and step-wise increased but its expression was rare in PDAC. Pharmacological inhibition or RNAi-mediated suppression of GluR1 or GluR2 did not affect cancer cell growth but significantly decreased invasion. In a K-ras wildtype cell line, AMPA receptor activation enhanced K-ras activity and--further downstream--phosphorylation of p38 and of p44/42. Preemptive blockade of AMPA receptors in a mouse model of pancreatic cancer inhibited tumor cell settling. AMPA receptor activation thus not only activates MAPK signalling but also directly increases activity of K-ras. Glutamate might serve as a molecular switch that decreases the threshold of K-ras-induced oncogenic signalling and increases the chance of malignant transformation of pancreatic cancer precursor lesions. Copyright © 2011 UICC.

  5. Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

    PubMed Central

    Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

    1997-01-01

    We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

  6. Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition

    PubMed Central

    Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

    2017-01-01

    Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 (GluR2) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2. This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT. PMID:28800112

  7. Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition.

    PubMed

    Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

    2017-08-11

    Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 ( GluR2 ) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2 . This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT.

  8. Drosophila fragile X mental retardation protein and metabotropic glutamate receptor A convergently regulate the synaptic ratio of ionotropic glutamate receptor subclasses.

    PubMed

    Pan, Luyuan; Broadie, Kendal S

    2007-11-07

    A current hypothesis proposes that fragile X mental retardation protein (FMRP), an RNA-binding translational regulator, acts downstream of glutamatergic transmission, via metabotropic glutamate receptor (mGluR) G(q)-dependent signaling, to modulate protein synthesis critical for trafficking ionotropic glutamate receptors (iGluRs) at synapses. However, direct evidence linking FMRP and mGluR function with iGluR synaptic expression is limited. In this study, we use the Drosophila fragile X model to test this hypothesis at the well characterized glutamatergic neuromuscular junction (NMJ). Two iGluR classes reside at this synapse, each containing common GluRIIC (III), IID and IIE subunits, and variable GluRIIA (A-class) or GluRIIB (B-class) subunits. In Drosophila fragile X mental retardation 1 (dfmr1) null mutants, A-class GluRs accumulate and B-class GluRs are lost, whereas total GluR levels do not change, resulting in a striking change in GluR subclass ratio at individual synapses. The sole Drosophila mGluR, DmGluRA, is also expressed at the NMJ. In dmGluRA null mutants, both iGluR classes increase, resulting in an increase in total synaptic GluR content at individual synapses. Targeted postsynaptic dmGluRA overexpression causes the exact opposite GluR phenotype to the dfmr1 null, confirming postsynaptic GluR subtype-specific regulation. In dfmr1; dmGluRA double null mutants, there is an additive increase in A-class GluRs, and a similar additive impact on B-class GluRs, toward normal levels in the double mutants. These results show that both dFMRP and DmGluRA differentially regulate the abundance of different GluR subclasses in a convergent mechanism within individual postsynaptic domains.

  9. Gating characteristics control glutamate receptor distribution and trafficking in vivo.

    PubMed

    Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J

    2014-09-08

    Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Straight-chain alcohols exhibit a cutoff in potency for the inhibition of recombinant glutamate receptor subunits

    PubMed Central

    Akinshola, B Emmanuel

    2001-01-01

    The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388

  11. Glutamate receptors as seen by light: Spectroscopic studies of structure-function relationships

    PubMed Central

    Mankiewicz, Kimberly A.; Jayaraman, Vasanthi

    2010-01-01

    Ionotropic glutamate receptors are major excitatory receptors in the central nervous system and also have far reaching influence in other areas of the body. Their modular nature has allowed for the isolation of the ligand binding domain and subsequent structural studies using a variety of spectroscopic techniques. This review will discuss the role of specific ligand:protein interactions in mediating activation in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subtype of glutamate receptors as established by various spectroscopic investigations of the GluR2 and GluR4 subunits of this receptor. Specifically, this review will provide an introduction of the insight gained from X-ray crystallography and nuclear magnetic resonance (NMR) investigations and then go on to focus on studies utilizing vibrational spectroscopy and fluorescence resonance energy transfer (FRET) to study the behavior of the isolated ligand binding domain in solution and discuss the importance of specific ligand:protein interactions in the mechanism of receptor activation. PMID:17934637

  12. Capsaicin-induced glutamate release is implicated in nociceptive processing through activation of ionotropic glutamate receptors and group I metabotropic glutamate receptor in primary afferent fibers.

    PubMed

    Jin, You-Hong; Yamaki, Fumiko; Takemura, Motohide; Koike, Yuichi; Furuyama, Akira; Yonehara, Norifumi

    2009-02-01

    Glutamate (Glu) is the major excitatory neurotransmitter in the central nervous system. The role of peripheral Glu and Glu receptors (GluRs) in nociceptive transmission is, however, still unclear. In the present study, we examined Glu levels released in the subcutaneous perfusate of the rat hind instep using a microdialysis catheter and the thermal withdrawal latency using the Plantar Test following injection of drugs associated with GluRs with/without capsaicin into the hindpaw. The injection of capsaicin into the rat hind instep caused an increase of Glu level in the s.c. perfusate. Capsaicin also significantly decreased withdrawal latency to irradiation. These effects of capsaicin were inhibited by pretreatment with capsazepine, a transient receptor potential vanilloid receptor 1 (TRPV1) competitive antagonist. Capsaicin-induced Glu release was also suppressed by combination with each antagonist of ionotropic GluRs (iGluRs: NMDA/AMPA receptors) and group I metabotropic GluR (mGluR), but not group II and group III mGluRs. Furthermore, these GluRs antagonists showed remarkable inhibition against capsaicin-induced thermal hyperalgesia. These results suggest that Glu is released from the peripheral endings of small-diameter afferent fibers by noxious stimulation and then activates peripheral iGluRs and group I mGluR in development and/or maintenance of nociception. Furthermore, the activation of peripheral NMDA/AMPA receptors and group I mGluR may be important in mechanisms whereby capsaicin evokes nociceptive responses.

  13. Characterization, cell-surface expression and ligand-binding properties of different truncated N-terminal extracellular domains of the ionotropic glutamate receptor subunit GluR1.

    PubMed

    McIlhinney, R A; Molnár, E

    1996-04-01

    To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.

  14. Distribution of AMPA receptor subunits GluR1-4 in the dorsal vagal complex of the rat: a light and electron microscope immunocytochemical study.

    PubMed

    Kessler, J P; Baude, A

    1999-10-01

    The dorsal vagal complex, localized in the dorsomedial medulla, includes the nucleus tractus solitarii (NTS), the dorsal motor nucleus of the vagus nerve (DMN) and the area postrema (AP). The distribution of AMPA-preferring glutamate receptors (AMPA receptors) within this region was investigated using immunohistochemistry and antibodies recognizing either one (GluR1 or GluR4) or two (GluR2 and GluR3) AMPA receptors subunits. The distribution of GluR1 immunoreactivity showed high contrast of staining between strongly and lightly labeled areas. Labeling was intense in the AP and weak in the NTS, except for its medial and dorsalmost parts which exhibited moderate staining. Almost no GluR1 immunoreactivity was found in the DMN. GluR2/3 immunolabeling was present in the entire dorsal vagal complex. This labeling was strong in the AP, the DMN and the medial half of the NTS and moderate in the lateral half of the NTS, except for the interstitial subdivision which exhibited intense staining. Labeling induced by the GluR4 antibody was very weak throughout the dorsal vagal complex. Ultrastructural examination showed that GluR1 and GluR2/3 immunoreactivity was localized in neuronal cell bodies and dendrites. No labeled axon terminal or glial cell body was found. Immunoperoxidase staining in labeled cell bodies and dendrites was associated with intracellular organelles (microtubules, mitochondria, cisternae of the endoplasmic reticulum,.) and/or parts of the plasma membrane. Plasma membrane labeling was often associated with asymmetrical synaptic differentiations. No labeled symmetrical synapse was found using either GluR1 or GluR2/3 antibody. The present results show that AMPA receptors have a widespread distribution in neuronal perikarya and dendrites of the rat dorsal vagal complex. They suggest differences in subunit composition between AMPA receptors localized in the NTS, the DMN and the AP. Ultrastructural data are consistent with the fact that AMPA receptors associated

  15. Regulation of GluR2 promoter activity by neurotrophic factors via a neuron-restrictive silencer element.

    PubMed

    Brené, S; Messer, C; Okado, H; Hartley, M; Heinemann, S F; Nestler, E J

    2000-05-01

    The AMPA glutamate receptor subunit GluR2, which plays a critical role in regulation of AMPA channel function, shows altered levels of expression in vivo after several chronic perturbations. To evaluate the possibility that transcriptional mechanisms are involved, we studied a 1254-nucleotide fragment of the 5'-promoter region of the mouse GluR2 gene in neural-derived cell lines. We focused on regulation of GluR2 promoter activity by two neurotrophic factors, which are known to be altered in vivo in some of the same systems that show GluR2 regulation. Glial-cell line derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) both induced GluR2 promoter activity. This was associated with increased expression of endogenous GluR2 immunoreactivity in the cells as measured by Western blotting. The effect of GDNF and BDNF appeared to be mediated via a NRSE (neuron-restrictive silencer element) present within the GluR2 promoter. The response to these neurotrophic factors was lost upon mutating or deleting this site, but not several other putative response elements present within the promoter. Moreover, overexpression of REST (restrictive element silencer transcription factor; also referred to as NRSF or neuron restrictive silencer factor), which is known to act on NRSEs in other genes to repress gene expression, blocked the ability of GDNF to induce GluR2 promoter activity. However, GDNF did not alter endogenous levels of REST in the cells. Together, these findings suggest that GluR2 expression can be regulated by neurotrophic factors via an apparently novel mechanism involving the NRSE present within the GluR2 gene promoter.

  16. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  17. Characteristics of AMPA receptor-mediated responses of cultured cortical and spinal cord neurones and their correlation to the expression of glutamate receptor subunits, GluR1-4

    PubMed Central

    Dai, Wei-Min; Egebjerg, Jan; Lambert, John D C

    2001-01-01

    Electrophysiological recordings have been used to characterize responses mediated by AMPA receptors expressed by cultured rat cortical and spinal cord neurones. The EC50 values for AMPA were 17 and 11 μM, respectively.Responses of cortical neurones to AMPA were inhibited competitively by NBQX (pKi=6.6). Lower concentrations of NBQX (⩽1 μM) also potentiated the plateau responses of spinal cord neurones to AMPA, which could be attributed to a depression of desensitization to AMPA.GYKI 52466 inhibited responses of spinal cord neurones to AMPA to about twice the extent of responses of cortical neurones.Blockade of AMPA receptor desensitization by cyclothiazide (CTZ) potentiated responses of spinal cord neurones (6.8 fold) significantly more than responses of cortical neurones (4.8 fold). Responses of cortical neurones to KA were potentiated 3.5 fold by CTZ, while responses of spinal cord neurones were unaffected.Ultra-fast applications of AMPA to outside-out patches showed responses of spinal cord neurones desensitized by 97.5% and exhibit marked inward rectification, whereas cortical neurones desensitized by 91% and exhibited slight outward rectification. The time constants of deactivation and desensitization were about twice as fast in spinal cord than cortical neurones.In cortical neurones, single-cell RT – PCR showed GluR2 and GluR1 accounted for 91% of all subunits and were expressed together in 67% of neurones, predominantly as the flip variants (78%). GluR2 was detected alone in 24% of neurones. GluR3 and GluR4 were present in only 14 and 29% of neurones, respectively. For spinal cord neurones, GluR4o was detected in 81% of neurones, whereas predominantly flop versions of GluR1, 2 and 3 were detected in 38, 13 and 13% of neurones, respectively. These expression patterns are related to the respective pharmacological and mechanistic properties. PMID:11309259

  18. Association of the AMPA receptor-related postsynaptic density proteins GRIP and ABP with subsets of glutamate-sensitive neurons in the rat retina.

    PubMed

    Gábriel, Robert; de Souza, Sunita; Ziff, Edward B; Witkovsky, Paul

    2002-07-22

    We used specific antibodies against two postsynaptic density proteins, GRIP (glutamate receptor interacting protein) and ABP (AMPA receptor-binding protein), to study their distribution in the rat retina. In the central nervous system, it has been shown that both proteins bind strongly to the AMPA glutamate receptor (GluR) 2/3 subunits, but not other GluRs, through a set of three PDZ domains. Western blots detected a single GRIP protein that was virtually identical in retina and brain, whereas retinal ABP corresponded to only one of three ABP peptides found in brain. The retinal distributions of GluR2/3, GRIP, and ABP immunoreactivity (IR) were similar but not identical. GluR2/3 immunoreactivity (IR) was abundant in both plexiform layers and in large perikarya. ABP IR was concentrated in large perikarya but was sparse in the plexiform layers, whereas GRIP IR was relatively more abundant in the plexiform layers than in perikarya. Immunolabel for these three antibodies consisted of puncta < or = 0.2 microm in diameter. The cellular localization of GRIP and ABP IR was examined by double labeling subclasses of retinal neuron with characteristic marker proteins, e.g., calbindin. GRIP, ABP, and GluR2/3 IR were detected in horizontal cells, dopaminergic and glycinergic AII amacrine cells and large ganglion cells. Immunolabel was absent in rod bipolar and weak or absent in cholinergic amacrine cells. By using the tyramide method of signal amplification, a colocalization of GluR2/3 was found with either GRIP or ABP in horizontal cell terminals, and perikarya of amacrine and ganglion cells. Our results show that ABP and GRIP colocalize with GluR2/3 in particular subsets of retinal neuron, as was previously established for certain neurons in the brain. Copyright 2002 Wiley-Liss, Inc.

  19. Increased Glutamate Receptor and Transporter Expression in the Cerebral Cortex and Striatum of Gcdh -/- Mice: Possible Implications for the Neuropathology of Glutaric Acidemia Type I

    PubMed Central

    Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir

    2014-01-01

    We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605

  20. Increased glutamate receptor and transporter expression in the cerebral cortex and striatum of gcdh-/- mice: possible implications for the neuropathology of glutaric acidemia type I.

    PubMed

    Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir

    2014-01-01

    We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.

  1. Chronic renal failure induces cell death in rat hippocampal CA1 via upregulation of αCaMKII/NR2A synaptic complex and phosphorylated GluR1-containing AMPA receptor cascades.

    PubMed

    Kim, Jong Wan; Ha, Gyoung Yim; Jung, Yong Wook

    2014-09-01

    N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-methylisoxazole-4-propinoic acid (AMPA) receptors bound to postsynaptic density-95 (PSD-95) and α isoform of calcium/calmodulin-dependent protein kinase II (αCaMKII) is fundamentally involved in the regulation of working memory. The aim of present study was to investigate the alterations of NMDA and AMPA receptors responsible for hippocampal synaptic dysfunction and selective neuronal cell death after chronic renal failure (CRF) which may be associated with impairment of working memory. Altered interactions between NMDA and AMPA receptors and PSD-95 and αCaMKII were analyzed in the cornu ammonis (CA) 1 and CA3/dentate gyrus (DG) subfields of the uremic rat hippocampi using the immunoblotting and immunoprecipitation methods. Uremia induced by CRF produced necrotic cell death and decreased neuronal nucleoli protein levels in the hippocampal CA1 subfield, but not in the CA3/DG subfields. The CA1 subfields of CRF rats exhibited significant decreases and increases, respectively, in the expressions of PSD-95/NR2B and αCaMKII/NR2A synaptic complex. Moreover, increased phosphorylation of glutamate receptor type 1 (GluR1) AMPA receptor at ser831 was observed in the CA1 subfield after CRF. These hippocampal CA1 neuronal vulnerability may be responsible for memory dysfunction after CRF as mediated by an increase in NR2A-containing NMDA receptors bound to αCaMKII and subsequent activation of GluR1-containing AMPA receptors caused by the phosphorylation of GluR1 at ser831.

  2. Isoflurane unveils a critical role of glutamate transporter type 3 in regulating hippocampal GluR1 trafficking and context-related learning and memory in mice.

    PubMed

    Cao, J; Wang, Z; Mi, W; Zuo, Z

    2014-07-11

    Glutamate transporter type 3 (EAAT3) may play a role in cognition. Isoflurane enhances EAAT3 trafficking to the plasma membrane. Thus, we used isoflurane to determine how EAAT3 might regulate learning and memory and the trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, such as GluR1, to the plasma membrane, a fundamental biochemical process for learning and memory. Here, isoflurane increased EAAT3 but did not change GluR1 levels in the plasma membrane of wild-type mouse hippocampus. Isoflurane increased protein phosphatase activity in the wild-type and EAAT3(-/-) mouse hippocampus. Also, isoflurane reduced GluR1 in the plasma membrane and decreased phospho-GluR1 in EAAT3(-/-) mice. The phosphatase inhibitor okadaic acid attenuated these effects. Finally, isoflurane inhibited context-related fear conditioning in EAAT3(-/-) mice but not in wild-type mice. Thus, isoflurane may increase GluR1 trafficking to the plasma membrane via EAAT3 and inhibit GluR1 trafficking via protein phosphatase. Lack of EAAT3 effects leads to decreased GluR1 trafficking and impaired cognition after isoflurane exposure in EAAT3(-/-) mice. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  3. 4-Alkylated homoibotenic acid (HIBO) analogues: versatile pharmacological agents with diverse selectivity profiles towards metabotropic and ionotropic glutamate receptor subtypes.

    PubMed

    Madsen, Ulf; Pickering, Darryl S; Nielsen, Birgitte; Bräuner-Osborne, Hans

    2005-01-01

    4-Alkylated analogues of homoibotenic acid (HIBO) have previously shown high potency and selectivity at ionotropic and metabotropic glutamic acid receptor (iGluR and mGluR) subtypes. Compounds with different selectivity profiles are valuable pharmacological tools for neuropharmacological studies, and the series of 4-alkyl-HIBO analogues have been extended in this paper in the search for versatile agents. Pharmacological characterization of five new analogues, branched and unbranched 4-alkyl-HIBO analogues, have been carried out. The present compounds are all weak antagonists at Group I mGluRs (mGluR1 and 5) presenting only small differences in potencies (Ki values ranging from 89 to 670 microM). Affinities were studied at native and cloned iGluRs, and the compounds described show preference for the AMPA receptor subtypes GluR1 and 2 over GluR3 and 4. However, compared to previous 4-alkyl-HIBO analogues, these compounds show a remarkably high affinity for the Kain preferring subtype GluR5. The observed GluR5 affinities were either similar or higher compared to their GluR1 and 2 affinity. Isopropyl-HIBO showed the highest affinity for GluR5 (Ki=0.16 microM), and represents a unique compound with high affinity towards the three subtypes GluR1, 2 and 5. In general, these compounds represent new selectivity profiles compared to previously reported Glu receptor analogues.

  4. Aqueous and Ethanolic Valeriana officinalis Extracts Change the Binding of Ligands to Glutamate Receptors.

    PubMed

    Del Valle-Mojica, Lisa M; Cordero-Hernández, José M; González-Medina, Giselle; Ramos-Vélez, Igmeris; Berríos-Cartagena, Nairimer; Torres-Hernández, Bianca A; Ortíz, José G

    2011-01-01

    The effects of two valerian extracts (aqueous and hydroalcoholic) were investigated through [(3)H]Glutamate ([(3)H]Glu) and [(3)H]Fluorowillardine ([(3)H]FW) receptor binding assays using rat synaptic membranes in presence of different receptor ligands. In addition, the extract stability was monitored spectrophotometrically. Both extracts demonstrated interaction with ionotropic glutamate receptors (iGluRs). However, the extracts displayed considerable differences in receptor selectivity. The hydroalcoholic extract selectively interacted with quisqualic acid (QA), group I metabotropic glutamate receptor (mGluR) ligand, while the aqueous extract did not alter the binding of QA. The stability of the extracts was examined during several weeks. Freshly prepared extract inhibited 38-60% of [(3)H]FW binding (AMPA). After 10 days, the aqueous extract inhibited 85% of [(3)H]FW binding while the hydroalcoholic extract markedly potentiated (200%) [(3)H]FW binding to AMPA receptors. Thus, our results showed that factors such as extraction solvent and extract stability determine the selectivity for glutamate receptor (GluR) interactions.

  5. Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

    2005-11-01

    The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

  6. Measurement of Conformational Changes Accompanying Desensitization in an Ionotropic Glutamate Receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Armstrong,N.; Jasti, J.; Beich-Frandsen, M.

    2006-01-01

    The canonical conformational states occupied by most ligand-gated ion channels, and many cell-surface receptors, are the resting, activated, and desensitized states. While the resting and activated states of multiple receptors are well characterized, elaboration of the structural properties of the desensitized state, a state that is by definition inactive, has proven difficult. Here we use electrical, chemical, and crystallographic experiments on the AMPA-sensitive GluR2 receptor, defining the conformational rearrangements of the agonist binding cores that occur upon desensitization of this ligand-gated ion channel. These studies demonstrate that desensitization involves the rupture of an extensive interface between domain 1 of 2-foldmore » related glutamate-binding core subunits, compensating for the ca. 21{sup o} of domain closure induced by glutamate binding. The rupture of the domain 1 interface allows the ion channel to close and thereby provides a simple explanation to the long-standing question of how agonist binding is decoupled from ion channel gating upon receptor desensitization.« less

  7. Stereochemistry of quinoxaline antagonist binding to a glutamate receptor investigated by Fourier transform infrared spectroscopy.

    PubMed

    Madden, D R; Thiran, S; Zimmermann, H; Romm, J; Jayaraman, V

    2001-10-12

    The stereochemistry of the interactions between quinoxaline antagonists and the ligand-binding domain of the glutamate receptor 4 (GluR4) have been investigated by probing their vibrational modes using Fourier transform infrared spectroscopy. In solution, the electron-withdrawing nitro groups of both compounds establish a resonance equilibrium that appears to stabilize the keto form of one of the cyclic amide carbonyl bonds. Changes in the 6,7-dinitro-2,3-dihydroxyquinoxaline vibrational spectra on binding to the glutamate receptor, interpreted within the framework of a published crystal structure, illuminate the stereochemistry of the interaction and suggest that the binding site imposes a more polarized electronic bonding configuration on this antagonist. Similar spectral changes are observed for 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline, confirming that its interactions with the binding site are highly similar to those of 6,7-dinitro-2,3-dihydroxyquinoxaline and leading to a model of the 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline-S1S2 complex, for which no crystal structure is available. Conformational changes within the GluR ligand binding domain were also monitored. Compared with the previously reported spectral changes seen on binding of the agonist glutamate, only a relatively small change is detected on antagonist binding. This correlation between the functional effects of different classes of ligand and the magnitude of the spectroscopic changes they induce suggests that the spectral data reflect physiologically relevant conformational processes.

  8. AMPA/kainate glutamate receptors contribute to inflammation, degeneration and pain related behaviour in inflammatory stages of arthritis

    PubMed Central

    Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J

    2015-01-01

    Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267

  9. Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons.

    PubMed

    Shi, S; Hayashi, Y; Esteban, J A; Malinow, R

    2001-05-04

    AMPA-type glutamate receptors (AMPA-Rs) mediate a majority of excitatory synaptic transmission in the brain. In hippocampus, most AMPA-Rs are hetero-oligomers composed of GluR1/GluR2 or GluR2/GluR3 subunits. Here we show that these AMPA-R forms display different synaptic delivery mechanisms. GluR1/GluR2 receptors are added to synapses during plasticity; this requires interactions between GluR1 and group I PDZ domain proteins. In contrast, GluR2/GluR3 receptors replace existing synaptic receptors continuously; this occurs only at synapses that already have AMPA-Rs and requires interactions by GluR2 with NSF and group II PDZ domain proteins. The combination of regulated addition and continuous replacement of synaptic receptors can stabilize long-term changes in synaptic efficacy and may serve as a general model for how surface receptor number is established and maintained.

  10. On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

    PubMed

    Speranskiy, Kirill; Kurnikova, Maria

    2005-08-30

    Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

  11. The AMPA receptor subunit GluR1 regulates dendritic architecture of motor neurons

    NASA Technical Reports Server (NTRS)

    Inglis, Fiona M.; Crockett, Richard; Korada, Sailaja; Abraham, Wickliffe C.; Hollmann, Michael; Kalb, Robert G.

    2002-01-01

    The morphology of the mature motor neuron dendritic arbor is determined by activity-dependent processes occurring during a critical period in early postnatal life. The abundance of the AMPA receptor subunit GluR1 in motor neurons is very high during this period and subsequently falls to a negligible level. To test the role of GluR1 in dendrite morphogenesis, we reintroduced GluR1 into rat motor neurons at the end of the critical period and quantitatively studied the effects on dendrite architecture. Two versions of GluR1 were studied that differed by the amino acid in the "Q/R" editing site. The amino acid occupying this site determines single-channel conductance, ionic permeability, and other essential electrophysiologic properties of the resulting receptor channels. We found large-scale remodeling of dendritic architectures in a manner depending on the amino acid occupying the Q/R editing site. Alterations in the distribution of dendritic arbor were not prevented by blocking NMDA receptors. These observations suggest that the expression of GluR1 in motor neurons modulates a component of the molecular substrate of activity-dependent dendrite morphogenesis. The control of these events relies on subunit-specific properties of AMPA receptors.

  12. Aqueous and Ethanolic Valeriana officinalis Extracts Change the Binding of Ligands to Glutamate Receptors

    PubMed Central

    Del Valle-Mojica, Lisa M.; Cordero-Hernández, José M.; González-Medina, Giselle; Ramos-Vélez, Igmeris; Berríos-Cartagena, Nairimer; Torres-Hernández, Bianca A.; Ortíz, José G.

    2011-01-01

    The effects of two valerian extracts (aqueous and hydroalcoholic) were investigated through [3H]Glutamate ([3H]Glu) and [3H]Fluorowillardine ([3H]FW) receptor binding assays using rat synaptic membranes in presence of different receptor ligands. In addition, the extract stability was monitored spectrophotometrically. Both extracts demonstrated interaction with ionotropic glutamate receptors (iGluRs). However, the extracts displayed considerable differences in receptor selectivity. The hydroalcoholic extract selectively interacted with quisqualic acid (QA), group I metabotropic glutamate receptor (mGluR) ligand, while the aqueous extract did not alter the binding of QA. The stability of the extracts was examined during several weeks. Freshly prepared extract inhibited 38–60% of [3H]FW binding (AMPA). After 10 days, the aqueous extract inhibited 85% of [3H]FW binding while the hydroalcoholic extract markedly potentiated (200%) [3H]FW binding to AMPA receptors. Thus, our results showed that factors such as extraction solvent and extract stability determine the selectivity for glutamate receptor (GluR) interactions. PMID:21151614

  13. Prostacyclin regulates spinal nociceptive processing through cyclic adenosine monophosphate-induced translocation of glutamate receptors.

    PubMed

    Schuh, Claus Dieter; Brenneis, Christian; Zhang, Dong Dong; Angioni, Carlo; Schreiber, Yannick; Ferreiros-Bouzas, Nerea; Pierre, Sandra; Henke, Marina; Linke, Bona; Nüsing, Rolf; Scholich, Klaus; Geisslinger, Gerd

    2014-02-01

    Prostacyclin (PGI2) is known to be an important mediator of peripheral pain sensation (nociception) whereas little is known about its role in central sensitization. The levels of the stable PGI2-metabolite 6-keto-prostaglandin F1α (6-keto-PGF1α) and of prostaglandin E2 (PGE2) were measured in the dorsal horn with the use of mass spectrometry after peripheral inflammation. Expression of the prostanoid receptors was determined by immunohistology. Effects of prostacyclin receptor (IP) activation on spinal neurons were investigated with biochemical assays (cyclic adenosine monophosphate-, glutamate release-measurement, Western blot analysis) in embryonic cultures and adult spinal cord. The specific IP antagonist Cay10441 was applied intrathecally after zymosan-induced mechanical hyperalgesia in vivo. Peripheral inflammation caused a significant increase of the stable PGI2 metabolite 6-keto-PGF1α in the dorsal horn of wild-type mice (n = 5). IP was located on spinal neurons and did not colocalize with the prostaglandin E2 receptors EP2 or EP4. The selective IP-agonist cicaprost increased cyclic adenosine monophosphate synthesis in spinal cultures from wild-type but not from IP-deficient mice (n = 5-10). The combination of fluorescence-resonance-energy transfer-based cyclic adenosine monophosphate imaging and calcium imaging showed a cicaprost-induced cyclic adenosine monophosphate synthesis in spinal cord neurons (n = 5-6). Fittingly, IP activation increased glutamate release from acute spinal cord sections of adult mice (n = 13-58). Cicaprost, but not agonists for EP2 and EP4, induced protein kinase A-dependent phosphorylation of the GluR1 subunit and its translocation to the membrane. Accordingly, intrathecal administration of the IP receptor antagonist Cay10441 had an antinociceptive effect (n = 8-11). Spinal prostacyclin synthesis during early inflammation causes the recruitment of GluR1 receptors to membrane fractions, thereby augmenting the onset of central

  14. Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors

    PubMed Central

    Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

    2006-01-01

    Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965

  15. Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors.

    PubMed

    Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

    2006-11-15

    Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.

  16. Agonist-stimulated cobalt uptake provides selective visualization of neurons expressing AMPA- or kainate-type glutamate receptors in the retina.

    PubMed

    Pourcho, Roberta G; Qin, Pu; Goebel, Dennis J; Fyk-Kolodziej, Bozena

    2002-12-16

    Fast-acting excitatory neurotransmission in the retina is mediated primarily by glutamate, acting at alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) -selective and kainate-selective receptors. To localize these sites of action, cat retinas were stimulated with either AMPA or kainate and processed for histochemical visualization of cobalt uptake through calcium-permeable channels. Treatment with both agonists resulted in staining of A- and B-type horizontal cells and several types of OFF cone bipolar cells; there was no evidence for staining of ON cone bipolar cells or rod bipolar cells. The subpopulations of OFF cone bipolar cells differed in their responses with two distinct types that stained heavily with cobalt after exposure to AMPA and three different types that were preferentially labeled after exposure to kainate. Although many amacrine and ganglion cells appeared to respond to both agonists, AII amacrine cells were stained after stimulation by AMPA but not by kainate. The OFF cone bipolar cells that exhibit AMPA-stimulated cobalt uptake were found to have a high level of correspondence with cells that show immunocytochemical staining for the AMPA-selective glutamate receptor subunits GluR1 and GluR2/3. Similarly, the cone bipolar cells exhibiting kainate-stimulated cobalt uptake resemble those that are immunoreactive for the kainate subunit GluR5. The results indicate that, whereas many retinal neurons express both AMPA and kainate receptors, AII amacrine cells and subpopulations of OFF cone bipolar cells are limited to the expression of either AMPA or kainate receptors. This differential expression may contribute to the unique character of transmission by these cell types. Copyright 2002 Wiley-Liss, Inc.

  17. Structure and assembly mechanism for heteromeric kainate receptors.

    PubMed

    Kumar, Janesh; Schuck, Peter; Mayer, Mark L

    2011-07-28

    Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Modeling Conformational Transitions and Energetics of Ligand Binding with the Glutamate Receptor Ligand Binding Domain

    NASA Astrophysics Data System (ADS)

    Kurnikova, Maria

    2009-03-01

    Understanding of protein motion and energetics of conformational transitions is crucial to understanding protein function. The glutamate receptor ligand binding domain (GluR2 S1S2) is a two lobe protein, which binds ligand at the interface of two lobes and undergoes conformational transition. The cleft closure conformational transition of S1S2 has been implicated in gating of the ion channel formed by the transmembrane domain of the receptor. In this study we present a composite multi-faceted theoretical analysis of the detailed mechanism of this conformational transition based on rigid cluster decomposition of the protein structure [1] and identifying hydrogen bonds that are responsible for stabilizing the closed conformation [2]. Free energy of the protein reorganization upon ligand binding was calculated using combined Thermodynamic Integration (TI) and Umbrella Sampling (US) simulations [3]. Ligand -- protein interactions in the binding cleft were analyzed using Molecular Dynamics, continuum electrostatics and QM/MM models [4]. All model calculations compare well with corresponding experimental measurements. [4pt] [1] Protein Flexibility using Constraints from Molecular Dynamics Simulations T. Mamonova, B. Hespenheide, R. Straub, M. F. Thorpe, M. G. Kurnikova , Phys. Biol., 2, S137 (2005)[0pt] [2] Theoretical Study of the Glutamate Receptor Ligand Binding Domain Flexibility and Conformational Reorganization T. Mamonova, K. Speranskiy, and M. Kurnikova , Prot.: Struct., Func., Bioinf., 73,656 (2008)[0pt] [3] Energetics of the cleft closing transition and glutamate binding in the Glutamate Receptor ligand Binding Domain T. Mamonova, M. Yonkunas, and M. Kurnikova Biochemistry 47, 11077 (2008)[0pt] [4] On the Binding Determinants of the Glutamate Agonist with the Glutamate Receptor Ligand Binding Domain K. Speranskiy and M. Kurnikova Biochemistry 44, 11208 (2005)

  19. Prenatal chronic mild stress induces depression-like behavior and sex-specific changes in regional glutamate receptor expression patterns in adult rats.

    PubMed

    Wang, Y; Ma, Y; Hu, J; Cheng, W; Jiang, H; Zhang, X; Li, M; Ren, J; Li, X

    2015-08-20

    Chronic stress during critical periods of human fetal brain development is associated with cognitive, behavioral, and mood disorders in later life. Altered glutamate receptor (GluR) expression has been implicated in the pathogenesis of stress-dependent disorders. To test whether prenatal chronic mild stress (PCMS) enhances offspring's vulnerability to stress-induced behavioral and neurobiological abnormalities and if this enhanced vulnerability is sex-dependent, we measured depression-like behavior in the forced swimming test (FST) and regional changes in GluR subunit expression in PCMS-exposed adult male and female rats. Both male and female PCMS-exposed rats exhibited stronger depression-like behavior than controls. Males and females exhibited unique regional changes in GluR expression in response to PCMS alone, FST alone (CON-FST), and PCMS with FST (PCMS-FST). In females, PCMS alone did not alter N-methyl-d-aspartate receptor (NMDAR) or metabotropic glutamate receptor (mGluR) expression, while in PCMS males, higher mGluR2/3, mGluR5, and NR1 expression levels were observed in the prefrontal cortex. In addition, PCMS altered the change in GluR expression induced by acute stress (the FST test), and this too was sex-specific. Male PCMS-FST rats expressed significantly lower mGluR5 levels in the hippocampus, lower mGluR5, NR1, postsynaptic density protein (PSD)95, and higher mGluR2/3 in the prefrontal cortex, and higher mGluR5 and PSD95 in the amygdala than male CON-FST rats. Female PCMS-FST rats expressed lower NR1 in the hippocampus, lower NR2B and PSD95 in the prefrontal cortex, lower mGluR2/3 in the amygdala, and higher PSD95 in the amygdala than female CON-FST rats. PCMS may increase the offspring's vulnerability to depression by altering sex-specific stress-induced changes in glutamatergic signaling. Copyright © 2015. Published by Elsevier Ltd.

  20. AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina

    PubMed Central

    FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.

    2012-01-01

    The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241

  1. Dendritic Glutamate Receptor mRNAs Show Contingent Local Hotspot-Dependent Translational Dynamics

    PubMed Central

    Kim, Tae Kyung; Sul, Jai-Yoon; Helmfors, Henrik; Langel, Ulo; Kim, Junhyong; Eberwine, James

    2014-01-01

    SUMMARY Protein synthesis in neuronal dendrites underlies long-term memory formation in the brain. Local translation of reporter mRNAs has demonstrated translation in dendrites at focal points called translational hotspots. Various reports have shown that hundreds to thousands of mRNAs are localized to dendrites, yet the dynamics of translation of multiple dendritic mRNAs has remained elusive. Here, we show that the protein translational activities of two dendritically localized mRNAs are spatiotemporally complex but constrained by the translational hotspots in which they are colocalized. Cotransfection of glutamate receptor 2 (GluR2) and GluR4 mRNAs (engineered to encode different fluorescent proteins) into rat hippocampal neurons demonstrates a heterogeneous distribution of translational hotspots for the two mRNAs along dendrites. Stimulation with s-3,5-dihydroxy-phenylglycine modifies the translational dynamics of both of these RNAs in a complex saturable manner. These results suggest that the translational hotspot is a primary structural regulator of the simultaneous yet differential translation of multiple mRNAs in the neuronal dendrite. PMID:24075992

  2. Propofol inhibits invasion and proliferation of C6 glioma cells by regulating the Ca2+ permeable AMPA receptor-system xc- pathway.

    PubMed

    Wang, Xin-Yue; Li, Yan-Li; Wang, Hai-Yun; Zhu, Min; Guo, Di; Wang, Guo-Lin; Gao, Ying-Tang; Yang, Zhuo; Li, Tang; Yang, Chen-Yi; Chen, Yi-Meng

    2017-10-01

    Anesthetics are documented to affect tumors; therefore, we studied the antiglioma effect of propofol on proliferation and invasiveness of glioma cells and explored the underlying mechanism. C6 glioma cells were cultured and treated with propofol, and cell viability, invasiveness, and migration were measured. Glutamate release was measured using an enzyme-catalyzed kinetic reaction. xCT protein and α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor GluR2 subunit protein expression was assessed with Western blot analysis and immunofluorescent staining. We observed that propofol significantly inhibited C6 glioma cell viability, invasiveness, and migration and decreased glutamate release. An agonist of the cystine/glutamate antiporter system (system x c - ), N-acetylcysteine (NAC), reversed propofol's effects, and propofol could inhibit C6 glioma cell proliferation by adding excess exogenous glutamate (100μM). Finally, propofol increased the surface expression of GluR2, but decreased surface expression of xCT. The effects of propofol on surface expression of GluR2 and xCT could be rescued by (R, S)-AMPA, an agonist of Ca 2+ permeable AMPA receptor (CPAR). Thus, propofol can inhibit cell viability, invasiveness, and migration of C6 glioma cells, and the CPAR-system x c - pathway contributes to these events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Distinct subunits in heteromeric kainate receptors mediate ionotropic and metabotropic function at hippocampal mossy fiber synapses.

    PubMed

    Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe

    2005-12-14

    Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.

  4. CORM-A1 prevents blood-brain barrier dysfunction caused by ionotropic glutamate receptor-mediated endothelial oxidative stress and apoptosis.

    PubMed

    Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena

    2013-06-01

    In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.

  5. Modulation of spinal nociception by GluR5 kainate receptor ligands in acute and hyperalgesic states and the role of gabaergic mechanisms.

    PubMed

    Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris

    2002-09-01

    GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the

  6. TPEN, a Specific Zn2+ Chelator, Inhibits Sodium Dithionite and Glucose Deprivation (SDGD)-Induced Neuronal Death by Modulating Apoptosis, Glutamate Signaling, and Voltage-Gated K+ and Na+ Channels.

    PubMed

    Zhang, Feng; Ma, Xue-Ling; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Xie, Lai-Hua; Liu, Yan-Qiang

    2017-03-01

    Hypoxia-ischemia-induced neuronal death is an important pathophysiological process that accompanies ischemic stroke and represents a major challenge in preventing ischemic stroke. To elucidate factors related to and a potential preventative mechanism of hypoxia-ischemia-induced neuronal death, primary neurons were exposed to sodium dithionite and glucose deprivation (SDGD) to mimic hypoxic-ischemic conditions. The effects of N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN), a specific Zn 2+ -chelating agent, on SDGD-induced neuronal death, glutamate signaling (including the free glutamate concentration and expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor (GluR2) and N-methyl-D-aspartate (NMDA) receptor subunits (NR2B), and voltage-dependent K + and Na + channel currents were also investigated. Our results demonstrated that TPEN significantly suppressed increases in cell death, apoptosis, neuronal glutamate release into the culture medium, NR2B protein expression, and I K as well as decreased GluR2 protein expression and Na + channel activity in primary cultured neurons exposed to SDGD. These results suggest that TPEN could inhibit SDGD-induced neuronal death by modulating apoptosis, glutamate signaling (via ligand-gated channels such as AMPA and NMDA receptors), and voltage-gated K + and Na + channels in neurons. Hence, Zn 2+ chelation might be a promising approach for counteracting the neuronal loss caused by transient global ischemia. Moreover, TPEN could represent a potential cell-targeted therapy.

  7. Sex-specific effects of prenatal chronic mild stress on adult spatial learning capacity and regional glutamate receptor expression profiles.

    PubMed

    Wang, Yan; Ma, Yuchao; Hu, Jingmin; Zhang, Xinxin; Cheng, Wenwen; Jiang, Han; Li, Min; Ren, Jintao; Zhang, Xiaosong; Liu, Mengxi; Sun, Anji; Wang, Qi; Li, Xiaobai

    2016-07-01

    Both animal experiments and clinical studies have demonstrated that prenatal stress can cause cognitive disorders in offspring. To explore the scope of these deficits and identify potential underlying mechanisms, we examined the spatial learning and memory performance and glutamate receptor (GluR) expression patterns of adult rats exposed to prenatal chronic mild stress (PCMS). Principal component analysis (PCA) was employed to reveal the interrelationships among spatial learning indices and GluR expression changes. Female PCMS-exposed offspring exhibited markedly impaired spatial learning and memory in the Morris water maze (MWM) task compared to control females, while PCMS-exposed males showed better initial spatial learning in the MWM compared to control males. PCMS also altered basal and post-MWM glutamate receptor expression patterns, but these effects differed markedly between sexes. Male PCMS-exposed offspring exhibited elevated basal expression of NR1, mGluR5, and mGluR2/3 in the prefrontal cortex (PFC), whereas females showed no basal expression changes. Following MWM training, PCMS-exposed males expressed higher NR1 in the PFC and mammillary body (MB), higher mGluR2/3 in PFC, and lower NR2B in the hippocampus (HIP), PFC, and MB compared to unstressed MWM-trained males. Female PCMS-exposed offspring showed strongly reduced NR1 in MB and NR2B in the HIP, PFC, and MB, and increased mGluR2/3 in PFC compared to unstressed MWM-trained females. This is the first report suggesting that NMDA subunits in the MB are involved in spatial learning. Additionally, PCA further suggests that the NR1-NR2B form is the most important for spatial memory formation. These results reveal long-term sex-specific effects of PCMS on spatial learning and memory performance in adulthood and implicate GluR expression changes within HIP, PFC, and MB as possible molecular mechanisms underlying cognitive dysfunction in offspring exposed to prenatal stress. Copyright © 2016 Elsevier Inc

  8. Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

    NASA Technical Reports Server (NTRS)

    Stegenga, S. L.; Kalb, R. G.

    2001-01-01

    Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

  9. GluR2-3Y Inhibits the Acquisition and Reinstatement of Morphine-Induced Conditioned Place Preference in Rats.

    PubMed

    Lin, Xiao-Jing; Zhang, Jian-Jun; Yu, Long-Chuan

    2016-04-01

    Accumulating evidence indicates that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors (AMPARs) are involved in the relapse to abused drugs. However, the role of AMPARs containing the GluR2 subunit in opiate addiction is still unclear. GluR2-3Y, an interfering peptide, prevents the endocytosis of AMPARs containing the GluR2 subunit. In this study, we explored the effect of intravenous injection of GluR2-3Y on the acquisition, expression, and reinstatement of morphine-induced conditioned place preference (mCPP) in rats. We found that infusion of GluR2-3Y (1.5 nmol/g) one hour before morphine during the conditioning phase inhibited the acquisition of mCPP, while an identical injection one hour before the post-conditioning test had no influence on the expression of mCPP. Injection of GluR2-3Y (1.5 nmol/g) after mCPP extinction blocked the morphine-induced reinstatement of mCPP. Our results strongly support the hypothesis that inhibition of AMPAR endocytosis provides a new target for the treatment of opiate addiction.

  10. Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.

    PubMed

    Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U

    2005-04-01

    The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.

  11. N-linked glycosylation of cortical N-methyl-D-aspartate and kainate receptor subunits in schizophrenia.

    PubMed

    Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H

    2013-08-21

    Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.

  12. Metabotropic Glutamate Receptors in the Trafficking of Ionotropic Glutamate and GABAA Receptors at Central Synapses

    PubMed Central

    Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping

    2006-01-01

    The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABAA receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABAA receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca2+ concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABAA receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABAA receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves. PMID:18615134

  13. Chronic SO2 inhalation above environmental standard impairs neuronal behavior and represses glutamate receptor gene expression and memory-related kinase activation via neuroinflammation in rats.

    PubMed

    Yao, Gaoyi; Yue, Huifeng; Yun, Yang; Sang, Nan

    2015-02-01

    Sulfur dioxide (SO2), as a ubiquitous air pollutant implicated in the genesis of pulmonary disease, is now being considered to be involved in neurotoxicity and increased risk for hospitalization of brain disorders. However, comparatively little is known about the impact of chronically SO2 inhalation on neuronal function. In the present study, by exposing male Wistar rats to SO2 at 3.50 and 7.00 mg/m(3) (approximately 1225 and 2450 ppb, 4.08-8.16 (24h average concentration) times higher than the EPA standard for environmental air concentrations) or filtered air for 90 days, we investigated the impact of chronic SO2 inhalation on performance in Morris water maze, and probed the accompanying neurobiological effects, including activity-regulated cytoskeletal associated gene (Arc) and glutamate receptor gene expression, memory-related kinase level and inflammatory cytokine release in the hippocampus. Here, we found that SO2 exposure reduced the number of target zone crossings and time spent in the target quadrant during the test session in the spatial memory retention of the Morris water maze. Following the neuro-functional abnormality, we detected that SO2 inhalation reduced the expression of Arc and glutamate receptor subunits (GluR1, GluR2, NR1, NR2A, and NR2B) with a concentration-dependent property in comparison to controls. Additionally, the expression of memory kinases was attenuated statistically in the animals receiving the higher concentration, including protein kinase A (PKA), protein kinase C (PKC) and calcium/calmodulin-dependent protein kinaseIIα (CaMKIIα). And the inflammatory cytokine release was increased in rats exposed to SO2. Taken together, our results suggest that long-term exposure to SO2 air pollution at concentrations above the environmental standard in rats impaired spatial learning and memory, and indicate a close link between the neurobiological changes highlighted in the brain and the behavioral disturbances. Copyright © 2014 Elsevier Inc

  14. Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells.

    PubMed

    Campana, Wendy M; Mantuano, Elisabetta; Azmoon, Pardis; Henry, Kenneth; Banki, Michael A; Kim, John H; Pizzo, Donald P; Gonias, Steven L

    2017-04-01

    In the peripheral nervous system, Schwann cells (SCs) demonstrate surveillance activity, detecting injury and undergoing trans -differentiation to support repair. SC receptors that detect peripheral nervous system injury remain incompletely understood. We used RT-PCR to profile ionotropic glutamate receptor expression in cultured SCs. We identified subunits required for assembly of N -methyl-d-aspartic acid (NMDA) receptors (NMDA-Rs), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, and kainate receptors. Treatment of SCs with 40-100 µM glutamate or with 0.5-1.0 µM NMDA robustly activated Akt and ERK1/2. The response was transient and bimodal; glutamate concentrations that exceeded 250 µM failed to activate cell signaling. Phosphoprotein profiling identified diverse phosphorylated proteins in glutamate-treated SCs in addition to ERK1/2 and Akt, including p70 S6-kinase, glycogen synthase kinase-3, ribosomal S6 kinase, c-Jun, and cAMP response element binding protein. Activation of SC signaling by glutamate was blocked by EGTA and dizocilpine and by silencing expression of the NMDA-R NR1 subunit. Phosphoinositide 3-kinase/PI3K functioned as an essential upstream activator of Akt and ERK1/2 in glutamate-treated SCs. When glutamate or NMDA was injected directly into crush-injured rat sciatic nerves, ERK1/2 phosphorylation was observed in myelinated and nonmyelinating SCs. Glutamate promoted SC migration by a pathway that required PI3K and ERK1/2. These results identified ionotropic glutamate receptors and NMDA-Rs, specifically, as potentially important cell signaling receptors in SCs.-Campana, W. M., Mantuano, E., Azmoon, P., Henry, K., Banki, M. A., Kim, J. H., Pizzo, D. P., Gonias, S. L. Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells. © FASEB.

  15. Trafficking of presynaptic AMPA receptors mediating neurotransmitter release: neuronal selectivity and relationships with sensitivity to cyclothiazide.

    PubMed

    Pittaluga, Anna; Feligioni, Marco; Longordo, Fabio; Luccini, Elisa; Raiteri, Maurizio

    2006-03-01

    Postsynaptic glutamate AMPA receptors (AMPARs) can recycle between plasma membrane and intracellular pools. In contrast, trafficking of presynaptic AMPARs has not been investigated. AMPAR surface expression involves interactions between the GluR2 carboxy tail and various proteins including glutamate receptor-interacting protein (GRIP), AMPA receptor-binding protein (ABP), protein interacting with C kinase 1 (PICK1), N-ethyl-maleimide-sensitive fusion protein (NSF). Here, peptides known to selectively block the above interactions were entrapped into synaptosomes to study the effects on the AMPA-evoked release of [3H]noradrenaline ([3H]NA) and [3H]acetylcholine ([3H]ACh) from rat hippocampal and cortical synaptosomes, respectively. Internalization of pep2-SVKI to prevent GluR2-GRIP/ABP/PICK1 interactions potentiated the AMPA-evoked release of [3H]NA but left unmodified that of [3H]ACh. Similar potentiation was caused by pep2-AVKI, the blocker of GluR2-PICK1 interaction. Conversely, a decrease in the AMPA-evoked release of [3H]NA, but not of [3H]ACh, was caused by pep2m, a selective blocker of the GluR2-NSF interaction. In the presence of pep2-SVKI the presynaptic AMPARs on noradrenergic terminals lost sensitivity to cyclothiazide. AMPARs releasing [3H]ACh, but not those releasing [3H]NA, were sensitive to spermine, suggesting that they are GluR2-lacking AMPARs. To conclude: (i) release-regulating presynaptic AMPARs constitutively cycle in isolated nerve terminals; (ii) the process exhibits neuronal selectivity; (iii) AMPAR trafficking and desensitization may be interrelated.

  16. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Maturation profile of inferior olivary neurons expressing ionotropic glutamate receptors in rats: role in coding linear accelerations.

    PubMed

    Li, Chuan; Han, Lei; Ma, Chun-Wai; Lai, Suk-King; Lai, Chun-Hong; Shum, Daisy Kwok Yan; Chan, Ying-Shing

    2013-07-01

    Using sinusoidal oscillations of linear acceleration along both the horizontal and vertical planes to stimulate otolith organs in the inner ear, we charted the postnatal time at which responsive neurons in the rat inferior olive (IO) first showed Fos expression, an indicator of neuronal recruitment into the otolith circuit. Neurons in subnucleus dorsomedial cell column (DMCC) were activated by vertical stimulation as early as P9 and by horizontal (interaural) stimulation as early as P11. By P13, neurons in the β subnucleus of IO (IOβ) became responsive to horizontal stimulation along the interaural and antero-posterior directions. By P21, neurons in the rostral IOβ became also responsive to vertical stimulation, but those in the caudal IOβ remained responsive only to horizontal stimulation. Nearly all functionally activated neurons in DMCC and IOβ were immunopositive for the NR1 subunit of the NMDA receptor and the GluR2/3 subunit of the AMPA receptor. In situ hybridization studies further indicated abundant mRNA signals of the glutamate receptor subunits by the end of the second postnatal week. This is reinforced by whole-cell patch-clamp data in which glutamate receptor-mediated miniature excitatory postsynaptic currents of rostral IOβ neurons showed postnatal increase in amplitude, reaching the adult level by P14. Further, these neurons exhibited subthreshold oscillations in membrane potential as from P14. Taken together, our results support that ionotropic glutamate receptors in the IO enable postnatal coding of gravity-related information and that the rostral IOβ is the only IO subnucleus that encodes spatial orientations in 3-D.

  18. Metabotropic glutamate receptors in the trafficking of ionotropic glutamate and GABA(A) receptors at central synapses.

    PubMed

    Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping

    2006-01-01

    The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABA(A) receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABA(A) receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca(2+) concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABA(A) receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABA(A) receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves.

  19. Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat.

    PubMed

    Pamenter, Matthew E; Carr, J Austin; Go, Ariel; Fu, Zhenxing; Reid, Stephen G; Powell, Frank L

    2014-04-15

    When exposed to a hypoxic environment the body's first response is a reflex increase in ventilation, termed the hypoxic ventilatory response (HVR). With chronic sustained hypoxia (CSH), such as during acclimatization to high altitude, an additional time-dependent increase in ventilation occurs, which increases the HVR. This secondary increase persists after exposure to CSH and involves plasticity within the circuits in the central nervous system that control breathing. Currently these mechanisms of HVR plasticity are unknown and we hypothesized that they involve glutamatergic synapses in the nucleus tractus solitarius (NTS), where afferent endings from arterial chemoreceptors terminate. To test this, we treated rats held in normoxia (CON) or 10% O2 (CSH) for 7 days and measured ventilation in conscious, unrestrained animals before and after microinjecting glutamate receptor agonists and antagonists into the NTS. In normoxia, AMPA increased ventilation 25% and 50% in CON and CSH, respectively, while NMDA doubled ventilation in both groups (P < 0.05). Specific AMPA and NMDA receptor antagonists (NBQX and MK801, respectively) abolished these effects. MK801 significantly decreased the HVR in CON rats, and completely blocked the acute HVR in CSH rats but had no effect on ventilation in normoxia. NBQX decreased ventilation whenever it was increased relative to normoxic controls; i.e. acute hypoxia in CON and CSH, and normoxia in CSH. These results support our hypothesis that glutamate receptors in the NTS contribute to plasticity in the HVR with CSH. The mechanism underlying this synaptic plasticity is probably glutamate receptor modification, as in CSH rats the expression of phosphorylated NR1 and GluR1 proteins in the NTS increased 35% and 70%, respectively, relative to that in CON rats.

  20. Activation of 5-HT7 serotonin receptors reverses metabotropic glutamate receptor-mediated synaptic plasticity in wild-type and Fmr1 knockout mice, a model of Fragile X syndrome.

    PubMed

    Costa, Lara; Spatuzza, Michela; D'Antoni, Simona; Bonaccorso, Carmela M; Trovato, Chiara; Musumeci, Sebastiano A; Leopoldo, Marcello; Lacivita, Enza; Catania, Maria V; Ciranna, Lucia

    2012-12-01

    Fragile X syndrome (FXS) is a genetic cause of intellectual disability and autism. Fmr1 knockout (Fmr1 KO) mice, an animal model of FXS, exhibit spatial memory impairment and synapse malfunctioning in the hippocampus, with abnormal enhancement of long-term depression mediated by metabotropic glutamate receptors (mGluR-LTD). The neurotransmitter serotonin (5-HT) modulates hippocampal-dependent learning through serotonin 1A (5-HT1A) and serotonin 7 (5-HT7) receptors; the underlying mechanisms are unknown. We used electrophysiology to test the effects of 5-HT on mGluR-LTD in wild-type and Fmr1 KO mice and immunocytochemistry and biotinylation assay to study related changes of 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid (AMPA) glutamate receptor surface expression. Application of 5-HT or 8-OH-DPAT (a mixed 5-HT1A/5-HT7 agonist) reversed mGluR-LTD in hippocampal slices. Reversal of mGluR-LTD by 8-OH-DPAT persisted in the presence of the 5-HT1A receptor antagonist WAY-100635, was abolished by SB-269970 (5-HT7 receptor antagonist), and was mimicked by LP-211, a novel selective 5-HT7 receptor agonist. Consistently, 8-OH-DPAT decreased mGluR-mediated reduction of AMPA glutamate receptor 2 (GluR2) subunit surface expression in hippocampal slices and cultured hippocampal neurons, an effect mimicked by LP-211 and blocked by SB-269970. In Fmr1 KO mice, mGluR-LTD was abnormally enhanced; similarly to wild-type, 8-OH-DPAT reversed mGluR-LTD and decreased mGluR-induced reduction of surface AMPA receptors, an effect antagonized by SB-269970. Serotonin 7 receptor activation reverses metabotropic glutamate receptor-induced AMPA receptor internalization and LTD both in wild-type and in Fmr1 KO mice, correcting excessive mGluR-LTD. Therefore, selective activation of 5-HT7 receptors may represent a novel strategy in the therapy of FXS. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  1. [Effect of electroacupuncture on expression of ionotropic glutamate receptor subunits and their genes in lumbar segments of spinal cord in rats with neuropathic pain].

    PubMed

    Ma, Cheng; Yu, Li; Yan, Li-ping

    2010-12-01

    To observe the effect of electroacupuncture (EA) on the expression of ionotropic glutamate receptor (iGluR) subunits and their mRNAs in the lumbar segments of spinal cord in rats with neuropathic pain, so as to explore its underlying mechanism in relieving spinal hyperalgesia. Thirty SD rats were randomly divided into control, model, and EA groups, with 10 rats in each. The spared nerve injury (SNI) model was established by ligature of the sural nerve after cutting off the common peroneal nerve and anterior tibial nerve. EA (2 Hz, 1 mA) was applied to "Huantiao" (GB 30) and "Weizhong" (BL 40) for 30 min, once daily for 7 days. Mechanical pain threshold was detected before and after modeling and before and after EA treatment. The expression levels of N-methyl-d-aspartic acid (NMDA) receptor subunits NR1 and NR 2 B,and AMPA receptor subunit GluR 1 of iGluR and their genes were assayed by Western blot and reverse transcription polymerase chain reaction (RT-PCR) separately. In comparison with control group, the mechanical pain thresholds were decreased significantly on day 2, 7 and day 14 following modeling in the model group (P < 0.05, P < 0.01). While compared with the model group, the pain threshold was increased considerably on day 14 in the EA group (P < 0.01). Compared with the control group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the model group were increased significantly (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the model group increased slightly (P > 0.05). In comparison with the model group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the EA group were downregulated remarkably (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the EA group down-regulated slightly (P > 0.05). EA can significantly suppress pain reaction in rats with neuropathic pain probably through down-regulating the expression of lumbar spinal cord

  2. Neuron-to-glia signaling mediated by excitatory amino acid receptors regulates ErbB receptor function in astroglial cells of the neuroendocrine brain.

    PubMed

    Dziedzic, Barbara; Prevot, Vincent; Lomniczi, Alejandro; Jung, Heike; Cornea, Anda; Ojeda, Sergio R

    2003-02-01

    Hypothalamic astroglial erbB tyrosine kinase receptors are required for the timely initiation of mammalian puberty. Ligand-dependent activation of these receptors sets in motion a glia-to-neuron signaling pathway that prompts the secretion of luteinizing hormone-releasing hormone (LHRH), the neuropeptide controlling sexual development, from hypothalamic neuroendocrine neurons. The neuronal systems that may regulate this growth factor-mediated back signaling to neuroendocrine neurons have not been identified. Here we demonstrate that hypothalamic astrocytes contain metabotropic receptors of the metabotropic glutamate receptor 5 subtype and the AMPA receptor subunits glutamate receptor 2 (GluR2) and GluR3. As in excitatory synapses, these receptors are in physical association with their respective interacting/clustering proteins Homer and PICK1. In addition, they are associated with erbB-1 and erbB-4 receptors. Concomitant activation of astroglial metabotropic and AMPA receptors results in the recruitment of erbB tyrosine kinase receptors and their respective ligands to the glial cell membrane, transactivation of erbB receptors via a mechanism requiring metalloproteinase activity, and increased erbB receptor gene expression. By facilitating erbB-dependent signaling and promoting erbB receptor gene expression in astrocytes, a neuron-to-glia glutamatergic pathway may represent a basic cell-cell communication mechanism used by the neuroendocrine brain to coordinate the facilitatory transsynaptic and astroglial input to LHRH neurons during sexual development.

  3. Nonvesicular Release of Glutamate by Glial xCT Transporters Suppresses Glutamate Receptor Clustering In Vivo

    PubMed Central

    Augustin, Hrvoje; Grosjean, Yael; Chen, Kaiyun; Sheng, Qi; Featherstone, David E.

    2008-01-01

    We hypothesized that cystine/glutamate transporters (xCTs) might be critical regulators of ambient extracellular glutamate levels in the nervous system and that misregulation of this glutamate pool might have important neurophysiological and/or behavioral consequences. To test this idea, we identified and functionally characterized a novel Drosophila xCT gene, which we subsequently named “genderblind” (gb). Genderblind is expressed in a previously overlooked subset of peripheral and central glia. Genetic elimination of gb causes a 50% reduction in extracellular glutamate concentration, demonstrating that xCT transporters are important regulators of extracellular glutamate. Consistent with previous studies showing that extracellular glutamate regulates postsynaptic glutamate receptor clustering, gb mutants show a large (200–300%) increase in the number of postsynaptic glutamate receptors. This increase in postsynaptic receptor abundance is not accompanied by other obvious synaptic changes and is completely rescued when synapses are cultured in wild-type levels of glutamate. Additional in situ pharmacology suggests that glutamate-mediated suppression of glutamate receptor clustering depends on receptor desensitization. Together, our results suggest that (1) xCT transporters are critical for regulation of ambient extracellular glutamate in vivo; (2) ambient extracellular glutamate maintains some receptors constitutively desensitized in vivo; and (3) constitutive desensitization of ionotropic glutamate receptors suppresses their ability to cluster at synapses. PMID:17202478

  4. Role of ionotropic glutamate receptors in LTP in rat hippocampal CA1 oriens-lacunosum moleculare interneurons

    PubMed Central

    Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.

    2009-01-01

    Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803

  5. Probing the Allosteric Modulator Binding Site of GluR2 with Thiazide Derivatives

    PubMed Central

    Ptak, Christopher P.; Ahmed, Ahmed H.; Oswald, Robert E.

    2009-01-01

    Ionotropic glutamate receptors mediate the majority of vertebrate excitatory synaptic transmission and are therapeutic targets for cognitive enhancement and treatment of schizophrenia. The binding domains of these tetrameric receptors consist of two dimers, and the dissociation of the dimer interface of the ligand-binding domain leads to desensitization in the continued presence of agonist. Positive allosteric modulators act by strengthening the dimer interface and reducing desensitization, thereby increasing steady-state activation. Removing the desensitized state for simplified analysis of receptor activation is commonly achieved using cyclothiazide (CTZ), the most potent modulator of the benzothiadiazide class, with the flip form of the AMPA receptor subtype. IDRA-21, the first benzothiadiazide to have an effect in behavioral tests, is an important lead compound in clinical trials for cognitive enhancement as it can cross the blood-brain barrier. Intermediate structures between CTZ and IDRA-21 show reduced potency suggesting that these two compounds have different contact points associated with binding. To understand how benzothiadiazides bind to the pocket bridging the dimer interface, we generated a series of crystal structures of the GluR2 ligand-binding domain complexed with benzothiadiazide derivatives (IDRA-21, hydroflumethiazide, hydrochlorothiazide, chlorothiazide, trichlormethiazide, and althiazide) for comparison with an existing structure for cyclothiazide. The structures detail how changes in the substituents in the 3- and 7-positions of the hydrobenzothiadiazide ring shift the orientation of the drug in the binding site and, in some cases, change the stoichiometry of binding. All derivatives maintain a hydrogen bond with the Ser754 hydroxyl, affirming the partial selectivity of the benzothiadiazides for the flip form of AMPA receptors. PMID:19673491

  6. Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat

    PubMed Central

    Pamenter, Matthew E; Carr, J Austin; Go, Ariel; Fu, Zhenxing; Reid, Stephen G; Powell, Frank L

    2014-01-01

    When exposed to a hypoxic environment the body's first response is a reflex increase in ventilation, termed the hypoxic ventilatory response (HVR). With chronic sustained hypoxia (CSH), such as during acclimatization to high altitude, an additional time-dependent increase in ventilation occurs, which increases the HVR. This secondary increase persists after exposure to CSH and involves plasticity within the circuits in the central nervous system that control breathing. Currently these mechanisms of HVR plasticity are unknown and we hypothesized that they involve glutamatergic synapses in the nucleus tractus solitarius (NTS), where afferent endings from arterial chemoreceptors terminate. To test this, we treated rats held in normoxia (CON) or 10% O2 (CSH) for 7 days and measured ventilation in conscious, unrestrained animals before and after microinjecting glutamate receptor agonists and antagonists into the NTS. In normoxia, AMPA increased ventilation 25% and 50% in CON and CSH, respectively, while NMDA doubled ventilation in both groups (P < 0.05). Specific AMPA and NMDA receptor antagonists (NBQX and MK801, respectively) abolished these effects. MK801 significantly decreased the HVR in CON rats, and completely blocked the acute HVR in CSH rats but had no effect on ventilation in normoxia. NBQX decreased ventilation whenever it was increased relative to normoxic controls; i.e. acute hypoxia in CON and CSH, and normoxia in CSH. These results support our hypothesis that glutamate receptors in the NTS contribute to plasticity in the HVR with CSH. The mechanism underlying this synaptic plasticity is probably glutamate receptor modification, as in CSH rats the expression of phosphorylated NR1 and GluR1 proteins in the NTS increased 35% and 70%, respectively, relative to that in CON rats. PMID:24492841

  7. Differential glutamate AMPA-receptor plasticity in subpopulations of VTA neurons in the presence or absence of residual cocaine: Implications for the development of addiction

    PubMed Central

    Lane, D.A.; Reed, B.; Kreek, M.J.; Pickel, V.M.

    2011-01-01

    Cocaine-induced plasticity of mesocorticolimbic dopamine (DA) neurons, originating in the ventral tegmental area (VTA), persists in the absence of cocaine and may contribute to both drug-craving and relapse. Glutamate AMPA receptors (AMPARs) in these neurons are implicated in this plasticity. However, there is no ultrastructural evidence that the absence of cocaine following repeated administrations affects the critical surface/synaptic availability of AMPAR GluR1 subunits in either DA or non-DA, putative GABAergic neurons within the VTA. To assess this, we used electron microscopic immunolabeling in the VTA of adult male mice sacrificed at 30 minutes or 72 hours after receiving the final of six (15 mg/kg) cocaine injections, a dosing paradigm that resulted in development of locomotor sensitization. At each time point, both cocaine- and saline-injected mice showed AMPAR GluR1 immunogold labeling in somatodendritic profiles, many of which contained immunoperoxidase labeling for the DA-synthesizing enzyme, tyrosine hydroxylase (TH). At 30 minutes after the last injection, when cocaine was systemically present, only the non-TH labeled dendrites showed a significant increase in the synaptic/plasmalemmal density of GluR1 immunogold particles. At 72 hours, when systemic cocaine was depleted, synaptic GluR1 labeling was greatly enhanced in TH-containing dendrites throughout the VTA and in non-TH dendrites of the limbic-associated paranigral VTA. Our results demonstrate that systemic cocaine produces GluR1 trafficking specifically in non-DA neurons of the VTA, which may subsequently contribute to the abstinent-induced enhancement of AMPA receptor synaptic transmission in mesocorticolimbic DA neurons leading to heightened drug seeking behavior. PMID:21215761

  8. Photolysis of Caged Ca2+ But Not Receptor-Mediated Ca2+ Signaling Triggers Astrocytic Glutamate Release

    PubMed Central

    Smith, Nathan A.; Xu, Qiwu; Goldman, Siri; Peng, Weiguo; Huang, Jason H.; Takano, Takahiro; Nedergaard, Maiken

    2013-01-01

    Astrocytes in hippocampal slices can dynamically regulate synaptic transmission in a process mediated by increases in intracellular Ca2+. However, it is debated whether astrocytic Ca2+ signals result in release of glutamate. We here compared astrocytic Ca2+ signaling triggered by agonist exposure versus photolysis side by side. Using transgenic mice in which astrocytes selectively express the MrgA1 receptor, we found that receptor-mediated astrocytic Ca2+ signaling consistently triggered neuronal hyperpolarization and decreased the frequency of miniature excitatory postsynaptic currents (EPSCs). In contrast, photolysis of caged Ca2+ (o-nitrophenyl–EGTA) in astrocytes led to neuronal depolarization and increased the frequency of mEPSCs through a metabotropic glutamate receptor-mediated pathway. Analysis of transgenic mice in which astrocytic vesicular release is suppressed (dominant-negative SNARE mice) and pharmacological manipulations suggested that glutamate is primarily released by opening of anion channels rather than exocytosis. Combined, these studies show that photolysis but not by agonists induced astrocytic Ca2+ signaling triggers glutamate release. PMID:24174673

  9. Cytochemical Organization of the Retino-Suprachiasmatic System

    DTIC Science & Technology

    1994-03-11

    strongly expiessed of the, non-NMDA ionotropic receptors . Other AMPA-preferring receptors , GluR3 and -R4, were also found, but to lesser extent...kainate, and NMDA receptor RN was found in the hypothalamus. GluRi and GluR2 were ang the nmst strongly expressed of the non-NvDA ionotropic receptors ...several different glutamate receptors . The expression of many different types of ionotropic glutamate receptors throughout the hypothalamus suggests that

  10. The association of metabotropic glutamate receptor type 5 with the neuronal Ca2+-binding protein 2 modulates receptor function.

    PubMed

    Canela, Laia; Fernández-Dueñas, Víctor; Albergaria, Catarina; Watanabe, Masahiko; Lluís, Carme; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Luján, Rafael; Ciruela, Francisco

    2009-10-01

    Metabotropic glutamate (mGlu) receptors mediate in part the CNS effects of glutamate. These receptors interact with a large array of intracellular proteins in which the final role is to regulate receptor function. Here, using co-immunoprecipitation and pull-down experiments we showed a close and specific interaction between mGlu(5) receptor and NECAB2 in both transfected human embryonic kidney cells and rat hippocampus. Interestingly, in pull-down experiments increasing concentrations of calcium drastically reduced the ability of these two proteins to interact, suggesting that NECAB2 binds to mGlu(5) receptor in a calcium-regulated manner. Immunoelectron microscopy detection of NECAB2 and mGlu(5) receptor in the rat hippocampal formation indicated that both proteins are codistributed in the same subcellular compartment of pyramidal cells. In addition, the NECAB2/mGlu(5) receptor interaction regulated mGlu(5b)-mediated activation of both inositol phosphate accumulation and the extracellular signal-regulated kinase/mitogen-activated protein kinase pathway. Overall, these findings indicate that NECAB2 by its physical interaction with mGlu(5b) receptor modulates receptor function.

  11. Simultaneous monitoring of presynaptic transmitter release and postsynaptic receptor trafficking reveals an enhancement of presynaptic activity in metabotropic glutamate receptor-mediated long-term depression.

    PubMed

    Xu, Wei; Tse, Yiu Chung; Dobie, Frederick A; Baudry, Michel; Craig, Ann Marie; Wong, Tak Pan; Wang, Yu Tian

    2013-03-27

    Although the contribution of postsynaptic mechanisms to long-term synaptic plasticity has been studied extensively, understanding the contribution of presynaptic modifications to this process lags behind, primarily because of a lack of techniques with which to directly and quantifiably measure neurotransmitter release from synaptic terminals. Here, we developed a method to measure presynaptic activity through the biotinylation of vesicular transporters in vesicles fused with presynaptic membranes during neurotransmitter release. This method allowed us for the first time to selectively quantify the spontaneous or evoked release of glutamate or GABA at their respective synapses. Using this method to investigate presynaptic changes during the expression of group I metabotropic glutamate receptor (mGluR1/5)-mediated long-term depression (LTD) in cultured rat hippocampal neurons, we discovered that this form of LTD was associated with increased presynaptic release of glutamate, despite reduced miniature EPSCs measured with whole-cell recording. Moreover, we found that specific blockade of AMPA receptor (AMPAR) endocytosis with a membrane-permeable GluR2-derived peptide not only prevented the expression of LTD but also eliminated LTD-associated increase in presynaptic release. Thus, our work not only demonstrates that mGluR1/5-mediated LTD is associated with increased endocytosis of postsynaptic AMPARs but also reveals an unexpected homeostatic/compensatory increase in presynaptic release. In addition, this study indicates that biotinylation of vesicular transporters in live cultured neurons is a valuable tool for studying presynaptic function.

  12. Genistein inhibition of OGD-induced brain neuron death correlates with its modulation of apoptosis, voltage-gated potassium and sodium currents and glutamate signal pathway.

    PubMed

    Ma, Xue-Ling; Zhang, Feng; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Liu, Yan-Qiang

    2016-07-25

    In the present study, we established an in vitro model of hypoxic-ischemia via exposing primary neurons of newborn rats to oxygen-glucose deprivation (OGD) and observing the effects of genistein, a soybean isoflavone, on hypoxic-ischemic neuron viability, apoptosis, voltage-activated potassium (Kv) and sodium (Nav) currents, and glutamate receptor subunits. The results indicated that OGD exposure reduced the viability and increased the apoptosis of brain neurons. Meanwhile, OGD exposure caused changes in the current-voltage curves and current amplitude values of voltage-activated potassium and sodium currents; OGD exposure also decreased GluR2 expression and increased NR2 expression. However, genistein at least partially reversed the effects caused by OGD. The results suggest that hypoxic-ischemia-caused neuronal apoptosis/death is related to an increase in K(+) efflux, a decrease in Na(+) influx, a down-regulation of GluR2, and an up-regulation of NR2. Genistein may exert some neuroprotective effects via the modulation of Kv and Nav currents and the glutamate signal pathway, mediated by GluR2 and NR2. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Different pools of glutamate receptors mediate sensitivity to ambient glutamate in the cochlear nucleus.

    PubMed

    Yang, Yang; Xu-Friedman, Matthew A

    2015-06-01

    Ambient glutamate plays an important role in pathological conditions, such as stroke, but its role during normal activity is not clear. In addition, it is not clear how ambient glutamate acts on glutamate receptors with varying affinities or subcellular localizations. To address this, we studied "endbulb of Held" synapses, which are formed by auditory nerve fibers onto bushy cells (BCs) in the anteroventral cochlear nucleus. When ambient glutamate was increased by applying the glutamate reuptake inhibitor TFB-TBOA, BCs depolarized as a result of activation of N-methyl-D-aspartate receptors (NMDARs) and group I metabotropic glutamate receptors (mGluRs). Application of antagonists against NMDARs (in 0 Mg(2+)) or mGluRs caused hyperpolarization, indicating that these receptors were bound by a tonic source of glutamate. AMPA receptors did not show these effects, consistent with their lower glutamate affinity. We also evaluated the subcellular localization of the receptors activated by ambient glutamate. The mGluRs were not activated by synaptic stimulation and thus appear to be exclusively extrasynaptic. By contrast, NMDARs in both synaptic and extrasynaptic compartments were activated by ambient glutamate, as shown using the use-dependent antagonist MK-801. Levels of ambient glutamate appeared to be regulated in a spike-independent manner, and glia likely play a major role. These low levels of ambient glutamate likely have functional consequences, as even low concentrations of TBOA caused significant increases in BC spiking following synaptic stimulation. These results indicate that normal resting potential appears to be poised in the region of maximal sensitivity to small changes in ambient glutamate. Copyright © 2015 the American Physiological Society.

  14. Different pools of glutamate receptors mediate sensitivity to ambient glutamate in the cochlear nucleus

    PubMed Central

    Yang, Yang

    2015-01-01

    Ambient glutamate plays an important role in pathological conditions, such as stroke, but its role during normal activity is not clear. In addition, it is not clear how ambient glutamate acts on glutamate receptors with varying affinities or subcellular localizations. To address this, we studied “endbulb of Held” synapses, which are formed by auditory nerve fibers onto bushy cells (BCs) in the anteroventral cochlear nucleus. When ambient glutamate was increased by applying the glutamate reuptake inhibitor TFB-TBOA, BCs depolarized as a result of activation of N-methyl-d-aspartate receptors (NMDARs) and group I metabotropic glutamate receptors (mGluRs). Application of antagonists against NMDARs (in 0 Mg2+) or mGluRs caused hyperpolarization, indicating that these receptors were bound by a tonic source of glutamate. AMPA receptors did not show these effects, consistent with their lower glutamate affinity. We also evaluated the subcellular localization of the receptors activated by ambient glutamate. The mGluRs were not activated by synaptic stimulation and thus appear to be exclusively extrasynaptic. By contrast, NMDARs in both synaptic and extrasynaptic compartments were activated by ambient glutamate, as shown using the use-dependent antagonist MK-801. Levels of ambient glutamate appeared to be regulated in a spike-independent manner, and glia likely play a major role. These low levels of ambient glutamate likely have functional consequences, as even low concentrations of TBOA caused significant increases in BC spiking following synaptic stimulation. These results indicate that normal resting potential appears to be poised in the region of maximal sensitivity to small changes in ambient glutamate. PMID:25855696

  15. Sequential expression of cyclooxygenase-2, glutamate receptor-2, and platelet activating factor receptor in rat hippocampal neurons after fluid percussion injury

    PubMed Central

    Li, Zhiqiang; Shu, Qingming; Li, Lingzhi; Ge, Maolin; Zhang, Yongliang

    2014-01-01

    Traumatic brain injury causes gene expression changes in different brain regions. Occurrence and development of traumatic brain injury are closely related, involving expression of three factors, namely cyclooxygenase-2, glutamate receptor-2, and platelet activating factor receptor. However, little is known about the correlation of these three factors and brain neuronal injury. In this study, primary cultured rat hippocampal neurons were subjected to fluid percussion injury according to Scott's method, with some modifications. RT-PCR and semi-quantitative immunocytochemical staining was used to measure the expression levels of cyclooxygenase-2, glutamate receptor-2, and platelet activating factor receptor. Our results found that cyclooxygenase-2 expression were firstly increased post-injury, and then decreased. Both mRNA and protein expression levels reached peaks at 8 and 12 hours post-injury, respectively. Similar sequential changes in glutamate receptor 2 were observed, with highest levels mRNA and protein expression at 8 and 12 hours post-injury respectively. On the contrary, the expressions of platelet activating factor receptor were firstly decreased post-injury, and then increased. Both mRNA and protein expression levels reached the lowest levels at 8 and 12 hours post-injury, respectively. Totally, our findings suggest that these three factors are involved in occurrence and development of hippocampal neuronal injury. PMID:25206921

  16. Early continuous white noise exposure alters l-alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor subunit glutamate receptor 2 and gamma-aminobutyric acid type a receptor subunit beta3 protein expression in rat auditory cortex.

    PubMed

    Xu, Jinghong; Yu, Liping; Zhang, Jiping; Cai, Rui; Sun, Xinde

    2010-02-15

    Auditory experience during the postnatal critical period is essential for the normal maturation of auditory function. Previous studies have shown that rearing infant rat pups under conditions of continuous moderate-level noise delayed the emergence of adult-like topographic representational order and the refinement of response selectivity in the primary auditory cortex (A1) beyond normal developmental benchmarks and indefinitely blocked the closure of a brief, critical-period window. To gain insight into the molecular mechanisms of these physiological changes after noise rearing, we studied expression of the AMPA receptor subunit GluR2 and GABA(A) receptor subunit beta3 in the auditory cortex after noise rearing. Our results show that continuous moderate-level noise rearing during the early stages of development decreases the expression levels of GluR2 and GABA(A)beta3. Furthermore, noise rearing also induced a significant decrease in the level of GABA(A) receptors relative to AMPA receptors. However, in adult rats, noise rearing did not have significant effects on GluR2 and GABA(A)beta3 expression or the ratio between the two units. These changes could have a role in the cellular mechanisms involved in the delayed maturation of auditory receptive field structure and topographic organization of A1 after noise rearing. Copyright 2009 Wiley-Liss, Inc.

  17. Ionotropic and metabotropic glutamate receptor structure and pharmacology.

    PubMed

    Kew, James N C; Kemp, John A

    2005-04-01

    L: -Glutamate is the major excitatory neurotransmitter in the central nervous system (CNS) and mediates its actions via activation of both ionotropic and metabotropic receptor families. The development of selective ligands, including competitive agonists and antagonists and positive and negative allosteric modulators, has enabled investigation of the functional roles of glutamate receptor family members. In this review we describe the subunit structure and composition of the ionotropic and metabotropic glutamate receptors and discuss their pharmacology, particularly with respect to selective tools useful for investigation of their function in the CNS. A large number of ligands are now available that are selective either for glutamate receptor subfamilies or for particular receptor subtypes. Such ligands have enabled considerable advances in the elucidation of the physiological and pathophysiological roles of receptor family members. Furthermore, efficacy in animal models of neurological and psychiatric disorders has supported the progression of several glutamatergic ligands into clinical studies. These include ionotropic glutamate receptor antagonists, which have entered clinical trials for disorders including epilepsy and ischaemic stroke, alpha-amino-3-hydroxy-5-methyl-4-isoazolepropionic acid (AMPA) receptor positive allosteric modulators which are under evaluation as cognitive enhancers, and metabotropic glutamate receptor 2 (mGluR2) agonists which are undergoing clinical evaluation as anxiolytics. Furthermore, preclinical studies have illustrated therapeutic potential for ligands selective for other receptor subtypes in various disorders. These include mGluR1 antagonists in pain, mGluR5 antagonists in anxiety, pain and drug abuse and mGluR5 positive allosteric modulators in schizophrenia. Selective pharmacological tools have enabled the study of glutamate receptors. However, pharmacological coverage of the family is incomplete and considerable scope remains

  18. Identification of the kainate receptor subunits underlying modulation of excitatory synaptic transmission in the CA3 region of the hippocampus.

    PubMed

    Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F

    2000-11-15

    To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.

  19. Phenformin suppresses calcium responses to glutamate and protects hippocampal neurons against excitotoxicity.

    PubMed

    Lee, Jaewon; Chan, Sic L; Lu, Chengbiao; Lane, Mark A; Mattson, Mark P

    2002-05-01

    Phenformin is a biguanide compound that can modulate glucose metabolism and promote weight loss and is therefore used to treat patients with type-2 diabetes. While phenformin may indirectly affect neurons by changing peripheral energy metabolism, the possibility that it directly affects neurons has not been examined. We now report that phenformin suppresses responses of hippocampal neurons to glutamate and decreases their vulnerability to excitotoxicity. Pretreatment of embryonic rat hippocampal cell cultures with phenformin protected neurons against glutamate-induced death, which was correlated with reduced calcium responses to glutamate. Immunoblot analyses showed that levels of the N-methyl-d-aspartate (NMDA) subunits NR1 and NR2A were significantly decreased in neurons exposed to phenformin, whereas levels of the AMPA receptor subunit GluR1 were unchanged. Whole-cell patch clamp analyses revealed that NMDA-induced currents were decreased, and AMPA-induced currents were unchanged in neurons pretreated with phenformin. Our data demonstrate that phenformin can protect neurons against excitotoxicity by differentially modulating levels of NMDA receptor subunits in a manner that decreases glutamate-induced calcium influx. These findings show that phenformin can modulate neuronal responses to glutamate, and suggest possible use of phenformin and related compounds in the prevention and/or treatment of neurodegenerative conditions. Copyright 2002 Elsevier Science (USA).

  20. Distribution of Vesicular Glutamate Transporter 2 and Ionotropic Glutamate Receptors in the Auditory Ganglion and Cochlear Nuclei of Pigeons (Columba livia).

    PubMed

    Karim, M R; Atoji, Y

    2016-02-01

    Glutamate is a principal excitatory neurotransmitter in the auditory system. Our previous studies revealed localization of glutamate receptor mRNAs in the pigeon cochlear nuclei, suggesting the existence of glutamatergic input from the auditory nerve to the brainstem. This study demonstrated localization of mRNAs for vesicular glutamate transporter 2 (vGluT2) and ionotropic glutamate receptors (AMPA, kainate and NMDA) in the auditory ganglion (AG) and cochlear nuclei (magnocellular, angular and laminar nuclei). VGluT2 mRNA was intensely expressed in AG and intensely or moderately in the cochlear nuclei. The AG and cochlear nuclei showed intense-to-moderate mRNA signals for GluA2, GluA3, GluA4, GluK4 and GluN1. These results suggest that the pigeon AG neurons receives glutamatergic input from hair cells and in turn projects to the magnocellular and angular nuclei. Glutamate may play a pivotal role in the excitatory synapse transmission in the peripheral auditory pathway of birds. © 2015 Blackwell Verlag GmbH.

  1. Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jin,R.; Clark, S.; Weeks, A.

    2005-01-01

    Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less

  2. Overexpressed Calponin3 by Subsonic Vibration Induces Neural Differentiation of hUC-MSCs by Regulating the Ionotropic Glutamate Receptor.

    PubMed

    Kim, Hyun-Jung; Kim, Jin-Hee; Song, Yeo-Ju; Seo, Young-Kwon; Park, Jung-Keug; Kim, Chan-Wha

    2015-09-01

    In this study, we used proteomics to investigate the effects of sonic vibration (SV) on mesenchymal stem cells derived from human umbilical cords (hUC-MSCs) during neural differentiation to understand how SV enhances neural differentiation of hUC-MSCs. We investigated the levels of gene and protein related to neural differentiation after 3 or 5 days in a group treated with 40-Hz SV. In addition, protein expression patterns were compared between the control and the 40-Hz SV-treated hUC-MSC groups via a proteomic approach. Among these proteins, calponin3 (CNN3) was confirmed to have 299 % higher expression in the 40-Hz SV stimulated hUC-MSCs group than that in the control by Western blotting. Notably, overexpression of CNN3-GFP in Chinese hamster ovary (CHO)-K1 cells had positive effects on the stability and reorganization of F-actin compared with that in GFP-transfected cells. Moreover, CNN3 changed the morphology of the cells by making a neurite-like form. After being subjected to SV, messenger RNA (mRNA) levels of glutamate receptors such as PSD95, GluR1, and NR1 as well as intracellular calcium levels were upregulated. These results suggest that the activity of glutamate receptors increased because of CNN3 characteristics. Taken together, these results demonstrate that overexpressed CNN3 during SV increases expression of glutamate receptors and promotes functional neural differentiation of hUC-MSCs.

  3. Functional ionotropic glutamate receptors on peripheral axons and myelin.

    PubMed

    Christensen, Pia Crone; Welch, Nicole Cheryl; Brideau, Craig; Stys, Peter K

    2016-09-01

    Neurotransmitter-dependent signaling is traditionally restricted to axon terminals. However, receptors are present on myelinating glia, suggesting that chemical transmission may also occur along axons. Confocal microscopy and Ca(2+) -imaging using an axonally expressed FRET-based reporter was used to measure Ca(2+) changes and morphological alterations in myelin in response to stimulation of glutamate receptors. Activation of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) or N-methyl-D-aspartate (NMDA) receptors induced a Ca(2+) increase in axon cylinders. However, only the latter caused structural alterations in axons, despite similar Ca(2+) increases. Myelin morphology was significantly altered by NMDA receptor activation, but not by AMPA receptors. Cu(2+) ions influenced the NMDA receptor-dependent response, suggesting that this metal modulates axonal receptors. Glutamate increased ribosomal signal in Schwann cell cytoplasm. Axon cylinders and myelin of peripheral nervous system axons respond to glutamate, with a consequence being an increase in Schwann cell ribosomes. This may have implications for nerve pathology and regeneration. Muscle Nerve 54: 451-459, 2016. © 2016 Wiley Periodicals, Inc.

  4. Guanosine-5'-monophosphate induces cell death in rat hippocampal slices via ionotropic glutamate receptors activation and glutamate uptake inhibition.

    PubMed

    Molz, Simone; Dal-Cim, Tharine; Tasca, Carla I

    2009-12-01

    Guanine derivatives modulate the glutamatergic system through displacement of binding of glutamate to its receptors acting as antagonist of glutamate receptors in moderate to high micromolar concentrations. Guanosine-5'-monophosphate (GMP) is shown to be neuroprotective against glutamate- or oxygen/glucose deprivation-induced neurotoxicity and also against NMDA-induced apoptosis in hippocampal slices. However, in this study we are showing that high extracellular GMP concentrations (5mM) reduced cell viability in hippocampal brain slices. The toxic effect of GMP was not blocked by dipyridamole, a nucleoside transport inhibitor, nor mimicked by guanosine, suggesting an extracellular mode of action to GMP which does not involve its hydrolysis to guanosine. GMP-dependent cell damage was not blocked by P1 purinergic receptor antagonists, neither altered by adenosine A(1) or A(2A) receptor agonists. The blockage of the ionotropic glutamate receptors AMPA or NMDA, but not KA or metabotropic glutamate receptors, reversed the toxicity induced by GMP. GMP (5mM) induced a decrease in glutamate uptake into hippocampal slices, which was reversed by dl-TBOA. Therefore, GMP-induced hippocampal cell damage involves activation of ionotropic glutamate receptors and inhibition of glutamate transporters activity.

  5. Glutamate Delta-1 Receptor Regulates Metabotropic Glutamate Receptor 5 Signaling in the Hippocampus.

    PubMed

    Suryavanshi, Pratyush S; Gupta, Subhash C; Yadav, Roopali; Kesherwani, Varun; Liu, Jinxu; Dravid, Shashank M

    2016-08-01

    The delta family of ionotropic glutamate receptors consists of glutamate delta-1 (GluD1) and glutamate delta-2 receptors. We have previously shown that GluD1 knockout mice exhibit features of developmental delay, including impaired spine pruning and switch in the N-methyl-D-aspartate receptor subunit, which are relevant to autism and other neurodevelopmental disorders. Here, we identified a novel role of GluD1 in regulating metabotropic glutamate receptor 5 (mGlu5) signaling in the hippocampus. Immunohistochemical analysis demonstrated colocalization of mGlu5 with GluD1 punctas in the hippocampus. Additionally, GluD1 protein coimmunoprecipitated with mGlu5 in the hippocampal membrane fraction, as well as when overexpressed in human embryonic kidney 293 cells, demonstrating that GluD1 and mGlu5 may cooperate in a signaling complex. The interaction of mGlu5 with scaffold protein effector Homer, which regulates mechanistic target of rapamycin (mTOR) signaling, was abnormal both under basal conditions and in response to mGlu1/5 agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) in GluD1 knockout mice. The basal levels of phosphorylated mTOR and protein kinase B, the signaling proteins downstream of mGlu5 activation, were higher in GluD1 knockout mice, and no further increase was induced by DHPG. We also observed higher basal protein translation and an absence of DHPG-induced increase in GluD1 knockout mice. In accordance with a role of mGlu5-mediated mTOR signaling in synaptic plasticity, DHPG-induced internalization of surface α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor subunits was impaired in the GluD1 knockout mice. These results demonstrate that GluD1 interacts with mGlu5, and loss of GluD1 impairs normal mGlu5 signaling potentially by dysregulating coupling to its effector. These studies identify a novel role of the enigmatic GluD1 subunit in hippocampal function. Copyright © 2016 by The American Society for Pharmacology and Experimental

  6. Prostaglandin E(2) stimulates glutamate receptor-dependent astrocyte neuromodulation in cultured hippocampal cells.

    PubMed

    Sanzgiri, R P; Araque, A; Haydon, P G

    1999-11-05

    Recent Ca(2+) imaging studies in cell culture and in situ have shown that Ca(2+) elevations in astrocytes stimulate glutamate release and increase neuronal Ca(2+) levels, and that this astrocyte-neuron signaling can be stimulated by prostaglandin E(2) (PGE(2)). We investigated the electrophysiological consequences of the PGE(2)-mediated astrocyte-neuron signaling using whole-cell recordings on cultured rat hippocampal cells. Focal application of PGE(2) to astrocytes evoked a Ca(2+) elevation in the stimulated cell by mobilizing internal Ca(2+) stores, which further propagated as a Ca(2+) wave to neighboring astrocytes. Whole-cell recordings from neurons revealed that PGE(2) evoked a slow inward current in neurons adjacent to astrocytes. This neuronal response required the presence of an astrocyte Ca(2+) wave and was mediated through both N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptors. Taken together with previous studies, these data demonstrate that PGE(2)-evoked Ca(2+) elevations in astrocyte cause the release of glutamate which activates neuronal ionotropic receptors. Copyright 1999 John Wiley & Sons, Inc.

  7. Activation of NOX2 by the stimulation of ionotropic and metabotropic glutamate receptors contributes to glutamate neurotoxicity in vivo through the production of reactive oxygen species and calpain activation.

    PubMed

    Guemez-Gamboa, Alicia; Estrada-Sánchez, Ana María; Montiel, Teresa; Páramo, Blanca; Massieu, Lourdes; Morán, Julio

    2011-11-01

    Prolonged activation of glutamate receptors leads to excitotoxicity. Several processes such as reactive oxygen species (ROS) production and activation of the calcium-dependent protease, calpain, contribute to glutamate-induced damage. It has been suggested that the ROS-producing enzyme, NADPH oxidase (NOX), plays a role in excitotoxicity. Studies have reported NOX activation after NMDA receptor stimulation during excitotoxic damage, but the role of non-NMDA and metabotropic receptors is unknown. We evaluated the roles of different glutamate receptor subtypes on NOX activation and neuronal death induced by the intrastriatal administration of glutamate in mice. In wild-type mice, NOX2 immunoreactivity in neurons and microglia was stimulated by glutamate administration, and it progressively increased as microglia became activated; calpain activity was also induced. By contrast, mice lacking NOX2 were less vulnerable to excitotoxicity, and there was reduced ROS production and protein nitrosylation, microglial reactivity, and calpain activation. These results suggest that NOX2 is stimulated by glutamate in neurons and reactive microglia through the activation of ionotropic and metabotropic receptors. Neuronal damage involves ROS production by NOX2, which, in turn, contributes to calpain activation.

  8. Role of amino acids in salivation and the localization of their receptors in the rat salivary gland.

    PubMed

    Shida, T; Kondo, E; Ueda, Y; Takai, N; Yoshida, Y; Araki, T; Kiyama, H; Tohyama, M

    1995-11-01

    The distribution of gamma-aminobutyric acid (GABA) receptor subunits such as GABAAR-gamma 1 and GABAAR-gamma 2, and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) type receptor subunits such as GluR-1, GluR-2/3 and GluR-4, and N-methyl-D-aspartic acid (NMDA) type subunits such as NR1 were investigated by immunocytochemistry. Furthermore, the roles of these amino acids, GABA and glutamate, on salivation were analyzed in the rat submandibular and sublingual glands. Some similarities were observed in the distribution patterns of GABAA type receptors and AMPA receptors. In the submandibular ganglion cells, collecting ducts and striated ducts, these subunits were expressed strongly; however, there were some differences in their expression patterns between the submandibular and sublingual gland acinar cells. Since these receptor subunits were expressed in the acinar cell bodies of the submandibular gland, they were not expressed in the acinar cells but were expressed in the myoepithelial cells in the sublingual gland. On the other hand, no NR1 expression was observed. To examine the roles of GABA and glutamate in salivation, the submandibular and sublingual glands were perfused partially with Ringer's solution via a facial artery to avoid systemic influence, and substrates were infused into the perfusion solution. No salivary secretion was evoked by GABA or glutamate infusion in the absence of electrical stimulation (2-3 V, 5 ms, 20 Hz). Salivary flow evoked by electrical stimulation of the chorda-lingual nerve caused significant inhibition by GABA (10(-6), 10(-5), 10(-4) and 10(-3) M) and the GABAAR agonist muscimol 10(-3) and 10(-6) M) (n = 6, P < 0.05). Such GABA-induced inhibition was antagonized by the GABAAR antagonists bicuculline (BCC; 10(-6) and 10(-3) M) and picrotoxin (PTX; 10(-6) and 10(-3) M). On the other hand, salivary flow evoked by electrical stimulation (8-10 V, 5 ms, 20 Hz) of the superior cervical ganglion (SCG) was not affected by

  9. Glutamate-dependent transcriptional regulation in bergmann glia cells: involvement of p38 MAP kinase.

    PubMed

    Zepeda, Rossana C; Barrera, Iliana; Castelán, Francisco; Soto-Cid, Abraham; Hernández-Kelly, Luisa C; López-Bayghen, Esther; Ortega, Arturo

    2008-07-01

    Glutamate (Glu) is the major excitatory neurotransmitter in the Central Nervous System (CNS). Ionotropic and metabotropic glutamate receptors (GluRs) are present in neurons and glial cells and are involved in gene expression regulation. Mitogen-activated proteins kinases (MAPK) are critical for all the membrane to nuclei signaling pathways described so far. In cerebellar Bergmann glial cells, glutamate-dependent transcriptional regulation is partially dependent on p42/44 MAPK activity. Another member of this kinase family, p38 MAPK is activated by non-mitogenic stimuli through its Thr180/Tyr182 phosphorylation and phosphorylates cytoplasmic and nuclear protein targets involved in translational and transcriptional events. Taking into consideration that the role of p38MAPK in glial cells is not well understood, we demonstrate here that glutamate increases p38 MAPK phosphorylation in a time and dose dependent manner in cultured chick cerebellar Bergmann glial cells (BGC). Moreover, p38 MAPK is involved in the glutamate-induced transcriptional activation in these cells. Ionotropic as well as metabotropic glutamate receptors participate in p38 MAPK activation. The present findings demonstrate the involvement of p38 MAPK in glutamate-dependent gene expression regulation in glial cells.

  10. Interaction of medullary P2 and glutamate receptors mediates the vasodilation in the hindlimb of rat.

    PubMed

    Korim, Willian Seiji; Ferreira-Neto, Marcos L; Pedrino, Gustavo R; Pilowsky, Paul M; Cravo, Sergio L

    2012-12-01

    In the nucleus tractus solitarii (NTS) of rats, blockade of extracellular ATP breakdown to adenosine reduces arterial blood pressure (AP) increases that follow stimulation of the hypothalamic defense area (HDA). The effects of ATP on NTS P2 receptors, during stimulation of the HDA, are still unclear. The aim of this study was to determine whether activation of P2 receptors in the NTS mediates cardiovascular responses to HDA stimulation. Further investigation was taken to establish if changes in hindlimb vascular conductance (HVC) elicited by electrical stimulation of the HDA, or activation of P2 receptors in the NTS, are relayed in the rostral ventrolateral medulla (RVLM); and if those responses depend on glutamate release by ATP acting on presynaptic terminals. In anesthetized and paralyzed rats, electrical stimulation of the HDA increased AP and HVC. Blockade of P2 or glutamate receptors in the NTS, with bilateral microinjections of suramin (10 mM) or kynurenate (50 mM) reduced only the evoked increase in HVC by 75 % or more. Similar results were obtained with the blockade combining both antagonists. Blockade of P2 and glutamate receptors in the RVLM also reduced the increases in HVC to stimulation of the HDA by up to 75 %. Bilateral microinjections of kynurenate in the RVLM abolished changes in AP and HVC to injections of the P2 receptor agonist α,β-methylene ATP (20 mM) into the NTS. The findings suggest that HDA-NTS-RVLM pathways in control of HVC are mediated by activation of P2 and glutamate receptors in the brainstem in alerting-defense reactions.

  11. The aniracetam metabolite 2-pyrrolidinone induces a long-term enhancement in AMPA receptor responses via a CaMKII pathway.

    PubMed

    Nishizaki, Tomoyuki; Matsumura, Takuro

    2002-01-31

    The present study was conducted to assess the effect of aniracetam and its metabolites, such as 2-pyrrolidinone, p-anisic acid, and anisamide butyrate, on the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, heteromerically formed of GluR1,2 (GluR1 and GluR2), GluR1,3 (GluR1 and GluR3), and GluR1,2,3 (GluR1, GluR2, and GluR3), expressed in Xenopus oocytes. 2-Pyrrolidinone potentiated kainate-evoked currents through GluR1,2,3 channels in a bell-shaped dose-dependent manner at concentrations ranged from 1 nM to 300 microM, with a maximal effect at 100 microM. The potentiation was long-lasting, reaching approximately 180% of basal levels 60 min after 5-min treatment with 2-pyrrolidinone at 100 microM. 2-Pyrrolidinone (100 microM) potentiated GluR1,3 channel currents as observed in GluR1,2,3, but instead it depressed GluR1,2 currents. Aniracetam and p-anisic acid potentiated GluR1,2,3 channel currents, but to a lesser extent, each about 130 and 103% of basal levels 60 min after treatment at 100 microM. In contrast, anisamide butyrate had no potentiating effect on the currents. Potentiation of GluR1,2,3 channel currents obtained with 2-pyrrolidinone was inhibited by KN-93, a selective inhibitor of calcium/calmodulin-dependent protein kinase (CaMKII), while it was not affected by GF109203X, a selective inhibitor of protein kinase C or H-89, a selective inhibitor of cAMP-dependent protein kinase. The results of the present study suggest that 2-pyrrolidinone persistently enhances activity of the Ca2+-permeable AMPA receptors, GluR1,3 and GluR1,2,3, by interacting with CaMKII.

  12. Functional reconstitution of Drosophila melanogaster NMJ glutamate receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Tae Hee; Dharkar, Poorva; Mayer, Mark L.

    The Drosophila larval neuromuscular junction (NMJ), at which glutamate acts as the excitatory neurotransmitter, is a widely used model for genetic analysis of synapse function and development. Despite decades of study, the inability to reconstitute NMJ glutamate receptor function using heterologous expression systems has complicated the analysis of receptor function, such that it is difficult to resolve the molecular basis for compound phenotypes observed in mutant flies. In this paper, we find that Drosophila Neto functions as an essential component required for the function of NMJ glutamate receptors, permitting analysis of glutamate receptor responses in Xenopus oocytes. Finally, in combinationmore » with a crystallographic analysis of the GluRIIB ligand binding domain, we use this system to characterize the subunit dependence of assembly, channel block, and ligand selectivity for Drosophila NMJ glutamate receptors.« less

  13. Functional reconstitution of Drosophila melanogaster NMJ glutamate receptors

    DOE PAGES

    Han, Tae Hee; Dharkar, Poorva; Mayer, Mark L.; ...

    2015-04-27

    The Drosophila larval neuromuscular junction (NMJ), at which glutamate acts as the excitatory neurotransmitter, is a widely used model for genetic analysis of synapse function and development. Despite decades of study, the inability to reconstitute NMJ glutamate receptor function using heterologous expression systems has complicated the analysis of receptor function, such that it is difficult to resolve the molecular basis for compound phenotypes observed in mutant flies. In this paper, we find that Drosophila Neto functions as an essential component required for the function of NMJ glutamate receptors, permitting analysis of glutamate receptor responses in Xenopus oocytes. Finally, in combinationmore » with a crystallographic analysis of the GluRIIB ligand binding domain, we use this system to characterize the subunit dependence of assembly, channel block, and ligand selectivity for Drosophila NMJ glutamate receptors.« less

  14. Role of group II metabotropic glutamate receptors 2/3 and group I metabotropic glutamate receptor 5 in developing rat medial vestibular nuclei.

    PubMed

    Grassi, Silvarosa; Frondaroli, Adele; Pettorossi, Vito Enrico

    2005-08-22

    In brainstem slices from developing rats, metabotropic glutamate receptors mGluR2/3 and mGluR5 play different inhibitory roles in synaptic transmission and plasticity of the medial vestibular nuclei. The mGluR2/3 block (LY341495) reduces the occurrence of long-term depression after vestibular afferent high frequency stimulation at P8-P10, and increases that of long-term potentiation, while the mGluR5 block prevents high frequency stimulation long-term depression. Later on, the receptor block does not influence high frequency stimulation effects. In addition, while mGluR2/3 agonist (APDC) always provokes a transient reduction of synaptic responses, that of mGluR5 (CHPG) induces long-term depression per se at P8-P10. These results show a key role of mGluR5 in inducing high frequency stimulation long-term depression in developing medial vestibular nuclei, while mGluR2/3 modulate synaptic transmission, probably through presynaptic control of glutamate release.

  15. Cocaine modulates allosteric D2-σ1 receptor-receptor interactions on dopamine and glutamate nerve terminals from rat striatum.

    PubMed

    Beggiato, Sarah; Borelli, Andrea Celeste; Borroto-Escuela, Dasiel; Corbucci, Ilaria; Tomasini, Maria Cristina; Marti, Matteo; Antonelli, Tiziana; Tanganelli, Sergio; Fuxe, Kjell; Ferraro, Luca

    2017-12-01

    The effects of nanomolar cocaine concentrations, possibly not blocking the dopamine transporter activity, on striatal D 2 -σ 1 heteroreceptor complexes and their inhibitory signaling over Gi/o, have been tested in rat striatal synaptosomes and HEK293T cells. Furthermore, the possible role of σ 1 receptors (σ 1 Rs) in the cocaine-provoked amplification of D 2 receptor (D 2 R)-induced reduction of K + -evoked [ 3 H]-DA and glutamate release from rat striatal synaptosomes, has also been investigated. The dopamine D 2 -likeR agonist quinpirole (10nM-1μM), concentration-dependently reduced K + -evoked [ 3 H]-DA and glutamate release from rat striatal synaptosomes. The σ 1 R antagonist BD1063 (100nM), amplified the effects of quinpirole (10 and 100nM) on K + -evoked [ 3 H]-DA, but not glutamate, release. Nanomolar cocaine concentrations significantly enhanced the quinpirole (100nM)-induced decrease of K + -evoked [ 3 H]-DA and glutamate release from rat striatal synaptosomes. In the presence of BD1063 (10nM), cocaine failed to amplify the quinpirole (100nM)-induced effects. In cotransfected σ 1 R and D 2L R HEK293T cells, quinpirole had a reduced potency to inhibit the CREB signal versus D 2L R singly transfected cells. In the presence of cocaine (100nM), the potency of quinpirole to inhibit the CREB signal was restored. In D 2L singly transfected cells cocaine (100nM and 10μM) exerted no modulatory effects on the inhibitory potency of quinpirole to bring down the CREB signal. These results led us to hypothesize the existence of functional D 2 -σ 1 R complexes on the rat striatal DA and glutamate nerve terminals and functional D 2 -σ 1 R-DA transporter complexes on the striatal DA terminals. Nanomolar cocaine concentrations appear to alter the allosteric receptor-receptor interactions in such complexes leading to enhancement of Gi/o mediated D 2 R signaling. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Glutamate Stimulates Local Protein Synthesis in the Axons of Rat Cortical Neurons by Activating α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors and Metabotropic Glutamate Receptors.

    PubMed

    Hsu, Wei-Lun; Chung, Hui-Wen; Wu, Chih-Yueh; Wu, Huei-Ing; Lee, Yu-Tao; Chen, En-Chan; Fang, Weilun; Chang, Yen-Chung

    2015-08-21

    Glutamate is the principal excitatory neurotransmitter in the mammalian CNS. By analyzing the metabolic incorporation of azidohomoalanine, a methionine analogue, in newly synthesized proteins, we find that glutamate treatments up-regulate protein translation not only in intact rat cortical neurons in culture but also in the axons emitting from cortical neurons before making synapses with target cells. The process by which glutamate stimulates local translation in axons begins with the binding of glutamate to the ionotropic AMPA receptors and metabotropic glutamate receptor 1 and members of group 2 metabotropic glutamate receptors on the plasma membrane. Subsequently, the activated mammalian target of rapamycin (mTOR) signaling pathway and the rise in Ca(2+), resulting from Ca(2+) influxes through calcium-permeable AMPA receptors, voltage-gated Ca(2+) channels, and transient receptor potential canonical channels, in axons stimulate the local translation machinery. For comparison, the enhancement effects of brain-derived neurotrophic factor (BDNF) on the local protein synthesis in cortical axons were also studied. The results indicate that Ca(2+) influxes via transient receptor potential canonical channels and activated the mTOR pathway in axons also mediate BDNF stimulation to local protein synthesis. However, glutamate- and BDNF-induced enhancements of translation in axons exhibit different kinetics. Moreover, Ca(2+) and mTOR signaling appear to play roles carrying different weights, respectively, in transducing glutamate- and BDNF-induced enhancements of axonal translation. Thus, our results indicate that exposure to transient increases of glutamate and more lasting increases of BDNF would stimulate local protein synthesis in migrating axons en route to their targets in the developing brain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Glutamate Stimulates Local Protein Synthesis in the Axons of Rat Cortical Neurons by Activating α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors and Metabotropic Glutamate Receptors*

    PubMed Central

    Hsu, Wei-Lun; Chung, Hui-Wen; Wu, Chih-Yueh; Wu, Huei-Ing; Lee, Yu-Tao; Chen, En-Chan; Fang, Weilun; Chang, Yen-Chung

    2015-01-01

    Glutamate is the principal excitatory neurotransmitter in the mammalian CNS. By analyzing the metabolic incorporation of azidohomoalanine, a methionine analogue, in newly synthesized proteins, we find that glutamate treatments up-regulate protein translation not only in intact rat cortical neurons in culture but also in the axons emitting from cortical neurons before making synapses with target cells. The process by which glutamate stimulates local translation in axons begins with the binding of glutamate to the ionotropic AMPA receptors and metabotropic glutamate receptor 1 and members of group 2 metabotropic glutamate receptors on the plasma membrane. Subsequently, the activated mammalian target of rapamycin (mTOR) signaling pathway and the rise in Ca2+, resulting from Ca2+ influxes through calcium-permeable AMPA receptors, voltage-gated Ca2+ channels, and transient receptor potential canonical channels, in axons stimulate the local translation machinery. For comparison, the enhancement effects of brain-derived neurotrophic factor (BDNF) on the local protein synthesis in cortical axons were also studied. The results indicate that Ca2+ influxes via transient receptor potential canonical channels and activated the mTOR pathway in axons also mediate BDNF stimulation to local protein synthesis. However, glutamate- and BDNF-induced enhancements of translation in axons exhibit different kinetics. Moreover, Ca2+ and mTOR signaling appear to play roles carrying different weights, respectively, in transducing glutamate- and BDNF-induced enhancements of axonal translation. Thus, our results indicate that exposure to transient increases of glutamate and more lasting increases of BDNF would stimulate local protein synthesis in migrating axons en route to their targets in the developing brain. PMID:26134564

  18. Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

    1986-11-04

    The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

  19. Therapeutic potential of metabotropic glutamate receptor modulators.

    PubMed

    Hovelsø, N; Sotty, F; Montezinho, L P; Pinheiro, P S; Herrik, K F; Mørk, A

    2012-03-01

    Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson's disease, Alzheimer's disease and pain.

  20. Therapeutic Potential of Metabotropic Glutamate Receptor Modulators

    PubMed Central

    Hovelsø, N; Sotty, F; Montezinho, L.P; Pinheiro, P.S; Herrik, K.F; Mørk, A

    2012-01-01

    Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson’s disease, Alzheimer’s disease and pain. PMID:22942876

  1. Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus

    PubMed Central

    Minbay, Zehra; Kocoglu, Sema Serter; Yurtseven, Duygu Gok; Eyigor, Ozhan

    2017-01-01

    In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus. PMID:28027456

  2. Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus.

    PubMed

    Minbay, Zehra; Serter Kocoglu, Sema; Gok Yurtseven, Duygu; Eyigor, Ozhan

    2017-02-21

    In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus.

  3. Glutamate and Its Receptors as Therapeutic Targets for Migraine.

    PubMed

    Hoffmann, Jan; Charles, Andrew

    2018-04-01

    There is substantial evidence indicating a role for glutamate in migraine. Levels of glutamate are higher in the brain and possibly also in the peripheral circulation in migraine patients, particularly during attacks. Altered blood levels of kynurenines, endogenous modulators of glutamate receptors, have been reported in migraine patients. Population genetic studies implicate genes that are involved with glutamate signaling in migraine, and gene mutations responsible for familial hemiplegic migraine and other familial migraine syndromes may influence glutamate signaling. Animal studies indicate that glutamate plays a key role in pain transmission, central sensitization, and cortical spreading depression. Multiple therapies that target glutamate receptors including magnesium, topiramate, memantine, and ketamine have been reported to have efficacy in the treatment of migraine, although with the exception of topiramate, the evidence for the efficacy of these therapies is not strong. Also, because all of these therapies have other mechanisms of action, it is not possible to conclude that the efficacy of these drugs is entirely due to their effects on glutamate receptors. Further studies are needed to more clearly delineate the possible roles of glutamate and its specific receptor subtypes in migraine and to identify new ways of targeting glutamate for migraine therapy.

  4. L-glutamate Receptor In Paramecium

    NASA Astrophysics Data System (ADS)

    Bernal-Martínez, Juan; Ortega-Soto, Arturo

    2004-09-01

    Behavioral, electrophysiological and biochemical experiments were performed in order to establish the presence of a glutamate receptor in the ciliate Paramecium. It was found that an AMPA/KA receptor is functionally expressed in Paramecium and that this receptor is immunologically and fillogenetically related to the AMPA/KA receptor present in vertebrates.

  5. Modulation of taurine release by glutamate receptors and nitric oxide.

    PubMed

    Oja, S S; Saransaari, P

    2000-11-01

    Taurine is held to function as a modulator and osmoregulator in the central nervous system, being of particular importance in the immature brain. In view of the possible involvement of excitatory pathways in the regulation of taurine function in the brain, the interference of glutamate receptors with taurine release from different tissue preparations in vitro and from the brain in vivo is of special interest. The release of taurine from the brain is enhanced by glutamate receptor agonists. This enhancement is inhibited by the respective receptor antagonists both in vitro and in vivo. The ionotropic N-methyl-D-aspartate (NMDA) and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor agonists appear to be the most effective in enhancing taurine release, their effects being receptor-mediated. Kainate is less effective, particularly in adults. Of the glutamate receptors, the NMDA class seems to be the most susceptible to modulation by nitric oxide. Nitric oxide also modulates taurine release, enhancing the basal release in both immature and mature hippocampus, whereas the K(+)-stimulated release is generally inhibited. Metabotropic glutamate receptors also participate in the regulation of taurine release, group I metabotropic glutamate receptors potentiating the release in the developing hippocampus, while group III receptors may be involved in the adult. Under various cell-damaging conditions, including ischemia, hypoxia and hypoglycemia, taurine release is enhanced, together with an enhanced release of excitatory amino acids. The increase in extracellular taurine upon excessive stimulation of glutamate receptors and under cell-damaging conditions may serve as an important protective mechanism against excitotoxicity, being particularly effective in the immature brain.

  6. Post-Translational Modification Biology of Glutamate Receptors and Drug Addiction

    PubMed Central

    Mao, Li-Min; Guo, Ming-Lei; Jin, Dao-Zhong; Fibuch, Eugene E.; Choe, Eun Sang; Wang, John Q.

    2011-01-01

    Post-translational covalent modifications of glutamate receptors remain a hot topic. Early studies have established that this family of receptors, including almost all ionotropic and metabotropic glutamate receptor subtypes, undergoes active phosphorylation at serine, threonine, or tyrosine residues in their intracellular domains. Recent evidence identifies several glutamate receptor subtypes to be direct substrates for palmitoylation at cysteine residues. Other modifications such as ubiquitination and sumoylation at lysine residues also occur to certain glutamate receptors. These modifications are dynamic and reversible in nature and are regulatable by changing synaptic inputs. The regulated modifications significantly impact the receptor in many ways, including interrelated changes in biochemistry (synthesis, subunit assembling, and protein–protein interactions), subcellular redistribution (trafficking, endocytosis, synaptic delivery, and clustering), and physiology, usually associated with changes in synaptic plasticity. Glutamate receptors are enriched in the striatum and cooperate closely with dopamine to regulate striatal signaling. Emerging evidence shows that modification processes of striatal glutamate receptors are sensitive to addictive drugs, such as psychostimulants (cocaine and amphetamine). Altered modifications are believed to be directly linked to enduring receptor/synaptic plasticity and drug-seeking. This review summarizes several major types of modifications of glutamate receptors and analyzes the role of these modifications in striatal signaling and in the pathogenesis of psychostimulant addiction. PMID:21441996

  7. Intercellular signal communication among odontoblasts and trigeminal ganglion neurons via glutamate.

    PubMed

    Nishiyama, A; Sato, M; Kimura, M; Katakura, A; Tazaki, M; Shibukawa, Y

    2016-11-01

    Various stimuli to the exposed surface of dentin induce changes in the hydrodynamic force inside the dentinal tubules resulting in dentinal pain. Recent evidences indicate that mechano-sensor channels, such as the transient receptor potential channels, in odontoblasts receive these hydrodynamic forces and trigger the release of ATP to the pulpal neurons, to generate dentinal pain. A recent study, however, has shown that odontoblasts also express glutamate receptors (GluRs). This implies that cells in the dental pulp tissue have the ability to release glutamate, which acts as a functional intercellular mediator to establish inter-odontoblast and odontoblast-trigeminal ganglion (TG) neuron signal communication. To investigate the intercellular signal communication, we applied mechanical stimulation to odontoblasts and measured the intracellular free Ca 2+ concentration ([Ca 2+ ] i ). During mechanical stimulation in the presence of extracellular Ca 2+ , we observed a transient [Ca 2+ ] i increase not only in single stimulated odontoblasts, but also in adjacent odontoblasts. We could not observe these responses in the absence of extracellular Ca 2+ . [Ca 2+ ] i increases in the neighboring odontoblasts during mechanical stimulation of single odontoblasts were inhibited by antagonists of metabotropic glutamate receptors (mGluRs) as well as glutamate-permeable anion channels. In the odontoblast-TG neuron coculture, we observed an increase in [Ca 2+ ] i in the stimulated odontoblasts and TG neurons, in response to direct mechanical stimulation of single odontoblasts. These [Ca 2+ ] i increases in the neighboring TG neurons were inhibited by antagonists for mGluRs. The [Ca 2+ ] i increases in the stimulated odontoblasts were also inhibited by mGluRs antagonists. We further confirmed that the odontoblasts express group I, II, and III mGluRs. However, we could not record any currents evoked from odontoblasts near the mechanically stimulated odontoblast, with or without

  8. Novel metabotropic glutamate receptor 4 and glutamate receptor 8 therapeutics for the treatment of anxiety.

    PubMed

    Raber, Jacob; Duvoisin, Robert M

    2015-04-01

    The fast actions of the excitatory neurotransmitter glutamate are mediated by glutamate-gated ion channels (ionotropic Glu receptors). Metabotropic glutamate receptors (mGlus) are coupled to second messenger pathways via G proteins and modulate glutamatergic and GABAergic neurotransmission. Of the eight different types of mGlus (mGlu1-mGlu8), mGlu4, mGlu6, mGlu7 and mGlu8 are members of group III. Except for mGlu6, group III receptors are generally located presynaptically and regulate neurotransmitter release. Because of their role in modulating excitatory neurotransmission, mGlus are attractive targets for therapies aimed at treating anxiety disorders. In this review, the authors discuss the role of mGlu4 and mGlu8 in anxiety disorders. They also discuss how mGlu4 and mGlu8 have distinct expression patterns in the brain, which might have related functions. Finally, the authors discuss how compounds that target more than one mGlu receptor might be therapeutically more effective. mGlu4 might compensate for mGlu8 deficiency, and deficiency of both receptors might result in a more pronounced phenotype than deficiency of either receptor alone. The distinct and overlapping anatomical distribution and functions of mGlu4 and mGlu8 suggest that both receptors, either individually or combined, are attractive therapeutic targets in anxiety disorders, post-traumatic stress disorder, Parkinson's disease, and multiple sclerosis.

  9. Costimulation of AMPA and metabotropic glutamate receptors underlies phospholipase C activation by glutamate in hippocampus.

    PubMed

    Kim, Hye-Hyun; Lee, Kyu-Hee; Lee, Doyun; Han, Young-Eun; Lee, Suk-Ho; Sohn, Jong-Woo; Ho, Won-Kyung

    2015-04-22

    Glutamate, a major neurotransmitter in the brain, activates ionotropic and metabotropic glutamate receptors (iGluRs and mGluRs, respectively). The two types of glutamate receptors interact with each other, as exemplified by the modulation of iGluRs by mGluRs. However, the other way of interaction (i.e., modulation of mGluRs by iGluRs) has not received much attention. In this study, we found that group I mGluR-specific agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) alone is not sufficient to activate phospholipase C (PLC) in rat hippocampus, while glutamate robustly activates PLC. These results suggested that additional mechanisms provided by iGluRs are involved in group I mGluR-mediated PLC activation. A series of experiments demonstrated that glutamate-induced PLC activation is mediated by mGluR5 and is facilitated by local Ca(2+) signals that are induced by AMPA-mediated depolarization and L-type Ca(2+) channel activation. Finally, we found that PLC and L-type Ca(2+) channels are involved in hippocampal mGluR-dependent long-term depression (mGluR-LTD) induced by paired-pulse low-frequency stimulation, but not in DHPG-induced chemical LTD. Together, we propose that AMPA receptors initiate Ca(2+) influx via the L-type Ca(2+) channels that facilitate mGluR5-PLC signaling cascades, which underlie mGluR-LTD in rat hippocampus. Copyright © 2015 the authors 0270-6474/15/356401-12$15.00/0.

  10. PICK1 interacts with ABP/GRIP to regulate AMPA receptor trafficking.

    PubMed

    Lu, Wei; Ziff, Edward B

    2005-08-04

    PICK1 and ABP/GRIP bind to the AMPA receptor (AMPAR) GluR2 subunit C terminus. Transfer of the receptor from ABP/GRIP to PICK1, facilitated by GluR2 S880 phosphorylation, may initiate receptor trafficking. Here we report protein interactions that regulate these steps. The PICK1 BAR domain interacts intermolecularly with the ABP/GRIP linker II region and intramolecularly with the PICK1 PDZ domain. Binding of PKCalpha or GluR2 to the PICK1 PDZ domain disrupts the intramolecular interaction and facilitates the PICK1 BAR domain association with ABP/GRIP. Interference with the PICK1-ABP/GRIP interaction impairs S880 phosphorylation of GluR2 by PKC and decreases the constitutive surface expression of GluR2, the NMDA-induced endocytosis of GluR2, and recycling of internalized GluR2. We suggest that the PICK1 interaction with ABP/GRIP is a critical step in controlling GluR2 trafficking.

  11. Genetic analysis of neuronal ionotropic glutamate receptor subunits

    PubMed Central

    Granger, Adam J; Gray, John A; Lu, Wei; Nicoll, Roger A

    2011-01-01

    Abstract In the brain, fast, excitatory synaptic transmission occurs primarily through AMPA- and NMDA-type ionotropic glutamate receptors. These receptors are composed of subunit proteins that determine their biophysical properties and trafficking behaviour. Therefore, determining the function of these subunits and receptor subunit composition is essential for understanding the physiological properties of synaptic transmission. Here, we discuss and evaluate various genetic approaches that have been used to study AMPA and NMDA receptor subunits. These approaches have demonstrated that the GluA1 AMPA receptor subunit is required for activity-dependent trafficking and contributes to basal synaptic transmission, while the GluA2 subunit regulates Ca2+ permeability, homeostasis and trafficking to the synapse under basal conditions. In contrast, the GluN2A and GluN2B NMDA receptor subunits regulate synaptic AMPA receptor content, both during synaptic development and plasticity. Ongoing research in this field is focusing on the molecular interactions and mechanisms that control these functions. To accomplish this, molecular replacement techniques are being used, where native subunits are replaced with receptors containing targeted mutations. In this review, we discuss a single-cell molecular replacement approach which should arguably advance our physiological understanding of ionotropic glutamate receptor subunits, but is generally applicable to study of any neuronal protein. PMID:21768264

  12. Genetic analysis of neuronal ionotropic glutamate receptor subunits.

    PubMed

    Granger, Adam J; Gray, John A; Lu, Wei; Nicoll, Roger A

    2011-09-01

    In the brain, fast, excitatory synaptic transmission occurs primarily through AMPA- and NMDA-type ionotropic glutamate receptors. These receptors are composed of subunit proteins that determine their biophysical properties and trafficking behaviour. Therefore, determining the function of these subunits and receptor subunit composition is essential for understanding the physiological properties of synaptic transmission. Here, we discuss and evaluate various genetic approaches that have been used to study AMPA and NMDA receptor subunits. These approaches have demonstrated that the GluA1 AMPA receptor subunit is required for activity-dependent trafficking and contributes to basal synaptic transmission, while the GluA2 subunit regulates Ca(2+) permeability, homeostasis and trafficking to the synapse under basal conditions. In contrast, the GluN2A and GluN2B NMDA receptor subunits regulate synaptic AMPA receptor content, both during synaptic development and plasticity. Ongoing research in this field is focusing on the molecular interactions and mechanisms that control these functions. To accomplish this, molecular replacement techniques are being used, where native subunits are replaced with receptors containing targeted mutations. In this review, we discuss a single-cell molecular replacement approach which should arguably advance our physiological understanding of ionotropic glutamate receptor subunits, but is generally applicable to study of any neuronal protein.

  13. Moclobemide attenuates anoxia and glutamate-induced neuronal damage in vitro independently of interaction with glutamate receptor subtypes.

    PubMed

    Verleye, Marc; Steinschneider, Remy; Bernard, François Xavier; Gillardin, Jean-Marie

    2007-03-23

    Recent data suggested the existence of a bidirectional relation between depression and neurodegenerative diseases resulting from cerebral ischemia injury. Glutamate, a major excitatory neurotransmitter, has long been recognised to play a key role in the pathophysiology of anoxia or ischemia, due to its excessive accumulation in the extracellular space and the subsequent activation of its receptors. A characteristic response to glutamate is the increase in cytosolic Na(+) and Ca(2+) levels which is due mainly to influx from the extracellular space, with a consequent cell swelling and oxidative metabolism dysfunction. The present study examined the in vitro effects of the antidepressant and type-A monoamine oxidase inhibitor, moclobemide, in neuronal-astroglial cultures from rat cerebral cortex exposed to anoxia (for 5 and 7 h) or to glutamate (2 mM for 6 h), two in vitro models of brain ischemia. In addition, the affinity of moclobemide for the different glutamate receptor subtypes and an interaction with the cell influx of Na(+) and of Ca(2+) enhanced by veratridine and K(+) excess, respectively, were evaluated. Moclobemide (10-100 microM) included in the culture medium during anoxia or with glutamate significantly increased in a concentration-dependent manner the amount of surviving neurons compared to controls. Moclobemide displayed no binding affinity for the different glutamate receptor subtypes (IC(50)>100 microM) and did not block up to 300 microM the entry of Na(+) and of Ca(2+) activated by veratridine and K(+), respectively. These results suggest that the neuroprotective properties of moclobemide imply neither the glutamate neurotransmission nor the Na(+) and Ca(2+) channels.

  14. Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice.

    PubMed

    Pandey, Surya P; Singh, Hemant K; Prasad, S

    2015-01-01

    Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications.

  15. Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice

    PubMed Central

    Pandey, Surya P.; Singh, Hemant K.; Prasad, S.

    2015-01-01

    Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications. PMID:26161865

  16. Modulation of group II metabotropic glutamate receptor (mGlu2) elicits common changes in rat and mice sleep-wake architecture.

    PubMed

    Ahnaou, Abdellah; Dautzenberg, Frank M; Geys, Helena; Imogai, Hassan; Gibelin, Antoine; Moechars, Dieder; Steckler, Thomas; Drinkenburg, Wilhelmus H I M

    2009-01-28

    Compiling pharmacological evidence implicates metabotropic glutamate mGlu(2) receptors in the regulation of emotional states and suggests positive modulators as a novel therapeutic approach of Anxiety/Depression and Schizophrenia. Here, we investigated subcutaneous effects of the metabotropic glutamate mGlu(2/3) agonist (LY354740) on sleep-wake architecture in rat. To confirm the specific effects on rapid eye movement (REM) sleep were mediated via metabotropic glutamate mGlu(2) receptors, we characterized the sleep-wake cycles in metabotropic glutamate mGlu(2) receptor deficient mice (mGlu(2)R(-/-)) and their arousal response to LY354740. We furthermore examined effects on sleep behavior in rats of the positive allosteric modulator, biphenyl-indanone A (BINA) alone and in combination with LY354740 at sub-effective doses. LY354740 (1, 3 and 10 mg/kg) dose-dependently suppressed REM sleep and prolonged its onset latency. Metabotropic glutamate mGlu(2)R(-/-) and their wild type (WT) littermates exhibited similar spontaneous sleep-wake phenotype, while LY354740 (10 mg/kg) significantly affected REM sleep variables in WT but not in the mutant. In rats, BINA (1, 3, 10, 20, 40 mg/kg) dose-dependently suppressed REM sleep, lengthened its onset latency and slightly enhanced passive waking. Additionally, combined treatment elicited a synergistic action on REM sleep variables. Our findings show common changes of REM sleep variables following modulation of metabotropic glutamate mGlu(2) receptor and support an active role of this receptor in the regulation of REM sleep. The synergistic action of BINA on LY354740's effects on sleep pattern implies that positive modulators would tune the endogenous glutamate tone suggesting potential benefit in the treatment of psychiatric disorders, in which REM sleep overdrive is manifested.

  17. Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation

    PubMed Central

    Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.

    2009-01-01

    Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838

  18. The utility of ionotropic glutamate receptor antagonists in the treatment of nociception induced by epidural glutamate infusion in rats.

    PubMed

    Osgood, Doreen B; Harrington, William F; Kenney, Elizabeth V; Harrington, J Frederick

    2013-01-01

    The authors have previously demonstrated that human herniated disc material contains high concentrations of free glutamate. In an experimental model, elevated epidural glutamate concentrations in the lumbar spine can cause a focal hyperesthetic state. Rats underwent epidural glutamate infusion in the lumbar spine by a miniosmotic pump over a 72-hour period. Some rats underwent coinfusion with glutamate and ionotropic glutamate antagonists. Nociception was assessed by von Frey fibers and by assessment of glutamate receptor expression in the corresponding dorsal horn of the spinal cord. The kainic acid antagonist, UBP 301, decreased epidural glutamate-based hyperesthesia in a dose dependent manner. Concordant with these findings, there was significant decrease in kainate receptor expression in the dorsal horn. The N-Methyl-4-isoxazoleproionic acid (NMDA) antagonist Norketamine also significantly diminished hyperesthesia and decreased receptor expression in the dorsal horn. Both UBP 301, the kainic acid receptor antagonist and Norketamine, an NMDA receptor antagonist, dampened epidural glutamate-based nociception. Focal epidural injections of Kainate or NMDA receptor antagonists could be effective treatments for disc herniation-based lumbar radiculopathy.

  19. A modern ionotropic glutamate receptor with a K(+) selectivity signature sequence.

    PubMed

    Janovjak, H; Sandoz, G; Isacoff, E Y

    2011-01-01

    Glutamate is the major excitatory neurotransmitter in the mammalian central nervous system and gates non-selective cation channels. The origins of glutamate receptors are not well understood as they differ structurally and functionally from simple bacterial ligand-gated ion channels. Here we report the discovery of an ionotropic glutamate receptor that combines the typical eukaryotic domain architecture with the 'TXVGYG' signature sequence of the selectivity filter found in K(+) channels. This receptor exhibits functional properties intermediate between bacterial and eukaryotic glutamate-gated ion channels, suggesting a link in the evolution of ionotropic glutamate receptors.

  20. Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.

    PubMed

    Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

    2016-10-01

    In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK.

  1. Metabotropic Glutamate Receptors for Parkinson's Disease Therapy

    PubMed Central

    Gasparini, Fabrizio; Di Paolo, Thérèse; Gomez-Mancilla, Baltazar

    2013-01-01

    Excessive glutamatergic signalling within the basal ganglia is implicated in the progression of Parkinson's disease (PD) and inthe emergence of dyskinesia associated with long-term treatment with L-DOPA. There is considerable research focus on the discovery and development of compounds that modulate glutamatergic signalling via glutamate receptors, as treatments for PD and L-DOPA-induced dyskinesia (LID). Although initial preclinical studies with ionotropic glutamate receptor antagonists showed antiparkinsonian and antidyskinetic activity, their clinical use was limited due to psychiatric adverse effects, with the exception of amantadine, a weak N-methyl-d-aspartate (NMDA) antagonist, currently used to reduce dyskinesia in PD patients. Metabotropic receptor (mGlu receptor) modulators were considered to have a more favourable side-effect profile, and several agents have been studied in preclinical models of PD. The most promising results have been seen clinically with selective antagonists of mGlu5 receptor and preclinically with selective positive allosteric modulators of mGlu4 receptor. The growing understanding of glutamate receptor crosstalk also raises the possibility of more precise modulation of glutamatergic transmission, which may lead to the development of more effective agents for PD. PMID:23853735

  2. The SOL-2/Neto Auxiliary Protein Modulates the Function of AMPA-Subtype Ionotropic Glutamate Receptors

    PubMed Central

    Wang, Rui; Mellem, Jerry E.; Jensen, Michael; Brockie, Penelope J.; Walker, Craig S.; Hoerndli, Frédéric J.; Madsen, David M.; Maricq, Andres V.

    2012-01-01

    Summary The neurotransmitter glutamate mediates excitatory synaptic transmission by gating ionotropic glutamate receptors (iGluRs). AMPA receptors (AMPARs), a subtype of iGluR, are strongly implicated in synaptic plasticity, learning and memory. We previously discovered two classes of AMPAR auxiliary proteins in C. elegans that modify receptor kinetics and thus change synaptic transmission. Here, we have identified another auxiliary protein, SOL-2, a CUB-domain protein that associates with both the related auxiliary subunit SOL-1 and with the GLR-1 AMPAR. In sol-2 mutants, behaviors dependent on glutamatergic transmission are disrupted, GLR-1-mediated currents are diminished, and GLR-1 desensitization and pharmacology are modified. Remarkably, a secreted variant of SOL-1 delivered in trans can rescue sol-1 mutants and this rescue depends on in cis expression of SOL-2. Finally, we demonstrate that SOL-1 and SOL-2 have an ongoing role in the adult nervous system to control AMPAR-mediated currents. PMID:22958824

  3. The SOL-2/Neto auxiliary protein modulates the function of AMPA-subtype ionotropic glutamate receptors.

    PubMed

    Wang, Rui; Mellem, Jerry E; Jensen, Michael; Brockie, Penelope J; Walker, Craig S; Hoerndli, Frédéric J; Hauth, Linda; Madsen, David M; Maricq, Andres V

    2012-09-06

    The neurotransmitter glutamate mediates excitatory synaptic transmission by gating ionotropic glutamate receptors (iGluRs). AMPA receptors (AMPARs), a subtype of iGluR, are strongly implicated in synaptic plasticity, learning, and memory. We previously discovered two classes of AMPAR auxiliary proteins in C. elegans that modify receptor kinetics and thus change synaptic transmission. Here, we have identified another auxiliary protein, SOL-2, a CUB-domain protein that associates with both the related auxiliary subunit SOL-1 and with the GLR-1 AMPAR. In sol-2 mutants, behaviors dependent on glutamatergic transmission are disrupted, GLR-1-mediated currents are diminished, and GLR-1 desensitization and pharmacology are modified. Remarkably, a secreted variant of SOL-1 delivered in trans can rescue sol-1 mutants, and this rescue depends on in cis expression of SOL-2. Finally, we demonstrate that SOL-1 and SOL-2 have an ongoing role in the adult nervous system to control AMPAR-mediated currents. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. A Molecular Determinant of Subtype-Specific Desensitization in Ionotropic Glutamate Receptors.

    PubMed

    Alsaloum, Matthew; Kazi, Rashek; Gan, Quan; Amin, Johansen; Wollmuth, Lonnie P

    2016-03-02

    AMPA and NMDA receptors are glutamate-gated ion channels that mediate fast excitatory synaptic transmission throughout the nervous system. In the continual presence of glutamate, AMPA and NMDA receptors containing the GluN2A or GluN2B subunit enter into a nonconducting, desensitized state that can impact synaptic responses and glutamate-mediated excitotoxicity. The process of desensitization is dramatically different between subtypes, but the basis for these differences is unknown. We generated an extensive sequence alignment of ionotropic glutamate receptors (iGluRs) from diverse animal phyla and identified a highly conserved motif, which we termed the "hydrophobic box," located at the extracellular interface of transmembrane helices. A single position in the hydrophobic box differed between mammalian AMPA and NMDA receptors. Surprisingly, we find that an NMDAR-to-AMPAR exchange mutation at this position in the rat GluN2A or GluN2B subunit had a dramatic and highly specific effect on NMDAR desensitization, making it AMPAR-like. In contrast, a reverse exchange mutation in AMPARs had minimal effects on desensitization. These experiments highlight differences in desensitization between iGluR subtypes and the highly specific contribution of the GluN2 subunit to this process. Rapid communication between cells in the nervous system depends on ion channels that are directly activated by neurotransmitter molecules. Here, we studied ionotropic glutamate receptors (iGluRs), which are ion channels activated by the neurotransmitter glutamate. By comparing the sequences of a vast number of iGluR proteins from diverse animal species, assisted by available structural information, we identified a highly conserved motif. We showed that a single amino acid difference in this motif between mammalian iGluR subtypes has dramatic effects on receptor function. These results have implications in both the evolution of synaptic function, as well as the role of iGluRs in health and disease

  5. Rapidly progressive neurological deterioration in anti-AMPA receptor encephalitis with additional CRMP5 antibodies.

    PubMed

    Yang, Shuangshuang; Qin, Jie; Li, Jinghong; Gao, Yuan; Zhao, Lu; Wu, Jun; Song, Bo; Xu, Yuming; Sun, Shilei

    2016-11-01

    Anti-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) encephalitis positive for additional onconeural antibodies is rarely reported. Here we report the clinical features of a patient who developed limbic encephalitis with both glutamate receptor 2 (GluR2) and collapsin response mediator protein 5 (CRMP5) antibodies. Brain magnetic resonance imaging revealed multifocal encephalopathy. Chest computed tomography showed a highly suspicious malignant thymoma. He experienced rapid neurological deterioration during hospitalization. This report indicates that the clinical diversity of anti-AMPAR encephalitis and the presence of onconeural antibodies may lead to poor prognosis.

  6. Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila

    PubMed Central

    Benton, Richard; Vannice, Kirsten S.; Gomez-Diaz, Carolina; Vosshall, Leslie B.

    2009-01-01

    Summary Ionotropic glutamate receptors (iGluRs) mediate neuronal communication at synapses throughout vertebrate and invertebrate nervous systems. We have characterized a novel family of iGluR-related genes in Drosophila, which we name Ionotropic Receptors (IRs). These receptors do not belong to the well-described Kainate, AMPA, or NMDA classes of iGluRs, and have divergent ligand-binding domains that lack their characteristic glutamate-interacting residues. IRs are expressed in a combinatorial fashion in sensory neurons that respond to many distinct odors but do not express either insect odorant receptors (ORs) or gustatory receptors (GRs). IR proteins accumulate in sensory dendrites and not at synapses. Mis-expression of IRs induces novel odor responses in ectopic neurons. Together, these results lead us to propose that the IRs comprise a novel family of chemosensory receptors. Conservation of IR/iGluR-related proteins in bacteria, plants, and animals suggests that this receptor family represents an evolutionarily ancient mechanism for sensing both internal and external chemical cues. PMID:19135896

  7. Ligands for Ionotropic Glutamate Receptors

    PubMed Central

    Swanson, Geoffrey T.; Sakai, Ryuichi

    2010-01-01

    Marine-derived small molecules and peptides have played a central role in elaborating pharmacological specificities and neuronal functions of mammalian ionotropic glutamate receptors (iGluRs), the primary mediators of excitatory synaptic transmission in the central nervous system (CNS). As well, the pathological sequelae elicited by one class of compounds (the kainoids) constitute a widely-used animal model for human mesial temporal lobe epilepsy (mTLE). New and existing molecules could prove useful as lead compounds for the development of therapeutics for neuropathologies that have aberrant glutamatergic signaling as a central component. In this chapter we discuss natural source origins and pharmacological activities of those marine compounds that target ionotropic glutamate receptors. PMID:19184587

  8. Ligands for Ionotropic Glutamate Receptors

    NASA Astrophysics Data System (ADS)

    Swanson, Geoffrey T.; Sakai, Ryuichi

    Marine-derived small molecules and peptides have played a central role in elaborating pharmacological specificities and neuronal functions of mammalian ionotropic glutamate receptors (iGluRs), the primary mediators of excitatory syn-aptic transmission in the central nervous system (CNS). As well, the pathological sequelae elicited by one class of compounds (the kainoids) constitute a widely-used animal model for human mesial temporal lobe epilepsy (mTLE). New and existing molecules could prove useful as lead compounds for the development of therapeutics for neuropathologies that have aberrant glutamatergic signaling as a central component. In this chapter we discuss natural source origins and pharmacological activities of those marine compounds that target ionotropic glutamate receptors.

  9. Ubiquitin-dependent trafficking and turnover of ionotropic glutamate receptors

    PubMed Central

    Goo, Marisa S.; Scudder, Samantha L.; Patrick, Gentry N.

    2015-01-01

    Changes in synaptic strength underlie the basis of learning and memory and are controlled, in part, by the insertion or removal of AMPA-type glutamate receptors at the postsynaptic membrane of excitatory synapses. Once internalized, these receptors may be recycled back to the plasma membrane by subunit-specific interactions with other proteins or by post-translational modifications such as phosphorylation. Alternatively, these receptors may be targeted for destruction by multiple degradation pathways in the cell. Ubiquitination, another post-translational modification, has recently emerged as a key signal that regulates the recycling and trafficking of glutamate receptors. In this review, we will discuss recent findings on the role of ubiquitination in the trafficking and turnover of ionotropic glutamate receptors and plasticity of excitatory synapses. PMID:26528125

  10. Metabotropic glutamate receptors are required for the induction of long-term potentiation

    NASA Technical Reports Server (NTRS)

    Zheng, F.; Gallagher, J. P.

    1992-01-01

    Recent observations have led to the suggestion that the metabotropic glutamate receptor may play a role in the induction or maintenance of long-term potentiation (LTP). However, experimental evidence supporting a role for this receptor in the induction of LTP is still inconclusive and controversial. Here we report that, in rat dorsolateral septal nucleus (DLSN) neurons, which have the highest density of metabotropic receptors and show functional responses, the induction of LTP is not blocked by the NMDA receptor antagonist 2-amino-5-phosphonovalerate, but is blocked by two putative metabotropic glutamate receptor antagonists, L-2-amino-3-phosphonopropionic acid and L-2-amino-4-phosphonobutyrate. Furthermore, superfusion of (1S,3R)-1-aminocyclopentane-1,3-dicarboxylic acid, a selective metabotropic glutamate agonist, resulted in a long-lasting potentiation of synaptic transmission similar to that induced by tetanic stimuli. Our results demonstrated that activation of postsynaptic metabotropic receptors is both necessary and sufficient for the induction of LTP in the DLSN, and we suggest that such a mechanism may be important at other CNS synapses.

  11. Opiate withdrawal induces dynamic expressions of AMPA receptors and its regulatory molecule CaMKIIalpha in hippocampal synapses.

    PubMed

    Zhong, Weixia; Dong, Zhifang; Tian, Meng; Cao, Jun; Xu, Tianle; Xu, Lin; Luo, Jianhong

    2006-07-24

    Adaptive changes in brain areas following drug withdrawal are believed to contribute to drug seeking and relapse. Cocaine withdrawal alters the expression of GluR1 and GluR2/3 subunits of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors in nucleus accumbens or amygdala, but the influence of drug withdrawal on hippocampus is little known. Here, we have examined the expression of GluR1 and GluR2/3 in hippocampal membrane and synaptic fractions following repeated morphine exposure and subsequent withdrawal. Repeated morphine exposure for 12 d increased GluR1 and GluR2/3 in synaptosome but not in membrane fraction. Interestingly, CaMKIIalpha, known to be able to regulate the function of AMPA receptors, was decreased in synaptosome but not in membrane fraction; pCaMKIIalpha, the phosphorylated form of CaMKIIalpha, was increased in both fractions. However, during opiate withdrawal, GluR1 was generally reduced while GluR2/3 was prominently increased in both fractions; pCaMKIIalpha was strongly decreased immediately after withdrawal, but detectably increased in late phase of morphine withdrawal in both fractions. Importantly, the opiate withdrawal-induced increase in GluR2/3 was dependent on the activation of glucocorticoid receptors and NMDA receptors, as it was prevented by the glucocorticoid receptor antagonist RU38486, or intrahippocampal injection of the NMDA receptor antagonist AP-5 or the antagonist to NR2B-containing NMDA receptors, Ro25-6981. These findings indicate that opiate withdrawal induces dynamic expression of GluR1 and GluR2/3 subunits of AMPA receptors in hippocampal synapses, possibly revealing an adaptive process of the hippocampal functions following opiate withdrawal.

  12. Tolerance to LSD and DOB induced shaking behaviour: differential adaptations of frontocortical 5-HT(2A) and glutamate receptor binding sites.

    PubMed

    Buchborn, Tobias; Schröder, Helmut; Dieterich, Daniela C; Grecksch, Gisela; Höllt, Volker

    2015-03-15

    Serotonergic hallucinogens, such as lysergic acid diethylamide (LSD) and dimethoxy-bromoamphetamine (DOB), provoke stereotype-like shaking behaviour in rodents, which is hypothesised to engage frontocortical glutamate receptor activation secondary to serotonin2A (5-HT2A) related glutamate release. Challenging this hypothesis, we here investigate whether tolerance to LSD and DOB correlates with frontocortical adaptations of 5-HT2A and/or overall-glutamate binding sites. LSD and DOB (0.025 and 0.25 mg/kg, i.p.) induce a ketanserin-sensitive (0.5 mg/kg, i.p., 30-min pretreatment) increase in shaking behaviour (including head twitches and wet dog shakes), which with repeated application (7× in 4 ds) is undermined by tolerance. Tolerance to DOB, as indexed by DOB-sensitive [(3)H]spiroperidol and DOB induced [(35)S]GTP-gamma-S binding, is accompanied by a frontocortical decrease in 5-HT2A binding sites and 5-HT2 signalling, respectively; glutamate-sensitive [(3)H]glutamate binding sites, in contrast, remain unchanged. As to LSD, 5-HT2 signalling and 5-HT2A binding, respectively, are not or only marginally affected, yet [(3)H]glutamate binding is significantly decreased. Correlation analysis interrelates tolerance to DOB to the reduced 5-HT2A (r=.80) as well as the unchanged [(3)H]glutamate binding sites (r=.84); tolerance to LSD, as opposed, shares variance with the reduction in [(3)H]glutamate binding sites only (r=.86). Given that DOB and LSD both induce tolerance, one correlating with 5-HT2A, the other with glutamate receptor adaptations, it might be inferred that tolerance can arise at either level. That is, if a hallucinogen (like LSD in our study) fails to induce 5-HT2A (down-)regulation, glutamate receptors (activated postsynaptic to 5-HT2A related glutamate release) might instead adapt and thus prevent further overstimulation of the cortex. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Glutamate receptor 1 phosphorylation at serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability after early life seizures.

    PubMed

    Rakhade, Sanjay N; Fitzgerald, Erin F; Klein, Peter M; Zhou, Chengwen; Sun, Hongyu; Huganir, Richard L; Hunganir, Richard L; Jensen, Frances E

    2012-12-05

    Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We showed previously that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of serine-831 (S831) and Serine 845 (S845) sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced posttranslational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild-type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation [GluR1 double-phosphomutant (GluR1 DPM) mice]. Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex after a single episode of pentyleneterazol-induced seizures in postnatal day 7 (P7) wild-type mouse pups and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild-type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex and were associated with enhanced seizure susceptibility to later-life kainic-acid-induced seizures. In contrast, later-life seizure susceptibility after hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for posttranslational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue.

  14. Ionotropic and metabotropic glutamate receptor antagonism attenuates cue-induced cocaine seeking.

    PubMed

    Bäckström, Pia; Hyytiä, Petri

    2006-04-01

    Neuroanatomical and pharmacological evidence implicates glutamate transmission in drug-environment conditioning that partly controls drug seeking and relapse. Glutamate receptors could be targets for pharmacological attenuation of the motivational properties of drug-paired cues and for relapse prevention. The purpose of the present study was therefore to investigate the involvement of ionotropic and metabotropic glutamate receptor subtypes in cue-induced reinstatement of cocaine-seeking behavior. Rats were trained to self-administer cocaine using a second-order schedule of reinforcement (FR4(FR5:S)) under which a compound stimulus (light and tone) associated with cocaine infusions was presented contingently. Following extinction, the effects of the competitive NMDA receptor antagonist CGP 39551 (0, 2.5, 5, 10 mg/kg intraperitoneally (i.p.)), two competitive AMPA/kainate antagonists, CNQX (0, 0.75, 1.5, 3 mg/kg i.p.) and NBQX (0, 1.25, 2.5, 5 mg/kg i.p.), the NMDA/glycine site antagonist L-701,324 (0, 0.63, 1.25, 2.5 mg/kg i.p.), and the mGluR5 antagonist MPEP (0, 1.25, 2.5, 5 mg/kg i.p.) on cue-induced reinstatement of cocaine seeking were examined. The AMPA/kainate receptor antagonists CNQX and NBQX, the NMDA/glycine site antagonist L-701,324, and the mGluR5 antagonist MPEP attenuated significantly cue-induced reinstatement. The NMDA antagonist CGP 39551 failed to affect reinstatement. Additional control experiments indicated that attenuation of cue-induced reinstatement by CNQX, NBQX, L-701,324, and MPEP was not accompanied by significant suppression of spontaneous locomotor activity. These results suggest that conditioned influences on cocaine seeking depend on glutamate transmission. Accordingly, drugs with antagonist properties at various glutamate receptor subtypes could be useful in prevention of relapse induced by conditioned stimuli.

  15. Group II metabotropic glutamate receptor type 2 allosteric potentiators prevent sodium lactate-induced panic-like response in panic-vulnerable rats

    PubMed Central

    Johnson, Philip L; Fitz, Stephanie D; Engleman, Eric A; Svensson, Kjell A; Schkeryantz, Jeffrey M; Shekhar, Anantha

    2015-01-01

    Rats with chronic inhibition of GABA synthesis by infusion of l-allyglycine, a glutamic acid decarboxylase inhibitor, into their dorsomedial/perifornical hypothalamus are anxious and exhibit panic-like cardio-respiratory responses to treatment with intravenous (i.v.) sodium lactate (NaLac) infusions, in a manner similar to what occurs in patients with panic disorder. We previously showed that either NMDA receptor antagonists or metabotropic glutamate receptor type 2/3 receptor agonists can block such a NaLac response, suggesting that a glutamate mechanism is contributing to this panic-like state. Using this animal model of panic, we tested the efficacy of CBiPES and THIIC, which are selective group II metabotropic glutamate type 2 receptor allosteric potentiators (at 10–30mg/kg i.p.), in preventing NaLac-induced panic-like behavioral and cardiovascular responses. The positive control was alprazolam (3mg/kg i.p.), a clinically effective anti-panic benzodiazepine. As predicted, panic-prone rats given a NaLac challenge displayed NaLac-induced panic-like cardiovascular (i.e. tachycardia and hypertensive) responses and “anxiety” (i.e. decreased social interaction time) and “flight” (i.e. increased locomotion) -associated behaviors; however, systemic injection of the panic-prone rats with CBiPES, THIIC or alprazolam prior to the NaLac dose blocked all NaLac-induced panic-like behaviors and cardiovascular responses. These data suggested that in a rat animal model, selective group II metabotropic glutamate type 2 receptor allosteric potentiators show an anti-panic efficacy similar to alprazolam. PMID:22914798

  16. [Comparative analysis of metabotropic and ionotropic glutamate striatal receptors blockade influence on rats locomotor behaviour].

    PubMed

    Iakimovskiĭ, A F; Kerko, T V

    2013-02-01

    The influence of NMDA and metabotropic neostriatal glutamate receptors blockade to avoidance conditioning (in shuttle box) and free locomotor behavior (in open field) in chronic experiments in rats were investigated. The glutamate receptor antagonists were injected bilateral into striatum separately and with the GABA-A receptor antagonist picrotoxin (2 microg), that produced in rats the impairment of avoidance conditioning and choreo-myoklonic hyperkinesis. The most effective in preventing of negative picrotoxin influence on behavior was 5-type metabotropic glutamate receptors antagonist MTEP (3 microg). Separately injected MTEP did not influence on avoidance conditioning and free locomotor behavior. Unlike that, 1-type metabotropic glutamate receptors antagonist EMQMCM (3 microg) impaired normal locomotor behavior and did not prevent the picrotoxin effects. The NMDA glutamate receptors MK 801 (disocilpin--1 and 5 microg) impaired the picrotoxin-induced hyperkinesis, but did not to prevent the negative effects on avoidance conditioning; separately injected MK 801 reduced free locomotor activity. Based on location of investigated receptor types in neostriatal neurons membranes, we proposed that the most effective influence on 5-type metabotropic glutamate receptors is associated with their involvement in "indirect" efferent pathway, suffered in hyperkinetic extrapyramidal motor dysfunction--Huntington's chorea in human.

  17. Metabotropic and ionotropic glutamate receptors as potential targets for the treatment of alcohol use disorder.

    PubMed

    Goodwani, Sunil; Saternos, Hannah; Alasmari, Fawaz; Sari, Youssef

    2017-06-01

    Emerging evidence indicates that dysfunctional glutamate neurotransmission is critical in the initiation and development of alcohol and drug dependence. Alcohol consumption induced downregulation of glutamate transporter 1 (GLT-1) as reported in previous studies from our laboratory. Glutamate is the major excitatory neurotransmitter in the brain, which acts via interactions with several glutamate receptors. Alcohol consumption interferes with the glutamatergic signal transmission by altering the functions of these receptors. Among the glutamate receptors involved in alcohol-drinking behavior are the metabotropic receptors such as mGluR1/5, mGluR2/3, and mGluR7, as well as the ionotropic receptors, NMDA and AMPA. Preclinical studies using agonists and antagonists implicate these glutamatergic receptors in the development of alcohol use disorder (AUD). Therefore, the purpose of this review is to discuss the neurocircuitry involving glutamate transmission in animals exposed to alcohol and further outline the role of metabotropic and ionotropic receptors in the regulation of alcohol-drinking behavior. This review provides ample information about the potential therapeutic role of glutamatergic receptors for the treatment of AUD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Differential Expression of Glutamate Receptors in Avian Neural Pathways for Learned Vocalization

    PubMed Central

    WADA, KAZUHIRO; SAKAGUCHI, HIRONOBU; JARVIS, ERICH D.; HAGIWARA, MASATOSHI

    2008-01-01

    Learned vocalization, the substrate for human language, is a rare trait. It is found in three distantly related groups of birds—parrots, hummingbirds, and songbirds. These three groups contain cerebral vocal nuclei for learned vocalization not found in their more closely related vocal nonlearning relatives. Here, we cloned 21 receptor subunits/subtypes of all four glutamate receptor families (AMPA, kainate, NMDA, and metabotropic) and examined their expression in vocal nuclei of songbirds. We also examined expression of a subset of these receptors in vocal nuclei of hummingbirds and parrots, as well as in the brains of dove species as examples of close vocal nonlearning relatives. Among the 21 subunits/subtypes, 19 showed higher and/or lower prominent differential expression in songbird vocal nuclei relative to the surrounding brain subdivisions in which the vocal nuclei are located. This included relatively lower levels of all four AMPA subunits in lMAN, strikingly higher levels of the kainite subunit GluR5 in the robust nucleus of the arcopallium (RA), higher and lower levels respectively of the NMDA subunits NR2A and NR2B in most vocal nuclei and lower levels of the metabotropic group I subtypes (mGluR1 and -5) in most vocal nuclei and the group II subtype (mGluR2), showing a unique expression pattern of very low levels in RA and very high levels in HVC. The splice variants of AMPA subunits showed further differential expression in vocal nuclei. Some of the receptor subunits/subtypes also showed differential expression in hummingbird and parrot vocal nuclei. The magnitude of differential expression in vocal nuclei of all three vocal learners was unique compared with the smaller magnitude of differences found for nonvocal areas of vocal learners and vocal nonlearners. Our results suggest that evolution of vocal learning was accompanied by differential expression of a conserved gene family for synaptic transmission and plasticity in vocal nuclei. They also

  19. Quantal amplitude at the cone ribbon synapse can be adjusted by changes in cytosolic glutamate

    PubMed Central

    Bartoletti, Theodore M.

    2011-01-01

    Purpose Vision is encoded at photoreceptor synapses by the number of released vesicles and size of the post-synaptic response. We hypothesized that elevating cytosolic glutamate could enhance quantal size by increasing glutamate in vesicles. Methods We introduced glutamate (10–40 mM) into cone terminals through a patch pipette and recorded excitatory post-synaptic currents (EPSCs) from horizontal or OFF bipolar cells in the Ambystoma tigrinum retinal slice preparation. Results Elevating cytosolic glutamate in cone terminals enhanced EPSCs as well as quantal miniature EPSCs (mEPSCs). Enhancement was prevented by inhibiting vesicular glutamate transport with 1S,3R-1-aminocyclopentane-1,3-dicarboxylate in the patch pipette. A low affinity glutamate receptor antagonist, γD-glutamylglycine (1 mM), less effectively inhibited EPSCs evoked from cones loaded with glutamate than control cones indicating that release from cones with supplemental glutamate produced higher glutamate levels in the synaptic cleft. Raising presynaptic glutamate did not alter exocytotic capacitance responses and exocytosis was observed after inhibiting glutamate loading with the vesicular ATPase inhibitor, concanamycin A, suggesting that release capability is not restricted by low vesicular glutamate levels. Variance-mean analysis of currents evoked by flash photolysis of caged glutamate indicated that horizontal cell AMPA receptors have a single channel conductance of 10.1 pS suggesting that ~8.7 GluRs contribute to each mEPSC. Conclusions Quantal amplitude at the cone ribbon synapse is capable of adjustment by changes in cytosolic glutamate levels. The small number of channels contributing to each mEPSC suggests that stochastic variability in channel opening could be an important source of quantal variability. PMID:21541265

  20. Somatostatin type-2 receptor activation inhibits glutamate release and prevents status epilepticus

    PubMed Central

    Kozhemyakin, Maxim; Rajasekaran, Karthik; Todorovic, Marko S.; Kowalski, Samuel L.; Balint, Corinne; Kapur, Jaideep

    2013-01-01

    Summary Newer therapies are needed for the treatment of status epilepticus (SE) refractory to benzodiazepines. Enhanced glutamatergic neurotransmission leads to SE, and AMPA receptors are modified during SE. Reducing glutamate release during SE is a potential approach to terminate SE. The neuropeptide somatostatin (SST) is proposed to diminish presynaptic glutamate release by activating SST type-2 receptors (SST2R). SST exerts an anticonvulsant action in some experimental models of seizures. Here, we investigated the mechanism of action of SST on excitatory synaptic transmission at the Schaffer collateral-CA1 synapses and the ability of SST to treat SE in rats using patch-clamp electrophysiology and video-EEG monitoring of seizures. SST reduced action potential-dependent EPSCs (sEPSCs) at Schaffer collateral-CA1 synapses at concentrations up to 1 μM; higher concentrations had no effect or increased the sEPSC frequency. SST also prevented paired-pulse facilitation of evoked EPSCs and did not alter action-potential-independent miniature EPSCs (mEPSCs). The effect of SST on EPSCs was inhibited by the SST2R antagonist cyanamid-154806 and was mimicked by the SST2R agonists, octreotide and lanreotide. Both SST and octreotide reduced the firing rate of CA1 pyramidal neurons. Intraventricular administration of SST, within a range of doses, either prevented or attenuated pilocarpine-induced SE or delayed the median time to the first grade 5 seizure by 11 min. Similarly, octreotide or lanreotide prevented or attenuated SE in more than 65% of animals. Compared to the pilocarpine model, octreotide was highly potent in preventing or attenuating continuous hippocampal stimulation-induced SE in all animals within 60 min of SE onset. Our results demonstrate that SST, through the activation of SST2Rs, diminishes presynaptic glutamate release and attenuates SE. PMID:23473742

  1. Metabotropic and ionotropic glutamate receptors as potential targets for the treatment of alcohol use disorder

    PubMed Central

    Goodwani, Sunil; Saternos, Hannah; Alasmari, Fawaz; Sari, Youssef

    2017-01-01

    Emerging evidence indicates that dysfunctional glutamate neurotransmission is critical in the initiation and development of alcohol and drug dependence. Alcohol consumption induced downregulation of glutamate transporter 1 (GLT-1) as reported in previous studies from our laboratory. Glutamate is the major excitatory neurotransmitter in the brain, which acts via interactions with several glutamate receptors. Alcohol consumption interferes with the glutamatergic signal transmission by altering the functions of these receptors. Among the glutamatergic receptors involved in alcohol-drinking behavior are the metabotropic receptors such as mGluR1/5, mGluR2/3, and mGluR7, as well as the ionotropic receptors, NMDA and AMPA. Preclinical studies using agonists and antagonists implicate these glutamatergic receptors in the development of alcohol use disorder (AUD). Therefore, the purpose of this review is to discuss the neurocircuitry involving glutamate transmission in animals exposed to alcohol and further outline the role of metabotropic and ionotropic receptors in the regulation of alcohol-drinking behavior. This review provides ample information about the potential therapeutic role of glutamatergic receptors for the treatment of AUD. PMID:28242339

  2. Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response

    PubMed Central

    Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

    2016-01-01

    In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK. PMID:27736876

  3. Glutamate receptor 1 phosphorylation at Serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability following early life seizures

    PubMed Central

    Rakhade, S.N.; Fitzgerald, E.F.; Klein, P.M.; Zhou, C.; Sun, H; Huganir, R.L.; Jensen, F.E.

    2012-01-01

    Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We previously showed that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of S831 and S845 sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced post-translational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation (GluR1 double phosphomutant (GluR1DPM) mice). Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex following a single episode of pentyleneterazol (PTZ) induced seizures in postnatal day 9 (P9) wild type mouse pups, and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex, and were associated with enhanced seizure susceptibility to later-life kainic acid induced seizures. In contrast, later-life seizure susceptibility following hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for post-translational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue. PMID:23223299

  4. How glutamate receptor subunits mix and match: details uncovered.

    PubMed

    Hansen, Kasper B; Traynelis, Stephen F

    2011-07-28

    Until now, the atomic details explaining why certain subunits prefer to coassemble has been lacking in our understanding of glutamate receptor biogenesis. In this issue, Kumar et al. describe the structural basis by which preferential subunit assembly occurs for homomeric and heteromeric kainate-type glutamate receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Metabotropic Glutamate2 Receptors Play a Key Role in Modulating Head Twitches Induced by a Serotonergic Hallucinogen in Mice

    PubMed Central

    Benvenga, Mark J.; Chaney, Stephen F.; Baez, Melvyn; Britton, Thomas C.; Hornback, William J.; Monn, James A.; Marek, Gerard J.

    2018-01-01

    There is substantial evidence that glutamate can modulate the effects of 5-hydroxytryptamine2A (5-HT2A) receptor activation through stimulation of metabotropic glutamate2/3 (mGlu2/3) receptors in the prefrontal cortex. Here we show that constitutive deletion of the mGlu2 gene profoundly attenuates an effect of 5-HT2A receptor activation using the mouse head twitch response (HTR). MGlu2 and mGlu3 receptor knockout (KO) as well as age-matched ICR (CD-1) wild type (WT) mice were administered (±)1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI) and observed for head twitch activity. DOI failed to produce significant head twitches in mGlu2 receptor KO mice at a dose 10-fold higher than the peak effective dose in WT or mGlu3 receptor KO mice. In addition, the mGlu2/3 receptor agonist LY379268, and the mGlu2 receptor positive allosteric modulator (PAM) CBiPES, potently blocked the HTR to DOI in WT and mGlu3 receptor KO mice. Conversely, the mGlu2/3 receptor antagonist LY341495 (10 mg/kg) increased the HTR produced by DOI (3 mg/kg) in mGlu3 receptor KO mice. Finally, the mGlu2 receptor potentiator CBiPES was able to attenuate the increase in the HTR produced by LY341495 in mGlu3 receptor KO mice. Taken together, all of these results are consistent with the hypothesis that that DOI-induced head twitches are modulated by mGlu2 receptor activation. These results also are in keeping with a critical autoreceptor function for mGlu2 receptors in the prefrontal cortex with differential effects of acute vs. chronic perturbation (e.g., constitutive mGlu2 receptor KO mice). The robust attenuation of DOI-induced head twitches in the mGlu2 receptor KO mice appears to reflect the critical role of glutamate in ongoing regulation of 5-HT2A receptors in the prefrontal cortex. Future experiments with inducible knockouts for the mGlu2 receptor and/or selective mGlu3 receptor agonists/PAMs/antagonists could provide an important tools in understanding glutamatergic modulation of prefrontal

  6. The metabotropic glutamate receptors: structure, activation mechanism and pharmacology.

    PubMed

    Pin, Jean-Philippe; Acher, Francine

    2002-06-01

    The metabotropic glutamate receptors are G-protein coupled receptors (GPCR) involved in the regulation of many synapses, including most glutamatergic fast excitatory synapses. Eight subtypes have been identified that can be classified into three groups. The molecular characterization of these receptors revealed proteins much more complex than any other GPCRs. They are composed of a Venus Flytrap (VFT) module where glutamate binds, connected to a heptahelical domain responsible for G-protein coupling. Recent data including the structure of the VFT module determined with and without glutamate, indicate that these receptors function as dimers. Moreover a number of intracellular proteins can regulate their targeting and transduction mechanism. Such structural features of mGlu receptors offer multiple possibilities for synthetic compounds to modulate their activity. In addition to agonists and competitive antagonists acting at the glutamate binding site, a number of non-competitive antagonists with inverse agonist activity, and positive allosteric modulators have been discovered. These later compounds share specific properties that make them good candidates for therapeutic applications. First, their non-amino acid structure makes them pass more easily the blood brain barrier. Second, they are much more selective than any other compound identified so far, being the first subtype selective molecules. Third, for the negative modulators, their non competitive mechanism of action makes them relatively unaffected by high concentrations of glutamate that may be present in disease states (e.g. stroke, epilepsy, neuropathic pain, etc.). Fourth, like the benzodiazepines acting at the GABA(A) receptors, the positive modulators offer a new way to increase the activity of these receptors in vivo, with a low risk of inducing their desensitization. The present review article focuses on the specific structural features of these receptors and highlights the various possibilities these

  7. Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

    PubMed

    Yu, Alvin; Lau, Albert Y

    2017-11-22

    Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

  8. Mechanism for the activation of glutamate receptors

    Cancer.gov

    Scientists at the NIH have used a technique called cryo-electron microscopy to determine a molecular mechanism for the activation and desensitization of ionotropic glutamate receptors, a prominent class of neurotransmitter receptors in the brain and spina

  9. Premyelinated central axons express neurotoxic NMDA receptors: relevance to early developing white-matter injury

    PubMed Central

    Huria, Tahani; Beeraka, Narasimha Murthy; Al-Ghamdi, Badrah; Fern, Robert

    2015-01-01

    Ischemic-type injury to developing white matter is associated with the significant clinical condition cerebral palsy and with the cognitive deficits associated with premature birth. Premyelinated axons are the major cellular component of fetal white matter and loss of axon function underlies the disability, but the cellular mechanisms producing ischemic injury to premyelinated axons have not previously been described. Injury was found to require longer periods of modelled ischemia than at latter developmental points. Ischemia produced initial hyperexcitability in axons followed by loss of function after Na+ and Ca2+ influx. N-methyl-D-aspartate- (NMDA) type glutamate receptor (GluR) agonists potentiated axon injury while antagonists were protective. The NMDA GluR obligatory Nr1 subunit colocalized with markers of small premyelinated axons and expression was found at focal regions of axon injury. Ischemic injury of glial cells present in early developing white matter was NMDA GluR independent. Axons in human postconception week 18 to 23 white matter had a uniform prediameter expansion phenotype and postembedded immuno-gold labelling showed Nr1 subunit expression on the membrane of these axons, demonstrating a shared key neuropathologic feature with the rodent model. Premyelinated central axons therefore express high levels of functional NMDA GluRs that confer sensitivity to ischemic injury. PMID:25515212

  10. Metabotropic and ionotropic glutamate receptors regulate calcium channel currents in salamander retinal ganglion cells

    PubMed Central

    Shen, Wen; Slaughter, Malcolm M

    1998-01-01

    Glutamate suppressed high-voltage-activated barium currents (IBa,HVA) in tiger salamander retinal ganglion cells. Both ionotropic (iGluR) and metabotropic (mGluR) receptors contributed to this calcium channel inhibition. Trans-ACPD (1-aminocyclopentane-trans-1S,3R-dicarboxylic acid), a broad-spectrum metabotropic glutamate receptor agonist, suppressed a dihydropyridine-sensitive barium current. Kainate, an ionotropic glutamate receptor agonist, reduced an ω-conotoxin GVIA-sensitive current. The relative effectiveness of selective agonists indicated that the predominant metabotropic receptor was the L-2-amino-4-phosphonobutyrate (l-AP4)-sensitive, group III receptor. This receptor reversed the action of forskolin, but this was not responsible for calcium channel suppression. l-AP4 raised internal calcium concentration. Antagonists of phospholipase C, inositol trisphosphate (IP3) receptors and ryanodine receptors inhibited the action of metabotropic agonists, indicating that group III receptor transduction was linked to this pathway. The action of kainate was partially suppressed by BAPTA, by calmodulin antagonists and by blockers of calmodulin-dependent phosphatase. Suppression by kainate of the calcium channel current was more rapid when calcium was the charge carrier, instead of barium. The results indicate that calcium influx through kainate-sensitive glutamate receptors can activate calmodulin, which stimulates phosphatases that may directly suppress voltage-sensitive calcium channels. Thus, ionotropic and metabotropic glutamate receptors inhibit distinct calcium channels. They could act synergistically, since both increase internal calcium. These pathways provide negative feedback that can reduce calcium influx when ganglion cells are depolarized. PMID:9660896

  11. [The potential of group II metabotropic glutamate receptor antagonists as a novel antidepressant].

    PubMed

    Chaki, Shigeyuki

    2012-08-01

    Recently, abnormalities of glutamatergic transmission have been implicated in the pathophysiology of depression. Moreover, both ketamine, an NMDA receptor antagonist, and riluzole, a modulator of glutamatergic, transmission have been reported to be effective for the treatment of patients with treatment-refractory depression. Based on these findings, extensive studies to develop agents acting on glutamatergic transmission have been conducted. Glutamate receptors are divided into two main subtypes, ionotropic glutamate receptors and metabotropic glutamate (mGlu) receptors, both of which have subtypes. Of these, much attention has been paid to mGlu2/3 receptors. mGlu2/3 receptor antagonists such as MGS0039 and LY341495 have been reported to exert antidepressant effects in animal models of depression including the forced swim test, tail suspension test, learned helplessness paradigm, olfactory bulmectomy model and isolation rearing model, and to enhance serotonin release in the prefrontal cortex and dopamine release in the nucleus accumbens. Moreover, activation of AMPA receptor and mTOR signaling have been suggested to be involved in the antidepressant effects of mGlu2/3 receptor antagonists, as demonstrated in the actions of ketamine. Thus, mGlu2/3 receptor antagonists may share some neural networks with ketamine in exerting their antidepressant effects. In addition, the potential of other agents targeting glutamatergic transmission for novel antidepressants is being investigated.

  12. Ionotropic glutamate receptor expression in human white matter.

    PubMed

    Christensen, Pia Crone; Samadi-Bahrami, Zahra; Pavlov, Vlady; Stys, Peter K; Moore, G R Wayne

    2016-09-06

    Glutamate is the key excitatory neurotransmitter of the central nervous system (CNS). Its role in human grey matter transmission is well understood, but this is less clear in white matter (WM). Ionotropic glutamate receptors (iGluR) are found on both neuronal cell bodies and glia as well as on myelinated axons in rodents, and rodent WM tissue is capable of glutamate release. Thus, rodent WM expresses many of the components of the traditional grey matter neuron-to-neuron synapse, but to date this has not been shown for human WM. We demonstrate the presence of iGluRs in human WM by immunofluorescence employing high-resolution spectral confocal imaging. We found that the obligatory N-methyl-d-aspartic acid (NMDA) receptor subunit GluN1 and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluA4 co-localized with myelin, oligodendroglial cell bodies and processes. Additionally, GluA4 colocalized with axons, often in distinct clusters. These findings may explain why human WM is vulnerable to excitotoxic events following acute insults such as stroke and traumatic brain injury and in more chronic inflammatory conditions such as multiple sclerosis (MS). Further exploration of human WM glutamate signalling could pave the way for developing future therapies modulating the glutamate-mediated damage in these and other CNS disorders. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Structure of an agonist-bound ionotropic glutamate receptor.

    PubMed

    Yelshanskaya, Maria V; Li, Minfen; Sobolevsky, Alexander I

    2014-08-29

    Ionotropic glutamate receptors (iGluRs) mediate most excitatory neurotransmission in the central nervous system and function by opening their ion channel in response to binding of agonist glutamate. Here, we report a structure of a homotetrameric rat GluA2 receptor in complex with partial agonist (S)-5-nitrowillardiine. Comparison of this structure with the closed-state structure in complex with competitive antagonist ZK 200775 suggests conformational changes that occur during iGluR gating. Guided by the structures, we engineered disulfide cross-links to probe domain interactions that are important for iGluR gating events. The combination of structural information, kinetic modeling, and biochemical and electrophysiological experiments provides insight into the mechanism of iGluR gating. Copyright © 2014, American Association for the Advancement of Science.

  14. Coantagonism of Glutamate Receptors and Nicotinic Acetylcholinergic Receptors Disrupts Fear Conditioning and Latent Inhibition of Fear Conditioning

    ERIC Educational Resources Information Center

    Gould, Thomas J.; Lewis, Michael C.

    2005-01-01

    The present study investigated the hypothesis that both nicotinic acetylcholinergic receptors (nAChRs) and glutamate receptors ([alpha]-amino-3-hydroxy-5-methyl-4-isoxazole propionate receptors (AMPARs) and N-methyl-D-aspartate glutamate receptors (NMDARs)) are involved in fear conditioning, and may modulate similar processes. The effects of the…

  15. Metabotropic glutamate receptor 5 responses dictate differentiation of neural progenitors to NMDA-responsive cells in fragile X syndrome.

    PubMed

    Achuta, Venkat Swaroop; Grym, Heli; Putkonen, Noora; Louhivuori, Verna; Kärkkäinen, Virve; Koistinaho, Jari; Roybon, Laurent; Castrén, Maija L

    2017-04-01

    Disrupted metabotropic glutamate receptor 5 (mGluR5) signaling is implicated in many neuropsychiatric disorders, including autism spectrum disorder, found in fragile X syndrome (FXS). Here we report that intracellular calcium responses to the group I mGluR agonist (S)-3,5-dihydroxyphenylglycine (DHPG) are augmented, and calcium-dependent mGluR5-mediated mechanisms alter the differentiation of neural progenitors in neurospheres derived from human induced pluripotent FXS stem cells and the brains of mouse model of FXS. Treatment with the mGluR5 antagonist 2-methyl-6-(phenylethynyl)-pyridine (MPEP) prevents an abnormal clustering of DHPG-responsive cells that are responsive to activation of ionotropic receptors in mouse FXS neurospheres. MPEP also corrects morphological defects of differentiated cells and enhanced migration of neuron-like cells in mouse FXS neurospheres. Unlike in mouse neurospheres, MPEP increases the differentiation of DHPG-responsive radial glial cells as well as the subpopulation of cells responsive to both DHPG and activation of ionotropic receptors in human neurospheres. However, MPEP normalizes the FXS-specific increase in the differentiation of cells responsive only to N-methyl-d-aspartate (NMDA) present in human neurospheres. Exposure to MPEP prevents the accumulation of intermediate basal progenitors in embryonic FXS mouse brain suggesting that rescue effects of GluR5 antagonist are progenitor type-dependent and species-specific differences of basal progenitors may modify effects of MPEP on the cortical development. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 77: 419-437, 2017. © 2016 Wiley Periodicals, Inc.

  16. Presynaptic kainate receptor-mediated facilitation of glutamate release involves Ca2+ -calmodulin at mossy fiber-CA3 synapses.

    PubMed

    Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Negrete-Díaz, José Vicente; Sihra, Talvinder S; Flores, Gonzalo; Rodríguez-Moreno, Antonio

    2012-09-01

    Presynaptic kainate receptors (KARs) modulate the release of glutamate at synapses established between mossy fibers (MF) and CA3 pyramidal cells in the hippocampus. The activation of KAR by low, nanomolar, kainate concentrations facilitates glutamate release. KAR-mediated facilitation of glutamate release involves the activation of an adenylate cyclase/cyclic adenosine monophosphate/protein kinase A cascade at MF-CA3 synapses. Here, we studied the mechanisms by which KAR activation produces this facilitation of glutamate release in slices and synaptosomes. We find that the facilitation of glutamate release mediated by KAR activation requires an increase in Ca(2+) levels in the cytosol and the formation of a Ca(2+) -calmodulin complex to activate adenylate cyclase. The increase in cytosolic Ca(2+) underpinning this modulation is achieved, both, by Ca(2+) entering via Ca(2+) -permeable KARs and, by the mobilization of intraterminal Ca(2+) stores. Finally, we find that, congruent with the Ca(2+) -calmodulin support of KAR-mediated facilitation of glutamate release, induction of long-term potentiation at MF-CA3 synapses has an obligate requirement for Ca(2+) -calmodulin activity. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

  17. X-ray structure, symmetry and mechanism of an AMPA-subtype glutamate receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sobolevsky, Alexander I.; Rosconi, Michael P.; Gouaux, Eric

    2010-02-02

    Ionotropic glutamate receptors mediate most excitatory neurotransmission in the central nervous system and function by opening a transmembrane ion channel upon binding of glutamate. Despite their crucial role in neurobiology, the architecture and atomic structure of an intact ionotropic glutamate receptor are unknown. Here we report the crystal structure of the {alpha}-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)-sensitive, homotetrameric, rat GluA2 receptor at 3.6 {angstrom} resolution in complex with a competitive antagonist. The receptor harbours an overall axis of two-fold symmetry with the extracellular domains organized as pairs of local dimers and with the ion channel domain exhibiting four-fold symmetry. A symmetry mismatchmore » between the extracellular and ion channel domains is mediated by two pairs of conformationally distinct subunits, A/C and B/D. Therefore, the stereochemical manner in which the A/C subunits are coupled to the ion channel gate is different from the B/D subunits. Guided by the GluA2 structure and site-directed cysteine mutagenesis, we suggest that GluN1 and GluN2A NMDA (N-methyl-D-aspartate) receptors have a similar architecture, with subunits arranged in a 1-2-1-2 pattern. We exploit the GluA2 structure to develop mechanisms of ion channel activation, desensitization and inhibition by non-competitive antagonists and pore blockers.« less

  18. Involvement of metabotropic glutamate receptors in taurine release in the adult and developing mouse hippocampus.

    PubMed

    Saransaari, P; Oja, S S

    1999-01-01

    The inhibitory amino acid taurine has been held to function as an osmoregulator and modulator of neural activity, being particularly important in the immature brain. Ionotropic glutamate receptor agonists are known markedly to potentiate taurine release. The effects of different metabotropic glutamate receptor (mGluR) agonists and antagonists on the basal and K(+)-stimulated release of [3H]taurine from hippocampal slices from 3-month-old (adult) and 7-day-old mice were now investigated using a superfusion system. Of group I metabotropic glutamate receptor agonists, quisqualate potentiated basal taurine release in both age groups, more markedly in the immature hippocampus. This action was not antagonized by the specific antagonists of group I but by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) and 6-nitro-7-sulphamoylbenzo[f]quinoxaline-2,3-dione (NBQX), which would suggest an involvement of ionotropic glutamate receptors. (S)-3,5-dihydroxyphenylglycine (DHPG) potentiated the basal release by a receptor-mediated mechanism in the immature hippocampus. The group II agonist (2S, 2'R, 3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG IV) markedly potentiated basal taurine release at both ages. These effects were antagonized by dizocilpine, indicating again the participation of ionotropic receptors. Group III agonists slightly potentiated basal taurine release, as did several antagonists of the three metabotropic receptor groups. Potassium-stimulated (50 mM K+) taurine release was generally significantly reduced by mGluR agents, mainly by group I and II compounds. This may be harmful to neurons in hyperexcitatory states. On the other hand, the potentiation by mGluRs of basal taurine release, particularly in the immature hippocampus, together with the earlier demonstrated pronounced enhancement by activation of ionotropic glutamate receptors, may protect neurons against excitotoxicity.

  19. Control of neuronal excitability by Group I metabotropic glutamate receptors.

    PubMed

    Correa, Ana Maria Bernal; Guimarães, Jennifer Diniz Soares; Dos Santos E Alhadas, Everton; Kushmerick, Christopher

    2017-10-01

    Metabotropic glutamate (mGlu) receptors couple through G proteins to regulate a large number of cell functions. Eight mGlu receptor isoforms have been cloned and classified into three Groups based on sequence, signal transduction mechanisms and pharmacology. This review will focus on Group I mGlu receptors, comprising the isoforms mGlu 1 and mGlu 5 . Activation of these receptors initiates both G protein-dependent and -independent signal transduction pathways. The G-protein-dependent pathway involves mainly Gα q , which can activate PLCβ, leading initially to the formation of IP 3 and diacylglycerol. IP 3 can release Ca 2+ from cellular stores resulting in activation of Ca 2+ -dependent ion channels. Intracellular Ca 2+ , together with diacylglycerol, activates PKC, which has many protein targets, including ion channels. Thus, activation of the G-protein-dependent pathway affects cellular excitability though several different effectors. In parallel, G protein-independent pathways lead to activation of non-selective cationic currents and metabotropic synaptic currents and potentials. Here, we provide a survey of the membrane transport proteins responsible for these electrical effects of Group I metabotropic glutamate receptors.

  20. [A case of acute cerebellar ataxia following infectious mononucleosis accompanied by intrathecal anti-glutamate receptor δ2 antibody].

    PubMed

    Murakami, Hidetomo; Iijima, Shoji; Kawamura, Mitsuru; Takahashi, Yukitoshi; Ichikawa, Hiroo

    2013-01-01

    An 18-year-old woman was admitted because of sore throat and pain in the epigastric region. On admission, she presented with swollen tonsils and hepatosplenomegaly. Blood examinations revealed the presence of atypical lymphocytes, liver damage and anti-VCA IgM and IgG antibodies. These findings led to diagnosis of infectious mononucleosis. After admission, her condition improved, but on hospital day 4, she suddenly developed cerebellar ataxia in the trunk and four limbs. Cranial MRI findings were normal. Cerebrospinal fluid (CSF) collected on hospital day 6 showed normal cell counts and normal concentrations of protein and glucose. EB virus DNA and anti-VCA IgM and IgG antibodies were negative and glutamate receptor δ2 antibody was positive in CSF collected on hospital day 11. We diagnosed acute cerebellar ataxia (ACA) and performed methylprednisolone pulse therapy. After this therapy, her cerebellar ataxia improved over a few days. This is the first reported case of ACA after EB virus infection presenting with glutamate receptor δ2 antibody in CSF. The glutamate receptor δ2 subunit is expressed on cerebellar Purkinje cells. Therefore, the presence of the antibody may be associated with cerebellar dysfunction. In the present case, secondary immune reactions after EB virus infection may have produced the antibody.

  1. Effect of glutamate receptor antagonists and antirheumatic drugs on proliferation of synoviocytes in vitro.

    PubMed

    Parada-Turska, Jolanta; Rzeski, Wojciech; Majdan, Maria; Kandefer-Szerszeń, Martyna; Turski, Waldemar A

    2006-03-27

    One of the most striking features of inflammatory arthritis is the hyperplasia of synovial fibroblasts. It is not known whether the massive synovial hyperplasia characteristic of rheumatoid arthritis is due to the proliferation of synovial fibroblasts or to defective apoptosis. It has been found that glutamate receptor antagonists inhibit proliferation of different human tumour cells and the anticancer potential of glutamate receptor antagonists was suggested. Here, we investigated the effect of glutamate receptor antagonists and selected antirheumatic drugs on proliferation of synoviocytes in vitro. Experiments were conducted on rabbit synoviocytes cell line HIG-82 obtained from American Type Culture Collection (Menassas, VA, USA). Cell proliferation was assessed by means of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The IC50 value (the concentration of drug necessary to induce 50% inhibition) together with confidence limits was calculated. Glutamate receptor antagonists, 1-(4-aminophenyl)-3,5-dihydro-7,8-dimethoxy-4H-2,3-benzodiazepin-4-one (CFM-2), riluzole, memantine, 1-4-aminophenyl-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI 52466), dizocilpine, ketamine and 2,3-dihydroxy-6-nitro-7-sulfamoylbenzo(f)quinoxaline (NBQX), inhibited proliferation of synoviocytes with the following IC50 values (in mM): 0.014, 0.017, 0.065, 0.102, 0.15, 0.435 and 1.16, respectively. Antirheumatic drugs, celecoxib, diclofenac, nimesulide, sulfasalazine, naproxen and methotrexate, inhibited proliferation of synoviocytes with the following IC50 values (in mM): 0.0043, 0.034, 0.044, 0.096, 0.385 and 1.123, respectively. Thus, the antiproliferative potential of glutamate receptor antagonists is comparable to that of antirheumatic drugs.

  2. Glutamate spillover modulates GABAergic synaptic transmission in the rat midbrain periaqueductal grey via metabotropic glutamate receptors and endocannabinoid signaling.

    PubMed

    Drew, Geoffrey M; Mitchell, Vanessa A; Vaughan, Christopher W

    2008-01-23

    Glutamate spillover regulates GABAergic synaptic transmission at several CNS synapses via presynaptic ionotropic and metabotropic glutamate receptors (mGluRs). We have previously demonstrated that activation of group I-III mGluRs inhibits GABAergic transmission in the midbrain periaqueductal gray (PAG), a region involved in organizing behavioral responses to threat, stress, and pain. Here, we examined the role of glutamate spillover in the modulation of GABAergic transmission in the PAG. Using whole-cell recordings from rat PAG slices, we found that evoked IPSCs were reduced by the nonspecific glutamate transport blockers DL-threo-beta-benzyloxyaspartic acid (TBOA) and L-trans-pyrrolidine-2,4-dicarboxylic acid, but not by the glial GLT1-specific blocker dihydrokainate. In contrast, TBOA had no effect on evoked IPSCs when glutamate uptake into the postsynaptic neuron was selectively impaired. TBOA increased the paired-pulse ratio of evoked IPSCs and reduced the rate but not the amplitude of spontaneous miniature IPSCs. The effect of TBOA on evoked IPSCs was abolished by the broad-spectrum mGluR antagonist (2S)-2-amino-2-[(1S,2S)-2-carboxycycloprop-1-yl]-3-(xanth-9-yl) propanoic acid (100 microM), reduced by the mGluR5-specific antagonist 2-methyl-6-(phenylethynyl)pyridine hydrochloride (MPEP) and mimicked by the mGluR1/5 agonist (RS)-3,5-dihydroxyphenylglycine (DHPG). Furthermore, the effects of both TBOA and DHPG were reduced by the cannabinoid CB1 receptor antagonist 1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-1-piperidinyl-1H-pyrazole-3-carboxamide (AM251). Finally, although MPEP and AM251 had no effect on single evoked IPSCs, they increased evoked IPSCs during repetitive stimulation. These results indicate that neuronal glutamate transporters limit mGluR5 activation and endocannabinoid signaling, but may be overwhelmed during conditions of elevated glutamate release. Thus, neuronal glutamate transporters play a key role in regulating endocannabinoid

  3. Subunit-dependent postsynaptic expression of kainate receptors on hippocampal interneurons in area CA1

    PubMed Central

    Wondolowski, Joyce; Frerking, Matthew

    2009-01-01

    Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856

  4. Rectification properties and Ca2+ permeability of glutamate receptor channels in hippocampal cells.

    PubMed

    Lerma, J; Morales, M; Ibarz, J M; Somohano, F

    1994-07-01

    Excitatory amino acids exert a depolarizing action on central nervous system cells through an increase in cationic conductances. Non-NMDA receptors have been considered to be selectively permeable to Na+ and K+, while Ca2+ influx has been thought to occur through the NMDA receptor subtype. Recently, however, the expression of cloned non-NMDA receptor subunits has shown that alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are permeable to Ca2+ whenever the receptor lacks a particular subunit (edited GluR-B). The behaviour of recombinant glutamate receptor channels predicts that Ca2+ would only permeate through receptors that show strong inward rectification and vice versa, i.e. AMPA receptors with linear current-voltage relationships would be impermeable to Ca2+. Using the whole-cell configuration of the patch-clamp technique, we have studied the Ca2+ permeability and the rectifying properties of AMPA receptors, when activated by kainate, in hippocampal neurons kept in culture or acutely dissociated from differentiated hippocampus. Cells were classified according to whether they showed outward rectifying (type I), inward rectifying (type II) or almost linear (type III) current-voltage relationships for kainate-activated responses. AMPA receptors of type I cells (52.2%) were mostly Ca(2+)-impermeable (PCa/PCs = 0.1), while type II cells (6.5%) expressed Ca(2+)-permeable receptors (PCa/PCs = 0.9). Type III cells (41.3%) showed responses with low but not negligible Ca2+ permeability (PCa/PCs = 0.18). The degree of Ca2+ permeability and inward rectification were well correlated in cultured cells, i.e. more inward rectification corresponded to higher Ca2+ permeability.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Positive and negative modulation of circadian activity rhythms by mGluR5 and mGluR2/3 metabotropic glutamate receptors.

    PubMed

    Gannon, Robert L; Millan, Mark J

    2011-01-01

    Glutamate released from retinal ganglion cells conveys information about the daily light:dark cycle to master circadian pacemaker neurons within the suprachiasmatic nucleus that then synchronize internal circadian rhythms with the external day-length. Glutamate activation of ionotropic glutamate receptors in the suprachiasmatic nucleus is well established, but the function of the metabotropic glutamate receptors that are also located in this nucleus is not known. Therefore, in this study we evaluated agonists and antagonists acting at orthosteric or allosteric sites for mGluR5 and mGluR2/3 metabotropic glutamate receptors for their ability to modulate light-induced phase advances and delays of hamster circadian activity rhythms. mGluR5 allosteric antagonists fenobam, MPEP and MTEP, each 10 mg/kg, potentiated light-induced phase advances of hamster circadian activity rhythms, while the mGluR5 agonists CHPG, (S)-3,5-DHPG or positive allosteric modulator CDPPB had no effect. Neither mGluR5 agonists nor antagonists had any effect on light-induced phase delays of activity rhythms. The competitive mGluR2/3 antagonist LY341495, 10 mg/kg, also potentiated light-induced phase advances, but inhibited light-induced phase delays. The mGluR2/3 agonists LY354740 and LY404039 were without effect on phase advances while a third agonist LY379268, 10 mg/kg, inhibited both light-induced advances and delays. Finally, mGluR2/3 agonists LY379268 and LY404039 also inhibited light-induced phase delays of activity rhythms. These results suggest that during light-induced phase advances, mGluR2/3 and mGluR5 receptors act to negatively modulate the effects of light on the circadian pacemaker or its output(s). mGluR5 receptors do not appear to be involved during light-induced phase delays. In contrast, the role for mGluR2/3 receptors during phase delays is more complicated as both agonists and antagonists inhibit light-induced phase delays. Dysfunctions in human circadian rhythms have been

  6. Vitamin C modulates glutamate transport and NMDA receptor function in the retina.

    PubMed

    Domith, Ivan; Socodato, Renato; Portugal, Camila C; Munis, Andressa F; Duarte-Silva, Aline T; Paes-de-Carvalho, Roberto

    2018-02-01

    Vitamin C (in the reduced form ascorbate or in the oxidized form dehydroascorbate) is implicated in signaling events throughout the central nervous system (CNS). In the retina, a high-affinity transport system for ascorbate has been described and glutamatergic signaling has been reported to control ascorbate release. Here, we investigated the modulatory role played by vitamin C upon glutamate uptake and N-methyl-d-aspartate (NMDA) receptor activation in cultured retinal cells or in intact retinal tissue using biochemical and imaging techniques. We show that both forms of vitamin C, ascorbate or dehydroascorbate, promote an accumulation of extracellular glutamate by a mechanism involving the inhibition of glutamate uptake. This inhibition correlates with the finding that ascorbate promotes a decrease in cell surface levels of the neuronal glutamate transporter excitatory amino acid transporter 3 in retinal neuronal cultures. Interestingly, vitamin C is prone to increase the activity of NMDA receptors but also promotes a decrease in glutamate-stimulated [ 3 H] MK801 binding and decreases cell membrane content of NMDA receptor glutamate ionotropic receptor subunit 1 (GluN1) subunits. Both compounds were also able to increase cAMP response element-binding protein phosphorylation in neuronal nuclei in a glutamate receptor and calcium/calmodulin kinase-dependent manner. Moreover, the effect of ascorbate is not blocked by sulfinpyrazone and then does not depend on its uptake by retinal cells. Overall, these data indicate a novel molecular and functional target for vitamin C impacting on glutamate signaling in retinal neurons. © 2017 International Society for Neurochemistry.

  7. Modeling the effect of glutamate diffusion and uptake on NMDA and non-NMDA receptor saturation.

    PubMed Central

    Holmes, W R

    1995-01-01

    One- and two-dimensional models of glutamate diffusion, uptake, and binding in the synaptic cleft were developed to determine if the release of single vesicles of glutamate would saturate NMDA and non-NMDA receptors. Ranges of parameter values were used in the simulations to determine the conditions when saturation could occur. Single vesicles of glutamate did not saturate NMDA receptors unless diffusion was very slow and the number of glutamate molecules in a vesicle was large. However, the release of eight vesicles at 400 Hz caused NMDA receptor saturation for all parameter values tested. Glutamate uptake was found to reduce NMDA receptor saturation, but the effect was smaller than that of changes in the diffusion coefficient or in the number of glutamate molecules in a vesicle. Non-NMDA receptors were not saturated unless diffusion was very slow and the number of glutamate molecules in a vesicle was large. The release of eight vesicles at 400 Hz caused significant non-NMDA receptor desensitization. The results suggest that NMDA and non-NMDA receptors are not saturated by single vesicles of glutamate under usual conditions, and that tetanic input, of the type typically used to induce long-term potentiation, will increase calcium influx by increasing receptor binding as well as by reducing voltage-dependent block of NMDA receptors. Images FIGURE 1 PMID:8580317

  8. Allosteric Modulation of Metabotropic Glutamate Receptors

    PubMed Central

    Sheffler, Douglas J.; Gregory, Karen J.; Rook, Jerri M.; Conn, P. Jeffrey

    2013-01-01

    The development of receptor subtype-selective ligands by targeting allosteric sites of G protein-coupled receptors (GPCRs) has proven highly successful in recent years. One GPCR family that has greatly benefited from this approach is the metabotropic glutamate receptors (mGlus). These family C GPCRs participate in the neuromodulatory actions of glutamate throughout the CNS, where they play a number of key roles in regulating synaptic transmission and neuronal excitability. A large number of mGlu subtype-selective allosteric modulators have been identified, the majority of which are thought to bind within the transmembrane regions of the receptor. These modulators can either enhance or inhibit mGlu functional responses and, together with mGlu knockout mice, have furthered the establishment of the physiologic roles of many mGlu subtypes. Numerous pharmacological and receptor mutagenesis studies have been aimed at providing a greater mechanistic understanding of the interaction of mGlu allosteric modulators with the receptor, which have revealed evidence for common allosteric binding sites across multiple mGlu subtypes and the presence for multiple allosteric sites within a single mGlu subtype. Recent data have also revealed that mGlu allosteric modulators can display functional selectivity toward particular signal transduction cascades downstream of an individual mGlu subtype. Studies continue to validate the therapeutic utility of mGlu allosteric modulators as a potential therapeutic approach for a number of disorders including anxiety, schizophrenia, Parkinson’s disease, and Fragile X syndrome. PMID:21907906

  9. Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels.

    PubMed

    Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L

    2013-03-05

    AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine, and phenylalanine, which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate, and serine. AvGluR1 LBD crystal structures reveal an unusual scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, whereas in the alanine, methionine, and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl(-) lowers affinity for these ligands but not for glutamate or aspartate nor for phenylalanine, which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure-based studies on iGluR-ligand interactions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels

    PubMed Central

    Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L.

    2014-01-01

    SUMMARY AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine and phenylalanine which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate and serine. AvGluR1 LBD crystal structures reveal a novel scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, while in the alanine, methionine and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl− lowers affinity for these ligands, but not for glutamate, aspartate or for phenylalanine which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure based studies on iGluR-ligand interactions. PMID:23434404

  11. Interaction between P2X and nicotinic acetylcholine receptors in glutamate nerve terminals of the rat hippocampus.

    PubMed

    Rodrigues, Ricardo J; Almeida, Teresa; de Mendonça, Alexandre; Cunha, Rodrigo A

    2006-01-01

    Nicotinic acetylcholine receptors (nAChRs [constituted by pentameric association of alpha2-10 and beta2-4 subunits]) and P2X receptors (P2XRs [activated by ATP and constituted by multimeric association of P2X1-7 subunits]) are both ionotropic receptors permeable to cations, which have in common the disparity between the wealth of data showing their presence in the brain and little evidence of their participation in mediating synaptic transmission. This has led to the proposal that both nAChRs and P2XRs might primarily modulate rather than directly mediate synaptic transmission, which is in accordance with the predominant presynaptic localization of both receptor subtypes (Role and Berg, 1996; Cunha and Ribeiro, 2000). Interestingly, both functional neurochemical (Allgaier et al., 1995; Salgado et al., 2000; Diáz-Hernández et al., 2002) and electrophysiological studies (Barajas-Lopez et al., 1998; Searl et al., 1998; Zhou and Calligan, 1998; Khakh et al., 2000) indicated a close interaction between nAChRs and P2XRs, which is paralleled by a co-release of ATPand ACh from central terminals (e.g., Richardson and Brown, 1987). Because glutamate release in the hippocampus is controlled by both nAChRs (e.g., McGehee et al., 1995) and P2XRs (Khakh et al., 2003; Rodrigues et al., 2005), we investigated if there was a functional interaction between these two presynaptic ionotropic receptors in the control of glutamate release in the rat hippocampus.

  12. Regulation of mGlu4 metabotropic glutamate receptor signaling by type-2 G-protein coupled receptor kinase (GRK2).

    PubMed

    Iacovelli, L; Capobianco, L; Iula, M; Di Giorgi Gerevini, V; Picascia, A; Blahos, J; Melchiorri, D; Nicoletti, F; De Blasi, A

    2004-05-01

    We examined the role of G-protein coupled receptor kinase-2 (GRK2) in the homologous desensitization of mGlu4 metabotropic glutamate receptors transiently expressed in human embryonic kidney (HEK) 293 cells. Receptor activation with the agonist l-2-amino-4-phosphonobutanoate (l-AP4) stimulated at least two distinct signaling pathways: inhibition of cAMP formation and activation of the mitogen-activated protein kinase (MAPK) pathway [assessed by Western blot analysis of phosphorylated extracellular signal-regulated kinase (ERK) 1 and 2]. Activation of both pathways was attenuated by pertussis toxin. Overexpression of GRK2 (but not GRK4) largely attenuated the stimulation of the MAPK pathway by l-AP4, whereas it slightly potentiated the inhibition of FSK-stimulated cAMP formation. Transfection with a kinase-dead mutant of GRK2 (GRK2-K220R) or with the C-terminal fragment of GRK2 also reduced the mGlu4-mediated stimulation of MAPK, suggesting that GRK2 binds to the Gbetagamma subunits to inhibit signal propagation toward the MAPK pathway. This was confirmed by the evidence that GRK2 coimmunoprecipitated with Gbetagamma subunits in an agonist-dependent manner. Finally, neither GRK2 nor its kinase-dead mutant had any effect on agonist-induced mGlu4 receptor internalization in HEK293 cells transiently transfected with GFP-tagged receptors. Agonist-dependent internalization was instead abolished by a negative-dominant mutant of dynamin, which also reduced the stimulation of MAPK pathway by l-AP4. We speculate that GRK2 acts as a "switch molecule" by inhibiting the mGlu4 receptor-mediated stimulation of MAPK and therefore directing the signal propagation toward the inhibition of adenylyl cyclase.

  13. Structure and symmetry inform gating principles of ionotropic glutamate receptors.

    PubMed

    Zhu, Shujia; Gouaux, Eric

    2017-01-01

    Ionotropic glutamate receptors (iGluRs) transduce signals derived from release of the excitatory neurotransmitter glutamate from pre-synaptic neurons into excitation of post-synaptic neurons on a millisecond time-scale. In recent years, the elucidation of full-length iGluR structures of NMDA, AMPA and kainate receptors by X-ray crystallography and single particle cryo-electron microscopy has greatly enhanced our understanding of the interrelationships between receptor architecture and gating mechanism. Here we briefly review full-length iGluR structures and discuss the similarities and differences between NMDA receptors and non-NMDA iGluRs. We focus on distinct conformations, including ligand-free, agonist-bound active, agonist-bound desensitized and antagonist-bound conformations as well as modulator and auxiliary protein-bound states. These findings provide insights into structure-based mechanisms of iGluR gating and modulation which together shape the amplitude and time course of the excitatory postsynaptic potential. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. High Concentrations of Tranexamic Acid Inhibit Ionotropic Glutamate Receptors.

    PubMed

    Lecker, Irene; Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Mazer, C David; Orser, Beverley A

    2017-07-01

    The antifibrinolytic drug tranexamic acid is structurally similar to the amino acid glycine and may cause seizures and myoclonus by acting as a competitive antagonist of glycine receptors. Glycine is an obligatory co-agonist of the N-methyl-D-aspartate (NMDA) subtype of glutamate receptors. Thus, it is plausible that tranexamic acid inhibits NMDA receptors by acting as a competitive antagonist at the glycine binding site. The aim of this study was to determine whether tranexamic acid inhibits NMDA receptors, as well as α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate subtypes of ionotropic glutamate receptors. Tranexamic acid modulation of NMDA, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and kainate receptors was studied using whole cell voltage-clamp recordings of current from cultured mouse hippocampal neurons. Tranexamic acid rapidly and reversibly inhibited NMDA receptors (half maximal inhibitory concentration = 241 ± 45 mM, mean ± SD; 95% CI, 200 to 281; n = 5) and shifted the glycine concentration-response curve for NMDA-evoked current to the right. Tranexamic acid also inhibited α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (half maximal inhibitory concentration = 231 ± 91 mM; 95% CI, 148 to 314; n = 5 to 6) and kainate receptors (half maximal inhibitory concentration = 90 ± 24 mM; 95% CI, 68 to 112; n = 5). Tranexamic acid inhibits NMDA receptors likely by reducing the binding of the co-agonist glycine and also inhibits α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate receptors. Receptor blockade occurs at high millimolar concentrations of tranexamic acid, similar to the concentrations that occur after topical application to peripheral tissues. Glutamate receptors in tissues including bone, heart, and nerves play various physiologic roles, and tranexamic acid inhibition of these receptors may contribute to adverse drug effects.

  15. Ionotropic glutamate receptors: regulation by G-protein-coupled receptors.

    PubMed

    Rojas, Asheebo; Dingledine, Raymond

    2013-04-01

    The function of many ion channels is under dynamic control by coincident activation of G-protein-coupled receptors (GPCRs), particularly those coupled to the Gαs and Gαq family members. Such regulation is typically dependent on the subunit composition of the ionotropic receptor or channel as well as the GPCR subtype and the cell-specific panoply of signaling pathways available. Because GPCRs and ion channels are so highly represented among targets of U.S. Food and Drug Administration-approved drugs, functional cross-talk between these drug target classes is likely to underlie many therapeutic and adverse effects of marketed drugs. GPCRs engage a myriad of signaling pathways that involve protein kinases A and C (PKC) and, through PKC and interaction with β-arrestin, Src kinase, and hence the mitogen-activated-protein-kinase cascades. We focus here on the control of ionotropic glutamate receptor function by GPCR signaling because this form of regulation can influence the strength of synaptic plasticity. The amino acid residues phosphorylated by specific kinases have been securely identified in many ionotropic glutamate (iGlu) receptor subunits, but which of these sites are GPCR targets is less well known even when the kinase has been identified. N-methyl-d-aspartate, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and heteromeric kainate receptors are all downstream targets of GPCR signaling pathways. The details of GPCR-iGlu receptor cross-talk should inform a better understanding of how synaptic transmission is regulated and lead to new therapeutic strategies for neuropsychiatric disorders.

  16. Metabotropic glutamate receptor-mediated signaling dampens the HPA axis response to restraint stress

    PubMed Central

    Evanson, Nathan K.; Herman, James P.

    2015-01-01

    Glutamate is an important neurotransmitter in regulation of the neural portion of hypothalamus-pituitary-adrenal (HPA) axis activity, and signals through ionotropic and metabotropic receptors. In the current studies we investigated the role of hypothalamic paraventricular group I metabotropic glutamate receptors in regulation of the HPA axis response to restraint stress in rats. Direct injection of the group I metabotropic glutamate receptor agonist 3,5-dihydroxyphenylglycine (DHPG) into the PVN prior to restraint leads to blunting of the HPA axis response in awake animals. Consistent with this result, infusion of the group I receptor antagonist hexyl-homoibotenic acid (HIBO) potentiates the HPA axis response to restraint. The excitatory effect of blocking paraventricular group I metabotropic glutamate signaling is blocked by co-administration of dexamethasone into the PVN. However, the inhibitory effect of DHPG is not affected by co-administration of the cannabinoid CB1 receptor antagonist AM-251 into the PVN. Together, these results suggest that paraventricular group I metabotropic glutamate receptor signaling acts to dampen HPA axis reactivity. This effect appears to be similar to the rapid inhibitory effect of glucocorticoids at the PVN, but is not mediated by endocannabinoid signaling. PMID:25701594

  17. Glutamate Increases In Vitro Survival and Proliferation and Attenuates Oxidative Stress-Induced Cell Death in Adult Spinal Cord-Derived Neural Stem/Progenitor Cells via Non-NMDA Ionotropic Glutamate Receptors.

    PubMed

    Hachem, Laureen D; Mothe, Andrea J; Tator, Charles H

    2016-08-15

    Traumatic spinal cord injury (SCI) leads to a cascade of secondary chemical insults, including oxidative stress and glutamate excitotoxicity, which damage host neurons and glia. Transplantation of exogenous neural stem/progenitor cells (NSPCs) has shown promise in enhancing regeneration after SCI, although survival of transplanted cells remains poor. Understanding the response of NSPCs to the chemical mediators of secondary injury is essential in finding therapies to enhance survival. We examined the in vitro effects of glutamate and glutamate receptor agonists on adult rat spinal cord-derived NSPCs. NSPCs isolated from the periventricular region of the adult rat spinal cord were exposed to various concentrations of glutamate for 96 h. We found that glutamate treatment (500 μM) for 96 h significantly increased live cell numbers, reduced cell death, and increased proliferation, but did not significantly alter cell phenotype. Concurrent glutamate treatment (500 μM) in the setting of H2O2 exposure (500 μM) for 10 h increased NSPC survival compared to H2O2 exposure alone. The effects of glutamate on NSPCs were blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)/kainate receptor antagonist GYKI-52466, but not by the N-methyl-D-aspartic acid receptor antagonist MK-801 or DL-AP5, or the mGluR3 antagonist LY-341495. Furthermore, treatment of NSPCs with AMPA, kainic acid, or the kainate receptor-specific agonist (RS)-2-amino-3-(3-hydroxy-5-tert-butylisoxazol-4-yl)propanoic acid mimicked the responses seen with glutamate both alone and in the setting of oxidative stress. These findings offer important insights into potential mechanisms to enhance NSPC survival and implicate a potential role for glutamate in promoting NSPC survival and proliferation after traumatic SCI.

  18. Ionotropic glutamate receptors contribute to pain transmission and chronic pain.

    PubMed

    Zhuo, Min

    2017-01-01

    Investigation of the synaptic mechanisms for sensory transmission and modulation provide us with critical information about the transmission of painful sensation as well as the basic mechanisms of chronic pain. Recent studies consistently demonstrate that glutamatergic synapses not only play an important role in sensory transmission, including pain and itch transmission, but also contribute to nociceptive sensitization at different levels of the brain. Different subtypes of glutamate receptors play selective roles in synaptic transmission and long-term potentiation (LTP), as well as synaptic modulation. Understanding the contribution of each subtype of glutamate receptors, and related downstream signaling pathways may provide a new opportunity to design better medicine for the treatment of different forms of chronic pain. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. [Studying specific effects of nootropic drugs on glutamate receptors in the rat brain].

    PubMed

    Firstova, Iu Iu; Vasil'eva, E V; Kovalev, G I

    2011-01-01

    The influence of nootropic drugs of different groups (piracetam, phenotropil, nooglutil, noopept, semax, meclofenoxate, pantocalcine, and dimebon) on the binding of the corresponding ligands to AMPA, NMDA, and mGlu receptors of rat brain has been studied by the method of radio-ligand binding in vitro. It is established that nooglutil exhibits pharmacologically significant competition with a selective agonist of AMPA receptors ([G-3H]Ro 48-8587) for the receptor binding sites (with IC50 = 6.4 +/- 0.2 microM), while the competition of noopept for these receptor binding sites was lower by an order of magnitude (IC50 = 80 +/- 5.6 microM). The heptapeptide drug semax was moderately competitive with [G-3H]LY 354740 for mGlu receptor sites (IC50 = 33 +/- 2.4 microM). Dimebon moderately influenced the specific binding of the ligand of NMDA receptor channel ([G-3H]MK-801) at IC50 = 59 +/- 3.6 microM. Nootropic drugs of the pyrrolidone group (piracetam, phenotropil) as well as meclofenoxate, pantocalcine (pantogam) in a broad rage of concentrations (10(-4)-10(-10) M) did not affect the binding of the corresponding ligands to glutamate receptors (IC50 100 pM). Thus, the direct neurochemical investigation was used for the first time to qualitatively characterize the specific binding sites for nooglutil and (to a lower extent) noopept on AMPA receptors, for semax on metabotropic glutamate receptors, and for dimebon on the channel region of NMDA receptors. The results are indicative of a selective action of some nootropes on the glutamate family.

  20. A slow excitatory postsynaptic current mediated by a novel metabotropic glutamate receptor in CA1 pyramidal neurons.

    PubMed

    Sheng, Nengyin; Yang, Jing; Silm, Katlin; Edwards, Robert H; Nicoll, Roger A

    2017-03-15

    Slow excitatory postsynaptic currents (EPSCs) mediated by metabotropic glutamate receptors (mGlu receptors) have been reported in several neuronal subtypes, but their presence in hippocampal pyramidal neurons remains elusive. Here we find that in CA1 pyramidal neurons a slow EPSC is induced by repetitive stimulation while ionotropic glutamate receptors and glutamate-uptake are blocked whereas it is absent in the VGLUT1 knockout mouse in which presynaptic glutamate is lost, suggesting the slow EPSC is mediated by glutamate activating mGlu receptors. However, it is not inhibited by known mGlu receptor antagonists. These findings suggest that this slow EPSC is mediated by a novel mGlu receptor, and that it may be involved in neurological diseases associated with abnormal high-concentration of extracellular glutamate. This article is part of the Special Issue entitled 'Metabotropic Glutamate Receptors, 5 years on'. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Prenatal exposure to the cannabinoid receptor agonist WIN 55,212-2 increases glutamate uptake through overexpression of GLT1 and EAAC1 glutamate transporter subtypes in rat frontal cerebral cortex.

    PubMed

    Castaldo, Pasqualina; Magi, Simona; Gaetani, Silvana; Cassano, Tommaso; Ferraro, Luca; Antonelli, Tiziana; Amoroso, Salvatore; Cuomo, Vincenzo

    2007-09-01

    Prenatal exposure to the CB1 receptor agonist (R)-(+)-[2,3-dihydro-5-methyl-3-(4-morpholinylmethyl)-pyrrolo[1,2,3-de]-1,4-benzoxazinyl]-(1-naphthalenyl)methanone) mesylate (WIN) at a daily dose of 0.5 mg/kg, and Delta9-tetrahydrocannabinol (Delta9-THC) at a daily dose of 5 mg/kg, reduced dialysate glutamate levels in frontal cerebral cortex of adolescent offspring (40-day-old) with respect to those born from vehicle-treated mothers. WIN treatment induced a statistically significant enhancement of Vmaxl-[3H]glutamate uptake, whereas it did not modify glutamate Km, in frontal cerebral cortex synaptosomes of adolescent rats. Western blotting analysis, performed either in membrane proteins derived from homogenates and in proteins extracted from synaptosomes of frontal cerebral cortex, revealed that prenatal WIN exposure enhanced the expression of glutamate transporter 1 (GLT1) and excitatory amino acid carrier 1 (EAAC1). Moreover, immunocytochemical analyses of frontal cortex area revealed a more intense GLT1 and EAAC1 immunoreactivity (ir) distribution in the WIN-treated group. Collectively these results show that prenatal exposure to the cannabinoid CB1 receptor agonist WIN increases expression and functional activity of GLT1 and EAAC1 glutamate transporters (GluTs) associated to a decrease of cortical glutamate outflow, in adolescent rats. These findings may contribute to explain the mechanism underlying the cognitive impairment observed in the offspring of mothers who used marijuana during pregnancy.

  2. Chemoenzymatic synthesis of new 2,4-syn-functionalized (S)-glutamate analogues and structure-activity relationship studies at ionotropic glutamate receptors and excitatory amino acid transporters.

    PubMed

    Assaf, Zeinab; Larsen, Anja P; Venskutonytė, Raminta; Han, Liwei; Abrahamsen, Bjarke; Nielsen, Birgitte; Gajhede, Michael; Kastrup, Jette S; Jensen, Anders A; Pickering, Darryl S; Frydenvang, Karla; Gefflaut, Thierry; Bunch, Lennart

    2013-02-28

    In the mammalian central nervous system, (S)-glutamate (Glu) is released from the presynaptic neuron where it activates a plethora of pre- and postsynaptic Glu receptors. The fast acting ionotropic Glu receptors (iGluRs) are ligand gated ion channels and are believed to be involved in a vast number of neurological functions such as memory and learning, synaptic plasticity, and motor function. The synthesis of 14 enantiopure 2,4-syn-Glu analogues 2b-p is accessed by a short and efficient chemoenzymatic approach starting from readily available cyclohexanone 3. Pharmacological characterization at the iGluRs and EAAT1-3 subtypes revealed analogue 2i as a selective GluK1 ligand with low nanomolar affinity. Two X-ray crystal structures of the key analogue 2i in the ligand-binding domain (LBD) of GluA2 and GluK3 were determined. Partial domain closure was seen in the GluA2-LBD complex with 2i comparable to that induced by kainate. In contrast, full domain closure was observed in the GluK3-LBD complex with 2i, similar to that of GluK3-LBD with glutamate bound.

  3. Control of glutamate release by calcium channels and κ-opioid receptors in rodent and primate striatum

    PubMed Central

    Hill, M P; Brotchie, J M

    1999-01-01

    The modulation of depolarization (4-aminopyridine, 2 mM)-evoked endogenous glutamate release by κ-opioid receptor activation and blockade of voltage-dependent Ca2+-channels has been investigated in synaptosomes prepared from rat and marmoset striatum.4-Aminopyridine (4-AP)-stimulated, Ca2+-dependent glutamate release was inhibited by enadoline, a selective κ-opioid receptor agonist, in a concentration-dependent and nor-binaltorphimine (nor-BNI, selective κ-opioid receptor antagonist)-sensitive manner in rat (IC50=4.4±0.4 μM) and marmoset (IC50=2.9±0.7 μM) striatal synaptosomes. However, in the marmoset, there was a significant (≈23%) nor-BNI-insensitive component.In rat striatal synaptosomes, the Ca2+-channel antagonists ω-agatoxin-IVA (P/Q-type blocker), ω-conotoxin-MVIIC (N/P/Q-type blocker) and ω-conotoxin-GVIA (N-type blocker) reduced 4-AP-stimulated, Ca2+-dependent glutamate release in a concentration-dependent manner with IC50 values of 6.5±0.9 nM, 75.5±5.9 nM and 106.5±8.7 nM, respectively. In marmoset striatal synaptosomes, 4-AP-stimulated, Ca2+-dependent glutamate release was significantly inhibited by ω-agatoxin-IVA (30 nM, 57.6±2.3%, inhibition), ω-conotoxin-MVIIC (300 nM, 57.8±3.1%) and ω-conotoxin-GVIA (1 μM, 56.7±2%).Studies utilizing combinations of Ca2+-channel antagonists suggests that in the rat striatum, two relatively distinct pools of glutamate, released by activation of either P or Q-type Ca2+-channels, exist. In contrast, in the primate there is much overlap between the glutamate released by P and Q-type Ca2+-channel activation.Studies using combinations of enadoline and the Ca2+-channel antagonists suggest that enadoline-induced inhibition of glutamate release occurs primarily via reduction of Ca2+-influx through P-type Ca2+-channels in the rat but via N-type Ca2+-channels in the marmoset.In conclusion, the results presented suggest that there are species differences in the control of glutamate release

  4. Modafinil attenuates reinstatement of cocaine seeking: role for cystine-glutamate exchange and metabotropic glutamate receptors.

    PubMed

    Mahler, Stephen V; Hensley-Simon, Megan; Tahsili-Fahadan, Pouya; LaLumiere, Ryan T; Thomas, Charles; Fallon, Rebecca V; Kalivas, Peter W; Aston-Jones, Gary

    2014-01-01

    Modafinil may be useful for treating stimulant abuse, but the mechanisms by which it acts to do so are unknown. Indeed, a primary effect of modafinil is to inhibit dopamine transport, which typically promotes rather than inhibits motivated behavior. Therefore, we examined the role of nucleus accumbens extracellular glutamate and the group II metabotropic glutamate receptor (mGluR2/3) in modafinil effects. One group of rats was trained to self-administer cocaine for 10 days and extinguished, then given priming injections of cocaine to elicit reinstatement. Modafinil (300 mg/kg, intraperitoneal) inhibited reinstated cocaine seeking (but did not alter extinction responding by itself), and this effect was prevented by pre-treatment with bilateral microinjections of the mGluR2/3 antagonist LY-341495 (LY) into nucleus accumbens core. No reversal of modafinil effects was seen after unilateral accumbens core LY, or bilateral LY in the rostral pole of accumbens. Next, we sought to explore effects of modafinil on extracellular glutamate levels in accumbens after chronic cocaine. Separate rats were administered non-contingent cocaine, and after 3 weeks of withdrawal underwent accumbens microdialysis. Modafinil increased extracellular accumbens glutamate in chronic cocaine, but not chronic saline-pre-treated animals. This increase was prevented by reverse dialysis of cystine-glutamate exchange or voltage-dependent calcium channel antagonists. Voltage-dependent sodium channel blockade partly attenuated the increase in glutamate, but mGluR1 blockade did not. We conclude that modafinil increases extracellular glutamate in nucleus accumbens from glial and neuronal sources in cocaine-exposed rats, which may be important for its mGluR2/3-mediated antirelapse properties. © 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction.

  5. Metabotropic glutamate receptor 5 upregulates surface NMDA receptor expression in striatal neurons via CaMKII.

    PubMed

    Jin, Dao-Zhong; Xue, Bing; Mao, Li-Min; Wang, John Q

    2015-10-22

    Metabotropic and ionotropic glutamate receptors are closely clustered in postsynaptic membranes and are believed to interact actively with each other to control excitatory synaptic transmission. Metabotropic glutamate receptor 5 (mGluR5), for example, has been well documented to potentiate ionotropic NMDA receptor activity, although underlying mechanisms are poorly understood. In this study, we investigated the role of mGluR5 in regulating trafficking and subcellular distribution of NMDA receptors in adult rat striatal neurons. We found that the mGluR1/5 agonist DHPG concentration-dependently increased NMDA receptor GluN1 and GluN2B subunit expression in the surface membrane. Meanwhile, DHPG reduced GluN1 and GluN2B levels in the intracellular compartment. The effect of DHPG was blocked by an mGluR5 selective antagonist MTEP but not by an mGluR1 selective antagonist 3-MATIDA. Pretreatment with an inhibitor or a specific inhibitory peptide for synapse-enriched Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) also blocked the DHPG-stimulated redistribution of GluN1 and GluN2B. In addition, DHPG enhanced CaMKIIα activity and elevated GluN2B phosphorylation at a CaMKII-sensitive site (serine 1303). These results demonstrate that mGluR5 regulates trafficking of NMDA receptors in striatal neurons. Activation of mGluR5 appears to induce rapid trafficking of GluN1 and GluN2B to surface membranes through a signaling pathway involving CaMKII. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Glutamate Receptor Aptamers and ALS

    DTIC Science & Technology

    2008-01-01

    XXGATC ACC Consensus sequence RNA library Cloning and sequencing SELEX DIAGRAM Fig. 1. (a) Flow chart of SELEX. The library we used for SELEX...recording electrode and placed ~100 µm away from the hole. The linear flow rate of the solution is 1-4 cm/s. An optical fiber through which laser light for...channel recording (26) GluR6Q 1.1 × 104 4.2 × 102 Laser-pulse photolysis (67) 1.0 × 104 4.4 × 102 Fitting (52) 1.0 × 104 Flow measurement (46

  7. Different Classes of Glutamate Receptors Mediate Distinct Behaviors in a Single Brainstem Nucleus

    NASA Astrophysics Data System (ADS)

    Dye, John; Heiligenberg, Walter; Keller, Clifford H.; Kawasaki, Masashi

    1989-11-01

    We have taken advantage of the increasing understanding of glutamate neuropharmacology to probe mechanisms of well-defined vertebrate behaviors. Here we report a set of experiments that suggests distinct roles for two major classes of glutamate receptors in a discrete premotor nucleus of the brainstem. The medullary pacemaker nucleus of weakly electric fish is an endogenous oscillator that controls the electric organ discharge (EOD). Its regular frequency of firing is modulated during several distinct behaviors. The pacemaker nucleus continues firing regularly when isolated in vitro, and modulatory behaviors can be reproduced by stimulating the descending input pathway. Glutamate agonists applied to the pacemaker in vitro produced increases in frequency, while glutamate antagonists selectively blocked stimulus-induced modulations. Experiments with glutamate antagonists in the intact animal resulted in specific effects on two well-characterized behaviors. Our data indicate that these behaviors are separately mediated in the pacemaker by receptors displaying characteristics of the kainate/quisqualate and N-methyl-D-aspartate subtypes of glutamate receptor, respectively.

  8. EVALUATING THE NMDA-GLUTAMATE RECEPTOR AS A SITE OF ACTION FOR TOLUENE, IN VIVO

    EPA Science Inventory

    In vitro, toluene disrupts the function of NMDA-glutamate receptors, indicating that effects on NMDA receptor function may contribute to toluene neurotoxicity. NMDA-glutamate receptors are widely present in the visual system and contribute to pattern-elicited visual evoked potent...

  9. Acquisition and expression of conditioned taste aversion differentially affects extracellular signal regulated kinase and glutamate receptor phosphorylation in rat prefrontal cortex and nucleus accumbens

    PubMed Central

    Marotta, Roberto; Fenu, Sandro; Scheggi, Simona; Vinci, Stefania; Rosas, Michela; Falqui, Andrea; Gambarana, Carla; De Montis, M. Graziella; Acquas, Elio

    2014-01-01

    Conditioned taste aversion (CTA) can be applied to study associative learning and its relevant underpinning molecular mechanisms in discrete brain regions. The present study examined, by immunohistochemistry and immunocytochemistry, the effects of acquisition and expression of lithium-induced CTA on activated Extracellular signal Regulated Kinase (p-ERK) in the prefrontal cortex (PFCx) and nucleus accumbens (Acb) of male Sprague-Dawley rats. The study also examined, by immunoblotting, whether acquisition and expression of lithium-induced CTA resulted in modified levels of phosphorylation of glutamate receptor subunits (NR1 and GluR1) and Thr34- and Thr75-Dopamine-and-cAMP-Regulated PhosphoProtein (DARPP-32). CTA acquisition was associated with an increase of p-ERK-positive neurons and phosphorylated NR1 receptor subunit (p-NR1) in the PFCx, whereas p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels were not changed in this brain region. CTA expression increased the number of p-ERK-positive neurons in the shell (AcbSh) and core (AcbC) but left unmodified p-NR1, p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels. Furthermore, post-embedding immunogold quantitative analysis in AcbSh revealed that CTA expression significantly increased nuclear p-ERK immunostaining as well as p-ERK-labeled axo-spinous contacts. Overall, these results indicate that ERK and NR1, but not GluR1 and DARPP-32, are differentially phosphorylated as a consequence of acquisition and expression of aversive associative learning. Moreover, these results confirm that CTA represents an useful approach to study the molecular basis of associative learning in rats and suggest the involvement of ERK cascade in learning-associated synaptic plasticity. PMID:24847227

  10. Role of glutamate receptors in the dorsal reticular nucleus in formalin-induced secondary allodynia.

    PubMed

    Ambriz-Tututi, Mónica; Palomero-Rivero, Marcela; Ramirez-López, Fernanda; Millán-Aldaco, Diana; Drucker-Colín, And René

    2013-10-01

    The role of glutamate receptors present in the medullary dorsal reticular nucleus (DRt) in the formalin test and formalin-induced secondary nociception was studied in rats. Secondary mechanical allodynia was assessed with von Frey filaments applied to the rat's hindpaw, and secondary thermal hyperalgesia was evaluated with the tail-immersion test. The selective glutamate receptor antagonists MK801 (N-methyl-D-aspartate receptor antagonist), 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) (AMPA/KA receptor antagonist) and A841720 (metabotropic glutamate 1 receptor antagonist) were injected into the DRt before or 6 days after formalin injection in the rat. In the formalin test, the three antagonists significantly reduced the number of flinches in both phases of the test. DRt microinjection of MK801 or A841720, but not of CNQX, reduced both secondary nociceptive behaviors. Moreover, pre-treatment with the three antagonists injected into the DRt prevented the development of secondary mechanical allodynia and secondary thermal hyperalgesia. Similarly, in these rats, the number of c-Fos-like immunoreactive neurons were markedly reduced in both the superficial and deep lamina of the dorsal horn. Our findings support the role of DRt as a pain facilitator in acute and chronic pain states, and suggest a key role of glutamate receptors during the development and maintenance of formalin-induced secondary allodynia. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  11. Metabotropic glutamate receptor-mediated signaling dampens the HPA axis response to restraint stress.

    PubMed

    Evanson, Nathan K; Herman, James P

    2015-10-15

    Glutamate is an important neurotransmitter in the regulation of the neural portion of hypothalamus-pituitary-adrenal (HPA) axis activity, and signals through ionotropic and metabotropic receptors. In the current studies we investigated the role of hypothalamic paraventricular group I metabotropic glutamate receptors in the regulation of the HPA axis response to restraint stress in rats. Direct injection of the group I metabotropic glutamate receptor agonist 3,5-dihydroxyphenylglycine (DHPG) into the PVN prior to restraint leads to blunting of the HPA axis response in awake animals. Consistent with this result, infusion of the group I receptor antagonist hexyl-homoibotenic acid (HIBO) potentiates the HPA axis response to restraint. The excitatory effect of blocking paraventricular group I metabotropic glutamate signaling is blocked by co-administration of dexamethasone into the PVN. However, the inhibitory effect of DHPG is not affected by co-administration of the cannabinoid CB1 receptor antagonist AM-251 into the PVN. Together, these results suggest that paraventricular group I metabotropic glutamate receptor signaling acts to dampen HPA axis reactivity. This effect appears to be similar to the rapid inhibitory effect of glucocorticoids at the PVN, but is not mediated by endocannabinoid signaling. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Modulation of desensitization at glutamate receptors in isolated crucian carp horizontal cells by concanavalin A, cyclothiazide, aniracetam and PEPA.

    PubMed

    Shen, Y; Lu, T; Yang, X L

    1999-03-01

    In horizontal cells freshly dissociated from crucian carp (Carassius auratus) retina, we examined the effects of modulators of glutamate receptor desensitization, concanavalin A, cyclothiazide, aniracetam and 4-[2-(phenylsulfonylamino)ethylthio]-2,6-difluoro-phenoxyacetam ide (PEPA), on responses to rapid application of glutamate and kainate, using whole-cell voltage-clamp techniques. Incubation of concanavalin A suppressed the peak response but weakly potentiated the equilibrium response of horizontal cells to glutamate. Cyclothiazide blocked glutamate-induced desensitization in a dose-dependent manner, which resulted in a steady increase of the equilibrium current. The concentration of cyclothiazide causing a half-maximal potentiation for the equilibrium response was 85 microM. Furthermore, cyclothiazide shifted the dose-response relationship of the equilibrium current to the right, but slightly suppressed the kainate-induced sustained current. These effects of concanavalin A and cyclothiazide are consistent with the supposition that glutamate receptors of carp horizontal cells may be an alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)-preferring subtype. In order to further characterize the AMPA receptors of horizontal cells, modulation by aniracetam and PEPA of glutamate- and kainate-induced currents was studied. Aniracetam, a preferential modulator of flop variants of AMPA receptors, considerably blocked desensitization of glutamate-induced currents, but only slightly potentiated kainate-induced currents. It was further found that PEPA, a flop-preferring allosteric modulator of AMPA receptor desensitization, slightly suppressed the peak current, while it dramatically potentiated the equilibrium current induced by glutamate in a dose-dependent manner. PEPA was much potent than aniracetam at these receptors and showed the effect on glutamate-induced desensitization even at a concentration as low as 3 microM. PEPA also potentiated non

  13. Dopamine D1 vs D5 receptor-dependent induction of seizures in relation to DARPP-32, ERK1/2 and GluR1-AMPA signalling

    PubMed Central

    O’Sullivan, Gerard J.; Dunleavy, Mark; Hakansson, Kerstin; Clementi, Mario; Kinsella, Anthony; Croke, David T.; Drago, John; Fienberg, Allen A.; Greengard, Paul; Sibley, David R.; Fisone, Gilberto; Henshall, David C.; Waddington, John L.

    2013-01-01

    Summary Recent reports have shown that the selective dopamine D1-like agonist SKF 83822 [which stimulates adenylate cyclase, but not phospholipase C] induces prominent behavioral seizures in mice, whereas its benzazepine congener SKF 83959 [which stimulates phospholipase C, but not adenylate cyclase] does not. To investigate the relative involvement of D1 vs D5 receptors in mediating seizures, ethological behavioral topography and cortical EEGs were recorded in D1, D5 and DARPP-32 knockout mice in response to a convulsant dose of SKF 83822. SKF 83822-induced behavioral and EEG seizures were gene dose-dependently abolished in D1 knockouts. In both heterozygous and homozygous D5 knockouts, the latency to first seizure was significantly increased and total EEG seizures were reduced relative to wild-types. The majority (60%) of homozygous DARPP-32 knockouts did not have seizures; of those having seizures (40%), the latency to first seizure was significantly increased and the number of high amplitude, high frequency polyspike EEG events was reduced. In addition, immunoblotting was performed to investigate downstream intracellular signalling mechanisms at D1-like receptors following challenge with SKF 83822 and SKF 83959. In wild-types administered SKF 83822, levels of ERK1/2 and GluR1 AMPA receptor phosphorylation increased two-fold in both the striatum and hippocampus; in striatal slices DARPP-32 phosphorylation at Thr34 increased five-fold relative to vehicle-treated controls. These findings indicate that D1, and to a lesser extent D5, receptor coupling to DARPP-32, ERK1/2 and glutamatergic signalling is involved in mediating the convulsant effects of SKF 83822. PMID:18367215

  14. Regulation of cellular plasticity and resilience by mood stabilizers: the role of AMPA receptor trafficking

    PubMed Central

    Du, Jing; Quiroz, Jorge A.; Gray, Neil A.; Szabo, Steve T.; Zarate Jr, Carlos A.; Manji, Husseini K.

    2004-01-01

    There is increasing evidence from a variety of sources that severe mood disorders are associated with regional reductions in brain volume, as well as reductions in the number, size, and density of glia and neurons in discrete brain areas. Although the precise pathophysiology underlying these morphometric changes remains to be fully elucidated, the data suggest that severe mood disorders are associated with impairments of structural plasticity and cellular resilience. In this context, it is noteworthy that a growing body of data suggests that the glutamaiergic system (which is known to play a major role in neuronal plasticity and cellular resilience) may be involved in the pathophysiology and treatment of mood disorders. Glutamate α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) GluR1 receptor trafficking plays a critical role in regulating various forms of neural plasticity. It is thus noteworthy that recent studies have shown that structurally dissimilar mood stabilizers lithium and valproate regulate GluR1 receptor subunit trafficking and localization at synapses. These studies suggest that regulation of glutamatergically mediated synaptic plasticity may play a role in the treatment of mood disorders, and raises the possibility that agents more directly affecting synaptic GluR1 represent novel therapies for these devastating illnesses. PMID:22034247

  15. Mechanisms of dopamine D1 receptor-mediated ERK1/2 activation in the parkinsonian striatum and their modulation by metabotropic glutamate receptor type 5.

    PubMed

    Fieblinger, Tim; Sebastianutto, Irene; Alcacer, Cristina; Bimpisidis, Zisis; Maslava, Natallia; Sandberg, Sabina; Engblom, David; Cenci, M Angela

    2014-03-26

    In animal models of Parkinson's disease, striatal overactivation of ERK1/2 via dopamine (DA) D1 receptors is the hallmark of a supersensitive molecular response associated with dyskinetic behaviors. Here we investigate the pathways involved in D1 receptor-dependent ERK1/2 activation using acute striatal slices from rodents with unilateral 6-hydroxydopamine (6-OHDA) lesions. Application of the dopamine D1-like receptor agonist SKF38393 induced ERK1/2 phosphorylation and downstream signaling in the DA-denervated but not the intact striatum. This response was mediated through a canonical D1R/PKA/MEK1/2 pathway and independent of ionotropic glutamate receptors but blocked by antagonists of L-type calcium channels. Coapplication of an antagonist of metabotropic glutamate receptor type 5 (mGluR5) or its downstream signaling molecules (PLC, PKC, IP3 receptors) markedly attenuated SKF38393-induced ERK1/2 activation. The role of striatal mGluR5 in D1-dependent ERK1/2 activation was confirmed in vivo in 6-OHDA-lesioned animals treated systemically with SKF38393. In one experiment, local infusion of the mGluR5 antagonist MTEP in the DA-denervated rat striatum attenuated the activation of ERK1/2 signaling by SKF38393. In another experiment, 6-OHDA lesions were applied to transgenic mice with a cell-specific knockdown of mGluR5 in D1 receptor-expressing neurons. These mice showed a blunted striatal ERK1/2 activation in response to SFK38393 treatment. Our results reveal that D1-dependent ERK1/2 activation in the DA-denervated striatum depends on a complex interaction between PKA- and Ca(2+)-dependent signaling pathways that is critically modulated by striatal mGluR5.

  16. Expression of ionotropic glutamate receptors, AMPA, kainite and NMDA, in the pigeon retina.

    PubMed

    Atoji, Yasuro

    2015-07-01

    Glutamate is an excitatory neurotransmitter in the vertebrate retina. A previous study found vesicular glutamate transporter 2 (vGluT2) mRNA in the pigeon retina, suggesting that bipolar and ganglion cells are glutamatergic. The present study examined the localization of ionotropic glutamate receptors to identify receptor cells in the pigeon retina using in situ hybridization histochemistry. Nine subunits of AMPA receptor (GluA1, GluA2, GluA3, and GluA4), kainate receptor (GluK1, GluK2, and GluK4), and NMDA receptor (GluN1 and GluN2A) were found to be expressed in the inner nuclear layer (INL) and ganglion cell layers. GluA1, GluA2, GluA3, and GluA4 were primarily expressed in the inner half of INL, and the signal intensity was strong for GluA2, GluA3, and GluA4. GluK1 was intensely expressed in the outer half of INL, whereas GluK2 and GluK4 were mainly localized in the inner half of INL. GluN1 and GluN2A were moderately expressed in the inner half of INL. Horizontal cells expressed GluA3 and GluA4, and ganglion cells expressed all subunits examined. These results suggest that the glutamatergic neurotransmission in the pigeon retina is similar to that in mammals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Functional expression of ionotropic glutamate receptors in the rabbit retinal ganglion cells.

    PubMed

    Chen, Yin-Peng; Chiao, Chuan-Chin

    2012-01-03

    It has been known that retinal ganglion cells (RGCs) with distinct morphologies have different physiological properties. It was hypothesized that different functions of RGCs may in part result from various expressions of N-methyl-d-aspartate (NMDA), α-amino-3-hydroxyl-5-methyl-isoxazole-4-propinoic acid (AMPA), and kainic acid (KA) receptors on their dendrites. In the present study, we aimed to characterize the functional expression of AMPA and NMDA receptors of morphologically identified RGCs in the wholemount rabbit retina. The agmatine (AGB) activation assay was used to reveal functional expression of ionotropic glutamate receptors after the RGCs were targeted by injecting Neurobiotin. To examine the excitability of these glutamate receptors in an agonist specific manner, the lower concentrations of AMPA (2 μM) and NMDA (100 μM) were chosen to examine G7 (ON-OFF direction selective ganglion cells) and G11 (alpha ganglion cells) types of RGCs. We found that less than 40% of G7 type RGCs had salient AGB activation when incubated with 2 μM AMPA or 100 μM NMDA. The G11 type RGCs also showed similar activation frequencies, except that all of the OFF subtype examined had no AGB permeation under the same AMPA concentration. These results suggest that RGCs with large somata (G7 and G11 types) may express various heterogeneous functional ionotropic glutamate receptors, thus in part rendering their functional diversity. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Pharmacological characterization of stress-induced hyperthermia in DBA/2 mice using metabotropic and ionotropic glutamate receptor ligands.

    PubMed

    Rorick-Kehn, Linda M; Hart, John C; McKinzie, David L

    2005-12-01

    Accumulating evidence suggests that drugs acting on the glutamatergic system may represent promising novel therapeutic targets for the treatment of anxiety disorders. The stress-induced hyperthermia paradigm has been used widely to model some of the physiological symptoms associated with anxiety disorders and has produced results that are predictive of clinical efficacy. We have modified this paradigm to measure the autonomic consequences of stress induced by the fear of predation in mice. To evaluate the efficacy of several classes of metabotropic and ionotropic glutamate receptor ligands, as well as known anxiolytics and psychotropic comparators, in attenuating predatory-stress-induced hyperthermia. Male DBA/2 mice were implanted with radiotelemetric transmitters in the peritoneal cavity to measure stress-related increases in core body temperature, following placement in a novel cage containing soiled rat shavings. Clinically active compounds such as chlordiazepoxide (5-10 mg/kg), alprazolam (0.3-3 mg/kg), and buspirone (10-30 mg/kg) exhibited an anxiolytic profile. Assessment of glutamatergic agents indicated that the mGlu1 receptor antagonist LY456236 (10-30 mg/kg), mGlu5 receptor antagonist MPEP (10-30 mg/kg), mGlu2/3 receptor agonist LY354740 (3-10 mg/kg), mGlu2 receptor potentiator LY566332 (30 and 100 mg/kg), mGlu8 receptor agonist (S)-3,4-dicarboxyphenylglycine (30-60 mg/kg), competitive NMDA receptor antagonist LY235959 (1 mg/kg), AMPA receptor antagonist GYKI-52466 (10-20 mg/kg), and glycine transporter-1 (GlyT-1) inhibitor ALX-5407 (3-10 mg/kg) dose-dependently attenuated stress-induced hyperthermia. The AMPA receptor potentiator LY451646, iGlu5 kainate receptor antagonist LY382884, glycine(B) receptor partial agonist D: -cycloserine, and GlyT-1 inhibitor ORG-24461 were ineffective in this model. Select metabotropic and ionotropic glutamate receptor ligands exhibited an anxiolytic profile, as measured by the attenuation of stress-induced hyperthermia

  19. Diverse roles for ionotropic glutamate receptors on inhibitory interneurons in developing and adult brain.

    PubMed

    Akgül, Gülcan; McBain, Chris J

    2016-10-01

    Glutamate receptor-mediated recruitment of GABAergic inhibitory interneurons is a critical determinant of network processing. Early studies observed that many, but not all, interneuron glutamatergic synapses contain AMPA receptors that are GluA2-subunit lacking and Ca(2+) permeable, making them distinct from AMPA receptors at most principal cell synapses. Subsequent studies demonstrated considerable alignment of synaptic AMPA and NMDA receptor subunit composition within specific subtypes of interneurons, suggesting that both receptor expression profiles are developmentally and functionally linked. Indeed glutamate receptor expression profiles are largely predicted by the embryonic origins of cortical interneurons within the medial and caudal ganglionic eminences of the developing telencephalon. Distinct complements of AMPA and NMDA receptors within different interneuron subpopulations contribute to the differential recruitment of functionally divergent interneuron subtypes by common afferent inputs for appropriate feed-forward and feedback inhibitory drive and network entrainment. In contrast, the lesser-studied kainate receptors, which are often present at both pre- and postsynaptic sites, appear to follow an independent developmental expression profile. Loss of specific ionotropic glutamate receptor (iGluR) subunits during interneuron development has dramatic consequences for both cellular and network function, often precipitating circuit inhibition-excitation imbalances and in some cases lethality. Here we briefly review recent findings highlighting the roles of iGluRs in interneuron development. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  20. TAAR1 Modulates Cortical Glutamate NMDA Receptor Function

    PubMed Central

    Espinoza, Stefano; Lignani, Gabriele; Caffino, Lucia; Maggi, Silvia; Sukhanov, Ilya; Leo, Damiana; Mus, Liudmila; Emanuele, Marco; Ronzitti, Giuseppe; Harmeier, Anja; Medrihan, Lucian; Sotnikova, Tatyana D; Chieregatti, Evelina; Hoener, Marius C; Benfenati, Fabio; Tucci, Valter; Fumagalli, Fabio; Gainetdinov, Raul R

    2015-01-01

    Trace Amine-Associated Receptor 1 (TAAR1) is a G protein-coupled receptor expressed in the mammalian brain and known to influence subcortical monoaminergic transmission. Monoamines, such as dopamine, also play an important role within the prefrontal cortex (PFC) circuitry, which is critically involved in high-o5rder cognitive processes. TAAR1-selective ligands have shown potential antipsychotic, antidepressant, and pro-cognitive effects in experimental animal models; however, it remains unclear whether TAAR1 can affect PFC-related processes and functions. In this study, we document a distinct pattern of expression of TAAR1 in the PFC, as well as altered subunit composition and deficient functionality of the glutamate N-methyl-D-aspartate (NMDA) receptors in the pyramidal neurons of layer V of PFC in mice lacking TAAR1. The dysregulated cortical glutamate transmission in TAAR1-KO mice was associated with aberrant behaviors in several tests, indicating a perseverative and impulsive phenotype of mutants. Conversely, pharmacological activation of TAAR1 with selective agonists reduced premature impulsive responses observed in the fixed-interval conditioning schedule in normal mice. Our study indicates that TAAR1 plays an important role in the modulation of NMDA receptor-mediated glutamate transmission in the PFC and related functions. Furthermore, these data suggest that the development of TAAR1-based drugs could provide a novel therapeutic approach for the treatment of disorders related to aberrant cortical functions. PMID:25749299

  1. Metabotropic glutamate receptors as therapeutic targets in Parkinson's disease: An update from the last 5 years of research.

    PubMed

    Litim, Nadhir; Morissette, Marc; Di Paolo, Thérèse

    2017-03-15

    Disturbance of glutamate neurotransmission in Parkinson's disease (PD) and l-DOPA induced dyskinesia (LID) is well documented. This review focuses on advances during the past five years on pharmacological modulation of metabotropic glutamate (mGlu) receptors in relation to anti-parkinsonian activity, LID attenuation, and neuroprotection. Drug design and characterization have led to the development of orthosteric agonists binding the same site as glutamate and Positive and Negative Allosteric modulators (PAMs and NAMs) binding sites different from the orthosteric site and offering subtype selectivity. Inhibition of group I (mGlu1 and mGlu5) receptors with NAMs and activation of group II (mGlu2 and 3 receptors) and group III (mGlu 4, 7 and 8 receptors) with PAMs and orthosteric agonists have shown their potential to inhibit glutamate release and attenuate excitotoxicity. Earlier and recent studies have led to the development of mGlu5 receptors NAMs to reduce LID and for neuroprotection, mGlu3 receptor agonists for neuroprotection while mGlu4 receptor PAMs and agonists for antiparkinsonian effects and neuroprotection. Furthermore, homo- and heterodimers of mGlu receptors are documented and highlight the complexity of the functioning of these receptors. Research on partial allosteric modulators and biased mGlu receptor allosteric modulators offer new glutamatergic drugs with better therapeutic effects and less off target adverse activity. Thus these various mGlu receptor targets will enable the development of novel drugs with improved clinical effects for normalization of glutamate transmission, treat PD and LID relief. This article is part of the Special Issue entitled 'Metabotropic Glutamate Receptors, 5 years on'. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes

    DOE PAGES

    Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...

    2015-10-12

    Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less

  3. Dynamics of Learning in Cultured Neuronal Networks with Antagonists of Glutamate Receptors

    PubMed Central

    Li, Yanling; Zhou, Wei; Li, Xiangning; Zeng, Shaoqun; Luo, Qingming

    2007-01-01

    Cognitive dysfunction may result from abnormality of ionotropic glutamate receptors. Although various forms of synaptic plasticity in learning that rely on altering of glutamate receptors have been considered, the evidence is insufficient from an informatics view. Dynamics could reflect neuroinformatics encoding, including temporal pattern encoding, spatial pattern encoding, and energy distribution. Discovering informatics encoding is fundamental and crucial to understanding the working principle of the neural system. In this article, we analyzed the dynamic characteristics of response activities during learning training in cultured hippocampal networks under normal and abnormal conditions of ionotropic glutamate receptors, respectively. The rate, which is one of the temporal configurations, was decreased markedly by inhibition of α-amino-3-hydroxy-5-methylisoxazole-4-proprionic acid (AMPA) receptors. Moreover, the energy distribution in different characteristic frequencies was changed markedly by inhibition of AMPA receptors. Spatial configurations, including regularization, correlation, and synchrony, were changed significantly by inhibition of N-methyl-d-aspartate receptors. These results suggest that temporal pattern encoding and energy distribution of response activities in cultured hippocampal neuronal networks during learning training are modulated by AMPA receptors, whereas spatial pattern encoding of response activities is modulated by N-methyl-d-aspartate receptors. PMID:17766359

  4. Conformation changes in the Glutamate receptor as studied by LRET

    NASA Astrophysics Data System (ADS)

    Jayaraman, Vasanthi

    2009-03-01

    Glutamate receptors are the primary mediators of excitatory neurotransmission in the mammalian central nervous system. Glutamate binding to an extracellular ligand binding domain initiates a series of conformational changes that results in the formation of cation selective transmembrane ion channels that ultimately desensitize. We have used luminescence resonance energy transfer to determine the conformational changes that underlie the allosteric process of glutamate mediated gating in the receptor. These investigations showed that agonist binding induced cleft closure in the ligand binding domain confirming that this change observed in the isolated ligand binding domain of the receptor is one of the mechanisms by which agonist mediates activation. The LRET investigations also allowed a study of the conformational changes between the subunits. The apo state of the protein showed a dimer interface that was open. The dimer interface was brought together only in the activated state, suggesting that cleft closure drives the formation of the contacts at dimer interface, which in turn transiently stabilizes the open channel. At longer times, the stress induced by the transmembrane segments, ultimately drives the breakdown of the interface, leading to channel closure and receptor desensitization.

  5. Pharmacological Analysis of Ionotropic Glutamate Receptor Function in Neuronal Circuits of the Zebrafish Olfactory Bulb

    PubMed Central

    Tabor, Rico; Friedrich, Rainer W.

    2008-01-01

    Although synaptic functions of ionotropic glutamate receptors in the olfactory bulb have been studied in vitro, their roles in pattern processing in the intact system remain controversial. We therefore examined the functions of ionotropic glutamate receptors during odor processing in the intact olfactory bulb of zebrafish using pharmacological manipulations. Odor responses of mitral cells and interneurons were recorded by electrophysiology and 2-photon Ca2+ imaging. The combined blockade of AMPA/kainate and NMDA receptors abolished odor-evoked excitation of mitral cells. The blockade of AMPA/kainate receptors alone, in contrast, increased the mean response of mitral cells and decreased the mean response of interneurons. The blockade of NMDA receptors caused little or no change in the mean responses of mitral cells and interneurons. However, antagonists of both receptor types had diverse effects on the magnitude and time course of individual mitral cell and interneuron responses and, thus, changed spatio-temporal activity patterns across neuronal populations. Oscillatory synchronization was abolished or reduced by AMPA/kainate and NMDA receptor antagonists, respectively. These results indicate that (1) interneuron responses depend mainly on AMPA/kainate receptor input during an odor response, (2) interactions among mitral cells and interneurons regulate the total olfactory bulb output activity, (3) AMPA/kainate receptors participate in the synchronization of odor-dependent neuronal ensembles, and (4) ionotropic glutamate receptor-containing synaptic circuits shape odor-specific patterns of olfactory bulb output activity. These mechanisms are likely to be important for the processing of odor-encoding activity patterns in the olfactory bulb. PMID:18183297

  6. A2A-D2 receptor-receptor interaction modulates gliotransmitter release from striatal astrocyte processes.

    PubMed

    Cervetto, Chiara; Venturini, Arianna; Passalacqua, Mario; Guidolin, Diego; Genedani, Susanna; Fuxe, Kjell; Borroto-Esquela, Dasiel O; Cortelli, Pietro; Woods, Amina; Maura, Guido; Marcoli, Manuela; Agnati, Luigi F

    2017-01-01

    Evidence for striatal A2A-D2 heterodimers has led to a new perspective on molecular mechanisms involved in schizophrenia and Parkinson's disease. Despite the increasing recognition of astrocytes' participation in neuropsychiatric disease vulnerability, involvement of striatal astrocytes in A2A and D2 receptor signal transmission has never been explored. Here, we investigated the presence of D2 and A2A receptors in isolated astrocyte processes prepared from adult rat striatum by confocal imaging; the effects of receptor activation were measured on the 4-aminopyridine-evoked release of glutamate from the processes. Confocal analysis showed that A2A and D2 receptors were co-expressed on the same astrocyte processes. Evidence for A2A-D2 receptor-receptor interactions was obtained by measuring the release of the gliotransmitter glutamate: D2 receptors inhibited the glutamate release, while activation of A2A receptors, per se ineffective, abolished the effect of D2 receptor activation. The synthetic D2 peptide VLRRRRKRVN corresponding to the receptor region involved in electrostatic interaction underlying A2A-D2 heteromerization abolished the ability of the A2A receptor to antagonize the D2 receptor-mediated effect. Together, the findings are consistent with heteromerization of native striatal astrocytic A2A-D2 receptors that via allosteric receptor-receptor interactions could play a role in the control of striatal glutamatergic transmission. These new findings suggest possible new pathogenic mechanisms and/or therapeutic approaches to neuropsychiatric disorders. © 2016 International Society for Neurochemistry.

  7. Dopamine alters glutamate receptor desensitization in retinal horizontal cells of the perch (Perca fluviatilis).

    PubMed Central

    Schmidt, K F; Kruse, M; Hatt, H

    1994-01-01

    The patch-clamp technique in combination with a fast liquid filament application system was used to study the effect of dopamine on the glutamate receptor desensitization in horizontal cells of the perch (Perca fluviatilis). Kinetics of ligand-gated ion channels in fish horizontal cells are modulated by dopamine. This modulation is presumably mediated by a cAMP-dependent protein phosphorylation. Before incubation with dopamine, the glutamate receptors of horizontal cells activate and desensitize with fast time constants. In the whole-cell recording mode, fast application of the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid prior to the dopamine incubation gives rise to fast transient currents with peak values of about 200 pA that desensitize within 100 ms. Kainate as agonist produced higher steady-state currents but no transient currents. After incubation of the cells with dopamine for 3 min, the desensitization was significantly reduced and the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid induced steady-state currents with amplitudes that were similar to the previously observed transient currents. Kainate-induced currents were only slightly affected. Fast desensitizing currents upon fast application of L-glutamate were also recorded from outside-out patches that were excised from horizontal cells before incubation with dopamine. The currents from excised patches desensitized to a steady-state level of about 0.2 of the peak amplitude with time constants of less than 2 ms. When the outside-out patches were excised from cells after dopamine incubation, steady-state currents were enhanced and no transient currents were observed. The results may indicate that the dopamine-dependent modulation of glutamate-induced currents, which is presumably mediated by a protein phosphorylation, is due to an alteration of the desensitization of the glutamate receptors. PMID:7520178

  8. Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases.

    PubMed

    Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A; Jenkins, Andrew; Traynelis, Stephen F

    2015-07-01

    The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. Copyright © 2015 by The American Society for Pharmacology and Experimental

  9. Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases

    PubMed Central

    Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A.; Jenkins, Andrew

    2015-01-01

    The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. PMID:25904555

  10. The effect of adenosine A(2A) receptor antagonists on hydroxyl radical, dopamine, and glutamate in the striatum of rats with altered function of VMAT2.

    PubMed

    Gołembiowska, Krystyna; Dziubina, Anna

    2012-08-01

    It has been shown that a decreased vesicular monoamine transporter (VMAT2) function and the disruption of dopamine (DA) storage is an early contributor to oxidative damage of dopamine neurons in Parkinson's disease (PD). In our previous study, we demonstrated that adenosine A(2A) receptor antagonists suppressed oxidative stress in 6-hydroxydopamine-treated rats suggesting that this effect may account for neuroprotective properties of drugs. In the present study, rats were injected with reserpine (10 mg/kg sc) and 18 h later the effect of the adenosine A(2A) receptor antagonists 8-(3-chlorostyryl)caffeine (CSC) and 4-(2-[7-amino-2-(2-furyl)[1,2,4]triazolo[2,3-a][1,3,5]triazin-5-ylamino]ethyl)phenol (ZM 241385) on extracellular DA, glutamate and hydroxyl radical formation was studied in the rat striatum using in vivo microdialysis. By disrupting VMAT2 function, reserpine depleted DA stores, and increased glutamate and hydroxyl radical levels in the rat striatum. CSC (1 mg/kg) but not ZM 241385 (3 mg/kg) increased extracellular DA level and production of hydroxyl radical in reserpinised rats. Both antagonists decreased the reserpine-induced increase in extracellular glutamate. L-3,4-Dihydroxyphenylalanine (L-DOPA) (25 mg/kg) significantly enhanced extracellular DA, had no effect on reserpine-induced hydroxyl radical production and decreased extracellular glutamate concentration. CSC but not ZM 241385 given jointly with L-DOPA increased the effect of L-DOPA on extracellular DA and augmented the reserpine-induced hydroxyl radical production. CSC and ZM 241385 did not influence extracellular glutamate level, which was decreased by L-DOPA. It seems that by decreasing the MAO-dependent DA metabolism rate, CSC raised cytosolic DA and by DA autoxidation, it induced hydroxyl radical overproduction. Thus, the methylxanthine A(2A) receptor antagonists bearing properties of MAO-B inhibitor, like CSC, may cause a risk of oxidative stress resulting from dysfunctional DA storage

  11. Controlling ionotropic and metabotropic glutamate receptors with light: principles and potential

    PubMed Central

    Reiner, Andreas; Levitz, Joshua; Isacoff, Ehud Y.

    2014-01-01

    Light offers unique advantages for studying and manipulating biomolecules and the cellular processes that they control. Optical control of ionotropic and metabotropic glutamate receptors has garnered significant interest, since these receptors are central to signaling at neuronal synapses and only optical approaches provide the spatial and temporal resolution required to directly probe receptor function in cells and tissue. Following the classical method of glutamate photo-uncaging, recently developed methods have added other forms of remote control, including those with high molecular specificity and genetic targeting. These tools open the door to the direct optical control of synaptic transmission and plasticity, as well as the probing of native receptor function in intact neural circuits. PMID:25573450

  12. Regulation of Hypothalamic Presympathetic Neurons and Sympathetic Outflow by Group II Metabotropic Glutamate Receptors in Spontaneously Hypertensive Rats.

    PubMed

    Ye, Zeng-You; Li, De-Pei; Pan, Hui-Lin

    2013-08-01

    Increased glutamatergic input in the hypothalamic paraventricular nucleus (PVN) plays an important role in the development of hypertension. Group II metabotropic glutamate receptors are expressed in the PVN, but their involvement in regulating synaptic transmission and sympathetic outflow in hypertension is unclear. Here, we show that the group II metabotropic glutamate receptors agonist (2S,2'R,3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG-IV) produced a significantly greater reduction in the frequency of spontaneous and miniature excitatory postsynaptic currents and in the amplitude of electrically evoked excitatory postsynaptic currents in retrogradely labeled spinally projecting PVN neurons in spontaneously hypertensive rats (SHRs) than in normotensive control rats. DCG-IV similarly decreased the frequency of GABAergic inhibitory postsynaptic currents of labeled PVN neurons in the 2 groups of rats. Strikingly, DCG-IV suppressed the firing of labeled PVN neurons only in SHRs. DCG-IV failed to inhibit the firing of PVN neurons of SHRs in the presence of ionotropic glutamate receptor antagonists. Lowering blood pressure with celiac ganglionectomy in SHRs normalized the DCG-IV effect on excitatory postsynaptic currents to the same level seen in control rats. Furthermore, microinjection of DCG-IV into the PVN significantly reduced blood pressure and sympathetic nerve activity in SHRs. Our findings provide new information that presynaptic group II metabotropic glutamate receptor activity at the glutamatergic terminals increases in the PVN in SHRs. Activation of group II metabotropic glutamate receptors in the PVN inhibits sympathetic vasomotor tone through attenuation of increased glutamatergic input and neuronal hyperactivity in SHRs.

  13. Regulation of dopamine D1 receptor dynamics within the postsynaptic density of hippocampal glutamate synapses.

    PubMed

    Ladepeche, Laurent; Yang, Luting; Bouchet, Delphine; Groc, Laurent

    2013-01-01

    Dopamine receptor potently modulates glutamate signalling, synaptic plasticity and neuronal network adaptations in various pathophysiological processes. Although key intracellular signalling cascades have been identified, the cellular mechanism by which dopamine and glutamate receptor-mediated signalling interplay at glutamate synapse remain poorly understood. Among the cellular mechanisms proposed to aggregate D1R in glutamate synapses, the direct interaction between D1R and the scaffold protein PSD95 or the direct interaction with the glutamate NMDA receptor (NMDAR) have been proposed. To tackle this question we here used high-resolution single nanoparticle imaging since it provides a powerful way to investigate at the sub-micron resolution the dynamic interaction between these partners in live synapses. We demonstrate in hippocampal neuronal networks that dopamine D1 receptors (D1R) laterally diffuse within glutamate synapses, in which their diffusion is reduced. Disrupting the interaction between D1R and PSD95, through genetical manipulation and competing peptide, did not affect D1R dynamics in glutamatergic synapses. However, preventing the physical interaction between D1R and the GluN1 subunit of NMDAR abolished the synaptic stabilization of diffusing D1R. Together, these data provide direct evidence that the interaction between D1R and NMDAR in synapses participate in the building of the dopamine-receptor-mediated signalling, and most likely to the glutamate-dopamine cross-talk.

  14. Molecular Basis for Modulation of Metabotropic Glutamate Receptors and Their Drug Actions by Extracellular Ca2+

    PubMed Central

    Zou, Juan; Jiang, Jason Y.; Yang, Jenny J.

    2017-01-01

    Metabotropic glutamate receptors (mGluRs) associated with the slow phase of the glutamatergic signaling pathway in neurons of the central nervous system have gained importance as drug targets for chronic neurodegenerative diseases. While extracellular Ca2+ was reported to exhibit direct activation and modulation via an allosteric site, the identification of those binding sites was challenged by weak binding. Herein, we review the discovery of extracellular Ca2+ in regulation of mGluRs, summarize the recent developments in probing Ca2+ binding and its co-regulation of the receptor based on structural and biochemical analysis, and discuss the molecular basis for Ca2+ to regulate various classes of drug action as well as its importance as an allosteric modulator in mGluRs. PMID:28335551

  15. NMDA-Type Glutamate Receptor Activation Promotes Vascular Remodeling and Pulmonary Arterial Hypertension.

    PubMed

    Dumas, Sébastien J; Bru-Mercier, Gilles; Courboulin, Audrey; Quatredeniers, Marceau; Rücker-Martin, Catherine; Antigny, Fabrice; Nakhleh, Morad K; Ranchoux, Benoit; Gouadon, Elodie; Vinhas, Maria-Candida; Vocelle, Matthieu; Raymond, Nicolas; Dorfmüller, Peter; Fadel, Elie; Perros, Frédéric; Humbert, Marc; Cohen-Kaminsky, Sylvia

    2018-05-29

    Excessive proliferation and apoptosis resistance in pulmonary vascular cells underlie vascular remodeling in pulmonary arterial hypertension (PAH). Specific treatments for PAH exist, mostly targeting endothelial dysfunction, but high pulmonary arterial pressure still causes heart failure and death. Pulmonary vascular remodeling may be driven by metabolic reprogramming of vascular cells to increase glutaminolysis and glutamate production. The N -methyl-d-aspartate receptor (NMDAR), a major neuronal glutamate receptor, is also expressed on vascular cells, but its role in PAH is unknown. We assessed the status of the glutamate-NMDAR axis in the pulmonary arteries of patients with PAH and controls through mass spectrometry imaging, Western blotting, and immunohistochemistry. We measured the glutamate release from cultured pulmonary vascular cells using enzymatic assays and analyzed NMDAR regulation/phosphorylation through Western blot experiments. The effect of NMDAR blockade on human pulmonary arterial smooth muscle cell proliferation was determined using a BrdU incorporation assay. We assessed the role of NMDARs in vascular remodeling associated to pulmonary hypertension, in both smooth muscle-specific NMDAR knockout mice exposed to chronic hypoxia and the monocrotaline rat model of pulmonary hypertension using NMDAR blockers. We report glutamate accumulation, upregulation of the NMDAR, and NMDAR engagement reflected by increases in GluN1-subunit phosphorylation in the pulmonary arteries of human patients with PAH. K v channel inhibition and type A-selective endothelin receptor activation amplified calcium-dependent glutamate release from human pulmonary arterial smooth muscle cell, and type A-selective endothelin receptor and platelet-derived growth factor receptor activation led to NMDAR engagement, highlighting crosstalk between the glutamate-NMDAR axis and major PAH-associated pathways. The platelet-derived growth factor-BB-induced proliferation of human

  16. Controlling ionotropic and metabotropic glutamate receptors with light: principles and potential.

    PubMed

    Reiner, Andreas; Levitz, Joshua; Isacoff, Ehud Y

    2015-02-01

    Light offers unique advantages for studying and manipulating biomolecules and the cellular processes that they control. Optical control of ionotropic and metabotropic glutamate receptors has garnered significant interest, since these receptors are central to signaling at neuronal synapses and only optical approaches provide the spatial and temporal resolution required to directly probe receptor function in cells and tissue. Following the classical method of glutamate photo-uncaging, recently developed methods have added other forms of remote control, including those with high molecular specificity and genetic targeting. These tools open the door to the direct optical control of synaptic transmission and plasticity, as well as the probing of native receptor function in intact neural circuits. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Effects of Chronic Alcohol Exposure on the Modulation of Ischemia-Induced Glutamate Release via Cannabinoid Receptors in the Dorsal Hippocampus.

    PubMed

    Zheng, Lei; Wu, Xiaoda; Dong, Xiao; Ding, Xinli; Song, Cunfeng

    2015-10-01

    Chronic alcohol consumption is a critical contributing factor to ischemic stroke, as it enhances ischemia-induced glutamate release, leading to more severe excitotoxicity and brain damage. But the neural mechanisms underlying this phenomenon are poorly understood. We evaluated the effects of chronic alcohol exposure on the modulation of ischemia-induced glutamate release via CB1 and CB2 cannabinoid receptors during middle cerebral artery occlusion, using in vivo microdialysis coupled with high-performance liquid chromatography, in alcohol-naïve rats or rats after 1 or 30 days of withdrawal from chronic ethanol intake (6% v/v for 14 days). Intra-dorsal hippocampus (DH) infusions of ACEA or JWH133, selective CB1 or CB2 receptor agonists, respectively, decreased glutamate release in the DH in alcohol-naïve rats in a dose-dependent manner. Such an effect was reversed by co-infusions of SR141716A or AM630, selective CB1 or CB2 receptor antagonists, respectively. After 30 days, but not 1 day of withdrawal, ischemia induced an enhancement in glutamate release in the DH, as compared with non-alcohol-treated control group. Intra-DH infusions of JWH133, but not ACEA, inhibited ischemia-induced glutamate release in the DH after 30 days of withdrawal. Finally, 1 day of withdrawal did not alter the protein level of CB1 or CB2 receptors in the DH, as compared to non-alcohol-treated control rats. Whereas 30 days of withdrawal robustly decreased the protein level of CB1 receptors, but failed to alter the protein level of CB2 receptors, in the DH, as compared to non-alcohol-treated control rats. Together, these findings suggest that loss of expression/function of CB1 receptors, but not CB2 receptors in the DH, is correlated with the enhancement of ischemia-induced glutamate release after prolonged alcohol withdrawal. Copyright © 2015 by the Research Society on Alcoholism.

  18. [60]Fullerene derivative modulates adenosine and metabotropic glutamate receptors gene expression: a possible protective effect against hypoxia

    PubMed Central

    2014-01-01

    Background Glutamate, the main excitatory neurotransmitter, is involved in learning and memory processes but at higher concentration results excitotoxic causing degeneration and neuronal death. Adenosine is a nucleoside that exhibit neuroprotective effects by modulating of glutamate release. Hypoxic and related oxidative conditions, in which adenosine and metabotropic glutamate receptors are involved, have been demonstrated to contribute to neurodegenerative processes occurring in certain human pathologies. Results Human neuroblastoma cells (SH-SY5Y) were used to evaluate the long time (24, 48 and 72 hours) effects of a [60]fullerene hydrosoluble derivative (t3ss) as potential inhibitor of hypoxic insult. Low oxygen concentration (5% O2) caused cell death, which was avoided by t3ss exposure in a concentration dependent manner. In addition, gene expression analysis by real time PCR of adenosine A1, A2A and A2B and metabotropic glutamate 1 and 5 receptors revealed that t3ss significantly increased A1 and mGlu1 expression in hypoxic conditions. Moreover, t3ss prevented the hypoxia-induced increase in A2A mRNA expression. Conclusions As t3ss causes overexpression of adenosine A1 and metabotropic glutamate receptors which have been shown to be neuroprotective, our results point to a radical scavenger protective effect of t3ss through the enhancement of these neuroprotective receptors expression. Therefore, the utility of these nanoparticles as therapeutic target to avoid degeneration and cell death of neurodegenerative diseases is suggested. PMID:25123848

  19. Opposing effects of AMPA and 5-HT1A receptor blockade on passive avoidance and object recognition performance: correlation with AMPA receptor subunit expression in rat hippocampus.

    PubMed

    Schiapparelli, L; Simón, A M; Del Río, J; Frechilla, D

    2006-06-01

    It has been suggested that antagonists at serotonin 5-HT1A receptors may exert a procognitive effect by facilitating glutamatergic neurotransmission. Here we further explored this issue by looking for the ability of a 5-HT1A antagonist to prevent the learning deficit induced by AMPA receptor blockade in two behavioural procedures in rats, and for concomitant molecular changes presumably involved in memory formation in the hippocampus. Pretraining administration of the competitive AMPA receptor antagonist, NBQX, produced a dose-related retention impairment in a passive avoidance task 24h later, and also impaired retention in a novel object recognition test when an intertrial interval of 3h was selected. Pretreatment with the selective 5-HT1A receptor antagonist, WAY-100635, prevented the learning deficit induced by NBQX in the two behavioural procedures. In biochemical studies performed on rat hippocampus after the retention tests, we found that learning increased the membrane levels of AMPA receptor GluR1 and GluR2/3 subunits, as well as the phosphorylated forms of GluR1, effects that were abolished by NBQX administration before the training session. Pretreatment with WAY-100635 counteracted the NBQX effects and restored the initial learning-specific increase in Ca2+/calmodulin-dependent protein kinase II (CaMKII) function and the later increase in GluR2/3 and phosphorylated GluR1 surface expression. Moreover, administration of WAY-100635 before object recognition training improved recognition memory 24h later and potentiated the learning-associated increase in AMPA receptor subunits. The results support the proposed utility of 5-HT1A antagonists in the treatment of cognitive disorders.

  20. Metabotropic Glutamate 7 (mGlu7) Receptor: A Target for Medication Development for the Treatment of Cocaine Dependence

    PubMed Central

    Li, Xia; Xi, Zheng-Xiong; Markou, Athina

    2013-01-01

    Brain glutamate has been shown to play an important role in reinstatement to drug seeking, a behavior considered to be of relevance to relapse to drug taking in humans. Therefore, glutamate receptors, in particular metabotropic glutamate (mGlu) receptors, have become important targets for medication development for the treatment of drug dependence. In this review article, we focus on the mGlu7 receptor subtype, and discuss recent findings with AMN082, a selective mGlu7 receptor allosteric agonist, in animal models with relevance to drug dependence. Systemic or local administration of AMN082 into the nucleus accumbens (NAc), a critical brain region involved in reward and drug dependence processes, inhibited the reinforcing and motivational effects of cocaine, heroin and ethanol, as assessed by the intravenous drug self-administration procedure. In addition, AMN082 inhibited the reward-enhancing effects induced by cocaine, as assessed in the intracranial self-stimulation procedure, and cocaine- or cue-induced reinstatement of drug-seeking behavior. In vivo microdialysis studies indicated that systemic or intra-NAc administration of AMN082 significantly decreased extracellular γ-aminobutyric acid (GABA) and elevated extracellular glutamate, but had no effect on extracellular dopamine in the NAc, suggesting that a non-dopaminergic mechanism underlies the effects of AMN082 on the actions of cocaine. Further, data indicated that AMN082-induced changes in glutamate were the net effect of two actions: one is the direct inhibition of glutamate release by activation of mGlu7 receptors on glutamatergic neurons; another is the indirect increases of glutamate release mediated by decreases in GABA transmission. These increases in extracellular glutamate functionally antagonized cocaine-induced inhibition of NAc-ventral pallidum GABAergic neurotransmission, and therefore, the rewarding effects of cocaine. In addition, elevated extracellular glutamate activated presynaptic mGlu2

  1. Ionotropic receptors (IRs): chemosensory ionotropic glutamate receptors in Drosophila and beyond.

    PubMed

    Rytz, Raphael; Croset, Vincent; Benton, Richard

    2013-09-01

    Ionotropic Receptors (IRs) are a recently characterized family of olfactory receptors in the fruit fly, Drosophila melanogaster. IRs are not related to insect Odorant Receptors (ORs), but rather have evolved from ionotropic glutamate receptors (iGluRs), a conserved family of synaptic ligand-gated ion channels. Here, we review the expression and function of IRs in Drosophila, highlighting similarities and differences with iGluRs. We also briefly describe the organization of the neuronal circuits in which IRs function, comparing and contrasting them with the sensory pathways expressing ORs. Finally, we summarize the bioinformatic identification and initial characterization of IRs in other species, which imply an evolutionarily conserved role for these receptors in chemosensation in insects and other protostomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Glutamate metabotropic receptors as targets for drug therapy in epilepsy.

    PubMed

    Moldrich, Randal X; Chapman, Astrid G; De Sarro, Giovambattista; Meldrum, Brian S

    2003-08-22

    Metabotropic glutamate (mGlu) receptors have multiple actions on neuronal excitability through G-protein-linked modifications of enzymes and ion channels. They act presynaptically to modify glutamatergic and gamma-aminobutyric acid (GABA)-ergic transmission and can contribute to long-term changes in synaptic function. The recent identification of subtype-selective agonists and antagonists has permitted evaluation of mGlu receptors as potential targets in the treatment of epilepsy. Agonists acting on group I mGlu receptors (mGlu1 and mGlu5) are convulsant. Antagonists acting on mGlu1 or mGlu5 receptors are anticonvulsant against 3,5-dihydroxyphenylglycine (DHPG)-induced seizures and in mouse models of generalized motor seizures and absence seizures. The competitive, phenylglycine mGlu1/5 receptor antagonists generally require intracerebroventricular administration for potent anticonvulsant efficacy but noncompetitive antagonists, e.g., (3aS,6aS)-6a-naphthalen-2-ylmethyl-5-methyliden-hexahydrocyclopenta[c]furan-1-on (BAY36-7620), 2-methyl-6-(phenylethynyl)pyridine hydrochloride (MPEP), and 2-methyl-6-(2-phenylethenyl)pyridine (SIB-1893) block generalized seizures with systemic administration. Agonists acting on group II mGlu receptors (mGlu2, mGlu3) to reduce glutamate release are anticonvulsant, e.g., 2R,4R-aminopyrrolidine-2,4-dicarboxylate [(2R,4R)-APDC], (+)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylic acid (LY354740), and (-)-2-oxa-4-aminobicyclo[3.1.0]hexane-4,6-dicarboxylate (LY379268). The classical agonists acting on group III mGlu receptors such as L-(+)-2-amino-4-phosphonobutyric acid, and L-serine-O-phosphate are acutely proconvulsant with some anticonvulsant activity. The more recently identified agonists (R,S)-4-phosphonophenylglycine [(R,S)-PPG] and (S)-3,4-dicarboxyphenylglycine [(S)-3,4-DCPG] and (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid [ACPT-1] are all anticonvulsant without proconvulsant effects. Studies in animal models of kindling

  3. Different effects of ionotropic and metabotropic glutamate receptor antagonists on attention and the attentional properties of nicotine.

    PubMed

    Quarta, Davide; Naylor, Christopher G; Morris, Hannah V; Patel, Swital; Genn, Rachel F; Stolerman, Ian P

    2007-09-01

    Distinct lines of evidence indicate that glutamate plays a primary role in modulating cognitive functions. Notably, competitive glutamate receptor antagonists acting at ionotropic N-methyl-d-aspartate (NMDA) or metabotropic glutamate 5 (mGlu5) receptors impair cognitive performance. Conversely, nicotine and other psychostimulants stimulate glutamatergic mechanisms and can act as cognitive enhancers. Hence we analysed the role of glutamate in performance of an attentional task and in nicotine-induced enhancement of attention by using the rodent five-choice serial reaction time task (5-CSRTT). Rats were trained to criterion performance and were then pre-dosed with either vehicle, the NMDA receptor antagonist (+)3-(2-carboxypiperazin-4-propyl)-1-propenyl-1-phosphonic acid (CPP, 0.3-2.0 mg/kg) or the mGlu5 antagonist 2-methyl-6-phenylethynyl-pyridine (MPEP, 1.0-9.0 mg/kg) and challenged with nicotine (0.2 mg/kg). Nicotine improved attentional performance, an effect that was weakened by doses of CPP that themselves had little impact on performance; importantly, CPP dose-dependently blunted the ability of nicotine to improve response accuracy, the major measure of signal detection in the paradigm. MPEP dose-dependently impaired signal detection under conditions with a high attentional load, an effect that was reversed by nicotine; thus, MPEP did not block nicotine-induced attentional enhancement. Co-administration of either CPP or MPEP with nicotine also produced a general slowing of performance characterised by increases in omission errors and response latencies and reduced anticipatory responding. It is concluded that activation of NMDA receptors may be an important determinant of the effects of nicotine in the 5-CSRTT. Stimulation of nicotinic receptors may also reverse attentional deficits associated with the impaired function of the glutamate network.

  4. Ciproxifan, a histamine H{sub 3} receptor antagonist and inverse agonist, presynaptically inhibits glutamate release in rat hippocampus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Cheng-Wei; Lin, Tzu-Yu

    2017-03-15

    Ciproxifan is an H{sub 3} receptor antagonist and inverse agonist with antipsychotic effects in several preclinical models; its effect on glutamate release has been investigated in the rat hippocampus. In a synaptosomal preparation, ciproxifan reduced 4-aminopyridine (4-AP)-evoked Ca{sup 2+}-dependent glutamate release and cytosolic Ca{sup 2+} concentration elevation but did not affect the membrane potential. The inhibitory effect of ciproxifan on 4-AP-evoked glutamate release was prevented by the Gi/Go-protein inhibitor pertussis toxin and Ca{sub v}2.2 (N-type) and Ca{sub v}2.1 (P/Q-type) channel blocker ω-conotoxin MVIIC, but was not affected by the intracellular Ca{sup 2+}-release inhibitors dantrolene and CGP37157. Furthermore, the phospholipase A{submore » 2} (PLA{sub 2}) inhibitor OBAA, prostaglandin E{sub 2} (PGE{sub 2}), PGE2 subtype 2 (EP{sub 2}) receptor antagonist PF04418948, and extracellular signal-regulated kinase (ERK) inhibitor FR180204 eliminated the inhibitory effect of ciproxifan on glutamate release. Ciproxifan reduced the 4-AP-evoked phosphorylation of ERK and synapsin I, a presynaptic target of ERK. The ciproxifan-mediated inhibition of glutamate release was prevented in synaptosomes from synapsin I-deficient mice. Moreover, ciproxifan reduced the frequency of miniature excitatory postsynaptic currents without affecting their amplitude in hippocampal slices. Our data suggest that ciproxifan, acting through the blockade of Gi/Go protein-coupled H{sub 3} receptors present on hippocampal nerve terminals, reduces voltage-dependent Ca{sup 2+} entry by diminishing PLA{sub 2}/PGE{sub 2}/EP{sub 2} receptor pathway, which subsequently suppresses the ERK/synapsin I cascade to decrease the evoked glutamate release. - Highlights: • Ciproxifan presynaptically reduces glutamate release in the hippocampus in vitro. • Decrease in voltage-dependent Ca{sup 2+} influx is involved. • A role for the PLA{sub 2}/PGE{sub 2}/EP{sub 2} pathway in the action of

  5. Radial symmetry in a chimeric glutamate receptor pore

    NASA Astrophysics Data System (ADS)

    Wilding, Timothy J.; Lopez, Melany N.; Huettner, James E.

    2014-02-01

    Ionotropic glutamate receptors comprise two conformationally different A/C and B/D subunit pairs. Closed channels exhibit fourfold radial symmetry in the transmembrane domain (TMD) but transition to twofold dimer-of-dimers symmetry for extracellular ligand binding and N-terminal domains. Here, to evaluate symmetry in open pores we analysed interaction between the Q/R editing site near the pore loop apex and the transmembrane M3 helix of kainate receptor subunit GluK2. Chimeric subunits that combined the GluK2 TMD with extracellular segments from NMDA receptors, which are obligate heteromers, yielded channels made up of A/C and B/D subunit pairs with distinct substitutions along M3 and/or Q/R site editing status, in an otherwise identical homotetrameric TMD. Our results indicate that Q/R site interaction with M3 occurs within individual subunits and is essentially the same for both A/C and B/D subunit conformations, suggesting that fourfold pore symmetry persists in the open state.

  6. Pu-erh Tea Protects the Nervous System by Inhibiting the Expression of Metabotropic Glutamate Receptor 5.

    PubMed

    Li, Chunjie; Chai, Shaomeng; Ju, Yongzhi; Hou, Lu; Zhao, Hang; Ma, Wei; Li, Tian; Sheng, Jun; Shi, Wei

    2017-09-01

    Glutamate is one of the major excitatory neurotransmitters of the CNS and is essential for numerous key neuronal functions. However, excess glutamate causes massive neuronal death and brain damage owing to excitotoxicity via the glutamate receptors. Metabotropic glutamate receptor 5 (mGluR5) is one of the glutamate receptors and represents a promising target for studying neuroprotective agents of potential application in neurodegenerative diseases. Pu-erh tea, a fermented tea, mainly produced in Yunnan province, China, has beneficial effects, including the accommodation of the CNS. In this study, pu-erh tea markedly decreased the transcription and translation of mGluR5 compared to those by black and green teas. Pu-erh tea also inhibited the expression of Homer, one of the synaptic scaffolding proteins binding to mGluR5. Pu-erh tea protected neural cells from necrosis via blocked Ca 2+ influx and inhibited protein kinase C (PKC) activation induced by excess glutamate. Pu-erh tea relieved rat epilepsy induced by LiCl-pilocarpine in behavioural and physiological assays. Pu-erh tea also decreased the expression of mGluR5 in the hippocampus. These results show that the inhibition of mGluR5 plays a role in protecting neural cells from glutamate. The results also indicate that pu-erh tea contains biological compounds binding transcription factors and inhibiting the expression of mGluR5 and identify pu-erh tea as a novel natural neuroprotective agent.

  7. Both neurons and astrocytes exhibited tetrodotoxin-resistant metabotropic glutamate receptor-dependent spontaneous slow Ca2+ oscillations in striatum.

    PubMed

    Tamura, Atsushi; Yamada, Naohiro; Yaguchi, Yuichi; Machida, Yoshio; Mori, Issei; Osanai, Makoto

    2014-01-01

    The striatum plays an important role in linking cortical activity to basal ganglia outputs. Group I metabotropic glutamate receptors (mGluRs) are densely expressed in the medium spiny projection neurons and may be a therapeutic target for Parkinson's disease. The group I mGluRs are known to modulate the intracellular Ca(2+) signaling. To characterize Ca(2+) signaling in striatal cells, spontaneous cytoplasmic Ca(2+) transients were examined in acute slice preparations from transgenic mice expressing green fluorescent protein (GFP) in the astrocytes. In both the GFP-negative cells (putative-neurons) and astrocytes of the striatum, spontaneous slow and long-lasting intracellular Ca(2+) transients (referred to as slow Ca(2+) oscillations), which lasted up to approximately 200 s, were found. Neither the inhibition of action potentials nor ionotropic glutamate receptors blocked the slow Ca(2+) oscillation. Depletion of the intracellular Ca(2+) store and the blockade of inositol 1,4,5-trisphosphate receptors greatly reduced the transient rate of the slow Ca(2+) oscillation, and the application of an antagonist against mGluR5 also blocked the slow Ca(2+) oscillation in both putative-neurons and astrocytes. Thus, the mGluR5-inositol 1,4,5-trisphosphate signal cascade is the primary contributor to the slow Ca(2+) oscillation in both putative-neurons and astrocytes. The slow Ca(2+) oscillation features multicellular synchrony, and both putative-neurons and astrocytes participate in the synchronous activity. Therefore, the mGluR5-dependent slow Ca(2+) oscillation may involve in the neuron-glia interaction in the striatum.

  8. Adenosine A2A receptor inhibition restores the normal transport of endothelial glutamate transporters in the brain.

    PubMed

    Bai, Wei; Li, Ping; Ning, Ya-Lei; Peng, Yan; Xiong, Ren-Ping; Yang, Nan; Chen, Xing; Zhou, Yuan-Guo

    2018-04-15

    Excitatory amino acid transporters (EAATs) on cerebral vascular endothelial cells play an important role in maintaining glutamate homeostasis in the brain. The dysfunction of endothelial EAATs is an important reason for the dramatically elevated brain glutamate levels after brain injury, such as traumatic brain injury (TBI). The adenosine A 2A receptor (A 2A R) plays an important role in regulating the brain glutamate level after brain injury; however, researchers have not clearly determined whether this role was related to its ability to regulate endothelial EAATs. Activation of A 2A R in vitro not only decreased the PKA- and glutamate level-dependent strengthening of the interaction between NKA-α1 and the FXYD1 subunit and the subsequent decrease in the activity of Na + /K + -ATPases (NKAs) but also enhanced its interaction with EAATs and ultimately aggravated the reverse transport function of endothelial EAATs under oxygen-glucose deprivation (OGD) conditions. Conversely, inhibition of A 2A R restored the normal transport of EAAT. Moreover, A 2A R inhibition increased NKA activity and decreased its interaction with EAATs in isolated brain capillaries after TBI, further confirming its role in endothelial EAATs in vivo. Based on our results, A 2A R played an important role in regulating endothelial EAAT function, and strategies that restore the normal transport of endothelial EAATs through the inhibition of A 2A R might serve as an effective treatment for brain injury. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. The activation of metabotropic glutamate 5 receptors in the rat ventral tegmental area increases dopamine extracellular levels.

    PubMed

    Ferrada, Carla; Sotomayor-Zárate, Ramón; Abarca, Jorge; Gysling, Katia

    2017-01-01

    The mesocorticolimbic circuit projects to the prefrontal cortex, hippocampus, amygdala, and nucleus accumbens, among others, and it originates in the dopaminergic neurons of the ventral tegmental area (VTA). The VTA receives glutamatergic inputs from the prefrontal cortex and several subcortical regions. The glutamate released activates dopaminergic neurons and its action depends on the activation of ionotropic and metabotropic glutamate receptors. VTA dopaminergic neurons release dopamine (DA) from axon terminals in the innervated regions and somatodendritically in the VTA itself. DA release in the VTA is directly correlated with the activity of dopaminergic neurons. We hypothesized that metabotropic glutamate 5 receptors (mGlu5) directly regulate the activity of VTA dopaminergic neurons. To test this hypothesis, the extracellular levels of VTA DA and glutamate were studied by in-vivo microdialysis after an intra-VTA perfusion of (R,S)-2-chloro-5-hydroxyphenylglycine (CHPG), selective mGlu5 agonist. We observed that CHPG induced a significant increase in VTA DA and glutamate extracellular levels. To determine whether the effect of CHPG on DA levels is because of the increase in glutamate release, we perfused kynurenic acid, an ionotropic glutamate receptor antagonist, through the probe. Our results showed that kynurenic acid did not block the ability of CHPG to cause DA release. Thus, our results suggest that CHPG acts directly on mGlu5 in dopaminergic neurons to induce the release of DA.

  10. Glutamate Receptor Homologs in Plants: Functions and Evolutionary Origins

    PubMed Central

    Price, Michelle Beth; Jelesko, John; Okumoto, Sakiko

    2012-01-01

    The plant glutamate-like receptor homologs (GLRs) are homologs of mammalian ionotropic glutamate receptors (iGluRs) which were discovered more than 10 years ago, and are hypothesized to be potential amino acid sensors in plants. Although initial progress on this gene family has been hampered by gene redundancy and technical issues such as gene toxicity; genetic, pharmacological, and electrophysiological approaches are starting to uncover the functions of this protein family. In parallel, there has been tremendous progress in elucidating the structure of animal glutamate receptors (iGluRs), which in turn will help understanding of the molecular mechanisms of plant GLR functions. In this review, we will summarize recent progress on the plant GLRs. Emerging evidence implicates plant GLRs in various biological processes in and beyond N sensing, and implies that there is some overlap in the signaling mechanisms of amino acids between plants and animals. Phylogenetic analysis using iGluRs from metazoans, plants, and bacteria showed that the plant GLRs are no more closely related to metazoan iGluRs as they are to bacterial iGluRs, indicating the separation of plant, other eukaryotic, and bacterial GLRs might have happened as early on as the last universal common ancestor. Structural similarities and differences with animal iGluRs, and the implication thereof, are also discussed. PMID:23115559

  11. The function of metabotropic glutamate receptors in thalamus and cortex.

    PubMed

    Sherman, S Murray

    2014-04-01

    Metabotropic glutamate receptors (mGluRs) are found throughout thalamus and cortex and are clearly important to circuit behavior in both structures, and so considering only participation of ionotropic glutamate receptors (e.g., [R,S]-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid [AMPA] and N-methyl-d-aspartate receptors [NMDA] receptors) in glutamatergic processing would be an unfortunate oversimplification. These mGluRs are found both postsynaptically, on target cells of glutamatergic afferents, and presynaptically, on various synaptic terminals themselves, and when activated, they produce prolonged effects lasting at least hundreds of msec to several sec and perhaps longer. Two main types exist: activation of group I mGluRs causes postsynaptic depolarization, and group II, hyperpolarization. Both types are implicated in synaptic plasticity, both short term and long term. Their evident importance in functioning of thalamus and cortex makes it critical to develop a better understanding of how these receptors are normally activated, especially because they also seem implicated in a wide range of neurological and cognitive pathologies.

  12. The Function of Metabotropic Glutamate Receptors in Thalamus and Cortex

    PubMed Central

    Sherman, S. Murray

    2016-01-01

    Metabotropic glutamate receptors (mGluRs) are found throughout thalamus and cortex and are clearly important to circuit behavior in both structures, and so considering only participation of ionotropic glutamate receptors (e.g., [R,S]-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid [AMPA] and N-methyl-d-aspartate receptors [NMDA] receptors) in glutamatergic processing would be an unfortunate oversimplification. These mGluRs are found both postsynaptically, on target cells of glutamatergic afferents, and presynaptically, on various synaptic terminals themselves, and when activated, they produce prolonged effects lasting at least hundreds of msec to several sec and perhaps longer. Two main types exist: activation of group I mGluRs causes postsynaptic depolarization, and group II, hyperpolarization. Both types are implicated in synaptic plasticity, both short term and long term. Their evident importance in functioning of thalamus and cortex makes it critical to develop a better understanding of how these receptors are normally activated, especially because they also seem implicated in a wide range of neurological and cognitive pathologies. PMID:23459618

  13. 1,2,4-Benzothiadiazine-1,1-dioxide derivatives as ionotropic glutamate receptor ligands: synthesis and structure-activity relationships.

    PubMed

    Varano, Flavia; Catarzi, Daniela; Colotta, Vittoria; Squarcialupi, Lucia; Matucci, Rosanna

    2014-11-01

    Ionotropic glutamate receptor (iGluR) modulators, specially AMPA receptor antagonists, are potential tools for numerous therapeutic applications in neurological disorders, including Alzheimer's and Parkinson's diseases, amyotrophic lateral sclerosis, epilepsy, chronic pain, and neuropathology ensuing from cerebral ischemia or cardiac arrest. In this work, the synthesis and binding affinities at the Gly/NMDA, AMPA, and kainic acid (KA) receptors of a new series of 1,2,4-benzothiadiazine-1,1-dioxide derivatives are reported. The results show that 1,2,4-benzothiadiazine-1,1-dioxide is a new scaffold for obtaining iGluR ligands. Moreover, this work has led us to the 7-(3-formylpyrrol-1-yl)-6-trifluoromethyl substituted compound 7, which displays the highest AMPA receptor affinity and high selectivity versus the Gly/NMDA (90-fold) and KA (46-fold) receptors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Expression of specific ionotropic glutamate and GABA-A receptor subunits is decreased in central amygdala of alcoholics.

    PubMed

    Jin, Zhe; Bhandage, Amol K; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R; Birnir, Bryndis

    2014-01-01

    The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence.

  15. Expression of specific ionotropic glutamate and GABA-A receptor subunits is decreased in central amygdala of alcoholics

    PubMed Central

    Jin, Zhe; Bhandage, Amol K.; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R.; Birnir, Bryndis

    2014-01-01

    The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence. PMID:25278838

  16. Metabotropic Glutamate Receptors and Interacting Proteins in Epileptogenesis

    PubMed Central

    Qian, Feng; Tang, Feng-Ru

    2016-01-01

    Neurotransmitter and receptor systems are involved in different neurological and neuropsychological disorders such as Parkinson's disease, depression, Alzheimer’s disease and epilepsy. Recent advances in studies of signal transduction pathways or interacting proteins of neurotransmitter receptor systems suggest that different receptor systems may share the common signal transduction pathways or interacting proteins which may be better therapeutic targets for development of drugs to effectively control brain diseases. In this paper, we reviewed metabotropic glutamate receptors (mGluRs) and their related signal transduction pathways or interacting proteins in status epilepticus and temporal lobe epilepsy, and proposed some novel therapeutical drug targets for controlling epilepsy and epileptogenesis. PMID:27030135

  17. Reciprocal regulation between taurine and glutamate response via Ca2+- dependent pathways in retinal third-order neurons

    PubMed Central

    2010-01-01

    Although taurine and glutamate are the most abundant amino acids conducting neural signals in the central nervous system, the communication between these two neurotransmitters is largely unknown. This study explores the interaction of taurine and glutamate in the retinal third-order neurons. Using specific antibodies, both taurine and taurine transporters were localized in photoreceptors and Off-bipolar cells, glutamatergic neurons in retinas. It is possible that Off-bipolar cells release juxtaposed glutamate and taurine to activate the third-order neurons in retina. The interaction of taurine and glutamate was studied in acutely dissociated third-order neurons in whole-cell patch-clamp recording and Ca2+ imaging. We find that taurine effectively reduces glutamate-induced Ca2+ influx via ionotropic glutamate receptors and voltage-dependent Ca2+ channels in the neurons, and the effect of taurine was selectively inhibited by strychnine and picrotoxin, but not GABA receptor antagonists, although GABA receptors are present in the neurons. A CaMKII inhibitor partially reversed the effect of taurine, suggesting that a Ca2+/calmodulin-dependent pathway is involved in taurine regulation. On the other hand, a rapid influx of Ca2+ through ionotropic glutamate receptors could inhibit the amplitude and kinetics of taurine-elicited currents in the third-order neurons, which could be controlled with intracellular application of BAPTA a fast Ca2+ chelator. This study indicates that taurine is a potential neuromodulator in glutamate transmission. The reciprocal inhibition between taurine and glutamate in the postsynaptic neurons contributes to computation of visual signals in the retinal neurons. PMID:20804625

  18. A conserved mechanism for gating in an ionotropic glutamate receptor.

    PubMed

    Moore, Bryn S; Mirshahi, Uyenlinh L; Ebersole, Tonya L; Mirshahi, Tooraj

    2013-06-28

    Ionotropic glutamate receptor (iGluR) channels control synaptic activity. The crystallographic structure of GluA2, the prototypical iGluR, reveals a clamshell-like ligand-binding domain (LBD) that closes in the presence of glutamate to open a gate on the pore lining α-helix. How LBD closure leads to gate opening remains unclear. Here, we show that bending the pore helix at a highly conserved alanine residue (Ala-621) below the gate is responsible for channel opening. Substituting Ala-621 with the smaller more flexible glycine resulted in a basally active, nondesensitizing channel with ∼39-fold increase in glutamate potency without affecting surface expression or binding. On GluA2(A621G), the partial agonist kainate showed efficacy similar to a full agonist, and competitive antagonists CNQX and DNQX acted as a partial agonists. Met-629 in GluA2 sits above the gate and is critical in transmitting LBD closure to the gate. Substituting Met-629 with the flexible glycine resulted in reduced channel activity and glutamate potency. The pore regions in potassium channels are structurally similar to iGluRs. Whereas potassium channels typically use glycines as a hinge for gating, iGluRs use the less flexible alanine as a hinge at a similar position to maintain low basal activity allowing for ligand-mediated gating.

  19. Extrasynaptic Glutamate Receptor Activation as Cellular Bases for Dynamic Range Compression in Pyramidal Neurons

    PubMed Central

    Oikonomou, Katerina D.; Short, Shaina M.; Rich, Matthew T.; Antic, Srdjan D.

    2012-01-01

    Repetitive synaptic stimulation overcomes the ability of astrocytic processes to clear glutamate from the extracellular space, allowing some dendritic segments to become submerged in a pool of glutamate, for a brief period of time. This dynamic arrangement activates extrasynaptic NMDA receptors located on dendritic shafts. We used voltage-sensitive and calcium-sensitive dyes to probe dendritic function in this glutamate-rich location. An excess of glutamate in the extrasynaptic space was achieved either by repetitive synaptic stimulation or by glutamate iontophoresis onto the dendrites of pyramidal neurons. Two successive activations of synaptic inputs produced a typical NMDA spike, whereas five successive synaptic inputs produced characteristic plateau potentials, reminiscent of cortical UP states. While NMDA spikes were coupled with brief calcium transients highly restricted to the glutamate input site, the dendritic plateau potentials were accompanied by calcium influx along the entire dendritic branch. Once initiated, the glutamate-mediated dendritic plateau potentials could not be interrupted by negative voltage pulses. Activation of extrasynaptic NMDA receptors in cellular compartments void of spines is sufficient to initiate and support plateau potentials. The only requirement for sustained depolarizing events is a surplus of free glutamate near a group of extrasynaptic receptors. Highly non-linear dendritic spikes (plateau potentials) are summed in a highly sublinear fashion at the soma, revealing the cellular bases of signal compression in cortical circuits. Extrasynaptic NMDA receptors provide pyramidal neurons with a function analogous to a dynamic range compression in audio engineering. They limit or reduce the volume of “loud sounds” (i.e., strong glutamatergic inputs) and amplify “quiet sounds” (i.e., glutamatergic inputs that barely cross the dendritic threshold for local spike initiation). Our data also explain why consecutive cortical UP

  20. Ionotropic Glutamate Receptors & CNS Disorders

    PubMed Central

    Bowie, Derek

    2008-01-01

    Disorders of the central nervous system (CNS) are complex disease states that represent a major challenge for modern medicine. Although etiology is often unknown, it is established that multiple factors such as defects in genetics and/or epigenetics, the environment as well as imbalance in neurotransmitter receptor systems are all at play in determining an individual’s susceptibility to disease. Gene therapy is currently not available and therefore, most conditions are treated with pharmacological agents that modify neurotransmitter receptor signaling. Here, I provide a review of ionotropic glutamate receptors (iGluRs) and the roles they fulfill in numerous CNS disorders. Specifically, I argue that our understanding of iGluRs has reached a critical turning point to permit, for the first time, a comprehensive re-evaluation of their role in the cause of disease. I illustrate this by highlighting how defects in AMPA receptor trafficking are important to Fragile X mental retardation and ectopic expression of kainate (KA) receptor synapses contributes to the pathology of temporal lobe epilepsy. Finally, I discuss how parallel advances in studies of other neurotransmitter systems may allow pharmacologists to work towards a cure for many CNS disorders rather than developing drugs to treat their symptoms. PMID:18537642

  1. Oxytocin reduces cocaine seeking and reverses chronic cocaine-induced changes in glutamate receptor function.

    PubMed

    Zhou, Luyi; Sun, Wei-Lun; Young, Amy B; Lee, Kunhee; McGinty, Jacqueline F; See, Ronald E

    2014-10-31

    Oxytocin, a neurohypophyseal neuropeptide, is a potential mediator and regulator of drug addiction. However, the cellular mechanisms of oxytocin in drug seeking remain unknown. In the present study, we used a self-administration/reinstatement model to study the effects of oxytocin on cocaine seeking and its potential interaction with glutamate function at the receptor level. Systemic oxytocin dose-dependently reduced cocaine self-administration during various schedules of reinforcement, including fixed ratio 1, fixed ratio 5, and progressive ratio. Oxytocin also attenuated reinstatement to cocaine seeking induced by cocaine prime or conditioned cues. Western-blot analysis indicated that oxytocin increased phosphorylation of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate receptor GluA1 subunit at the Ser 845 site with or without accompanying increases in phosphorylation of extracellular signal-regulated kinase, in several brain regions, including the prefrontal cortex, bed nucleus of the stria terminalis, amygdala, and dorsal hippocampus. Immunoprecipitation of oxytocin receptor and GluA1 subunit receptors further demonstrated a physical interaction between these 2 receptors, although the interaction was not influenced by chronic cocaine or oxytocin treatment. Oxytocin also attenuated sucrose seeking in a GluA1- or extracellular-signal-regulated kinase-independent manner. These findings suggest that oxytocin mediates cocaine seeking through interacting with glutamate receptor systems via second messenger cascades in mesocorticolimbic regions. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Progress toward advanced understanding of metabotropic glutamate receptors: structure, signaling and therapeutic indications

    PubMed Central

    Yin, Shen; Niswender, Colleen M.

    2014-01-01

    The metabotropic glutamate (mGlu) receptors are a group of Class C Seven Transmembrane Spanning/G Protein Coupled Receptors (7TMRs/GPCRs). These receptors are activated by glutamate, one of the standard amino acids and the major excitatory neurotransmitter. By activating G protein-dependent and non G protein-dependent signaling pathways, mGlus modulate glutamatergic transmission in both the periphery and throughout the central nervous system. Since the discovery of the first mGlu receptor, especially the last decade, a great deal of progress has been made in understanding the signaling, structure, pharmacological manipulation and therapeutic indications of the 8 mGlu members. PMID:24793301

  3. Oral administration of MSG increases expression of glutamate receptors and transporters in the gastrointestinal tract of young piglets.

    PubMed

    Zhang, Jun; Yin, Yulong; Shu, Xu Gang; Li, Tiejun; Li, Fengna; Tan, Bie; Wu, Zhenlong; Wu, Guoyao

    2013-11-01

    Glutamate receptors and transporters, including T1R1 and T1R3 (taste receptor 1, subtypes 1 and 3), mGluRs (metabotropic glutamate receptors), EAAC-1 (excitatory amino acid carrier-1), GLAST-1 (glutamate-aspartate transporter-1), and GLT-1 (glutamate transporter-1), are expressed in the gastrointestinal tract. This study determined effects of oral administration of monosodium glutamate [MSG; 0, 0.06, 0.5, or 1 g/kg body weight (BW)/day] for 21 days on expression of glutamate receptors and transporters in the stomach and jejunum of sow-reared piglets. Both mRNA and protein levels for gastric T1R1, T1R3, mGluR1, mGluR4, EAAT1, EAAT2, EAAT3, and EAAT4 and mRNA levels for jejunal T1R1, T1R3, EAAT1, EAAT2, EAAT3 and EAAT4 were increased (P < 0.05) by MSG supplementation. Among all groups, mRNA levels for gastric EAAT1, EAAT2, EAAT3, and EAAT4 were highest (P < 0.05) in piglets receiving 1 g MSG/kg BW/day. EAAT1 and EAAT2 mRNA levels in the stomach and jejunum of piglets receiving 0.5 g MSG/kg BW/day, as well as jejunal EAAT3 and EAAT4 mRNA levels in piglets receiving 1 g MSG/kg BW/day, were higher (P < 0.05) than those in the control and in piglets receiving 0.06 g MSG/kg BW/day. Furthermore, protein levels for jejunal T1R1 and EAAT3 were higher (P < 0.05) in piglets receiving 1 g MSG/kg BW/day than those in the control and in piglets receiving 0.06 g MSG/kg BW/day. Collectively, these findings indicate that dietary MSG may beneficially stimulate glutamate signaling and sensing in the stomach and jejunum of young pigs, as well as their gastrointestinal function.

  4. Inside story of Group I Metabotropic Glutamate Receptors (mGluRs).

    PubMed

    Bhattacharyya, Samarjit

    2016-08-01

    Metabotropic glutamate receptors (mGluRs) are G-protein coupled receptors (GPCRs) that are activated by the neurotransmitter glutamate in the central nervous system. Among the eight subtypes, mGluR1 and mGluR5 belong to the group I family. These receptors play important roles in the brain and are believed to be involved in multiple forms of experience dependent synaptic plasticity including learning and memory. In addition, group I mGluRs also have been implicated in various neuropsychiatric disorders like Fragile X syndrome, autism etc. The normal signaling depends on the precise location of these receptors in specific region of the neuron and the process of receptor trafficking plays a crucial role in controlling this localization. Intracellular trafficking could also regulate the desensitization, resensitization, down-regulation and intracellular signaling of these receptors. In this review I focus on the current understanding of group I mGluR regulation in the central nervous system and also their role in neuropsychiatric disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Structure and organization of heteromeric AMPA-type glutamate receptors.

    PubMed

    Herguedas, Beatriz; García-Nafría, Javier; Cais, Ondrej; Fernández-Leiro, Rafael; Krieger, James; Ho, Hinze; Greger, Ingo H

    2016-04-29

    AMPA-type glutamate receptors (AMPARs), which are central mediators of rapid neurotransmission and synaptic plasticity, predominantly exist as heteromers of the subunits GluA1 to GluA4. Here we report the first AMPAR heteromer structures, which deviate substantially from existing GluA2 homomer structures. Crystal structures of the GluA2/3 and GluA2/4 N-terminal domains reveal a novel compact conformation with an alternating arrangement of the four subunits around a central axis. This organization is confirmed by cysteine cross-linking in full-length receptors, and it permitted us to determine the structure of an intact GluA2/3 receptor by cryogenic electron microscopy. Two models in the ligand-free state, at resolutions of 8.25 and 10.3 angstroms, exhibit substantial vertical compression and close associations between domain layers, reminiscent of N-methyl-D-aspartate receptors. Model 1 resembles a resting state and model 2 a desensitized state, thus providing snapshots of gating transitions in the nominal absence of ligand. Our data reveal organizational features of heteromeric AMPARs and provide a framework to decipher AMPAR architecture and signaling. Copyright © 2016, American Association for the Advancement of Science.

  6. Input- and subunit-specific AMPA receptor trafficking underlying long-term potentiation at hippocampal CA3 synapses.

    PubMed

    Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji

    2004-07-01

    Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.

  7. Morphology and kainate-receptor immunoreactivity of identified neurons within the entorhinal cortex projecting to superior temporal sulcus in the cynomolgus monkey

    NASA Technical Reports Server (NTRS)

    Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)

    1995-01-01

    Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.

  8. Plasticity of calcium-permeable AMPA glutamate receptors in Pro-opiomelanocortin neurons.

    PubMed

    Suyama, Shigetomo; Ralevski, Alexandra; Liu, Zhong-Wu; Dietrich, Marcelo O; Yada, Toshihiko; Simonds, Stephanie E; Cowley, Michael A; Gao, Xiao-Bing; Diano, Sabrina; Horvath, Tamas L

    2017-08-01

    POMC neurons integrate metabolic signals from the periphery. Here, we show in mice that food deprivation induces a linear current-voltage relationship of AMPAR-mediated excitatory postsynaptic currents (EPSCs) in POMC neurons. Inhibition of EPSCs by IEM-1460, an antagonist of calcium-permeable (Cp) AMPARs, diminished EPSC amplitude in the fed but not in the fasted state, suggesting entry of GluR2 subunits into the AMPA receptor complex during food deprivation. Accordingly, removal of extracellular calcium from ACSF decreased the amplitude of mEPSCs in the fed but not the fasted state. Ten days of high-fat diet exposure, which was accompanied by elevated leptin levels and increased POMC neuronal activity, resulted in increased expression of Cp-AMPARs on POMC neurons. Altogether, our results show that entry of calcium via Cp-AMPARs is inherent to activation of POMC neurons, which may underlie a vulnerability of these neurons to calcium overload while activated in a sustained manner during over-nutrition.

  9. Cocaine-Induced Behavioral Sensitization Is Associated With Changes in the Expression of Endocannabinoid and Glutamatergic Signaling Systems in the Mouse Prefrontal Cortex

    PubMed Central

    Blanco, Eduardo; Pavón, Francisco J.; Palomino, Ana; Luque-Rojas, María Jesús; Serrano, Antonia; Rivera, Patricia; Bilbao, Ainhoa; Alen, Francisco; Vida, Margarita; Suárez, Juan

    2015-01-01

    transmission-related genes. An overall decrease was observed in the mRNA expression of the glutamate-synthesizing gene kidney-type glutaminase (KGA), the metabotropic glutamate receptors (mGluR3 and GluR), and subunits of NMDA ionotropic receptors (NR1, NR2A, NR2B and NR2C) after acute cocaine administration, while mice repeatedly exposed to cocaine only displayed an increase in NR2C. However, in cocaine-sensitized mice primed with cocaine, this inhibition was reversed and a strong increase was detected in the mGluR5, NR2 subunits, and both GluR1 and GluR3. Conclusions: These findings indicate that cocaine sensitization is associated with an endocannabinoid downregulation and a hyperglutamatergic state in the PFC that, overall, contribute to an enhanced glutamatergic input into PFC-projecting areas. PMID:25539508

  10. Discovery of 1,5-Disubstituted Pyridones: A New Class of Positive Allosteric Modulators of the Metabotropic Glutamate 2 Receptor

    PubMed Central

    2010-01-01

    A series of 1,5-disubstituted pyridones was identified as positive allosteric modulators (PAMs) of the metabotropic glutamate receptor 2 (mGluR2) via high throughput screening (HTS). Subsequent SAR exploration led to the identification of several compounds with improved in vitro activity. Lead compound 8 was further profiled and found to attenuate the increase in PCP induced locomotor activity in mice. PMID:22778815

  11. Glutamate receptor antibodies in neurological diseases: anti-AMPA-GluR3 antibodies, anti-NMDA-NR1 antibodies, anti-NMDA-NR2A/B antibodies, anti-mGluR1 antibodies or anti-mGluR5 antibodies are present in subpopulations of patients with either: epilepsy, encephalitis, cerebellar ataxia, systemic lupus erythematosus (SLE) and neuropsychiatric SLE, Sjogren's syndrome, schizophrenia, mania or stroke. These autoimmune anti-glutamate receptor antibodies can bind neurons in few brain regions, activate glutamate receptors, decrease glutamate receptor's expression, impair glutamate-induced signaling and function, activate blood brain barrier endothelial cells, kill neurons, damage the brain, induce behavioral/psychiatric/cognitive abnormalities and ataxia in animal models, and can be removed or silenced in some patients by immunotherapy.

    PubMed

    Levite, Mia

    2014-08-01

    Glutamate is the major excitatory neurotransmitter of the Central Nervous System (CNS), and it is crucially needed for numerous key neuronal functions. Yet, excess glutamate causes massive neuronal death and brain damage by excitotoxicity--detrimental over activation of glutamate receptors. Glutamate-mediated excitotoxicity is the main pathological process taking place in many types of acute and chronic CNS diseases and injuries. In recent years, it became clear that not only excess glutamate can cause massive brain damage, but that several types of anti-glutamate receptor antibodies, that are present in the serum and CSF of subpopulations of patients with a kaleidoscope of human neurological diseases, can undoubtedly do so too, by inducing several very potent pathological effects in the CNS. Collectively, the family of anti-glutamate receptor autoimmune antibodies seem to be the most widespread, potent, dangerous and interesting anti-brain autoimmune antibodies discovered up to now. This impression stems from taking together the presence of various types of anti-glutamate receptor antibodies in a kaleidoscope of human neurological and autoimmune diseases, their high levels in the CNS due to intrathecal production, their multiple pathological effects in the brain, and the unique and diverse mechanisms of action by which they can affect glutamate receptors, signaling and effects, and subsequently impair neuronal signaling and induce brain damage. The two main families of autoimmune anti-glutamate receptor antibodies that were already found in patients with neurological and/or autoimmune diseases, and that were already shown to be detrimental to the CNS, include the antibodies directed against ionotorpic glutamate receptors: the anti-AMPA-GluR3 antibodies, anti-NMDA-NR1 antibodies and anti-NMDA-NR2 antibodies, and the antibodies directed against Metabotropic glutamate receptors: the anti-mGluR1 antibodies and the anti-mGluR5 antibodies. Each type of these anti-glutamate

  12. Role of Major NMDA or AMPA Receptor Subunits in MK-801 Potentiation of Ethanol Intoxication

    PubMed Central

    Palachick, Benjamin; Chen, Yi-Chyan; Enoch, Abigail J.; Karlsson, Rose-Marie; Mishina, Masayoshi; Holmes, Andrew

    2008-01-01

    Background The glutamate system plays a major role in mediating EtOH’s effects on brain and behavior, and is implicated in the pathophysiology of alcohol-related disorders. N-methyl-D-aspartate receptor (NMDAR) antagonists such as MK-801 (dizocilpine) interact with EtOH at the behavioral level, but the molecular basis of this interaction is unclear. Methods We first characterized the effects of MK-801 treatment on responses to the ataxic (accelerating rotarod), hypothermic and sedative/hypnotic effects of acute EtOH administration in C57BL/6J and 129/SvImJ inbred mice. Effects of another NMDAR antagonist, phencyclidine, on EtOH-induced sedation/hypnosis were also assessed. Gene knockout of the NMDAR subunit NR2A or L-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate GluR1 or pharmacological antagonism of the NMDAR subunit NR2B (via Ro 25-6981) was employed to examine whether inactivating any one of these glutamate signaling molecules modified MK-801’s effect on EtOH-related behaviors. Results MK-801 markedly potentiated the ataxic effects of 1.75 g/kg EtOH and the sedative/hypnotic effects of 3.0 g/kg EtOH, but not the hypothermic effects of 3.0 g/kg EtOH, in C57BL/6J and 129/SvImJ mice. Phencyclidine potentiated EtOH-induced sedation/hypnosis in both inbred strains. Neither NR2A nor GluR1 KO significantly altered basal EtOH-induced ataxia, hypothermia, or sedation/hypnosis. Ro 25-6981 modestly increased EtOH-induced sedation/hypnosis. The ability of MK-801 to potentiate EtOH-induced ataxia and sedation/hypnosis was unaffected by GluR1 KO or NR2B antagonism. NR2A KO partially reduced MK-801 + EtOH-induced sedation/hypnosis, but not ataxia or hypothermia. Conclusions Data confirm a robust and response-specific potentiating effect of MK-801 on sensitivity to EtOH’s intoxicating effects. Inactivation of three major components of glutamate signaling had no or only partial impact on the ability of MK-801 to potentiate behavioral sensitivity to EtOH. Further

  13. Spike-independent release of ATP from Xenopus spinal neurons evoked by activation of glutamate receptors

    PubMed Central

    Brown, Paul; Dale, Nicholas

    2002-01-01

    As the release of ATP from neurons has only been directly studied in a few cases, we have used patch sniffing to examine ATP release from Xenopus spinal neurons. ATP release was detected following intracellular current injection to evoke spikes. However, spiking was not essential as both glutamate and NMDA could evoke release of ATP in the presence of TTX. Neither acetylcholine nor high K+ was effective at inducing ATP release in the presence of TTX. Although Cd2+ blocked glutamate-evoked release of ATP suggesting a dependence on Ca2+ entry, neither ω-conotoxin-GVIA nor nifedipine prevented ATP release. N-type and L-type channels are thus not essential for glutamate-evoked ATP release. That glutamate receptors can elicit release in the absence of spiking suggests a close physical relationship between these receptors, the Ca2+ channels and release sites. As the dependence of ATP release on the influx of Ca2+ through Ca2+ channel subtypes differs from that of synaptic transmitter release, ATP may be released from sites that are distinct from those of the principal transmitter. In addition to its role as a fast transmitter, ATP may thus be released as a consequence of the activation of excitatory glutamatergic synapses and act to signal information about activity patterns in the nervous system. PMID:11986374

  14. Progress toward advanced understanding of metabotropic glutamate receptors: structure, signaling and therapeutic indications.

    PubMed

    Yin, Shen; Niswender, Colleen M

    2014-10-01

    The metabotropic glutamate (mGlu) receptors are a group of Class C seven-transmembrane spanning/G protein-coupled receptors (7TMRs/GPCRs). These receptors are activated by glutamate, one of the standard amino acids and the major excitatory neurotransmitter. By activating G protein-dependent and non-G protein-dependent signaling pathways, mGlus modulate glutamatergic transmission both in the periphery and throughout the central nervous system. Since the discovery of the first mGlu receptor, and especially during the last decade, a great deal of progress has been made in understanding the signaling, structure, pharmacological manipulation and therapeutic indications of the 8 mGlu members. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Blast waves from detonated military explosive reduce GluR1 and synaptophysin levels in hippocampal slice cultures✩

    PubMed Central

    Smith, Marquitta; Piehler, Thuvan; Benjamin, Richard; Farizatto, Karen L.; Pait, Morgan C.; Almeida, Michael F.; Ghukasyan, Vladimir V.; Bahr, Ben A.

    2017-01-01

    Explosives create shockwaves that cause blast-induced neurotrauma, one of the most common types of traumatic brain injury (TBI) linked to military service. Blast-induced TBIs are often associated with reduced cognitive and behavioral functions due to a variety of factors. To study the direct effects of military explosive blasts on brain tissue, we removed systemic factors by utilizing rat hippocampal slice cultures. The long-term slice cultures were briefly sealed air-tight in serum-free medium, lowered into a 37 °C water-filled tank, and small 1.7-gram assemblies of cyclotrimethylene trinitramine (RDX) were detonated 15 cm outside the tank, creating a distinct shockwave recorded at the culture plate position. Compared to control mock-treated groups of slices that received equal submerge time, 1–3 blast impacts caused a dose-dependent reduction in the AMPA receptor subunit GluR1. While only a small reduction was found in hippocampal slices exposed to a single RDX blast and harvested 1–2 days later, slices that received two consecutive RDX blasts 4 min apart exhibited a 26–40% reduction in GluR1, and the receptor subunit was further reduced by 64–72% after three consecutive blasts. Such loss correlated with increased levels of HDAC2, a histone deacetylase implicated in stress-induced reduction of glutamatergic transmission. No evidence of synaptic marker recovery was found at 72 h post-blast. The presynaptic marker synaptophysin was found to have similar susceptibility as GluR1 to the multiple explosive detonations. In contrast to the synaptic protein reductions, actin levels were unchanged, spectrin breakdown was not detected, and Fluoro-Jade B staining found no indication of degenerating neurons in slices exposed to three RDX blasts, suggesting that small, sub-lethal explosives are capable of producing selective alterations to synaptic integrity. Together, these results indicate that blast waves from military explosive cause signs of synaptic compromise

  16. Oligomers of Amyloid β Prevent Physiological Activation of the Cellular Prion Protein-Metabotropic Glutamate Receptor 5 Complex by Glutamate in Alzheimer Disease.

    PubMed

    Haas, Laura T; Strittmatter, Stephen M

    2016-08-12

    The dysfunction and loss of synapses in Alzheimer disease are central to dementia symptoms. We have recently demonstrated that pathological Amyloid β oligomer (Aβo) regulates the association between intracellular protein mediators and the synaptic receptor complex composed of cellular prion protein (PrP(C)) and metabotropic glutamate receptor 5 (mGluR5). Here we sought to determine whether Aβo alters the physiological signaling of the PrP(C)-mGluR5 complex upon glutamate activation. We provide evidence that acute exposure to Aβo as well as chronic expression of familial Alzheimer disease mutant transgenes in model mice prevents protein-protein interaction changes of the complex induced by the glutamate analog 3,5-dihydroxyphenylglycine. We further show that 3,5-dihydroxyphenylglycine triggers the phosphorylation and activation of protein-tyrosine kinase 2-β (PTK2B, also referred to as Pyk2) and of calcium/calmodulin-dependent protein kinase II in wild-type brain slices but not in Alzheimer disease transgenic brain slices or wild-type slices incubated with Aβo. This study further distinguishes two separate Aβo-dependent signaling cascades, one dependent on extracellular Ca(2+) and Fyn kinase activation and the other dependent on the release of Ca(2+) from intracellular stores. Thus, Aβo triggers multiple distinct PrP(C)-mGluR5-dependent events implicated in neurodegeneration and dementia. We propose that targeting the PrP(C)-mGluR5 complex will reverse aberrant Aβo-triggered states of the complex to allow physiological fluctuations of glutamate signaling. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Human Neural Cell-Based Biosensor

    DTIC Science & Technology

    2010-04-26

    SNAP25 (SNAP25), GluR1 (GRIA1) glutamate receptor , ionotropic , AMPA1, Nav1.2 (SCN2A), Nav1.6 (SCN8A), CaV 2.1 (CACNA1A), HERG (KCNH2), and KCC2...transitions to mesenchymal progenitor cells." Tissue Eng Part A 15(8): 1897-907. Haltiwanger, R. S. and P. Stanley (2002). "Modulation of receptor ...cytometry studies previously conducted by the Stice lab identified ciliary neurotrophic factor receptor alpha (CNTFRα) as a novel cell surface marker to

  18. NMR spectroscopy of the ligand binding core of ionotropic glutamate receptor 2 bound to 5-substituted willardiine partial agonists

    PubMed Central

    Fenwick, Michael K.; Oswald, Robert E.

    2008-01-01

    Glutamate receptors mediate neuronal intercommunication in the central nervous system by coupling extracellular neurotransmitter-receptor interactions to ion channel conductivity. To gain insight into structural and dynamical factors that underlie this coupling, solution NMR experiments were performed on the bi-lobed ligand-binding core of glutamate receptor 2 in complexes with a set of willardiine partial agonists. These agonists are valuable for studying structure-function relationships because their 5-position substituent size is correlated with ligand efficacy and extent of receptor desensitization whereas the substituent electronegativity is correlated with ligand potency. NMR results show that the protein backbone amide chemical shift deviations correlate mainly with efficacy and extent of desensitization. Pronounced deviations occur at specific residues in the ligand-binding site and in the two helical segments that join the lobes by a disulfide bond. Experiments detecting conformational exchange show that micro- to millisecond timescale motions also occur near the disulfide bond and vary largely with efficacy and extent of desensitization. These results thus identify regions displaying structural and dynamical dissimilarity arising from differences in ligand-protein interactions and lobe closure which may play a critical role in receptor response. Furthermore, measures of line broadening and conformational exchange for a portion of the ligand-binding site correlate with ligand EC50 data. These results do not have any correlate in the currently available crystal structures and thus provide a novel view of ligand-binding events that may be associated with agonist potency differences. PMID:18387631

  19. Glutamate receptors modulate sodium-dependent and calcium-independent vitamin C bidirectional transport in cultured avian retinal cells.

    PubMed

    Portugal, Camila Cabral; Miya, Vivian Sayuri; Calaza, Karin da Costa; Santos, Rochelle Alberto Martins; Paes-de-Carvalho, Roberto

    2009-01-01

    Vitamin C is transported in the brain by sodium vitamin C co-transporter 2 (SVCT-2) for ascorbate and glucose transporters for dehydroascorbate. Here we have studied the expression of SVCT-2 and the uptake and release of [(14)C] ascorbate in chick retinal cells. SVCT-2 immunoreactivity was detected in rat and chick retina, specially in amacrine cells and in cells in the ganglion cell layer. Accordingly, SVCT-2 was expressed in cultured retinal neurons, but not in glial cells. [(14)C] ascorbate uptake was saturable and inhibited by sulfinpyrazone or sodium-free medium, but not by treatments that inhibit dehydroascorbate transport. Glutamate-stimulated vitamin C release was not inhibited by the glutamate transport inhibitor l-beta-threo-benzylaspartate, indicating that vitamin C release was not mediated by glutamate uptake. Also, ascorbate had no effect on [(3)H] D-aspartate release, ruling out a glutamate/ascorbate exchange mechanism. 2-Carboxy-3-carboxymethyl-4-isopropenylpyrrolidine (Kainate) or NMDA stimulated the release, effects blocked by their respective antagonists 6,7-initroquinoxaline-2,3-dione (DNQX) or (5R,2S)-(1)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine hydrogen maleate (MK-801). However, DNQX, but not MK-801 or 2-amino-5-phosphonopentanoic acid (APV), blocked the stimulation by glutamate. Interestingly, DNQX prevented the stimulation by NMDA, suggesting that the effect of NMDA was mediated by glutamate release and stimulation of non-NMDA receptors. The effect of glutamate was neither dependent on external calcium nor inhibited by 1,2-bis (2-aminophenoxy) ethane-N',N',N',N',-tetraacetic acid tetrakis (acetoxy-methyl ester) (BAPTA-AM), an internal calcium chelator, but was inhibited by sulfinpyrazone or by the absence of sodium. In conclusion, retinal cells take up and release vitamin C, probably through SVCT-2, and the release can be stimulated by NMDA or non-NMDA glutamate receptors.

  20. On the Role of Glutamate in Presynaptic Development: Possible Contributions of Presynaptic NMDA Receptors.

    PubMed

    Fedder, Karlie N; Sabo, Shasta L

    2015-12-14

    Proper formation and maturation of synapses during development is a crucial step in building the functional neural circuits that underlie perception and behavior. It is well established that experience modifies circuit development. Therefore, understanding how synapse formation is controlled by synaptic activity is a key question in neuroscience. In this review, we focus on the regulation of excitatory presynaptic terminal development by glutamate, the predominant excitatory neurotransmitter in the brain. We discuss the evidence that NMDA receptor activation mediates these effects of glutamate and present the hypothesis that local activation of presynaptic NMDA receptors (preNMDARs) contributes to glutamate-dependent control of presynaptic development. Abnormal glutamate signaling and aberrant synapse development are both thought to contribute to the pathogenesis of a variety of neurodevelopmental disorders, including autism spectrum disorders, intellectual disability, epilepsy, anxiety, depression, and schizophrenia. Therefore, understanding how glutamate signaling and synapse development are linked is important for understanding the etiology of these diseases.

  1. Effects of metabotropic glutamate receptor block on the synaptic transmission and plasticity in the rat medial vestibular nuclei.

    PubMed

    Grassi, S; Malfagia, C; Pettorossi, V E

    1998-11-01

    In rat brainstem slices, we investigated the possible role of metabotropic glutamate receptors in modulating the synaptic transmission within the medial vestibular nuclei, under basal and plasticity inducing conditions. We analysed the effect of the metabotropic glutamate receptor antagonist (R,S)-alpha-methyl-4-carboxyphenylglycine on the amplitude of the field potentials and latency of unitary potentials evoked in the ventral portion of the medial vestibular nuclei by primary vestibular afferent stimulation, and on the induction and maintenance of long-term potentiation, after high-frequency stimulation. Two effects were observed, consisting of a slight increase of the field potentials and reduction of unit latency during the drug infusion, and a further long-lasting development of these modifications after the drug wash-out. The long-term effect depended on N-methyl-D-aspartate receptor activation, as D,L-2-amino-5-phosphonopentanoic acid prevented its development. We suggest that (R,S)-alpha-methyl-4carboxyphenylglycine enhances the vestibular responses and induces N-methyl-D-aspartate-dependent long-term potentiation by increasing glutamate release, through the block of presynaptic metabotropic glutamate receptors which actively inhibit it. The block of these receptors was indirectly supported by the fact that the agonist (1S,3R)-1-aminocyclopentane-1,3-dicarboxylic acid reduced the vestibular responses and blocked the induction of long-term potentiation by high-frequency stimulation. The simultaneous block of metabotropic glutamate receptors facilitating synaptic plasticity, impedes the full expression of the long-term effect throughout the (R,S)-alpha-methyl-4-carboxyphenylglycine infusion. The involvement of such a facilitatory mechanism in the potentiation is supported by its reversible reduction following a second (R,S)-alpha-methyl-4-carboxyphenylglycine infusion. The drug also reduced the expression of potentiation induced by high-frequency stimulation

  2. Interaction of blockers of ionotropic NMDA receptors and metabotropic glutamate receptors in a working memory test in rats.

    PubMed

    Novitskaya, Y A; Dravolina, O A; Zvartau, E E; Danysz, W; Bespalov, A Y

    2010-09-01

    Glutamate, the main excitatory neurotransmitter in the mammalian CNS, acts via ionotropic and metabotropic receptors. Results from in vitro studies demonstrating tight interactions between ionotropic NMDA receptors and subtype 5 metabotropic glutamate receptors (mGlu5) have shown that blockade of mGlu5 receptors increases the behavioral effects of NMDA receptor antagonists. The aim of the present work was to study the actions of the highly selective mGlu5 receptor antagonist MTEP alone and in combination with MK-801, a blocker of the NMDA receptor-associated ion channel, on performance of a delayed selection task (a test of working memory) in rats. MK-801 (0.1 mg/kg) induced a specific impairment to working memory, with proactive interference (degradation of the ability to remember current information because of the effects of previously learned material). Administration of MTEP (5.0 mg/kg) combined with both solvent and with MK-801 had no significant effects, demonstrating the small or nonexistent involvement of mGlu5 receptors in the mechanisms of working memory.

  3. Protection by imidazol(ine) drugs and agmatine of glutamate-induced neurotoxicity in cultured cerebellar granule cells through blockade of NMDA receptor

    PubMed Central

    Olmos, Gabriel; DeGregorio-Rocasolano, Nuria; Regalado, M Paz; Gasull, Teresa; Boronat, M Assumpció; Trullas, Ramón; Villarroel, Alvaro; Lerma, Juan; García-Sevilla, Jesús A

    1999-01-01

    This study was designed to assess the potential neuroprotective effect of several imidazol(ine) drugs and agmatine on glutamate-induced necrosis and on apoptosis induced by low extracellular K+ in cultured cerebellar granule cells.Exposure (30 min) of energy deprived cells to L-glutamate (1–100 μM) caused a concentration-dependent neurotoxicity, as determined 24 h later by a decrease in the ability of the cells to metabolize 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) into a reduced formazan product. L-glutamate-induced neurotoxicity (EC50=5 μM) was blocked by the specific NMDA receptor antagonist MK-801 (dizocilpine).Imidazol(ine) drugs and agmatine fully prevented neurotoxicity induced by 20 μM (EC100) L-glutamate with the rank order (EC50 in μM): antazoline (13)>cirazoline (44)>LSL 61122 [2-styryl-2-imidazoline] (54)>LSL 60101 [2-(2-benzofuranyl) imidazole] (75)>idazoxan (90)>LSL 60129 [2-(1,4-benzodioxan-6-yl)-4,5-dihydroimidazole] (101)>RX821002 (2-methoxy idazoxan) (106)>agmatine (196). No neuroprotective effect of these drugs was observed in a model of apoptotic neuronal cell death (reduction of extracellular K+) which does not involve stimulation of NMDA receptors.Imidazol(ine) drugs and agmatine fully inhibited [3H]-(+)-MK-801 binding to the phencyclidine site of NMDA receptors in rat brain. The profile of drug potency protecting against L-glutamate neurotoxicity correlated well (r=0.90) with the potency of the same compounds competing against [3H]-(+)-MK-801 binding.In HEK-293 cells transfected to express the NR1-1a and NR2C subunits of the NMDA receptor, antazoline and agmatine produced a voltage- and concentration-dependent block of glutamate-induced currents. Analysis of the voltage dependence of the block was consistent with the presence of a binding site for antazoline located within the NMDA channel pore with an IC50 of 10–12 μM at 0 mV.It is concluded that imidazol(ine) drugs and agmatine are

  4. Permissive role for mGlu1 metabotropic glutamate receptors in excitotoxic retinal degeneration.

    PubMed

    Liberatore, Francesca; Bucci, Domenico; Mascio, Giada; Madonna, Michele; Di Pietro, Paola; Beneventano, Martina; Puliti, Alda Maria; Battaglia, Giuseppe; Bruno, Valeria; Nicoletti, Ferdinando; Romano, Maria Rosaria

    2017-11-05

    Neuroprotection is an unmet need in eye disorders characterized by retinal ganglion cell (RGC) death, such as prematurity-induced retinal degeneration, glaucoma, and age-related macular degeneration. In all these disorders excitotoxicity is a prominent component of neuronal damage, but clinical data discourage the development of NMDA receptor antagonists as neuroprotectants. Here, we show that activation of mGlu1 metabotropic glutamate receptors largely contributes to excitotoxic degeneration of RGCs. Mice at postnatal day 9 were challenged with a toxic dose of monosodium glutamate (MSG, 3g/kg), which caused the death of >70% of Brn-3a + RGCs. Systemic administration of the mGlu1 receptor negative allosteric modulator (NAM), JNJ16259685 (2.5mg/kg, s.c.), was largely protective against MSG-induced RGC death. This treatment did not cause changes in motor behavior in the pups. We also injected MSG to crv4 mice, which lack mGlu1 receptors because of a recessive mutation of the gene encoding the mGlu1 receptor. MSG did not cause retinal degeneration in crv4 mice, whereas it retained its toxic activity in their wild-type littermates. These findings demonstrate that mGlu1 receptors play a key role in excitotoxic degeneration of RGCs, and encourage the study of mGlu1 receptor NAMs in models of retinal neurodegeneration. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Fragment Based Optimization of Metabotropic Glutamate Receptor 2 (mGluR2) Positive Allosteric Modulators in the Absence of Structural Information.

    PubMed

    Szabó, György; Túrós, György I; Kolok, Sándor; Vastag, Mónika; Sánta, Zsuzsanna; Dékány, Miklós; Lévay, György I; Greiner, István; Natsumi, Minami; Tatsuya, Watanabe; Keserű, György M

    2018-03-14

    Metabotropic glutamate receptor 2 (mGluR2) positive allosteric modulators (PAMs) have been implicated as potential pharmacotherapy for psychiatric conditions. Screening our corporate compound deck, we identified a benzotriazole fragment (4) that was rapidly optimized to a potent and metabolically stable early lead (16). The highly lipophilic character of 16, together with its limited solubility, permeability, and high protein binding, however, did not allow reaching of the proof of concept in vivo. Since further attempts on the optimization of druglike properties were unsuccessful, the original hit 4 has been revisited and was optimized following the principles of fragment based drug discovery (FBDD). Lacking structural information on the receptor-ligand complex, we implemented a group efficiency (GE) based strategy and identified a new fragment like lead (60) with more balanced profile. Significant improvement achieved on the druglike properties nominated the compound for in vivo proof of concept studies that revealed the chemotype being a promising PAM lead targeting mGluR2 receptors.

  6. Editing for an AMPA receptor subunit RNA in prefrontal cortex and striatum in Alzheimer's disease, Huntington's disease and schizophrenia

    NASA Technical Reports Server (NTRS)

    Akbarian, S.; Smith, M. A.; Jones, E. G.; Bloom, F. E. (Principal Investigator)

    1995-01-01

    Animal studies and cell culture experiments demonstrated that posttranscriptional editing of the transcript of the GluR-2 gene, resulting in substitution of an arginine for glutamine in the second transmembrane region (TM II) of the expressed protein, is associated with a reduction in Ca2+ permeability of the receptor channel. Thus, disturbances in GluR-2 RNA editing with alteration of intracellular Ca2+ homeostasis could lead to neuronal dysfunction and even neuronal degeneration. The present study determined the proportions of edited and unedited GluR-2 RNA in the prefrontal cortex of brains from patients with Alzheimer's disease, in the striatum of brains from patients with Huntington's disease, and in the same areas of brains from age-matched schizophrenics and controls, by using reverse transcriptase-polymerase chain reaction, restriction endonuclease digestion, gel electrophoresis and scintillation radiometry. In the prefrontal cortex of controls, < 0.1% of all GluR-2 RNA molecules were unedited and > 99.9% were edited; in the prefrontal cortex both of schizophrenics and of Alzheimer's patients approximately 1.0% of all GluR-2 RNA molecules were unedited and 99% were edited. In the striatum of controls and of schizophrenics, approximately 0.5% of GluR-2 RNA molecules were unedited and 99.5% were edited; in the striatum of Huntington's patients nearly 5.0% of GluR-2 RNA was unedited. In the prefrontal white matter of controls, approximately 7.0% of GluR-2 RNA was unedited. In the normal human prefrontal cortex and striatum, the large majority of GluR-2 RNA molecules contains a CGG codon for arginine in the TMII coding region; this implies that the corresponding AMPA receptors have a low Ca2+ permeability, as previously demonstrated for the rat brain. The process of GluR-2 RNA editing is compromised in a region-specific manner in schizophrenia, in Alzheimer's disease and Huntington's Chorea although in each of these disorders there is still a large excess of

  7. Ionotropic glutamate receptor antagonists and cancer therapy: time to think out of the box?

    PubMed

    Ribeiro, Mariana P C; Custódio, José B A; Santos, Armanda E

    2017-02-01

    Glutamate has a trophic function in the development of the central nervous system, regulating the proliferation and migration of neuronal progenitors. The resemblance between neuronal embryonic and tumor cells has paved the way for the investigation of the effects of glutamate on tumor cells. Indeed, tumor cells derived from neuronal tissue express ionotropic glutamate receptor (iGluRs) subunits and iGluR antagonists decrease cell proliferation. Likewise, iGluRs subunits are expressed in several peripheral cancer cells and blockade of the N-methyl-D-aspartate (NMDA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptor subtypes decreases their proliferation and migration. Although these mechanisms are still being investigated, the inhibition of the mitogen-activated protein kinase pathway was shown to play a key role in the antiproliferative activity of iGluR antagonists. Importantly, MK-801, a NMDAR channel blocker, was effective and well tolerated in animal models of melanoma, lung, and breast cancers, suggesting that the blockade of iGluR signaling may represent a new strategy for cancer treatment. In this review, we focus on the significance of NMDA and AMPA receptor expression in tumor cells, as well as possible therapeutic strategies targeting these receptors.

  8. Comparing Plant and Animal Glutamate Receptors: Common Traits but Different Fates?

    PubMed

    Wudick, Michael M; Michard, Erwan; Oliveira Nunes, Custódio; Feijó, José A

    2018-04-19

    Animal ionotropic glutamate receptors (iGluRs) are ligand-gated channels whose evolution is intimately linked to the one of the nervous system, where the agonist glutamate and co-agonists glycine/D-serine act as neuro-transmitters or -modulators. While iGluRs are specialized in neuronal communication, plant glutamate receptor-like (GLR) homologues have evolved many plant-specific physiological functions, such as sperm signaling in moss, pollen tube growth, root meristem proliferation, innate immune and wound responses. GLRs have been associated with Ca2+ signaling by directly channeling its extracellular influx into the cytosol. Nevertheless, very limited information on functional properties of GLRs is available, and we mostly rely on structure/function data obtained for animal iGluRs to interpret experimental results obtained for plant GLRs. Yet, a deeper characterization and better understanding of plant GLRs is progressively unveiling original and different mode of functions when compared to their mammalian counterparts. Here, we review the function of plant GLRs comparing their predicted structure and physiological roles to the well-documented ones of iGluRs. We conclude that interpreting GLR function based on comparison to their animal counterparts calls for caution, especially when presuming physiological roles and mode of action for plant GLRs from comparison to iGluRs in peripheral, non-neuronal tissues.

  9. Ketamine and other glutamate receptor modulators for depression in adults.

    PubMed

    Caddy, Caroline; Amit, Ben H; McCloud, Tayla L; Rendell, Jennifer M; Furukawa, Toshi A; McShane, Rupert; Hawton, Keith; Cipriani, Andrea

    2015-09-23

    Considering the ample evidence of involvement of the glutamate system in the pathophysiology of depression, pre-clinical and clinical studies have been conducted to assess the antidepressant efficacy of glutamate inhibition, and glutamate receptor modulators in particular. This review focuses on the use of glutamate receptor modulators in unipolar depression. To assess the effects - and review the acceptability - of ketamine and other glutamate receptor modulators in comparison to placebo (or saline placebo), other pharmacologically active agents, or electroconvulsive therapy (ECT) in alleviating the acute symptoms of depression in people with unipolar major depressive disorder. We searched the Cochrane Depression, Anxiety and Neurosis Review Group's Specialised Register (CCDANCTR, to 9 January 2015). This register includes relevant randomised controlled trials (RCTs) from: the Cochrane Library (all years), MEDLINE (1950 to date), EMBASE (1974 to date), and PsycINFO (1967 to date). We did not apply any restrictions to date, language or publication status. Double- or single-blind RCTs comparing ketamine, memantine, or other glutamate receptor modulators with placebo (or saline placebo), other active psychotropic drugs, or electroconvulsive therapy (ECT) in adults with unipolar major depression. Three review authors independently identified studies, assessed trial quality and extracted data. The primary outcomes for this review were response rate and adverse events. We included 25 studies (1242 participants) on ketamine (9 trials), memantine (3), AZD6765 (3), D-cycloserine (2), Org26576 (2), atomoxetine (1), CP-101,606 (1), MK-0657 (1), N-acetylcysteine (1), riluzole (1) and sarcosine (1). Twenty-one studies were placebo-controlled and the majority were two-arm studies (23 out of 25). Twenty-two studies defined an inclusion criteria specifying the severity of depression; 11 specified at least moderate depression; eight, severe depression; and the remaining three

  10. Pre-synaptic kainate receptor-mediated facilitation of glutamate release involves PKA and Ca(2+) -calmodulin at thalamocortical synapses.

    PubMed

    Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Sihra, Talvinder S; Rodríguez-Moreno, Antonio

    2013-09-01

    We have investigated the mechanisms underlying the facilitatory modulation mediated by kainate receptor (KAR) activation in the cortex, using isolated nerve terminals (synaptosomes) and slice preparations. In cortical nerve terminals, kainate (KA, 100 μM) produced an increase in 4-aminopyridine (4-AP)-evoked glutamate release. In thalamocortical slices, KA (1 μM) produced an increase in the amplitude of evoked excitatory post-synaptic currents (eEPSCs) at synapses established between thalamic axon terminals from the ventrobasal nucleus onto stellate neurons of L4 of the somatosensory cortex. In both, synaptosomes and slices, the effect of KA was antagonized by 6-cyano-7-nitroquinoxaline-2,3-dione, and persisted after pre-treatment with a cocktail of antagonists of other receptors whose activation could potentially have produced facilitation of release indirectly. Mechanistically, the observed effects of KA appear to be congruent in synaptosomal and slice preparations. Thus, the facilitation by KA of synaptosomal glutamate release and thalamocortical synaptic transmission were suppressed by the inhibition of protein kinase A and occluded by the stimulation of adenylyl cyclase. Dissecting this G-protein-independent regulation further in thalamocortical slices, the KAR-mediated facilitation of synaptic transmission was found to be sensitive to the block of Ca(2+) permeant KARs by philanthotoxin. Intriguingly, the synaptic facilitation was abrogated by depletion of intracellular Ca(2+) stores by thapsigargin, or inhibition of Ca(2+) -induced Ca(2+) -release by ryanodine. Thus, the KA-mediated modulation was contingent on both Ca(2+) entry through Ca(2+) -permeable KARs and liberation of intracellular Ca(2+) stores. Finally, sensitivity to W-7 indicated that the increased cytosolic [Ca(2+) ] underpinning KAR-mediated regulation of synaptic transmission at thalamocortical synapses, requires downstream activation of calmodulin. We conclude that neocortical pre

  11. Role of AMPA glutamate receptors in the conditioned rewarding effects of MDMA in mice.

    PubMed

    García-Pardo, M P; Miñarro, J; Aguilar, M A

    2018-07-16

    Currently, there is not an effective treatment for 3,4-methylenedioxymethamphetamine (MDMA) dependence but pharmacotherapies targeting glutamate neurotransmission are a promising strategy. Previously, we showed that blockade of glutamate NMDA and AMPA receptors impairs the conditioned rewarding effects of MDMA and cocaine, respectively. In this study we evaluated the role of AMPA receptors in the rewarding effects of MDMA in mice using the conditioned place preference (CPP) paradigm. Mice were conditioned with MDMA (1.25 mg/kg) 60 min after the treatment with saline or different doses (0.25, 1 and 5 mg/kg) of the AMPA/kainate receptor antagonist, 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Mice conditioned with MDMA acquired CPP while those treated with any dose of CNQX + MDMA did not. These results supported the involvement of the glutamatergic system in the rewarding properties of MDMA, and suggest that AMPA receptor blockade could be a new therapeutic option for the treatment of those individuals that develop MDMA dependence. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Fractionating spatial memory with glutamate receptor subunit-knockout mice.

    PubMed

    Bannerman, David M

    2009-12-01

    In recent years, the contribution that different glutamate receptor subtypes and subunits make to spatial learning and memory has been studied extensively using genetically modified mice in which key proteins are knocked out. This has revealed dissociations between different aspects of spatial memory that were not previously apparent from lesion studies. For example, studies with GluA1 AMPAR [AMPA (alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid) receptor] subunit-knockout mice have revealed the presence of a GluA1-dependent, non-associative short-term memory mechanism that is important for performance on spatial working memory tasks, and a GluA1-independent, long-term associative memory mechanism which underlies performance on spatial reference memory tasks. Within this framework we have also studied the contributions of different GluN2-containing NMDARs [NMDA (N-methyl-D-aspartate) receptors] to spatial memory. Studies with GluN2 NMDAR mutants have revealed different contributions from GluN2A- and GluN2B-containing NMDARs to spatial learning. Furthermore, comparison of forebrain- and hippocampus-specific GluN2B-knockout mice has demonstrated that both hippocampal and extra-hippocampal NMDARs make important contributions to spatial memory performance.

  13. Gain-of-function glutamate receptor interacting protein 1 variants alter GluA2 recycling and surface distribution in patients with autism

    PubMed Central

    Mejias, Rebeca; Adamczyk, Abby; Anggono, Victor; Niranjan, Tejasvi; Thomas, Gareth M.; Sharma, Kamal; Skinner, Cindy; Schwartz, Charles E.; Stevenson, Roger E.; Fallin, M. Daniele; Kaufmann, Walter; Pletnikov, Mikhail; Valle, David; Huganir, Richard L.; Wang, Tao

    2011-01-01

    Glutamate receptor interacting protein 1 (GRIP1) is a neuronal scaffolding protein that interacts directly with the C termini of glutamate receptors 2/3 (GluA2/3) via its PDZ domains 4 to 6 (PDZ4–6). We found an association (P < 0.05) of a SNP within the PDZ4-6 genomic region with autism by genotyping autistic patients (n = 480) and matched controls (n = 480). Parallel sequencing identified five rare missense variants within or near PDZ4–6 only in the autism cohort, resulting in a higher cumulative mutation load (P = 0.032). Two variants correlated with a more severe deficit in reciprocal social interaction in affected sibling pairs from proband families. These variants were associated with altered interactions with GluA2/3 and faster recycling and increased surface distribution of GluA2 in neurons, suggesting gain-of-function because GRIP1/2 deficiency showed opposite phenotypes. Grip1/2 knockout mice exhibited increased sociability and impaired prepulse inhibition. These results support a role for GRIP in social behavior and implicate GRIP1 variants in modulating autistic phenotype. PMID:21383172

  14. Molecular Insights into Metabotropic Glutamate Receptor Allosteric Modulation

    PubMed Central

    Gregory, Karen J.

    2015-01-01

    The metabotropic glutamate (mGlu) receptors are a group of eight family C G protein–coupled receptors that are expressed throughout the central nervous system (CNS) and periphery. Within the CNS the different subtypes are found in neurons, both pre- and/or postsynaptically, where they mediate modulatory roles and in glial cells. The mGlu receptor family provides attractive targets for numerous psychiatric and neurologic disorders, with the majority of discovery programs focused on targeting allosteric sites, with allosteric ligands now available for all mGlu receptor subtypes. However, the development of allosteric ligands remains challenging. Biased modulation, probe dependence, and molecular switches all contribute to the complex molecular pharmacology exhibited by mGlu receptor allosteric ligands. In recent years we have made significant progress in our understanding of this molecular complexity coupled with an increased understanding of the structural basis of mGlu allosteric modulation. PMID:25808929

  15. Brainstem metabotropic glutamate receptors reduce food intake and activate dorsal pontine and medullar structures after peripheral bacterial lipopolysaccharide administration.

    PubMed

    Chaskiel, Léa; Paul, Flora; Gerstberger, Rüdiger; Hübschle, Thomas; Konsman, Jan Pieter

    2016-08-01

    During infection-induced inflammation food intake is reduced. Vagal and brainstem pathways are important both in feeding regulation and immune-to-brain communication. Glutamate is released by vagal afferent terminals in the nucleus of the solitary tract and by its neurons projecting to the parabrachial nuclei. We therefore studied the role of brainstem glutamate receptors in spontaneous food intake of healthy animals and during sickness-associated hypophagia after peripheral administration of bacterial lipopolysaccharides or interleukin-1beta. Brainstem group I and II metabotropic, but not ionotropic, glutamate receptor antagonism increased food intake both in saline- and lipopolysaccharide-treated rats. In these animals, expression of the cellular activation marker c-Fos in the lateral parabrachial nuclei and lipopolysaccharide-induced activation of the nucleus of the solitary tract rostral to the area postrema were suppressed. Group I metabotropic glutamate receptors did not colocalize with c-Fos or neurons regulating gastric function in these structures. Group I metabotropic glutamate receptors were, however, found on raphé magnus neurons that were part of the brainstem circuit innervating the stomach and on trigeminal and hypoglossal motor neurons. In conclusion, our findings show that brainstem metabotropic glutamate receptors reduce food intake and activate the lateral parabrachial nuclei as well as the rostral nucleus of the solitary tract after peripheral bacterial lipopolysaccharide administration. They also provide insight into potential group I metabotropic glutamate receptor-dependent brainstem circuits mediating these effects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Ionotropic and metabotropic glutamate receptor mediation of glucocorticoid-induced apoptosis in hippocampal cells and the neuroprotective role of synaptic N-methyl-D-aspartate receptors.

    PubMed

    Lu, J; Goula, D; Sousa, N; Almeida, O F X

    2003-01-01

    Glutamate receptors have been proposed to mediate the apoptotic actions of glucocorticoids in hippocampal cells. To further analyze the role of glutamate receptors in this process, we pretreated primary hippocampal cells from neonatal (postnatal day 4) rats with antagonists of ionotropic glutamate receptor (iGluR) and metabotropic glutamate receptor (mGluR) antagonists before exposure to the specific glucocorticoid receptor agonist dexamethasone (DEX) at a dose of 1 microM. Dizocilpine (MK801; a general N-methyl-D-aspartic acid [NMDA] receptor antagonist, NMDAR antagonist) and ifenprodil (a specific ligand of the NMDAR 2B subunit, NR2B), were used to block iGluR; (RS)-alpha-ethyl-4-carboxyphenylglycine (E4CPG) and (RS)-alpha-cyclopropyl-4-phosphonophenyl-glycine (CPPG) were employed as I/II (E4CPG) and II/III (CPPG) mGluR antagonists. Blockade of iGluR resulted in a significant attenuation of DEX-induced cell death; the finding that ifenprodil exerted a similar potency to MK801 demonstrates the involvement of NR2B receptors in glucocorticoid-induced cell death. Apoptosis accounted for a significant amount of the cell loss observed, as detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling histochemistry for the in situ labeling of DNA breaks; apoptotic cells were distinguished from necrosis on the basis of morphological criteria, including chromatin condensation, membrane blebbing and presence of apoptotic bodies. Treatment with E4CPG and CPPG completely abolished the apoptotic response to DEX, thus showing the additional contribution of mGluR to the phenomenon. Further, dose-response studies with NMDA revealed that whereas high (10 microM) doses of NMDA themselves elicit cytotoxic responses, low (1-5 microM) concentrations of NMDA can effectively oppose DEX-induced cell death. Interestingly, the neuroprotective actions of low dose NMDA stimulation were abolished when either synaptic or extrasynaptic NMDA receptors were blocked with MK801

  17. KCa2 channels activation prevents [Ca2+]i deregulation and reduces neuronal death following glutamate toxicity and cerebral ischemia

    PubMed Central

    Dolga, A M; Terpolilli, N; Kepura, F; Nijholt, I M; Knaus, H-G; D'Orsi, B; Prehn, J H M; Eisel, U L M; Plant, T; Plesnila, N; Culmsee, C

    2011-01-01

    Exacerbated activation of glutamate receptor-coupled calcium channels and subsequent increase in intracellular calcium ([Ca2+]i) are established hallmarks of neuronal cell death in acute and chronic neurological diseases. Here we show that pathological [Ca2+]i deregulation occurring after glutamate receptor stimulation is effectively modulated by small conductance calcium-activated potassium (KCa2) channels. We found that neuronal excitotoxicity was associated with a rapid downregulation of KCa2.2 channels within 3 h after the onset of glutamate exposure. Activation of KCa2 channels preserved KCa2 expression and significantly reduced pathological increases in [Ca2+]i providing robust neuroprotection in vitro and in vivo. These data suggest a critical role for KCa2 channels in excitotoxic neuronal cell death and propose their activation as potential therapeutic strategy for the treatment of acute and chronic neurodegenerative disorders. PMID:21509037

  18. KCa2 channels activation prevents [Ca2+]i deregulation and reduces neuronal death following glutamate toxicity and cerebral ischemia.

    PubMed

    Dolga, A M; Terpolilli, N; Kepura, F; Nijholt, I M; Knaus, H-G; D'Orsi, B; Prehn, J H M; Eisel, U L M; Plant, T; Plesnila, N; Culmsee, C

    2011-04-21

    Exacerbated activation of glutamate receptor-coupled calcium channels and subsequent increase in intracellular calcium ([Ca2+]i) are established hallmarks of neuronal cell death in acute and chronic neurological diseases. Here we show that pathological [Ca2+]i deregulation occurring after glutamate receptor stimulation is effectively modulated by small conductance calcium-activated potassium (KCa2) channels. We found that neuronal excitotoxicity was associated with a rapid downregulation of KCa2.2 channels within 3 h after the onset of glutamate exposure. Activation of KCa2 channels preserved KCa2 expression and significantly reduced pathological increases in [Ca2+]i providing robust neuroprotection in vitro and in vivo. These data suggest a critical role for KCa2 channels in excitotoxic neuronal cell death and propose their activation as potential therapeutic strategy for the treatment of acute and chronic neurodegenerative disorders.

  19. Novel Functional Properties of Drosophila CNS Glutamate Receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yan; Dharkar, Poorva; Han, Tae-Hee

    Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation bymore » its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation.« less

  20. Novel Functional Properties of Drosophila CNS Glutamate Receptors.

    PubMed

    Li, Yan; Dharkar, Poorva; Han, Tae-Hee; Serpe, Mihaela; Lee, Chi-Hon; Mayer, Mark L

    2016-12-07

    Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation by its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation. VIDEO ABSTRACT. Published by Elsevier Inc.

  1. Anticonvulsant activity of artificial sweeteners: a structural link between sweet-taste receptor T1R3 and brain glutamate receptors.

    PubMed

    Talevi, Alan; Enrique, Andrea V; Bruno-Blanch, Luis E

    2012-06-15

    A virtual screening campaign based on application of a topological discriminant function capable of identifying novel anticonvulsant agents indicated several widely-used artificial sweeteners as potential anticonvulsant candidates. Acesulfame potassium, cyclamate and saccharin were tested in the Maximal Electroshock Seizure model (mice, ip), showing moderate anticonvulsant activity. We hypothesized a probable structural link between the receptor responsible of sweet taste and anticonvulsant molecular targets. Bioinformatic tools confirmed a highly significant sequence-similarity between taste-related protein T1R3 and several metabotropic glutamate receptors from different species, including glutamate receptors upregulated in epileptogenesis and certain types of epilepsy. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. A Temporally Distinct Role for Group I and Group II Metabotropic Glutamate Receptors in Object Recognition Memory

    ERIC Educational Resources Information Center

    Brown, Malcolm Watson; Warburton, Elizabeth Clea; Barker, Gareth Robert Isaac; Bashir, Zafar Iqbal

    2006-01-01

    Recognition memory, involving the ability to discriminate between a novel and familiar object, depends on the integrity of the perirhinal cortex (PRH). Glutamate, the main excitatory neurotransmitter in the cortex, is essential for many types of memory processes. Of the subtypes of glutamate receptor, metabotropic receptors (mGluRs) have received…

  3. Glutamate receptor activation in the kindled dentate gyrus.

    PubMed

    Behr, J; Heinemann, U; Mody, I

    2000-01-01

    The contribution of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), N-methyl-D-aspartate (NMDA), and kainate receptor activation to the enhanced seizure susceptibility of the dentate gyrus was investigated in an experimental model of temporal lobe epilepsy. Using the specific NMDA and AMPA receptor antagonists D-APV and SYM 2206, we examined alterations in glutamate receptor-dependent synaptic currents 48 hours and 28 days after kindling in field-potential and voltage-clamp recordings. Forty-eight hours after kindling, the fractions of AMPA and NMDA receptor-mediated excitatory postsynaptic current components shifted dramatically in favor of the NMDA receptor-mediated response. Four weeks after kindling, however, AMPA and NMDA receptor-mediated excitatory postsynaptic currents reverted to control-like values. Neither single nor repetitive perforant path stimuli evoked kainate receptor-mediated excitatory postsynaptic currents in dentate gyrus granule cells of control or kindled rats. The enhanced excitability of the kindled dentate gyrus 48 hours after the last seizure most likely results from transiently enhanced NMDA receptor activation. The NMDA receptor seems to play a critical role in the induction of the kindled state rather than in the persistence of the enhanced seizure susceptibility.

  4. Alcohol drinking increases the dopamine-stimulating effects of ethanol and reduces D2 auto-receptor and group II metabotropic glutamate receptor function within the posterior ventral tegmental area of alcohol preferring (P) rats.

    PubMed

    Ding, Zheng-Ming; Ingraham, Cynthia M; Rodd, Zachary A; McBride, William J

    2016-10-01

    Repeated local administration of ethanol (EtOH) sensitized the posterior ventral tegmental area (pVTA) to the local dopamine (DA)-stimulating effects of EtOH. Chronic alcohol drinking increased nucleus accumbens (NAC) DA transmission and pVTA glutamate transmission in alcohol-preferring (P) rats. The objectives of the present study were to determine the effects of chronic alcohol drinking by P rats on the (a) sensitivity and response of the pVTA DA neurons to the DA-stimulating actions of EtOH, and (b) negative feedback control of DA (via D2 auto-receptors) and glutamate (via group II mGlu auto-receptors) release in the pVTA. EtOH (50 or 150 mg%) or the D2/3 receptor antagonist sulpiride (100 or 200 μM) was microinjected into the pVTA while DA was sampled with microdialysis in the NAC shell (NACsh). The mGluR2/3 antagonist LY341495 (1 or 10 μM) was perfused through the pVTA via reverse microdialysis and local extracellular glutamate and DA levels were measured. EtOH produced a more robust increase of NACsh DA in the 'EtOH' than 'Water' groups (e.g., 150 mg% EtOH: to ∼ 210 vs 150% of baseline). In contrast, sulpiride increased DA release in the NACsh more in the 'Water' than 'EtOH' groups (e.g., 200 μM sulpiride: to ∼ 190-240 vs 150-160% of baseline). LY341495 (at 10 μM) increased extracellular glutamate and DA levels in the 'Water' (to ∼ 150-180% and 180-230% of baseline, respectively) but not the 'EtOH' groups. These results indicate that alcohol drinking enhanced the DA-stimulating effects of EtOH, and attenuated the functional activities of D2 auto-receptors and group II mGluRs within the pVTA. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Radiosynthesis of carbon-11 and fluorine-18 labelled radiotracers to image the ionotropic and metabotropic glutamate receptors.

    PubMed

    Sobrio, Franck

    2013-01-01

    l-Glutamate is the major neurotransmitter in the central nervous system and activates both ionotropic and metabotropic receptors. Here the radiosynthesis of radiotracers developed for both types of receptors are reviewed with a highlight on the radiopharmaceuticals used or evaluated in humans. At first, radiotracers were developed for ionotropic N-methyl-d-aspartate receptors without any success to obtain radiopharmaceuticals useable for clinical or even preclinical positron emission tomography (PET) imaging purposes. Some compounds were radiolabelled and evaluated for α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors without any successful results. The recent development of radiotracers for metabotropic glutamate receptors was more efficient because radiopharmaceuticals are currently evaluated or used in clinical trials to study the mGluR1, mGluR2 or mGluR5 receptors by PET. Although the majority of the radiotracers were classically labelled with carbon-11 by O- or N-[(11) C]-methylation or with fluorine-18 nucleophilic substitution of aromatic nitro or halogeno precursors using krypofix 2.2.2/potassium [(18) F]fluoride complex, some radiosyntheses were performed with recent radiolabelling reactions like the use of iodionium salt for [(18) F]-labelling. Copyright © 2013 John Wiley & Sons, Ltd.

  6. Modulation of ionotropic glutamate receptor function by vertebrate galectins

    PubMed Central

    Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T

    2014-01-01

    AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. PMID:24614744

  7. Neurosteroid binding to the amino terminal and glutamate binding domains of ionotropic glutamate receptors.

    PubMed

    Cameron, Krasnodara; Bartle, Emily; Roark, Ryan; Fanelli, David; Pham, Melissa; Pollard, Beth; Borkowski, Brian; Rhoads, Sarah; Kim, Joon; Rocha, Monica; Kahlson, Martha; Kangala, Melinda; Gentile, Lisa

    2012-06-01

    The endogenous neurosteroids, pregnenolone sulfate (PS) and 3α-hydroxy-5β-pregnan-20-one sulfate (PREGAS), have been shown to differentially regulate the ionotropic glutamate receptor (iGluR) family of ligand-gated ion channels. Upon binding to these receptors, PREGAS decreases current flow through the channels. Upon binding to non-NMDA or NMDA receptors containing an GluN2C or GluN2D subunit, PS also decreases current flow through the channels, however, upon binding to NMDA receptors containing an GluN2A or GluN2B subunit, flow through the channels increases. To begin to understand this differential regulation, we have cloned the S1S2 and amino terminal domains (ATD) of the NMDA GluN2B and GluN2D and AMPA GluA2 subunits. Here we present results that show that PS and PREGAS bind to different sites in the ATD of the GluA2 subunit, which when combined with previous results from our lab, now identifies two binding domains for each neurosteroid. We also show both neurosteroids bind only to the ATD of the GluN2D subunit, suggesting that this binding is distinct from that of the AMPA GluA2 subunit, with both leading to iGluR inhibition. Finally, we provide evidence that both PS and PREGAS bind to the S1S2 domain of the NMDA GluN2B subunit. Neurosteroid binding to the S1S2 domain of NMDA subunits responsible for potentiation of iGluRs and to the ATD of NMDA subunits responsible for inhibition of iGluRs, provides an interesting option for therapeutic design. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Evidence for involvement of nitric oxide and GABAB receptors in MK-801- stimulated release of glutamate in rat prefrontal cortex

    PubMed Central

    Roenker, Nicole L.; Gudelsky, Gary A.; Ahlbrand, Rebecca; Horn, Paul S.; Richtand, Neil M.

    2012-01-01

    Systemic administration of NMDA receptor antagonists elevates extracellular glutamate within prefrontal cortex. The cognitive and behavioral effects of NMDA receptor blockade have direct relevance to symptoms of schizophrenia, and recent studies demonstrate an important role for nitric oxide and GABAB receptors in mediating the effects of NMDA receptor blockade on these behaviors. We sought to extend those observations by directly measuring the effects of nitric oxide and GABAB receptor mechanisms on MK-801-induced glutamate release in the prefrontal cortex. Systemic MK-801 injection (0.3 mg/kg) to male Sprague-Dawley rats significantly increased extracellular glutamate levels in prefrontal cortex, as determined by microdialysis. This effect was blocked by pretreatment with the nitric oxide synthase inhibitor L-NAME (60 mg/kg). Reverse dialysis of the nitric oxide donor SNAP (0.5 – 5 mM) directly into prefrontal cortex mimicked the effect of systemic MK-801, dose-dependently elevating cortical extracellular glutamate. The effect of MK-801 was also blocked by systemic treatment with the GABAB receptor agonist baclofen (5 mg/kg). In combination, these data suggest increased nitric oxide formation is necessary for NMDA antagonist-induced elevations of extracellular glutamate in the prefrontal cortex. Additionally, the data suggest GABAB receptor activation can modulate the NMDA antagonist-induced increase in cortical glutamate release. PMID:22579658

  9. Dual regulation of Ca2+-dependent glutamate release from astrocytes: vesicular glutamate transporters and cytosolic glutamate levels.

    PubMed

    Ni, Yingchun; Parpura, Vladimir

    2009-09-01

    Vesicular glutamate transporters (VGLUTs) are responsible for vesicular glutamate storage and exocytotic glutamate release in neurons and astrocytes. Here, we selectively and efficiently overexpressed individual VGLUT proteins (VGLUT1, 2, or 3) in solitary astrocytes and studied their effects on mechanical stimulation-induced Ca2+-dependent glutamate release. Neither VGLUT1 nor VGLUT2 overexpression changed the amount of glutamate release, whereas overexpression of VGLUT3 significantly enhanced Ca2+-dependent glutamate release from astrocytes. None of the VGLUT overexpression affected mechanically induced intracellular Ca2+ increase. Inhibition of glutamine synthetase activity by L-methionine sulfoximine in astrocytes, which leads to increased cytosolic glutamate concentration, greatly increased their mechanically induced Ca2+-dependent glutamate release, without affecting intracellular Ca2+ dynamics. Taken together, these data indicate that both VGLUT3 and the cytosolic concentration of glutamate are key limiting factors in regulating the Ca2+-dependent release of glutamate from astrocytes.

  10. Receptor changes and LTP: an analysis using aniracetam, a drug that reversibly modifies glutamate (AMPA) receptors.

    PubMed

    Staubli, U; Ambros-Ingerson, J; Lynch, G

    1992-01-01

    The hypothesis that long-term potentiation (LTP) involves receptor modifications was tested with aniracetam, a nootropic drug that selectively increases currents mediated by the AMPA subclass of glutamate receptors. Aniracetam had different effects on the waveform of synaptic potentials in hippocampus before and after induction of LTP: (1) the drug caused a slight reduction (or delay) of the initial segment of the response after LTP; and (2) the facilitatory effects of aniracetam occurred at a later time point in the response after LTP than before. The interactions between LTP and aniracetam were still present when synaptic responses were greatly reduced by partial blockade of postsynaptic receptors and were not reproduced by increasing release or the number of stimulated synapses. A mathematical treatment of synaptic currents produced the following results: (1) if aniracetam facilitates AMPA receptor currents simply by reducing desensitization, then its complex interaction with LTP emerges when potentiation changes the kinetic and conductance properties of receptor channels; (2) if aniracetam also significantly increases conductance, then the experimental data can be reproduced by modeling LTP as an increase in channel conductance alone.

  11. Kainate Receptors Inhibit Glutamate Release Via Mobilization of Endocannabinoids in Striatal Direct Pathway Spiny Projection Neurons.

    PubMed

    Marshall, John J; Xu, Jian; Contractor, Anis

    2018-04-18

    Kainate receptors are members of the glutamate receptor family that function by both generating ionotropic currents through an integral ion channel pore and coupling to downstream metabotropic signaling pathways. They are highly expressed in the striatum, yet their roles in regulating striatal synapses are not known. Using mice of both sexes, we demonstrate that GluK2-containing kainate receptors expressed in direct pathway spiny projection neurons (dSPNs) inhibit glutamate release at corticostriatal synapses in the dorsolateral striatum. This inhibition requires postsynaptic kainate-receptor-mediated mobilization of a retrograde endocannabinoid (eCB) signal and activation of presynaptic CB1 receptors. This pathway can be activated during repetitive 25 Hz trains of synaptic stimulation, causing short-term depression of corticostriatal synapses. This is the first study to demonstrate a role for kainate receptors in regulating eCB-mediated plasticity at the corticostriatal synapse and demonstrates an important role for these receptors in regulating basal ganglia circuits. SIGNIFICANCE STATEMENT The GRIK2 gene, encoding the GluK2 subunit of the kainate receptor, has been linked to several neuropsychiatric and neurodevelopmental disorders including obsessive compulsive disorder (OCD). Perseverative behaviors associated with OCD are known to result from pathophysiological changes in the striatum and kainate receptor knock-out mice have striatal-dependent phenotypes. However, the role of kainate receptors in striatal synapses is not known. We demonstrate that GluK2-containing kainate receptors regulate corticostriatal synapses by mobilizing endocannabinoids from direct pathway spiny projection neurons. Synaptic activation of GluK2 receptors during trains of synaptic input causes short-term synaptic depression, demonstrating a novel role for these receptors in regulating striatal circuits. Copyright © 2018 the authors 0270-6474/18/383901-10$15.00/0.

  12. Cell Surface Translocation of Annexin A2 Facilitates Glutamate-induced Extracellular Proteolysis*

    PubMed Central

    Valapala, Mallika; Maji, Sayantan; Borejdo, Julian; Vishwanatha, Jamboor K.

    2014-01-01

    Glutamate-induced elevation in intracellular Ca2+ has been implicated in excitotoxic cell death. Neurons respond to increased glutamate levels by activating an extracellular proteolytic cascade involving the components of the plasmin-plasminogen system. AnxA2 is a Ca2+-dependent phospholipid binding protein and serves as an extracellular proteolytic center by recruiting the tissue plasminogen activator and plasminogen and mediating the localized generation of plasmin. Ratiometric Ca2+ imaging and time-lapse confocal microscopy demonstrated glutamate-induced Ca2+ influx. We showed that glutamate translocated both endogenous and AnxA2-GFP to the cell surface in a process dependent on the activity of the NMDA receptor. Glutamate-induced translocation of AnxA2 is dependent on the phosphorylation of tyrosine 23 at the N terminus, and mutation of tyrosine 23 to a non-phosphomimetic variant inhibits the translocation process. The cell surface-translocated AnxA2 forms an active plasmin-generating complex, and this activity can be neutralized by a hexapeptide directed against the N terminus. These results suggest an involvement of AnxA2 in potentiating glutamate-induced cell death processes. PMID:24742684

  13. Recent advances in targeting the ionotropic glutamate receptors in treating schizophrenia

    PubMed Central

    McCullumsmith, Robert E.; Hammond, John; Funk, Adam; Meador-Woodruff, James H.

    2013-01-01

    The treatment of schizophrenia has been focused on modulation of dopamine receptors for over 50 years. Recent developments have implicated other neurotransmitter systems in the pathophysiology of this illness. The discovery and characterization of glutamate receptors and their roles in the brain has lead to novel approaches for the treatment of schizophrenia. In this article, we review drugs that modulate ionotropic gluamate receptors and discuss their efficacy for the treatment of this often debilitating severe mental illness. PMID:22283761

  14. The selective metabotropic glutamate 2/3 receptor agonist MGS0028 reverses psychomotor abnormalities and recognition memory deficits in mice lacking the pituitary adenylate cyclase-activating polypeptide.

    PubMed

    Ago, Yukio; Hiramatsu, Naoki; Ishihama, Toshihiro; Hazama, Keisuke; Hayata-Takano, Atsuko; Shibasaki, Yasuhiro; Shintani, Norihito; Hashimoto, Hitoshi; Kawasaki, Toshiyuki; Onoe, Hirotaka; Chaki, Shigeyuki; Nakazato, Atsuro; Baba, Akemichi; Takuma, Kazuhiro; Matsuda, Toshio

    2013-02-01

    Previous studies suggest that metabotropic glutamate 2/3 receptors are involved in psychiatric disorders. In this study, we examined the effects of the selective metabotropic glutamate 2/3 (mGlu2/3) receptor agonist MGS0028 on behavioral abnormalities in mice lacking the pituitary adenylate cyclase-activating polypeptide (PACAP), an experimental model of psychiatric disorders such as schizophrenia and attention-deficit/hyperactivity disorder. We found that PACAP-deficient mice showed impairments in the novel object recognition test and these impairments were improved by MGS0028 (0.1 mg/kg). Similarly, MGS0028 improved hyperactivity and jumping behaviors, but did not reverse increased immobility times in the forced swim test in PACAP-deficient mice. These results suggest that MGS0028 may be a potential, novel treatment for psychiatric disorders.

  15. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer’s disease

    PubMed Central

    Haas, Laura T.; Salazar, Santiago V.; Kostylev, Mikhail A.; Um, Ji Won; Kaufman, Adam C.

    2016-01-01

    Alzheimer’s disease-related phenotypes in mice can be rescued by blockade of either cellular prion protein or metabotropic glutamate receptor 5. We sought genetic and biochemical evidence that these proteins function cooperatively as an obligate complex in the brain. We show that cellular prion protein associates via transmembrane metabotropic glutamate receptor 5 with the intracellular protein mediators Homer1b/c, calcium/calmodulin-dependent protein kinase II, and the Alzheimer’s disease risk gene product protein tyrosine kinase 2 beta. Coupling of cellular prion protein to these intracellular proteins is modified by soluble amyloid-β oligomers, by mouse brain Alzheimer’s disease transgenes or by human Alzheimer’s disease pathology. Amyloid-β oligomer-triggered phosphorylation of intracellular protein mediators and impairment of synaptic plasticity in vitro requires Prnp–Grm5 genetic interaction, being absent in transheterozygous loss-of-function, but present in either single heterozygote. Importantly, genetic coupling between Prnp and Grm5 is also responsible for signalling, for survival and for synapse loss in Alzheimer’s disease transgenic model mice. Thus, the interaction between metabotropic glutamate receptor 5 and cellular prion protein has a central role in Alzheimer’s disease pathogenesis, and the complex is a potential target for disease-modifying intervention. PMID:26667279

  16. Glutamate Receptors within the Mesolimbic Dopamine System Mediate Alcohol Relapse Behavior.

    PubMed

    Eisenhardt, Manuela; Leixner, Sarah; Luján, Rafael; Spanagel, Rainer; Bilbao, Ainhoa

    2015-11-25

    Glutamatergic input within the mesolimbic dopamine (DA) pathway plays a critical role in the development of addictive behavior. Although this is well established for some drugs of abuse, it is not known whether glutamate receptors within the mesolimbic system are involved in mediating the addictive properties of chronic alcohol use. Here we evaluated the contribution of mesolimbic NMDARs and AMPARs in mediating alcohol-seeking responses induced by environmental stimuli and relapse behavior using four inducible mutant mouse lines lacking the glutamate receptor genes Grin1 or Gria1 in either DA transporter (DAT) or D1R-expressing neurons. We first demonstrate the lack of GluN1 or GluA1 in either DAT- or D1R-expressing neurons in our mutant mouse lines by colocalization studies. We then show that GluN1 and GluA1 receptor subunits within these neuronal subpopulations mediate the alcohol deprivation effect, while having no impact on context- plus cue-induced reinstatement of alcohol-seeking behavior. We further validated these results pharmacologically by demonstrating similar reductions in the alcohol deprivation effect after infusion of the NMDAR antagonist memantine into the nucleus accumbens and ventral tegmental area of control mice, and a rescue of the mutant phenotype via pharmacological potentiation of AMPAR activity using aniracetam. In conclusion, dopamine neurons as well as D1R-expressing medium spiny neurons and their glutamatergic inputs via NMDARs and AMPARs act in concert to influence relapse responses. These results provide a neuroanatomical and molecular substrate for relapse behavior and emphasize the importance of glutamatergic drugs in modulating relapse behavior. Here we provide genetic and pharmacological evidence that glutamate receptors within the mesolimbic dopamine system play an essential role in alcohol relapse. Using various inducible and site-specific transgenic mouse models and pharmacological validation experiments, we show that critical

  17. Platelet-activating factor and group I metabotropic glutamate receptors interact for full development and maintenance of long-term potentiation in the rat medial vestibular nuclei.

    PubMed

    Grassi, S; Francescangeli, E; Goracci, G; Pettorossi, V E

    1999-01-01

    In rat brainstem slices, we investigated the interaction between platelet-activating factor and group I metabotropic glutamate receptors in mediating long-term potentiation within the medial vestibular nuclei. We analysed the N1 field potential wave evoked in the ventral portion of the medial vestibular nuclei by primary vestibular afferent stimulation. The group I metabotropic glutamate receptor antagonist, (R,S)-1-aminoindan-1,5-dicarboxylic acid, prevented long-term potentiation induced by a platelet-activating factor analogue [1-O-hexadecyl-2-O-(methylcarbamyl)-sn-glycero-3-phosphocholine], as well as the full development of potentiation, induced by high-frequency stimulation under the blocking agent for synaptosomal platelet-activating factor receptors (ginkolide B), at drug washout. However, potentiation directly induced by the group I glutamate metabotropic receptor agonist, (R,S)-3,5-dihydroxyphenylglycine, was reduced by ginkolide B. These findings suggest that platelet-activating factor, whether exogenous or released following potentiation induction, exerts its effect through presynaptic group I metabotropic glutamate receptors, mediating the increase of glutamate release. In addition, we found that this mechanism, which led to full potentiation through presynaptic group I metabotropic glutamate receptor activation, was inactivated soon after application of potentiation-inducing stimulus. In fact, the long-lasting block of the platelet-activating factor and metabotropic glutamate receptors prevented the full potentiation development and the induced potentiation progressively declined to null. Moreover, ginkolide B, given when high-frequency-dependent potentiation was established, only reduced it within 5 min after potentiation induction. We conclude that to fully develop vestibular long-term potentiation requires presynaptic events. Platelet-activating factor, released after the activation of postsynaptic mechanisms which induce potentiation, is necessary

  18. Structure, Dynamics, and Allosteric Potential of Ionotropic Glutamate Receptor N-Terminal Domains

    PubMed Central

    Krieger, James; Bahar, Ivet; Greger, Ingo H.

    2015-01-01

    Ionotropic glutamate receptors (iGluRs) are tetrameric cation channels that mediate synaptic transmission and plasticity. They have a unique modular architecture with four domains: the intracellular C-terminal domain (CTD) that is involved in synaptic targeting, the transmembrane domain (TMD) that forms the ion channel, the membrane-proximal ligand-binding domain (LBD) that binds agonists such as L-glutamate, and the distal N-terminal domain (NTD), whose function is the least clear. The extracellular portion, comprised of the LBD and NTD, is loosely arranged, mediating complex allosteric regulation and providing a rich target for drug development. Here, we briefly review recent work on iGluR NTD structure and dynamics, and further explore the allosteric potential for the NTD in AMPA-type iGluRs using coarse-grained simulations. We also investigate mechanisms underlying the established NTD allostery in NMDA-type iGluRs, as well as the fold-related metabotropic glutamate and GABAB receptors. We show that the clamshell motions intrinsically favored by the NTD bilobate fold are coupled to dimeric and higher-order rearrangements that impact the iGluR LBD and ultimately the TMD. Finally, we explore the dynamics of intact iGluRs and describe how it might affect receptor operation in a synaptic environment. PMID:26255587

  19. Dynamic DNA Methylation Controls Glutamate Receptor Trafficking and Synaptic Scaling

    PubMed Central

    Sweatt, J. David

    2016-01-01

    Hebbian plasticity, including LTP and LTD, has long been regarded as important for local circuit refinement in the context of memory formation and stabilization. However, circuit development and stabilization additionally relies on non-Hebbian, homoeostatic, forms of plasticity such as synaptic scaling. Synaptic scaling is induced by chronic increases or decreases in neuronal activity. Synaptic scaling is associated with cell-wide adjustments in postsynaptic receptor density, and can occur in a multiplicative manner resulting in preservation of relative synaptic strengths across the entire neuron's population of synapses. Both active DNA methylation and de-methylation have been validated as crucial regulators of gene transcription during learning, and synaptic scaling is known to be transcriptionally dependent. However, it has been unclear whether homeostatic forms of plasticity such as synaptic scaling are regulated via epigenetic mechanisms. This review describes exciting recent work that has demonstrated a role for active changes in neuronal DNA methylation and demethylation as a controller of synaptic scaling and glutamate receptor trafficking. These findings bring together three major categories of memory-associated mechanisms that were previously largely considered separately: DNA methylation, homeostatic plasticity, and glutamate receptor trafficking. PMID:26849493

  20. Effects of ethanol and anesthetics on type 1 and 5 metabotropic glutamate receptors expressed in Xenopus laevis oocytes.

    PubMed

    Minami, K; Gereau, R W; Minami, M; Heinemann, S F; Harris, R A

    1998-01-01

    Previous studies have demonstrated that ethanol and volatile anesthetics inhibit the function of some metabotropic (G protein-coupled) receptors, including the 5-hydroxytryptamine2 and muscarinic cholinergic receptors. The metabotropic glutamate receptors (mGluRs) show little sequence homology with most other metabotropic receptors and are important modulators of synaptic transmission in the mammalian central nervous system. It was of interest to determine drug actions on these receptors, and we investigated the effects of ethanol, halothane, the anesthetic compound F3 (1-chloro-1,2,2-trifluorocyclobutane), and the nonanesthetics F6 (1,2-dichlorohexafluorocyclobutane) and F8 (2,3-chlorooctafluorobutane) on the function of mGluR1 and mGluR5 expressed in Xenopus laevis oocytes. Halothane, F3, and ethanol inhibited mGluR5-induced Ca(2+)-dependent Cl- currents, yet pharmacologically relevant concentrations of these compounds had little effect on the glutamate-induced currents in the oocytes expressing mGluR1. F6 had inhibitory effects on both receptors, and F8 did not affect either mGluR1 or mGluR5 function. The protein kinase C (PKC) inhibitor GF109203X enhanced the glutamate-induced current, and the PKC activator phorbol-12-myristate-13-acetate inhibited this current in the oocytes expressing mGluR5, but these compounds had little effect on mGluR1 function. GF109203X abolished the inhibitory effects of halothane, F3, and ethanol on mGluR5s. Conversely, the phosphatase inhibitor calyculin A prolonged the action of halothane and ethanol. Furthermore, mutation of a PKC consensus site (Ser890) of mGluR5 abolished the inhibitory effects of halothane, F3, and ethanol. These results suggest that ethanol and volatile anesthetics inhibit mGluR5 because they promote PKC-mediated phosphorylation.

  1. AMPA receptor activation controls type I metabotropic glutamate receptor signalling via a tyrosine kinase at parallel fibre-Purkinje cell synapses.

    PubMed

    Auger, Céline; Ogden, David

    2010-08-15

    Metabotropic glutamate receptors type 1 (mGluR1s) and ionotropic AMPA receptors (AMPARs) are colocalized at parallel fibre (PF) to Purkinje cell synapses of the cerebellum. Single stimulation of PFs activates fast AMPAR excitatory postsynaptic currents, whereas the activation of mGluR1s requires burst stimulation. mGluR1s signal through several pathways in Purkinje cells and the most prominent is the activation of a slow EPSC (sEPSC). To separate the two synaptic currents, studies of the sEPSC have commonly been performed in the presence of AMPA/KA receptor antagonists. We show here in rat cerebellar slices that inhibition of the fast EPSC by AMPAR antagonists strongly and selectively potentiates the mGluR1 sEPSC, showing a negative regulation of mGluR1 by AMPAR. This effect is observed with low concentrations of NBQX (300 nM to 1 microM), with the selective AMPAR antagonist GYKI 53655 and also with gamma-DGG, a low affinity glutamate receptor antagonist. When photorelease of glutamate from MNI-glutamate was used to study the postsynaptic responses in isolation, AMPAR inhibition produced a similar potentiation of the mGluR1 sEPSC, showing that the interaction is postsynaptic. Finally, perfusion of the postsynaptic cell with PP1, an inhibitor of src-family tyrosine kinase, increased the amplitude of the mGluR1 sEPSC and occluded the effect of AMPAR inhibition. Thus, at PF to Purkinje cell synapses, AMPAR activation inhibits the mGluR1 sEPSC via activation of a src-family tyrosine kinase. Consequently mGluR1 signalling will be more sensitive to spillover of glutamate than to local synaptic release. Furthermore, it will be enhanced at silent PF synapses which are the majority in Purkinje cells.

  2. Enthalpy-Entropy Compensation in the Binding of Modulators at Ionotropic Glutamate Receptor GluA2.

    PubMed

    Krintel, Christian; Francotte, Pierre; Pickering, Darryl S; Juknaitė, Lina; Pøhlsgaard, Jacob; Olsen, Lars; Frydenvang, Karla; Goffin, Eric; Pirotte, Bernard; Kastrup, Jette S

    2016-06-07

    The 1,2,4-benzothiadiazine 1,1-dioxide type of positive allosteric modulators of the ionotropic glutamate receptor A2 (GluA2) are promising lead compounds for the treatment of cognitive disorders, e.g., Alzheimer's disease. The modulators bind in a cleft formed by the interface of two neighboring ligand binding domains and act by stabilizing the agonist-bound open-channel conformation. The driving forces behind the binding of these modulators can be significantly altered with only minor substitutions to the parent molecules. In this study, we show that changing the 7-fluorine substituent of modulators BPAM97 (2) and BPAM344 (3) into a hydroxyl group (BPAM557 (4) and BPAM521 (5), respectively), leads to a more favorable binding enthalpy (ΔH, kcal/mol) from -4.9 (2) and -7.5 (3) to -6.2 (4) and -14.5 (5), but also a less favorable binding entropy (-TΔS, kcal/mol) from -2.3 (2) and -1.3 (3) to -0.5 (4) and 4.8 (5). Thus, the dissociation constants (Kd, μM) of 4 (11.2) and 5 (0.16) are similar to those of 2 (5.6) and 3 (0.35). Functionally, 4 and 5 potentiated responses of 10 μM L-glutamate at homomeric rat GluA2(Q)i receptors with EC50 values of 67.3 and 2.45 μM, respectively. The binding mode of 5 was examined with x-ray crystallography, showing that the only change compared to that of earlier compounds was the orientation of Ser-497 pointing toward the hydroxyl group of 5. The favorable enthalpy can be explained by the formation of a hydrogen bond from the side-chain hydroxyl group of Ser-497 to the hydroxyl group of 5, whereas the unfavorable entropy might be due to desolvation effects combined with a conformational restriction of Ser-497 and 5. In summary, this study shows a remarkable example of enthalpy-entropy compensation in drug development accompanied with a likely explanation of the underlying structural mechanism. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. Differential effects of protein phosphatases in the recycling of metabotropic glutamate receptor 5.

    PubMed

    Mahato, P K; Pandey, S; Bhattacharyya, S

    2015-10-15

    The major excitatory neurotransmitter Glutamate acts on both ionotropic and metabotropic glutamate receptors (mGluRs) in the central nervous system. mGluR5, a member of the group I mGluR family is widely expressed throughout the brain and plays important roles in a variety of neuronal processes including various forms of synaptic plasticity. This receptor is also involved in various neuropsychiatric disorders, viz., Fragile X syndrome, autism etc. It has been reported that mGluR5 undergoes desensitization and subsequently internalization on ligand exposure in various cell types. However, the downstream events after the internalization and the molecular players involved in the post-endocytic events of this receptor have not been studied. In the present study, we find that subsequent to internalization mGluR5 enters the recycling compartment. After that the receptor recycles back to the cell surface. We also show here that the recycling of mGluR5 is dependent on protein phosphatases. Our data suggest that mGluR5 recycling is completely dependent on the activity of PP2A whereas, PP2B has partial effect on this process. Thus our study suggests that mGluR5 recycles back to the cell surface after ligand-dependent internalization and protein phosphatases that have been implicated in various forms of synaptic plasticity have differential effects on the recycling of mGluR5. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  4. Glutamate: Tastant and Neuromodulator in Taste Buds.

    PubMed

    Vandenbeuch, Aurelie; Kinnamon, Sue C

    2016-07-01

    In taste buds, glutamate plays a double role as a gustatory stimulus and neuromodulator. The detection of glutamate as a tastant involves several G protein-coupled receptors, including the heterodimer taste receptor type 1, member 1 and 3 as well as metabotropic glutamate receptors (mGluR1 and mGluR4). Both receptor types participate in the detection of glutamate as shown with knockout animals and selective antagonists. At the basal part of taste buds, ionotropic glutamate receptors [N-methyl-d-aspartate (NMDA) and non-NMDA] are expressed and participate in the modulation of the taste signal before its transmission to the brain. Evidence suggests that glutamate has an efferent function on taste cells and modulates the release of other neurotransmitters such as serotonin and ATP. This short article reviews the recent developments in the field with regard to glutamate receptors involved in both functions as well as the influence of glutamate on the taste signal. © 2016 American Society for Nutrition.

  5. Modulation of ionotropic glutamate receptor function by vertebrate galectins.

    PubMed

    Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T

    2014-05-15

    AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

  6. Genetically encoding a light switch in an ionotropic glutamate receptor reveals subunit-specific interfaces.

    PubMed

    Zhu, Shujia; Riou, Morgane; Yao, C Andrea; Carvalho, Stéphanie; Rodriguez, Pamela C; Bensaude, Olivier; Paoletti, Pierre; Ye, Shixin

    2014-04-22

    Reprogramming receptors to artificially respond to light has strong potential for molecular studies and interrogation of biological functions. Here, we design a light-controlled ionotropic glutamate receptor by genetically encoding a photoreactive unnatural amino acid (UAA). The photo-cross-linker p-azido-L-phenylalanine (AzF) was encoded in NMDA receptors (NMDARs), a class of glutamate-gated ion channels that play key roles in neuronal development and plasticity. AzF incorporation in the obligatory GluN1 subunit at the GluN1/GluN2B N-terminal domain (NTD) upper lobe dimer interface leads to an irreversible allosteric inhibition of channel activity upon UV illumination. In contrast, when pairing the UAA-containing GluN1 subunit with the GluN2A subunit, light-dependent inactivation is completely absent. By combining electrophysiological and biochemical analyses, we identify subunit-specific structural determinants at the GluN1/GluN2 NTD dimer interfaces that critically dictate UV-controlled inactivation. Our work reveals that the two major NMDAR subtypes differ in their ectodomain-subunit interactions, in particular their electrostatic contacts, resulting in GluN1 NTD coupling more tightly to the GluN2B NTD than to the GluN2A NTD. It also paves the way for engineering light-sensitive ligand-gated ion channels with subtype specificity through the genetic code expansion.

  7. Phaseic Acid, an Endogenous and Reversible Inhibitor of Glutamate Receptors in Mouse Brain*

    PubMed Central

    Hou, Sheng Tao; Jiang, Susan X.; Zaharia, L. Irina; Han, Xiumei; Benson, Chantel L.; Slinn, Jacqueline; Abrams, Suzanne R.

    2016-01-01

    Phaseic acid (PA) is a phytohormone regulating important physiological functions in higher plants. Here, we show the presence of naturally occurring (−)-PA in mouse and rat brains. (−)-PA is exclusively present in the choroid plexus and the cerebral vascular endothelial cells. Purified (−)-PA has no toxicity and protects cultured cortical neurons against glutamate toxicity through reversible inhibition of glutamate receptors. Focal occlusion of the middle cerebral artery elicited a significant induction in (−)-PA expression in the cerebrospinal fluid but not in the peripheral blood. Importantly, (−)-PA induction only occurred in the penumbra area, indicting a protective role of PA in the brain. Indeed, elevating the (−)-PA level in the brain reduced ischemic brain injury, whereas reducing the (−)-PA level using a monoclonal antibody against (−)-PA increased ischemic injury. Collectively, these studies showed for the first time that (−)-PA is an endogenous neuroprotective molecule capable of reversibly inhibiting glutamate receptors during ischemic brain injury. PMID:27864367

  8. Phaseic Acid, an Endogenous and Reversible Inhibitor of Glutamate Receptors in Mouse Brain.

    PubMed

    Hou, Sheng Tao; Jiang, Susan X; Zaharia, L Irina; Han, Xiumei; Benson, Chantel L; Slinn, Jacqueline; Abrams, Suzanne R

    2016-12-30

    Phaseic acid (PA) is a phytohormone regulating important physiological functions in higher plants. Here, we show the presence of naturally occurring (-)-PA in mouse and rat brains. (-)-PA is exclusively present in the choroid plexus and the cerebral vascular endothelial cells. Purified (-)-PA has no toxicity and protects cultured cortical neurons against glutamate toxicity through reversible inhibition of glutamate receptors. Focal occlusion of the middle cerebral artery elicited a significant induction in (-)-PA expression in the cerebrospinal fluid but not in the peripheral blood. Importantly, (-)-PA induction only occurred in the penumbra area, indicting a protective role of PA in the brain. Indeed, elevating the (-)-PA level in the brain reduced ischemic brain injury, whereas reducing the (-)-PA level using a monoclonal antibody against (-)-PA increased ischemic injury. Collectively, these studies showed for the first time that (-)-PA is an endogenous neuroprotective molecule capable of reversibly inhibiting glutamate receptors during ischemic brain injury. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. AMPA receptor desensitization mutation results in severe developmental phenotypes and early postnatal lethality

    PubMed Central

    Christie, Louisa A.; Russell, Theron A.; Xu, Jian; Wood, Lydia; Shepherd, Gordon M. G.; Contractor, Anis

    2010-01-01

    AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazole-propionate) recep-tors desensitize rapidly and completely in the continued presence of their endogenous ligand glutamate; however, it is not clear what role AMPA receptor desensitization plays in the brain. We generated a knock-in mouse in which a single amino acid residue, which controls desensitization, was mutated in the GluA2 (GluR2) receptor subunit (GluA2L483Y). This mutation was homozygous lethal. However, mice carrying a single mutated allele, GluA2L483Y/wt, survived past birth, but displayed severe and progressive neurological deficits including seizures and, ultimately, increased mortality. The expression of the AMPA receptor subunits GluA1 and GluA2 was decreased, whereas NMDA receptor protein expression was increased in GluA2L483Y/wt mice. Despite this, basal synaptic transmission and plasticity in the hippocampus were largely unaffected, suggesting that neurons preferentially target receptors to synapses to normalize synaptic weight. We found no gross neuroanatomical alterations in GluA2L483Y/wt mice. Moreover, there was no accumulation of AMPA receptor subunits in intracellular compartments, suggesting that folding and assembly of AMPA receptors are not affected by this mutation. Interestingly, EPSC paired pulse ratios in the CA1 were enhanced without a change in synaptic release probability, demonstrating that postsynaptic receptor properties can contribute to facilitation. The dramatic phenotype observed in this study by the introduction of a single amino acid change demonstrates an essential role in vivo for AMPA receptor desensitization. PMID:20439731

  10. [Analgesic effects of ionotropic glutamate receptor antagonists MK-801 and NBQX on collagen-induced arthritis rats].

    PubMed

    Zhu, H; Zhu, R; Deng, Z D; Feng, Y C; Shen, H L

    2016-12-18

    The ionotropic glutamate receptorantagonists include two types: MK-801, antagonist of N-methyl-D-asparticacid (NMDA) receptor, and NBQX, antagonist of non-NMDA receptor.The above-mentioned ionotropic antagonists can block the glutamate and its corresponding receptor binding to produce analgesic effect. The objective of this research was to study two antagonists in analgesic effect on rat behavior,as well as to investigate the down-regulation and up-regulation of cyclooxygenase-2 (COX-2) and Janus-activated kinase (Jak3) in collagen-induced arthritis (CIA) rat serum and tissue fluid after the application of these antagonists, that is, the effect on molecular biology. This study used the ionotropic glutamate receptors as the target and established CIA rat model. Vivo studies were used to observe changes in behavior and molecular biology of the CIA rat.Behavioral assessment includedmechanical allodynia and joint swelling in the CIA rat,where themechanical allodynia was measured using the paw-withdrawal threshold (PWT) with VonFrey filaments according to the "Up-Down" method,and the drainage volume was used to assess joint swelling. Then the blood samples taken from the heart of the rat and the tissue homogenate were collected to detect the down-regulation and up-regulation of COX-2 and Jak3 in the serum and tissue fluid after the antagonists wereused. Using MK-801, NBQX alone or using the combination of these two antagonists,these three methods all could alleviate pain(P<0.01).The analgesic effect lasted more than 24 h.Both antagonists reached the peak of analgesia at the end of 4 hours post-injection. NBQX had stronger analgesic effect than MK-801 (P<0.05).Whether alone or combined use of these two antagonists,could not change the CIA rats' swelling of the joint (P>0.05). MK-801 could decrease the expression of COX-2 (P<0.01).At the same time, NBQX did not have this effect (P>0.05). Using MK-801, NBQX alone or combination of these two antagonists could not affect the

  11. LY404187: a novel positive allosteric modulator of AMPA receptors.

    PubMed

    Quirk, Jennifer C; Nisenbaum, Eric S

    2002-01-01

    LY404187 is a selective, potent and centrally active positive allosteric modulator of AMPA receptors. LY404187 preferentially acts at recombinant human homomeric GluR2 and GluR4 versus GluR1 and GluR3 AMPA receptors. In addition, LY404187 potentiates the flip splice variant of these AMPA receptors to a greater degree than the flop splice variant. In both recombinant and native AMPA receptors, potentiation by LY404187 displays a unique time-dependent growth that appears to involve a suppression of the desensitization process of these ion channels. LY404187 has been shown to enhance glutamatergic synaptic transmission both in vitro and in vivo. This augmentation of synaptic activity is due to the direct potentiation of AMPA receptor function, as well as an indirect recruitment of voltage-dependent NMDA receptor activity. Enhanced calcium influx through NMDA receptors is known to be a critical step in initiating long-term modifications in synaptic function (e.g., long-term potentiation, LTP). These modifications in synaptic function may be substrates for certain forms of memory encoding. Consistent with a recruitment of NMDA receptor activity, LY404187 has been shown to enhance performance in animal models of cognitive function requiring different mnemonic processes. These data suggest that AMPA receptor potentiators may be therapeutically beneficial for treating cognitive deficits in a variety of disorders, particularly those that are associated with reduced glutamatergic signaling such as schizophrenia. In addition, LY404187 has been demonstrated to be efficacious in animal models of behavioral despair that possess considerable predictive validity for antidepressant activity. Although the therapeutic efficacy of AMPA receptor potentiators in these and other diseases will ultimately be determined in the clinic, evidence suggests that the benefit of these compounds will be mediated by multiple mechanisms of action. These mechanisms include direct enhancement of AMPA

  12. Differential expression of glutamate transporters EAAT1 and EAAT2 in mice deficient for PACAP-type I receptor.

    PubMed

    Zink, M; Schmitt, A; Henn, F A; Gass, P

    2004-12-01

    Pituitary adenylate cyclase-activating polypeptide (PACAP) modulates glutamatergic neurotransmission and induces the expression of glutamate transporters EAAT1 and EAAT2 in newborn mouse astroglial cell cultures. Since nanomolar concentrations of PACAP exert this effect, signal transduction via the high affinity PACAP-type I-receptor PAC1 was assumed. To test this hypothesis and to assess the importance of PAC1-signalling in vivo, we analyzed glutamate transporter expression in mice with a PAC1 knockout. EAAT1 and EAAT2 expression was investigated in the hippocampus and the cerebral cortex of PAC1 mutant mice and wildtype littermates by semiquantitative in-situ-hybridization. PAC1-knockout mice show a subtle but significant reduction of EAAT1 expression in the dentate gyrus. In contrast, reduced expression levels of EAAT1 in the cerebral cortex did not reach statistical significance and EAAT2 expression was unchanged in CA3 and cerebral cortex of PAC1 mutant mice. Our data confirm the previously reported in-vitro-regulation of EAAT1 in the adult nervous system in vivo. EAAT2 expression, however, is unchanged in PAC1 knockout mice, most likely due to counterbalancing factors.

  13. Role of ionotropic glutamate receptors in delay and probability discounting in the rat.

    PubMed

    Yates, Justin R; Batten, Seth R; Bardo, Michael T; Beckmann, Joshua S

    2015-04-01

    Discounting of delayed and probabilistic reinforcement is linked to increased drug use and pathological gambling. Understanding the neurobiology of discounting is important for designing treatments for these disorders. Glutamate is considered to be involved in addiction-like behaviors; however, the role of ionotropic glutamate receptors (iGluRs) in discounting remains unclear. The current study examined the effects of N-methyl-D-aspartate (NMDA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptor blockade on performance in delay and probability discounting tasks. Following training in either delay or probability discounting, rats (n = 12, each task) received pretreatments of the NMDA receptor antagonists MK-801 (0, 0.01, 0.03, 0.1, or 0.3 mg/kg, s.c.) or ketamine (0, 1.0, 5.0, or 10.0 mg/kg, i.p.), as well as the AMPA receptor antagonist CNQX (0, 1.0, 3.0, or 5.6 mg/kg, i.p.). Hyperbolic discounting functions were used to estimate sensitivity to delayed/probabilistic reinforcement and sensitivity to reinforcer amount. An intermediate dose of MK-801 (0.03 mg/kg) decreased sensitivity to both delayed and probabilistic reinforcement. In contrast, ketamine did not affect the rate of discounting in either task but decreased sensitivity to reinforcer amount. CNQX did not alter sensitivity to reinforcer amount or delayed/probabilistic reinforcement. These results show that blockade of NMDA receptors, but not AMPA receptors, decreases sensitivity to delayed/probabilistic reinforcement (MK-801) and sensitivity to reinforcer amount (ketamine). The differential effects of MK-801 and ketamine demonstrate that sensitivities to delayed/probabilistic reinforcement and reinforcer amount are pharmacologically dissociable.

  14. Structure, Dynamics, and Allosteric Potential of Ionotropic Glutamate Receptor N-Terminal Domains.

    PubMed

    Krieger, James; Bahar, Ivet; Greger, Ingo H

    2015-09-15

    Ionotropic glutamate receptors (iGluRs) are tetrameric cation channels that mediate synaptic transmission and plasticity. They have a unique modular architecture with four domains: the intracellular C-terminal domain (CTD) that is involved in synaptic targeting, the transmembrane domain (TMD) that forms the ion channel, the membrane-proximal ligand-binding domain (LBD) that binds agonists such as L-glutamate, and the distal N-terminal domain (NTD), whose function is the least clear. The extracellular portion, comprised of the LBD and NTD, is loosely arranged, mediating complex allosteric regulation and providing a rich target for drug development. Here, we briefly review recent work on iGluR NTD structure and dynamics, and further explore the allosteric potential for the NTD in AMPA-type iGluRs using coarse-grained simulations. We also investigate mechanisms underlying the established NTD allostery in NMDA-type iGluRs, as well as the fold-related metabotropic glutamate and GABAB receptors. We show that the clamshell motions intrinsically favored by the NTD bilobate fold are coupled to dimeric and higher-order rearrangements that impact the iGluR LBD and ultimately the TMD. Finally, we explore the dynamics of intact iGluRs and describe how it might affect receptor operation in a synaptic environment. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Glutamate and Neurodegenerative Disease

    NASA Astrophysics Data System (ADS)

    Schaeffer, Eric; Duplantier, Allen

    As the main excitatory neurotransmitter in the mammalian central nervous system, glutamate is critically involved in most aspects of CNS function. Given this critical role, it is not surprising that glutamatergic dysfunction is associated with many CNS disorders. In this chapter, we review the literature that links aberrant glutamate neurotransmission with CNS pathology, with a focus on neurodegenerative diseases. The biology and pharmacology of the various glutamate receptor families are discussed, along with data which links these receptors with neurodegenerative conditions. In addition, we review progress that has been made in developing small molecule modulators of glutamate receptors and transporters, and describe how these compounds have helped us understand the complex pharmacology of glutamate in normal CNS function, as well as their potential for the treatment of neurodegenerative diseases.

  16. Design and Synthesis of a Series of l-trans-4-Substituted Prolines as Selective Antagonists for the Ionotropic Glutamate Receptors Including Functional and X-ray Crystallographic Studies of New Subtype Selective Kainic Acid Receptor Subtype 1 (GluK1) Antagonist (2S,4R)-4-(2-Carboxyphenoxy)pyrrolidine-2-carboxylic Acid.

    PubMed

    Krogsgaard-Larsen, Niels; Delgar, Claudia G; Koch, Karina; Brown, Patricia M G E; Møller, Charlotte; Han, Liwei; Huynh, Tri H V; Hansen, Stinne W; Nielsen, Birgitte; Bowie, Derek; Pickering, Darryl S; Kastrup, Jette Sandholm; Frydenvang, Karla; Bunch, Lennart

    2017-01-12

    Ionotropic glutamate receptor antagonists are valuable tool compounds for studies of neurological pathways in the central nervous system. On the basis of rational ligand design, a new class of selective antagonists, represented by (2S,4R)-4-(2-carboxyphenoxy)pyrrolidine-2-carboxylic acid (1b), for cloned homomeric kainic acid receptors subtype 1 (GluK1) was attained (K i = 4 μM). In a functional assay, 1b displayed full antagonist activity with IC 50 = 6 ± 2 μM. A crystal structure was obtained of 1b when bound in the ligand binding domain of GluK1. A domain opening of 13-14° was seen compared to the structure with glutamate, consistent with 1b being an antagonist. A structure-activity relationship study showed that the chemical nature of the tethering atom (C, O, or S) linking the pyrrolidine ring and the phenyl ring plays a key role in the receptor selectivity profile and that substituents on the phenyl ring are well accommodated by the GluK1 receptor.

  17. Vinpocetine protects inner retinal neurons with functional NMDA glutamate receptors against retinal ischemia.

    PubMed

    Nivison-Smith, Lisa; Khoo, Pauline; Acosta, Monica L; Kalloniatis, Michael

    2018-02-01

    Retinal ischemia is involved in the pathogenesis of many major vision threatening diseases. Vinpocetine is a natural drug, which has a range of neuroprotective actions against retinal ischemia including modulating cation flow, improving metabolic activity and preventing apoptosis. The exact mechanism behind these actions remains unknown but may involve glutamate receptors, major components of the ischemic cascade. This study examined the effects of vinpocetine in association with specific ionotropic glutamate receptor agonists: N-methyl-D-aspartate (NMDA) and kainate. Vinpocetine's actions to improve cation channel permeability and cell marker immunoreactivity following ischemia appeared to be limited to NMDA activation with no changes observed following kainate stimulation. Vinpocetine's actions were lost in the presence of an NMDA receptor inhibitor further suggesting they may be secondary to NMDA receptor activation. NMDA receptor function was also necessary for vinpocetine's actions on glucose availability during ischemia but not lactate dehydrogenase (LDH) activity in the ischemic retina suggesting not all of vinpocetine's actions are linked to NMDA receptor function. These results may explain vinpocetine's effectiveness as a neuroprotective agent as the NMDA receptor is implicated in the pathogenesis of ischemia in a range of tissues of the central nervous system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Glutamate may be an efferent transmitter that elicits inhibition in mouse taste buds.

    PubMed

    Huang, Yijen A; Grant, Jeff; Roper, Stephen

    2012-01-01

    Recent studies suggest that l-glutamate may be an efferent transmitter released from axons innervating taste buds. In this report, we determined the types of ionotropic synaptic glutamate receptors present on taste cells and that underlie this postulated efferent transmission. We also studied what effect glutamate exerts on taste bud function. We isolated mouse taste buds and taste cells, conducted functional imaging using Fura 2, and used cellular biosensors to monitor taste-evoked transmitter release. The findings show that a large fraction of Presynaptic (Type III) taste bud cells (∼50%) respond to 100 µM glutamate, NMDA, or kainic acid (KA) with an increase in intracellular Ca(2+). In contrast, Receptor (Type II) taste cells rarely (4%) responded to 100 µM glutamate. At this concentration and with these compounds, these agonists activate glutamatergic synaptic receptors, not glutamate taste (umami) receptors. Moreover, applying glutamate, NMDA, or KA caused taste buds to secrete 5-HT, a Presynaptic taste cell transmitter, but not ATP, a Receptor cell transmitter. Indeed, glutamate-evoked 5-HT release inhibited taste-evoked ATP secretion. The findings are consistent with a role for glutamate in taste buds as an inhibitory efferent transmitter that acts via ionotropic synaptic glutamate receptors.

  19. Felbamate but not phenytoin or gabapentin reduces glutamate release by blocking presynaptic NMDA receptors in the entorhinal cortex

    PubMed Central

    Yang, Jian; Wetterstrand, Caroline; Jones, Roland S.G.

    2007-01-01

    Summary We have shown that a number of anticonvulsant drugs can reduce glutamate release at synapses in the rat entorhinal cortex (EC) in vitro. We have also shown that presynaptic NMDA receptors (NMDAr) tonically facilitate glutamate release at these synapses. In the present study we determined whether, phenytoin, gabapentin and felbamate may reduce glutamate release by blocking the presynaptic NMDAr. Whole cell patch clamp recordings of spontaneous excitatory postsynaptic currents (sEPSCs) were used as a monitor of presynaptic glutamate release. Postsynaptic NMDAr were blocked with internal dialysis with an NMDAr channel blocker. The antagonist, 2-AP5, reduced the frequency of sEPSCs by blocking the presynaptic facilitatory NMDAr, but did not occlude a reduction in sEPSC frequency by gabapentin or phenytoin. Felbamate also reduced sEPSC frequency, but this effect was occluded by prior application of 2-AP5. Thus, whilst all three drugs can reduce glutamate release, only the action of felbamate seems to be due to interaction with presynaptic NMDAr. PMID:17980555

  20. Functional architecture of olfactory ionotropic glutamate receptors.

    PubMed

    Abuin, Liliane; Bargeton, Benoîte; Ulbrich, Maximilian H; Isacoff, Ehud Y; Kellenberger, Stephan; Benton, Richard

    2011-01-13

    Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate chemical communication between neurons at synapses. A variant iGluR subfamily, the Ionotropic Receptors (IRs), was recently proposed to detect environmental volatile chemicals in olfactory cilia. Here, we elucidate how these peripheral chemosensors have evolved mechanistically from their iGluR ancestors. Using a Drosophila model, we demonstrate that IRs act in combinations of up to three subunits, comprising individual odor-specific receptors and one or two broadly expressed coreceptors. Heteromeric IR complex formation is necessary and sufficient for trafficking to cilia and mediating odor-evoked electrophysiological responses in vivo and in vitro. IRs display heterogeneous ion conduction specificities related to their variable pore sequences, and divergent ligand-binding domains function in odor recognition and cilia localization. Our results provide insights into the conserved and distinct architecture of these olfactory and synaptic ion channels and offer perspectives into the use of IRs as genetically encoded chemical sensors. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. The influence of ionotropic and metabotropic glutamate receptor ligands on anxiety-like effect of amphetamine withdrawal in rats.

    PubMed

    Koltunowska, D; Gibula-Bruzda, E; Kotlinska, J H

    2013-08-01

    Chronic amphetamine use results in anxiety-like states after drug cessation. The aim of the study was to determine a role of ionotropic and metabotropic glutamate receptor ligands in amphetamine-evoked withdrawal anxiety in the elevated plus-maze test in rats. In our study memantine (8 and 12 mg/kg), a noncompetitive N-methyl-d-aspartate (NMDA) receptor antagonist did not reduce amphetamine withdrawal anxiety. Acamprosate (NMDA and metabotropic glutamate 5 receptor (mGluR5) antagonist) at the dose 200 and 400mg/kg showed anxiolytic-like effect, thus increasing the percent of time spent in open arms and a number of open arm entries. mGluR5 selective antagonist, MTEP (3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine hydrochloride) and mGluR2/3 agonist, LY354740 (1S,2S,5R,6S)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylic acid), caused effects similar to acamprosate at doses 1.25-5mg/kg and 2.5-5mg/kg, respectively. None of the glutamate ligands influenced locomotor activity of rats when given to the saline-treated group. Taking into account the positive correlation between amphetamine withdrawal-induced anxiety and relapse to amphetamine taking, our results suggest that modulation of mGluRs may prevent relapse to amphetamine and might pose a new direction in amphetamine abuse therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Metabotropic glutamate mGlu2 receptor is necessary for the pharmacological and behavioral effects induced by hallucinogenic 5-HT2A receptor agonists

    PubMed Central

    Moreno, José L.; Holloway, Terrell; Albizu, Laura; Sealfon, Stuart C.; González-Maeso, Javier

    2011-01-01

    Hallucinogenic drugs, including mescaline, psilocybin and lysergic acid diethylamide (LSD), act at serotonin 5-HT2A receptors (5-HT2ARs). Metabotropic glutamate receptor 2/3 (mGluR2/3) ligands show efficacy in modulating the responses induced by activation of 5-HT2ARs. The formation of a 5-HT2AR-mGluR2 complex suggests a functional interaction that affects the hallucinogen-regulated cellular signaling pathways. Here, we tested the cellular and behavioral effects of hallucinogenic 5-HT2AR agonists in mGluR2 knockout (mGluR2-KO) mice. Mice were intraperitoneally injected with the hallucinogens DOI (2 mg/kg) and LSD (0.24 mg/kg), or vehicle. Head-twitch behavioral response, expression of c-fos, which is induced by all 5-HT2AR agonists, and expression of egr-2, which is hallucinogen-specific, were determined in wild type and mGluR2-KO mice. [3H]Ketanserin binding displacement curves by DOI were performed in mouse frontal cortex membrane preparations. Head twitch behavior was abolished in mGluR2-KO mice. The high-affinity binding site of DOI was undetected in mGluR2-KO mice. The hallucinogen DOI induced c-fos in both wild type and mGluR2-KO mice. However, the induction of egr-2 by DOI was eliminated in mGlu2-KO mice. These findings suggest that the 5-HT2AR-mGluR2 complex is necessary for the neuropsychological responses induced by hallucinogens. PMID:21276828

  3. Synaptic Glutamate Spillover Due to Impaired Glutamate Uptake Mediates Heroin Relapse

    PubMed Central

    Scofield, Michael D.; Boger, Heather; Hensley, Megan; Kalivas, Peter W.

    2014-01-01

    Reducing the enduring vulnerability to relapse is a therapeutic goal in treating drug addiction. Studies with animal models of drug addiction show a marked increase in extrasynaptic glutamate in the core subcompartment of the nucleus accumbens (NAcore) during reinstated drug seeking. However, the synaptic mechanisms linking drug-induced changes in extrasynaptic glutamate to relapse are poorly understood. Here, we discovered impaired glutamate elimination in rats extinguished from heroin self-administration that leads to spillover of synaptically released glutamate into the nonsynaptic extracellular space in NAcore and investigated whether restoration of glutamate transport prevented reinstated heroin seeking. Through multiple functional assays of glutamate uptake and analyzing NMDA receptor-mediated currents, we show that heroin self-administration produced long-lasting downregulation of glutamate uptake and surface expression of the transporter GLT-1. This downregulation was associated with spillover of synaptic glutamate to extrasynaptic NMDA receptors within the NAcore. Ceftriaxone restored glutamate uptake and prevented synaptic glutamate spillover and cue-induced heroin seeking. Ceftriaxone-induced inhibition of reinstated heroin seeking was blocked by morpholino-antisense targeting GLT-1 synthesis. These data reveal that the synaptic glutamate spillover in the NAcore results from reduced glutamate transport and is a critical pathophysiological mechanism underling reinstated drug seeking in rats extinguished from heroin self-administration. PMID:24741055

  4. Postsynaptic and presynaptic group II metabotropic glutamate receptor activation reduces neuronal excitability in rat midline paraventricular thalamic nucleus.

    PubMed

    Hermes, M L H J; Renaud, L P

    2011-03-01

    Drugs that interact with group II metabotropic glutamate receptors (mGluRs) are presently being evaluated for a role in the treatment of anxiety disorders and symptoms of schizophrenia. Their mechanism of action is believed to involve a reduction in excitatory neurotransmission in limbic and forebrain regions commonly associated with these mental disorders. In rodents, the glutamatergic neurons in the midline paraventricular thalamic nucleus (PVT) provide excitatory inputs to the limbic system and forebrain. PVT also displays a high density of group II mGluRs, predominantly the metabotropic glutamate 2 receptor (mGluR2). Because the role of group II mGluRs in regulating cellular and synaptic excitability in this location has yet to be determined, we used whole-cell patch-clamp recording and acute rat brain slice preparations to evaluate PVT neuron responses to a selective group II mGluR agonist, (1R,4R,5S,6R)-4-amino-2-oxabicyclo[3.1.0]hexane-4,6-dicarboxylic acid (LY 379268). LY 379268 consistently induced membrane hyperpolarization and suppressed firing by postsynaptic receptor-mediated activation of a barium-sensitive background K(+) conductance. This effect could be blocked by (2S)-2-amino-2-[(1S,2S)-2-carboxycycloprop-1-yl]-3-(xanth-9-yl)propanoic acid (LY 341495), a selective group II mGluR antagonist. In addition, LY 379268 acted at presynaptic receptors to reduce ionotropic glutamate receptor-mediated excitatory synaptic transmission. An mGluR2-positive allosteric modulator, 2,2,2-trifluoro-N-[4-(2-methoxyphenoxy)phenyl]-N-(3-pyridinylmethyl)ethanesulfonamide hydrochloride (LY 487379), resulted in leftward shifts of the LY 379268 dose-response curve for both postsynaptic and presynaptic actions. The data demonstrate that activation of postsynaptic and presynaptic group II (presumably mGluR2) mGluRs reduces neuronal excitability in midline thalamus, an action that may contribute to the effectiveness of mGluR2-activating drugs in rodent models of anxiety and

  5. Reduced dopamine and glutamate neurotransmission in the nucleus accumbens of quinpirole-sensitized rats hints at inhibitory D2 autoreceptor function.

    PubMed

    Escobar, Angélica P; Cornejo, Francisca A; Olivares-Costa, Montserrat; González, Marcela; Fuentealba, José A; Gysling, Katia; España, Rodrigo A; Andrés, María E

    2015-09-01

    Dopamine from the ventral tegmental area and glutamate from several brain nuclei converge in the nucleus accumbens (NAc) to drive motivated behaviors. Repeated activation of D2 receptors with quinpirole (QNP) induces locomotor sensitization and compulsive behaviors, but the mechanisms are unknown. In this study, in vivo microdialysis and fast scan cyclic voltammetry in adult anesthetized rats were used to investigate the effect of repeated QNP on dopamine and glutamate neurotransmission within the NAc. Following eight injections of QNP, a significant decrease in phasic and tonic dopamine release was observed in rats that displayed locomotor sensitization. Either a systemic injection or the infusion of QNP into the NAc decreased dopamine release, and the extent of this effect was similar in QNP-sensitized and control rats, indicating that inhibitory D2 autoreceptor function is maintained despite repeated activation of D2 receptors and decreased dopamine extracellular levels. Basal extracellular levels of glutamate in the NAc were also significantly lower in QNP-treated rats than in controls. Moreover, the increase in NAc glutamate release induced by direct stimulation of medial prefrontal cortex was significantly lower in QNP-sensitized rats. Together, these results indicate that repeated activation of D2 receptors disconnects NAc from medial prefrontal cortex and ventral tegmental area. Repeated administration of the dopamine D2 receptor agonist quinpirole (QNP) induces locomotor sensitization. We found that the NAc of QNP-sensitized rats has reduced glutamate levels coming from prefrontal cortex together with a decreased phasic and tonic dopamine neurotransmission but a conserved presynaptic D2 receptor function. We suggest that locomotor sensitization is because of increased affinity state of D2 post-synaptic receptors. © 2015 International Society for Neurochemistry.

  6. Metabotropic glutamate receptors in auditory processing

    PubMed Central

    Lu, Yong

    2014-01-01

    As the major excitatory neurotransmitter used in the vertebrate brain, glutamate activates ionotropic and metabotropic glutamate receptors (mGluRs), which mediate fast and slow neuronal actions, respectively. Important modulatory roles of mGluRs have been shown in many brain areas, and drugs targeting mGluRs have been developed for treatment of brain disorders. Here, I review the studies on mGluRs in the auditory system. Anatomical expression of mGluRs in the cochlear nucleus has been well characterized, while data for other auditory nuclei await more systematic investigations at both the light and electron microscopy levels. The physiology of mGluRs has been extensively studied using in vitro brain slice preparations, with a focus on the lower auditory brainstem in both mammals and birds. These in vitro physiological studies have revealed that mGluRs participate in neurotransmission, regulate ionic homeostasis, induce synaptic plasticity, and maintain the balance between excitation and inhibition in a variety of auditory structures. However, very few in vivo physiological studies on mGluRs in auditory processing have been undertaken at the systems level. Many questions regarding the essential roles of mGluRs in auditory processing still remain unanswered and more rigorous basic research is warranted. PMID:24909898

  7. Enhanced sampling of glutamate receptor ligand-binding domains.

    PubMed

    Lau, Albert Y

    2018-04-14

    The majority of excitatory synaptic transmission in the central nervous system is mediated by ionotropic glutamate receptors (iGluRs). These membrane-bound protein assemblies consist of modular domains that can be genetically isolated and expressed, which has resulted in a plethora of crystal structures of individual domains in different conformations bound to different ligands. These structures have presented opportunities for molecular dynamics (MD) simulation studies. To examine the free energies that govern molecular behavior, simulation strategies and algorithms have been developed, collectively called enhanced sampling methods This review focuses on the use of enhanced sampling MD simulations of isolated iGluR ligand-binding domains to characterize thermodynamic properties important to receptor function. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Emerging structural insights into the function of ionotropic glutamate receptors

    PubMed Central

    Karakas, Erkan; Regan, Michael C.; Furukawa, Hiro

    2015-01-01

    Summary Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function including learning and memory formation. Recently a wealth of structural studies on iGluRs, including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available.. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, which illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. Here we review mechanistic insights into iGluR functions gained through structural studies of multiple groups. PMID:25941168

  9. Emerging structural insights into the function of ionotropic glutamate receptors.

    PubMed

    Karakas, Erkan; Regan, Michael C; Furukawa, Hiro

    2015-06-01

    Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function, including learning and memory formation. Recently a wealth of structural studies on iGluRs including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, and this illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. We review mechanistic insights into iGluR functions gained through structural studies of multiple groups. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Behavioural pharmacology: 40+ years of progress, with a focus on glutamate receptors and cognition

    PubMed Central

    Robbins, Trevor W.; Murphy, Emily R.

    2006-01-01

    Behavioural pharmacology is an interdisciplinary field at the intersection of several research areas that ultimately lead to the development of drugs for clinical use and build understanding of how brain functions enable cognition and behaviour. In this article, the development of behavioural pharmacology in the UK is briefly surveyed, and the current status and success of the field is highlighted by the progress in our understanding of learning and memory that has resulted from discoveries in glutamate receptor pharmacology allied to theoretical and methodological advances in behavioural neuroscience. We describe the original breakthrough in terms of the role of NMDA receptors in hippocampal-mediated spatial learning and long-term potentiation, and review recent advances that demonstrate the involvement of glutamate receptor in working memory, recognition memory, stimulus–response learning and memory, and higher cognitive functions. We also discuss the unique functions of NMDA receptors and the fundamental role of AMPA receptors in processes that are common to some of these forms of memory, including encoding, consolidation and retrieval. PMID:16490260

  11. Taurine release from the developing and ageing hippocampus: stimulation by agonists of ionotropic glutamate receptors.

    PubMed

    Saransaari, P; Oja, S S

    1997-12-30

    The inhibitory amino acid taurine has been held to function as a modulator and osmoregulator in the brain, being of particular importance in the immature brain. The release of preloaded [3H]taurine was now studied in hippocampal slices from developing (7-day-old), adult (3-month-old) and ageing (6-24-month-old) mice focussing on the effects of agonists of ionotropic glutamate receptors. N-methyl-D-aspartate (NMDA), kainate and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) potentiated taurine release concentration-dependently at each age, more so in the immature than in the adult and ageing hippocampus. The effect of kainate was blocked by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) in the developing and aged hippocampus and those of AMPA and NMDA by 6-nitro-7-sulphamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and dizocilpine a(MK-801) at every age studied. This indicates the involvement of NMDA and AMPA receptors in taurine release throughout the life-span of mice, while the kainate-receptor-mediated release does not appear to function in adults. The increased hippocampal taurine release evoked by ionotropic glutamate receptors could act neuroprotectively, counteracting by several mechanisms the harmful effects of the simultaneous release of excitatory amino acids. The substantial release of taurine in the immature hippocampus might be particularly significant in view of the vulnerability of brain tissue to excitotoxicity at early age.

  12. Group 1 Metabotropic Glutamate Receptor Function and Its Regulation of Learning and Memory in the Aging Brain

    PubMed Central

    Ménard, Caroline; Quirion, Rémi

    2012-01-01

    Normal aging is generally characterized by a slow decline of cognitive abilities albeit with marked individual differences. Several animal models have been studied to explore the molecular and cellular mechanisms underlying this phenomenon. The excitatory neurotransmitter glutamate and its receptors have been closely linked to spatial learning and hippocampus-dependent memory processes. For decades, ionotropic glutamate receptors have been known to play a critical role in synaptic plasticity, a form of adaptation regulating memory formation. Over the past 10 years, several groups have shown the importance of group 1 metabotropic glutamate receptor (mGluR) in successful cognitive aging. These G-protein-coupled receptors are enriched in the hippocampal formation and interact physically with other proteins in the membrane including glutamate ionotropic receptors. Synaptic plasticity is crucial to maintain cognitive abilities and long-term depression (LTD) induced by group 1 mGluR activation, which has been linked to memory in the aging brain. The translation and synthesis of proteins by mGluR-LTD modulate ionotropic receptor trafficking and expression of immediate early genes related to cognition. Fragile X syndrome, a genetic form of autism characterized by memory deficits, has been associated to mGluR receptor malfunction and aberrant activation of its downstream signaling pathways. Dysfunction of mGluR could also be involved in neurodegenerative disorders like Alzheimer’s disease (AD). Indeed, beta-amyloid, the main component of insoluble senile plaques and one of the hallmarks of AD, occludes mGluR-dependent LTD leading to diminished functional synapses. This review highlights recent findings regarding mGluR signaling, related synaptic plasticity, and their potential involvement in normal aging and neurological disorders. PMID:23091460

  13. Group 1 metabotropic glutamate receptor function and its regulation of learning and memory in the aging brain.

    PubMed

    Ménard, Caroline; Quirion, Rémi

    2012-01-01

    Normal aging is generally characterized by a slow decline of cognitive abilities albeit with marked individual differences. Several animal models have been studied to explore the molecular and cellular mechanisms underlying this phenomenon. The excitatory neurotransmitter glutamate and its receptors have been closely linked to spatial learning and hippocampus-dependent memory processes. For decades, ionotropic glutamate receptors have been known to play a critical role in synaptic plasticity, a form of adaptation regulating memory formation. Over the past 10 years, several groups have shown the importance of group 1 metabotropic glutamate receptor (mGluR) in successful cognitive aging. These G-protein-coupled receptors are enriched in the hippocampal formation and interact physically with other proteins in the membrane including glutamate ionotropic receptors. Synaptic plasticity is crucial to maintain cognitive abilities and long-term depression (LTD) induced by group 1 mGluR activation, which has been linked to memory in the aging brain. The translation and synthesis of proteins by mGluR-LTD modulate ionotropic receptor trafficking and expression of immediate early genes related to cognition. Fragile X syndrome, a genetic form of autism characterized by memory deficits, has been associated to mGluR receptor malfunction and aberrant activation of its downstream signaling pathways. Dysfunction of mGluR could also be involved in neurodegenerative disorders like Alzheimer's disease (AD). Indeed, beta-amyloid, the main component of insoluble senile plaques and one of the hallmarks of AD, occludes mGluR-dependent LTD leading to diminished functional synapses. This review highlights recent findings regarding mGluR signaling, related synaptic plasticity, and their potential involvement in normal aging and neurological disorders.

  14. Peri-adolescent drinking of ethanol and/or nicotine modulates astroglial glutamate transporters and metabotropic glutamate receptor-1 in female alcohol-preferring rats.

    PubMed

    Alasmari, Fawaz; Bell, Richard L; Rao, P S S; Hammad, Alaa M; Sari, Youssef

    2018-07-01

    Impairment in glutamate neurotransmission mediates the development of dependence upon nicotine (NIC) and ethanol (EtOH). Previous work indicates that continuous access to EtOH or phasic exposure to NIC reduces expression of the glutamate transporter-1 (GLT-1) and cystine/glutamate antiporter (xCT) but not the glutamate/aspartate transporter (GLAST). Additionally, metabotropic glutamate receptors (mGluRs) expression was affected following exposure to EtOH or NIC. However, little is known about the effects of EtOH and NIC co-consumption on GLT-1, xCT, GLAST, and mGluR1 expression. In this study, peri-adolescent female alcohol preferring (P) rats were given binge-like access to water, sucrose (SUC), SUC-NIC, EtOH, or EtOH-NIC for four weeks. The present study determined the effects of these reinforcers on GLT-1, xCT, GLAST, and mGluR1 expression in the nucleus accumbens (NAc), hippocampus (HIP) and prefrontal cortex (PFC). GLT-1 and xCT expression were decreased in the NAc following both SUC-NIC and EtOH-NIC. In addition, only xCT expression was downregulated in the HIP in both of these latter groups. Also, glutathione peroxidase (GPx) activity in the HIP was reduced following SUC, SUC-NIC, EtOH, and EtOH-NIC consumption. Similar to previous work, GLAST expression was not altered in any brain region by any of the reinforcers. However, mGluR1 expression was increased in the NAc in the SUC-NIC, EtOH, and EtOH-NIC groups. These results indicate that peri-adolescent binge-like drinking of EtOH or SUC with or without NIC may exert differential effects on astroglial glutamate transporters and receptors. Our data further parallel some of the previous findings observed in adult rats. Copyright © 2018. Published by Elsevier Inc.

  15. Characterization of mGluR5R, a novel, metabotropic glutamate receptor 5-related gene.

    PubMed

    Bates, Brian; Xie, Yuhong; Taylor, Noel; Johnson, Jeremy; Wu, Leeying; Kwak, Seung; Blatcher, Maria; Gulukota, Kamalakar; Paulsen, Janet E

    2002-12-30

    We report here the isolation of a novel gene termed mGluR5R (mGluR5-related). The N-terminus of mGluR5R is highly similar to the extracellular domain of metabotropic glutamate receptor 5 (mGluR5) whereas the C-terminus bears similarity to the testis-specific gene, RNF18. mGluR5R is expressed in the human CNS in a coordinate fashion with mGluR5. Although the sequence suggests that mGluR5R may be a secreted glutamate binding protein, we found that when expressed in HEK293 cells it was membrane associated and not secreted. Furthermore, mGluR5R was incapable of binding the metabotropic glutamate receptor class I selective agonist, quisqualate. Although mGluR5R could not form disulfide-mediated covalent homodimers, it was able to form a homomeric complex, presumably through noncovalent interactions. mGluR5R also formed noncovalent heteromeric associations with an engineered construct of the extracellular domain of mGluR5 as well as with full-length mGluR5 and mGluR1alpha. The ability of mGluR5R to associate with mGluR1alpha and mGluR5 suggests that it may be a modulator of class I metabotropic glutamate receptor function.

  16. Activation of presynaptic oxytocin receptors enhances glutamate release in the ventral hippocampus of prenatally restraint stressed rats.

    PubMed

    Mairesse, Jérôme; Gatta, Eleonora; Reynaert, Marie-Line; Marrocco, Jordan; Morley-Fletcher, Sara; Soichot, Marion; Deruyter, Lucie; Camp, Gilles Van; Bouwalerh, Hammou; Fagioli, Francesca; Pittaluga, Anna; Allorge, Delphine; Nicoletti, Ferdinando; Maccari, Stefania

    2015-12-01

    Oxytocin receptors are known to modulate synaptic transmission and network activity in the hippocampus, but their precise function has been only partially elucidated. Here, we have found that activation of presynaptic oxytocin receptor with the potent agonist, carbetocin, enhanced depolarization-evoked glutamate release in the ventral hippocampus with no effect on GABA release. This evidence paved the way for examining the effect of carbetocin treatment in "prenatally restraint stressed" (PRS) rats, i.e., the offspring of dams exposed to repeated episodes of restraint stress during pregnancy. Adult PRS rats exhibit an anxious/depressive-like phenotype associated with an abnormal glucocorticoid feedback regulation of the hypothalamus-pituitary-adrenal (HPA) axis, and, remarkably, with a reduced depolarization-evoked glutamate release in the ventral hippocampus. Chronic systemic treatment with carbetocin (1mg/kg, i.p., once a day for 2-3 weeks) in PRS rats corrected the defect in glutamate release, anxiety- and depressive-like behavior, and abnormalities in social behavior, in the HPA response to stress, and in the expression of stress-related genes in the hippocampus and amygdala. Of note, carbetocin treatment had no effect on these behavioral and neuroendocrine parameters in prenatally unstressed (control) rats, with the exception of a reduced expression of the oxytocin receptor gene in the amygdala. These findings disclose a novel function of oxytocin receptors in the hippocampus, and encourage the use of oxytocin receptor agonists in the treatment of stress-related psychiatric disorders in adult life. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Ligand-specific Deactivation Time Course of GluN1/GluN2D NMDA Receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    K Vance; N Simorowski; S Traynelis

    2011-12-31

    N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors that mediate a majority of excitatory synaptic transmission. One unique property of GluN1/GluN2D NMDA receptors is an unusually prolonged deactivation time course following the removal of L-glutamate. Here we show, using x-ray crystallography and electrophysiology, that the deactivation time course of GluN1/GluN2D receptors is influenced by the conformational variability of the ligand-binding domain (LBD) as well as the structure of the activating ligand. L-glutamate and L-CCG-IV induce significantly slower deactivation time courses compared with other agonists. Crystal structures of the isolated GluN2D LBD in complex with various ligands revealmore » that the binding of L-glutamate induces a unique conformation at the backside of the ligand-binding site in proximity to the region at which the transmembrane domain would be located in the intact receptors. These data suggest that the activity of the GluN1/GluN2D NMDA receptor is controlled distinctively by the endogenous neurotransmitter L-glutamate.« less

  18. Coordinating structural and functional synapse development: postsynaptic p21-activated kinase independently specifies glutamate receptor abundance and postsynaptic morphology.

    PubMed

    Albin, Stephanie D; Davis, Graeme W

    2004-08-04

    Here, we show that postsynaptic p21-activated kinase (Pak) signaling diverges into two genetically separable pathways at the Drosophila neuromuscular junction. One pathway controls glutamate receptor abundance. Pak signaling within this pathway is specified by a required interaction with the adaptor protein Dreadlocks (Dock). We demonstrate that Dock is localized to the synapse via an Src homology 2-mediated protein interaction. Dock is not necessary for Pak localization but is necessary to restrict Pak signaling to control glutamate receptor abundance. A second genetically separable function of Pak kinase signaling controls muscle membrane specialization through the regulation of synaptic Discs-large. In this pathway, Dock is dispensable. We present a model in which divergent Pak signaling is able to coordinate two different features of postsynaptic maturation, receptor abundance, and muscle membrane specialization.

  19. [Hexamethonium, nicotinic receptor blocker, changes the neuronal reactions on glutamate in the medial septal area in vitro].

    PubMed

    Karavaev, E N; Popova, I Iu; Kichigina, V F

    2007-01-01

    Despite the great interest in studying the medial septal area, the interactions of its neurochemical systems are not yet clearly understood. The aim of this study was to elucidate the role of nicotinic receptors in the interaction of glutamatergic and cholinergic systems of the medial septal area. The effect of L-glutamate (1 microM) on septal neurons was studied under the application of hexamethonium, nicotinic cholinoreceptor blocker by using the method of extracellular recording of neuronal activity in brain slices of ground squirrels. The response of septal neurons to glutamate depended on the type of their initial activity and on the presence of pacemaker properties. For the first time, the ability of septal neurons to respond to glutamate with an increase in burst frequency was shown. The influence of hexamethonium on the neuronal activity was similar to that of glutamate. After a preliminary application of hexamethonium, the reactions of neurons to glutamate changed. The excitatory reactions were masked, while the inhibitory reactions became stronger. It was found that nicotinic cholinergic receptors modulated the reactions of MS-DB cells to glutamate and the expression of the oscillatory properties of the septal neuronal network.

  20. Selective activation of group III metabotropic glutamate receptor subtypes produces different patterns of γ-aminobutyric acid immunoreactivity and glutamate release in the retina.

    PubMed

    Guimarães-Souza, E M; Calaza, K C

    2012-12-01

    Glutamate, the major excitatory neurotransmitter in the retina, functions by activation of both ionotropic (iGluR) and metabotropic (mGluR) glutamate receptors. Group III mGluRs, except for mGluR6, are mostly found in the inner plexiform layer (IPL), and their retinal functions are not well known. Therefore, we decided to investigate the effect of mGluRIII on glutamate release and GABAergic amacrine cells in the chick retina. The nonselective mGluRIII agonist L-SOP promoted a decrease in the number of γ-aminobutyric acid (GABA)-positive cells and in the GABA immunoreactivity in all sublayers of the IPL. This effect was prevented by the antagonist MAP-4, by GAT-1 inhibitor, and by antagonists of iGluR. Under the conditions used, L-SOP did not alter endogenous glutamate release. VU0155041, an mGluR4-positive allosteric modulator, reduced GABA immunoreactivity in amacrine cells and in sublayers 2 and 4 of the IPL but evoked an increase in the glutamate released. VU0155041's effect was inhibited by the absence of calcium. AMN082, a selective mGluR7-positive allosteric modulator, also decreased GABA immunoreactivity in amacrine cells and sublayers 1, 2, and 3 and increased glutamate release, and this effect was also inhibited by calcium absence. DCPG, an mGluR8-selective agonist, did not significantly alter GABA immunoreactivity in amacrine cells or glutamate release. However, it did significantly increase GABA immunoreactivity in sublayers 4 and 5. The results suggest that mGluRIIIs are involved in the modulation of glutamate and GABA release in the retina, possibly participating in distinct visual pathways: mGluR4 might be involved with cholinergic circuitry, whereas mGluR7 and mGluR8 might participate, respectively, in the OFF and the ON pathways. Copyright © 2012 Wiley Periodicals, Inc.

  1. Changes of several brain receptor complexes in the cerebral cortex of patients with Alzheimer disease: probable new potential pharmaceutical targets.

    PubMed

    Falsafi, Soheil Keihan; Roßner, Steffen; Ghafari, Maryam; Groessl, Michael; Morawski, Markus; Gerner, Christopher; Lubec, Gert

    2014-01-01

    Although Alzheimer disease (AD) has been linked to defects in major brain receptors, studies thus far have been limited to the determination of receptor subunits or specific ligand binding studies. However, the availability of current technology enables the determination and quantification of brain receptor complexes. Thus, we examined levels of native receptor complexes in the brains of patients with AD. Cortical tissue was obtained from control subjects (n = 12 females and 12 males) and patients with AD (n = 12 females and 12 males) within a 3-h postmortem time period. The tissues were kept frozen until further biochemical analyses. Membrane proteins were extracted and subsequently enriched by ultracentrifugation using a sucrose gradient. Membrane proteins were then electrophoresed onto native gels and immunoblotted using antibodies against individual brain receptors. We found that the levels were comparable for complexes containing GluR2, GluR3 and GluR4 as well as 5-HT1A. Moreover, the levels of complexes containing muscarinic AChR M1, NR1 and GluR1 were significantly increased in male patients with AD. Nicotinic AChRs 4 and 7 as well as dopaminergic receptors D1 and D2 were also increased in males and females with AD. These findings reveal a pattern of altered receptor complex levels that may contribute to the deterioration of the concerted activity of these receptors and thus result in cognitive deficits observed in patients with AD. It should be emphasised that receptor complexes function as working units rather than individual subunits. Thus, the receptor deficits identified may be relevant for the design of experimental therapies. Therefore, specific pharmacological modulation of these receptors is within the pharmaceutical repertoire.

  2. Regulation of Hippocampal Glutamate Receptors: Evidence for the Involvement of a Calcium-Activated Protease

    NASA Astrophysics Data System (ADS)

    Baudry, Michel; Lynch, Gary

    1980-04-01

    Specific [3H]glutamate binding to rat hippocampal membranes and the calcium-induced increase in this binding are markedly temperature-sensitive and are inhibited by alkylating or reducing agents as well as by various protease inhibitors. N-Ethylmaleimide, chloromethyl ketone derivatives of lysine and phenylalanine, and tosylarginine methyl ester decrease the maximum number of [3H]glutamate binding sites without changing their affinity for glutamate. Preincubation of the membranes with glutamate does not protect the glutamate ``receptors'' from the suppressive effects of these agents. The proteases trypsin and α -chymotrypsin increase the maximum number of [3H]glutamate binding sites. The effects of calcium on glutamate binding are different across brain regions. Cerebellar membranes are almost insensitive whereas hippocampal and striatal membranes exhibit a strong increase in the number of binding sites after exposure to even low concentrations of calcium. These results suggest that an endogenous membrane-associated thiol protease regulates the number of [3H]glutamate binding sites in hippocampal membranes and that this is the mechanism by which calcium stimulates glutamate binding. The possibility is discussed that the postulated mechanisms participate in synaptic physiology and in particular may be related to the long-term potentiation of transmission found in hippocampus under certain conditions.

  3. Revisiting the Quinoxalinedione Scaffold in the Construction of New Ligands for the Ionotropic Glutamate Receptors.

    PubMed

    Demmer, Charles S; Rombach, David; Liu, Na; Nielsen, Birgitte; Pickering, Darryl S; Bunch, Lennart

    2017-11-15

    More than two decades ago, the quinoxalinedione scaffold was shown to act as an α-amino acid bioisoster. Following extensive structure-activity relationship (SAR) studies, the antagonists DNQX, CNQX, and NBQX in the ionotropic glutamate receptor field were identified. In this work, we revisit the quinoxalinedione scaffold and explore the incorporation of an acid functionality in the 6-position. The SAR studies disclose that by this strategy it was possible to tune in iGluR selectivity among the AMPA, NMDA, and KA receptors, and to some extent also obtain full receptor subtype selectivity. Highlights of the study of 44 new analogues are compound 2m being a high affinity ligand for native AMPA receptors (IC 50 = 0.48 μM), analogues 2e,f,h,k,v all displayed selectivity for native NMDA receptors, and compounds 2s,t,u are selective ligand for the GluK1 receptor. Most interestingly, compound 2w was shown to be a GluK3-preferring ligand with full selectivity over native AMPA, KA and NMDA receptors.

  4. [Expression of AMPA receptors and related protein in immobilization stressed rats and effect of Xiaoyaosan].

    PubMed

    Yue, Guang-Xin; Wang, Zhu-Feng; Zhang, Qiao-Li; Zhao, Xin; Yue, Li-Feng; Ding, Jie; Chen, Jia-Xu

    2008-05-01

    To observe protein expression changes of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor and related regulatory protein in the hippocampus and amygdala in chronic immobilization stressed rat and Xiaoyaosan's regulatory effect. Rats were tied 3 h per day to establish immobilization stress condition and treatment with Xiaoyaosan. After 7 days and 21 days stress, the protein expression of AMPA receptor subunit (GluR2/3), N-ethylmaleimide sensitive factor (NSF) and protein interacting with C-kinase 1 (PICK1) in hippocampus and amygdala were detected by using Western blot techniques. The expression of GluR2/3, NSF in dentate gyrus (DG) and amygdala were markedly attenuated (P < 0.05) and PICK1 in CA1 region were significantly increased (P < 0.05) in 7 d immobilization stressed rats while 7 days xiaoyaosan treatment showed an effective regulatory result to PICK1's changes. Under 21 days immobilization stressed condition, the expression of GluR2/3, NSF in CA1 region showed an increasing trend, and GluR2/3 showed a markedly increase (P < 0.01), but showed an significantly decreased trend in amygdala, Xiaoyaosan showed an effective result to such changes above (P < 0.05). The expression of PICK1 showed increasing trend in amygdala and xiaoyaosan could lower its expression (P < 0.05). There are different trends of the expression of AMPA receptor in repeat short-term stress versus chronic immobilization stress, and in hippocampal CA1 region versus amygdala. Xiaoyaosan has better regulation effect on the expression of AMPA receptors in the condition of chronic immobilization stress than those of repeat shortterm stress.

  5. Altered expression of genes involved in GABAergic transmission and neuromodulation of granule cell activity in the cerebellum of schizophrenia patients.

    PubMed

    Bullock, W Michael; Cardon, Karen; Bustillo, Juan; Roberts, Rosalinda C; Perrone-Bizzozero, Nora I

    2008-12-01

    Deficits in gamma-aminobutyric acid (GABA) signaling have been described in the prefrontal cortex, limbic system, and cerebellum in individuals with schizophrenia. The purpose of the present study was to further investigate cerebellar gene expression alterations as they relate to decreases in GABAergic transmission by examining the expression of GABAergic markers, N-methyl-d-aspartic-acid (NMDA) receptor subunits, and cerebellum neuromodulators in individuals with schizophrenia. Subjects were postmortem men with a diagnosis of schizophrenia (N=13) and a postmortem interval-matched non-psychiatric male comparison group (N=13). The authors utilized real-time-quantitative polymerase chain reaction (PCR) to measure mRNA levels of the following GABAergic markers: glutamic acid decarboxylase (GAD) 65 and 67; GABA plasma membrane transporter-1 (GAT-1); GABA type A (GABA(A)) receptor subunits alpha(6), beta(3), and delta; and parvalbumin. In addition, real-time-quantitative PCR was utilized to assess mRNA levels of the NMDA receptor (NR) subunits NR1, NR2-A, NR2-B, NR2-C, and NR2-D as well as the cerebellar neuromodulators glutamate receptor (GluR)-6, kainate-preferring glutamate receptor subunit-2 (KA2), metabotropic glutamate receptor (mGluR)-2 and mGluR3, and neuronal nitric oxide synthase. Measurements for mRNA levels were determined using lateral cerebellar hemisphere tissue from both schizophrenia and comparison subjects. Schizophrenia subjects showed significant decreases in mRNA levels of GAD(67), GAD(65), GAT-1, mGluR2, and neuronal nitric oxide synthase. Increases in GABA(A)-alpha(6 )and GABA(A)-delta as well as GluR6 and KA2 were also observed. Medication effects on the expression of the same genes were examined in rats treated with either haloperidol (Sprague-Dawley rats [N=16]) or clozapine (Long-Evans rats [N=20]). Both haloperidol and clozapine increased the levels of GAD(67) in the cerebellum and altered the expression of other cerebellar mRNAs. These

  6. Metabotropic glutamate mGlu2 receptor is necessary for the pharmacological and behavioral effects induced by hallucinogenic 5-HT2A receptor agonists.

    PubMed

    Moreno, José L; Holloway, Terrell; Albizu, Laura; Sealfon, Stuart C; González-Maeso, Javier

    2011-04-15

    Hallucinogenic drugs, including mescaline, psilocybin and lysergic acid diethylamide (LSD), act at serotonin 5-HT2A receptors (5-HT2ARs). Metabotropic glutamate receptor 2/3 (mGluR2/3) ligands show efficacy in modulating the responses induced by activation of 5-HT2ARs. The formation of a 5-HT2AR-mGluR2 complex suggests a functional interaction that affects the hallucinogen-regulated cellular signaling pathways. Here, we tested the cellular and behavioral effects of hallucinogenic 5-HT2AR agonists in mGluR2 knockout (mGluR2-KO) mice. Mice were intraperitoneally injected with the hallucinogens DOI (2 mg/kg) and LSD (0.24 mg/kg), or vehicle. Head-twitch behavioral response, expression of c-fos, which is induced by all 5-HT2AR agonists, and expression of egr-2, which is hallucinogen-specific, were determined in wild type and mGluR2-KO mice. [(3)H]Ketanserin binding displacement curves by DOI were performed in mouse frontal cortex membrane preparations. Head twitch behavior was abolished in mGluR2-KO mice. The high-affinity binding site of DOI was undetected in mGluR2-KO mice. The hallucinogen DOI induced c-fos in both wild type and mGluR2-KO mice. However, the induction of egr-2 by DOI was eliminated in mGlu2-KO mice. These findings suggest that the 5-HT2AR-mGluR2 complex is necessary for the neuropsychological responses induced by hallucinogens. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  7. Deeper Insights into the Allosteric Modulation of Ionotropic Glutamate Receptors.

    PubMed

    Regan, Michael C; Furukawa, Hiro

    2016-09-21

    Two articles in this issue of Neuron (Yelshanskaya et al., 2016; Yi et al., 2016) explore the structural basis of allosteric inhibition in ionotropic glutamate receptors, providing key insights into how iGluRs function in the brain as well as how they might be pharmacologically modulated in neurological disorders and disease. Copyright © 2016. Published by Elsevier Inc.

  8. Impaired expression and function of group II metabotropic glutamate receptors in pilocarpine-treated chronically epileptic rats

    PubMed Central

    Garrido-Sanabria, Emilio R.; Otalora, Luis F. Pacheco; Arshadmansab, Massoud F.; Herrera, Berenice; Francisco, Sebastian; Ermolinsky, Boris

    2008-01-01

    Group II metabotropic (mGlu II) receptor subtypes mGlu2 and mGlu3 are important modulators of synaptic plasticity and glutamate release in the brain. Accordingly, several pharmacological ligands have been designed to target these receptors for the treatment of neurological disorders characterized by anomalous glutamate regulation including epilepsy. In this study, we examine whether the expression level and function of mGlu2 and mGlu3 are altered in experimental epilepsy by using immunohistochemistry, Western blot analysis, RT-PCR and extracellular recordings. A down-regulation of mGlu2/3 protein expression at the mossy fiber pathway was associated with a significant reduction in mGlu2/3 protein expression in the hippocampus and cortex of chronically epileptic rats. Moreover, a reduction in mGlu2 and mGlu3 transcripts levels was noticed as early as 24h after pilocarpine-induced status epilepticus (SE) and persisted during subsequent “latent” and chronic periods. In addition, a significant impairment of mGlu II-mediated depression of field excitatory postsynaptic potentials at mossy fiber-CA3 synapses was detected in chronically epileptic rats. Application of mGlu II agonists (2S,2'R,3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG-IV) induced a significant reduction of the fEPSP amplitude in control rats, but not in chronic epileptic rats. These data indicate a long-lasting impairment of mGlu2/3 expression that may contribute to abnormal presynaptic plasticity, exaggerate glutamate release and hyperexcitability in temporal lobe epilepsy. PMID:18804094

  9. Prefrontal glutamate correlates of methamphetamine sensitization and preference

    PubMed Central

    Lominac, Kevin D.; Quadir, Sema G.; Barrett, Hannah M.; McKenna, Courtney L.; Schwartz, Lisa M.; Ruiz, Paige N.; Wroten, Melissa G.; Campbell, Rianne R.; Miller, Bailey W.; Holloway, John J.; Travis, Katherine O.; Rajasekar, Ganesh; Maliniak, Dan; Thompson, Andrew B.; Urman, Lawrence E.; Kippin, Tod E.; Phillips, Tamara J.; Szumlinski, Karen K.

    2016-01-01

    Methamphetamine (MA) is a widely abused, highly addictive, psychostimulant that elicits pronounced deficits in neurocognitive function related to hypo-functioning of the prefrontal cortex (PFC). Our understanding of how repeated methamphetamine impacts excitatory glutamatergic transmission within the PFC is limited, as is information about the relation between PFC glutamate and addiction vulnerability/resiliency. In vivo microdialysis and immunoblotting studies characterized the effects of methamphetamine (10 injections of 2 mg/kg, IP) upon extracellular glutamate in C57BL/6J mice and upon glutamate receptor and transporter expression, within the medial PFC. Glutamatergic correlates of both genetic and idiopathic variance in MA preference/intake were determined through studies of high versus low MA-drinking selectively bred mouse lines (MAHDR versus MALDR, respectively) and inbred C57BL/6J mice exhibiting spontaneously divergent place-conditioning phenotypes. Repeated methamphetamine sensitized drug-induced glutamate release and lowered indices of NMDA receptor expression in C57BL/6J mice, but did not alter basal extracellular glutamate content or total protein expression of Homer proteins, or metabotropic or AMPA glutamate receptors. Elevated basal glutamate, blunted methamphetamine-induced glutamate release and ERK activation, as well as reduced protein expression of mGlu2/3 and Homer2a/b were all correlated biochemical traits of selection for high versus low methamphetamine drinking, and Homer2a/b levels were inversely correlated with the motivational valence of methamphetamine in C57BL/6J mice. These data provide novel evidence that repeated, low-dose, methamphetamine is sufficient to perturb pre- and post-synaptic aspects of glutamate transmission within the medial PFC and that glutamate anomalies within this region may contribute to both genetic and idiopathic variance in methamphetamine addiction vulnerability/resiliency. PMID:26742098

  10. Modulatory Effects of Metabotropic Glutamate Receptors on Local Cortical Circuits

    PubMed Central

    De Pasquale, Roberto; Sherman, S. Murray

    2012-01-01

    Glutamatergic pathways in various thalamic and cortical circuits have been classified into two types: Class 1 and Class 2, where it has been suggested that Class 1 carries main information for processing and Class 2 is mainly modulatory. We now extend this to the local circuitry of visual cortex of the mouse by demonstrating the modulatory actions on the Class 1 pathway from layer 4 to layers 2/3 of a Class 2 input from adjacent locations in layers 2/3. We found that this Class 2 input produces a long lasting hyperpolarization and suppresses the initial responses of input from layer 4 and that this involves the postsynaptic activation of Group II metabotropic glutamate receptors. This modulation also shifts the paired pulse ratio of the layer 4 input from depression to facilitation. PMID:22623682

  11. Identification of differentiation-associated brain-specific phosphate transporter as a second vesicular glutamate transporter (VGLUT2).

    PubMed

    Takamori, S; Rhee, J S; Rosenmund, C; Jahn, R

    2001-11-15

    Glutamate is the major excitatory neurotransmitter in mammalian CNS. In the presynaptic nerve terminal, glutamate is stored in synaptic vesicles and released by exocytosis. Previously, it has been shown that a transport protein originally identified as a brain-specific Na(+)-dependent inorganic phosphate transporter I (BNPI) functions as vesicular glutamate transporter and thus has been renamed VGLUT1. Recently, a protein highly homologous to VGLUT1, "differentiation-associated BNPI" (DNPI), has been discovered. Northern blot and in situ hybridization analyses indicate that DNPI mRNA is expressed in some brain regions in which VGLUT1 mRNA is not expressed. We now show that DNPI functions as vesicular glutamate transporter with properties very similar to VGLUT1 and propose to rename the protein VGLUT2. VGLUT2 is highly enriched in synaptic vesicles. Furthermore, VGLUT2 resides on a vesicle population that is distinct from vesicles containing the vesicular GABA transporter or VGLUT1, showing that the expression of VGLUT1 and VGLUT2 do not overlap. When VGLUT2 was expressed in BON cells, membrane fractions displayed ATP-dependent, carbonyl cyanide p-trifluoromethoxyphenylhydrazone-sensitive glutamate uptake. Overexpression of VGLUT2 in cultured autaptic GABAergic neurons yielded postsynaptic currents that were insensitive to the GABA(A) receptor antagonist bicuculline but blocked by the AMPA-receptor antagonist 2,3-dihydroxy-6-nitro-7-sulfonyl-benzo[F]quinoxaline. Thus, expression of VGLUT2 suffices to cause GABAergic neurons to release glutamate in addition to GABA in a manner very similar to that reported previously for VGLUT1.

  12. Differential co-localisation of the P2X7 receptor subunit with vesicular glutamate transporters VGLUT1 and VGLUT2 in rat CNS.

    PubMed

    Atkinson, L; Batten, T F C; Moores, T S; Varoqui, H; Erickson, J D; Deuchars, J

    2004-01-01

    Presynaptic P2X(7) receptors are thought to play a role in the modulation of transmitter release and have been localised to terminals with the location and morphology typical of excitatory boutons. To test the hypothesis that this receptor is preferentially associated with excitatory terminals we combined immunohistochemistry for the P2X(7) receptor subunit (P2X(7)R) with that for two vesicular glutamate transporters (VGLUT1 and VGLUT2) in the rat CNS. This confirmed that P2X(7)R immunoreactivity (IR) is present in glutamatergic terminals; however, whether it was co-localised with VGLUT1-IR or VGLUT2-IR depended on the CNS region examined. In the spinal cord, P2X(7)R-IR co-localised with VGLUT2-IR. In the brainstem, co-localisation of P2X(7)R-IR with VGLUT2-IR was widespread, but co-localisation with VGLUT1-IR was seen only in the external cuneate nucleus and spinocerebellar tract region of the ventral medulla. In the cerebellum, P2X(7)R-IR co-localised with both VGLUT1 and VGLUT2-IR in the granular layer. In the hippocampus it was co-localised only with VGLUT1-IR, including in the polymorphic layer of the dentate gyrus and the substantia radiatum of the CA3 region. In other forebrain areas, P2X(7)R-IR co-localised with VGLUT1-IR throughout the amygdala, caudate putamen, striatum, reticular thalamic nucleus and cortex and with VGLUT2-IR in the dorsal lateral geniculate nucleus, amygdala and hypothalamus. Dual labelling studies performed using markers for cholinergic, monoaminergic, GABAergic and glycinergic terminals indicated that in certain brainstem and spinal cord nuclei the P2X(7)R is also expressed by subpopulations of cholinergic and GABAergic/glycinergic terminals. These data support our previous hypothesis that the P2X(7)R may play a role in modulating glutamate release in functionally different systems throughout the CNS but further suggest a role in modulating release of inhibitory transmitters in some regions.

  13. Fragile X Mental Retardation Protein Regulates the Levels of Scaffold Proteins and Glutamate Receptors in Postsynaptic Densities*

    PubMed Central

    Schütt, Janin; Falley, Katrin; Richter, Dietmar; Kreienkamp, Hans-Jürgen; Kindler, Stefan

    2009-01-01

    Functional absence of fragile X mental retardation protein (FMRP) causes the fragile X syndrome, a hereditary form of mental retardation characterized by a change in dendritic spine morphology. The RNA-binding protein FMRP has been implicated in regulating postsynaptic protein synthesis. Here we have analyzed whether the abundance of scaffold proteins and neurotransmitter receptor subunits in postsynaptic densities (PSDs) is altered in the neocortex and hippocampus of FMRP-deficient mice. Whereas the levels of several PSD components are unchanged, concentrations of Shank1 and SAPAP scaffold proteins and various glutamate receptor subunits are altered in both adult and juvenile knock-out mice. With the exception of slightly increased hippocampal SAPAP2 mRNA levels in adult animals, altered postsynaptic protein concentrations do not correlate with similar changes in total and synaptic levels of corresponding mRNAs. Thus, loss of FMRP in neurons appears to mainly affect the translation and not the abundance of particular brain transcripts. Semi-quantitative analysis of RNA levels in FMRP immunoprecipitates showed that in the mouse brain mRNAs encoding PSD components, such as Shank1, SAPAP1–3, PSD-95, and the glutamate receptor subunits NR1 and NR2B, are associated with FMRP. Luciferase reporter assays performed in primary cortical neurons from knock-out and wild-type mice indicate that FMRP silences translation of Shank1 mRNAs via their 3′-untranslated region. Activation of metabotropic glutamate receptors relieves translational suppression. As Shank1 controls dendritic spine morphology, our data suggest that dysregulation of Shank1 synthesis may significantly contribute to the abnormal spine development and function observed in brains of fragile X syndrome patients. PMID:19640847

  14. Effects of metabotropic glutamate receptor ligands on male sexual behavior in rats.

    PubMed

    Li, Xia; Higley, Amanda; Song, Rui; Xi, Zheng-Xiong

    2013-03-01

    Metabotropic glutamate receptors (mGluRs), particularly mGluR2/3, mGluR5 and mGluR7, have received much attention in medication development for the treatment of drug addiction and other neuropsychiatric diseases. However, little is known as to whether mGluR ligands also alter natural sexual behavior, a possible unwanted effect when used in humans. In the present study, we used classical copulatory behaviors to evaluate the effects of LY379268 (a selective mGluR2/3 agonist), MPEP (a selective mGluR5 antagonist) and AMN082 (a selective mGluR7 agonist), on male sexual performance in rats. We found that systemic administration of LY379268 (1, 3 mg/kg, i.p.) had no effect, while MPEP (20 mg/kg, but not 10 mg/kg, i.p.) and AMN082 (10, 20 mg/kg, but not 3 mg/kg) produced a significant and dose-dependent reduction in both sex-seeking and sex-performance behaviors, manifested as an increase in mount or intromission latency and time required for ejaculation, and a reduction in mount or intromission frequency. This inhibition lasted for about 30-60 min. These findings suggest that compounds that target mGluR5 or mGluR7, but not mGluR2/3, may have short-term inhibitory effects on male sexual performance. This article is part of a Special Issue entitled 'Metabotropic Glutamate Receptors'. Published by Elsevier Ltd.

  15. Modulation of Long-Term Potentiation and Epileptiform Activity in the Rat Dentate Gyrus by the Group II Metabotropic Glutamate Receptor Subtype mGluR3

    DTIC Science & Technology

    2000-05-25

    subsequent transmitter release. The rat hippocampal slice is a preparation richly endowed with ionotropic and metabotropic glutamate receptors ...M. Zhao and R. J. Wenthold (1996b). Ionotropic and metabotropic glutamate receptors show unique postsynaptic, presynaptic, and glial localizations in...epileptiform activity in the rat cortex. Neuroreport 3(10): 916-8. Shen, W. and M. M. Slaughter (1998). Metabotropic and ionotropic glutamate receptors

  16. Glutamate-mediated protection of crayfish glial cells from PDT-induced apoptosis

    NASA Astrophysics Data System (ADS)

    Rudkovskii, M. V.; Romanenko, N. P.; Berezhnaya, E. V.; Kovaleva, V. D.; Uzdensky, A. B.

    2011-03-01

    Photodynamic treatment that causes intense oxidative stress and kills cells is currently used in neurooncology. However, along with tumor it damages surrounding healthy neurons and glial cells. In order to study the possible role of glutamate-related signaling pathways in photodynamic injury of neurons and glia, we investigated photodynamic effect of alumophthalocyanine Photosens on isolated crayfish stretch receptor that consists of a single neuron surrounded by glial cells. The laser diode (670 nm, 0.4 W/cm2) was used for dye photoexcitation. Application of glutamate increased photodynamically induced necrosis of neurons and glial cells but significantly decreased glial apoptosis. The natural neuroglial mediator N-acetylaspartylglutamate, which releases glutamate after cleavage in the extracellular space by glutamate carboxypeptidase II, also inhibited photoinduced apoptosis. Inhibition of glutamate carboxypeptidase II, oppositely, enhanced apoptosis of glial cells. These data confirm the anti-apoptotic activity of glutamate. Application of NMDA or inhibition of NMDA receptors by MK801 did not influence photodynamic death of neurons and glial cells that indicated nonparticipation of NMDA receptors in these processes. Inhibition of metabotropic glutamate receptors by AP-3 decreased PDT-induced apoptosis. One can suggest that crayfish neurons naturally secrete NAAG, which being cleaved by GCOP produces glutamate. Glutamate prevents photoinduced apoptosis of glial cells possibly through metabotropic but not ionotropic glutamate receptors.

  17. Suppression of neurite outgrowth of primary cultured hippocampal neurons is involved in impairment of glutamate metabolism and NMDA receptor function caused by nanoparticulate TiO2.

    PubMed

    Hong, Fashui; Sheng, Lei; Ze, Yuguan; Hong, Jie; Zhou, Yingjun; Wang, Ling; Liu, Dong; Yu, Xiaohong; Xu, Bingqing; Zhao, Xiaoyang; Ze, Xiao

    2015-06-01

    Numerous studies have indicated that nano-titanium dioxide (TiO2) can induce neurotoxicity in vitro and in vivo, however, it is unclear whether nano-TiO2 affects neurite outgrowth of hippocampal neurons. In order to investigate the mechanism of neurotoxicity, rat primary cultured hippocampal neurons on the fourth day of culture were exposed to 5, 15, and 30 μg/mL nano-TiO2 for 24 h, and nano-TiO2 internalization, dendritic growth, glutamate metabolism, expression of N-methyl-D-aspartate (NMDA) receptor subunits (NR1, NR2A and NR2B), calcium homeostasis, sodium current (INa) and potassium current (IK) were examined. Our findings demonstrated that nano-TiO2 crossed the membrane into the cytoplasm or nucleus, and significantly suppressed dendritic growth of primary cultured hippocampal neurons in a concentration-dependent manner. Furthermore, nano-TiO2 induced a marked release of glutamate to the extracellular region, decreased glutamine synthetase activity and increased phosphate-activated glutaminase activity, elevated intracellular calcium ([Ca(2+)]i), down-regulated protein expression of NR1, NR2A and NR2B, and increased the amplitudes of the INa and IK. In addition, nano-TiO2 increased nitric oxide and nitrice synthase, attenuated the activities of Ca(2+)-ATPase and Na(+)/K(+)-ATPase, and increased the ADP/ATP ratio in the primary neurons. Taken together, these findings indicate that nano-TiO2 inhibits neurite outgrowth of hippocampal neurons by interfering with glutamate metabolism and impairing NMDA receptor function. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Steered Molecular Dynamics Simulations Predict Conformational Stability of Glutamate Receptors.

    PubMed

    Musgaard, Maria; Biggin, Philip C

    2016-09-26

    The stability of protein-protein interfaces can be essential for protein function. For ionotropic glutamate receptors, a family of ligand-gated ion channels vital for normal function of the central nervous system, such an interface exists between the extracellular ligand binding domains (LBDs). In the full-length protein, the LBDs are arranged as a dimer of dimers. Agonist binding to the LBDs opens the ion channel, and briefly after activation the receptor desensitizes. Several residues at the LBD dimer interface are known to modulate desensitization, and conformational changes around these residues are believed to be involved in the state transition. The general hypothesis is that the interface is disrupted upon desensitization, and structural evidence suggests that the disruption might be substantial. However, when cross-linking the central part of this interface, functional data suggest that the receptor can still undergo desensitization, contradicting the hypothesis of major interface disruption. Here, we illustrate how opening the dimer interface using steered molecular dynamics (SMD) simulations, and analyzing the work values required, provides a quantitative measure for interface stability. For one subtype of glutamate receptors, which is regulated by ion binding to the dimer interface, we show that opening the interface without ions bound requires less work than with ions present, suggesting that ion binding indeed stabilizes the interface. Likewise, for interface mutants with longer-lived active states, the interface is more stable, while the work required to open the interface is reduced for less active mutants. Moreover, a cross-linked mutant can still undergo initial interface opening motions similar to the native receptor and at similar energetic cost. Thus, our results support that interface opening is involved in desensitization. Furthermore, they provide reconciliation of apparently opposing data and demonstrate that SMD simulations can give

  19. Short-term sleep deprivation impairs spatial working memory and modulates expression levels of ionotropic glutamate receptor subunits in hippocampus.

    PubMed

    Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali

    2015-06-01

    Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.

  20. Synthesis and biological evaluation of aryl isoxazole derivatives as metabotropic glutamate receptor 1 antagonists: a potential treatment for neuropathic pain.

    PubMed

    Cho, Gyeong Hi; Kim, TaeHun; Son, Woo Seung; Seo, Seon Hee; Min, Sun-Joon; Cho, Yong Seo; Keum, Gyochang; Jeong, Kyu-Sung; Koh, Hun Yeong; Lee, Jiyoun; Pae, Ae Nim

    2015-03-15

    Glutamate is the major excitatory neurotransmitter and known to activate the metabotropic and ionotropic glutamate receptors in the brain. Among these glutamate receptors, metabotropic glutamate receptor 1 (mGluR1) has been implicated in various brain disorders including anxiety, schizophrenia and chronic pain. Several studies demonstrated that the blockade of mGluR1 signaling reduced pain responses in animal models, suggesting that mGluR1 is a promising target for the treatment of neuropathic pain. In this study, we have developed mGluR1 antagonists with an aryl isoxazole scaffold, and identify several compounds that are orally active in vivo. We believe that these compounds can serve as a useful tool for the investigation of the role of mGluR1 and a promising lead for the potential treatment of neuropathic pain. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Depression of neuronal excitability and epileptic activities by group II metabotropic glutamate receptors in the medial entorhinal cortex.

    PubMed

    Zhang, Haopeng; Cilz, Nicholas I; Yang, Chuanxiu; Hu, Binqi; Dong, Hailong; Lei, Saobo

    2015-11-01

    Whereas the ionotropic glutamate receptors are the major mediator in glutamatergic transmission, the metabotropic glutamate receptors (mGluRs) usually play a modulatory role. Whereas the entorhinal cortex (EC) is an essential structure involved in the generation and propagation of epilepsy, the roles and mechanisms of mGluRs in epilepsy in the EC have not been determined. Here, we studied the effects of activation of group II metabotropic glutamate receptors (mGluRs II) on epileptiform activity induced by picrotoxin or deprivation of extracellular Mg2+ and neuronal excitability in the medial EC. We found that activation of mGluRs II by application of the selective agonist, LY354740, exerted robust inhibition on epileptiform activity. LY354740 hyperpolarized entorhinal neurons via activation of a K+ conductance and inhibition of a Na+ -permeable channel. LY354740-induced hyperpolarization was G protein-dependent, but independent of adenylyl cyclase and protein kinase A. However, the function of Gβγ was involved in mGluRs II-mediated depression of both neuronal excitability and epileptiform activity. Our results provide a novel cellular mechanism to explain the antiepileptic effects of mGluRs II in the treatment of epilepsy. © 2015 Wiley Periodicals, Inc.

  2. Modulation of Long-Term Potentiation and Epileptiform Activity in the Rat Dentate Gyrus by the Group II Metabotropic Glutamate Receptor Subtype mGluR3

    DTIC Science & Technology

    2000-05-25

    preparation richly endowed with ionotropic and metabotropic glutamate receptors , including mGluR3 (Shigemoto et al., 1997). NAAG is concentrated in...Zhao and R. J. Wenthold (1996b). Ionotropic and metabotropic glutamate receptors show unique postsynaptic, presynaptic, and glial localizations in...epileptiform activity in the rat cortex. Neuroreport 3(10): 916-8. Shen, W. and M. M. Slaughter (1998). Metabotropic and ionotropic glutamate receptors

  3. Arabidopsis Glutamate Receptor Homolog3.5 Modulates Cytosolic Ca2+ Level to Counteract Effect of Abscisic Acid in Seed Germination1[OPEN

    PubMed Central

    Kong, Dongdong; Ju, Chuanli; Parihar, Aisha; Kim, So; Cho, Daeshik; Kwak, June M.

    2015-01-01

    Seed germination is a critical step in a plant’s life cycle that allows successful propagation and is therefore strictly controlled by endogenous and environmental signals. However, the molecular mechanisms underlying germination control remain elusive. Here, we report that the Arabidopsis (Arabidopsis thaliana) glutamate receptor homolog3.5 (AtGLR3.5) is predominantly expressed in germinating seeds and increases cytosolic Ca2+ concentration that counteracts the effect of abscisic acid (ABA) to promote germination. Repression of AtGLR3.5 impairs cytosolic Ca2+ concentration elevation, significantly delays germination, and enhances ABA sensitivity in seeds, whereas overexpression of AtGLR3.5 results in earlier germination and reduced seed sensitivity to ABA. Furthermore, we show that Ca2+ suppresses the expression of ABSCISIC ACID INSENSITIVE4 (ABI4), a key transcription factor involved in ABA response in seeds, and that ABI4 plays a fundamental role in modulation of Ca2+-dependent germination. Taken together, our results provide molecular genetic evidence that AtGLR3.5-mediated Ca2+ influx stimulates seed germination by antagonizing the inhibitory effects of ABA through suppression of ABI4. These findings establish, to our knowledge, a new and pivotal role of the plant glutamate receptor homolog and Ca2+ signaling in germination control and uncover the orchestrated modulation of the AtGLR3.5-mediated Ca2+ signal and ABA signaling via ABI4 to fine-tune the crucial developmental process, germination, in Arabidopsis. PMID:25681329

  4. Glutamate and its receptors in the pathophysiology and treatment of major depressive disorder

    PubMed Central

    Ionescu, Dawn F.; Richards, Erica M.; Zarate, Carlos A.

    2014-01-01

    Monoaminergic neurotransmitter (serotonin, norepinephrine and dopamine) mechanisms of disease dominated the research landscape in the pathophysiology and treatment of major depressive disorder (MDD) for more than 50 years and still dominate available treatment options. However, the sum of all brain neurons that use monoamines as their primary neurotransmitter is <20 %. In addition, most patients treated with monoaminergic antidepressants are left with significant residual symptoms and psychosocial disability not to mention side effects, e.g., sexual dysfunction. In the past several decades, there has been greater focus on the major excitatory neurotransmitter in the human brain, glutamate, in the pathophysiology and treatment of MDD. Although several preclinical and human magnetic resonance spectroscopy studies had already implicated glutamatergic abnormalities in the human brain, it was rocketed by the discovery that the N-methyl-D-aspartate receptor antagonist ketamine has rapid and potent antidepressant effects in even the most treatment-resistant MDD patients, including those who failed to respond to electroconvulsive therapy and who have active suicidal ideation. In this review, we will first provide a brief introduction to glutamate and its receptors in the mammalian brain. We will then review the clinical evidence for glutamatergic dysfunction in MDD, the discovery and progress-to-date with ketamine as a rapidly acting antidepressant, and other glutamate receptor modulators (including proprietary medications) for treatment-resistant depression. We will finally conclude by offering potential future directions necessary to realize the enormous therapeutic promise of glutamatergic antidepressants. PMID:24318540

  5. Ionotropic AMPA-type glutamate and metabotropic GABAB receptors: determining cellular physiology by proteomes.

    PubMed

    Bettler, Bernhard; Fakler, Bernd

    2017-08-01

    Ionotropic AMPA-type glutamate receptors and G-protein-coupled metabotropic GABA B receptors are key elements of neurotransmission whose cellular functions are determined by their protein constituents. Over the past couple of years unbiased proteomic approaches identified comprehensive sets of protein building blocks of these two types of neurotransmitter receptors in the brain (termed receptor proteomes). This provided the opportunity to match receptor proteomes with receptor physiology and to study the structural organization, regulation and function of native receptor complexes in an unprecedented manner. In this review we discuss the principles of receptor architecture and regulation emerging from the functional characterization of the proteomes of AMPA and GABA B receptors. We also highlight progress in unraveling the role of unexpected protein components for receptor physiology. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. The Sigma Receptor Ligand (+)-Pentazocine Prevents Apoptotic Retinal Ganglion Cell Death induced in vitro by Homocysteine and Glutamate

    PubMed Central

    Martin, Pamela Moore; Ola, Mohammad S.; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B.

    2013-01-01

    Recent studies demonstrated that the excitotoxic amino acid homocysteine induces apoptotic death of retinal ganglion cells in vivo. In the present study, an in vitro rat retinal ganglion cell (RGC-5) culture system was used to analyze the toxicity of acute exposure to high levels of homocysteine, the mechanism of homocysteine-induced toxicity and the usefulness of σR1 ligands as neuroprotectants. When cultured RGC-5 cells were subjected to treatment with 1 mM D, L- homocysteine, a significant increase in cell death was detected by TUNEL analysis and analysis of activated caspase. When cells were treated with homocysteine- or glutamate in the presence of MK-801, an antagonist of the NMDA receptor, the cell death was inhibited significantly. In contrast, NBQX, an antagonist of the AMPA/Kainate receptor, and nifedipine, a calcium channel blocker, did not prevent the homocysteine- or glutamate-induced cell death. Semi-quantitative RT-PCR and immunocytochemical analysis demonstrated that RGC-5 cells exposed to homocysteine or glutamate express type 1 sigma receptor at levels similar to control cells. Treatment of RGC-5 cells with 3 µM or 10 µM concentrations of the σR1-specific ligand (+)-pentazocine inhibited significantly the apoptotic cell death induced by homocysteine or glutamate. The results suggest that homocysteine is toxic to ganglion cells in vitro, that the toxicity is mediated via NMDA receptor activation, and that the σR1-specific ligand (+)-pentazocine can block the RGC-5 cell death induced by homocysteine and glutamate. PMID:15046867

  7. Estrogen Receptor β Activation Rapidly Modulates Male Sexual Motivation through the Transactivation of Metabotropic Glutamate Receptor 1a

    PubMed Central

    Seredynski, Aurore L.; Balthazart, Jacques; Ball, Gregory F.

    2015-01-01

    In addition to the transcriptional activity of their liganded nuclear receptors, estrogens, such as estradiol (E2), modulate cell functions, and consequently physiology and behavior, within minutes through membrane-initiated events. The membrane-associated receptors (mERs) underlying the acute effects of estrogens on behavior have mostly been documented in females where active estrogens are thought to be of ovarian origin. We determined here, by acute intracerebroventricular injections of specific agonists and antagonists, the type(s) of mERs that modulate rapid effects of brain-derived estrogens on sexual motivation in male Japanese quail. Brain aromatase blockade acutely inhibited sexual motivation. Diarylpropionitrile (DPN), an estrogen receptor β (ERβ)-specific agonist, and to a lesser extent 17α-estradiol, possibly acting through ER-X, prevented this effect. In contrast, drugs targeting ERα (PPT and MPP), GPR30 (G1 and G15), and the Gq-mER (STX) did not affect sexual motivation. The mGluR1a antagonist LY367385 significantly inhibited sexual motivation but mGluR2/3 and mGluR5 antagonists were ineffective. LY367385 also blocked the behavioral restoration induced by E2 or DPN, providing functional evidence that ERβ interacts with metabotropic glutamate receptor 1a (mGluR1a) signaling to acutely regulate male sexual motivation. Together these results show that ERβ plays a key role in sexual behavior regulation and the recently uncovered cooperation between mERs and mGluRs is functional in males where it mediates the acute effects of estrogens produced centrally in response to social stimuli. The presence of an ER–mGluR interaction in birds suggests that this mechanism emerged relatively early in vertebrate history and is well conserved. SIGNIFICANCE STATEMENT The membrane-associated receptors underlying the acute effects of estrogens on behavior have mostly been documented in females, where active estrogens are thought to be of ovarian origin. Using acute

  8. Estrogen Receptor β Activation Rapidly Modulates Male Sexual Motivation through the Transactivation of Metabotropic Glutamate Receptor 1a.

    PubMed

    Seredynski, Aurore L; Balthazart, Jacques; Ball, Gregory F; Cornil, Charlotte A

    2015-09-23

    In addition to the transcriptional activity of their liganded nuclear receptors, estrogens, such as estradiol (E2), modulate cell functions, and consequently physiology and behavior, within minutes through membrane-initiated events. The membrane-associated receptors (mERs) underlying the acute effects of estrogens on behavior have mostly been documented in females where active estrogens are thought to be of ovarian origin. We determined here, by acute intracerebroventricular injections of specific agonists and antagonists, the type(s) of mERs that modulate rapid effects of brain-derived estrogens on sexual motivation in male Japanese quail. Brain aromatase blockade acutely inhibited sexual motivation. Diarylpropionitrile (DPN), an estrogen receptor β (ERβ)-specific agonist, and to a lesser extent 17α-estradiol, possibly acting through ER-X, prevented this effect. In contrast, drugs targeting ERα (PPT and MPP), GPR30 (G1 and G15), and the Gq-mER (STX) did not affect sexual motivation. The mGluR1a antagonist LY367385 significantly inhibited sexual motivation but mGluR2/3 and mGluR5 antagonists were ineffective. LY367385 also blocked the behavioral restoration induced by E2 or DPN, providing functional evidence that ERβ interacts with metabotropic glutamate receptor 1a (mGluR1a) signaling to acutely regulate male sexual motivation. Together these results show that ERβ plays a key role in sexual behavior regulation and the recently uncovered cooperation between mERs and mGluRs is functional in males where it mediates the acute effects of estrogens produced centrally in response to social stimuli. The presence of an ER-mGluR interaction in birds suggests that this mechanism emerged relatively early in vertebrate history and is well conserved. Significance statement: The membrane-associated receptors underlying the acute effects of estrogens on behavior have mostly been documented in females, where active estrogens are thought to be of ovarian origin. Using acute

  9. Induction of θ-frequency oscillations in the rat medial septal diagonal band slice by metabotropic glutamate receptor agonists.

    PubMed

    Lu, C B; Ouyang, G; Henderson, Z; Li, X

    2011-03-17

    The aim of this study was to examine the role of metabotropic glutamate receptors (mGluR) in the generation of oscillatory field activity at theta frequency (4-12 Hz) in the medial septal slice prepared from rat brain. Bath application of mGluR agonists and antagonists showed that activation of mGluR1-type receptors produces persistent theta frequency oscillations in a dose-responsive manner. This activity, induced by the group I mGluR agonist (RS)-3,5-dihydroxyphenylglycine (DHPG), was reduced by ionotropic glutamate receptor antagonists and abolished by further addition of a GABAA receptor antagonist. However, addition of a GABAA receptor antagonist on its own converted the DHPG-induced oscillations to intermittent episodes of accentuated theta frequency activity following a burst. In a proportion of slices, DHPG induced large amplitude field population spiking activity (100-300 μV) which is correlated linearly with the field theta oscillations and is sensitive to glutamate receptor antagonists, suggesting a role of this type of spikes in theta generation induced by DHPG. These data demonstrate that DHPG-sensitive neuronal networks within medial septum generate theta rhythmic activity and are differentially modulated by excitatory and inhibitory ionotropic neurotransmissions. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  10. Characterization of ionotropic glutamate receptors in human lymphocytes

    PubMed Central

    Lombardi, Grazia; Dianzani, Chiara; Miglio, Gianluca; Canonico, Pier Luigi; Fantozzi, Roberto

    2001-01-01

    The effect of L-glutamate (Glu) on human lymphocyte function was studied by measuring anti-CD3 monoclonal antibody (mAb) or phytohaemagglutinin (PHA)-induced intracellular Ca2+ ([Ca2+]i) rise (Fura-2 method), and cell proliferation (MTT assay). Glu (0.001 – 100 μM) did not modify basal lymphocyte [Ca2+]i, but significantly potentiated the effects of anti-CD3 mAb or PHA. Maximal [Ca2+]i rises over resting cells were: 165±8 and 247±10 nM at 3.0×10−2 mg ml−1 anti-CD3 mAb; 201±4 and 266±9 nM at 5.0×10−2 mg ml−1 PHA, in the absence or presence of 1 μM Glu, respectively. The Glu effect showed a bell-shape concentration-dependent relationship, with a maximum (+90±3% for anti-CD3 mAb and +57±2% for PHA over Glu-untreated cells) at 1 μM. Non-NMDA receptor agonists (1 μM) showed a greater efficacy (+76±2% for (S)-AMPA; +78±4% for KA), if compared to NMDA (+46±2%), or Glu itself. Ionotropic Glu receptor antagonists completely inhibited the effects of the corresponding specific receptor agonists (1 μM). The IC50 values calculated were: 0.9 μM for D-AP5; 0.6 μM for (+)-MK801; 0.3 μM for NBQX. Both NBQX and KYNA were able to abolish Glu effect. The IC50s calculated were: 3.4 μM for NBQX; 0.4 μM for KYNA. Glu (0.1 – 1 mM) did not change the resting cell proliferation, whereas Glu (1 mM) significant inhibited (−27±4%) PHA (1.0×10−2 mg ml−1)-induced lymphocyte proliferation at 72 h. In conclusion, human lymphocytes express ionotropic Glu receptors functionally operating as modulators of cell activation. PMID:11454668

  11. Researching glutamate – induced cytotoxicity in different cell lines: a comparative/collective analysis/study

    PubMed Central

    Kritis, Aristeidis A.; Stamoula, Eleni G.; Paniskaki, Krystallenia A.; Vavilis, Theofanis D.

    2015-01-01

    Although glutamate is one of the most important excitatory neurotransmitters of the central nervous system, its excessive extracellular concentration leads to uncontrolled continuous depolarization of neurons, a toxic process called, excitotoxicity. In excitotoxicity glutamate triggers the rise of intracellular Ca2+ levels, followed by up regulation of nNOS, dysfunction of mitochondria, ROS production, ER stress, and release of lysosomal enzymes. Excessive calcium concentration is the key mediator of glutamate toxicity through over activation of ionotropic and metabotropic receptors. In addition, glutamate accumulation can also inhibit cystine (CySS) uptake by reversing the action of the CySS/glutamate antiporter. Reversal of the antiporter action reinforces the aforementioned events by depleting neurons of cysteine and eventually glutathione’s reducing potential. Various cell lines have been employed in the pursuit to understand the mechanism(s) by which excitotoxicity affects the cells leading them ultimately to their demise. In some cell lines glutamate toxicity is exerted mainly through over activation of NMDA, AMPA, or kainate receptors whereas in other cell lines lacking such receptors, the toxicity is due to glutamate induced oxidative stress. However, in the greatest majority of the cell lines ionotropic glutamate receptors are present, co-existing to CySS/glutamate antiporters and metabotropic glutamate receptors, supporting the assumption that excitotoxicity effect in these cells is accumulative. Different cell lines differ in their responses when exposed to glutamate. In this review article the responses of PC12, SH-SY5Y, HT-22, NT-2, OLCs, C6, primary rat cortical neurons, RGC-5, and SCN2.2 cell systems are systematically collected and analyzed. PMID:25852482

  12. Enriched environment influences hormonal status and hippocampal brain derived neurotrophic factor in a sex dependent manner.

    PubMed

    Bakos, J; Hlavacova, N; Rajman, M; Ondicova, K; Koros, C; Kitraki, E; Steinbusch, H W M; Jezova, D

    2009-12-01

    The present study is aimed at testing the hypothesis that an enriched environment (EE) induces sex-dependent changes in stress hormone release and in markers of increased brain plasticity. The focus was on hypothalamic-pituitary-adrenocortical (HPA) axis activity, plasma levels of stress hormones, gene expression of glutamate receptor subunits and concentrations of brain-derived neurotrophic factor (BDNF) in selected brain regions. Rats exposed to EE were housed in groups of 12 in large cages with various objects, which were frequently changed, for 6 weeks. Control animals were housed four per cage under standard conditions. In females the EE-induced rise in hippocampal BDNF, a neurotrophic factor associated with increased neural plasticity, was more pronounced than in males. Similar sex-specific changes were observed in BDNF concentrations in the hypothalamus. EE also significantly attenuated oxytocin and aldosterone levels only in female but not male rats. Plasma testosterone positively correlated with hippocampal BDNF in female but not male rats housed in EE. In male rats housing in EE led to enhanced levels of testosterone and adrenocorticotropic hormone (ACTH), this was not seen in females. Hippocampal glucocorticoid but not mineralocorticoid receptor levels decreased in rats housed in EE irrespective of sex. Housing conditions failed to modify mRNA levels of glutamate receptor type 1 (Glur1) and metabotropic glutamate receptor subtype 5 (mGlur5) subunits of glutamate receptors in the forebrain. Moreover, a negative association between corticosterone and BDNF was observed in both sexes. The results demonstrate that the association between hormones and changes in brain plasticity is sex related. In particular, testosterone seems to be involved in the regulatory processes related to neuroplasticity in females.

  13. Structure and synthesis of a potent glutamate receptor antagonist in wasp venom.

    PubMed Central

    Eldefrawi, A T; Eldefrawi, M E; Konno, K; Mansour, N A; Nakanishi, K; Oltz, E; Usherwood, P N

    1988-01-01

    A low molecular weight toxin isolated from the venom of the digger wasp Philanthus triangulum, first noted by T. Piek, is a potent antagonist of transmission at quisqualate-sensitive glutamate synapses of locust leg muscle. This philanthotoxin 433 (PTX-433) has been purified, chemically characterized, and subsequently synthesized along with two closely related analogues. It has a butyryl/tyrosyl/spermine sequence and a molecular weight of 435. Its two analogues, PTX-343 and PTX-334 (the numerals denoting the number of methylenes between the amino groups of the spermine moiety), are also active on the glutamate synapse of the locust leg muscle; PTX-334 was more potent and PTX-343 was less potent than the natural toxin. Such chemicals are useful for studying, labeling, and purifying glutamate receptors and may become models for an additional class of therapeutic drugs and possibly insecticides. Images PMID:2838850

  14. Parabrachial complex glutamate receptors modulate the cardiorespiratory response evoked from hypothalamic defense area.

    PubMed

    Díaz-Casares, A; López-González, M V; Peinado-Aragonés, C A; González-Barón, S; Dawid-Milner, M S

    2012-08-16

    To characterize the possible role of glutamate in the interaction between Hypothalamic Defense Area (HDA) and Parabrachial complex (PBc) nuclei, cardiorespiratory changes were analyzed in response to electrical stimulation of the HDA (1 ms pulses, 30-50 μA given at 100 Hz for 5s) before and after the microinjection of the nonspecific glutamate receptor antagonist kynurenic acid (50 nl, 5 nmol), NMDA receptor antagonist MK-801 (50 nl, 50 nmol), non-NMDA receptor antagonist CNQX (50 nl, 50 nmol) or metabotropic glutamate receptor antagonist MCPG (50 nl, 5 nmol) within the PBc. HDA stimulation evoked an inspiratory facilitatory response, consisting of an increase in respiratory rate (p<0.001) due to a decrease in expiratory time (p<0.01). The respiratory response was accompanied by a pressor (p<0.001) and a tachycardic response (p<0.001). Kynurenic acid within the lateral parabrachial region (lPB) abolished the tachycardia (p<0.001) and decreased the magnitude of blood pressure response (p<0.001) to HDA stimulation. Similarly, the magnitude of the tachycardia and the pressor response was decreased after the microinjection of MK-801 (p<0.01 and p<0.001, respectively) and CNQX (p<0.05 in both cases) into the lPB. Kynurenic acid microinjection in this region produced an inhibition of the tachypnea (p<0.001) to HDA stimulation but the respiratory response persisted unchanged after MK-801 or CNQX microinjection into the lPB. Kynurenic acid within the medial parabrachial region (mPB) abolished the tachycardia (p<0.01) and decreased the magnitude of the pressor response (p<0.001) to HDA stimulation. MK-801 and CNQX microinjection in this region decreased the magnitude of the tachycardia (p<0.05, in both cases) and pressor response (p<0.05, in both cases). The respiratory response evoked by HDA stimulation was not changed after the microinjection of kynurenic acid, MK-801 or CNQX within the mPB. No changes were observed in the cardiorespiratory response evoked to HDA

  15. Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca2+ Channels

    PubMed Central

    Astorga, César; Jorquera, Ramón A.; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

    2016-01-01

    The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo. PMID:27573697

  16. Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca(2+) Channels.

    PubMed

    Astorga, César; Jorquera, Ramón A; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

    2016-08-30

    The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo.

  17. Discovery of a new class of ionotropic glutamate receptor antagonists by the rational design of (2S,3R)-3-(3-carboxyphenyl)-pyrrolidine-2-carboxylic acid.

    PubMed

    Larsen, Ann M; Venskutonytė, Raminta; Valadés, Elena Antón; Nielsen, Birgitte; Pickering, Darryl S; Bunch, Lennart

    2011-02-16

    The kainic acid (KA) receptors belong to the class of glutamate (Glu) receptors in the brain and constitute a promising target for the treatment of neurological and/or psychiatric diseases such as schizophrenia, major depression, and epilepsy. Five KA subtypes have been identified and named GluK1-5. In this article, we present the discovery of (2S,3R)-3-(3-carboxyphenyl)-pyrrolidine-2-carboxylic acid (1) based on a rational design process. Target compound 1 was synthesized by a stereoselective strategy in 10 steps from commercially available starting materials. Binding affinities of 1 at native ionotropic Glu receptors were determined to be in the micromolar range (AMPA, 51 μM; KA, 22 μM; NMDA 6 μM), with the highest affinity for cloned homomeric KA receptor subtypes GluK1,3 (3.0 and 8.1 μM, respectively). Functional characterization of 1 by two electrode voltage clamp (TEVC) electrophysiology at a nondesensitizing mutant of GluK1 showed full competitive antagonistic behavior with a K(b) of 11.4 μM.

  18. Glutamate and GABA receptors and transporters in the basal ganglia: What does their subsynaptic localization reveal about their function?

    PubMed Central

    Galvan, Adriana; Kuwajima, Masaaki; Smith, Yoland

    2006-01-01

    GABA and glutamate, the main transmitters in the basal ganglia, exert their effects through ionotropic and metabotropic receptors. The dynamic activation of these receptors in response to released neurotransmitter depends, among other factors, on their precise localization in relation to corresponding synapses. The use of high resolution quantitative electron microscope immunocytochemical techniques has provided in-depth description of the subcellular and subsynaptic localization of these receptors in the CNS. In this article, we review recent findings on the ultrastructural localization of GABA and glutamate receptors and transporters in the basal ganglia, at synaptic, extrasynaptic and presynaptic sites. The anatomical evidence supports numerous potential locations for receptor-neurotransmitter interactions, and raises important questions regarding mechanisms of activation and function of synaptic versus extrasynaptic receptors in the basal ganglia. PMID:17059868

  19. Ionotropic Glutamate Receptors and Voltage-Gated Ca2+ Channels in Long-Term Potentiation of Spinal Dorsal Horn Synapses and Pain Hypersensitivity

    PubMed Central

    Youn, Dong-ho; Gerber, Gábor; Sather, William A.

    2013-01-01

    Over the last twenty years of research on cellular mechanisms of pain hypersensitivity, long-term potentiation (LTP) of synaptic transmission in the spinal cord dorsal horn (DH) has emerged as an important contributor to pain pathology. Mechanisms that underlie LTP of spinal DH neurons include changes in the numbers, activity, and properties of ionotropic glutamate receptors (AMPA and NMDA receptors) and of voltage-gated Ca2+ channels. Here, we review the roles and mechanisms of these channels in the induction and expression of spinal DH LTP, and we present this within the framework of the anatomical organization and synaptic circuitry of the spinal DH. Moreover, we compare synaptic plasticity in the spinal DH with classical LTP described for hippocampal synapses. PMID:24224102

  20. Cortical ionotropic glutamate receptor antagonism protects against methamphetamine-induced striatal neurotoxicity.

    PubMed

    Gross, N B; Duncker, P C; Marshall, J F

    2011-12-29

    Binge administration of the psychostimulant drug, methamphetamine (mAMPH), produces long-lasting structural and functional abnormalities in the striatum. mAMPH binges produce nonexocytotic release of dopamine (DA), and mAMPH-induced activation of excitatory afferent inputs to cortex and striatum is evidenced by elevated extracellular glutamate (GLU) in both regions. The mAMPH-induced increases in DA and GLU neurotransmission are thought to combine to injure striatal DA nerve terminals of mAMPH-exposed brains. Systemic pretreatment with either competitive or noncompetitive N-methyl-D-aspartic acid (NMDA) antagonists protects against mAMPH-induced striatal DA terminal damage, but the locus of these antagonists' effects has not been determined. Here, we applied either the NMDA receptor antagonist, (dl)-amino-5-phosphonovaleric acid (AP5), or the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor antagonist, dinitroquinoxaline-2,3-dione (DNQX), directly to the dura mater over frontoparietal cortex to assess their effects on mAMPH-induced cortical and striatal immediate-early gene (c-fos) expression. In a separate experiment we applied AP5 or DNQX epidurally in the same cortical location of rats during a binge regimen of mAMPH and assessed mAMPH-induced striatal dopamine transporter (DAT) depletions 1 week later. Our results indicate that both ionotropic glutamate receptor antagonists reduced the mAMPH-induced Fos expression in cerebral cortex regions near the site of epidural application and reduced Fos immunoreactivity in striatal regions innervated by the affected cortical regions. Also, epidural application of the same concentration of either antagonist during a binge mAMPH regimen blunted the mAMPH-induced striatal DAT depletions with a topography similar to its effects on Fos expression. These findings demonstrate that mAMPH-induced dopaminergic injury depends upon cortical NMDA and AMPA receptor activation and suggest the involvement of the

  1. Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

    PubMed

    Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

    2005-07-01

    Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

  2. Different structural requirements for functional ion pore transplantation suggest different gating mechanisms of NMDA and kainate receptors.

    PubMed

    Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael

    2008-10-01

    Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.

  3. The role of metabotropic glutamate receptor mGlu5 in control of micturition and bladder nociception.

    PubMed

    Hu, Youmin; Dong, Li; Sun, Biying; Guillon, Marlene A; Burbach, Leah R; Nunn, Philip A; Liu, Xingrong; Vilenski, Olga; Ford, Anthony P D W; Zhong, Yu; Rong, Weifang

    2009-01-23

    In micturition control, the roles of ionotropic glutamate (iGlu) receptors NMDA and AMPA are well established, whereas little is known about the function of metabotropic glutamate (mGlu) receptors. Since antagonists for mGlu5 receptors are efficacious in animal models of inflammatory and neuropathic pain, we examined whether mGlu5 receptors play a role in the voiding reflex and bladder nociception and, if so, via centrally or peripherally localized receptors. The mGlu5 receptor antagonist MPEP dose-dependently increased the micturition threshold (MT) volume in the volume-induced micturition reflex (VIMR) model in anesthetized rats. Following doses of 5.2, 15.5 and 51.7micromol/kg of MPEP (intraduodenal), the MT was increased by 24.7+/-5.0%, 97.2+/-12.5% (P<0.01) and 128.0+/-28.3% (P<0.01) from the baseline, respectively (n=4-5; compared with 0.8+/-9.1% in the vehicle group). Infusing MPEP (0.3, 1mM) directly into the bladder also raised MT. However, the efficacious plasma concentrations of MPEP following intravesical dosing were similar to that after intraduodenal dosing (EC(50) of 0.11 and 0.27microM, respectively, P>0.05). MPEP also dose-dependently attenuated the visceromotor responses (VMR, total number of abdominal EMG spikes during phasic bladder distension) in anesthetized rats. The VMR was decreased to 1332.4+/-353.9 from control of 2886.5+/-692.2 spikes/distension (n=6, P<0.01) following MPEP (10micromol/kg, iv). Utilizing the isolated mouse bladder/pelvic nerve preparation, we found that neither MPEP (up to 3microM) nor MTEP (up to 10microM) affected afferent discharge in response to bladder distension (n=4-6). In contrast, MPEP attenuated the responses of the mesenteric nerves to distension of the mouse jejunum in vitro. These data suggest that mGlu5 receptors play facilitatory roles in the processing of afferent input from the urinary bladder, and that central rather than peripheral mGlu5 receptors appear to be responsible.

  4. NMDA and AMPA receptors in the anterior cingulate cortex mediates visceral pain in visceral hypersensitivity rats.

    PubMed

    Zhou, Lin; Huang, Junjing; Gao, Jun; Zhang, Guanpo; Jiang, Jinjin

    2014-02-01

    Several studies have shown that N-methyl-D-aspartate (NMDA)-receptor activation in anterior cingulate cortex (ACC) neurons plays critical roles in modulating visceral pain responses in visceral hypersensitivity (VH) rats. However, there are few reports about the expressions of NMDA and α-amino-3-hydroxy-5-methyl-4-isox-azolepropionic-acid (AMPA) receptor subtypes in ACC of VH model rats at different time points. The current study was undertaken to investigate NR2A, NR2B and GluR2 expressions in ACC of VH rats that were induced by administration with 5% mustard oil. Our results indicated that NR2B, but not NR2A, was highly expressed in VH model group on day 15, 22, and 36 compared with normal group (p < 0.05). GluR2 expression was also higher in VH model group on day 15, 22, and 36 than that of normal group (p < 0.05). These findings suggested increased expression of NR2B and GluR2 might be key mechanisms for long-term synaptic plastic changes in VH rats. Copyright © 2014. Published by Elsevier Inc.

  5. Symptomatic and neuroprotective effects following activation of nigral group III metabotropic glutamate receptors in rodent models of Parkinson's disease

    PubMed Central

    Austin, PJ; Betts, MJ; Broadstock, M; O'Neill, MJ; Mitchell, SN; Duty, S

    2010-01-01

    Background and purpose: Increased glutamatergic innervation of the substantia nigra pars reticulata (SNpr) and pars compacta (SNpc) may contribute to the motor deficits and neurodegeneration, respectively, in Parkinson's disease (PD). This study aimed to establish whether activation of pre-synaptic group III metabotropic glutamate (mGlu) receptors reduced glutamate release in the SN, and provided symptomatic or neuroprotective relief in animal models of PD. Experimental approach: Broad-spectrum group III mGlu receptor agonists, O-phospho-l-serine (l-SOP) and l-2-amino-4-phosphonobutyrate (l-AP4), were assessed for their ability to inhibit KCl-evoked [3H]-d-aspartate release in rat nigral prisms or inhibit KCl-evoked endogenous glutamate release in the SNpr in vivo using microdialysis. Reversal of akinesia in reserpine-treated rats was assessed following intranigral injection of l-SOP and l-AP4. Finally, the neuroprotective effect of 7 days' supra-nigral treatment with l-AP4 was examined in 6-hydroxydopamine (6-OHDA)-lesioned rats. Key results: l-SOP and l-AP4 inhibited [3H]-d-aspartate release by 33 and 44% respectively. These effects were blocked by the selective group III mGlu antagonist (RS)-α-cyclopropyl-4-phosphonophenylglycine (CPPG). l-SOP also reduced glutamate release in the SNpr in vivo by 48%. Injection of l-SOP and l-AP4 into the SNpr reversed reserpine-induced akinesia. Following administration above the SNpc, l-AP4 provided neurochemical, histological and functional protection against 6-OHDA lesion of the nigrostriatal tract. Pretreatment with CPPG inhibited these effects. Conclusions and implications: These findings highlight group III mGlu receptors in the SN as potential targets for providing both symptomatic and neuroprotective relief in PD, and indicate that inhibition of glutamate release in the SN may underlie these effects. PMID:20649576

  6. Repeated electroconvulsive shock (ECS) alters the phosphorylation of glutamate receptor subunits in the rat hippocampus.

    PubMed

    Fumagalli, Fabio; Pasini, Matteo; Sartorius, Alexander; Scherer, Rosine; Racagni, Giorgio; Riva, Marco A; Gass, Peter

    2010-10-01

    Glutamate and its receptors are involved in the pathophysiology of mood disorders and have recently emerged as potential targets for the pharmacotherapy of depression. In rats, we investigated plasticity changes of the glutamatergic system evoked by electroconvulsive shock (ECS), which represents the most effective therapy for patients who are refractory to antidepressants. Chronic ECS produced a marked increase in the phosphorylation of the regulatory NMDA receptor subunit NR2B (Ser1303) and the AMPA receptor subunit GluR-A (Ser831) in the hippocampus, with no effects on the obligatory subunit NR1. No effects were found on total receptor subunit expression levels. We suggest that, at least in part, ECS exerts its clinical activity through the modulation of the glutamatergic synapses, via potentiation of AMPA currents mediated by GluR-A (Ser831) phosphorylation, and a reduction of NMDA receptor activity through the phosphorylation of NR2B (Ser1303), presumably uncoupling NR2B from its signalling partner CaMKII. These effects functionally resemble the recently described antidepressant effects of ketamine.

  7. Peripheral ionotropic glutamate receptors contribute to Fos expression increase in the spinal cord through antidromic electrical stimulation of sensory nerves.

    PubMed

    Li, Jia-Heng; He, Pei-Yao; Fan, Dan-Ni; Alemujiang, Dilinapa; Huo, Fu-Quan; Zhao, Yan; Cao, Dong-Yuan

    2018-06-21

    Previous studies have shown that peripheral ionotropic glutamate receptors are involved in the increase in sensitivity of a cutaneous branch of spinal dorsal ramus (CBDR) through antidromic electrical stimulation (ADES) of another CBDR in the adjacent segment. CBDR in the thoracic segments run parallel to each other and no synaptic contact at the periphery is reported. The present study investigated whether the increased sensitivity of peripheral sensory nerves via ADES of a CBDR induced Fos expression changes in the adjacent segments of the spinal cord. Fos expression increased in the T8 - T12 segments of the spinal cord evoked by ADES of the T10 CBDR in rats. The increased Fos expression in the T11 and T12, but not T8 - T10 spinal cord segments, was significantly blocked by local application of either N-methyl-D-aspartate (NMDA) receptor antagonist dizocilpine maleate (MK-801) or non-NMDA receptor antagonist 6,7-dinitroquinoxaline-2,3-dione (DNQX) into the receptive field of T11 CBDR. The results suggest that endogenous glutamate released by ADES of sensory nerve may bind to peripheral ionotropic glutamate receptors and activate adjacent sensory nerve endings to increase the sensitivity of the spinal cord. These data reveal the potential mechanisms of neuron activation in the spinal cord evoked by peripheral sensitization. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Guidepost neurons for the lateral olfactory tract: expression of metabotropic glutamate receptor 1 and innervation by glutamatergic olfactory bulb axons.

    PubMed

    Hirata, Tatsumi; Kumada, Tatsuro; Kawasaki, Takahiko; Furukawa, Tomonori; Aiba, Atsu; Conquet, François; Saga, Yumiko; Fukuda, Atsuo

    2012-12-01

    The guidepost neurons for the lateral olfactory tract, which are called lot cells, are the earliest-generated neurons in the neocortex. They migrate tangentially and ventrally further down this tract, and provide scaffolding for the olfactory bulb axons projecting into this pathway. The molecular profiles of the lot cells are largely uncharacterized. We found that lot cells specifically express metabotropic glutamate receptor subtype-1 at a very early stage of development. This receptor is functionally competent and responds to a metabotropic glutamate receptor agonist with a transient increase in the intracellular calcium ion concentration. When the glutamatergic olfactory bulb axons were electrically stimulated, lot cells responded to the stimulation with a calcium increase mainly via ionotropic glutamate receptors, suggesting potential neurotransmission between the axons and lot cells during early development. Together with the finding that lot cells themselves are glutamatergic excitatory neurons, our results provide another notable example of precocious interactions between the projecting axons and their intermediate targets. Copyright © 2012 Wiley Periodicals, Inc.

  9. NAc Shell Arc/Arg3.1 Protein Mediates Reconsolidation of Morphine CPP by Increased GluR1 Cell Surface Expression: Activation of ERK-Coupled CREB is Required

    PubMed Central

    Lv, Xiu-Fang; Sun, Lin-Lin; Han, Ji-Sheng

    2015-01-01

    Background: Relapse into drug abuse evoked by reexposure to the drug-associated context has been a primary problem in the treatment of drug addiction. Disrupting the reconsolidation of drug-related context memory would therefore limit the relapse susceptibility. Methods: Morphine conditioned place preference (CPP) was used to assess activity-regulated cytoskeleton-associated protein (Arc/Arg3.1) and correlative molecule expression in the Nucleus accumbens (NAc) shell during the reconsolidation of morphine CPP. U0126 and Arc/Arg3.1 antisense oligodeoxynucleotide were adapted to evaluate the role and the underlying mechanism of Arc/Arg3.1 during the reconsolidation. Results: The retrieval of morphine CPP in rats specifically increased the Arc/Arg3.1 protein level in the NAc shell, accompanied simultaneously by increases in the phosphorylation of extracellular signal-regulated kinase1/2 (pERK1/2), the phosphorylation of Cyclic Adenosine monophosphate (cAMP) response element-binding (pCREB), and the up-regulation of the membrane α-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors GluR1 subunit level. Intra-NAc shell infusion U0126, an inhibitor of the Mitogen-activated protein kinase kinase (MEK), prevented the retrieval-induced up-regulation of pERK1/2, pCREB, Arc/Arg3.1, and membrane GluR1 immediately after retrieval of morphine CPP. The effect of disrupting the reconsolidation of morphine CPP by U0126 could last for at least 14 days, and could not be evoked by a priming injection of morphine. Furthermore, the specific knockdown of Arc/Arg3.1 in the NAc shell decreased the membrane GluR1 level, and impaired both the reconsolidation and the reinstatement of morphine CPP. Conclusions: Arc/Arg3.1 in the NAc shell mediates the reconsolidation of morphine-associated context memory via up-regulating the level of membrane of GluR1, for which the local activation of the ERK-CREB signal pathway, as an upstream mechanism of Arc/Arg3.1, is required. PMID

  10. Molecular dynamics in an optical trap of glutamate receptors labeled with quantum-dots on living neurons

    NASA Astrophysics Data System (ADS)

    Kishimoto, Tatsunori; Maezawa, Yasuyo; Kudoh, Suguru N.; Taguchi, Takahisa; Hosokawa, Chie

    2017-04-01

    Molecular dynamics of glutamate receptor, which is major neurotransmitter receptor at excitatory synapse located on neuron, is essential for synaptic plasticity in the complex neuronal networks. Here we studied molecular dynamics in an optical trap of AMPA-type glutamate receptor (AMPAR) labeled with quantum-dot (QD) on living neuronal cells with fluorescence imaging and fluorescence correlation spectroscopy (FCS). When a 1064-nm laser beam for optical trapping was focused on QD-AMPARs located on neuronal cells, the fluorescence intensity of QD-AMPARs gradually increased at the focal spot. Using single-particle tracking of QD-AMPARs on neurons, the average diffusion coefficient decreased in an optical trap. Moreover, the decay time obtained from FCS analysis increased with the laser power and the initial assembling state of AMPARs depended on culturing day, suggesting that the motion of QD-AMPAR was constrained in an optical trap.

  11. Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

    2007-07-01

    The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

  12. Phrenic motoneuron expression of serotonergic and glutamatergic receptors following upper cervical spinal cord injury

    PubMed Central

    Mantilla, Carlos B.; Bailey, Jeffrey P.; Zhan, Wen-Zhi; Sieck, Gary C.

    2012-01-01

    Following cervical spinal cord injury at C2 (SH hemisection model) there is progressive recovery of phrenic activity. Neuroplasticity in the postsynaptic expression of neurotransmitter receptors may contribute to functional recovery. Phrenic motoneurons express multiple serotonergic (5-HTR) and glutamatergic (GluR) receptors, but the timing and possible role of these different neurotransmitter receptor subtypes in the neuroplasticity following SH are not clear. The current study was designed to test the hypothesis that there is an increased expression of serotonergic and glutamatergic neurotransmitter receptors within phrenic motoneurons after SH. In adult male rats, phrenic motoneurons were labeled retrogradely by intrapleural injection of Alexa 488-conjugated cholera toxin B. In thin (10 μm) frozen sections of the spinal cord, fluorescently-labeled phrenic motoneurons were visualized for laser capture microdissection (LCM). Using quantitative real-time RT-PCR in LCM samples, the time course of changes in 5-HTR and GluR mRNA expression was determined in phrenic motoneurons up to 21 days post-SH. Expression of 5-HTR subtypes 1b, 2a and 2c and GluR subtypes AMPA, NMDA, mGluR1 and mGluR5 was evident in phrenic motoneurons from control and SH rats. Phrenic motoneuron expression of 5-HTR2a increased ~8-fold (relative to control) at 14 days post-SH, whereas NMDA expression increased ~16-fold by 21-days post-SH. There were no other significant changes in receptor expression at any time post-SH. This is the first study to systematically document changes in motoneuron expression of multiple neurotransmitter receptors involved in regulation of motoneuron excitability. By providing information on the neuroplasticity of receptors expressed in a motoneuron pool that is inactivated by a higher-level spinal cord injury, appropriate pharmacological targets can be identified to alter motoneuron excitability. PMID:22227062

  13. Control of cortical neuronal migration by glutamate and GABA

    PubMed Central

    Luhmann, Heiko J.; Fukuda, A.; Kilb, W.

    2015-01-01

    Neuronal migration in the cortex is controlled by the paracrine action of the classical neurotransmitters glutamate and GABA. Glutamate controls radial migration of pyramidal neurons by acting primarily on NMDA receptors and regulates tangential migration of inhibitory interneurons by activating non-NMDA and NMDA receptors. GABA, acting on ionotropic GABAA-rho and GABAA receptors, has a dichotomic action on radially migrating neurons by acting as a GO signal in lower layers and as a STOP signal in upper cortical plate (CP), respectively. Metabotropic GABAB receptors promote radial migration into the CP and tangential migration of interneurons. Besides GABA, the endogenous GABAergic agonist taurine is a relevant agonist controlling radial migration. To a smaller extent glycine receptor activation can also influence radial and tangential migration. Activation of glutamate and GABA receptors causes increases in intracellular Ca2+ transients, which promote neuronal migration by acting on the cytoskeleton. Pharmacological or genetic manipulation of glutamate or GABA receptors during early corticogenesis induce heterotopic cell clusters in upper layers and loss of cortical lamination, i.e., neuronal migration disorders which can be associated with neurological or neuropsychiatric diseases. The pivotal role of NMDA and ionotropic GABA receptors in cortical neuronal migration is of major clinical relevance, since a number of drugs acting on these receptors (e.g., anti-epileptics, anesthetics, alcohol) may disturb the normal migration pattern when present during early corticogenesis. PMID:25688185

  14. The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region

    NASA Astrophysics Data System (ADS)

    Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

    2017-04-01

    Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine.

  15. The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region.

    PubMed

    Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

    2017-04-07

    Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine.

  16. [The role of non-NMDA glutamate receptors in the EEG effects of chronic administration of noopept GVS-111 in awake rats].

    PubMed

    Kovalev, G I; Vorob'ev, V V

    2002-01-01

    Participation of the non-NMDA glutamate receptor subtype in the formation of the EEG frequency spectrum was studied in wakeful rats upon a long-term (10 x 0.2 mg/kg, s.c.) administration of the nootropic dipeptide GVS-111 (noopept or N-phenylacetyl-L-prolyglycine ethylate). The EEGs were measured with electrodes implanted into somatosensor cortex regions, hippocampus, and a cannula in the lateral ventricle. The acute reactions (characteristic of nootropes) in the alpha and beta ranges of EEG exhibited inversion after the 6th injection of noopept and almost completely vanished after the 9th injection. Preliminary introduction of the non-NMDA antagonist GDEE (glutamic acid diethyl ester) in a dose of 1 mumole into the lateral ventricle restored the EEG pattern observed upon the 6th dose of GVS-111. The role of glutamate receptors in the course of a prolonged administration of nootropes, as well as the possible mechanisms accounting for a difference in the action of GVS-111 and piracetam are discussed.

  17. Implication of NMDA type glutamate receptors in neural regeneration and neoformation of synapses after excitotoxic injury in the guinea pig cochlea.

    PubMed

    d'Aldin, C G; Ruel, J; Assié, R; Pujol, R; Puel, J L

    1997-07-01

    In the adult mammalian cochlea, the ability of nerve fibres to regenerate has been observed following disruption of the organ of Corti by various means, or transsection of the cochlear nerve in the internal auditory meatus. Based upon the implication of glutamate as a neurotransmitter at synapses between sensory hair cells and terminal dendrites of the auditory nerve in the mammalian cochlea, we have developed, in a previous study, an in vivo model of neural regeneration and formation of synapses after the destruction of the afferent nerve endings by local application of the glutamate agonist alpha-amino-3-hydroxy-5-methyl-isoxazol-propionic acid (AMPA). In situ hybridization experiments performed during the re-innervation process revealed an overexpression of mRNA coding for NR1 subunit of N-methyl-D-aspartate (NMDA) receptors in the spiral ganglion neurons, suggesting that these receptors are implicated in neural regenerative processes. The present study has been designed to study the functional implication of NMDA receptors in the regrowth and synaptic repair of auditory dendrites in the guinea pig cochlea, by blocking the NMDA receptors during the period of normal functional recovery. In a first set of experiments, we recorded compound action potential after acute perilymphatic perfusion of cumulative doses (0.03-10mM) of DL 2-amino-5-phosphonovalerate (D-AP5), a NMDA antagonist, to determine the efficiency of the drug. In a second set of experiments, the auditory dendrites were destroyed by local application of the glutamate agonist AMPA. The blockage of NMDA by the antagonist D-AP5 applied with an osmotic micropump delayed the functional recovery and the regrowth of auditory dendrites. The findings of our study support the hypothesis that, in addition to acting as a fast transmitter, glutamate has a neurotrophic role via the activation of NMDA receptors.

  18. Investigation of the antidyskinetic site of action of metabotropic and ionotropic glutamate receptor antagonists. Intracerebral infusions in 6-hydroxydopamine-lesioned rats with levodopa-induced dyskinesia.

    PubMed

    Maranis, Sotirios; Stamatis, Dimitrios; Tsironis, Christos; Konitsiotis, Spiridon

    2012-05-15

    Long-term levodopa replacement therapy in Parkinson's disease is confounded by abnormal involuntary movements, known as levodopa induced dyskinesia (LID). Dysfunctional glutamatergic neurotransmission has been implicated in the pathogenesis of LID making metabotropic and ionotropic glutamate receptors attractive novel therapeutic targets. The objective of the present study was to investigate the antidyskinetic site of action of different glutamate receptor antagonists in the brain. For that purpose, metabotropic glutamate subtype 5 (3-((2-Methyl-1,3-thiazol-4-yl)ethynyl)pyridine hydrochloride, MTEP), NMDA NR2B selective ((aR,bS)-a-(4-Hydroxyphenyl)-b-methyl-4-(phenylmethyl)-1-piperidinepropanol maleate, Ro 25-6981) and AMPA (2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide disodium salt, NBQX) receptor antagonists or saline were administered by intracerebral infusion in the caudate-putamen (CPu), the substantia nigra zona reticulata (SNr) or the subthalamic nucleus (STN) of 6-hydroxydopamine-lesioned rats exhibiting LID. Dyskinesia was assessed with the modified version of the rat Abnormal Involuntary Movements scale (AIMS). Ro 25-6981 and to a lesser extent NBQX improved dyskinesia (82% and 19% reduction in AIM score respectively) after infusion in the caudate-putamen. None of the three drugs managed to noticeably reduce AIM score after infusion in the SNr. MTEP was the only drug that produced a reduction in AIM score (48%) when infused in STN. In conclusion, while the striatum proved important in the antidyskinetic action of NMDA and AMPA receptor antagonists, the results of this study highlight also the importance of the metabotropic glutamate receptors that reside in the STN as therapeutic targets in the treatment of LID. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. A genome wide association study links glutamate receptor pathway to sporadic Creutzfeldt-Jakob disease risk.

    PubMed

    Sanchez-Juan, Pascual; Bishop, Matthew T; Kovacs, Gabor G; Calero, Miguel; Aulchenko, Yurii S; Ladogana, Anna; Boyd, Alison; Lewis, Victoria; Ponto, Claudia; Calero, Olga; Poleggi, Anna; Carracedo, Ángel; van der Lee, Sven J; Ströbel, Thomas; Rivadeneira, Fernando; Hofman, Albert; Haïk, Stéphane; Combarros, Onofre; Berciano, José; Uitterlinden, Andre G; Collins, Steven J; Budka, Herbert; Brandel, Jean-Philippe; Laplanche, Jean Louis; Pocchiari, Maurizio; Zerr, Inga; Knight, Richard S G; Will, Robert G; van Duijn, Cornelia M

    2014-01-01

    We performed a genome-wide association (GWA) study in 434 sporadic Creutzfeldt-Jakob disease (sCJD) patients and 1939 controls from the United Kingdom, Germany and The Netherlands. The findings were replicated in an independent sample of 1109 sCJD and 2264 controls provided by a multinational consortium. From the initial GWA analysis we selected 23 SNPs for further genotyping in 1109 sCJD cases from seven different countries. Five SNPs were significantly associated with sCJD after correction for multiple testing. Subsequently these five SNPs were genotyped in 2264 controls. The pooled analysis, including 1543 sCJD cases and 4203 controls, yielded two genome wide significant results: rs6107516 (p-value=7.62x10-9) a variant tagging the prion protein gene (PRNP); and rs6951643 (p-value=1.66x10-8) tagging the Glutamate Receptor Metabotropic 8 gene (GRM8). Next we analysed the data stratifying by country of origin combining samples from the pooled analysis with genotypes from the 1000 Genomes Project and imputed genotypes from the Rotterdam Study (Total n=12967). The meta-analysis of the results showed that rs6107516 (p-value=3.00x10-8) and rs6951643 (p-value=3.91x10-5) remained as the two most significantly associated SNPs. Rs6951643 is located in an intronic region of GRM8, a gene that was additionally tagged by a cluster of 12 SNPs within our top100 ranked results. GRM8 encodes for mGluR8, a protein which belongs to the metabotropic glutamate receptor family, recently shown to be involved in the transduction of cellular signals triggered by the prion protein. Pathway enrichment analyses performed with both Ingenuity Pathway Analysis and ALIGATOR postulates glutamate receptor signalling as one of the main pathways associated with sCJD. In summary, we have detected GRM8 as a novel, non-PRNP, genome-wide significant marker associated with heightened disease risk, providing additional evidence supporting a role of glutamate receptors in sCJD pathogenesis.

  20. Vesicular glutamate release from central axons contributes to myelin damage.

    PubMed

    Doyle, Sean; Hansen, Daniel Bloch; Vella, Jasmine; Bond, Peter; Harper, Glenn; Zammit, Christian; Valentino, Mario; Fern, Robert

    2018-03-12

    The axon myelin sheath is prone to injury associated with N-methyl-D-aspartate (NMDA)-type glutamate receptor activation but the source of glutamate in this context is unknown. Myelin damage results in permanent action potential loss and severe functional deficit in the white matter of the CNS, for example in ischemic stroke. Here, we show that in rats and mice, ischemic conditions trigger activation of myelinic NMDA receptors incorporating GluN2C/D subunits following release of axonal vesicular glutamate into the peri-axonal space under the myelin sheath. Glial sources of glutamate such as reverse transport did not contribute significantly to this phenomenon. We demonstrate selective myelin uptake and retention of a GluN2C/D NMDA receptor negative allosteric modulator that shields myelin from ischemic injury. The findings potentially support a rational approach toward a low-impact prophylactic therapy to protect patients at risk of stroke and other forms of excitotoxic injury.

  1. Astroglial Glutamate Signaling and Uptake in the Hippocampus

    PubMed Central

    Rose, Christine R.; Felix, Lisa; Zeug, Andre; Dietrich, Dirk; Reiner, Andreas; Henneberger, Christian

    2018-01-01

    Astrocytes have long been regarded as essentially unexcitable cells that do not contribute to active signaling and information processing in the brain. Contrary to this classical view, it is now firmly established that astrocytes can specifically respond to glutamate released from neurons. Astrocyte glutamate signaling is initiated upon binding of glutamate to ionotropic and/or metabotropic receptors, which can result in calcium signaling, a major form of glial excitability. Release of so-called gliotransmitters like glutamate, ATP and D-serine from astrocytes in response to activation of glutamate receptors has been demonstrated to modulate various aspects of neuronal function in the hippocampus. In addition to receptors, glutamate binds to high-affinity, sodium-dependent transporters, which results in rapid buffering of synaptically-released glutamate, followed by its removal from the synaptic cleft through uptake into astrocytes. The degree to which astrocytes modulate and control extracellular glutamate levels through glutamate transporters depends on their expression levels and on the ionic driving forces that decrease with ongoing activity. Another major determinant of astrocytic control of glutamate levels could be the precise morphological arrangement of fine perisynaptic processes close to synapses, defining the diffusional distance for glutamate, and the spatial proximity of transporters in relation to the synaptic cleft. In this review, we will present an overview of the mechanisms and physiological role of glutamate-induced ion signaling in astrocytes in the hippocampus as mediated by receptors and transporters. Moreover, we will discuss the relevance of astroglial glutamate uptake for extracellular glutamate homeostasis, focusing on how activity-induced dynamic changes of perisynaptic processes could shape synaptic transmission at glutamatergic synapses. PMID:29386994

  2. The role of glutamate and its receptors in autism and the use of glutamate receptor antagonists in treatment

    PubMed Central

    Rojas, Donald C.

    2014-01-01

    Glutamate is the major excitatory neurotransmitter in the brain and may be a key neurotransmitter involved in autism. Literature pertaining to glutamate and autism or related disorders (e.g., Fragile X syndrome) is reviewed in this article. Interest in glutamatergic dysfunction in autism is high due to increasing convergent evidence implicating the system in the disorder from peripheral biomarkers, neuroimaging, protein expression, genetics and animal models. Currently, there are no pharmaceutical interventions approved for autism that address glutamate deficits in the disorder. New treatments related to glutamatergic neurotransmission, however, are emerging. In addition, older glutamate-modulating medications with approved indications for use in other disorders are being investigated for re-tasking as treatments for autism. This review presents evidence in support of glutamate abnormalities in autism and the potential for translation into new treatments for the disorder. PMID:24752754

  3. The role of S-nitrosylation of kainate-type of ionotropic glutamate receptor 2 in epilepsy induced by kainic acid.

    PubMed

    Wang, Linxiao; Liu, Yanyan; Lu, Rulan; Dong, Guoying; Chen, Xia; Yun, Wenwei; Zhou, Xianju

    2018-02-01

    Epilepsy is a chronic brain disease affecting millions of individuals. Kainate receptors, especially kainate-type of ionotropic glutamate receptor 2 (GluK2), play an important role in epileptogenesis. Recent data showed that GluK2 could undergo post-translational modifications in terms of S-nitrosylation (SNO), and affect the signaling pathway of cell death in cerebral ischemia-reperfusion. However, it is unclear whether S-nitrosylation of GluK2 (SNO-GluK2) contributes to cell death induced by epilepsy. Here, we report that kainic acid-induced SNO-GluK2 is mediated by GluK2 itself, regulated by neuronal nitric oxide synthase (nNOS) and the level of cytoplasmic calcium in vivo and in vitro hippocampus neurons. The whole-cell patch clamp recordings showed the influence of SNO-GluK2 on ion channel characterization of GluK2-Kainate receptors. Moreover, immunohistochemistry staining results showed that inhibition of SNO-GluK2 by blocking nNOS or GluK2 or by reducing the level of cytoplasmic calcium-protected hippocampal neurons from kainic acid-induced injury. Finally, immunoprecipitation and western blotting data revealed the involvement of assembly of a GluK2-PSD95-nNOS signaling complex in epilepsy. Taken together, our results showed that the SNO-GluK2 plays an important role in neuronal injury of epileptic rats by forming GluK2-PSD95-nNOS signaling module in a cytoplasmic calcium-dependent way, suggesting a potential therapeutic target site for epilepsy. © 2017 International Society for Neurochemistry.

  4. L-phenylalanyl-L-glutamate-stimulated, chloride-dependent glutamate binding represents glutamate sequestration mediated by an exchange system.

    PubMed

    Kessler, M; Petersen, G; Vu, H M; Baudry, M; Lynch, G

    1987-04-01

    Stimulation of glutamate binding by the dipeptide L-phenylalanyl-L-glutamate (Phe-Glu) was inhibited by the peptidase inhibitor bestatin, suggesting that the stimulation was caused by glutamate liberated from the dipeptide and not by the dipeptide itself. It further suggests that this form of glutamate binding should be reinterpreted as glutamate sequestration and that stimulation of binding both by dipeptides and after preincubation with high concentrations of glutamate is likely to be due to counterflow accumulation. Several other criteria indicate that most of glutamate binding stimulated by chloride represents glutamate sequestration: Binding is reduced when the osmolarity of the incubation medium is increased, when membranes incubated with [3H]glutamate are lysed before filtration, and when membranes are made permeable by transient exposure to saponin. Moreover, dissociation of bound glutamate after a 100-fold dilution of the incubation medium is accelerated about 50 times by the addition of glutamate to the dilution medium. This result would be anomalous if glutamate were bound to a receptor site; it suggests instead that glutamate is transported in and out of membrane vesicles by a transport system that preferentially mediates exchange between internal and external glutamate. Glutamate binding contains a component of glutamate sequestration even when measured in the absence of chloride. Sequestration is adequately abolished only after treating membranes with detergents; even extensive lysis, sonication, and freezing/thawing may be insufficient.

  5. Arctigenin reduces neuronal responses in the somatosensory cortex via the inhibition of non-NMDA glutamate receptors.

    PubMed

    Borbély, Sándor; Jócsák, Gergely; Moldován, Kinga; Sedlák, Éva; Preininger, Éva; Boldizsár, Imre; Tóth, Attila; Atlason, Palmi T; Molnár, Elek; Világi, Ildikó

    2016-07-01

    Lignans are biologically active phenolic compounds related to lignin, produced in different plants. Arctigenin, a dibenzylbutyrolactone-type lignan, has been used as a neuroprotective agent for the treatment of encephalitis. Previous studies of cultured rat cerebral cortical neurones raised the possibility that arctigenin inhibits kainate-induced excitotoxicity. The aims of the present study were: 1) to analyse the effect of arctigenin on normal synaptic activity in ex vivo brain slices, 2) to determine its receptor binding properties and test the effect of arctigenin on AMPA/kainate receptor activation and 3) to establish its effects on neuronal activity in vivo. Arctigenin inhibited glutamatergic transmission and reduced the evoked field responses. The inhibitory effect of arctigenin on the evoked field responses proved to be substantially dose dependent. Our results indicate that arctigenin exerts its effects under physiological conditions and not only on hyper-excited neurons. Furthermore, arctigenin can cross the blood-brain barrier and in the brain it interacts with kainate sensitive ionotropic glutamate receptors. These results indicate that arctigenin is a potentially useful new pharmacological tool for the inhibition of glutamate-evoked responses in the central nervous system in vivo. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Synaptic Neurotransmission Depression in Ventral Tegmental Dopamine Neurons and Cannabinoid-Associated Addictive Learning

    PubMed Central

    Liu, Zhiqiang; Han, Jing; Jia, Lintao; Maillet, Jean-Christian; Bai, Guang; Xu, Lin; Jia, Zhengping; Zheng, Qiaohua; Zhang, Wandong; Monette, Robert; Merali, Zul; Zhu, Zhou; Wang, Wei; Ren, Wei; Zhang, Xia

    2010-01-01

    Drug addiction is an association of compulsive drug use with long-term associative learning/memory. Multiple forms of learning/memory are primarily subserved by activity- or experience-dependent synaptic long-term potentiation (LTP) and long-term depression (LTD). Recent studies suggest LTP expression in locally activated glutamate synapses onto dopamine neurons (local Glu-DA synapses) of the midbrain ventral tegmental area (VTA) following a single or chronic exposure to many drugs of abuse, whereas a single exposure to cannabinoid did not significantly affect synaptic plasticity at these synapses. It is unknown whether chronic exposure of cannabis (marijuana or cannabinoids), the most commonly used illicit drug worldwide, induce LTP or LTD at these synapses. More importantly, whether such alterations in VTA synaptic plasticity causatively contribute to drug addictive behavior has not previously been addressed. Here we show in rats that chronic cannabinoid exposure activates VTA cannabinoid CB1 receptors to induce transient neurotransmission depression at VTA local Glu-DA synapses through activation of NMDA receptors and subsequent endocytosis of AMPA receptor GluR2 subunits. A GluR2-derived peptide blocks cannabinoid-induced VTA synaptic depression and conditioned place preference, i.e., learning to associate drug exposure with environmental cues. These data not only provide the first evidence, to our knowledge, that NMDA receptor-dependent synaptic depression at VTA dopamine circuitry requires GluR2 endocytosis, but also suggest an essential contribution of such synaptic depression to cannabinoid-associated addictive learning, in addition to pointing to novel pharmacological strategies for the treatment of cannabis addiction. PMID:21187978

  7. MDMA Increases Excitability in the Dentate Gyrus: Role of 5HT2A Receptor Induced PGE2 Signaling

    PubMed Central

    Collins, Stuart A.; Huff, Courtney; Chiaia, Nicolas; Gudelsky, Gary A.; Yamamoto, Bryan K.

    2015-01-01

    MDMA is a widely abused psychostimulant which causes release of serotonin in various forebrain regions. Recently, we reported that MDMA increases extracellular glutamate concentrations in the dentate gyrus, via activation of 5HT2A receptors. We examined the role of prostaglandin signaling in mediating the effects of 5HT2A receptor activation on the increases in extracellular glutamate and the subsequent long-term loss of parvalbumin interneurons in the dentate gyrus caused by MDMA. Administration of MDMA into the dentate gyrus of rats increased PGE2 concentrations which was prevented by coadministration of MDL100907, a 5HT2A receptor antagonist. MDMA-induced increases in extracellular glutamate were inhibited by local administration of SC-51089, an inhibitor of the EP1 prostaglandin receptor. Systemic administration of SC-51089 during injections of MDMA prevented the decreases in parvalbumin interneurons observed 10 days later. The loss of parvalbumin immunoreactivity after MDMA exposure coincided with a decrease in paired-pulse inhibition and afterdischarge threshold in the dentate gyrus. These changes were prevented by inhibition of EP1 and 5HT2A receptors during MDMA. Additional experiments revealed an increased susceptibility to kainic acid-induced seizures in MDMA treated rats which could be prevented with SC51089 treatments during MDMA exposure. Overall, these findings suggest that 5HT2A receptors mediate MDMA-induced PGE2 signaling and subsequent increases in glutamate. This signaling mediates parvalbumin cell losses as well as physiologic changes in the dentate gyrus, suggesting that the lack of the inhibition provided by these neurons increases the excitability within the dentate gyrus of MDMA treated rats. PMID:26670377

  8. Measurement of membrane potential and [Ca2+]i in cell ensembles: application to the study of glutamate taste in mice.

    PubMed Central

    Hayashi, Y; Zviman, M M; Brand, J G; Teeter, J H; Restrepo, D

    1996-01-01

    We have studied the spectral properties of the voltage-sensitive dye, 1-(3-sulfonatopropyl)-4-[beta [2-(di-n-octylamino)-6-naphtyl]vinyl] pyridinium betaine (di-8-ANEPPS), and the Ca(2+)-sensitive dye, fura-2, in azolectin liposomes and in isolated taste buds from mouse. We find that the fluorescence excitation spectra of di-8-ANEPPS and fura-2 are largely nonoverlapping, allowing alternate ratio measurements of membrane potential and intracellular calcium ([Ca2+]i). There is a small spillover of di-8-ANEPPS fluorescence at the excitation wavelengths used for fura-2 (340 and 360 nm). However, voltage-induced changes in the fluorescence of di-8-ANEPPS, excited at the fura-2 wavelengths, are small. In addition, di-8-ANEPPS fluorescence is localized to the membrane, whereas fura-2 fluorescence is distributed throughout the cytoplasm. Because of this, the effect of spillover of di-8-ANEPPS fluorescence in the [Ca2+]i estimate is < 1%, under the appropriate conditions. We have applied this method to study of the responses of multiple taste cells within isolated taste buds. We show that membrane potential and [Ca2+]i can be measured alternately in isolated taste buds from mouse. Stimulation with glutamate and glutamate analogs indicates that taste cells express both metabotropic and ionotropic receptors. The data suggest that the receptors responding to 2-amino-4-phosphonobutyrate (L-AP4), presumably metabotropic L-glutamate receptors, do not mediate excitatory glutamate taste responses. Images FIGURE 5 PMID:8842242

  9. Dopamine D2 Antagonist-Induced Striatal Nur77 Expression Requires Activation of mGlu5 Receptors by Cortical Afferents

    PubMed Central

    Maheux, Jérôme; St-Hilaire, Michel; Voyer, David; Tirotta, Emanuele; Borrelli, Emiliana; Rouillard, Claude; Rompré, Pierre-Paul; Lévesque, Daniel

    2012-01-01

    Dopamine D2 receptor antagonists modulate gene transcription in the striatum. However, the molecular mechanism underlying this effect remains elusive. Here we used the expression of Nur77, a transcription factor of the orphan nuclear receptor family, as readout to explore the role of dopamine, glutamate, and adenosine receptors in the effect of a dopamine D2 antagonist in the striatum. First, we investigated D2 antagonist-induced Nur77 mRNA in D2L receptor knockout mice. Surprisingly, deletion of the D2L receptor isoform did not reduce eticlopride-induced upregulation of Nur77 mRNA levels in the striatum. Next, we tested if an ibotenic acid-induced cortical lesion could block the effect of eticlopride on Nur77 expression. Cortical lesions strongly reduced eticlopride-induced striatal upregulation of Nur77 mRNA. Then, we investigated if glutamatergic neurotransmission could modulate eticlopride-induced Nur77 expression. A combination of a metabotropic glutamate type 5 (mGlu5) and adenosine A2A receptor antagonists abolished eticlopride-induced upregulation of Nur77 mRNA levels in the striatum. Direct modulation of Nur77 expression by striatal glutamate and adenosine receptors was confirmed using corticostriatal organotypic cultures. Taken together, these results indicate that blockade of postsynaptic D2 receptors is not sufficient to trigger striatal transcriptional activity and that interaction with corticostriatal presynaptic D2 receptors and subsequent activation of postsynaptic glutamate and adenosine receptors in the striatum is required. Thus, these results uncover an unappreciated role of presynaptic D2 heteroreceptors and support a prominent role of glutamate in the effect of D2 antagonists. PMID:22912617

  10. Metabotropic glutamate receptors mGluR4 and mGluR8 regulate transmission in the lateral olfactory tract-piriform cortex synapse

    PubMed Central

    Jones, Paulianda J.; Xiang, Zixiu; Conn, P. Jeffrey

    2008-01-01

    The piriform cortex (PC) is the primary terminal zone of projections from the olfactory bulb, termed the lateral olfactory tract (LOT). The PC plays a critical role in processing of olfactory stimuli and is also a highly seizure prone area thought to be involved in some forms of temporal lobe epilepsy. Pharmacological and immunohistochemical studies provide evidence for the localization of various metabotropic glutamate receptors (GluRs) in the PC. We employed whole cell patch clamp recordings from PC pyramidal cells to determine the roles of group III mGluRs in modulating synaptic transmission at the LOT–PC synapse. The group III mGluR agonist, L-AP4, induced a concentration-dependent inhibition of synaptic transmission at the LOT-PC synapse at concentrations that activate mGluR4 and mGluR8, but not mGluR7 or other mGluR subtypes (EC50 = 473 nM). In addition, the selective mGluR8 agonist, DCPG (300 nM), also suppressed synaptic transmission at the LOT synapse. Furthermore, the inhibitory actions of L-AP4 and Z-cyclopentyl-AP4, a selective mGluR4 agonist, were potentiated by the mGluR4 positive allosteric modulator, PHCCC (30 µM). The high potency of L-AP4, combined with the observed effects of DCPG and PHCCC, suggests that both mGluR4 and mGluR8 play a role in the L-AP4-induced inhibition of synaptic transmission at the LOT-PC synapse. PMID:18625254

  11. The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region

    PubMed Central

    Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

    2017-01-01

    Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine. PMID:28387240

  12. Ionotropic glutamate receptor mRNA editing in the prefrontal cortex: no alterations in schizophrenia or bipolar disorder.

    PubMed

    Lyddon, Rebecca; Navarrett, Scott; Dracheva, Stella

    2012-07-01

    Dysfunction of glutamate neurotransmission has been implicated in the pathology of schizophrenia and bipolar disorder, and one mechanism by which glutamate signalling can be altered is through RNA editing of ionotropic glutamate receptors (iGluRs). The objectives of the present study were to evaluate the editing status of iGluRs in the human prefrontal cortex, determine whether iGluR editing is associated with psychiatric disease or suicide and evaluate a potential association between editing and alternative splicing in the α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA) iGluR subunits' pre-mRNA. We studied specimens derived from patients with antemortem diagnoses of bipolar disorder (n = 31) or schizophrenia (n = 34) who died by suicide or other causes, and from psychiatrically healthy controls (n = 34) who died from causes other than suicide. The RNA editing at all 8 editing sites within AMPA (GluA2-4 subunits) and kainate (GluK1-2 subunits) iGluRs was analyzed using a novel real-time quantitative polymerase chain reaction assay. No differences in editing were detected among schizophrenia, bipolar or control groups or between suicide completers and patients who died from causes other than suicide. The editing efficiency was significantly higher in the flop than in the flip splicoforms of GluA3-4 AMPA subunits (all p < 0.001). The study is limited by the near absence of specimens from medicationnaive psychiatric patients and considerable variation in medication regimens among individuals, both of which introduce considerable uncertainty into the analysis of potential medication effects. We found that iGluR RNA editing status was not associated with bipolar disorder, schizophrenia or suicide. Differences in editing between flip and flop splicoforms suggest that glutamate sensitivity of receptors containing GluA3 and/or GluA4 flop subunits is moderated as a result of increased editing.

  13. Direct interaction enables cross-talk between ionotropic and group I metabotropic glutamate receptors.

    PubMed

    Perroy, Julie; Raynaud, Fabrice; Homburger, Vincent; Rousset, Marie-Claude; Telley, Ludovic; Bockaert, Joël; Fagni, Laurent

    2008-03-14

    Functional interplay between ionotropic and metabotropic receptors frequently involves complex intracellular signaling cascades. The group I metabotropic glutamate receptor mGlu5a co-clusters with the ionotropic N-methyl-d-aspartate (NMDA) receptor in hippocampal neurons. In this study, we report that a more direct cross-talk can exist between these types of receptors. Using bioluminescence resonance energy transfer in living HEK293 cells, we demonstrate that mGlu5a and NMDA receptor clustering reflects the existence of direct physical interactions. Consequently, the mGlu5a receptor decreased NMDA receptor current, and reciprocally, the NMDA receptor strongly reduced the ability of the mGlu5a receptor to release intracellular calcium. We show that deletion of the C terminus of the mGlu5a receptor abolished both its interaction with the NMDA receptor and reciprocal inhibition of the receptors. This direct functional interaction implies a higher degree of target-effector specificity, timing, and subcellular localization of signaling than could ever be predicted with complex signaling pathways.

  14. Α-amino-β-fluorocyclopropanecarboxylic acids as a new tool for drug development: synthesis of glutamic acid analogs and agonist activity towards metabotropic glutamate receptor 4.

    PubMed

    Lemonnier, Gérald; Lion, Cédric; Quirion, Jean-Charles; Pin, Jean-Philippe; Goudet, Cyril; Jubault, Philippe

    2012-08-01

    Herein we describe the diastereoselective synthesis of glutamic acid analogs and the evaluation of their agonist activity towards metabotropic glutamate receptor subtype 4 (mGluR4). These analogs are based on a monofluorinated cyclopropane core substituted with an α-aminoacid function. The potential of this new building block as a tool for the development of a novel class of drugs is demonstrated with racemic analog 11a that displayed the best agonist activity with an EC50 of 340 nM. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Neonatal (+)-methamphetamine exposure in rats alters adult locomotor responses to dopamine D1 and D2 agonists and to a glutamate NMDA receptor antagonist, but not to serotonin agonists

    PubMed Central

    Graham, Devon L.; Amos-Kroohs, Robyn M.; Braun, Amanda A.; Grace, Curtis E.; Schaefer, Tori L.; Skelton, Matthew R.; Williams, Michael T.; Vorhees, Charles V.

    2015-01-01

    Neonatal exposure to (+)-methamphetamine (Meth) results in long-term behavioural abnormalities but its developmental mechanisms are unknown. In a series of experiments, rats were treated from post-natal days (PD) 11–20 (stage that approximates human development from the second to third trimester) with Meth or saline and assessed using locomotor activity as the readout following pharmacological challenge doses with dopamine, serotonin and glutamate agonists or antagonists during adulthood. Exposure to Meth early in life resulted in an exaggerated adult locomotor hyperactivity response to the dopamine D1 agonist SKF-82958 at multiple doses, a high dose only under-response activating effect of the D2 agonist quinpirole, and an exaggerated under-response to the activating effect of the N-methyl-D-aspartic acid (NMDA) receptor antagonist, MK-801. No change in locomotor response was seen following challenge with the 5-HT releaser p-chloroamphetamine or the 5-HT2/3 receptor agonist, quipazine. These are the first data to show that PD 11-20 Meth exposure induces long-lasting alterations to dopamine D1, D2 and glutamate NMDA receptor function and may suggest how developmental Meth exposure leads to many of its long-term adverse effects. PMID:22391043

  16. Neonatal seizures alter NMDA glutamate receptor GluN2A and 3A subunit expression and function in hippocampal CA1 neurons

    PubMed Central

    Zhou, Chengwen; Sun, Hongyu; Klein, Peter M.; Jensen, Frances E.

    2015-01-01

    Neonatal seizures are commonly caused by hypoxic and/or ischemic injury during birth and can lead to long-term epilepsy and cognitive deficits. In a rodent hypoxic seizure (HS) model, we have previously demonstrated a critical role for seizure-induced enhancement of the AMPA subtype of glutamate receptor (GluA) in epileptogenesis and cognitive consequences, in part due to GluA maturational upregulation of expression. Similarly, as the expression and function of the N-Methyl-D-aspartate (NMDA) subtype of glutamate receptor (GluN) is also developmentally controlled, we examined how early life seizures during the critical period of synaptogenesis could modify GluN development and function. In a postnatal day (P)10 rat model of neonatal seizures, we found that seizures could alter GluN2/3 subunit composition of GluNs and physiological function of synaptic GluNs. In hippocampal slices removed from rats within 48–96 h following seizures, the amplitudes of synaptic GluN-mediated evoked excitatory postsynaptic currents (eEPSCs) were elevated in CA1 pyramidal neurons. Moreover, GluN eEPSCs showed a decreased sensitivity to GluN2B selective antagonists and decreased Mg2+ sensitivity at negative holding potentials, indicating a higher proportion of GluN2A and GluN3A subunit function, respectively. These physiological findings were accompanied by a concurrent increase in GluN2A phosphorylation and GluN3A protein. These results suggest that altered GluN function and expression could potentially contribute to future epileptogenesis following neonatal seizures, and may represent potential therapeutic targets for the blockade of future epileptogenesis in the developing brain. PMID:26441533

  17. Interactions between estrogen receptors and metabotropic glutamate receptors and their impact on drug addiction in females.

    PubMed

    Tonn Eisinger, Katherine R; Gross, Kellie S; Head, Brian P; Mermelstein, Paul G

    2018-03-10

    Estrogen receptors α and β (ERα and ERβ) have a unique relationship with metabotropic glutamate receptors (mGluRs) in the female rodent brain such that estradiol is able to recruit intracellular G-protein signaling cascades to influence neuronal physiology, structure, and ultimately behavior. While this association between ERs and mGluRs exists in many cell types and brain regions, its effects are perhaps most striking in the nucleus accumbens (NAc). This review will discuss the original characterization of ER/mGluR signaling and how estradiol activity in the NAc confers increased sensitivity to drugs of abuse in females through this mechanism. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. The nicotinic receptor blocker hexamethonium alters neuronal responses to glutamate in the medial septal area of the brain of the ground squirrel in vitro.

    PubMed

    Karavaev, E N; Popova, I Yu; Kichigina, V F

    2008-03-01

    Despite extensive interest in studies of the medial septal area, the nature of the interactions of its various neurochemical systems remains largely unclear. The aim of the present work was to clarify the role of nicotinic receptors in mediating the interaction of the glutamatergic and cholinergic systems in this structure. Extracellular recording of neuron activity in living slices of ground squirrel brain was used to study the influences of L-glutamate (1 microM) during application of the nicotinic receptor blocker hexamethonium (1 mM). The responses of septal neurons to glutamate depended on the type of their initial activity and the presence of pacemaker properties. This study is the first to show that glutamate increases the frequency of volleys in rhythmic neurons in the septum. Hexamethonium induced changes in neuron activity similar to the influences of glutamate. After prior application of hexamethonium, the responses of neurons to glutamate changed: activatory responses were masked and inhibitory responses were enhanced. Cholinergic modulation of the responses of septal neurons to glutamate were shown to occur, as did modulation of the strength of the oscillatory properties of the septal network by nicotinic receptors.

  19. Functional role of striatal A2A, D2, and mGlu5 receptor interactions in regulating striatopallidal GABA neuronal transmission.

    PubMed

    Beggiato, Sarah; Tomasini, Maria Cristina; Borelli, Andrea Celeste; Borroto-Escuela, Dasiel Oscar; Fuxe, Kjell; Antonelli, Tiziana; Tanganelli, Sergio; Ferraro, Luca

    2016-07-01

    In this study, the functional role of individual striatal receptors for adenosine (A2AR), dopamine (D2R), and the metabotropic glutamate receptor mGlu5R in regulating rat basal ganglia activity was characterized in vivo using dual-probe microdialysis in freely moving rats. In particular, intrastriatal perfusion with the D2R agonist quinpirole (10 μM, 60 min) decreased ipsilateral pallidal GABA and glutamate levels, whereas intrastriatal CGS21680 (A2AR agonist; 1 μM, 60 min) was ineffective on either pallidal GABA and glutamate levels or the quinpirole-induced effects. Intrastriatal perfusion with the mGlu5R agonist (RS)-2-chloro-5-hydroxyphenylglycine (600 μM, 60 min), by itself ineffective on pallidal GABA and glutamate levels, partially counteracted the effects of quinpirole. When combined with CGS21680 (1 μM, 60 min), (RS)-2-chloro-5-hydroxyphenylglycine (CHPG; 600 μM, 60 min) fully counteracted the quinpirole (10 μM, 60 min)-induced reduction in ipsilateral pallidal GABA and glutamate levels. These effects were fully counteracted by local perfusion with the mGlu5R antagonist MPEP (300 μM) or the A2AR antagonist ZM 241385 (100 nM). These results suggest that A2ARs and mGlu5Rs interact synergistically in modulating the D2R-mediated control of striatopallidal GABA neurons. Using dual-probe microdialysis, we characterized the functional role of striatal adenosine A2A receptor (A2AR), dopamine D2 receptor (D2R), and metabotropic glutamate receptor 5 (mGluR5) interactions in regulating rat basal ganglia activity. The results suggest the possible usefulness of using an A2AR antagonist and mGluR5 antagonist combination in the treatment of Parkinson's disease to increase the inhibitory D2 signaling on striatopallidal GABA neurons. © 2016 International Society for Neurochemistry.

  20. Structure of metabotropic glutamate receptor C-terminal domains in contact with interacting proteins.

    PubMed

    Enz, Ralf

    2012-01-01

    Metabotropic glutamate receptors (mGluRs) regulate intracellular signal pathways that control several physiological tasks, including neuronal excitability, learning, and memory. This is achieved by the formation of synaptic signal complexes, in which mGluRs assemble with functionally related proteins such as enzymes, scaffolds, and cytoskeletal anchor proteins. Thus, mGluR associated proteins actively participate in the regulation of glutamatergic neurotransmission. Importantly, dysfunction of mGluRs and interacting proteins may lead to impaired signal transduction and finally result in neurological disorders, e.g., night blindness, addiction, epilepsy, schizophrenia, autism spectrum disorders and Parkinson's disease. In contrast to solved crystal structures of extracellular N-terminal domains of some mGluR types, only a few studies analyzed the conformation of intracellular receptor domains. Intracellular C-termini of most mGluR types are subject to alternative splicing and can be further modified by phosphorylation and SUMOylation. In this way, diverse interaction sites for intracellular proteins that bind to and regulate the glutamate receptors are generated. Indeed, most of the known mGluR binding partners interact with the receptors' C-terminal domains. Within the last years, different laboratories analyzed the structure of these domains and described the geometry of the contact surface between mGluR C-termini and interacting proteins. Here, I will review recent progress in the structure characterization of mGluR C-termini and provide an up-to-date summary of the geometry of these domains in contact with binding partners.

  1. Behavioral analysis of the consequences of chronic blockade of NMDA-type glutamate receptors in the early postnatal period in rats.

    PubMed

    Latysheva, N V; Raevskii, K S

    2003-02-01

    Considering data on the possible glutamatergic nature of the pathogenesis of schizophrenia, we attempted to model cognitive derangements in animals by chronic blockade of NMDA glutamate receptors. Wistar rats received daily s.c. injections of the non-competitive NMDA glutamate receptor antagonist MK-801 (0.05 mg/kg) from days 7 to day 49 of postnatal life. One day after the antagonist injections given on days 27 and 28 of life, animals of the experimental group showed decreased levels of spontaneous movement and orientational-investigative activity as compared with controls, where there was no change in the elevated locomotor reaction produced in response to the direct action of MK-801. These animals showed decreases in the level of anxiety (on day 40 of life) and derangement in spatial learning with food reinforcement (days 50-54 of life). It is suggested that early neonatal blockade of NMDA glutamate receptors leads to the development in animals of disturbances to situational perception and assessment of incoming sensory information.

  2. Development of a method to evaluate glutamate receptor function in rat barrel cortex slices.

    PubMed

    Lehohla, M; Russell, V; Kellaway, L; Govender, A

    2000-12-01

    The rat is a nocturnal animal and uses its vibrissae extensively to navigate its environment. The vibrissae are linked to a highly organized part of the sensory cortex, called the barrel cortex which contains spiny neurons that receive whisker specific thalamic input and distribute their output mainly within the cortical column. The aim of the present study was to develop a method to evaluate glutamate receptor function in the rat barrel cortex. Long Evans rats (90-160 g) were killed by cervical dislocation and decapitated. The brain was rapidly removed, cooled in a continuously oxygenated, ice-cold Hepes buffer (pH 7.4) and sliced using a vibratome to produce 0.35 mm slices. The barrel cortex was dissected from slices corresponding to 8.6 to 4.8 mm anterior to the interaural line and divided into rostral, middle and caudal regions. Depolarization-induced uptake of 45Ca2+ was achieved by incubating test slices in a high K+ (62.5 mM) buffer for 2 minutes at 35 degrees C. Potassium-stimulated uptake of 45Ca2+ into the rostral region was significantly lower than into middle and caudal regions of the barrel cortex. Glutamate had no effect. NMDA significantly increased uptake of 45Ca2+ into all regions of the barrel cortex. The technique is useful in determining NMDA receptor function and will be applied to study differences between spontaneously hypertensive rats (SHR) that are used as a model for attention deficit disorder and their normotensive control rats.

  3. MDMA-induced loss of parvalbumin interneurons within the dentate gyrus is mediated by 5HT2A and NMDA receptors

    PubMed Central

    Collins, Stuart A.; Gudelsky, Gary A.; Yamamoto, Bryan K.

    2015-01-01

    MDMA is a widely abused psychostimulant which causes a rapid and robust release of the monoaminergic neurotransmitters dopamine and serotonin. Recently, it was shown that MDMA increases extracellular glutamate concentrations in the dorsal hippocampus, which is dependent on serotonin release and 5HT2A/2C receptor activation. The increased extracellular glutamate concentration coincides with a loss of parvalbumin-immunoreactive (PV-IR) interneurons of the dentate gyrus region. Given the known susceptibility of PV interneurons to excitotoxicity, we examined whether MDMA-induced increases in extracellular glutamate in the dentate gyrus are necessary for the loss of PV cells in rats. Extracellular glutamate concentrations increased in the dentate gyrus during systemic and local administration of MDMA. Administration of the NMDA receptor antagonist, MK-801, during systemic injections of MDMA, prevented the loss of PV-IR interneurons seen 10 days after MDMA exposure. Local administration of MDL100907, a selective 5HT2A receptor antagonist, prevented the increases in glutamate caused by reverse dialysis of MDMA directly into the dentate gyrus and prevented the reduction of PV-IR. These findings provide evidence that MDMA causes decreases in PV within the dentate gyrus through a 5HT2A receptor-mediated increase in glutamate and subsequent NMDA receptor activation. PMID:25936514

  4. High affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling

    PubMed Central

    Fernandes, Herman B.; Catches, Justin S.; Petralia, Ronald S.; Copits, Bryan A.; Xu, Jian; Russell, Theron A.; Swanson, Geoffrey T.; Contractor, Anis

    2009-01-01

    Summary Kainate receptors are atypical members of the glutamate receptor family which are able to signal through both ionotropic and metabotropic pathways. Of the five individual kainate receptor subunits the high-affinity subunits, GluK4 (KA1) and GluK5 (KA2), are unique in that they do not form functional homomeric receptors in recombinant expression systems, but combine with the primary subunits GluK1-3 (GluR5-7) to form heteromeric assemblies. Here we generated a GluK4 mutant mouse by disrupting the Grik4 gene locus. We found that loss of the GluK4 subunit leads to a significant reduction in synaptic kainate receptor currents. Moreover, ablation of both high-affinity subunits in GluK4/GluK5 double knockout mice leads to a complete loss of pre- and postsynaptic ionotropic function of synaptic kainate receptors. The principal subunits remain at the synaptic plasma membrane, but are distributed away from postsynaptic densities and presynaptic active zones. There is also an alteration in the properties of the remaining kainate receptors, as kainic acid application fails to elicit responses in GluK4/GluK5 knockout neurons. Despite the lack of detectable ionotropic synaptic receptors, the kainate receptor-mediated inhibition of the slow afterhyperpolarization current (IsAHP), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown critical role for the high-affinity kainate receptor subunits as obligatory components of ionotropic kainate receptor function, and further, demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels. PMID:19778510

  5. [Glutamate receptors genes polymorphism and the risk of paranoid schizophrenia in Russians and tatars from the Republic of Bashkortostan].

    PubMed

    Gareeva, A E; Khusnutdinova, E K

    2014-01-01

    Schizophrenia is a severe mental disorder that affects about 1% of the world population, leading to disability and social exclusion. Glutamatergic neurotransmission is a violation of one of the main hypotheses put forward to explain the neurobiological mechanisms of schizophrenia. Post mortem studies have found changes in the degree of affinity glutamate receptors, their transcription, and altered expression of their subunits in the prefrontal cortex, hippocampus, and thalamus in patients with schizophrenia. As a result of genetic studies of gene family encoding ionotropic AMPA and kainate glutamate receptors in schizophrenia, ambiguous results were received. The association of polymorphic variants of genes GRIA2 and GRIK2 with paranoid schizophrenia and response to therapy with haloperidol in Russian and Tatar of the Republic of Bashkortostan was conducted in the present study. DNA samples of 257 patients with paranoid schizophrenia and of 349 healthy controls of Russian and Tatar ethnic group living in the Republic of Bashkortostan were involved into the present study. In the result of the present study: (1) high risk genetic markers of paranoid schizophrenia (PSZ) were obtained: in Russians-GR4IA2*CCC (OR = 9.60) and in Tatars-GRIK2*ATG (OR = 3.5), GRIK2*TGG (OR = 3.12) (2) The following low risk genetic markers of PSZ were revealed: in Tatars-GRIA2*T/T (rs43025506) of GRIA2 gene (OR = 0.34); in Russians.- GRIA2*CCT (OR = 0.481). (3) Genetic markers of low haloperido! treatment efficacy in respect of negative and positive symptoms GRIK2*T/T (rs2227281) of GRIK2 gene and GRAL42*C/C in Russians, GRIK2*A/A (rs995640) of GRIK2 gene in Tatars. (4) Genetic markers of low haloperidol treatment efficacy in respect of positive symptoms GRL42*C/C in Russians. The results of the present study support the hypothesis of the involvement of glutamate receptor genes in schizophrenia pathway. Considerable inter-ethnic'diversity of genetic risk factors for this disease was

  6. Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor

    PubMed Central

    Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.

    2011-01-01

    The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591

  7. Attenuation of excitatory amino acid toxicity by metabotropic glutamate receptor agonists and aniracetam in primary cultures of cerebellar granule cells.

    PubMed

    Pizzi, M; Fallacara, C; Arrighi, V; Memo, M; Spano, P F

    1993-08-01

    Activation of glutamate ionotropic receptors represents the primary event in the neurotoxicity process triggered by excitatory amino acids. We demonstrate here that the concentration-dependent stimulation of metabotropic glutamate receptor (mGluR) by the selective agonist trans-1-aminocyclopentane-1,3-dicarboxylate or by quisqualate counteracts both glutamate- and kainate-induced neurotoxicity in primary cultures of rat cerebellar granule cells. The mGluR-evoked responses are potentiated by aniracetam, which per se also elicits neuroprotection. Aniracetam concentration-dependently counteracted glutamate-, kainate-, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-induced cell death and greatly facilitated neuroprotective response achieved by different concentrations of both quisqualate and trans-1-aminocyclopentane-1,3-dicarboxylate. In addition, aniracetam potentiated the mGluR-coupled stimulation of phospholipase C, as revealed by the measurement of 3H-inositol phosphate formation. Thus, mGluRs could be a suitable target for novel pharmacological strategies pointing to the treatment of neurodegenerative diseases.

  8. Ectopic vesicular glutamate release at the optic nerve head and axon loss in mouse experimental glaucoma.

    PubMed

    Fu, Christine T; Sretavan, David W

    2012-11-07

    Although clinical and experimental observations indicate that the optic nerve head (ONH) is a major site of axon degeneration in glaucoma, the mechanisms by which local retinal ganglion cell (RGC) axons are injured and damage spreads among axons remain poorly defined. Using a laser-induced ocular hypertension (LIOH) mouse model of glaucoma, we found that within 48 h of intraocular pressure elevation, RGC axon segments within the ONH exhibited ectopic accumulation and colocalization of multiple components of the glutamatergic presynaptic machinery including the vesicular glutamate transporter VGLUT2, several synaptic vesicle marker proteins, glutamate, the soluble N-ethylmaleimide-sensitive factor attachment protein receptor complex and active zone cytomatrix components, as well as ultrastructurally identified, synaptophysin-containing vesicles. Ectopic vesicle exocytosis and glutamate release were detected in acute preparations of the LIOH ONH. Immunolocalization and analysis using the ionotropic receptor channel-permeant cation agmatine indicated that ONH axon segments and glia expressed glutamate receptors, and these receptors were more active after LIOH compared with controls. Pharmacological antagonism of glutamate receptors and neuronal activity resulted in increased RGC axon sparing in vivo. Furthermore, in vivo RGC-specific genetic disruption of the vesicular glutamate transporter VGLUT2 or the obligatory NMDA receptor subunit NR1 promoted axon survival in experimental glaucoma. As the inhibition of ectopic glutamate vesicular release or glutamate receptivity can independently modify the severity of RGC axon loss, synaptic release mechanisms may provide useful therapeutic entry points into glaucomatous axon degeneration.

  9. Activation of Metabotropic Glutamate Receptor Type 2/3 Supports the Involvement of the Hippocampal Mossy Fiber Pathway on Contextual Fear Memory Consolidation

    ERIC Educational Resources Information Center

    Daumas, Stephanie; Ceccom, Johnatan; Halley, Helene; Frances, Bernard; Lassalle, Jean-Michel

    2009-01-01

    Elucidating the functional properties of the dentate gyrus (DG), CA3, and CA1 areas is critical for understanding the role of the dorsal hippocampus in contextual fear memory processing. In order to specifically disrupt various hippocampal inputs, we used region-specific infusions of DCG-IV, the metabotropic glutamate receptor agonist, which…

  10. Identification of novel modulators for ionotropic glutamate receptor, iGluA2 by in-silico screening

    PubMed Central

    2013-01-01

    Background Ionotropic glutamate receptors (iGluAs, IUPHAR nomenclature) are the major excitatory amino acid neurotransmitter receptors in the mammalian central nervous system (CNS). iGluAs are potential therapeutic drug targets for various neurological disorders including ischemia, epilepsy, Parkinson’s and Alzheimer’s diseases. The known iGluA modulators, cyclothiazide (CTZ), IDRA-21, and other benzothiadiazide derivatives (ALTZ, HCTZ, and CLTZ) bind to the ligand-binding domain of flip-form of iGluA2 at the dimer interface, thereby increasing steady-state activation by reducing desensitization. Methods To discover new modulator compounds, we performed virtual screening for the ligand binding domain (LBD) of iGluA2 against NCI Diversity Set III library containing 1597 compounds, and subsequently performed binding-energy analysis for selected compounds. The crystal structure of rat iGluA2 S1S2J (PDB ID: 3IJO) was used for docking studies. Results and conclusion From this study, we obtained four compounds: (1) 10-2(methoxyethyl)-3-phenylbenzo[g]pteridine-2,4-dione, (2) 2-benzo[e]benzotriazol-2-yl-aniline, (3) 9-nitro-6H-indolo-(2,3,-b)quinoxaline, and (4) 1-hydroxy-n-(3-nitrophenyl)-2-napthamide. The binding mode of these four compounds is very similar to that of abovementioned established modulators: two molecules of each compound independently bind to the protein symmetrically at the dimer interface; occupy the subsites B, C, B’ and C’; potentially interact with Ser518 and Ser775. Binding energy analysis shows that all the four hits are comparable to the drug molecule, CTZ, and hence, we propose that the discovered hits may be potential molecules to develop new chemical libraries for modulating the flip form of iGluA2 function. PMID:23855825

  11. Identification of novel modulators for ionotropic glutamate receptor, iGluA2 by in-silico screening.

    PubMed

    Padmanabhan, Balasundaram

    2013-07-15

    Ionotropic glutamate receptors (iGluAs, IUPHAR nomenclature) are the major excitatory amino acid neurotransmitter receptors in the mammalian central nervous system (CNS). iGluAs are potential therapeutic drug targets for various neurological disorders including ischemia, epilepsy, Parkinson's and Alzheimer's diseases. The known iGluA modulators, cyclothiazide (CTZ), IDRA-21, and other benzothiadiazide derivatives (ALTZ, HCTZ, and CLTZ) bind to the ligand-binding domain of flip-form of iGluA2 at the dimer interface, thereby increasing steady-state activation by reducing desensitization. To discover new modulator compounds, we performed virtual screening for the ligand binding domain (LBD) of iGluA2 against NCI Diversity Set III library containing 1597 compounds, and subsequently performed binding-energy analysis for selected compounds. The crystal structure of rat iGluA2 S1S2J (PDB ID: 3IJO) was used for docking studies. From this study, we obtained four compounds: (1) 10-2(methoxyethyl)-3-phenylbenzo[g]pteridine-2,4-dione, (2) 2-benzo[e]benzotriazol-2-yl-aniline, (3) 9-nitro-6H-indolo-(2,3,-b)quinoxaline, and (4) 1-hydroxy-n-(3-nitrophenyl)-2-napthamide. The binding mode of these four compounds is very similar to that of abovementioned established modulators: two molecules of each compound independently bind to the protein symmetrically at the dimer interface; occupy the subsites B, C, B' and C'; potentially interact with Ser518 and Ser775. Binding energy analysis shows that all the four hits are comparable to the drug molecule, CTZ, and hence, we propose that the discovered hits may be potential molecules to develop new chemical libraries for modulating the flip form of iGluA2 function.

  12. Undifferentiated embryonic stem cells express ionotropic glutamate receptor mRNAs

    PubMed Central

    Pachernegg, Svenja; Joshi, Illah; Muth-Köhne, Elke; Pahl, Steffen; Münster, Yvonne; Terhag, Jan; Karus, Michael; Werner, Markus; Ma-Högemeier, Zhan-Lu; Körber, Christoph; Grunwald, Thomas; Faissner, Andreas; Wiese, Stefan; Hollmann, Michael

    2013-01-01

    Ionotropic glutamate receptors (iGluRs) do not only mediate the majority of excitatory neurotransmission in the vertebrate CNS, but also modulate pre- and postnatal neurogenesis. Most of the studies on the developmental role of iGluRs are performed on neural progenitors and neural stem cells (NSCs). We took a step back in our study by examining the role of iGluRs in the earliest possible cell type, embryonic stem cells (ESCs), by looking at the mRNA expression of the major iGluR subfamilies in undifferentiated mouse ESCs. For that, we used two distinct murine ES cell lines, 46C ESCs and J1 ESCs. Regarding 46C ESCs, we found transcripts of kainate receptors (KARs) (GluK2 to GluK5), AMPA receptors (AMPARs) (GluA1, GluA3, and GluA4), and NMDA receptors (NMDARs) (GluN1, and GluN2A to GluN2D). Analysis of 46C-derived cells of later developmental stages, namely neuroepithelial precursor cells (NEPs) and NSCs, revealed that the mRNA expression of KARs is significantly upregulated in NEPs and, subsequently, downregulated in NSCs. However, we could not detect any protein expression of any of the KAR subunits present on the mRNA level either in ESCs, NEPs, or NSCs. Regarding AMPARs and NMDARs, GluN2A is weakly expressed at the protein level only in NSCs. Matching our findings for iGluRs, all three cell types were found to weakly express pre- and postsynaptic markers of glutamatergic synapses only at the mRNA level. Finally, we performed patch-clamp recordings of 46C ESCs and could not detect any current upon iGluR agonist application. Similar to 46C ESCs, J1 ESCs express KARs (GluK2 to GluK5), AMPARs (GluA3), and NMDARs (GluN1, and GluN2A to GluN2D) at the mRNA level, but these transcripts are not translated into receptor proteins either. Thus, we conclude that ESCs do not contain functional iGluRs, although they do express an almost complete set of iGluR subunit mRNAs. PMID:24348335

  13. Late calcium EDTA rescues hippocampal CA1 neurons from global ischemia-induced death.

    PubMed

    Calderone, Agata; Jover, Teresa; Mashiko, Toshihiro; Noh, Kyung-min; Tanaka, Hidenobu; Bennett, Michael V L; Zukin, R Suzanne

    2004-11-03

    Transient global ischemia induces a delayed rise in intracellular Zn2+, which may be mediated via glutamate receptor 2 (GluR2)-lacking AMPA receptors (AMPARs), and selective, delayed death of hippocampal CA1 neurons. The molecular mechanisms underlying Zn2+ toxicity in vivo are not well delineated. Here we show the striking finding that intraventricular injection of the high-affinity Zn2+ chelator calcium EDTA (CaEDTA) at 30 min before ischemia (early CaEDTA) or at 48-60 hr (late CaEDTA), but not 3-6 hr, after ischemia, afforded robust protection of CA1 neurons in approximately 50% (late CaEDTA) to 75% (early CaEDTA) of animals. We also show that Zn2+ acts via temporally distinct mechanisms to promote neuronal death. Early CaEDTA attenuated ischemia-induced GluR2 mRNA and protein downregulation (and, by inference, formation of Zn2+-permeable AMPARs), the delayed rise in Zn2+, and neuronal death. These findings suggest that Zn2+ acts at step(s) upstream from GluR2 gene downregulation and implicate Zn2+ in transcriptional regulation and/or GluR2 mRNA stability. Early CaEDTA also blocked mitochondrial release of cytochrome c and Smac/DIABLO (second mitochondria-derived activator of caspases/direct inhibitor of apoptosis protein-binding protein with low pI), caspase-3 activity (but not procaspase-3 cleavage), p75NTR induction, and DNA fragmentation. These findings indicate that CaEDTA preserves the functional integrity of the mitochondrial outer membrane and arrests the caspase death cascade. Late injection of CaEDTA at a time when GluR2 is downregulated and caspase is activated inhibited the delayed rise in Zn2+, p75NTR induction, DNA fragmentation, and cell death. The finding of neuroprotection by late CaEDTA administration has striking implications for intervention in the delayed neuronal death associated with global ischemia.

  14. P2Y1 receptor antagonists mitigate oxygen and glucose deprivation‑induced astrocyte injury.

    PubMed

    Guo, Hui; Liu, Zhong-Qiang; Zhou, Hui; Wang, Zhi-Ling; Tao, Yu-Hong; Tong, Yu

    2018-01-01

    The aim of the present study was to elucidate the effects of blocking the calcium signaling pathway of astrocytes (ASs) on oxygen and glucose deprivation (OGD)‑induced AS injury. The association between the changes in the concentrations of AS‑derived transmitter ATP and glutamic acid, and the changes in calcium signaling under the challenge of OGD were investigated. The cortical ASs of Sprague Dawley rats were cultured to establish the OGD models of ASs. The extracellular concentrations of ATP and glutamic acid in the normal group and the OGD group were detected, and the intracellular concentration of calcium ions (Ca2+) was detected. The effects of 2'‑deoxy‑N6‑methyl adenosine 3', 5'‑diphosphate diammonium salt (MRS2179), a P2Y1 receptor antagonist, on the release of calcium and glutamic acid of ASs under the condition of OGD were observed. The OGD challenge induced the release of glutamic acid and ATP by ASs in a time‑dependent manner, whereas elevation in the concentration of glutamic acid lagged behind that of the ATP and Ca2+. The concentration of Ca2+ inside ASs peaked 16 h after OGD, following which the concentration of Ca2+ was decreased. The effects of elevated release of glutamic acid by ASs when challenged by OGD may be blocked by MRS2179, a P2Y1 receptor antagonist. Furthermore, MRS2179 may significantly mitigate OGD‑induced AS injury and increase cell survival. The ASs of rats cultured in vitro expressed P2Y1 receptors, which may inhibit excessive elevation in the concentration of intracellular Ca2+. Avoidance of intracellular calcium overload and the excessive release of glutamic acid may be an important reason why MRS2179 mitigates OGD‑induced AS injury.

  15. SELECTIVE POTENTIATION OF THE METABOTROPIC GLUTAMATE RECEPTOR SUBTYPE 2 BLOCKS PHENCYCLIDINE-INDUCED HYPERLOCOMOTION AND BRAIN ACTIVATION

    PubMed Central

    HACKLER, E. A.; BYUN, N. E.; JONES, C. K.; WILLIAMS, J. M.; BAHEZA, R.; SENGUPTA, S.; GRIER, M. D.; AVISON, M.; CONN, P. J.; GORE, J. C.

    2013-01-01

    Previous preclinical and clinical studies have demonstrated the efficacy of group II metabotropic glutamate receptor (mGluR) agonists as potential antipsychotics. Recent studies utilizing mGluR2-, mGluR3-, and double knockout mice support that the antipsychotic effects of those compounds are mediated by mGluR2. Indeed, biphenyl indanone-A (BINA), an allosteric potentiator of mGluR2, is effective in experimental models of psychosis, blocking phencyclidine (PCP)-induced hyperlocomotion and prepulse inhibition deficits in mice. In this study, we administered the NMDA receptor antagonist PCP (5.6 mg/kg i.p.) to rats, an established animal model predictive of schizophrenia. Here, we show that BINA (32 mg/kg i.p.) attenuated PCP-induced locomotor activity in rats. Using behaviorally relevant doses of BINA and PCP, we performed pharmacological magnetic resonance imaging (phMRI) to assess the specific brain regions that underlie the psychotomimetic effects of PCP, and examined how BINA modulated the PCP-induced functional changes in vivo. In anesthetized rats, acute administration of PCP produced robust, sustained blood oxygenation level-dependent (BOLD) activation in specific cortical, limbic, thalamic, and striatal regions. Pretreatment with BINA suppressed the amplitude of the BOLD response to PCP in the prefrontal cortex, caudaute–putamen, nucleus accumbens, and mediodorsal thalamus. Our results show key brain structures underlying PCP-induced behaviors in a preclinical model of schizophrenia, and, importantly, its reversal by potentiation of mGluR2 by BINA, revealing specific brain regions functionally involved in its pharmacological action. Finally, our findings bolster the growing body of evidence that mGluR2 is a viable target for the treatment of schizophrenia. PMID:20350588

  16. Multimodal use of calcitonin gene-related peptide and substance P in itch and acute pain uncovered by the elimination of vesicular glutamate transporter 2 from transient receptor potential cation channel subfamily V member 1 neurons.

    PubMed

    Rogoz, Katarzyna; Andersen, Helena H; Lagerström, Malin C; Kullander, Klas

    2014-10-15

    Primary afferents are known to use glutamate as their principal fast neurotransmitter. However, it has become increasingly clear that peptides have an influential role in both mediating and modulating sensory transmission. Here we describe the transmission accounting for different acute pain states and itch transmitted via the transient receptor potential cation channel subfamily V member 1 (TRPV1) population by either ablating Trpv1-Cre-expressing neurons or inducing vesicular glutamate transporter 2 (VGLUT2) deficiency in Trpv1-Cre-expressing neurons. Furthermore, by pharmacological inhibition of substance P or calcitonin gene-related peptide (CGRP) signaling in Vglut2-deficient mice, we evaluated the contribution of substance P or CGRP to these sensory modulations, with or without the presence of VGLUT2-mediated glutamatergic transmission in Trpv1-Cre neurons. This examination, together with c-Fos analyses, showed that glutamate via VGLUT2 in the Trpv1-Cre population together with substance P mediate acute cold pain, whereas glutamate together with CGRP mediate noxious heat. Moreover, we demonstrate that glutamate together with both substance P and CGRP mediate tissue-injury associated pain. We further show that itch, regulated by the VGLUT2-mediated transmission via the Trpv1-Cre population, depends on CGRP and gastrin-releasing peptide receptor (GRPR) transmission because pharmacological blockade of the CGRP or GRPR pathway, or genetic ablation of Grpr, led to a drastically attenuated itch. Our study reveals how different neurotransmitters combined can cooperate with each other to transmit or regulate various acute sensations, including itch. Copyright © 2014 the authors 0270-6474/14/3414055-14$15.00/0.

  17. Thermodynamics and structural analysis of positive allosteric modulation of the ionotropic glutamate receptor GluA2.

    PubMed

    Krintel, Christian; Frydenvang, Karla; Olsen, Lars; Kristensen, Maria T; de Barrios, Oriol; Naur, Peter; Francotte, Pierre; Pirotte, Bernard; Gajhede, Michael; Kastrup, Jette S

    2012-01-01

    Positive allosteric modulators of the ionotropic glutamate receptor-2 (GluA2) are promising compounds for the treatment of cognitive disorders, e.g. Alzheimer's disease. These modulators bind within the dimer interface of the LBD (ligand-binding domain) and stabilize the agonist-bound conformation slowing receptor desensitization and/or deactivation. In the present study, we employ isothermal titration calorimetry to determine binding affinities and thermodynamic details of binding of modulators of GluA2. A mutant of the LBD of GluA2 (LBD-L483Y-N754S) that forms a stable dimer in solution was used. The potent GluA2 modulator BPAM-97 was used as a reference compound. Evidence that BPAM-97 binds in the same pocket as the well-known GluA2 modulator cyclothiazide was obtained from X-ray structures. The LBD-L483Y-N754S:BPAM-97 complex has a Kd of 5.6 μM (ΔH=-4.9 kcal/mol, -TΔS=-2.3 kcal/mol; where 1 kcal≈4.187 kJ). BPAM-97 was used in a displacement assay to determine a Kd of 0.46 mM (ΔH=-1.2 kcal/mol, -TΔS=-3.3 kcal/mol) for the LBD-L483Y-N754S:IDRA-21 complex. The major structural factors increasing the potency of BPAM-97 over IDRA-21 are the increased van der Waals contacts to, primarily, Met496 in GluA2 imposed by the ethyl substituent of BPAM-97. These results add important information on binding affinities and thermodynamic details, and provide a new tool in the development of drugs against cognitive disorders.

  18. The phosphorylation status and cytoskeletal remodeling of striatal astrocytes treated with quinolinic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pierozan, Paula; Ferreira, Fernanda; Ortiz de Lima, Bárbara

    2014-04-01

    Quinolinic acid (QUIN) is a glutamate agonist which markedly enhances the vulnerability of neural cells to excitotoxicity. QUIN is produced from the amino acid tryptophan through the kynurenine pathway (KP). Dysregulation of this pathway is associated with neurodegenerative conditions. In this study we treated striatal astrocytes in culture with QUIN and assayed the endogenous phosphorylating system associated with glial fibrillary acidic protein (GFAP) and vimentin as well as cytoskeletal remodeling. After 24 h incubation with 100 µM QUIN, cells were exposed to {sup 32}P-orthophosphate and/or protein kinase A (PKA), protein kinase dependent of Ca{sup 2+}/calmodulin II (PKCaMII) or protein kinasemore » C (PKC) inhibitors, H89 (20 μM), KN93 (10 μM) and staurosporin (10 nM), respectively. Results showed that hyperphosphorylation was abrogated by PKA and PKC inhibitors but not by the PKCaMII inhibitor. The specific antagonists to ionotropic NMDA and non-NMDA (50 µM DL-AP5 and CNQX, respectively) glutamate receptors as well as to metabotropic glutamate receptor (mGLUR; 50 µM MCPG), mGLUR1 (100 µM MPEP) and mGLUR5 (10 µM 4C3HPG) prevented the hyperphosphorylation provoked by QUIN. Also, intra and extracellular Ca{sup 2+} quelators (1 mM EGTA; 10 µM BAPTA-AM, respectively) prevented QUIN-mediated effect, while Ca{sup 2+} influx through voltage-dependent Ca{sup 2+} channel type L (L-VDCC) (blocker: 10 µM verapamil) is not implicated in this effect. Morphological analysis showed dramatically altered actin cytoskeleton with concomitant change of morphology to fusiform and/or flattened cells with retracted cytoplasm and disruption of the GFAP meshwork, supporting misregulation of actin cytoskeleton. Both hyperphosphorylation and cytoskeletal remodeling were reversed 24 h after QUIN removal. Astrocytes are highly plastic cells and the vulnerability of astrocyte cytoskeleton may have important implications for understanding the neurotoxicity of QUIN in

  19. Central phencyclidine (PCP) receptor binding is glutamate dependent: evidence for a PCP/excitatory amino acid receptor (EAAR) complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loo, P.; Braunwalder, A.; Lehmann, J.

    PCP and other dissociative anesthetica block the increase in neuronal firing rate evoked by the EAAR agonist, N-methyl-Daspartate. NMDA and other EAAs such as glutamate (glu) have not been previously shown to affect PCP ligand binding. In the present study, using once washed rat forebrain membranes, 10 ..mu..M-glu was found to increase the binding of (/sup 3/H)TCP, a PCP analog, to defined PCP recognition sites by 20%. Removal of glu and aspartate (asp) by extensive washing decreased TCP binding by 75-90%. In these membranes, 10 ..mu..M L-glu increased TCP binding 3-fold. This effect was stereospecific and evoked by other EAAsmore » with the order of activity, L-glu > D-asp > L- asp > NMDA > D-glu > quisqualate. Kainate, GABA, NE, DA, 5-HT, 2-chloroadenosine, oxotremorine and histamine had no effect on TCP binding at concentrations up to 100 ..mu..M. The effects of L-glu were attenuated by the NMDA-type receptor antagonist, 2-amino-7--phosphonoheptanoate (AP7; 10 ..mu..M-1 mM). These findings indicate that EAAS facilitate TCP binding, possibly through NMDA-type receptors. The observed interaction between the PCP receptor and EAARs may reflect the existence of a macromolecular receptor complex similar to that demonstrated for the benzodiazepines and GABA.« less

  20. An examination of the roles of glutamate and sex in latent inhibition: Relevance to the glutamate hypothesis of schizophrenia?

    PubMed

    Huang, Andrew Chih Wei; Bo-Han He, Alan; Chen, Chih-Chung

    2017-10-01

    The present study examined the effects of the glutamate receptor antagonist MK-801, the glutamate receptor agonist N-methyl-D-aspartate (NMDA), and sexual dimorphism on latent inhibition to elucidate the glutamate hypothesis of schizophrenia. During the pre-exposure phase, 56 male and 65 female Wistar rats were intracerebroventricularly administered normal saline, MK-801 or NMDA, in the left ventricle and then exposed to a passive avoidance box (or a different context) in three trials over 3 days. Then, all of the rats were placed in the light compartment of the passive avoidance box and were allowed to enter the dark compartment, where they each received a footshock (1mA, 2s) in five trials over 5 days. Injections of the glutamate drugs NMDA and MK-801 did not affect latent inhibition. Sexual dimorphism did not occur in latent inhibition. The present data on the male rats indicated that the glutamate system did not affect latent inhibition, indicating that the glutamate system was not like the dopamine system in terms of mediating the positive symptoms of schizophrenia. The glutamate system might be involved in the negative and cognitive symptoms of schizophrenia. The results may provide information for novel treatments of the negative and cognitive symptoms of schizophrenia. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila.

    PubMed

    Knecht, Zachary A; Silbering, Ana F; Ni, Lina; Klein, Mason; Budelli, Gonzalo; Bell, Rati; Abuin, Liliane; Ferrer, Anggie J; Samuel, Aravinthan Dt; Benton, Richard; Garrity, Paul A

    2016-09-22

    Ionotropic Receptors (IRs) are a large subfamily of variant ionotropic glutamate receptors present across Protostomia. While these receptors are most extensively studied for their roles in chemosensory detection, recent work has implicated two family members, IR21a and IR25a, in thermosensation in Drosophila . Here we characterize one of the most evolutionarily deeply conserved receptors, IR93a, and show that it is co-expressed and functions with IR21a and IR25a to mediate physiological and behavioral responses to cool temperatures. IR93a is also co-expressed with IR25a and a distinct receptor, IR40a, in a discrete population of sensory neurons in the sacculus, a multi-chambered pocket within the antenna. We demonstrate that this combination of receptors is required for neuronal responses to dry air and behavioral discrimination of humidity differences. Our results identify IR93a as a common component of molecularly and cellularly distinct IR pathways important for thermosensation and hygrosensation in insects.

  2. The multifaceted subunit interfaces of ionotropic glutamate receptors.

    PubMed

    Green, Tim; Nayeem, Naushaba

    2015-01-01

    The past fifteen years has seen a revolution in our understanding of ionotropic glutamate receptor (iGluR) structure, starting with the first view of the ligand binding domain (LBD) published in 1998, and in many ways culminating in the publication of the full-length structure of GluA2 in 2009. These reports have revealed not only the central role played by subunit interfaces in iGluR function, but also myriad binding sites within interfaces for endogenous and exogenous factors. Changes in the conformation of inter-subunit interfaces are central to transmission of ligand gating into pore opening (itself a rearrangement of interfaces), and subsequent closure through desensitization. With the exception of the agonist binding site, which is located entirely within individual subunits, almost all modulatory factors affecting iGluRs appear to bind to sites in subunit interfaces. This review seeks to summarize what we currently understand about the diverse roles interfaces play in iGluR function, and to highlight questions for future research. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

  3. Anxiolytic properties of Valeriana officinalis in the zebrafish: a possible role for metabotropic glutamate receptors.

    PubMed

    Del Valle-Mojica, Lisa M; Ortíz, José G

    2012-11-01

    Valerian extract is used in complementary and alternative medicine for its anxiolytic and sedative properties. Our previous research demonstrated valerian interactions with glutamate receptors. The purpose of this study was to determine if valerian anxiolytic properties are mediated by metabotropic glutamate receptors (mGluR) such as mGluR (1/5) (mGluR I) and mGluR (2/3) (mGluR II). Adult wild-type zebrafish (Danio rerio) prefer the black compartment and avoid the white compartment in the dark/light preference task. Zebrafish exposed to 1 mg/mL of valerian extract or 0.00117 mg/mL valerenic acid increased their residence time in the white side by 84.61 ± 6.55 % and 58.30 ± 8.97 %, respectively. LAP3 (mGluR I antagonist) and EGLU (mGluR II antagonist) significantly inhibited the effects of valerian and valerenic acid. These results demonstrated that valerian and valerenic acid have anxiolytic properties in the zebrafish. Moreover, the selective interaction of valerian with mGluR I and II represent an alternative explanation for the anxiolytic properties of this plant and support the role of mGluR in anxiety. Georg Thieme Verlag KG Stuttgart · New York.

  4. MDMA-induced loss of parvalbumin interneurons within the dentate gyrus is mediated by 5HT2A and NMDA receptors.

    PubMed

    Collins, Stuart A; Gudelsky, Gary A; Yamamoto, Bryan K

    2015-08-15

    MDMA is a widely abused psychostimulant which causes a rapid and robust release of the monoaminergic neurotransmitters dopamine and serotonin. Recently, it was shown that MDMA increases extracellular glutamate concentrations in the dorsal hippocampus, which is dependent on serotonin release and 5HT2A/2C receptor activation. The increased extracellular glutamate concentration coincides with a loss of parvalbumin-immunoreactive (PV-IR) interneurons of the dentate gyrus region. Given the known susceptibility of PV interneurons to excitotoxicity, we examined whether MDMA-induced increases in extracellular glutamate in the dentate gyrus are necessary for the loss of PV cells in rats. Extracellular glutamate concentrations increased in the dentate gyrus during systemic and local administration of MDMA. Administration of the NMDA receptor antagonist, MK-801, during systemic injections of MDMA, prevented the loss of PV-IR interneurons seen 10 days after MDMA exposure. Local administration of MDL100907, a selective 5HT2A receptor antagonist, prevented the increases in glutamate caused by reverse dialysis of MDMA directly into the dentate gyrus and prevented the reduction of PV-IR. These findings provide evidence that MDMA causes decreases in PV within the dentate gyrus through a 5HT2A receptor-mediated increase in glutamate and subsequent NMDA receptor activation. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Transcriptional profiling of striatal neurons in response to single or concurrent activation of dopamine D2, adenosine A(2A) and metabotropic glutamate type 5 receptors: focus on beta-synuclein expression.

    PubMed

    Canela, Laia; Selga, Elisabet; García-Martínez, Juan Manuel; Amaral, Olavo B; Fernández-Dueñas, Víctor; Alberch, Jordi; Canela, Enric I; Franco, Rafael; Noé, Véronique; Lluís, Carme; Ciudad, Carlos J; Ciruela, Francisco

    2012-10-25

    G protein-coupled receptor oligomerization is a concept which is changing the understanding of classical pharmacology. Both, oligomerization and functional interaction between adenosine A(2A,) dopamine D(2) and metabotropic glutamate type 5 receptors have been demonstrated in the striatum. However, the transcriptional consequences of receptors co-activation are still unexplored. We aim here to determine the changes in gene expression of striatal primary cultured neurons upon isolated or simultaneous receptor activation. Interestingly, we found that 95 genes of the total analyzed (15,866 transcripts and variants) changed their expression in response to simultaneous stimulation of all three receptors. Among these genes, we focused on the β-synuclein (β-Syn) gene (SCNB). Quantitative PCR verified the magnitude and direction of change in expression of SCNB. Since β-Syn belongs to the homologous synuclein family and may be considered a natural regulator of α-synuclein (α-Syn), it has been proposed that β-Syn might act protectively against α-Syn neuropathology. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Attenuation of behavioral effects of cocaine by the Metabotropic Glutamate Receptor 5 Antagonist 2-Methyl-6-(phenylethynyl)-pyridine in squirrel monkeys: comparison with dizocilpine.

    PubMed

    Lee, Buyean; Platt, Donna M; Rowlett, James K; Adewale, Adepero S; Spealman, Roger D

    2005-03-01

    Growing evidence suggests a role for metabotropic glutamate receptors (mGluRs) in the behavioral effects of cocaine related to its abuse. The mGluR5 subtype, in particular, has come under scrutiny due to its distribution in brain regions associated with drug addiction. This study investigated interactions between the selective mGluR5 antagonist 2-methyl-6-(phenylethynyl)-pyridine (MPEP) and cocaine in squirrel monkeys whose lever-pressing behavior was 1) maintained under a second-order schedule of cocaine self-administration, 2) extinguished and then reinstated by cocaine priming, and 3) controlled by the discriminative stimulus (DS) effects of cocaine. Additional studies determined the effects of MPEP on unconditioned behaviors, coordination, and muscle resistance. In each experiment, the effects of MPEP were compared with those of the N-methyl-d-aspartate antagonist dizocilpine. MPEP attenuated cocaine self-administration, cocaine-induced reinstatement of drug seeking, and the DS effects of cocaine at doses that did not markedly impair motor function or operant behavior in the context of drug discrimination. Dizocilpine also attenuated cocaine self-administration, but it did not significantly alter cocaine-induced reinstatement of drug seeking, and it enhanced rather than attenuated the DS effects of cocaine. The findings point to a significant contribution of mGluR5 mechanisms in the behavioral effects of cocaine related to its abuse and suggest that MPEP has properties of a functional cocaine antagonist, which are not secondary to antagonism at NMDA receptors. The contrasting interactions of MPEP and dizocilpine with cocaine imply that glutamate acting through different metabotropic and ionotropic receptors may modulate the behavioral effects of cocaine in qualitatively different ways.

  7. Assessing the role of metabotropic glutamate receptor 5 in multiple nociceptive modalities.

    PubMed

    Zhu, Chang Z; Wilson, Sonya G; Mikusa, Joseph P; Wismer, Carol T; Gauvin, Donna M; Lynch, James J; Wade, Carrie L; Decker, Michael W; Honore, Prisca

    2004-12-15

    Preclinical data, performed in a limited number of pain models, suggest that functional blockade of metabotropic glutamate (mGlu) receptors may be beneficial for pain management. In the present study, effects of 2-methyl-6-(phenylethynyl)-pyridine (MPEP), a potent, selective mGlu5 receptor antagonist, were examined in a wide variety of rodent nociceptive and hypersensitivity models in order to fully characterize the potential analgesic profile of mGlu5 receptor blockade. Effects of 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP), as potent and selective as MPEP at mGlu5/mGlu1 receptors but more selective than MPEP at N-methyl-aspartate (NMDA) receptors, were also evaluated in selected nociceptive and side effect models. MPEP (3-30 mg/kg, i.p.) produced a dose-dependent reversal of thermal and mechanical hyperalgesia following complete Freund's adjuvant (CFA)-induced inflammatory hypersensitivity. Additionally, MPEP (3-30 mg/kg, i.p.) decreased thermal hyperalgesia observed in carrageenan-induced inflammatory hypersensitivity without affecting paw edema, abolished acetic acid-induced writhing activity in mice, and was shown to reduce mechanical allodynia and thermal hyperalgesia observed in a model of post-operative hypersensitivity and formalin-induced spontaneous pain. Furthermore, at 30 mg/kg, i.p., MPEP significantly attenuated mechanical allodynia observed in three neuropathic pain models, i.e. spinal nerve ligation, sciatic nerve constriction and vincristine-induced neuropathic pain. MTEP (3-30 mg/kg, i.p.) also potently reduced CFA-induced thermal hyperalgesia. However, at 100 mg/kg, i.p., MPEP and MTEP produced central nerve system (CNS) side effects as measured by rotarod performance and exploratory locomotor activity. These results suggest a role for mGlu5 receptors in multiple nociceptive modalities, though CNS side effects may be a limiting factor in developing mGlu5 receptor analgesic compounds.

  8. Phenotypic characterization of Grm1crv4 mice reveals a functional role for the type 1 metabotropic glutamate receptor in bone mineralization.

    PubMed

    Musante, Ilaria; Mattinzoli, Deborah; Otescu, Lavinia Alexandra; Bossi, Simone; Ikehata, Masami; Gentili, Chiara; Cangemi, Giuliana; Gatti, Cinzia; Emionite, Laura; Messa, Piergiorgio; Ravazzolo, Roberto; Rastaldi, Maria Pia; Riccardi, Daniela; Puliti, Aldamaria

    2017-01-01

    Recent increasing evidence supports a role for neuronal type signaling in bone. Specifically glutamate receptors have been found in cells responsible for bone remodeling, namely the osteoblasts and the osteoclasts. While most studies have focused on ionotropic glutamate receptors, the relevance of the metabotropic glutamate signaling in bone is poorly understood. Specifically type 1 metabotropic glutamate (mGlu1) receptors are expressed in bone, but the effect of its ablation on skeletal development has never been investigated. Here we report that Grm1 crv4/crv4 mice, homozygous for an inactivating mutation of the mGlu1 receptor, and mainly characterized by ataxia and renal dysfunction, exhibit decreased body weight, bone length and bone mineral density compared to wild type (WT) animals. Blood analyses of the affected mice demonstrate the absence of changes in circulating factors, such as vitamin D and PTH, suggesting renal damage is not the main culprit of the skeletal phenotype. Cultures of osteoblasts lacking functional mGlu1 receptors exhibit less homogeneous collagen deposition than WT cells, and present increased expression of osteocalcin, a marker of osteoblast maturation. These data suggest that the skeletal damage is directly linked to the absence of the receptor, which in turn leads to osteoblasts dysfunction and earlier maturation. Accordingly, skeletal histomorphology suggests that Grm1 crv4/crv4 mice exhibit enhanced bone maturation, resulting in premature fusion of the growth plate and shortened long bones, and further slowdown of bone apposition rate compared to the WT animals. In summary, this work reveals novel functions of mGlu1 receptors in the bone and indicates that in osteoblasts mGlu1 receptors are necessary for production of normal bone matrix, longitudinal bone growth, and normal skeletal development. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Paradoxical sleep deprivation in rats causes a selective reduction in the expression of type-2 metabotropic glutamate receptors in the hippocampus.

    PubMed

    Panaccione, Isabella; Iacovelli, Luisa; di Nuzzo, Luigi; Nardecchia, Francesca; Mauro, Gianluca; Janiri, Delfina; De Blasi, Antonio; Sani, Gabriele; Nicoletti, Ferdinando; Orlando, Rosamaria

    2017-03-01

    Paradoxical sleep deprivation in rats is considered as an experimental animal model of mania endowed with face, construct, and pharmacological validity. We induced paradoxical sleep deprivation by placing rats onto a small platform surrounded by water. This procedure caused the animal to fall in the water at the onset of REM phase of sleep. Control rats were either placed onto a larger platform (which allowed them to sleep) or maintained in their home cage. Sleep deprived rats showed a substantial reduction in type-2 metabotropic glutamate (mGlu2) receptors mRNA and protein levels in the hippocampus, but not in the prefrontal cortex or corpus striatum, as compared to both groups of control rats. No changes in the expression of mGlu3 receptor mRNA levels or mGlu1α and mGlu5 receptor protein levels were found with exception of an increase in mGlu1α receptor levels in the striatum of SD rats. Moving from these findings we treated SD and control rats with the selective mGlu2 receptor enhancer, BINA (30mg/kg, i.p.). SD rats were also treated with sodium valproate (300mg/kg, i.p.) as an active comparator. Both BINA and sodium valproate were effective in reversing the manic-like phenotype evaluated in an open field arena in SD rats. BINA treatment had no effect on motor activity in control rats, suggesting that our findings were not biased by a non-specific motor-lowering activity of BINA. These findings suggest that changes in the expression of mGlu2 receptors may be associated with the enhanced motor activity observed with mania. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Aniracetam reduces glutamate receptor desensitization and slows the decay of fast excitatory synaptic currents in the hippocampus.

    PubMed Central

    Isaacson, J S; Nicoll, R A

    1991-01-01

    Aniracetam is a nootropic drug that has been shown to selectively enhance quisqualate receptor-mediated responses in Xenopus oocytes injected with brain mRNA and in hippocampal pyramidal cells [Ito, I., Tanabe, S., Kohda, A. & Sugiyama, H. (1990) J. Physiol. (London) 424, 533-544]. We have used patch clamp recording techniques in hippocampal slices to elucidate the mechanism for this selective action. We find that aniracetam enhances glutamate-evoked currents in whole-cell recordings and, in outside-out patches, strongly reduces glutamate receptor desensitization. In addition, aniracetam selectively prolongs the time course and increases the peak amplitude of fast synaptic currents. These findings indicate that aniracetam slows the kinetics of fast synaptic transmission and are consistent with the proposal [Trussell, L. O. & Fischbach, G. D. (1989) Neuron 3, 209-218; Tang, C.-M., Dichter, M. & Morad, M. (1989) Science 243, 1474-1477] that receptor desensitization governs the strength of fast excitatory synaptic transmission in the brain. PMID:1660156

  11. Aniracetam reduces glutamate receptor desensitization and slows the decay of fast excitatory synaptic currents in the hippocampus.

    PubMed

    Isaacson, J S; Nicoll, R A

    1991-12-01

    Aniracetam is a nootropic drug that has been shown to selectively enhance quisqualate receptor-mediated responses in Xenopus oocytes injected with brain mRNA and in hippocampal pyramidal cells [Ito, I., Tanabe, S., Kohda, A. & Sugiyama, H. (1990) J. Physiol. (London) 424, 533-544]. We have used patch clamp recording techniques in hippocampal slices to elucidate the mechanism for this selective action. We find that aniracetam enhances glutamate-evoked currents in whole-cell recordings and, in outside-out patches, strongly reduces glutamate receptor desensitization. In addition, aniracetam selectively prolongs the time course and increases the peak amplitude of fast synaptic currents. These findings indicate that aniracetam slows the kinetics of fast synaptic transmission and are consistent with the proposal [Trussell, L. O. & Fischbach, G. D. (1989) Neuron 3, 209-218; Tang, C.-M., Dichter, M. & Morad, M. (1989) Science 243, 1474-1477] that receptor desensitization governs the strength of fast excitatory synaptic transmission in the brain.

  12. Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum.

    PubMed

    Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

    2014-01-01

    Growing awareness of cerebellar involvement in addiction is based on the cerebellum's intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and

  13. Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum

    PubMed Central

    Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

    2014-01-01

    Growing awareness of cerebellar involvement in addiction is based on the cerebellum’s intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and

  14. Glutamatergic Receptor Activation in the Commisural Nucleus Tractus Solitarii (cNTS) Mediates Brain Glucose Retention (BGR) Response to Anoxic Carotid Chemoreceptor (CChr) Stimulation in Rats.

    PubMed

    Cuéllar, R; Montero, S; Luquín, S; García-Estrada, J; Dobrovinskaya, O; Melnikov, V; Lemus, M; de Álvarez-Buylla, E Roces

    2015-01-01

    Glutamate, released from central terminals of glossopharyngeal nerve, is a major excitatory neurotransmitter of commissural nucleus tractus solitarii (cNTS) afferent terminals, and brain derived neurotrophic factor (BDNF) has been shown to attenuate glutamatergic AMPA currents in NTS neurons. To test the hypothesis that AMPA contributes to glucose regulation in vivo modulating the hyperglycemic reflex with brain glucose retention (BGR), we microinjected AMPA and NBQX (AMPA antagonist) into the cNTS before carotid chemoreceptor stimulation in anesthetized normal Wistar rats, while hyperglycemic reflex an brain glucose retention (BGR) were analyzed. To investigate the underlying mechanisms, GluR2/3 receptor and c-Fos protein expressions in cNTS neurons were determined. We showed that AMPA in the cNTS before CChr stimulation inhibited BGR observed in aCSF group. In contrast, NBQX in similar conditions, did not modify the effects on glucose variables observed in aCSF control group. These experiments suggest that glutamatergic pathways, via AMPA receptors, in the cNTS may play a role in glucose homeostasis.

  15. Activation of PPARδ attenuates neurotoxicity by inhibiting lipopolysaccharide-triggered glutamate release in BV-2 microglial cells.

    PubMed

    Lee, Won Jin; Ham, Sun Ah; Yoo, Hyunjin; Hwang, Jung Seok; Yoo, Taesik; Paek, Kyung Shin; Lim, Dae-Seog; Han, Sung Gu; Lee, Chi-Ho; Hong, Kwonho; Seo, Han Geuk

    2018-02-01

    Neuroinflammation-associated release of glutamate from activated microglia has been implicated in the progression of neurodegenerative diseases. However, the regulatory mechanisms underlying this glutamate release are poorly understood. Here, we show that peroxisome proliferator-activated receptor delta (PPARδ) modulates neurotoxicity by inhibiting glutamate release in lipopolysaccharide (LPS)-activated BV-2 microglial cells. Activation of PPARδ by GW501516, a specific PPARδ agonist, inhibited glutamate release in BV-2 cells. This effect of GW501516 was significantly blocked by shRNA-mediated knockdown of PPARδ and by treatment with GSK0660, a specific PPARδ antagonist, indicating that PPARδ is associated with blockade of glutamate release. Additionally, GW501516-activated PPARδ suppressed generation of reactive oxygen species and expression of gp91phox, a functional subunit of NADPH oxidase 2, in BV-2 cells stimulated with LPS. The inhibitory effect of GW501516 on gp91phox expression and glutamate release was further potentiated in the presence of AG490, a specific inhibitor of janus kinase 2 (JAK2), leading to the inhibition of signal transducer and activator of transcription 1 (STAT1). By contrast, GW501516 upregulated the expression of suppressor of cytokine signaling 1 (SOCS1), an endogenous inhibitor of JAK2. Furthermore, neurotoxicity induced by conditioned media from LPS-stimulated BV-2 cells was significantly reduced when conditioned media from BV-2 cells treated with both LPS and GW501516 were used. These results indicate that PPARδ attenuates LPS-triggered neuroinflammation by enhancing SOCS1-mediated inhibition of JAK2/STAT1 signaling, thereby inhibiting neurotoxicity associated with glutamate release. © 2018 Wiley Periodicals, Inc.

  16. Location-Dependent Signaling of the Group 1 Metabotropic Glutamate Receptor mGlu5

    PubMed Central

    Jong, Yuh-Jiin I.; Sergin, Ismail; Purgert, Carolyn A.

    2014-01-01

    Although G protein–coupled receptors are primarily known for converting extracellular signals into intracellular responses, some receptors, such as the group 1 metabotropic glutamate receptor, mGlu5, are also localized on intracellular membranes where they can mediate both overlapping and unique signaling effects. Thus, besides “ligand bias,” whereby a receptor’s signaling modality can shift from G protein dependence to independence, canonical mGlu5 receptor signaling can also be influenced by “location bias” (i.e., the particular membrane and/or cell type from which it signals). Because mGlu5 receptors play important roles in both normal development and in disorders such as Fragile X syndrome, autism, epilepsy, addiction, anxiety, schizophrenia, pain, dyskinesias, and melanoma, a large number of drugs are being developed to allosterically target this receptor. Therefore, it is critical to understand how such drugs might be affecting mGlu5 receptor function on different membranes and in different brain regions. Further elucidation of the site(s) of action of these drugs may determine which signal pathways mediate therapeutic efficacy. PMID:25326002

  17. Dynamics and allostery of the ionotropic glutamate receptors and the ligand binding domain.

    PubMed

    Tobi, Dror

    2016-02-01

    The dynamics of the ligand-binding domain (LBD) and the intact ionotropic glutamate receptor (iGluR) were studied using Gaussian Network Model (GNM) analysis. The dynamics of LBDs with various allosteric modulators is compared using a novel method of multiple alignment of GNM modes of motion. The analysis reveals that allosteric effectors change the dynamics of amino acids at the upper lobe interface of the LBD dimer as well as at the hinge region between the upper- and lower- lobes. For the intact glutamate receptor the analysis show that the clamshell-like movement of the LBD upper and lower lobes is coupled to the bending of the trans-membrane domain (TMD) helices which may open the channel pore. The results offer a new insight on the mechanism of action of allosteric modulators on the iGluR and support the notion of TMD helices bending as a possible mechanism for channel opening. In addition, the study validates the methodology of multiple GNM modes alignment as a useful tool to study allosteric effect and its relation to proteins dynamics. © 2015 Wiley Periodicals, Inc.

  18. Somatic and neuritic spines on tyrosine hydroxylase–immunopositive cells of rat retina

    PubMed Central

    Fasoli, Anna; Dang, James; Johnson, Jeffrey S.; Gouw, Aaron H.; Iseppe, Alex Fogli; Ishida, Andrew T.

    2018-01-01

    Dopamine- and tyrosine hydroxylase–immunopositive cells (TH cells) modulate visually driven signals as they flow through retinal photoreceptor, bipolar, and ganglion cells. Previous studies suggested that TH cells release dopamine from varicose axons arborizing in the inner and outer plexiform layers after glutamatergic synapses depolarize TH cell dendrites in the inner plexiform layer and these depolarizations propagate to the varicosities. Although it has been proposed that these excitatory synapses are formed onto appendages resembling dendritic spines, spines have not been found on TH cells of most species examined to date or on TH cell somata that release dopamine when exposed to glutamate receptor agonists. By use of protocols that preserve proximal retinal neuron morphology, we have examined the shape, distribution, and synapse-related immunoreactivity of adult rat TH cells. We report here that TH cell somata, tapering and varicose inner plexiform layer neurites, and varicose outer plexiform layer neurites all bear spines, that some of these spines are immunopositive for glutamate receptor and postsynaptic density proteins (viz., GluR1, GluR4, NR1, PSD-95, and PSD-93), that TH cell somata and tapering neurites are also immunopositive for a γ-aminobutyric acid (GABA) receptor subunit (GABAARα1), and that a synaptic ribbon-specific protein (RIBEYE) is found adjacent to some colocalizations of GluR1 and TH in the inner plexiform layer. These results identify previously undescribed sites at which glutamatergic and GABAergic inputs may stimulate and inhibit dopamine release, especially at somata and along varicose neurites that emerge from these somata and arborize in various levels of the retina. PMID:28035673

  19. Enhanced pre-synaptic glutamate release in deep-dorsal horn contributes to calcium channel alpha-2-delta-1 protein-mediated spinal sensitization and behavioral hypersensitivity

    PubMed Central

    Nguyen, David; Deng, Ping; Matthews, Elizabeth A; Kim, Doo-Sik; Feng, Guoping; Dickenson, Anthony H; Xu, Zao C; Luo, Z David

    2009-01-01

    Nerve injury-induced expression of the spinal calcium channel alpha-2-delta-1 subunit (Cavα2δ1) has been shown to mediate behavioral hypersensitivity through a yet identified mechanism. We examined if this neuroplasticity modulates behavioral hypersensitivity by regulating spinal glutamatergic neurotransmission in injury-free transgenic mice overexpressing the Cavα2δ1 proteins in neuronal tissues. The transgenic mice exhibited hypersensitivity to mechanical stimulation (allodynia) similar to the spinal nerve ligation injury model. Intrathecally delivered antagonists for N-methyl-D-aspartate (NMDA) and α-amino-3-hydroxyl-5-methylisoxazole-4-propionic acid (AMPA)/kainate receptors, but not for the metabotropic glutamate receptors, caused a dose-dependent allodynia reversal in the transgenic mice without changing the behavioral sensitivity in wild-type mice. This suggests that elevated spinal Cavα2δ1 mediates allodynia through a pathway involving activation of selective glutamate receptors. To determine if this is mediated by enhanced spinal neuronal excitability or pre-synaptic glutamate release in deep-dorsal horn, we examined wide-dynamic-range (WDR) neuron excitability with extracellular recording and glutamate-mediated excitatory postsynaptic currents with whole-cell patch recording in deep-dorsal horn of the Cavα2δ1 transgenic mice. Our data indicated that overexpression of Cavα2δ1 in neuronal tissues led to increased frequency, but not amplitude, of miniature excitatory post synaptic currents mediated mainly by AMPA/kainate receptors at physiological membrane potentials, and also by NMDA receptors upon depolarization, without changing the excitability of WDR neurons to high intensity stimulation. Together, these findings support a mechanism of Cavα2δ1-mediated spinal sensitization in which elevated Cavα2δ1 causes increased pre-synaptic glutamate release that leads to reduced excitation thresholds of post-synaptic dorsal horn neurons to innocuous

  20. [Molecular organization of glutamate-sensitive chemoexcitable membranes of nerve cells. Function of glutamate-binding proteins of the central nervous system when incorporated into liposomes].

    PubMed

    Besedin, V I; Kuznetsov, A S; Dambinova, S A

    1985-03-01

    The functioning of the glutamate-binding protein of rat brain cortex synaptic membranes was studied by its incorporation into liposomes. The optimal conditions for the receptor protein incorporation were established and the kinetics of 22Na+ and 86Rb+ incorporation into the liposomes in the presence of L-glutamate were analyzed. Modelling of the CNS glutamate receptor functions was found to be dependent on the lipid composition and amount of the incorporated membrane protein. The selective transport of 22Na+ into the liposomes was stimulated in the presence of 10(-4) M glutamate. Addition of monoclonal antibodies against glutamate-binding proteins blocked the incorporation of Na+ into the liposomes. The experimental results are suggestive of the nativity of the liposome-incorporated membrane protein, which is capable of binding glutamate and regulating selective transport of Na+. It was assumed that the glutamate receptor macromolecule represents an integral complex made up of several low molecular weight subunits of glucoprotein nature that form a selective ionic channel.

  1. Hypothesis: is infantile autism a hypoglutamatergic disorder? Relevance of glutamate - serotonin interactions for pharmacotherapy.

    PubMed

    Carlsson, M L

    1998-01-01

    Based on 1) neuroanatomical and neuroimaging studies indicating aberrations in brain regions that are rich in glutamate neurons and 2) similarities between symptoms produced by N-methyl-D-aspartate (NMDA) antagonists in healthy subjects and those seen in autism, it is proposed in the present paper that infantile autism is a hypoglutamatergic disorder. Possible future pharmacological interventions in autism are discussed in the light of the intimate interplay between central glutamate and serotonin, notably the serotonin (5-HT) 2A receptor. The possible benefit of treatment with glutamate agonists [e.g. agents acting on the modulatory glycine site of the NMDA receptor, or so-called ampakines acting on the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor] is discussed, as well as the potential usefulness of a selective 5-HT2A receptor antagonist.

  2. Postmortem brain abnormalities of the glutamate neurotransmitter system in autism.

    PubMed

    Purcell, A E; Jeon, O H; Zimmerman, A W; Blue, M E; Pevsner, J

    2001-11-13

    Studies examining the brains of individuals with autism have identified anatomic and pathologic changes in regions such as the cerebellum and hippocampus. Little, if anything, is known, however, about the molecules that are involved in the pathogenesis of this disorder. To identify genes with abnormal expression levels in the cerebella of subjects with autism. Brain samples from a total of 10 individuals with autism and 23 matched controls were collected, mainly from the cerebellum. Two cDNA microarray technologies were used to identify genes that were significantly up- or downregulated in autism. The abnormal mRNA or protein levels of several genes identified by microarray analysis were investigated using PCR with reverse transcription and Western blotting. alpha-Amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid (AMPA)- and NMDA-type glutamate receptor densities were examined with receptor autoradiography in the cerebellum, caudate-putamen, and prefrontal cortex. The mRNA levels of several genes were significantly increased in autism, including excitatory amino acid transporter 1 and glutamate receptor AMPA 1, two members of the glutamate system. Abnormalities in the protein or mRNA levels of several additional molecules in the glutamate system were identified on further analysis, including glutamate receptor binding proteins. AMPA-type glutamate receptor density was decreased in the cerebellum of individuals with autism (p < 0.05). Subjects with autism may have specific abnormalities in the AMPA-type glutamate receptors and glutamate transporters in the cerebellum. These abnormalities may be directly involved in the pathogenesis of the disorder.

  3. Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

    PubMed

    Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

    2007-07-01

    Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (P<0.001). These findings suggest that the GABRB2 and GAD1 genes alone and the combined effects of the polymorphisms in the four GABAergic system genes may confer susceptibility to the development of schizophrenia in the Chinese population.

  4. Structural and Functional Architecture of AMPA-Type Glutamate Receptors and Their Auxiliary Proteins.

    PubMed

    Greger, Ingo H; Watson, Jake F; Cull-Candy, Stuart G

    2017-05-17

    AMPA receptors (AMPARs) are tetrameric ion channels that together with other ionotropic glutamate receptors (iGluRs), the NMDA and kainate receptors, mediate a majority of excitatory neurotransmission in the central nervous system. Whereas NMDA receptors gate channels with slow kinetics, responsible primarily for generating long-term synaptic potentiation and depression, AMPARs are the main fast transduction elements at synapses and are critical for the expression of plasticity. The kinetic and conductance properties of AMPARs are laid down during their biogenesis and are regulated by post-transcriptional RNA editing, splice variation, post-translational modification, and subunit composition. Furthermore, AMPAR assembly, trafficking, and functional heterogeneity depends on a large repertoire of auxiliary subunits-a feature that is particularly striking for this type of iGluR. Here, we discuss how the subunit structure, stoichiometry, and auxiliary subunits generate a heterogeneous plethora of receptors, each tailored to fulfill a vital role in fast synaptic signaling and plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Pharmacological Blockade of Serotonin 5-HT7 Receptor Reverses Working Memory Deficits in Rats by Normalizing Cortical Glutamate Neurotransmission

    PubMed Central

    Bonaventure, Pascal; Aluisio, Leah; Shoblock, James; Boggs, Jamin D.; Fraser, Ian C.; Lord, Brian; Lovenberg, Timothy W.; Galici, Ruggero

    2011-01-01

    The role of 5-HT7 receptor has been demonstrated in various animal models of mood disorders; however its function in cognition remains largely speculative. This study evaluates the effects of SB-269970, a selective 5-HT7 antagonist, in a translational model of working memory deficit and investigates whether it modulates cortical glutamate and/or dopamine neurotransmission in rats. The effect of SB-269970 was evaluated in the delayed non-matching to position task alone or in combination with MK-801, a non-competitive NMDA receptor antagonist, and, in separate experiments, with scopolamine, a non-selective muscarinic antagonist. SB-269970 (10 mg/kg) significantly reversed the deficits induced by MK-801 (0.1 mg/kg) but augmented the deficit induced by scopolamine (0.06 mg/kg). The ability of SB-269970 to modulate MK-801-induced glutamate and dopamine extracellular levels was separately evaluated using biosensor technology and microdialysis in the prefrontal cortex of freely moving rats. SB-269970 normalized MK-801 -induced glutamate but not dopamine extracellular levels in the prefrontal cortex. Rat plasma and brain concentrations of MK-801 were not affected by co-administration of SB-269970, arguing for a pharmacodynamic rather than a pharmacokinetic mechanism. These results indicate that 5-HT7 receptor antagonists might reverse cognitive deficits associated with NMDA receptor hypofunction by selectively normalizing glutamatergic neurotransmission. PMID:21701689

  6. Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

    PubMed Central

    Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

    2014-01-01

    Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

  7. Differences in glutamate receptors and inflammatory cell numbers are associated with the resolution of pain in human rotator cuff tendinopathy.

    PubMed

    Dean, Benjamin John Floyd; Snelling, Sarah J B; Dakin, Stephanie G; Murphy, Richard J; Javaid, Muhammad Kassim; Carr, Andrew Jonathan

    2015-07-10

    The relationship between peripheral tissue characteristics and pain symptoms in soft tissue inflammation is poorly understood. The primary aim of this study was to determine immunohistochemical differences in tissue obtained from patients with persistent pain and patients who had become pain-free after surgical treatment for rotator cuff tendinopathy. The secondary aim was to investigate whether there would be differences in glutaminergic and inflammatory gene expression between disease-derived and healthy control cells in vitro. Supraspinatus tendon biopsies were obtained from nine patients with tendon pain before shoulder surgery and from nine further patients whose pain had resolved completely following shoulder surgery. Histological markers relating to the basic tendon characteristics, inflammation and glutaminergic signalling were quantified by immunohistochemical analysis. Gene expression of glutaminergic and inflammatory markers was determined in tenocyte explants derived from painful rotator cuff tendon tears in a separate cohort of patients and compared to that of explants from healthy control tendons. Dual labelling was performed to identify cell types expressing nociceptive neuromodulators. Tendon samples from patients with persistent pain demonstrated increased levels of metabotropic glutamate receptor 2 (mGluR2), kainate receptor 1 (KA1), protein gene product 9.5 (PGP9.5), CD206 (macrophage marker) and CD45 (pan-leucocyte marker) versus pain-free controls (p <0.05). NMDAR1 co-localised with CD206-positive cells, whereas PGP9.5 and glutamate were predominantly expressed by resident tendon cells. These results were validated by in vitro increases in the expression of mGluR2, N-methyl-D-aspartate receptor (NMDAR1), KA1, CD45, CD206 and tumour necrosis factor alpha (TNF-α) genes (p <0.05) in disease-derived versus control cells. We conclude that differences in glutamate receptors and inflammatory cell numbers are associated with the resolution of shoulder

  8. Maternal influenza viral infection causes schizophrenia-like alterations of 5-HT2A and mGlu2 receptors in the adult offspring

    PubMed Central

    Moreno, José L.; Kurita, Mitsumasa; Holloway, Terrell; López, Javier; Cadagan, Richard; Martínez-Sobrido, Luis; García-Sastre, Adolfo; González-Maeso, Javier

    2011-01-01

    Epidemiological studies indicate that maternal influenza viral infection increases the risk for schizophrenia in the adult offspring. The serotonin and glutamate systems are suspected in the etiology of schizophrenia, as well as in the mechanism of action of antipsychotic drugs. The effects of hallucinogens, such as psilocybin and mescaline, require the serotonin 5-HT2A receptor, and induce schizophrenia-like psychosis in humans. In addition, metabotropic glutamate receptor mGlu2/3 agonists show promise as a new treatment for schizophrenia. Here, we investigated the level of expression and behavioral function of 5-HT2A and mGlu2 receptors in a mouse model of maternal influenza viral infection. We show that spontaneous locomotor activity is diminished by maternal infection with the mouse-adapted influenza A/WSN/33 (H1N1) virus. The behavioral responses to hallucinogens and glutamate antipsychotics are both affected by maternal exposure to influenza virus, with increased head-twitch response to hallucinogens and diminished antipsychotic-like effect of the glutamate agonist. In frontal cortex of mice born to influenza virus-infected mothers, the 5-HT2A receptor is up-regulated and the mGlu2 receptor is down-regulated, an alteration that may be involved in the behavioral changes observed. Additionally, we find that the cortical 5-HT2A receptor-dependent signaling pathways are significantly altered in the offspring of infected mothers, showing higher c-fos, egr-1 and egr-2 expression in response to the hallucinogenic drug DOI. Identifying a biochemical alteration that parallels the behavioral changes observed in a mouse model of prenatal viral infection may facilitate targeting therapies for treatment and prevention of schizophrenia. PMID:21289196

  9. G protein‐coupled receptor 37‐like 1 modulates astrocyte glutamate transporters and neuronal NMDA receptors and is neuroprotective in ischemia

    PubMed Central

    Jolly, Sarah; Bazargani, Narges; Quiroga, Alejandra C.; Pringle, Nigel P.

    2017-01-01

    Abstract We show that the G protein‐coupled receptor GPR37‐like 1 (GPR37L1) is expressed in most astrocytes and some oligodendrocyte precursors in the mouse central nervous system. This contrasts with GPR37, which is mainly in mature oligodendrocytes. Comparison of wild type and Gpr37l1–/– mice showed that loss of GPR37L1 did not affect the input resistance or resting potential of astrocytes or neurons in the hippocampus. However, GPR37L1‐mediated signalling inhibited astrocyte glutamate transporters and – surprisingly, given its lack of expression in neurons – reduced neuronal NMDA receptor (NMDAR) activity during prolonged activation of the receptors as occurs in ischemia. This effect on NMDAR signalling was not mediated by a change in the release of D‐serine or TNF‐α, two astrocyte‐derived agents known to modulate NMDAR function. After middle cerebral artery occlusion, Gpr37l1 expression was increased around the lesion. Neuronal death was increased by ∼40% in Gpr37l1–/– brain compared to wild type in an in vitro model of ischemia. Thus, GPR37L1 protects neurons during ischemia, presumably by modulating extracellular glutamate concentration and NMDAR activation. PMID:28795439

  10. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila

    PubMed Central

    Knecht, Zachary A; Silbering, Ana F; Ni, Lina; Klein, Mason; Budelli, Gonzalo; Bell, Rati; Abuin, Liliane; Ferrer, Anggie J; Samuel, Aravinthan DT; Benton, Richard; Garrity, Paul A

    2016-01-01

    Ionotropic Receptors (IRs) are a large subfamily of variant ionotropic glutamate receptors present across Protostomia. While these receptors are most extensively studied for their roles in chemosensory detection, recent work has implicated two family members, IR21a and IR25a, in thermosensation in Drosophila. Here we characterize one of the most evolutionarily deeply conserved receptors, IR93a, and show that it is co-expressed and functions with IR21a and IR25a to mediate physiological and behavioral responses to cool temperatures. IR93a is also co-expressed with IR25a and a distinct receptor, IR40a, in a discrete population of sensory neurons in the sacculus, a multi-chambered pocket within the antenna. We demonstrate that this combination of receptors is required for neuronal responses to dry air and behavioral discrimination of humidity differences. Our results identify IR93a as a common component of molecularly and cellularly distinct IR pathways important for thermosensation and hygrosensation in insects. DOI: http://dx.doi.org/10.7554/eLife.17879.001 PMID:27656904

  11. Adenosine A2A Receptor in the Monkey Basal Ganglia: Ultrastructural Localization and Colocalization With the Metabotropic Glutamate Receptor 5 in the Striatum

    PubMed Central

    Bogenpohl, James W.; Ritter, Stefanie L.; Hall, Randy A.; Smith, Yoland

    2012-01-01

    The adenosine A2A receptor (A2AR) is a potential drug target for the treatment of Parkinson’s disease and other neurological disorders. In rodents, the therapeutic efficacy of A2AR modulation is improved by concomitant modulation of the metabotropic glutamate receptor 5 (mGluR5). To elucidate the anatomical substrate(s) through which these therapeutic benefits could be mediated, pre-embedding electron microscopy immunohistochemistry was used to conduct a detailed, quantitative ultrastructural analysis of A2AR localization in the primate basal ganglia and to assess the degree of A2AR/mGluR5 colocalization in the striatum. A2AR immunoreactivity was found at the highest levels in the striatum and external globus pallidus (GPe). However, the monkey, but not the rat, substantia nigra pars reticulata (SNr) also harbored a significant level of neuropil A2AR immunoreactivity. At the electron microscopic level, striatal A2AR labeling was most commonly localized in postsynaptic elements (58% ± 3% of labeled elements), whereas, in the GPe and SNr, the labeling was mainly presynaptic (71% ± 5%) or glial (27% ± 6%). In both striatal and pallidal structures, putative inhibitory and excitatory terminals displayed A2AR immunoreactivity. Striatal A2AR/mGluR5 colocalization was commonly found; 60–70% of A2AR-immunoreactive dendrites or spines in the monkey striatum coexpress mGluR5. These findings provide the first detailed account of the ultrastructural localization of A2AR in the primate basal ganglia and demonstrate that A2AR and mGluR5 are located to interact functionally in dendrites and spines of striatal neurons. Together, these data foster a deeper understanding of the substrates through which A2AR could regulate primate basal ganglia function and potentially mediate its therapeutic effects in parkinsonism. PMID:21858817

  12. Metabotropic glutamate receptor type 1 autoimmunity

    PubMed Central

    Lopez-Chiriboga, A. Sebastian; Komorowski, Lars; Kümpfel, Tania; Probst, Christian; Hinson, Shannon R.; Pittock, Sean J.

    2016-01-01

    Objective: To describe retrospectively the clinical associations of immunoglobulin G (IgG) targeting metabotropic glutamate receptor 1 (mGluR1-IgG). Methods: Specimens of 9 patients evaluated on a service basis in the Mayo Clinic Neuroimmunology Laboratory by tissue-based immunofluorescence assay (IFA) yielded a robust, synaptic immunostaining pattern consistent with mGluR1-IgG (serum, 9; CSF, 2 available). Transfected HEK293 cell-based assay (CBA) confirmed mGluR1 specificity in all 11 specimens. A further 2 patients were detected in Germany primarily by CBA. Results: The median symptom onset age for the 11 patients was 58 years (range 33–81 years); 6 were male. All 9 Mayo Clinic patients had subacute onset of cerebellar ataxia, 4 had dysgeusia, 1 had psychiatric symptoms, and 1 had cognitive impairment. All were evaluated for malignancy, but only 1 was affected (cutaneous T-cell lymphoma). One developed ataxia post–herpes zoster infection. Head MRIs were generally atrophic or normal-appearing, and CSF was inflammatory in just 1 of 5 tested, though mGluR1-IgG was detected in both specimens submitted. Five patients improved (attributable to immunotherapy in 4, spontaneously in 1), 3 stabilized (attributable to immunotherapy in 2, cancer therapy in 1), and 1 progressively declined (untreated). The 2 German patients had ataxia, but fulfilled multiple sclerosis diagnostic criteria (1 relapsing-remitting, 1 progressive). However, both had histories of hematologic malignancy (acute lymphocytic leukemia and mantle cell lymphoma), and had mGluR1-IgG detected in serum by CBA (weakly positive on tissue-based IFA). Conclusions: mGluR1 autoimmunity represents a treatable form of cerebellar ataxia. Dysgeusia may be a diagnostic clue. Paraneoplastic, parainfectious, or idiopathic causes may occur. PMID:26888994

  13. Spinal intracellular metabotropic glutamate receptor 5 (mGluR5) contributes to pain and c-fos expression in a rat model of inflammatory pain.

    PubMed

    Vincent, Kathleen; Wang, Shu Fan; Laferrière, André; Kumar, Naresh; Coderre, Terence J

    2017-04-01

    Metabotropic glutamate receptor 5 (mGluR5) is an excitatory G-protein-coupled receptor (GPCR) present in the spinal cord dorsal horn (SCDH) where it has a well-established role in pain. In addition to its traditional location on the cytoplasmic membrane, recent evidence shows that these receptors are present intracellularly on the nuclear membrane in the spinal cord dorsal horn and are implicated in neuropathic pain. Nuclear mGluR5 is a functional receptor that binds glutamate entering the cell through the neuronal glutamate transporter (GT) EAAT3 and activates transcription factor c-fos, whereas plasma membrane mGluR5 is responsible for c-jun activation. Here, we extend these findings to a model of inflammatory pain using complete Freund's adjuvant (CFA) and show that nuclear mGluR5 is also upregulated in the spinal cord dorsal horn following inflammation. We also show that pretreatment with an excitatory amino acid transporter (EAAT) inhibitor attenuates pain and decreases Fos, but not Jun, expression in complete Freund's adjuvant rats. In contrast, selective glial glutamate transporter inhibitors are pronociceptive and increase spinal glutamate concentrations. Additionally, we found that permeable mGluR5 antagonists are more effective at attenuating pain and Fos expression than nonpermeable group I mGluR antagonists. Taken together, these results suggest that under inflammatory conditions, intracellular mGluR5 is actively involved in the relay of nociceptive information in the spinal cord.

  14. Effects of NMDA and non-NMDA ionotropic glutamate receptors in the medial preoptic area on body temperature in awake rats.

    PubMed

    Sengupta, Trina; Jaryal, Ashok Kumar; Mallick, Hruda Nanda

    2016-10-01

    Glutamate when microinjected at the medial preoptic area (mPOA) influences brain temperature (T br ) and body temperature (T b ) in rats. Glutamate and its various receptors are present at the mPOA. The aim of this study was to identify the contribution of each of the ionotropic glutamatergic receptors at the mPOA on changes in T br and T b in freely moving rats. Adult male Wistar rats (n=40) were implanted with bilateral guide cannula with indwelling styli above the mPOA. A telemetric transmitter was implanted at the peritoneum to record T b and locomotor activity (LMA). A precalibrated thermocouple wire implanted near the hypothalamus was used to assess T br . Specific agonist for each ionotropic glutamate receptor was microinjected into the mPOA and its effects on temperature and LMA were measured in the rats. The rats were also microinjected with the respective ionotropic receptor antagonists, 15min prior to the microinjection of each agonist. Amongst amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), N-methyl-d-aspartate (NMDA) and kainic acid, AMPA increased T b and LMA when injected at the mPOA. Specific antagonists for AMPA receptors was able to attenuate this increase (p<0.005). Pharmacological blockade of NMDA was able to lower T br only. Microinjection of kainic acid and its antagonist had no effect on the variables. The finding of the study suggests that activation of the AMPA receptors at the mPOA, leads to the rise in body temperature. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Glutamate receptors of the A5 region modulate cardiovascular responses evoked from the dorsomedial hypothalamic nucleus and perifornical area.

    PubMed

    López-González, M V; Díaz-Casares, A; González-García, M; Peinado-Aragonés, C A; Barbancho, M A; Carrillo de Albornoz, M; Dawid-Milner, M S

    2018-05-01

    To assess the possible function of glutamate in the interaction between the dorsomedial hypothalamic nucleus-perifornical area (DMH-PeF) and the A5 pontine region (A5), cardiovascular and respiratory changes were studied in response to electrical stimulation of the DMH-PeF (1 ms pulses, 30-50 μA given at 100 Hz for 5 s) before and after the microinjection of kynurenic acid (non-specific glutamate receptor antagonist; 50 nl, 5 nmol), MK-801 (NMDA receptor antagonist; 50 nl, 50 nmol), CNQX (non-NMDA receptor antagonist; 50 nl, 50 nmol) or MCPG (metabotropic glutamate receptor antagonist; 50 nl, 5 nmol) within the A5 region. DMH-PeF electrical stimulation elicited a pressor (p < 0.001) and tachycardic response (p < 0.001) which was accompanied by an inspiratory facilitation characterised by an increase in respiratory rate (p < 0.001) due to a decrease in expiratory time (p < 0.01). Kynurenic acid within the A5 region decreased the tachycardia (p < 0.001) and the intensity of the blood pressure response (p < 0.001) to DMH-PeF stimulation. After the microinjection of MK-801 and CNQX into the A5 region, the magnitude of the tachycardia and the pressor response were decreased (p < 0.05 and p < 0.01; p < 0.001 and p < 0.05, respectively). After MCPG microinjection into the A5 region, a decrease in the tachycardia (p < 0.001) with no changes in the pressor response was observed during DMH-PeF stimulation. The respiratory response elicited by DMH-PeF stimulation was not changed after the microinjection of kynurenic acid, MK-801, CNQX or MCPG within the A5 region. These results suggest that A5 region glutamate receptors play a role in the cardiovascular response elicited from the DMH-PeF. The possible mechanisms involved in these interactions are discussed.

  16. The TiPS/TINS lecture: the molecular biology of mammalian glutamate receptor channels.

    PubMed

    Seeburg, P H

    1993-08-01

    In native brain membranes the principal excitatory neurotransmitter L-glutamate activates cation-conducting channels with distinct biophysical and pharmacological properties. Molecular cloning has revealed the existence of 16 channel subunits that can assemble in homomeric or heteromeric configurations in vitro to form receptor channels with disparate functional properties. This review describes the different channel types obtained by recombinant means and the genetic mechanisms controlling the expression of functionally important channel structures.

  17. The TINS/TiPS Lecture. The molecular biology of mammalian glutamate receptor channels.

    PubMed

    Seeburg, P H

    1993-09-01

    In native brain membranes the principal excitatory neurotransmitter L-glutamate activates cation-conducting channels with distinct biophysical and pharmacological properties. Molecular cloning has revealed the existence of 16 channel subunits that can assemble in homomeric or heteromeric configurations in vitro to form receptor channels with disparate functional properties. This review describes the different channel types obtained by recombinant means and the genetic mechanisms controlling the expression of functionally important channel structures.

  18. Boutons containing vesicular zinc define a subpopulation of synapses with low AMPAR content in rat hippocampus.

    PubMed

    Sindreu, Carlos Balet; Varoqui, Hélène; Erickson, Jeffrey D; Pérez-Clausell, Jeús

    2003-08-01

    Cortical regions of the brain stand out for their high content in synaptic zinc, which may thus be involved in synaptic function. The relative number, chemical nature and transmitter receptor profile of synapses that sequester vesicular zinc are largely unknown. To address this, we combined pre-embedding zinc histochemistry and post-embedding immunogold electron microscopy in rat hippocampus. All giant mossy fibre (MF) terminals in the CA3 region and approximately 45% of boutons making axospinous synapses in stratum radiatum in CA1 contained synaptic vesicles that stained for zinc. Both types of zinc-positive boutons selectively expressed the vesicular zinc transporter ZnT-3. Zinc-positive boutons further immunoreacted to the vesicular glutamate transporter VGLUT-1, but not to the transmitter gamma-aminobutyric acid. Most dendritic spines in CA1 immunoreacted to alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunits GluR1-3 (approximately 80%) and to N-methyl-D-aspartate receptor (NMDAR) subunits NR1 + NR2A/B (approximately 90%). Synapses made by zinc-positive boutons contained 40% less AMPAR particles than those made by zinc-negative boutons, whereas NMDAR counts were similar. Further analysis indicated that this was due to the reduced synaptic expression of both GluR1 and GluR2 subunits. Hence, the levels of postsynaptic AMPARs may vary according to the presence of vesicular zinc in excitatory afferents to CA1. Zinc-positive and zinc-negative synapses may represent two glutamatergic subpopulations with distinct synaptic signalling.

  19. New perspectives in glutamate and anxiety.

    PubMed

    Riaza Bermudo-Soriano, Carlos; Perez-Rodriguez, M Mercedes; Vaquero-Lorenzo, Concepcion; Baca-Garcia, Enrique

    2012-02-01

    Anxiety and stress-related disorders, namely posttraumatic stress disorder (PTSD), generalized anxiety disorder (GAD), obsessive-compulsive disorder (ODC), social and specific phobias, and panic disorder, are a major public health issue. A growing body of evidence suggests that glutamatergic neurotransmission may be involved in the biological mechanisms underlying stress response and anxiety-related disorders. The glutamatergic system mediates the acquisition and extinction of fear-conditioning. Thus, new drugs targeting glutamatergic neurotransmission may be promising candidates for new pharmacological treatments. In particular, N-methyl-d-aspartate receptors (NMDAR) antagonists (AP5, AP7, CGP37849, CGP39551, LY235959, NPC17742, and MK-801), NMDAR partial agonists (DCS, ACPC), α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate receptors (AMPARs) antagonists (topiramate), and several allosteric modulators targeting metabotropic glutamate receptors (mGluRs) mGluR1, mGluR2/3, and mGluR5, have shown anxiolytic-like effects in several animal and human studies. Several studies have suggested that polyamines (agmatine, putrescine, spermidine, and spermine) may be involved in the neurobiological mechanisms underlying stress-response and anxiety-related disorders. This could mainly be attributed to their ability to modulate ionotropic glutamate receptors, especially NR2B subunits. The aim of this review is to establish that glutamate neurotransmission and polyaminergic system play a fundamental role in the onset of anxiety-related disorders. This may open the way for new drugs that may help to treat these conditions. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. The role of ionotropic glutamate receptors in childhood neurodevelopmental disorders: autism spectrum disorders and fragile x syndrome.

    PubMed

    Uzunova, Genoveva; Hollander, Eric; Shepherd, Jason

    2014-01-01

    Autism spectrum disorder (ASD) and Fragile X syndrome (FXS) are relatively common childhood neurodevelopmental disorders with increasing incidence in recent years. They are currently accepted as disorders of the synapse with alterations in different forms of synaptic communication and neuronal network connectivity. The major excitatory neurotransmitter system in brain, the glutamatergic system, is implicated in learning and memory, synaptic plasticity, neuronal development. While much attention is attributed to the role of metabotropic glutamate receptors in ASD and FXS, studies indicate that the ionotropic glutamate receptors (iGluRs) and their regulatory proteins are also altered in several brain regions. Role of iGluRs in the neurobiology of ASD and FXS is supported by a weight of evidence that ranges from human genetics to in vitro cultured neurons. In this review we will discuss clinical, molecular, cellular and functional changes in NMDA, AMPA and kainate receptors and the synaptic proteins that regulate them in the context of ASD and FXS. We will also discuss the significance for the development of translational biomarkers and treatments for the core symptoms of ASD and FXS.