Sample records for groupings usingbranched dna

  1. Directed assembly of discrete gold nanoparticle groupings usingbranched DNA scaffolds

    SciTech Connect

    Claridge, Shelley A.; Goh, Sarah L.; Frechet, Jean M.J.; Williams, Shara C.; Micheel, Christine M.; Alivisatos, A. Paul

    2004-09-14

    The concept of self-assembled dendrimers is explored for the creation of discrete nanoparticle assemblies. Hybridization of branched DNA trimers and nanoparticle-DNA conjugates results in the synthesis of nanoparticle trimer and tetramer complexes. Multiple tetramer architectures are investigated, utilizing Au-DNA conjugates with varying secondary structural motifs. Hybridization products are analyzed by gel electrophoresis, and discrete bands are observed corresponding to structures with increasing numbers of hybridization events. Samples extracted from each band are analyzed by transmission electron microscopy, and statistics compiled from micrographs are used to compare assembly characteristics for each architecture. Asymmetric structures are also produced in which both 5 and 10 nm Au particles are assembled on branched scaffolds.

  2. DNA and Natural Algorithms Group

    NSDL National Science Digital Library

    This research group at the California Institute of Technology is studying the capability of DNA and other biomolecules to process information and implement algorithms. A general overview of the group's purpose and motivation is provided, as well as a number of publications.

  3. Polycomb Group Repression Reduces DNA Accessibility

    PubMed Central

    Fitzgerald, Daniel P.; Bender, Welcome

    2001-01-01

    The Polycomb group proteins are responsible for long-term repression of a number of genes in Drosophila melanogaster, including the homeotic genes of the bithorax complex. The Polycomb protein is thought to alter the chromatin structure of its target genes, but there has been little direct evidence for this model. In this study, the chromatin structure of the bithorax complex was probed with three separate assays for DNA accessibility: (i) activation of polymerase II (Pol II) transcription by Gal4, (ii) transcription by the bacteriophage T7 RNA polymerase (T7RNAP), and (iii) FLP-mediated site-specific recombination. All three processes are restricted or blocked in Polycomb-repressed segments. In contrast, control test sites outside of the bithorax complex permitted Gal4, T7RNAP, and FLP activities throughout the embryo. Several P insertions in the bithorax complex were tested, providing evidence that the Polycomb-induced effect is widespread over target genes. This accessibility effect is similar to that seen for SIR silencing in Saccharomyces cerevisiae. In contrast to SIR silencing, however, episomes excised from Polycomb-repressed chromosomal sites do not show an altered superhelix density. PMID:11533246

  4. Group C adenovirus DNA sequences in human lymphoid cells

    SciTech Connect

    Horvath, J.; Palkonyay, L.; Weber, J.

    1986-07-01

    Human peripheral blood lymphocytes from healthy adults, cord blood lymphocytes, and lymphoblastoid cell lines were screened by hybridization for the presence of group C adenovirus DNA sequences. In 13 of 17 peripheral blood lymphocyte samples from adults, 1 of 10 cord blood samples, and seven of seven lymphoblastoid cell lines tested, results were positive for Group C adenovirus DNA (adenovirus 1 (Ad1), Ad2, Ad5, or Ad6). About 1 to 2% of the lymphocytes carried 50 to 100 viral genome copies per positive cell, as estimated by in situ hybridization. Infectious virus representing all members of group C were recovered, but cultivation in the presence of adenovirus antibody did not cure the cells of free viral genomes. Viral DNA was found in B, T, and N cells but only in 1 of 10 cord blood samples. The results suggest that group C adenovirus infectious in childhood result in the persistence of the viral genome in circulating lymphocytes.

  5. Mitochondrial DNA evolution in the Anaxyrus boreas species group

    Microsoft Academic Search

    Anna M. Goebel; Tom A. Ranker; Paul Stephen Corn; Richard G. Olmstead

    2009-01-01

    The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrusexsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas

  6. DNA hybridization probe for the Pseudomonas fluorescens group.

    PubMed Central

    Festl, H; Ludwig, W; Schleifer, K H

    1986-01-01

    Plasmid pHF360 was constructed from cloned rRNA genes (rDNA) of Pseudomonas aeruginosa and used as hybridization probe for the Pseudomonas fluorescens group. The probe was tested by dot and in situ colony hybridizations to chromosomal DNAs from a wide variety of organisms. pHF360 DNA hybridized exclusively to chromosomal DNAs from bacteria representing the P. fluorescens group and separated them clearly from all other bacteria tested in the present study. Determination of the nucleotide sequence of the cloned DNA showed that it is a fragment from a 23S rRNA gene of P. aeruginosa. It was compared with the published 23S RNA sequence from Escherichia coli. Images PMID:3098169

  7. Mitochondrial DNA evolution in the Anaxyrus boreas species group

    USGS Publications Warehouse

    Goebel, A.M.; Ranker, T.A.; Corn, P.S.; Olmstead, R.G.

    2009-01-01

    The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrus exsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. ?? 2008 Elsevier Inc.

  8. Mitochondrial DNA evolution in the Anaxyrus boreas species group.

    PubMed

    Goebel, Anna M; Ranker, Tom A; Corn, Paul Stephen; Olmstead, Richard G

    2009-02-01

    The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrusexsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. PMID:18662792

  9. Mitochondrial DNA variation and Haldane's rule in the Papilio glaucus and P. troilus species groups

    Microsoft Academic Search

    FELIX A. H. SPERLING

    1993-01-01

    Variation in mitochondrial DNA (mtDNA) was surveyed, using restriction endonucleases, in all species of the Papilio glaucus and P. troilus groups (Lepidoptera: Papilionidae). Phylogenetic and distance relationships of mtDNA generally confirmed traditional species limits in the two species groups and compared favourably with a prior survey of their allozymes. The most notable exceptions were P. rutulus and P. eurymedon, which

  10. A Reduced Number of mtSNPs Saturates Mitochondrial DNA Haplotype Diversity of Worldwide Population Groups

    Microsoft Academic Search

    Antonio Salas; Jorge Amigo; Vincent Macaulay

    2010-01-01

    BackgroundThe high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population.

  11. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  12. [Mitochondrial DNA variability in populations and ethnic groups of Tatars of the Tobol-Irtysh basin].

    PubMed

    Naumova, O Iu; Rychkov, S Iu; Zhukova, O V

    2009-09-01

    The data on mitochondrial DNA diversity in seven local populations (villages) and four territorial groups of Tatars of the Tobol-Irtysh basin are presented. In the Turkic-speaking populations from the Tobol and Irtysh river basins, high levels of intergroup and interpopulation mtDNA variation were observed. It was demonstrated that genetic diversity of the territorial groups of Tatars of the Tobol-Irtysh basin resulted from various interethnic relationships and different ethnic components integrated into these groups. PMID:19824547

  13. Control region sequences for East Asian individuals in the Scientific Working Group on DNA Analysis Methods forensic mtDNA data set

    Microsoft Academic Search

    Marc W Allard; Mark R Wilson; Keith L Monson; Bruce Budowle

    2004-01-01

    The Scientific Working Group on DNA Analysis Methods (SWGDAM) mitochondrial DNA (mtDNA) population data set is used to infer the relative rarity of mtDNA profiles obtained from evidence samples and of profiles used to identify missing persons. In this study, the East Asian haplogroup patterns in the SWGDAM data sets were analyzed in a phylogenetic context to determine relevant single

  14. Xeroderma pigmentosum group A protein loads as a separate factor onto DNA lesions

    Microsoft Academic Search

    Suzanne Rademakers; Marcel Volker; Deborah Hoogstraten; Alex L. Nigg; Martijn J. Mone; Albert A. van Zeeland; A. B. Houtsmuller; W. Vermeulen; J. H. J. Hoeijmakers

    2003-01-01

    Nucleotide excision repair (NER) is the main DNA repair pathway in mammals for removal of UV-induced lesions. NER involves the concerted action of more than 25 polypeptides in a coordinated fashion. The xeroderma pigmentosum group A protein (XPA) has been suggested to function as a central organizer and damage verifier in NER. How XPA reaches DNA lesions and how the

  15. Xeroderma pigmentosum complementation group C protein (XPC) serves as a general sensor of damaged DNA.

    PubMed

    Shell, Steven M; Hawkins, Edward K; Tsai, Miaw-Sheue; Hlaing, Aye Su; Rizzo, Carmelo J; Chazin, Walter J

    2013-11-01

    The Xeroderma pigmentosum complementation group C protein (XPC) serves as the primary initiating factor in the global genome nucleotide excision repair pathway (GG-NER). Recent reports suggest XPC also stimulates repair of oxidative lesions by base excision repair. However, whether XPC distinguishes among various types of DNA lesions remains unclear. Although the DNA binding properties of XPC have been studied by several groups, there is a lack of consensus over whether XPC discriminates between DNA damaged by lesions associated with NER activity versus those that are not. In this study we report a high-throughput fluorescence anisotropy assay used to measure the DNA binding affinity of XPC for a panel of DNA substrates containing a range of chemical lesions in a common sequence. Our results demonstrate that while XPC displays a preference for binding damaged DNA, the identity of the lesion has little effect on the binding affinity of XPC. Moreover, XPC was equally capable of binding to DNA substrates containing lesions not repaired by GG-NER. Our results suggest XPC may act as a general sensor of damaged DNA that is capable of recognizing DNA containing lesions not repaired by NER. PMID:24051049

  16. Two high-mobility group box domains act together to underwind and kink DNA

    PubMed Central

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-01-01

    High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2?Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA. PMID:26143914

  17. DNA DNA DNA (d)DNA DNA DNA

    E-print Network

    Hagiya, Masami

    DNA DNA DNA DNA DNA DNA DNA DNA [ 2008] (d)DNA DNA DNA DNA 2 3 DNA DNA DNA DNA DNA DNA DNA (a) (c) (b) (d) #12;DNA DNA DNA DNA DNA DNA DNA DNA (b) DNA [Tanaka et al.2008] DNA DNA DNA DNA DNA DNA DNA #12;iGEM MIT MIT

  18. Efimov like phase of a three stranded DNA (Efimov-DNA) and the renormalization group limit cycle

    E-print Network

    Tanmoy Pal; Poulomi Sadhukhan; Somendra M. Bhattacharjee

    2015-04-10

    A three-stranded DNA with short range base pairings only is known to exhibit a classical analog of the quantum Efimov effect, viz., a three chain bound state at the two chain melting point where no two are bound. By using a non-perturbative renormalization group method for a rigid duplex DNA and a flexible third strand, with base pairings and strand exchange, we show that the Efimov-DNA is associated with a limit cycle type behavior of the flow of an effective three chain interaction. The analysis also shows that thermally generated bubbles play an essential role in producing the effect. A toy model for the flow equations shows the limit cycle in an extended three dimensional parameter space of the two-chain coupling and a complex three chain interaction.

  19. Numerous group I introns with variable distributions in the ribosomal DNA of a lichen fungus.

    PubMed

    DePriest, P T; Been, M D

    1992-11-20

    The length of the small subunit ribosomal DNA (SSU rDNA) differs significantly among individuals from natural populations of the ascomycetous lichen complex Cladonia chlorophaea. The sequence of the 3' region of the SSU rDNA from two individuals, chosen to represent the shortest and longest sequences, revealed multiple insertions within a region that otherwise aligned with a 520-nucleotide sequence of the SSU rDNA in Saccharomyces cerevisiae. The high degree of variability in SSU rDNA size can be accounted for by different numbers of insertions; one individual had two group I introns and the second had five introns, two of which were clearly related to introns at identical positions in the other individual. Yet, introns in different positions, whether within an individual or between individuals, were not similar in sequence. The distribution of introns at three of the positions is consistent with either intron loss or acquisition, and clearly indicates the dynamic variability in this region of the nuclear genome. All seven insertions, which ranged in size from 210 to 228 nucleotides, had the conserved sequence and secondary structural elements of group I introns. The variation in distribution and sequence of group I introns within a short highly conserved region of rDNA presents a unique opportunity for examining the molecular evolution and mobility of group I introns within a systematics framework. PMID:1453441

  20. Xeroderma Pigmentosum Group F Caused by a Defect in a Structure-Specific DNA Repair Endonuclease

    Microsoft Academic Search

    Anneke M Sijbers; Wouter L de Laat; Rafael R Ariza; Maureen Biggerstaff; Ying-Fei Wei; Jonathan G Moggs; Kenneth C Carter; Brenda K Shell; Elizabeth Evans; Mariska C de Jong; Suzanne Rademakers; Johan de Rooij; Nicolaas G. J Jaspers; Jan H. J Hoeijmakers; Richard D Wood

    1996-01-01

    Nucleotide excision repair, which is defective in xeroderma pigmentosum (XP), involves incision of a DNA strand on each side of a lesion. We isolated a human gene homologous to yeast Rad1 and found that it corrects the repair defects of XP group F as well as rodent groups 4 and 11. Causative mutations and strongly reduced levels of encoded protein

  1. Inverse phosphotriester DNA synthesis using photochemically-removable dimethoxybenzoin phosphate protecting groups

    SciTech Connect

    Pirrung, M.C.; Fallon, L.; Lever, D.C.; Shuey, S.W. [Duke Univ., Durham, NC (United States)] [Duke Univ., Durham, NC (United States)

    1996-03-22

    A method has been developed to prepare short DNA sequences using light to deprotect a nucleoside 3{prime}-phosphotriester, generating a phosphodiester useful for coupling with a free 5{prime}-OH-nucleotide. The dimethoxybenzoin group is used as the photochemically-removable protecting group for the 3{prime}-phosphate. Cyanoethyl is most effective as the second protecting group on the phosphodiester. Because the method is directed at the preparation and use of the DNA sequences while still bound to the support, allyl and allyloxycarbonyl protecting groups are used for the nitrogenous bases since, based on the work of Hayakawa and Noyori, they can be removed without cleaving the DNA from the support. Two simple trinucleotides have been prepared in solution using this method. It has been demonstrated that the photochemical deprotection conditions do not lead to the formation of cyclobutane dimers from adjacent T residues. 2 figs., 2 tabs.

  2. DNA Methylation Patterns in Peripheral Blood of Pregnant Women With Group B Streptococcus Colonization.

    PubMed

    Wright, Michelle L; Ralph, Jody L; Korniewicz, Denise M

    2015-07-01

    The primary risk factor for neonatal Group B streptococcus (GBS) infection, which is the leading cause of infectious neonatal morbidity and mortality, is maternal colonization. However, no definitive maternal risk factors for GBS colonization have been identified and no systematic efforts have been made to prevent maternal colonization. The purpose of this exploratory secondary analysis was to evaluate genome-wide DNA methylation patterns in maternal peripheral blood early in pregnancy for association with GBS colonization status in the third trimester. Genome-wide DNA methylation was analyzed from 18 nulliparous GBS-positive and -negative women (n = 9/group) recruited for a previous study. No statistically significant differences in baseline characteristics or DNA methylation in peripheral blood were identified between GBS-positive and -negative women in early pregnancy. The results suggest that DNA methylation patterns in peripheral blood are not associated with risk for GBS colonization. PMID:25964656

  3. Family selection study among DNA samples collected from Amerindian ethnic group (Wayuu) in northern Colombia

    Microsoft Academic Search

    Toshimichi Yamamoto; Tadashi Gomyoda; Toshinari Ito; Kaoru Saijo; Inaho Danjoh; Yukio Nakamura

    In the Sonoda-Tajima Cell Collection, one of the cell bank of RIKEN BioResource Center, DNA samples from an Amerindian ethnic minority group (Wayuu) in Colombia analysed for 21 autosomal STRs, 17 Y-STRs and HV-I and -II regions in mtDNA to select the kinships among those samples in order to study on how the kinships influence population genetic analysis. As a

  4. Spy: A New Group of Eukaryotic DNA Transposons without Target Site Duplications

    PubMed Central

    Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

    2014-01-01

    Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5?-AAA and TTT-3? host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. PMID:24966181

  5. Spy: a new group of eukaryotic DNA transposons without target site duplications.

    PubMed

    Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

    2014-07-01

    Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5'-AAA and TTT-3' host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. PMID:24966181

  6. Two-stage dynamic DNA quality check by xeroderma pigmentosum group C protein

    PubMed Central

    Camenisch, Ulrike; Träutlein, Daniel; Clement, Flurina C; Fei, Jia; Leitenstorfer, Alfred; Ferrando-May, Elisa; Naegeli, Hanspeter

    2009-01-01

    Xeroderma pigmentosum group C (XPC) protein initiates the DNA excision repair of helix-distorting base lesions. To understand how this versatile subunit searches for aberrant sites within the vast background of normal genomic DNA, the real-time redistribution of fluorescent fusion constructs was monitored after high-resolution DNA damage induction. Bidirectional truncation analyses disclosed a surprisingly short recognition hotspot, comprising ?15% of human XPC, that includes two ?-hairpin domains with a preference for non-hydrogen-bonded bases in double-stranded DNA. However, to detect damaged sites in living cells, these DNA-attractive domains depend on the partially DNA-repulsive action of an adjacent ?-turn extension that promotes the mobility of XPC molecules searching for lesions. The key function of this dynamic interaction surface is shown by a site-directed charge inversion, which results in increased affinity for native DNA, retarded nuclear mobility and diminished repair efficiency. These studies reveal a two-stage discrimination process, whereby XPC protein first deploys a dynamic sensor interface to rapidly interrogate the double helix, thus forming a transient recognition intermediate before the final installation of a more static repair-initiating complex. PMID:19609301

  7. Spy: A New Group of Eukaryotic DNA Transposons without Target Site Duplications

    E-print Network

    Feschotte, Cedric

    Spy: A New Group of Eukaryotic DNA Transposons without Target Site Duplications Min-Jin Han1 , Hong called Spy, whichalso include TIRsand DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 50 - AAA and TTT-30

  8. Sequence variation of the rDNA ITS regions within and between anastomosis groups in Rhizoctonia solani

    Microsoft Academic Search

    Shiro Kuninaga; Tomohide Natsuaki; Toru Takeuchi; Ryozo Yokosawa

    1997-01-01

    Sequence analysis of the rDNA region containing the internal transcribed spacer (ITS) regions and the 5.8s rDNA coding sequence was used to evaluate the genetic diversity of 45 isolates within and between anastomosis groups (AGs)\\u000a in Rhizoctonia solani. The 5.8s rDNA sequence was completely conserved across all the AGs examined, whereas the ITS rDNA sequence was found to be highly

  9. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups

    PubMed Central

    Peacock-Villada, Alexandra; Coljee, Vincent; Danilowicz, Claudia; Prentiss, Mara

    2015-01-01

    Accurate sequence dependent pairing of single-stranded DNA (ssDNA) molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones. PMID:26115175

  10. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

    PubMed

    Peacock-Villada, Alexandra; Coljee, Vincent; Danilowicz, Claudia; Prentiss, Mara

    2015-01-01

    Accurate sequence dependent pairing of single-stranded DNA (ssDNA) molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones. PMID:26115175

  11. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-01-01

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ? I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study. PMID:25100254

  12. Restriction fragment length polymorphism of 195 bp repeated satellite dna of Trypanosoma cruzi supports the existence of two phylogenetic groups

    Microsoft Academic Search

    Brigitte Bastrenta; Marie France Bosseno; Christian Barnabé; Michel Tibayrenc; Simone Frédérique Brenière

    1999-01-01

    Hinf I) and high molecular weight DNA (Hae III), while group 2 presents a ladder profile for each enzyme, which is a characteristic of tandemly repeated DNA. The two groups, respectively, clustered stocks pertaining to the two principal lineages evidenced by isoenzyme and RAPD markers. The congruence among these three independent genomic markers corroborates the existence of two real phylogenetic

  13. Distinct Structural Features of the Peroxide Response Regulator from Group A Streptococcus Drive DNA Binding

    PubMed Central

    Hammel, Michal; Nix, Jay C.; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

    2014-01-01

    Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators. PMID:24586487

  14. Ternary DNA chip based on a novel thymine spacer group chemistry.

    PubMed

    Yang, Yanli; Yildiz, Umit Hakan; Peh, Jaime; Liedberg, Bo

    2015-01-01

    A novel thymine-based surface chemistry suitable for label-free electrochemical DNA detection is described. It involves a simple two-step sequential process: immobilization of 9-mer thymine-terminated probe DNAs followed by backfilling with 9-mer thymine-based spacers (T9). As compared to commonly used organic spacer groups like 2-mercaptoethanol, 3-mercapto-1-propanol and 6-mercapto-1-hexanol, the 9-mer thymine-based spacers offer a 10-fold improvement in discriminating between complementary and non-complementary target hybridization, which is due mainly to facilitated transport of the redox probes through the probe-DNA/T9 layers. Electrochemical measurements, complemented with Surface Plasmon Resonance (SPR) and Quartz Crystal Microbalance (QCM-D) binding analyses, reveal that optimum selectivity between complementary and non-complementary hybridization is obtained for a sensing surface prepared using probe-DNA and backfiller T9 at equimolar concentration (1:1). At this particular ratio, the probe-DNAs are preferentially oriented and easily accessible to yield a sensing surface with favorable hybridization and electron transfer characteristics. Our findings suggest that oligonucleotide-based spacer groups offer an attractive alternative to short organic thiol spacers in the design of future DNA biochips. PMID:25465760

  15. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia.

    PubMed

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-11-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks). PMID:25051224

  16. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia

    PubMed Central

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W.; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-01-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks). PMID:25051224

  17. The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J

    Microsoft Academic Search

    Marieke Levitus; Quinten Waisfisz; Barbara C Godthelp; Yne de Vries; Shobbir Hussain; Wouter W Wiegant; Elhaam Elghalbzouri-Maghrani; Jûrgen Steltenpool; Martin A Rooimans; Gerard Pals; Fré Arwert; Christopher G Mathew; Ma?gorzata Z Zdzienicka; Kevin Hiom; Johan P De Winter; Hans Joenje

    2005-01-01

    The protein predicted to be defective in individuals with Fanconi anemia complementation group J (FA-J), FANCJ, is a missing component in the Fanconi anemia pathway of genome maintenance. Here we identify pathogenic mutations in eight individuals with FA-J in the gene encoding the DEAH-box DNA helicase BRIP1, also called FANCJ. This finding is compelling evidence that the Fanconi anemia pathway

  18. DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus

    PubMed Central

    Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R.; Stefanovi?, Saša; Dickinson, Timothy A.

    2015-01-01

    DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication of hawthorn materials in natural health products. PMID:25926325

  19. SUMOylation of xeroderma pigmentosum group C protein regulates DNA damage recognition during nucleotide excision repair.

    PubMed

    Akita, Masaki; Tak, Yon-Soo; Shimura, Tsutomu; Matsumoto, Syota; Okuda-Shimizu, Yuki; Shimizu, Yuichiro; Nishi, Ryotaro; Saitoh, Hisato; Iwai, Shigenori; Mori, Toshio; Ikura, Tsuyoshi; Sakai, Wataru; Hanaoka, Fumio; Sugasawa, Kaoru

    2015-01-01

    The xeroderma pigmentosum group C (XPC) protein complex is a key factor that detects DNA damage and initiates nucleotide excision repair (NER) in mammalian cells. Although biochemical and structural studies have elucidated the interaction of XPC with damaged DNA, the mechanism of its regulation in vivo remains to be understood in more details. Here, we show that the XPC protein undergoes modification by small ubiquitin-related modifier (SUMO) proteins and the lack of this modification compromises the repair of UV-induced DNA photolesions. In the absence of SUMOylation, XPC is normally recruited to the sites with photolesions, but then immobilized profoundly by the UV-damaged DNA-binding protein (UV-DDB) complex. Since the absence of UV-DDB alleviates the NER defect caused by impaired SUMOylation of XPC, we propose that this modification is critical for functional interactions of XPC with UV-DDB, which facilitate the efficient damage handover between the two damage recognition factors and subsequent initiation of NER. PMID:26042670

  20. High mobility group protein-mediated transcription requires DNA damage marker ?-H2AX.

    PubMed

    Singh, Indrabahadur; Ozturk, Nihan; Cordero, Julio; Mehta, Aditi; Hasan, Diya; Cosentino, Claudia; Sebastian, Carlos; Krüger, Marcus; Looso, Mario; Carraro, Gianni; Bellusci, Saverio; Seeger, Werner; Braun, Thomas; Mostoslavsky, Raul; Barreto, Guillermo

    2015-07-01

    The eukaryotic genome is organized into chromatins, the physiological template for DNA-dependent processes including replication, recombination, repair, and transcription. Chromatin-mediated transcription regulation involves DNA methylation, chromatin remodeling, and histone modifications. However, chromatin also contains non-histone chromatin-associated proteins, of which the high-mobility group (HMG) proteins are the most abundant. Although it is known that HMG proteins induce structural changes of chromatin, the processes underlying transcription regulation by HMG proteins are poorly understood. Here we decipher the molecular mechanism of transcription regulation mediated by the HMG AT-hook 2 protein (HMGA2). We combined proteomic, ChIP-seq, and transcriptome data to show that HMGA2-induced transcription requires phosphorylation of the histone variant H2AX at S139 (H2AXS139ph; ?-H2AX) mediated by the protein kinase ataxia telangiectasia mutated (ATM). Furthermore, we demonstrate the biological relevance of this mechanism within the context of TGF?1 signaling. The interplay between HMGA2, ATM, and H2AX is a novel mechanism of transcription initiation. Our results link H2AXS139ph to transcription, assigning a new function for this DNA damage marker. Controlled chromatin opening during transcription may involve intermediates with DNA breaks that may require mechanisms that ensure the integrity of the genome. PMID:26045162

  1. SUMOylation of xeroderma pigmentosum group C protein regulates DNA damage recognition during nucleotide excision repair

    PubMed Central

    Akita, Masaki; Tak, Yon-Soo; Shimura, Tsutomu; Matsumoto, Syota; Okuda-Shimizu, Yuki; Shimizu, Yuichiro; Nishi, Ryotaro; Saitoh, Hisato; Iwai, Shigenori; Mori, Toshio; Ikura, Tsuyoshi; Sakai, Wataru; Hanaoka, Fumio; Sugasawa, Kaoru

    2015-01-01

    The xeroderma pigmentosum group C (XPC) protein complex is a key factor that detects DNA damage and initiates nucleotide excision repair (NER) in mammalian cells. Although biochemical and structural studies have elucidated the interaction of XPC with damaged DNA, the mechanism of its regulation in vivo remains to be understood in more details. Here, we show that the XPC protein undergoes modification by small ubiquitin-related modifier (SUMO) proteins and the lack of this modification compromises the repair of UV-induced DNA photolesions. In the absence of SUMOylation, XPC is normally recruited to the sites with photolesions, but then immobilized profoundly by the UV-damaged DNA-binding protein (UV-DDB) complex. Since the absence of UV-DDB alleviates the NER defect caused by impaired SUMOylation of XPC, we propose that this modification is critical for functional interactions of XPC with UV-DDB, which facilitate the efficient damage handover between the two damage recognition factors and subsequent initiation of NER. PMID:26042670

  2. A Randomly Amplified Polymorphic DNA Marker Specific for the Bacillus cereus Group Is Diagnostic for Bacillus anthracis

    Microsoft Academic Search

    DANIELE DAFFONCHIO; SARA BORIN; GIUSEPPE FROVA; ROMINA GALLO; ELENA MORI; RENATO FANI; CLAUDIA SORLINI

    1999-01-01

    Aiming to develop a DNA marker specific for Bacillus anthracis and able to discriminate this species from Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides, we applied the randomly amplified polymorphic DNA (RAPD) fingerprinting technique to a collection of 101 strains of the genus Bacillus, including 61 strains of the B. cereus group. An 838-bp RAPD marker (SG-850) specific for B.

  3. Increased levels of chromosomal aberrations and DNA damage in a group of workers exposed to formaldehyde.

    PubMed

    Costa, Solange; Carvalho, Sandra; Costa, Carla; Coelho, Patrícia; Silva, Susana; Santos, Luís S; Gaspar, Jorge F; Porto, Beatriz; Laffon, Blanca; Teixeira, João P

    2015-07-01

    Formaldehyde (FA) is a commonly used chemical in anatomy and pathology laboratories as a tissue preservative and fixative. Because of its sensitising properties, irritating effects and cancer implication, FA accounts probably for the most important chemical-exposure hazard concerning this professional group. Evidence for genotoxic effects and carcinogenic properties in humans is insufficient and conflicting, particularly in regard to the ability of inhaled FA to induce toxicity on other cells besides first contact tissues, such as buccal and nasal cells. To evaluate the effects of exposure to FA in human peripheral blood lymphocytes, a group of 84 anatomy pathology laboratory workers exposed occupationally to FA and 87 control subjects were tested for chromosomal aberrations (CAs) and DNA damage (comet assay). The level of exposure to FA in the workplace air was evaluated. The association between genotoxicity biomarkers and polymorphic genes of xenobiotic-metabolising and DNA repair enzymes were also assessed. The estimated mean level of FA exposure was 0.38±0.03 ppm. All cytogenetic endpoints assessed by CAs test and comet assay % tail DNA (%TDNA) were significantly higher in FA-exposed workers compared with controls. Regarding the effect of susceptibility biomarkers, results suggest that polymorphisms in CYP2E1 and GSTP1 metabolic genes, as well as, XRCC1 and PARP1 polymorphic genes involved in DNA repair pathways are associated with higher genetic damage in FA-exposed subjects. Data obtained in this study show a potential health risk situation of anatomy pathology laboratory workers exposed to FA (0.38 ppm). Implementation of security and hygiene measures may be crucial to decrease risk. The obtained information may also provide new important data to be used by health care programs and by governmental agencies responsible for occupational health and safety. PMID:25711496

  4. Variability of Nuclear SSU-rDNA Group Introns Within Septoria Species: Incongruence with Host Sequence Phylogenies

    Microsoft Academic Search

    Nicolas Feau; Richard C. Hamelin; Louis Bernier

    2007-01-01

    We report structural features and distribution patterns of 26 different group I introns located at three distinct nucleotide\\u000a positions in nuclear small subunit ribosomal DNA (SSU-rDNA) of 10 Septoria and 4 other anamorphic species related to the teleomorphic genus Mycosphaerella. Secondary structure and sequence characteristics assigned the introns to the common IC1 and IE groups. Intron distribution\\u000a patterns and phylogenetic

  5. Complex Evolutionary History of the Aeromonas veronii Group Revealed by Host Interaction and DNA Sequence Data

    PubMed Central

    Faucher, Joshua; Horneman, Amy J.; Gogarten, J. Peter; Graf, Joerg

    2011-01-01

    Aeromonas veronii biovar sobria, Aeromonas veronii biovar veronii, and Aeromonas allosaccharophila are a closely related group of organisms, the Aeromonas veronii Group, that inhabit a wide range of host animals as a symbiont or pathogen. In this study, the ability of various strains to colonize the medicinal leech as a model for beneficial symbiosis and to kill wax worm larvae as a model for virulence was determined. Isolates cultured from the leech out-competed other strains in the leech model, while most strains were virulent in the wax worms. Three housekeeping genes, recA, dnaJ and gyrB, the gene encoding chitinase, chiA, and four loci associated with the type three secretion system, ascV, ascFG, aexT, and aexU were sequenced. The phylogenetic reconstruction failed to produce one consensus tree that was compatible with most of the individual genes. The Approximately Unbiased test and the Genetic Algorithm for Recombination Detection both provided further support for differing evolutionary histories among this group of genes. Two contrasting tests detected recombination within aexU, ascFG, ascV, dnaJ, and gyrB but not in aexT or chiA. Quartet decomposition analysis indicated a complex recent evolutionary history for these strains with a high frequency of horizontal gene transfer between several but not among all strains. In this study we demonstrate that at least for some strains, horizontal gene transfer occurs at a sufficient frequency to blur the signal from vertically inherited genes, despite strains being adapted to distinct niches. Simply increasing the number of genes included in the analysis is unlikely to overcome this challenge in organisms that occupy multiple niches and can exchange DNA between strains specialized to different niches. Instead, the detection of genes critical in the adaptation to specific niches may help to reveal the physiological specialization of these strains. PMID:21359176

  6. Preparation of DNA Containing 5-Hydroxymethyl-2?-Deoxycytidine Modification Through Phosphoramidites with TBDMS as 5-Hydroxymethyl Protecting Group

    PubMed Central

    Dai, Qing; He, Chuan

    2013-01-01

    This unit describes procedures for preparation of two phosphoramidite building blocks III and IV, both containing a TBDMS as 5-CH2OH-protecting group. Phosphoramidites III and IV allow efficient incorporation of 5-hmC into DNA and a “one-step” deprotection procedure to cleanly remove all the protecting groups. A “two-step” deprotection strategy is compatible with ultramild DNA synthesis, which enables the synthesis of 5hmC-containing DNA with additional modifications. Methods are also presented for their incorporation into oligonucleotides by solid-phase synthesis, subsequent deprotection, and HPLC analysis. PMID:22147420

  7. Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species

    NASA Astrophysics Data System (ADS)

    Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

    2009-05-01

    Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1?g) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288?A. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35?A) and for the noncomplementary oligonucleotide (5.77?A). The drop in current after each event was clearly noticeable and it proved to be effective.

  8. MtDNA phylogeny and biogeography of Copelatinae, a highly diverse group of tropical diving beetles (Dytiscidae)

    Microsoft Academic Search

    Michael Balke; Ignacio Ribera; Alfried P. Vogler

    2004-01-01

    Copelatinae is a diverse lineage of diving beetles (Dytiscidae) frequently encountered in wet tropical and subtropical forests, but phylogenetic relationships are very poorly understood. We performed a phylogenetic and biogeographic analysis of this worldwide distributed group based on 50 species including a representative sample of major taxonomic groups and biogeographical regions. DNA sequences were obtained for the mitochondrial genes cytochrome

  9. Increased UV Resistance in Xeroderma Pigmentosum Group A Cells After Transformation With a Human Genomic DNA Clone

    Microsoft Academic Search

    Augustinus Rinaldy; Terri Bellew; Eric Egli; R. Stephen Lloyd

    1990-01-01

    Xeroderma pigmentosum (XP) is an autosomal recessive disease in which the major clinical manifestation is a 2000-fold enhanced probability of developing sunlight-induced skin tumors, and the molecular basis for the disease is a defective DNA excision repair system. To clone the gene defective in XP complementation group A (XP-A), cDNA clones were isolated by a competition hybridization strategy in which

  10. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  11. Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

    PubMed Central

    Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

    2000-01-01

    Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

  12. Nosocomial CDC group IV c-2 bacteremia: epidemiological investigation by randomly amplified polymorphic DNA analysis.

    PubMed Central

    Moissenet, D; Tabone, M D; Girardet, J P; Leverger, G; Garbarg-Chenon, A; Vu-Thien, H

    1996-01-01

    The CDC group IV c-2 bacterium is a gram-negative bacillus rarely isolated from clinical specimens. This organism caused catheter-related bacteremia in five immunocompromised children hospitalized in two distinct wards of our institution between November 1993 and October 1994. Three patients recovered on empiric antibacterial chemotherapy combining ceftazidime and amikacin, and a fourth patient required imipenem instead of ceftazidime. The fifth patient recovered without treatment. Catheter removal was never necessary. The randomly amplified polymorphic DNA technique with three different primers was applied to nine isolates recovered by culturing blood from the five children and showed that all of the patients harbored isolates of the same genotype. The source of the outbreak could not be determined. PMID:8727914

  13. Characterization of polymorphisms in the mitochondrial DNA of twelve ethnic groups in the Guizhou province of China.

    PubMed

    He, Yan; Ren, Ling-Yan; Shan, Ke-Ren; Zhang, Ting; Wang, Chan-Juan; Guan, Zhi-Zhong

    2014-03-24

    Abstract To characterize the genetic profiles and relationships between ancient ethnic populations, we analyzed polymorphisms in mitochondrial DNA (mtDNA) isolated from the blood of 753 members of 12 ethnic groups (Buyi, Dong, Gelao, Hui, Man, Miao, Menggu, Mulao, Maonan, Qiang, She and Zhuang) living in the Guizhou Province of China. The 9-bp deletion of mtDNA was detected by the polymerase chain reaction (PCR) and PCR-PAGE, and 11 SNPs by restriction fragment length polymorphism and mini-sequencing. Thereafter, these genotyping results were verified by PCR-DNA sequencing. The mtDNA of these populations exhibited considerable diversity, both with respect to the haplogroups M and N, and subgroups thereof. The differences between the major ethnic groups reflected the maternal inheritance. These ethnic groups in Guizhou demonstrated a genetic profile that differed considerably from that of other Asian populations. Our findings indicate that the matrilineal genetic profiles of Guizhou groups are relatively complex and distinct, showing relationships that reflect national history and geography. PMID:24660920

  14. New porphyrins bearing positively charged peripheral groups linked by a sulfonamide group to meso-tetraphenylporphyrin: interactions with calf thymus DNA.

    PubMed

    Manono, Janet; Marzilli, Patricia A; Marzilli, Luigi G

    2009-07-01

    New water-soluble cationic meso-tetraarylporphyrins (TArP, Ar = 4-C(6)H(4)) and some metal derivatives have been synthesized and characterized. One main goal was to assess if N-methylpyridinium (N-Mepy) groups must be directly attached to the porphyrin core for intercalative binding of porphyrins to DNA. The new porphyrins have the general formula, [T(R(2)R(1)NSO(2)Ar)P]X(4/8) (R(1) = CH(3) or H and R(2) = N-Mepy-n-CH(2) with n = 2, 3, or 4; or R(1) = R(2) = Et(3)NCH(2)CH(2)). Interactions of selected porphyrins and metalloporphyrins (Cu(II), Zn(II)) with calf thymus DNA were investigated by visible circular dichroism (CD), absorption, and fluorescence spectroscopies. The DNA-induced changes in the porphyrin Soret region (a positive induced CD feature and, at high DNA concentration, increases in the Soret band and fluorescence intensities) indicate that the new porphyrins interact with DNA in an outside, non-self-stacking binding mode. Several new metalloporphyrins did not increase DNA solution viscosity and thus do not intercalate, confirming the conclusion drawn from spectroscopic studies. Porphyrins known to intercalate typically bear two or more N-Mepy groups directly attached to the porphyrin ring, such as the prototypical meso-tetra(N-Mepy)porphyrin tetracation (TMpyP(4)). The distances between the nitrogens of the N-Mepy group are estimated to be approximately 11 A (cis) and 16 A (trans) for the relatively rigid TMpyP(4). For the new flexible porphyrin, [T(N-Mepy-4-CH(2)(CH(3))NSO(2)Ar)P]Cl(4), the distances between the nitrogens are estimated to be able to span the range from approximately 9 to approximately 25 A. Thus, the N-Mepy groups in the new porphyrins can adopt the same spacing as in known intercalators such as TMpyP(4). The absence of intercalation by the new porphyrins indicates that the propensity for the N-Mepy group to facilitate DNA intercalation of cationic porphyrins requires direct attachment of N-Mepy groups to the porphyrin core. PMID:19518079

  15. Yeast high mobility group protein HMO1 stabilizes chromatin and is evicted during repair of DNA double strand breaks.

    PubMed

    Panday, Arvind; Xiao, LiJuan; Grove, Anne

    2015-07-13

    DNA is packaged into condensed chromatin fibers by association with histones and architectural proteins such as high mobility group (HMGB) proteins. However, this DNA packaging reduces accessibility of enzymes that act on DNA, such as proteins that process DNA after double strand breaks (DSBs). Chromatin remodeling overcomes this barrier. We show here that the Saccharomyces cerevisiae HMGB protein HMO1 stabilizes chromatin as evidenced by faster chromatin remodeling in its absence. HMO1 was evicted along with core histones during repair of DSBs, and chromatin remodeling events such as histone H2A phosphorylation and H3 eviction were faster in absence of HMO1. The facilitated chromatin remodeling in turn correlated with more efficient DNA resection and recruitment of repair proteins; for example, inward translocation of the DNA-end-binding protein Ku was faster in absence of HMO1. This chromatin stabilization requires the lysine-rich C-terminal extension of HMO1 as truncation of the HMO1 C-terminal tail phenocopies hmo1 deletion. Since this is reminiscent of the need for the basic C-terminal domain of mammalian histone H1 in chromatin compaction, we speculate that HMO1 promotes chromatin stability by DNA bending and compaction imposed by its lysine-rich domain and that it must be evicted along with core histones for efficient DSB repair. PMID:25979266

  16. Cloning of Glycoprotein D cDNA, Which Encodes the Major Subunit of the Duffy Blood Group System and the Receptor for the Plasmodium vivax Malaria Parasite

    Microsoft Academic Search

    Asok Chaudhuri; Julia Polyakova; Valerie Zbrzezna; Kenneth Williams; Subhash Gulati; A. Oscar Pogo

    1993-01-01

    cDNA clones encoding the major subunit of the Duffy blood group were isolated from a human bone marrow cDNA library using a PCR-amplified DNA fragment encoding an internal peptide sequence of glycoprotein D (gpD) protein. The open reading frame of the 1267-bp cDNA clone indicated that gpD protein was composed of 338 amino acids, predicting a M_r of 35,733, which

  17. A small insertion in the SSU rDNA of the lichen fungus Arthonia lapidicola is a degenerate group-I intron

    Microsoft Academic Search

    Martin Grube; Andrea Gargas; Paula T. DePriest

    1996-01-01

    Insertions of less than 100 nt occurring in highly conserved regions of the small subunit ribosomal DNA (SSU rDNA) may represent\\u000a degenerate forms of the group-I introns observed at the same positions in other organisms. A 63-nt insertion at SSU rDNA position\\u000a 1512 (relative to theEscherichia coli SSU rDNA) of the lichen-forming fungusArthonia lapidicola can be folded into a secondary

  18. Localization of the 5S and 45S rDNA Sites and cpDNA Sequence Analysis in Species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae)

    PubMed Central

    VAIO, MAGDALENA; SPERANZA, PABLO; VALLS, JOSÉ FRANCISCO; GUERRA, MARCELO; MAZZELLA, CRISTINA

    2005-01-01

    • Background and Aims The Quadrifaria group of Paspalum (Poaceae, Paniceae) comprises species native to the subtropical and temperate regions of South America. The purpose of this research was to characterize the I genomes in five species of this group and to establish phylogenetic relationships among them. • Methods Prometaphase chromatin condensation patterns, the physical location of 5S and 45S rDNA sites by fluorescence in situ hybridization (FISH), and sequences of five chloroplast non-coding regions were analysed. • Key Results The condensation patterns observed were highly conserved among diploid and tetraploid accessions studied and not influenced by the dyes used or by the FISH procedure, allowing the identification of almost all the chromosome pairs that carried the rDNA signals. The FISH analysis of 5S rDNA sites showed the same localization and a correspondence between the number of sites and ploidy level. In contrast, the distribution of 45S rDNA sites was variable. Two general patterns were observed with respect to the location of the 45S rDNA. The species and cytotypes Paspalum haumanii 2x, P. intermedium 2x, P. quadrifarium 4x and P. exaltatum 4x showed proximal sites on chromosome 8 and two to four distal sites in other chromosomes, while P. quarinii 4x and P. quadrifarium 2x showed only distal sites located on a variable number of small chromosomes and on the long arm of chromosome 1. The single most-parsimonious tree found from the phylogenetic analysis showed the Quadrifaria species partitioned in two clades, one of them includes P. haumanii 2x and P. intermedium 2x together with P. quadrifarium 4x and P. exaltatum 4x, while the other contains P. quadrifarium 2x and P. quarinii 4x. • Conclusions The subdivision found with FISH is consistent with the clades recovered with cpDNA data and both analyses suggest that the Quadrifaria group, as presently defined, is not monophyletic and its species belong in at least two clades. PMID:15911540

  19. Analysis of a human DNA excision repair gene involved in group A xeroderma pigmentosum and containing a zinc-finger domain

    Microsoft Academic Search

    Kiyoji Tanaka; Naoyuki Miura; Ichiro Satokata; Iwai Miyamoto; Michihiro C. Yoshida; Yoshiaki Satoh; Seiji Kondo; Akira Yasui; Hiroto Okayama; Yoshio Okada

    1990-01-01

    XERODERMA pigmentosum (XP) is an autosomal recessive disease, characterized by a high incidence of sunlight-induced skin cancer. Cells from people with this condition are hypersensitive to ultraviolet because of a defect in DNA repair. There are nine genetic complementation groups of XP, groups A-H and a variant. We have cloned the mouse DNA repair gene that complements the defect of

  20. DNA FINGERPRINTING ANALYSIS OF VEGETATIVE COMPATIBILITY GROUPS IN ASPERGILLUS FLAVUS FROM A PEANUT FEILD IN GEORGIA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability of a species specific DNA probe pAF28 to correctly match 75 strains of A. flavus isolated from a peanut field in Georgia with one of 44 distinct VCGs was assessed. Multiple strains belonging to the same VCG typically produced identical DNA fingerprints with the exception of VCG 17 and V...

  1. Small subunit rDNA variation in a population of lichen fungi due to optional group-I introns.

    PubMed

    DePriest, P T

    1993-11-30

    A natural population of the lichen-forming ascomycetous fungus, Cladonia chlorophaea, contained individuals with small subunit ribosomal DNA (SSU rDNA) of at least four different size classes and nine restriction-site patterns. The source of these differences was the variable occurrence of 200-400-nucleotide insertions, previously identified as small group-I introns, at five different positions within the SSU coding region. By specific amplification of the sequences flanking these five intron positions with the polymerase chain reaction (PCR), a minimum of nine types of rDNA repeats were defined that differ in number, position, restriction pattern and size of introns. The positions of the introns were verified by sequence analysis. The variable distribution of these introns suggests that they are currently mobile--either by intron insertion, deletion or both--within this species complex. PMID:8244032

  2. Efimov-like phase of a three-stranded DNA and the renormalization-group limit cycle

    NASA Astrophysics Data System (ADS)

    Pal, Tanmoy; Sadhukhan, Poulomi; Bhattacharjee, Somendra M.

    2015-04-01

    A three-stranded DNA with short range base pairings only is known to exhibit a classical analog of the quantum Efimov effect, viz., a three-chain bound state at the two-chain melting point where no two are bound. By using a nonperturbative renormalization-group method for a rigid duplex DNA and a flexible third strand, with base pairings and strand exchange, we show that the Efimov-DNA is associated with a limit cycle type behavior of the flow of an effective three-chain interaction. The analysis also shows that thermally generated bubbles play an essential role in producing the effect. A toy model for the flow equations shows the limit cycle in an extended three-dimensional parameter space of the two-chain coupling and a complex three-chain interaction.

  3. Complete mtDNA genomes of Filipino ethnolinguistic groups: a melting pot of recent and ancient lineages in the Asia-Pacific region

    PubMed Central

    Delfin, Frederick; Min-Shan Ko, Albert; Li, Mingkun; Gunnarsdóttir, Ellen D; Tabbada, Kristina A; Salvador, Jazelyn M; Calacal, Gayvelline C; Sagum, Minerva S; Datar, Francisco A; Padilla, Sabino G; De Ungria, Maria Corazon A; Stoneking, Mark

    2014-01-01

    The Philippines is a strategic point in the Asia-Pacific region for the study of human diversity, history and origins, as it is a cross-road for human migrations and consequently exhibits enormous ethnolinguistic diversity. Following on a previous in-depth study of Y-chromosome variation, here we provide new insights into the maternal genetic history of Filipino ethnolinguistic groups by surveying complete mitochondrial DNA (mtDNA) genomes from a total of 14 groups (11 groups in this study and 3 groups previously published) including previously published mtDNA hypervariable segment (HVS) data from Filipino regional center groups. Comparison of HVS data indicate genetic differences between ethnolinguistic and regional center groups. The complete mtDNA genomes of 14 ethnolinguistic groups reveal genetic aspects consistent with the Y-chromosome, namely: diversity and heterogeneity of groups, no support for a simple dichotomy between Negrito and non-Negrito groups, and different genetic affinities with Asia-Pacific groups that are both ancient and recent. Although some mtDNA haplogroups can be associated with the Austronesian expansion, there are others that associate with South Asia, Near Oceania and Australia that are consistent with a southern migration route for ethnolinguistic group ancestors into the Asia-Pacific, with a timeline that overlaps with the initial colonization of the Asia-Pacific region, the initial colonization of the Philippines and a possible separate post-colonization migration into the Philippine archipelago. PMID:23756438

  4. Multiple Group I Introns in the Small-Subunit rDNA of Botryosphaeria dothidea: Implication for Intraspecific Genetic Diversity

    PubMed Central

    Xu, Chao; Wang, Chunsheng; Sun, Xinyao; Zhang, Rong; Gleason, Mark L.; Eiji, Tanaka; Sun, Guangyu

    2013-01-01

    Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU) ribosomal DNA (rDNA) sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF) for encoding the homing endonuclease (HE), whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron) and genotype IV (Bdo.S1199-B) were each found in only one strain, whereas genotype I (Bdo.S1199-A) and genotype II (Bdo.S943 and Bdo.S1506) occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea. PMID:23844098

  5. New epistasis group for the repair of DNA damage in bacteriophage T4: replication repair

    SciTech Connect

    Wachsman, J.T.; Drake, J.W.

    1987-03-01

    The gene 32 mutation amA453 sensitizes bacteriophage T4 to the lethal effects of ultraviolet (UV) irradiation, methyl methanesulfonate and angelicin-mediated photodynamic irradiation when treated particles are plated on amber-suppressing host cells. The increased UV sensitivity caused by amA453 is additive to that caused by mutations in both the T4 excision repair (denV) and recombination repair (uvsWXY) systems, suggesting the operation of third kind of repair system. The mutation uvs79, with many similarities to amA453 but mapping in gene 41, is largely epistatic to amA453. The mutation mms1, also with many similarities to amA453, maps close to amA453 within gene 32 and is largely epistatic to uvs79. Neither amA453 nor uvs79 affect the ratio of UV-induced mutational to lethal hits, nor does amA453 affect spontaneous or UV-enhanced recombination frequencies. Gene 32 encode the major T4 ssDNA-binding protein (the scaffolding of the DNA replication) and gene 41 encodes a DNA helicase, both being required for T4 DNA replication. The authors conclude that a third repair process operates in phage T4 and suggest that it acts during rather than before of after DNA replication.

  6. A small insertion in the SSU rDNA of the lichen fungus Arthonia lapidicola is a degenerate group-I intron.

    PubMed

    Grube, M; Gargas, A; DePriest, P T

    1996-05-01

    Insertions of less than 100 nt occurring in highly conserved regions of the small subunit ribosomal DNA (SSU rDNA) may represent degenerate forms of the group-I introns observed at the same positions in other organisms. A 63-nt insertion at SSU rDNA position 1512 (relative to the Escherichia coli SSU rDNA) of the lichen-forming fungus Arthonia lapidicola can be folded into a secondary structure with two stem loops and a pairing of the insertion and flanking sequences. The two stem loops may correspond to the P1 and P2, and the insertion-flanking pairing to the P10, of a group-I intron. Considering these small insertions as degenerate introns provides important clues to the evolution and catalytic function of group-I introns. Keywords Ribosomal DNA middle dot Small subunit middle dot 18s middle dot Degenerate introns middle dot Ascomycetes PMID:8662198

  7. Fetal blood grouping using cell free DNA - an improved service for RhD negative pregnant women.

    PubMed

    Bills, V L; Soothill, P W

    2014-04-01

    Red cell alloimmunisation involves the transplacental movement of maternally derived red cell antibodies into the fetal circulation, causing red cell haemolysis, fetal anaemia and ultimately fetal death. Current standard UK practice is to prevent sensitisation to the D antigen by administering anti-D at about 28 weeks' gestation to all RhD negative pregnancies. The determination of fetal blood group by non-invasive cell free fetal DNA testing offers an improved and more efficient service to RhD negative pregnant women and avoids the potential iatrogenic harm associated with standard practice. It also has significantly improved the management of women with red cell alloimunisation to D and other antigens. This review summarises the past and future management of red cell alloimmunisation during pregnancy and the impact of ffDNA tests. PMID:24679596

  8. Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

    PubMed

    Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

    2014-01-01

    A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays. PMID:24315613

  9. A Fuzzy Classifier to Taxonomically Group DNA Fragments within a Metagenome

    E-print Network

    Nicolescu, Monica

    is influenced by their habitat. Most microorganisms genomes are known from pure cul- tures of organisms isolated natural habitat as part of a community. Research has broadened from studying single species for isolation and lab cultivation of individual species [4]. The whole genome(DNA) or metagenome population can

  10. Different instability of the CAG microsatellite in two haplotype groups of human mitochondrial DNA polymerase gamma

    Microsoft Academic Search

    B. A. Malyarchuk; M. A. Perkova; M. V. Derenko

    2009-01-01

    Two single nucleotide polymorphisms of the mitochondrial DNA polymerase gamma gene (POLG1), rs2238296 (T\\/C) and rs758130 (T\\/C), were analyzed in individuals of different ethnicity (Russians and Buryats) with known\\u000a genotypes of the CAG microsatellite located in the same gene. It was shown that microsatellite alleles with repeat numbers\\u000a other than 10 were significantly more frequent within the TT haplotype. A

  11. Molecular Renormalization Group Coarse-Graining of Polymer Chains: Application to Double-Stranded DNA

    Microsoft Academic Search

    Alexey Savelyev; Garegin A. Papoian

    2009-01-01

    Coarse-graining of atomistic force fields allows us to investigate complex biological problems, occurring at long timescales and large length scales. In this work, we have developed an accurate coarse-grained model for double-stranded DNA chain, derived systematically from atomistic simulations. Our approach is based on matching correlators obtained from atomistic and coarse-grained simulations, for observables that explicitly enter the coarse-grained Hamiltonian.

  12. Cockayne syndrome group B protein regulates DNA double-strand break repair and checkpoint activation.

    PubMed

    Batenburg, Nicole L; Thompson, Elizabeth L; Hendrickson, Eric A; Zhu, Xu-Dong

    2015-05-12

    Mutations of CSB account for the majority of Cockayne syndrome (CS), a devastating hereditary disorder characterized by physical impairment, neurological degeneration and segmental premature aging. Here we report the generation of a human CSB-knockout cell line. We find that CSB facilitates HR and represses NHEJ. Loss of CSB or a CS-associated CSB mutation abrogating its ATPase activity impairs the recruitment of BRCA1, RPA and Rad51 proteins to damaged chromatin but promotes the formation of 53BP1-Rif1 damage foci in S and G2 cells. Depletion of 53BP1 rescues the formation of BRCA1 damage foci in CSB-knockout cells. In addition, knockout of CSB impairs the ATM- and Chk2-mediated DNA damage responses, promoting a premature entry into mitosis. Furthermore, we show that CSB accumulates at sites of DNA double-strand breaks (DSBs) in a transcription-dependent manner. The kinetics of DSB-induced chromatin association of CSB is distinct from that of its UV-induced chromatin association. These results reveal novel, important functions of CSB in regulating the DNA DSB repair pathway choice as well as G2/M checkpoint activation. PMID:25820262

  13. Effect of multifold charge groups and imidazole-4-carboxaldehyde on physicochemical characteristics and transfection of cationic polyphosphazenes/DNA complexes.

    PubMed

    Yang, Yongxin; Zhang, Zhiwen; Chen, Lingli; Li, Yaping

    2010-05-10

    To understand the dual influence of multifold charge groups and conjugation of imidazole moiety on the physicochemical characteristics and the transfection activity of polymer complexes, a series of cationic polyphosphazenes based on poly(2-(2-aminoethyoxy)ethoxy) phosphazene (PAEP) with different components of multifold charge groups was synthesized by means of introducing imidazole-4-carboxaldehyde (IC) into PAEP through the formation of Schiff base. Though the polymers with primary amino groups (1 degree) alone or with abundant primary amino groups could bind DNA more efficiently than the ones with mainly or totally secondary (2 degrees) and tertiary (3 degrees) amino groups, all of the polymers could condense DNA into small particles within 100nm at the N/P ratio of 24. The cell viability of complexes and the pH buffering capacity of polymers increased with substitution degree of IC increasing. Among all the PAEP-based polymers, the highest transfection activity was found for poly(2-(2-aminoethyoxy)ethoxy/IC)phosphazene (PAEIC) 18 complexes containing 1 degree, 2 degrees and 3 degrees amines at a ratio of 3.5:1:1 with 18% substitution degree of IC, which indicated that either the coexistence of 1 degree, 2 degrees and 3 degrees amines or the conjugation of imidazole moiety played an important role in transfection activity. These results suggested that the most efficient gene carrier could be these polymers with 1 degree, 2 degrees and 3 degrees amines at an appropriate ratio, together with the presence of imidazole moiety in a small fraction. PMID:20074628

  14. Chromosome 9: gene for blood group, Matt RidleySite: DNA Interactive (www.dnai.org)

    NSDL National Science Digital Library

    2008-10-06

    Interviewee: Matt Ridley DNAi Location:Genome>tour>genome spots>Blood groups Location: chromosome 9 gene name: ABO (galactosyl transferase) The ABO gene codes for an enzyme called galactosyl transferase and determines your blood group. In people with A and B blood groups, the gene differs by seven basepairs, four of which have an effect on the type, shape and activity of the enzyme. People with O blood group have a single deletion in the gene that causes an inactive protein to be made.

  15. Group IIC intron mobility into attC sites involves a bulged DNA stem-loop motif.

    PubMed

    Léon, Grégory; Roy, Paul H

    2009-08-01

    Bacterial group IIC introns are a subclass of group II intron ribozymes that are typically located downstream from transcriptional terminators. Class IIC-attC introns constitute a monophyletic subset of subgroup IIC, which preferentially insert into site-specific recombination sequences for integron integrases (attC). attCs are a diverse family of nucleotide sequences composed of conserved inverted repeats that flank a variable, but palindromic, central region. In this study, we used both PCR and colony patch hybridization methods to determine the basis for recognition of the attC(aadA1) stem-loop motif by the Serratia marcescens intron (S.ma.I2) in vivo. The quantitative results showed that mobility into the wild-type site occurs at a frequency of 18%, and is strongly biased by the orientation of the homing site relative to the direction of DNA replication. S.ma.I2 mobility results into mutant attC(aadA1) sites are consistent with recognition of stem-loop motifs in unwound DNA. The homing frequency results showed that, while the entire attC sequence is not necessary for recognition of the insertion site, short deletions of the attC stem-loop motif inhibited the intron mobility. Moreover, our data show that S.ma.I2 requires a bulged base in the folded attC stem for high homing frequency. We demonstrate that the IBS1/IBS3 motifs and two bulge bases conserved among attCs determine S.ma.I2 homing specificity for the attC bottom strand. These results suggest that class IIC-attC introns tolerate attC variation by recognition of a bulged hairpin DNA motif rather than a specific sequence. PMID:19509303

  16. Critical effect of the N2 amino group on structure, dynamics, and elasticity of DNA polypurine tracts.

    PubMed Central

    Lankas, Filip; Cheatham, Thomas E; Spacková, Nad'a; Hobza, Pavel; Langowski, Jörg; Sponer, Jirí

    2002-01-01

    Unrestrained 5-20-ns explicit-solvent molecular dynamics simulations using the Cornell et al. force field have been carried out for d[GCG(N)11GCG]2 (N, purine base) considering guanine*cytosine (G*C), adenine*thymine (A*T), inosine*5-methyl-cytosine (I*mC), and 2-amino-adenine*thymine (D*T) basepairs. The simulations unambiguously show that the structure and elasticity of N-tracts is primarily determined by the presence of the amino group in the minor groove. Simulated A-, I-, and AI-tracts show almost identical structures, with high propeller twist and minor groove narrowing. G- and D-tracts have small propeller twisting and are partly shifted toward the A-form. The elastic properties also differ between the two groups. The sequence-dependent electrostatic component of base stacking seems to play a minor role. Our conclusions are entirely consistent with available experimental data. Nevertheless, the propeller twist and helical twist in the simulated A-tract appear to be underestimated compared to crystallographic studies. To obtain further insight into the possible force field deficiencies, additional multiple simulations have been made for d(A)10, systematically comparing four major force fields currently used in DNA simulations and utilizing B and A-DNA forms as the starting structure. This comparison shows that the conclusions of the present work are not influenced by the force field choice. PMID:11964246

  17. Rapid Plant Identification Using Species- and Group-Specific Primers Targeting Chloroplast DNA

    PubMed Central

    Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

    2012-01-01

    Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory. PMID:22253728

  18. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    PubMed

    Wallinger, Corinna; Juen, Anita; Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

    2012-01-01

    Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory. PMID:22253728

  19. Interaction of FACT, SSRP1, and the high mobility group (HMG) domain of SSRP1 with DNA damaged by the anticancer drug cisplatin.

    PubMed

    Yarnell, A T; Oh, S; Reinberg, D; Lippard, S J

    2001-07-13

    The structure-specific recognition protein SSRP1, initially isolated from expression screening of a human B-cell cDNA library for proteins that bind to cisplatin (cis-diamminedichloroplatinum(II))-modified DNA, contains a single DNA-binding high mobility group (HMG) domain. Human SSRP1 purifies as a heterodimer of SSRP1 and Spt16 (FACT) that alleviates the nucleosomal block to transcription elongation by RNAPII in vitro. The affinity and specificity of FACT, SSRP1, and the isolated HMG domain of SSRP1 for cisplatin-damaged DNA were investigated by gel mobility shift assays. FACT exhibits both affinity and specificity for DNA damaged globally with cisplatin compared with unmodified DNA or DNA damaged globally with the clinically ineffective trans-DDP isomer. FACT binds the major 1,2-d(GpG) intrastrand cisplatin adduct, but its isolated SSRP1 subunit fails to form discrete, high affinity complexes with cisplatin-modified DNA under similar conditions. These results suggest that Spt16 primes SSRP1 for cisplatin-damaged DNA recognition by unveiling its HMG domain. As expected, the isolated HMG domain of SSRP1 is sufficient for specific binding to cisplatin-damaged DNA and binds the major cisplatin 1,2-d(GpG) intrastrand cross-link. The affinity and specificity of FACT for cisplatin-modified DNA, as well as its importance for transcription of chromatin, suggests that the interaction of FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. PMID:11344167

  20. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    PubMed

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants. PMID:25100013

  1. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    Microsoft Academic Search

    VIROJ BOONYARATANAKORNKIT; VIDA MELVIN; PAUL PRENDERGAST; MAGDA ALTMANN; LORENZA RONFANI; MARCO E. BIANCHI; LAIMA TARASEVICIENE; STEVEN K. NORDEEN; ELIZABETH A. ALLEGRETTO; DEAN P. EDWARDS

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence- specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen,

  2. High mobility group 1 and 2 proteins bind preferentially to DNA that contains bulky adducts induced by benzo(a)pyrene diol epoxide and N-acetoxy-acetylaminofluorene

    Microsoft Academic Search

    Piotr Widak

    2000-01-01

    High mobility group (HMG) proteins 1 and 2 are abundant non-histone chromosomal proteins that bind preferentially DNA that is bent or underwound. Previous studies have shown that these proteins preferentially bind to DNA damaged by the crosslinking agents cis-diammine-dichloro-platinum(II), chromium(III) and UV-C radiation. Here we have studied the binding of HMG-1\\/2 proteins to a duplex oligonucleotide damaged by benzo(a)pyrene diol

  3. Sensitive non-radioactive dot-blot hybridization using DNA probes labelled with chelate group substituted psoralen and quantitative detection by europium ion fluorescence.

    PubMed Central

    Oser, A; Roth, W K; Valet, G

    1988-01-01

    A new labelling method for cloned DNA probes used in hybridization assays is described. The DNA insert of recombinant plasmid DNA was made partially single-stranded for the labelling reaction by a restriction enzyme digest, followed by a controlled exonuclease III incubation. A thiol-containing psoralen derivative was covalently bound through irradiation with UV-light to the remaining double-stranded region of the plasmid DNA. The psoralen-SH groups were labelled with a large number of metal chelators (diethylentriamine pentaacetic acid, DTPA) using poly-L-lysine as a macromolecular carrier. The main advantage of the labelling procedure is that a high degree of labelling is achieved without modification of the single-stranded DNA hybridizing sequences. The specific hybrids were labelled after filter hybridization with europium ions through the chelating groups of DTPA. The europium ions were quantitatively detected by time-resolved fluorometry. The sensitivity of the assay for target DNA detection was in the low picogram range, comparable to radioactively labelled DNA probes. PMID:3344204

  4. Sequence-length variation of mtDNA HVS-I C-stretch in Chinese ethnic groups*

    PubMed Central

    Chen, Feng; Dang, Yong-hui; Yan, Chun-xia; Liu, Yan-ling; Deng, Ya-jun; Fulton, David J. R.; Chen, Teng

    2009-01-01

    The purpose of this study was to investigate mitochondrial DNA (mtDNA) hypervariable segment-I (HVS-I) C-stretch variations and explore the significance of these variations in forensic and population genetics studies. The C-stretch sequence variation was studied in 919 unrelated individuals from 8 Chinese ethnic groups using both direct and clone sequencing approaches. Thirty eight C-stretch haplotypes were identified, and some novel and population specific haplotypes were also detected. The C-stretch genetic diversity (GD) values were relatively high, and probability (P) values were low. Additionally, C-stretch length heteroplasmy was observed in approximately 9% of individuals studied. There was a significant correlation (r=?0.961, P<0.01) between the expansion of the cytosine sequence length in the C-stretch of HVS-I and a reduction in the number of upstream adenines. These results indicate that the C-stretch could be a useful genetic maker in forensic identification of Chinese populations. The results from the Fst and dA genetic distance matrix, neighbor-joining tree, and principal component map also suggest that C-stretch could be used as a reliable genetic marker in population genetics. PMID:19816995

  5. Drosophila Polycomb-group regulated chromatin inhibits the accessibility of a trans-activator to its target DNA.

    PubMed Central

    Zink, D; Paro, R

    1995-01-01

    The genes of the Polycomb-group (Pc-G) are responsible for maintaining the inactive expression state of homeotic genes. They act through specific cis-regulatory DNA elements termed PREs (Pc-G Response Elements). Multimeric complexes containing the Pc-G proteins are thought to induce heterochromatin-like structures, which stably and heritably inactivate transcription. We have tested the functional role of the FAB fragment, a PRE of the bithorax complex. We find that this element behaves as an orientation dependent silencer, capable of inducing mosaic gene expression on neighboring genes. Transgenic fly lines were constructed containing a PRE adjacent to a reporter gene inducible by the yeast GAL4 trans-activator. The competition between the activator and Pc-G-containing chromatin was visualized on polytene chromosomes using immunocytochemistry. The Pc-G protein Polycomb and GAL4 have mutually exclusive binding patterns, supporting the notion that Pc-G-induced chromatin structures can prevent activators from binding to their target sequences. However, this antagonistic function can be overcome by high doses of GAL4, even in the absence of DNA replication. Images PMID:8521823

  6. The Retrohoming of Linear Group II Intron RNAs in Drosophila melanogaster Occurs by Both DNA Ligase 4–Dependent and –Independent Mechanisms

    PubMed Central

    White, Travis B.; Lambowitz, Alan M.

    2012-01-01

    Mobile group II introns are bacterial retrotransposons that are thought to have invaded early eukaryotes and evolved into introns and retroelements in higher organisms. In bacteria, group II introns typically retrohome via full reverse splicing of an excised intron lariat RNA into a DNA site, where it is reverse transcribed by the intron-encoded protein. Recently, we showed that linear group II intron RNAs, which can result from hydrolytic splicing or debranching of lariat RNAs, can retrohome in eukaryotes by performing only the first step of reverse splicing, ligating their 3? end to the downstream DNA exon. Reverse transcription then yields an intron cDNA, whose free end is linked to the upstream DNA exon by an error-prone process that yields junctions similar to those formed by non-homologous end joining (NHEJ). Here, by using Drosophila melanogaster NHEJ mutants, we show that linear intron RNA retrohoming occurs by major Lig4-dependent and minor Lig4-independent mechanisms, which appear to be related to classical and alternate NHEJ, respectively. The DNA repair polymerase ? plays a crucial role in both pathways. Surprisingly, however, mutations in Ku70, which functions in capping chromosome ends during NHEJ, have only moderate, possibly indirect effects, suggesting that both Lig4 and the alternate end-joining ligase act in some retrohoming events independently of Ku. Another potential Lig4-independent mechanism, reverse transcriptase template switching from the intron RNA to the upstream exon DNA, occurs in vitro, but gives junctions differing from the majority in vivo. Our results show that group II introns can utilize cellular NHEJ enzymes for retromobility in higher organisms, possibly exploiting mechanisms that contribute to retrotransposition and mitigate DNA damage by resident retrotransposons. Additionally, our results reveal novel activities of group II intron reverse transcriptases, with implications for retrohoming mechanisms and potential biotechnological applications. PMID:22359518

  7. Microsatellite DNA analysis shows that greater sage grouse leks are not kin groups.

    PubMed

    Gibson, Robert M; Pires, Debra; Delaney, Kathleen S; Wayne, Robert K

    2005-12-01

    The spectacular social courtship displays of lekking birds are thought to evolve via sexual selection, but this view does not easily explain the participation of many males that apparently fail to mate. One of several proposed solutions to this 'lek skew paradox' is that kin selection favours low-ranking males joining leks to increase the fitness of closely related breeders. We investigated the potential for kin selection to operate in leks of the greater sage grouse, Centrocercus urophasianus, by estimating relatedness between lekking males using microsatellite DNA markers. We also calibrated these estimates using data from known families. Mean relatedness within leks was statistically indistinguishable from zero. We also found no evidence for local clustering of kin during lek display, although males tended to range closer to kin when off the lek. These results make kin selection an unlikely solution to the lek skew paradox in sage grouse. Together with other recent studies, they also raise the question of why kin selection apparently promotes social courtship in some lekking species, but not in others. PMID:16313605

  8. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit

    2014-01-01

    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  9. Motion of groups of atoms in DNA studied by molecular dynamics simulation

    Microsoft Academic Search

    D. Genest

    1998-01-01

    The analysis of Molecular Dynamics simulations of two double stranded oligonucleotides is presented in terms of motions of\\u000a quasi rigid subunits. First, a strategy is presented for grouping atoms submitted to concerted internal motions. The method\\u000a is based on the analysis of the interatomic distance RMS matrix. It is found that each nucleotide can reasonably be decomposed\\u000a into 3 or

  10. Two group I ribozymes with different functions in a nuclear rDNA intron.

    PubMed Central

    Decatur, W A; Einvik, C; Johansen, S; Vogt, V M

    1995-01-01

    DiSSU1, a mobile intron in the nuclear rRNA gene of Didymium iridis, was previously reported to contain two independent catalytic RNA elements. We have found that both catalytic elements, renamed GIR1 and GIR2, are group I ribozymes, but with differing functionality. GIR2 carries out the several reactions associated with self-splicing. GIR1 carries out a hydrolysis reaction at an internal processing site (IPS-1). These conclusions are based on the catalytic properties of RNAs transcribed in vitro. Mutation of the P7 pairing segment of GIR2 abrogated self-splicing, while mutation of P7 in GIR1 abrogated hydrolysis at the IPS-1. Much of the P2 stem and all of the associated loop could be deleted without effect on self-splicing. These results are accounted for by a secondary structure model, in which a long P2 pairing segment brings the 5' splice site to the GIR2 catalytic core. GIR1 is the smallest natural group I ribozyme yet reported and is the first example of a group I ribozyme whose presumptive biological function is hydrolysis. We hypothesize that GIR1-mediated cleavage of the excised intron RNA functions in the generation and expression of the mRNA for the intron-encoded endonuclease I-DirI. Images PMID:7556099

  11. MtDNA phylogeny and biogeography of Copelatinae, a highly diverse group of tropical diving beetles (Dytiscidae).

    PubMed

    Balke, Michael; Ribera, Ignacio; Vogler, Alfried P

    2004-09-01

    Copelatinae is a diverse lineage of diving beetles (Dytiscidae) frequently encountered in wet tropical and subtropical forests, but phylogenetic relationships are very poorly understood. We performed a phylogenetic and biogeographic analysis of this worldwide distributed group based on 50 species including a representative sample of major taxonomic groups and biogeographical regions. DNA sequences were obtained for the mitochondrial genes cytochrome oxidase I, cytochrome b, and 16S rRNA, for a total of 1575 aligned nucleotide positions. We found Copelatinae to be monophyletic, placed in a derived position and not sister to all remaining dytiscids, as had been suggested by earlier authors. The largest genus, Copelatus with some 460 known species was paraphyletic with respect to the smaller genera Lacconectus and Aglymbus. Among the major lineages of Copelatus, the subgenus Papuadytes was consistently recovered as sister to all other species (including Lacconectus and Aglymbus) with the possible exception of two western Palearctic taxa. We propose that the subgenus Papuadytes is removed from Copelatus and assigned generic status. Likewise, the two western Palearctic Copelatus are removed from this genus, and assigned the available genus name Liopterus. Our best phylogenetic hypothesis retrieved Afrotropical and New Guinean plus Australian species of Copelatus as monophyletic. Asian species were paraphyletic with respect to a species from Sulawesi which grouped with the species from New Guinea. Asian species were also paraphyletic with respect to Oriental Lacconectus, which was grouped with a clade of Neotropical species. Neotropical Copelatus form at least two separate lineages. The biogeographical evolution of Papuadytes is consistent with the relative age of the landmasses in the Austral region. Basal species are Australian, and successively derived ones are from New Caledonia and New Guinea. One species apparently dispersed from New Caledonia to China. Assuming a molecular clock and using a standard calibration of 2% divergence/MY the origin of Copelatinae is estimated to be between 85 and 95 MY. PMID:15288062

  12. Homing of a group II intron in yeast mitochondrial DNA is accompanied by unidirectional co-conversion of upstream-located markers.

    PubMed Central

    Lazowska, J; Meunier, B; Macadre, C

    1994-01-01

    Group II introns ai1 and ai2 of the Saccharomyces cerevisiae mitochondrial COXI gene encode proteins having a dual function (maturase and reverse transcriptase) and are mobile genetic elements. By construction of adequate donor genomes, we demonstrate that each of them is self-sufficient and practises homing in the absence of homing-type endonucleases encoded by either group I introns or the ENS2 gene. Each of the S. cerevisiae group II self-mobile introns was tested for its ability to invade mitochondrial DNA (mtDNA) from two related Saccharomyces species. Surprisingly, only ai2 was observed to integrate into both genomes. The non-mobility of ai1 was clearly correlated with some polymorphic changes occurring in sequences flanking its insertion sites in the recipient mtDNAs. Importantly, studies of the behaviour of these introns in interspecific crosses demonstrate that flanking marker co-conversion accompanying group II intron homing is unidirectional and efficient only in the 3' to 5' direction towards the upstream exon. Thus, the polar co-conversion and dependence of the splicing proficiency of the intron reported previously by us are hallmarks of group II intron homing, which significantly distinguish it from the strictly DNA-based group I intron homing and strictly RNA-based group II intron transposition. Images PMID:7525273

  13. DNA conjugation andDNA conjugation and reversibility onreversibility on

    E-print Network

    Rubloff, Gary W.

    DNA conjugation andDNA conjugation and reversibility onreversibility on chitosan surfaceschitosan surfaceschitosan surfaceschitosan surfaces Rubloff Research Group Accomplishments #12;DNA conjugation and reversibility onDNA conjugation and reversibility on chitosan surfaceschitosan surfaces Accomplishment Single

  14. Genetic linkage relationships between the Xg blood group system and two X chromosome DNA polymorphisms in families with Duchenne and Becker muscular dystrophy

    Microsoft Academic Search

    M. Sarfarazi; P. S. Harper; H. M. Kingston; J. M. Murray; T. O'Brien; K. E. Davies; R. Williamson; P. Tippett; R. Sanger

    1983-01-01

    The existence of linkage has been investigated between the Xg blood group system, two DNA restriction fragment length polymorphisms (RFLPs) located on the short arm of the X chromosome, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD). No linkage was found between the Xg locus and the more proximal RFLP (L1.28); close linkage between Xg and the more distal

  15. DNA Evidence on the Phylogenetic Systematics of New World Monkeys: Support for the Sister-Grouping of Cebus and Saimiri from Two Unlinked Nuclear Genes

    Microsoft Academic Search

    M. L. Harada; H. Schneider; M. P. C. Schneider; I. Sampaio; J. Czelusniak; M. Goodman

    1995-01-01

    Previous inferences from ?-globin gene sequences on cladistic relationships among the 16 extant genera of Ceboidea (the New World monkeys) were tested by strength of grouping and bootstrap values for the clades in the most parsimonious trees found: for this epsilon data set enlarged with additional Cebus and Saimiri orthologues; for another nuclear DNA sequence data set consisting of IRBP

  16. A DNA vaccine encoding a chimeric allergen derived from major group 1 allergens of dust mite can be used for specific immunotherapy

    PubMed Central

    Sun, Tong; Yin, Kang; Wu, Lu-Yi; Jin, Wen-Jie; Li, Yang; Sheng, Bin; Jiang, Yu-Xin

    2014-01-01

    Immunization with DNA-based constructs has been shown to be against the antigen and the response is skewed in such a way as to ameliorate the symptoms of allergic disease. This approach is particularly useful in the treatment of allergic inflammatory diseases, such as asthma. The major group 1 allergen from house dust mites is one of the triggers of allergic asthma. This study explores whether a chimeric gene R8, derived from the major group 1 allergen of house dust mite species (Dermatophagoides farinae and Dermatophagoides pteronyssinus), can be expressed in Human Embryonic Kidney 293 cells (HEK 293T) and whether such a construct can be used as a DNA vaccine in asthma therapy. The eukaryotic expression vector pcDNA3.1 was used to express the R8 molecule in HEK 293T cells and successful expression of R8 was confirmed using a fluorescence microscope and western blot analysis. The efficacy of R8 as DNA vaccine was also assessed in a mouse asthma model. The in vivo data showed that R8 rectified the TH1/TH2 imbalance typical of allergic inflammation and stimulated the proliferation of regulatory T (Treg) cells. Immunization with the R8 construct also decreased serum allergen-specific IgE production in this mouse asthma model. Our findings suggest that R8 may be a feasible potential DNA vaccine for specific immunotherapy (SIT) in the treatment of allergic asthma. PMID:25337189

  17. DNA sequence of the serum opacity factor of group A streptococci: identification of a fibronectin-binding repeat domain.

    PubMed Central

    Rakonjac, J V; Robbins, J C; Fischetti, V A

    1995-01-01

    The serum opacity factor (SOF) is a group A streptococcal protein that induces opacity of mammalian serum. The serum opacity factor 22 gene (sof22) from an M type 22 strain was cloned from an EMBL4 library by screening for plaques exhibiting serum opacity activity. DNA sequencing yielded an open reading frame of 3,075 bp. Its deduced amino acid sequence predicts a protein of 1,025 residues with a molecular weight of 112,735, a size that approximates that of the SOF22 protein isolated from both the original streptococcal strain and Escherichia coli harboring the cloned sof22 gene. The molecule is composed of three domains: an N-terminal domain responsible for the opacity reaction (opacity domain), a repeat domain with fibronectin-binding (Fn-binding) activity, and a C-terminal cell attachment domain. The C-terminal end of SOF22 is characterized by a hexameric LPXTGX motif, an adjacent hydrophobic region, and a charged C terminus, which are the hallmarks of cell-bound surface proteins found on nearly all gram-positive bacteria. Immediately upstream of this cell anchor region, SOF22 contains four tandem repeat sequence blocks, flanked by prolinerich segments. The repeats share up to 50% identity with a repeated motif found in other group A streptococcal Fn-binding proteins and exhibit Fn-binding activity, as shown by subcloning experiments. According to deletion analysis, the opacity domain is confined to the region N terminal to the repeat segment. Thus, SOF22 is unique among the known Fn-binding proteins from gram-positive bacteria in containing an independent module with a defined function in its N-terminal portion. Southern blot analysis with a probe from this N-terminal region indicates that the opacity domain of SOF varies extensively among different SOF-producing M types. PMID:7822031

  18. A novel phylogenetic group within Thozetella (Chaetosphaeriaceae): a new taxon based on morphology and DNA sequence analyses.

    PubMed

    Jeewon, R; Yeung, S Y Q; Hyde, K D

    2009-06-01

    A new species, Thozetella pinicola, was isolated from leaf litter of Pinus elliottii Engelm. in Hong Kong. This taxon is described and compared with existing species in the genus. It occurs on the substrate as creamy white sporodochia and has short black conidiophores. Morphological characters are typical of Thozetella and it most closely resembles Thozetella falcata, Thozetella gigantea and Thozetella nivea, but may be distinguished by its distinct microawns and different conidial size. To gain further taxonomic insight into the phylogenetic relationships of our new taxon and its allies, we sequenced and analysed 6 different regions of 3 genes (ribosomal DNA and protein coding genes: RNA polymerase II largest subunit (RBP2) and b-tubulin). Resulting phylogenies are compared with existing morphological information. Molecular data support the relationship between Thozetella species and the Chaetosphaeriaceae (Chaetosphaeriales, Sordariomycetes). In addition, we recovered a new phylogenetic lineage (or group) within the existing phylogenetic framework of Thozetella as previously proposed. In particular, there is a close association between T. pinicola and T. nivea, which is strongly supported. The affinities of these 2 newly sequenced taxa are discussed in light of morphological and molecular characters. PMID:19767838

  19. SSX2 is a novel DNA-binding protein that antagonizes polycomb group body formation and gene repression

    PubMed Central

    Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden; Moeller, Jesper Bonnet; Elias, Daniel; Lindgreen, Jonas Nørrelund; Schmidt, Steffen; Mollenhauer, Jan; Voldborg, Bjørn; Pedersen, Christina Bøg; Brückmann, Nadine Heidi; Møllegaard, Niels Erik; Ditzel, Henrik Jørn

    2014-01-01

    Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition and stability of PcG complexes, and there is no direct concordance between SSX2 and BMI1/H3K27me3 presence at regulated genes. This suggests that SSX2 antagonizes PcG function through an indirect mechanism, such as modulation of chromatin structure. SSX2 binds double-stranded DNA in a sequence non-specific manner in agreement with the observed widespread association with chromatin. Our results implicate SSX2 in regulation of chromatin structure and function. PMID:25249625

  20. Isolation of a new cDNA clone encoding an Rh polypeptide associated with the Rh blood group system

    Microsoft Academic Search

    Eiji Kajii; Fuminori Umenishi; Sadahiko Iwamoto; Shigenori Ikemoto

    1993-01-01

    The polymerase chain reaction (PCR) was used to amplify Rh-related cDNAs from erythroid cells cultured by the selective two-phase liquid culture system for human erythroid progenitors in peripheral blood. Direct sequencing based on PCR presents heterozygous bands. Two Rh polypeptide cDNAs have been isolated from the PCR products and tentatively designated RhPI cDNA and RhPII cDNA. Both cDNA clones have

  1. Cloning of glycoprotein D cDNA, which encodes the major subunit of the Duffy blood group system and the receptor for the Plasmodium vivax malaria parasite.

    PubMed Central

    Chaudhuri, A; Polyakova, J; Zbrzezna, V; Williams, K; Gulati, S; Pogo, A O

    1993-01-01

    cDNA clones encoding the major subunit of the Duffy blood group were isolated from a human bone marrow cDNA library using a PCR-amplified DNA fragment encoding an internal peptide sequence of glycoprotein D (gpD) protein. The open reading frame of the 1267-bp cDNA clone indicated that gpD protein was composed of 338 amino acids, predicting a M(r) of 35,733, which was the same as a deglycosylated gpD protein. Portions of the predicted amino acid sequence, matched with six CNBr/pepsin peptides obtained from affinity-purified gpD protein. In ELISA analysis, an anti-Duffy murine monoclonal antibody reacted with a synthetic peptide deduced from the cDNA clone. Hydropathy analysis suggested the presence of 9 membrane-spanning alpha-helices. In bone marrow RNA blot analysis, the gpD cDNA detected a 1.27-kb mRNA in Duffy-positive but not in Duffy-negative individuals. It also identified the same size mRNA in adult kidney, adult spleen, and fetal liver; in brain, it detected a prominent 8.5-kb and a minor 2.2-kb mRNA. In Southern blot analysis, gpD cDNA identified a single gene in Duffy-positive and -negative individuals. Duffy-negative individuals, therefore, have the gpD gene, but it is not expressed in bone marrow. The same or a similar gene is active in adult kidney, adult spleen, and fetal liver of Duffy-positive individuals. Whether this is true in Duffy-negative individuals remains to be demonstrated. A GenBank sequence search yielded a significant protein sequence homology to human and rabbit interleukin-8 receptors. Images Fig. 3 Fig. 4 PMID:8248172

  2. Protein kinase CK2 phosphorylates the high mobility group domain protein SSRP1, inducing the recognition of UV-damaged DNA.

    PubMed

    Krohn, Nicholas M; Stemmer, Christian; Fojan, Peter; Grimm, Rudi; Grasser, Klaus D

    2003-04-11

    The structure-specific recognition protein SSRP1 plays a role in transcription and replication in the chromatin context. Mediated by its C-terminal high mobility group (HMG) box domain, SSRP1 binds DNA non-sequence specifically but recognizes certain DNA structures. Using acetic acid urea polyacrylamide gel electrophoresis and mass spectrometry, we have examined the phosphorylation of maize SSRP1 by protein kinase CK2 alpha. The kinase phosphorylated several amino acid residues in the C-terminal part of the SSRP1 protein. Two phosphorylation sites were mapped in the very C-terminal region next to the HMG box domain, and about seven sites are localized within the acidic domain. Circular dichroism showed that the phosphorylation of the two C-terminal sites by CK2 alpha resulted in a structural change in the region of HMG box domain, because the negative peak of the CD spectrum at 222 nm was decreased by approximately 10%. In parallel, the phosphorylation induced the recognition of UV-damaged DNA, whereas the non-phosphorylated protein does not discriminate between UV-damaged DNA and control DNA. The affinity of CK2 alpha-phosphorylated SSRP1 for the DNA correlates with the degree of UV-induced DNA damage. Moreover, maize SSRP1 can restore the increased UV-sensitivity of a yeast strain lacking the NHP6A/B HMG domain proteins to levels of the control strain. Collectively, these findings indicate a role for SSRP1 in the UV response of eukaryotic cells. PMID:12571244

  3. Effect of the growth medium on the cellular fatty acid composition of aeromonads: consequences for the chemotaxonomic differentiation of DNA hybridization groups in the genus Aeromonas

    Microsoft Academic Search

    Geert Huys; Peter Kämpfer; Marc Vancanneyt; Renata Coopman; Paul Janssen; Karel Kersters

    1997-01-01

    A total of 30 genotypically-characterized Aeromonas strains, encompassing DNA hybridization groups (HGs) 1, 2, 3 (A. hydrophila), 4, 5A (A. caviae), and 8 (A. veronii biogroup sobria), were cultivated on two different media, nutrient-rich trypticase soy agar (TSA) and nutrient-poor R2A medium, and their fatty acid methyl esters (FAMEs) were analyzed using an automated gas–liquid chromatographic system. A comparison of

  4. The sporadic occurrence of a group I intron-like element in the mtDNA rnl gene of Ophiostoma novo-ulmi subsp. americana.

    PubMed

    Sethuraman, Jyothi; Okoli, Chukwuemeka V; Majer, Anna; Corkery, Tamara L C; Hausner, Georg

    2008-05-01

    The presence of group I intron-like elements within the U7 region of the mtDNA large ribosomal subunit RNA gene (rnl) was investigated in strains of Ophiostoma novo-ulmi subsp. americana from Canada, Europe and Eurasia, and in selected strains of O. ips, O. minus, O. piceae, O. ulmi, and O. himal-ulmi. This insertion is of interest as it has been linked previously to the generation of plasmid-like mtDNA elements in diseased strains of O. novo-ulmi. Among 197 O. novo-ulmi subsp. americana strains tested, 61 contained a 1.6kb insertion within the rnl-U7 region and DNA sequence analysis suggests the presence of a group I intron (IA1 type) that encodes a potential double motif LAGLIDADG homing endonuclease-like gene (HEG). Phylogenetic analysis of rnl-U7 intron encoded HEG-like elements supports the view that double motif HEGs originated from a duplication event of a single-motif HEG followed by a fusion event that combined the two copies into one open reading frame (ORF). The data also show that rnl-U7 intron encoded ORFs belong to a clade that includes ORFs inserted into different types of group I introns, e.g. IB, ID, IC3, IA1, present within a variety of different mtDNA genes, such as the small ribosomal subunit RNA gene (rns), apo-cytochrome b gene (cob), NADH dehydrogenase subunit 5 (nad5), cytochrome oxidase subunit 1 gene (coxI), and ATPase subunit 9 gene (atp9). We also compared the occurrence of the rnl-U7 intron in our collection of 227 strains with the presence of the rnl-U11 group I intron and concluded that the U7 intron appears to be an optional element and the U11 intron is probably essential among the strains tested. PMID:18406119

  5. Xeroderma pigmentosum complementation group C genotypes/diplotypes play no independent or interaction role with polycyclic aromatic hydrocarbons-DNA adducts for breast cancer risk.

    PubMed

    Shen, Jing; Gammon, Marilie D; Terry, Mary Beth; Teitelbaum, Susan L; Eng, Sybil M; Neugut, Alfred I; Santella, Regina M

    2008-03-01

    Xeroderma pigmentosum complementation group C (XPC) is an important DNA nuclear excision repair (NER) gene that recognises the damage caused by a variety of bulky DNA adducts. We evaluated the association of two common non-synonymous polymorphisms in XPC (Ala499Val and Lys939Gln) with breast cancer risk in the Long Island Breast Cancer Study Project (LIBCSP), a population-based case-control study. Genotyping of 1067 cases and 1110 controls was performed by a high throughput assay with fluorescence polarisation. There were no overall associations between XPC polymorphisms and breast cancer risk. A diplotype CC-CC was significantly associated with increased breast cancer risk compared with diplotype CA-CA (OR=1.4, 95%CI: 1.0-1.9), but was not significant when compared with all other diplotypes combined (OR=1.22, 95%CI: 0.97-1.53). No modification effects were observed for XPC genotypes by cigarette smoking status, smoking pack-years or polycyclic aromatic hydrocarbons (PAH)-DNA adducts. The increase in breast cancer risk was slightly more pronounced among women with detectable PAH-DNA adducts and carrying the diplotype CC-CC (OR=1.6, 95%CI: 1.1-2.2) compared to women with non-detectable PAH-DNA adducts carrying other diplotypes combined, but no statistically significant interaction was observed (P(interaction)=0.69). These data suggest that XPCs have neither independent effects nor interactions with cigarette smoking and PAH-DNA adducts for breast cancer risk. Further studies with multiple genetic polymorphisms in NER pathway are warranted. PMID:18053706

  6. Tuning the DNA Conformational Perturbations Induced by Cytotoxic Platinum-Acridine Bisintercalators: Effect of Metal cis/trans Isomerism and DNA Threading Groups

    PubMed Central

    Choudhury, Jayati Roy; Guddneppanavar, Rajsekhar; Saluta, Gilda; Kucera, Gregory L.; Bierbach, Ulrich

    2009-01-01

    Four highly charged, water soluble platinum-acridine bisintercalating agents have been synthesized. Depending on the cis/trans isomerism of the metal and the nature of the acridine side chains, bisintercalation induces/stabilizes the classical Watson-Crick B-form or a non-B-form. Circular dichroism spectra and chemical footprinting experiments suggest that compound 4, the most active derivative in HL-60 cells, produces a structurally severely perturbed DNA with features of a Hoogsteen base-paired biopolymer. PMID:18457380

  7. Establishment of a quality assurance program for human immunodeficiency virus type 1 DNA polymerase chain reaction assays by the AIDS Clinical Trials Group. ACTG PCR Working Group, and the ACTG PCR Virology Laboratories.

    PubMed Central

    Jackson, J B; Drew, J; Lin, H J; Otto, P; Bremer, J W; Hollinger, F B; Wolinsky, S M

    1993-01-01

    An independent quality assurance program has been established by the Virology Committee of the AIDS Clinical Trials Group in the Division of AIDS, National Institute of Allergy and Infectious Diseases, for monitoring polymerase chain reaction (PCR) assays for human immunodeficiency virus type 1 (HIV-1) DNA that are performed by 11 laboratories participating in multicenter clinical trials in the United States. To perform HIV-1 DNA PCR for patients in AIDS Clinical Trials Group protocols, each laboratory was initially certified by correctly testing a coded certification panel consisting of eight well-defined clinical whole-blood specimens and 30 cell pellets containing 0, 2, 5, 10, 20, or 50 8E5/LAV cells per 125,000 uninfected peripheral blood mononuclear cells. PCR was performed by one of two standardized commercial assays for amplification and nonisotopic detection of HIV-1 proviral DNA. For continuing certification, each laboratory must correctly test eight coded whole-blood samples per quarter and run three or four coded cell pellets and HIV-1 DNA copy standards with every PCR assay in real time. The PCR results for the coded pellets on each run are entered into an encrypted computer file, which immediately assesses the validity of the run. To date, 10 of 11 laboratories have correctly tested all HIV-1-positive and -negative samples in the initial certification panel on their first or second attempt. Subsequently, 9 of these 11 laboratories have continued to maintain their certified status. The use of commercial HIV-1 DNA PCR assays and an external quality assurance program have ensured that results from different laboratories are comparable and that problems with sensitivity and specificity are quickly identified. PMID:8308102

  8. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  9. The Rox1 repressor of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility-group motif.

    PubMed Central

    Balasubramanian, B; Lowry, C V; Zitomer, R S

    1993-01-01

    The ROX1 gene encodes a repressor of the hypoxic functions of the yeast Saccharomyces cerevisiae. The DNA sequence of the gene was determined and found to encode a protein of 368 amino acids. The amino-terminal third of the protein contains a high-mobility-group motif characteristic of DNA-binding proteins. To determine whether the Rox1 repressor bound DNA, the gene was expressed in Escherichia coli cells as a fusion to the maltose-binding protein and this fusion was partially purified by amylose affinity chromatography. By using a gel retardation assay, both the fusion protein and Rox1 itself were found to bind specifically to a synthetic 32-bp DNA containing the hypoxic consensus sequence. We assessed the role of the general repressor Ssn6 in ANB1 repression. An ANB1-lacZ fusion was expressed constitutively in an ssn6 deletion strain, and deletion of the Rox1 binding sites in the ANB1 upstream region did not increase the level of derepression, suggesting that Ssn6 exerts its effect through Rox1. Finally, ROX1 was mapped to yeast chromosome XVI, near the ARO7-OSM2 locus. Images PMID:8413209

  10. [Gene pool of ethnic groups of the caucasus: results of integrated study of the Y chromosome and mitochondrial DNA and genome-wide data].

    PubMed

    Khusnutdinova, E K; Litvinov, S S; Kutuev, I A; Iunusbaev, B B; Khusainova, R I; Akhmetova, V L; Ahatova, F S; Metspalu, E; Rootsi, S; Villems, R

    2012-06-01

    Genetic diversity has been analyzed in 22 ethnic groups of the Caucasus on the basis of data on Y-chromosome and mitochondrial DNA (mtDNA) markers, as well as genome-wide data on autosomal single-nucleotide polymorphisms (SNPs). It has been found that the West Asian component is prevailing in all ethnic groups studied except for Nogays. This Near Eastern ancestral component has proved to be characteristic of Caucasian populations and almost entirely absent in their northern neighbors inhabiting the Eastern European Plain. Turkic-speaking populations, except Nogays, did not exhibit an increased proportion of Eastern Eurasian mtDNA or Y-chromosome haplogroups compared to some Abkhaz-Adyghe populations (Adygs and Kabardians). Genome-wide SNP analysis has also shown substantial differences of Nogays from all other Caucasian populations studied. However, the characteristic difference of Nogays from other populations of the Caucasus seems somewhat ambiguous in terms of the R1a1a-M17(M198) and R1b1b1-M73 haplogroups of the Y chromosome. The state of these haplogroups in Turkic-speaking populations of the Caucasus requires further study. PMID:22946333

  11. DNA Barcoding of Rhodiola (Crassulaceae): A Case Study on a Group of Recently Diversified Medicinal Plants from the Qinghai-Tibetan Plateau

    PubMed Central

    Zhang, Jian-Qiang; Meng, Shi-Yong; Wen, Jun; Rao, Guang-Yuan

    2015-01-01

    DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences — rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS) — for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau. PMID:25774915

  12. DNA barcoding of Rhodiola (crassulaceae): a case study on a group of recently diversified medicinal plants from the Qinghai-Tibetan Plateau.

    PubMed

    Zhang, Jian-Qiang; Meng, Shi-Yong; Wen, Jun; Rao, Guang-Yuan

    2015-01-01

    DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences - rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS) - for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau. PMID:25774915

  13. DNA repair in normal human and xeroderma pigmentosum group A fibroblasts following treatment with various methanesulfonates and the demonstration of a long-patch repair component

    SciTech Connect

    Snyder, R.D.; Regan, J.D.

    1982-01-01

    Excision repair of DNA in normal and xeroderma pigmentosum complementation group A fibroblasts were examined following treatment with methyl-, ethyl-, and isopropyl methanesulfonate. Studies utilizing repair synthesis methods and inhibition with arabinofuranosyl cytosine revealed two distinct phases of repair; one commencing and terminating within the first 3-5 h after the treatment, and a second much longer phase extending from 9-35 h post-treatment. Both phases of repair have a long-patch component, which establishes for the first time the existence of this mode of repair in response to alkane sulfonate damage. While xeroderma cells display somewhat fewer alkaline labile sites in their DNA following alkylation treatment than do their normal counterparts, researchers are unable to demonstrate a deficiency of these cells in either of the two phases of repair.

  14. Prognostic implications of DNA aneuploidy in 156 untreated multiple myeloma patients. Castelano-Leonés (Spain) Cooperative Group for the Study of Monoclonal Gammopathies.

    PubMed

    García-Sanz, R; Orfão, A; González, M; Moro, M J; Hernández, J M; Ortega, F; Borrego, D; Carnero, M; Casanova, F; Jiménez, R

    1995-05-01

    In this study the incidence of DNA aneuploidy in a large series of untreated multiple myeloma (MM) patients was assessed in order to determine its clinical and prognostic significance. A total of 156 MM patients were included in the study. DNA measurements were performed in all cases at diagnosis using two different flow cytometry methods: (1) propidium iodide (PI) staining on isolated nuclei, and (2) CD38/PI double staining on whole cells. The DNA ploidy status was correlated with the most relevant clinical and haematological disease characteristics. From the 156 cases analysed, 91 (58%) were aneuploid (56% hyperdiploid and 2% hypodiploid). The correlation between the two techniques on the detection of DNA aneuploidy was excellent, although CD38/PI double staining would be preferable in cases with < 5% of DNA aneuploid plasma cells (PC). Upon comparing the clinical and haematological disease characteristics of hyperdiploid versus diploid cases, the former group was characterized by a lower age, reduced incidence of anaemia, lower beta 2M levels, higher proliferative activity within the residual normal haemopoietic cells, increased expression of CD56 antigen in PC, and higher proportion of PB CD4+ T cells. In contrast, diploid cases had a higher expression of the CD10, CD20 and CD15 antigens and greater numbers of PB CD56+CD3- NK cells (P < 0.05). Circulating PC were identified in six cases, all being diploid. Overall survival was significantly longer in hyperdiploid compared to diploid MM (P = 0.02). These results show that over 50% of MM patients are aneuploid, almost all of them being hyperdiploid. This characteristic is associated with better prognosis. PMID:7786771

  15. RAD25 (SSL2), the yeast homolog of the human xeroderma pigmentosum group B DNA repair gene, is essential for viability

    SciTech Connect

    Park, E.; Prakash, L. (Univ. of Rochester School of Medicine, NY (United States)); Guzder, S.N.; Prakash, S. (Univ. of Rochester, NY (United States)); Koken, M.H.M.; Jaspers-Dekker, I.; Weeda, G.; Hoeijmakers, H.J. (Erasmus Univ., Rotterdam (Netherlands))

    1992-12-01

    Xeroderma pigmentosum (XP) patients are extremely sensitive to ultraviolet (UV) light and suffer from a high incidence of skin cancers, due to a defect in nucleotide excision repair. The disease is genetically heterogeneous, and seven complementation groups, A-G, have been identified. Homologs of human excision repair genes ERCC1, XPDC/ERCC2, and XPAC have been identified in the yeast Saccharomyces cerevisiae. Since no homolog of human XPBC/ERCC3 existed among the known yeast genes, we cloned the yeast homolog by using XPBC cDNA as a hybridization probe. The yeast homolog, RAD25 (SSL2), encodes a protein of 843 amino acids (M[sub r] 95,356). The RAD25 (SSL2)- and XPCX-encoded proteins share 55% identical and 72% conserved amino acid residues, and the two proteins resemble one another in containing the conserved DNA helicase sequence motifs. A nonsense mutation at codon 799 that deletes the 45 C-terminal amino acid residues in RAD25 (SSL2) confers UV sensitivity. This mutation shows epistasis with genes in the excision repair group, whereas a synergistic increase in UN sensitivity occurs when it is combined with mutations in genes in other DNA repair pathways, indicating that RAD25 (SSL2) functions in excision repair but not in other repair pathways. We also show that RAD25 (SSL2) is an essential gene. A mutation of the Lys[sup 392] residue to arginine in the conserved Walker type A nucleotide-binding motif is lethal, suggesting an essential role of the putative RAD 25 (SSL2) ATPase/DNA helicase activity in viability. 40 refs., 3 figs., 1 tab.

  16. Allelic frequency distributions of 21 non-combined DNA index system STR loci in a Russian ethnic minority group from Inner Mongolia, China*

    PubMed Central

    Wang, Hong-dan; Shen, Chun-mei; Liu, Wen-juan; Zhang, Yu-dang; Yang, Guang; Yan, Jiang-wei; Qin, Hai-xia; Zhu, Bo-feng

    2013-01-01

    We studied the allelic frequency distributions and statistical forensic parameters of 21 new short tandem repeat (STR) loci and the amelogenin locus, which are not included in the combined DNA index system (CODIS), in a Russian ethnic minority group from the Inner Mongolia Autonomous Region, China. A total of 114 bloodstain samples from unrelated individuals were extracted and co-amplified with four fluorescence-labeled primers in a multiplex polymerase chain reaction (PCR) system. Using capillary electrophoresis, the PCR products of the 21 STR loci were separated and genotyped. A total of 161 alleles were observed in the Russian ethnic minority group, and corresponding allelic frequencies ranged from 0.0044 to 0.5965. The 21 non-CODIS STR loci of the Russian ethnic minority group were characterized by high genetic diversity and therefore may be useful for elucidating the population’s genetic background, for individual identification, and for paternity testing in forensic practice. PMID:23733431

  17. Allelic frequency distributions of 21 non-combined DNA index system STR loci in a Russian ethnic minority group from Inner Mongolia, China.

    PubMed

    Wang, Hong-dan; Shen, Chun-mei; Liu, Wen-juan; Zhang, Yu-dang; Yang, Guang; Yan, Jiang-wei; Qin, Hai-xia; Zhu, Bo-feng

    2013-06-01

    We studied the allelic frequency distributions and statistical forensic parameters of 21 new short tandem repeat (STR) loci and the amelogenin locus, which are not included in the combined DNA index system (CODIS), in a Russian ethnic minority group from the Inner Mongolia Autonomous Region, China. A total of 114 bloodstain samples from unrelated individuals were extracted and co-amplified with four fluorescence-labeled primers in a multiplex polymerase chain reaction (PCR) system. Using capillary electrophoresis, the PCR products of the 21 STR loci were separated and genotyped. A total of 161 alleles were observed in the Russian ethnic minority group, and corresponding allelic frequencies ranged from 0.0044 to 0.5965. The 21 non-CODIS STR loci of the Russian ethnic minority group were characterized by high genetic diversity and therefore may be useful for elucidating the population's genetic background, for individual identification, and for paternity testing in forensic practice. PMID:23733431

  18. Identification of group-I introns in the 28s rDNA of the entomopathogenic fungus Beauveria brongniartii

    Microsoft Academic Search

    C. Neuvéglise; Y. Brygoo

    1994-01-01

    The length of the 28s ribosomal DNA differs significantly between two strains (Bt102 and Bt114) of the entomopathogenic fungus Beauveria brongniartii. RFLP analysis on PCR products revealed the presence of three insertional elements of 350–450 bp in strain Bt114. One of the insertions has been cloned and sequenced and shown to possess all the characteristic sequences and secondary structures of

  19. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M

    Microsoft Academic Search

    Amom Ruhikanta Meetei; Annette L Medhurst; Chen Ling; Yutong Xue; Thiyam Ramsing Singh; Patrick Bier; Jurgen Steltenpool; Stacie Stone; Inderjeet Dokal; Christopher G Mathew; Maureen Hoatlin; Hans Joenje; Johan P de Winter; Weidong Wang

    2005-01-01

    Fanconi anemia is a genetic disease characterized by genomic instability and cancer predisposition. Nine genes involved in Fanconi anemia have been identified; their products participate in a DNA damage-response network involving BRCA1 and BRCA2 (refs. 2,3). We previously purified a Fanconi anemia core complex containing the FANCL ubiquitin ligase and six other Fanconi anemia-associated proteins. Each protein in this complex

  20. Both the folate cycle and betaine-homocysteine methyltransferase contribute methyl groups for DNA methylation in mouse blastocysts.

    PubMed

    Zhang, Baohua; Denomme, Michelle M; White, Carlee R; Leung, Kit-Yi; Lee, Martin B; Greene, Nicholas D E; Mann, Mellissa R W; Trasler, Jacquetta M; Baltz, Jay M

    2015-03-01

    The embryonic pattern of global DNA methylation is first established in the inner cell mass (ICM) of the mouse blastocyst. The methyl donor S-adenosylmethionine (SAM) is produced in most cells through the folate cycle, but only a few cell types generate SAM from betaine (N,N,N-trimethylglycine) via betaine-homocysteine methyltransferase (BHMT), which is expressed in the mouse ICM. Here, mean ICM cell numbers decreased from 18-19 in controls to 11-13 when the folate cycle was inhibited by the antifolate methotrexate and to 12-14 when BHMT expression was knocked down by antisense morpholinos. Inhibiting both pathways, however, much more severely affected ICM development (7-8 cells). Total SAM levels in mouse blastocysts decreased significantly only when both pathways were inhibited (from 3.1 to 1.6 pmol/100 blastocysts). DNA methylation, detected as 5-methylcytosine (5-MeC) immunofluorescence in isolated ICMs, was minimally affected by inhibition of either pathway alone but decreased by at least 45-55% when both BHMT and the folate cycle were inhibited simultaneously. Effects on cell numbers and 5-MeC levels in the ICM were completely rescued by methionine (immediate SAM precursor) or SAM. Both the folate cycle and betaine/BHMT appear to contribute to a methyl pool required for normal ICM development and establishing initial embryonic DNA methylation. PMID:25466894

  1. Ancient DNA from Hunter-Gatherer and Farmer Groups from Northern Spain Supports a Random Dispersion Model for the Neolithic Expansion into Europe

    PubMed Central

    Hervella, Montserrat; Izagirre, Neskuts; Alonso, Santos; Fregel, Rosa; Alonso, Antonio; Cabrera, Vicente M.; de la Rúa, Concepción

    2012-01-01

    Background/Principal Findings The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. Methodology/Significance Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria). In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples) and replication of the results (43% of the samples) by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. Conclusion The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study) suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different impact on the various geographic regions, and thus contradicts the more simplistic total acculturation and replacement models proposed so far to explain Neolithisation. PMID:22563371

  2. HPV E6/E7 mRNA versus HPV DNA biomarker in cervical cancer screening of a group of Macedonian women.

    PubMed

    Duvlis, Sotirija; Popovska-Jankovic, Katerina; Arsova, Zorica Sarafinovska; Memeti, Shaban; Popeska, Zaneta; Plaseska-Karanfilska, Dijana

    2015-09-01

    High risk types of human papillomaviruses E6/E7 oncogenes and their association with tumor suppressor genes products are the key factors of cervical carcinogenesis. This study proposed them as specific markers for cervical dysplasia screening. The aim of the study is to compare the clinical and prognostic significance of HPV E6/E7 mRNA as an early biomarker versus HPV DNA detection and cytology in triage of woman for cervical cancer. The study group consists of 413 women: 258 NILM, 26 ASC-US, 81 LSIL, 41 HSIL, and 7 unsatisfactory cytology. HPV4AACE screening, real-time multiplex PCR and MY09/11 consensus PCR primers methods were used for the HPV DNA detection. The real-time multiplex nucleic acid sequence-based assay (NucliSENS EasyQ HPV assay) was used for HPV E6/E7 mRNA detection of the five most common high risk HPV types in cervical cancer (16, 18, 31, 33, and 45). The results show that HPV E6/E7 mRNA testing had a higher specificity 50% (95% CI 32-67) and positive predictive value (PPV) 62% (95% CI 46-76) for CIN2+ compared to HPV DNA testing that had specificity of 18% (95% CI 7-37) and PPV 52% (95% CI 39-76) respectively. The higher specificity and PPV of HPV E6/E7 mRNA testing are valuable in predicting insignificant HPV DNA infection among cases with borderline cytological finding. It can help in avoiding aggressive procedures (biopsies and over-referral of transient HPV infections) as well as lowering patient's anxiety and follow up period. J. Med. Virol. 87:1578-1586, 2015. © 2015 Wiley Periodicals, Inc. PMID:25880030

  3. Comparison of the 5.8s rDNA and internal transcribed spacer sequences of isolates of Leptosphaeria maculans from different pathogenicity groups.

    PubMed

    Morales, V M; Pelcher, L E; Taylor, J L

    1993-01-01

    The regions coding for the 5.8s rRNA and the flanking internal transcribed spacers (ITS1 and ITS2) from nine isolates of the blackleg pathogen Leptosphaeria maculans and one isolate of Sclerotinia sclerotiorum were amplified by the polymerase chain reaction and sequenced. Five of the L. maculans isolates were highly virulent to Brassica plants, two were weakly virulent and two were isolated from the cruciferous weed Thlaspi arvense. The 5.8s DNA sequences of all L. maculans isolates were identical. However, there were major differences in both ITS1 and ITS2 sequences that correlated with the pathogenicity grouping. Phylogenetic analysis of the ITS sequences by both parsimony and maximum-likelihood methods indicated that each pathogenicity group was statistically different from each other with the weakly-virulent isolates being more closely related to the Thlaspi than to the highly-virulent isolates. The relationships of L. maculans to other fungi, based on a comparison of the 5.8s rDNA sequences, are discussed. PMID:8319307

  4. Improving the affinity of naphthalene diimide ligand to telomeric DNA by incorporating Zn²? ions into its dipicolylamine groups.

    PubMed

    Czerwinska, Izabella; Sato, Shinobu; Takenaka, Shigeori

    2012-11-01

    N,N'-bis[3-[3-(2,2'-dipicolyl)methylaminopropyl]-methylaminopropyl]naphthalene-1,4,5,8-tetracarboxylic acid diimide, 1, and its complex with zinc ions, 2, were investigated against telomeric sequences, [TAGGG(TTAGGG)(3)] and [AGGG(TTAGGG)(3)], which reveal different G-quadruplex structures depending on the conditions. Spectrophotometric, SPR, and CD techniques revealed that both ligands showed large binding constants to hybrid-type G-quadruplexes formed in the presence of K(+) ions. Moreover, 2 revealed higher affinity to investigated oligonucleotides suggesting that complex of naphthalene diimide derivative with Zn(2+), comparing to 1, provided additional electrostatic or coordination interactions between positively charged zinc ions and condensed negative charged phosphate anions from G4 DNA. PMID:23021342

  5. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing (Johns Hopkins Univ., Baltimore, MD (United States)); Chingnien Chen (National Inst. of Health, Bethesda, MD (United States))

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  6. Phylogenetic analysis of LSU and SSU rDNA group I introns of lichen photobionts associated with the genera Xanthoria and Xanthomendoza (Teloschistaceae, lichenized Ascomycetes)

    PubMed Central

    Nyati, Shyam; Bhattacharya, Debashish; Werth, Silke; Honegger, Rosmarie

    2013-01-01

    We studied group I introns in sterile cultures of selected groups of lichen photobionts, focusing on Trebouxia species associated with Xanthoria s. lat. (including Xanthomendoza spp.; lichen-forming ascomycetes). Group I introns were found inserted after position 798 (Escherichia coli numbering) in the large subunit (LSU) rRNA in representatives of the green algal genera Trebouxia and Asterochloris. The 798 intron was found in about 25% of Xanthoria photobionts including several reference strains obtained from algal culture collections. An alignment of LSU-encoded rDNA intron sequences revealed high similarity of these sequences allowing their phylogenetic analysis. The 798 group I intron phylogeny was largely congruent with a phylogeny of the Internal Transcribed Spacer Region (ITS), indicating that the insertion of the intron most likely occurred in the common ancestor of the genera Trebouxia and Asterochloris. The intron was vertically inherited in some taxa, but lost in others. The high sequence similarity of this intron to one found in Chlorella angustoellipsoidea suggests that the 798 intron was either present in the common ancestor of Trebouxiophyceae, or that its present distribution results from more recent horizontal transfers, followed by vertical inheritance and loss. Analysis of another group I intron shared by these photobionts at small subunit (SSU) position 1512 supports the hypothesis of repeated lateral transfers of this intron among some taxa, but loss among others. Our data confirm that the history of group I introns is characterized by repeated horizontal transfers, and suggests that some of these introns have ancient origins within Chlorophyta. PMID:24415800

  7. DNA evidence on the phylogenetic systematics of New World monkeys: support for the sister-grouping of Cebus and Saimiri from two unlinked nuclear genes.

    PubMed

    Harada, M L; Schneider, H; Schneider, M P; Sampaio, I; Czelusniak, J; Goodman, M

    1995-09-01

    Previous inferences from epsilon-globin gene sequences on cladistic relationships among the 16 extant genera of Ceboidea (the New World monkeys) were tested by strength of grouping and bootstrap values for the clades in the most parsimonious trees found: for this epsilon data set enlarged with additional Cebus and Saimiri orthologues; for another nuclear DNA sequence data set consisting of IRBP (interstitial retinol-binding protein gene) intron 1 orthologues; and for tandemly combined epsilon and IRBP sequences. Different ceboid species of the same genus always grouped strongly together as demonstrated by results on Cebus (capuchin monkeys), Saimiri (squirrel monkeys), Callicebus (titi monkeys), Aotus (night monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys). Other strong groupings that could be represented as monophyletic taxa in a cladistic classification were: Cebuella (pygmy marmoset) and Callithrix (marmoset) into subtribe Callitrichina; Callitrichina, Callimico (Goeldi's monkey), Leontopithecus (lion tamarin), and Saguinus (tamarin) into subfamily Callitrichinae; Callitrichinae, Aotus, Cebus, and Saimiri into family Cebidae; Cacajao (uakari monkey) and Chiropotes (saki) into subtribe Chiropotina; Chiropotina and Pithecia (bearded saki) into tribe Pitheciini; Pitheciini and Callicebus into subfamily Pitheciinae; Brachyteles (woolly spider monkey), Lagothrix (woolly monkey), and Ateles into tribe Atelini; and Atelini and Alouatta into subfamily Atelinae. In addition the epsilon and IRBP results congruently grouped (but at lesser strengths) Brachyteles and Lagothrix into subtribe Brachytelina within Atelini, and also Cebus and Saimiri into subfamily Cebinae within Cebidae. Because the IRBP results weakly grouped Pitheciinae with Cebidae, whereas the epsilon results weakly grouped Pitheciinae with Atelinae, the present evidence is best represented in an interim cladistic classification of ceboids by dividing the superfamily Ceboidea into three families: Atelidae, Pitheciidae, and Cebidae. PMID:8845968

  8. Molecular phylogeny of the subgenus Ceratotropis (genus Vigna, Leguminosae) reveals three eco-geographical groups and Late Pliocene–Pleistocene diversification: evidence from four plastid DNA region sequences

    PubMed Central

    Javadi, Firouzeh; Tun, Ye Tun; Kawase, Makoto; Guan, Kaiyun; Yamaguchi, Hirofumi

    2011-01-01

    Background and Aims The subgenus Ceratotropis in the genus Vigna is widely distributed from the Himalayan highlands to South, Southeast and East Asia. However, the interspecific and geographical relationships of its members are poorly understood. This study investigates the phylogeny and biogeography of the subgenus Ceratotropis using chloroplast DNA sequence data. Methods Sequence data from four intergenic spacer regions (petA-psbJ, psbD-trnT, trnT-trnE and trnT-trnL) of chloroplast DNA, alone and in combination, were analysed using Bayesian and parsimony methods. Divergence times for major clades were estimated with penalized likelihood. Character evolution was examined by means of parsimony optimization and MacClade. Key Results Parsimony and Bayesian phylogenetic analyses on the combined data demonstrated well-resolved species relationships in which 18 Vigna species were divided into two major geographical clades: the East Asia–Southeast Asian clade and the Indian subcontinent clade. Within these two clades, three well-supported eco-geographical groups, temperate and subtropical (the East Asia–Southeast Asian clade) and tropical (the Indian subcontinent clade), are recognized. The temperate group consists of V. minima, V. nepalensis and V. angularis. The subtropical group comprises the V. nakashimae–V. riukiuensis–V. minima subgroup and the V. hirtella–V. exilis–V. umbellata subgroup. The tropical group contains two subgroups: the V. trinervia–V. reflexo-pilosa–V. trilobata subgroup and the V. mungo–V. grandiflora subgroup. An evolutionary rate analysis estimated the divergence time between the East Asia–Southeast Asia clade and the Indian subcontinent clade as 3·62 ± 0·3 million years, and that between the temperate and subtropical groups as 2·0 ± 0·2 million years. Conclusions The findings provide an improved understanding of the interspecific relationships, and ecological and geographical phylogenetic structure of the subgenus Ceratotropis. The quaternary diversification of the subgenus Ceratotropis implicates its geographical dispersal in the south-eastern part of Asia involving adaptation to climatic condition after the collision of the Indian subcontinent with the Asian plate. The phylogenetic results indicate that the epigeal germination is plesiomorphic, and the germination type evolved independently multiple times in this subgenus, implying its limited taxonomic utility. PMID:21725064

  9. Synthesis and structure of a new tetracopper(II) complex bridged both by oxamido and phenolato groups: Cytotoxic activity, and reactivity towards DNA and BSA

    NASA Astrophysics Data System (ADS)

    Xu, Xiao-Wen; Li, Xue-Jie; Zhan, Shu-Hui; Li, Yan-Tuan; Wu, Zhi-Yong; Yan, Cui-Wei

    2013-05-01

    A new tetracopper(II) complex bridged both by oxamido and phenolato groups, namely [Cu4(chmpoxd)2(dabt)2](ClO4)2, where H3chmpoxd and dabt stand for N-(5-chloro-2-hydroxyl-phenyl)-N'-[3-(methylamino)propyl]oxamide and 2,2'-diamino-4,4'-bithiazole, respectively, has been synthesized and characterized by elemental analyses, molar conductance measurements, IR and electronic spectra studies, and single-crystal X-ray diffraction. The crystal structure reveals a centrosymmetric circular tetranuclear cation [Cu4(chmpoxd)2(dabt)2]2+ assembled by a pair of cis-oxamido-bridged bicopper(II) units via ?2-phenolato bridges, in which one copper(II) atom is located in a slightly distorted square-planar environment, while the other is in a square-pyramidal geometry. The Cu⋯Cu separations through the oxamido and the phenolato bridges are 5.2217(12) and 3.7042(11) Å, respectively. In vitro cytotoxicity experiment shows that the tetracopper(II) complex exhibits cytotoxic activity against the SMMC7721 and A549 cell lines. The reactivities towards HS-DNA and protein BSA revealed that the tetracopper(II) complex can interact with HS-DNA in the mode of intercalation, and the complex binds to BSA responsible for quenching of tryptophan fluorescence by static quenching mechanism.

  10. Isolation of a DNA polymerase I (polA) mutant of Rhizobium leguminosarum that has significantly reduced levels of an IncQ-group plasmid.

    PubMed

    Crank, S F; Downie, J A

    1994-04-01

    A population of Tn5 mutagenized Rhizobium leguminosarum cells was screened for mutants affected in protein secretion by introducing a plasmid carrying the Erwinia chrysanthemi prtB gene and screening for mutants defective in secretion of the protease PrtB. One such mutant (A301) also appeared to be defective in secretion of the R. leguminosarum nodulation protein NodO. Genetic analysis showed that the defect in A301 was caused by the Tn5 insertion. However the DNA sequence adjacent to the site of Tn5 insertion had significant homology to the Escherichia coli polA gene, which encodes DNA polymerase I. The mutant A301 showed increased sensitivity to ultraviolet light, a characteristic of polA mutants of E. coli. The apparent defect in secretion by A301 was due to a large decrease in the copy number of the IncQ group replicon on which prtB and nodO were cloned and this decreased the total amounts of PrtB or NodO protein synthesised and secreted by the polA mutant. The polA mutant had a lower growth rate than the parent strain on both rich and minimal media, but there was no obvious effect of the polA mutation on the symbiosis of R. leguminosarum bv. viciae with pea. PMID:8190065

  11. Functional constraints and evolutionary dynamics of the repeats in the rDNA internal transcribed spacer 2 of members of the Anopheles barbirostris group

    PubMed Central

    2014-01-01

    Background The Anopheles barbirostris group is widely distributed in Southeast Asia. Although seven species have been formally described, a molecular analysis of the rDNA ITS2 and the mitochondrial cytochrome oxidase I gene suggests that the group includes species that are morphologically very similar or identical. We have previously shown that species in the Anopheles barbirostris Subgroup have an exceptionally large ITS2 (>1.5 kb), greater than in any other Anopheline group. However, the molecular processes responsible for generating such a large ITS2 have not previously been explored. Methods To determine the processes by which this large ITS2 is generated, we examined the sequence and secondary structure of the ITS2 of 51 specimens from five species of the Anopheles barbirostris Subgroup. These include the anthropophilic species An. campestris and three morphospecies of the Barbirostris Complex: An. vanderwulpi, An. barbirostris I and III, together with a previously undescribed member of this group (Clade IV). Results and conclusions All the specimens were found to have an ITS2 greater than 1.5 kb in length. The possibility that the spacer sequences amplified were pseudogenes was examined and discarded. The large size of ITS2 in the species studied is due to the presence of internal repeats of approximately 110 bp in length, confined to the central region of the spacer. Repeats varied markedly between the species examined, with respect to their organization, number and sequence similarity. The nucleotide diversity increased in direct relation to size variation and the presence of non-repeated elements. A secondary structure analysis showed that the repeats form hairpin structures with a wide range of free energy values. These hairpin structures are known to facilitate the subsequent processing of mature rRNA. An analysis of the repeats from the different species suggests they originate from a common ancestor, with the repeats appearing before speciation of the Barbirostris Group. PMID:24646478

  12. Design, synthesis, and DNA binding characteristics of a group of orthogonally positioned diamino, N-formamido, pyrrole- and imidazole-containing polyamides.

    PubMed

    Chavda, Sameer; Babu, Balaji; Patil, Pravin; Plaunt, Adam; Ferguson, Amanda; Lee, Megan; Tzou, Samuel; Sjoholm, Robert; Rice, Toni; Mackay, Hilary; Ramos, Joseph; Wang, Shuo; Lin, Shicai; Kiakos, Konstantinos; Wilson, W David; Hartley, John A; Lee, Moses

    2013-07-01

    Orthogonally positioned diamino/dicationic polyamides (PAs) have good water solubility and enhanced binding affinity, whilst retaining DNA minor groove and sequence specificity compared to their monoamino/monocationic counterparts. The synthesis and DNA binding properties of the following diamino PAs: f-IPI (3a), f-IPP (4), f-PIP (5), and f-PPP (6) are described. P denotes the site where a 1-propylamino group is attached to the N1-position of the heterocycle. Binding of the diamino PAs to DNA was assessed by DNase I footprinting, thermal denaturation, circular dichroism titration, biosensor surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC) studies. According to SPR studies, f-IPI (3a) bound more strongly (K(eq)=2.4×10(8) M(-1)) and with comparable sequence selectivity to its cognate sequence 5'-ACGCGT-3' when compared to its monoamino analog f-IPI (1). The binding of f-IPI (3a) to 5'-ACGCGT-3' via the stacked dimer motif was balanced between enthalpy and entropy, and that was quite different from the enthalpy-driven binding of its monoamino parent f-IPI (1). f-IPP (4) also bound more strongly to its cognate sequence 5'-ATGCAT-3' (K(eq)=7.4×10(6) M(-1)) via the side-by-side stacked motif than its monoamino analog f-IPP (2a). Although f-PPP (6) bound via a 1:1 motif, it bound strongly to its cognate sequence 5'-AAATTT-3' (K(eq)=4.8×10(7) M(-1)), 15-times higher than the binding of its monoamino analog f-PPP (2c), albeit f-PPP bound via the stacked motif. Finally, f-PIP (5) bound to its target sequence 5'-ATCGAT-3' as a stacked dimer and it has the lowest affinity among the diamino PAs tested (Keq <1×10(5) M(-1)). This was about two times lower in affinity than the binding of its monoamino analog f-PIP (2b). The results further demonstrated that the 'core rules' of DNA recognition by monoamino PAs also apply to their diamino analogs. Specifically, PAs that contain a stacked IP core structure bind most strongly (highest binding constants) to their cognate GC doublet, followed by the binding of PAs with a stacked PP structure to two degenerate AT base pairs, and finally the binding of PAs with a PI core to their cognate CG doublet. PMID:23647824

  13. Redox-mediated mechanisms regulate DNA binding activity of the G-group of basic region leucine zipper (bZIP) transcription factors in Arabidopsis.

    PubMed

    Shaikhali, Jehad; Norén, Louise; de Dios Barajas-López, Juan; Srivastava, Vaibhav; König, Janine; Sauer, Uwe H; Wingsle, Gunnar; Dietz, Karl-Josef; Strand, Åsa

    2012-08-10

    Plant genes that contain the G-box in their promoters are responsive to a variety of environmental stimuli. Bioinformatics analysis of transcriptome data revealed that the G-box element is significantly enriched in promoters of high light-responsive genes. From nuclear extracts of high light-treated Arabidopsis plants, we identified the AtbZIP16 transcription factor as a component binding to the G-box-containing promoter fragment of light-harvesting chlorophyll a/b-binding protein2.4 (LHCB2.4). AtbZIP16 belongs to the G-group of Arabidopsis basic region leucine zipper (bZIP) type transcription factors. Although AtbZIP16 and its close homologues AtbZIP68 and AtGBF1 bind the G-box, they do not bind the mutated half-sites of the G-box palindrome. In addition, AtbZIP16 interacts with AtbZIP68 and AtGBF1 in the yeast two-hybrid system. A conserved Cys residue was shown to be necessary for redox regulation and enhancement of DNA binding activity in all three proteins. Furthermore, transgenic Arabidopsis lines overexpressing the wild type version of bZIP16 and T-DNA insertion mutants for bZIP68 and GBF1 demonstrated impaired regulation of LHCB2.4 expression. Finally, overexpression lines for the mutated Cys variant of bZIP16 provided support for the biological significance of Cys(330) in redox regulation of gene expression. Thus, our results suggest that environmentally induced changes in the redox state regulate the activity of members of the G-group of bZIP transcription factors. PMID:22718771

  14. New Group-Specific 16S rDNA Primers for Monitoring Foaming Mycolata During Saline Waste-Water Treatment

    Microsoft Academic Search

    L. A. I. de Azeredo; C. D. da Cunha; A. S. Rosado; A. Macrae; D. M. G. Freire; L. C. S. Mendonça-Hagler; G. L. Sant’Anna

    2006-01-01

    Newly designed group-specific PCR primers for denaturing gradient gel electrophoresis (DGGE) were used to investigate foaming\\u000a mycolata from a bioreactor treating an industrial saline waste-water. Genetic profiles on DGGE gels were different with NaCl\\u000a at 1.65 and 8.24 g l?1, demonstrating that mycolata community was affected by salinity. A semi-nested PCR strategy resulted in more bands in community\\u000a genetic profiles than direct

  15. SOXE transcription factors form selective dimers on non-compact DNA motifs through multifaceted interactions between dimerization and high-mobility group domains

    PubMed Central

    Huang, Yong-Heng; Jankowski, Aleksander; Cheah, Kathryn S. E.; Prabhakar, Shyam; Jauch, Ralf

    2015-01-01

    The SOXE transcription factors SOX8, SOX9 and SOX10 are master regulators of mammalian development directing sex determination, gliogenesis, pancreas specification and neural crest development. We identified a set of palindromic SOX binding sites specifically enriched in regulatory regions of melanoma cells. SOXE proteins homodimerize on these sequences with high cooperativity. In contrast to other transcription factor dimers, which are typically rigidly spaced, SOXE group proteins can bind cooperatively at a wide range of dimer spacings. Using truncated forms of SOXE proteins, we show that a single dimerization (DIM) domain, that precedes the DNA binding high mobility group (HMG) domain, is sufficient for dimer formation, suggesting that DIM?:?HMG rather than DIM:DIM interactions mediate the dimerization. All SOXE members can also heterodimerize in this fashion, whereas SOXE heterodimers with SOX2, SOX4, SOX6 and SOX18 are not supported. We propose a structural model where SOXE-specific intramolecular DIM:HMG interactions are allosterically communicated to the HMG of juxtaposed molecules. Collectively, SOXE factors evolved a unique mode to combinatorially regulate their target genes that relies on a multifaceted interplay between the HMG and DIM domains. This property potentially extends further the diversity of target genes and cell-specific functions that are regulated by SOXE proteins. PMID:26013289

  16. Isolation and Characterization of Human cDNA Clones Encoding a High Mobility Group Box Protein that Recognizes Structural Distortions to DNA Caused by Binding of the Anticancer Agent Cisplatin

    Microsoft Academic Search

    Suzanne L. Bruhn; Pieter M. Pil; John M. Essigmann; David E. Housman; Stephen J. Lippard

    1992-01-01

    Human cDNA clones encoding a structure-specific recognition protein, SSRP1, that binds specifically to DNA modified with cisplatin have been isolated and characterized. The SSRP1 gene maps to human chromosome 11q12. The cDNA clones, obtained by using partial-length cDNAs described previously, predict an 81-kDa protein containing several highly charged domains and a stretch of 75 amino acids 47% identical to a

  17. Exploring DNA

    NSDL National Science Digital Library

    Mrs. Flitton

    2008-08-13

    Get ready to learn an explore DNA, genes and proteins. By moving through the different topics, you will hopefully gain greater understanding of how DNA, genes, and proteins are all related. DNA to Protein Module You will zoom into the human body to see and read more about DNA. The Journey Into DNA DNA Workshop Activity- You try it! More DNA and Protein Synthesis ...

  18. Variations of SSU rDNA group I introns in different isolates of Cordyceps militaris and the loss of an intron during cross-mating.

    PubMed

    Lian, Tiantian; Yang, Tao; Sun, Junde; Guo, Suping; Yang, Huaijun; Dong, Caihong

    2014-08-01

    Cordyceps militaris, the type species of genus Cordyceps, is one of the most popular mushrooms and a nutraceutical in eastern Asia. It is considered a model organism for the study of Cordyceps species because it can complete its life cycle when cultured in vitro. In the present study, the occurrence and sequence variation of SSU rDNA group I introns, Cmi.S943 and Cmi.S1199, among different isolates of C. militaris were analyzed. Based on the secondary structure predictions, the Cmi.S943 intron has been placed in subgroup IC1, and the Cmi.S1199 intron has been placed in subgroup IE. No significant similarity between Cmi.S943 and Cmi.S1199 suggested different origins. Three genotypes, based on the frequency and distribution of introns, were described to discriminate the 57 surveyed C. militaris strains. It was found that the genotype was related to the stroma characteristics. The stromata of all of the genotype II strains, which possessed only Cmi.S943, could produce perithecium. In contrast, the stromata of all genotype III strains, which had both Cmi.S943 and Cmi.S1199, could not produce perithecium. Cmi.S1199 showed the lowest level of intra-specific variation among the tested strains. Group I introns can be lost during strain cross-mating. Therefore, we presumed that during cross-mating and recombination, intron loss could be driven by positive Darwinian selection due to the energetic cost of transcribing long introns. PMID:24996897

  19. Mucosal Immunization with High-Mobility Group Box 1 in Chitosan Enhances DNA Vaccine-Induced Protection against Coxsackievirus B3-Induced Myocarditis

    PubMed Central

    Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei

    2013-01-01

    Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

  20. Mucosal immunization with high-mobility group box 1 in chitosan enhances DNA vaccine-induced protection against coxsackievirus B3-induced myocarditis.

    PubMed

    Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei; Xiong, Sidong

    2013-11-01

    Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

  1. Efficient rejoining of radiation-induced DNA double-strand breaks in vertebrate cells deficient in genes of the RAD52 epistasis group

    Microsoft Academic Search

    Huichen Wang; Zhao-Chong Zeng; Tu-Anh Bui; Eiichiro Sonoda; Minoru Takata; Shunichi Takeda; George Iliakis

    2001-01-01

    Rejoining of ionizing radiation (IR) induced DNA DSBs usually follows biphasic kinetics with a fast (t50: 5–30 min) component attributed to DNA-PK-dependent non-homologous endjoining (NHEJ) and a slow (t50: 1–20 h), as of yet uncharacterized, component. To examine whether homologous recombination (HR) contributes to DNA DSB rejoining, a systematic genetic study was undertaken using the hyper-recombinogenic DT40 chicken cell line

  2. Collagen-DNA complex.

    PubMed

    Svintradze, David V; Mrevlishvili, George M; Metreveli, Nunu; Jariashvili, Ketevan; Namicheishvili, Luisa; Skopinska, Joana; Sionkowska, Alina

    2008-01-01

    Previously presented models of collagen-DNA (7) and collagen-siRNA (8) complexes point to a general description of delivery systems and indicate to what specific topology that system should be equipped with to effectively deliver the gene into the living body via in vivo and in vitro injection. We focused our interest on the nature of collagen-DNA complex structure and the molecular and environmental determinants of the self-association processes of collagen with the presence of DNA. In this aspect, the self-association of collagen-DNA complex offers an opportunity to characterize a unique system, which may be related to the general mechanisms of self-association of fiber macromolecules by water bridges. For characterizing the collagen-DNA interaction, we used FTIR-ATR, NMR, and AFM experiments done on a separate collagen film, DNA film, and on the peptide-DNA aqueous solution. We demonstrate that collagen-DNA spontaneously forms self-assembling complex systems in aqueous solution. Such self-association of the complex could be induced by electrostatic interactions between neutral collagen cylinders, having strong dipole moment, and negatively charged DNA cylinders. A final complex could be formed by hydrogen bonds between specified donor groups of collagen and phosphate acceptor groups of DNA. According to FTIR measurements, a collagen triple helix should not change global conformation during collagen-DNA complex formation. PMID:18052128

  3. Nanotechnology with DNA DNA Nanodevices

    E-print Network

    Ludwig-Maximilians-Universität, München

    Nanotechnology with DNA DNA Nanodevices Friedrich C. Simmel* and Wendy U. Dittmer A DNA actuator. Introduction.............285 2. Overview: DNA Nanotechnology.......285 3. Prototypes of Nanomechanical DNA overview of DNA nanotechnology as a whole is given. The most important properties of DNA molecules

  4. DNA microarray (spot) .

    E-print Network

    1. DNA microarray DNA (spot) . DNA probe , probe (hybridization) . DNA microarray cDNA oligonucleotide oligonucleotide cDNA probe . oligonucleotide microarray , DNA , probe . oligonucleotide microarray probe

  5. DNA codes

    SciTech Connect

    Torney, D. C. (David C.)

    2001-01-01

    We have begun to characterize a variety of codes, motivated by potential implementation as (quaternary) DNA n-sequences, with letters denoted A, C The first codes we studied are the most reminiscent of conventional group codes. For these codes, Hamming similarity was generalized so that the score for matched letters takes more than one value, depending upon which letters are matched [2]. These codes consist of n-sequences satisfying an upper bound on the similarities, summed over the letter positions, of distinct codewords. We chose similarity 2 for matches of letters A and T and 3 for matches of the letters C and G, providing a rough approximation to double-strand bond energies in DNA. An inherent novelty of DNA codes is 'reverse complementation'. The latter may be defined, as follows, not only for alphabets of size four, but, more generally, for any even-size alphabet. All that is required is a matching of the letters of the alphabet: a partition into pairs. Then, the reverse complement of a codeword is obtained by reversing the order of its letters and replacing each letter by its match. For DNA, the matching is AT/CG because these are the Watson-Crick bonding pairs. Reversal arises because two DNA sequences form a double strand with opposite relative orientations. Thus, as will be described in detail, because in vitro decoding involves the formation of double-stranded DNA from two codewords, it is reasonable to assume - for universal applicability - that the reverse complement of any codeword is also a codeword. In particular, self-reverse complementary codewords are expressly forbidden in reverse-complement codes. Thus, an appropriate distance between all pairs of codewords must, when large, effectively prohibit binding between the respective codewords: to form a double strand. Only reverse-complement pairs of codewords should be able to bind. For most applications, a DNA code is to be bi-partitioned, such that the reverse-complementary pairs are separated across the two blocks. For the foregoing reasons, these two blocks of codewords suffice as the hooks and loops of a digital Velcro. We began our investigations of such codes by constructing quaternary BCH reverse-complement codes, using cyclic codes and conventional Hamming distance [4]. We also obtained upper and lower bounds on the rate of reverse-complement codes with a metric function based on the foregoing similarities [3]. For most applications involving DNA, however, the reverse-complementary analogue of codes based on the insertion-deletion distance is more advantageous. This distance equals the codeword length minus the longest length of a common (not necessarily contiguous) subsequence. (The 'aligned' codes described above may be used under special experimental conditions), The advantage arises because, under the assumption that DNA is very flexible, the sharing of sufficiently long subsequences between codewords would be tantamount to the ability of one of their reverse complements to form a double strand with the other codeword. Thus far, using the random coding method, we have derived an asymptotic lower bound on the rate of reverse-complement insertion-deletion codes, as a function of the insertion-deletion distance fraction and of the alphabet size [1]. For the quaternary DNA alphabet of primary importance, this lower bound yields an asymptotically positive rate if the insertion-deletion-distance fraction does not exceed the threshold {approx} 0.19. Extensions of the Varsamov-Tenengol'ts construction of insertion-deletion codes [5] for reverse-complement insertion-deletion codes will be described. Experiments have been performed involving some of our DNA codes.

  6. Reactions of 5-methylcytosine cation radicals in DNA and model systems: thermal deprotonation from the 5-methyl group vs. excited state deprotonation from sugar

    PubMed Central

    Adhikary, Amitava; Kumar, Anil; Palmer, Brian J.; Todd, Andrew D.; Heizer, Alicia N.; Sevilla, Michael D.

    2014-01-01

    Purpose To study the formation and subsequent reactions of the 5-methyl-2?-deoxycytidine cation radical (5-Me-2?-dC•+) in nucleosides and DNA-oligomers and compare to one electron oxidized thymidine. Materials and methods Employing electron spin resonance (ESR), cation radical formation and its reactions were investigated in 5-Me-2?-dC, thymidine (Thd) and their derivatives, in fully double stranded (ds) d[GC*GC*GC*GC*]2 and in the 5-Me-C/A mismatched, d[GGAC*AAGC:CCTAATCG], where C* = 5-Me-C. Results We report 5-Me-2?-dC•+ production by one-electron oxidation of 5-Me-2?-dC by Cl2•? via annealing in the dark at 155 K. Progressive annealing of 5-Me-2?-dC•+ at 155 K produces the allylic radical (C-CH2•). However, photoexcitation of 5-Me-2?-dC•+ by 405 nm laser or by photoflood lamp leads to only C3?• formation. Photoexcitation of N3-deprotonated thyminyl radical in Thd and its 5?-nucleotides leads to C3?• formation but not in 3?-TMP which resulted in the allylic radical (U-CH2•) and C5?• production. For excited 5-Me-2?,3?-ddC•+, absence of the 3?-OH group does not prevent C3?• formation. For d[GC*GC*GC*GC*]2 and d[GGAC*AAGC:CCTAATCG], intra-base paired proton transferred form of G cation radical (G(N1-H)•:C(+H+)) is found with no observable 5-Me-2?-dC•+ formation. Photoexcitation of (G(N1-H)•:C(+H+)) in d[GC*GC*GC*GC*]2 produced only C1?• and not the expected photoproducts from 5-Me-2?-dC•+. However, photoexcitation of (G(N1-H)•:C(+H+)) in d[GGAC*AAGC:CCTAATCG] led to C5?• and C1?• formation. Conclusions C-CH2• formation from 5-Me-2?-dC•+ occurs via ground state deprotonation from C5-methyl group on the base. In the excited 5-Me-2?-dC•+ and 5-Me-2?,3?-ddC•+, spin and charge localization at C3? followed by deprotonation leads to C3?• formation. Thus, deprotonation from C3? in the excited cation radical is kinetically controlled and sugar C-H bond energies are not the only controlling factor in these deprotonations. PMID:24428230

  7. Alprazolam intercalates into DNA.

    PubMed

    Saha, Biswarup; Mukherjee, Ananda; Santra, Chitta Ranjan; Chattopadhyay, Atiskumar; Ghosh, Amar Nath; Choudhuri, Utpal; Karmakar, Parimal

    2009-02-01

    In vitro interaction of a benzodiazepine group of drugs Alprazolam (Alp), a hypnotic and tranquilizer, with DNA was studied by various methods. Absorption spectrophotometric study showed that Alp binds strongly with supercoiled pUC 19 DNA and the calculated binding constant is 8.245x10(3) M(-1) in 10 mM Tris-Cl buffer, pH 7.4. Spectrofluorometric study showed that ethidium bromide induced DNA fluorescence intensity was reduced completely after addition of Alp. But Alp did not interfere with the interaction of Hoechst 33258, a DNA minor groove binder, with plasmid DNA. Circular dichroic spectroscopic study showed that with the gradual increase in Alp concentrations, both the positive and the negative peaks of DNA were gradually decreased and at higher concentrations of Alp (60 microM and 80 microM), the negative peaks became positive indicating the intercalation and the conformational change in the DNA. Binding of Alp with DNA increased the thermal stability of DNA by 6 degrees C with respect to the mock treated sample. Gel electrophoresis study of supercoiled pUC 19 DNA showed more compact structure as a result of Alp binding. Transmission electron microscopic observations also confirmed this compactness. Thus, our observations suggest the strong interaction of Alp with DNA, which may raise serious questions about the random uses of Alprazolam. PMID:19108581

  8. Differentiation of Spotted Fever Group Rickettsiae by Sequencing and Analysis of Restriction Fragment Length Polymorphism of PCR Amplified DNA of the Gene Encoding the Protein rOmpA

    Microsoft Academic Search

    VERONIQUE ROUX; PIERRE-EDOUARD FOURNIER; ANDDIDIER RAOULT

    1996-01-01

    Currently, the genotypic identification of the spotted fever group (SFG) rickettsiae is based on restriction fragmentlengthpolymorphismanalysisofPCR-amplifiedgenescodingfortheenzymecitratesynthaseandthe surfaceproteinsrOmpAandrOmpB.Asetofusefulrestrictionendonucleaseswasfoundfollowingcomparison ofRickettsiarickettsiiandR.prowazekiisequences.However,byusingthreePCRamplificationsandfourenzyme digestions with this set, it was impossible to differentiate between all of the known serotypes of the SFG rickettsiae. We amplified by PCR and sequenced using an automated laser fluorescent DNA sequencer a fragment of the gene encoding the protein rOmpA from

  9. The sequences of heat shock protein 40 (DnaJ) homologs provide evidence for a close evolutionary relationship between the Deinococcus- Thermus group and cyanobacteria

    Microsoft Academic Search

    Kevin Bustard; Radhey S. Gupta

    1997-01-01

    The genes encoding for heat shock protein 40 (Hsp40 or DnaJ) homologs were cloned and sequenced from the archaebacterium Halobacterium cutirubrum and the eubacterium Deinococcus proteolyticus to add to sequences from the gene banks. These genes were identified downstream of the Hsp70 (or DnaK) genes in genomic fragments spanning this region and, as in other prokaryotic species, Hsp70- Hsp40 genes

  10. DNA Computing Hamiltonian path

    E-print Network

    Hagiya, Masami

    2014 DNA DNA #12;DNA Computing · Feynman · Adleman · DNASIMD · ... · · · · · DNADNA #12;DNA · DNA · · · · DNA · · #12;2000 2005 2010 1995 Hamiltonian path DNA tweezers DNA tile DNA origami DNA box Sierpinski DNA tile self assembly DNA logic gates Whiplash PCR DNA automaton DNA spider MAYA

  11. Towards Multi-fueled DNA walker on DNA trails

    NASA Astrophysics Data System (ADS)

    Nishikawa, Akio; Ohtake, Kazumasa; Tanaka, Fumiaki; Hagiya, Masami

    2008-10-01

    Basic idea and preliminary experimental results for photo-controllable DNA tiles are described. Although self-assembly of DNA cross tiles is an established technique, it only results in a static structure controlled by sequence design of sticky ends. For realizing dynamic control of DNA nanostructures, multi-fueled approach to self-assembly of DNA cross tiles is introduced. It is based on thermal-fuel, pH-fuel and photo-fuel. We already verified their basic behaviors in test tubes. In addition, we started to examine them for DNA walker on DNA trails made of DNA cross tiles. Especially, azobenzene intercalation groups for the sticky ends in DNA cross tiles are useful for photo-fuel, as they can control the assembly process with irradiation of UV/visible light. Preliminary results concerning the DNA cross tiles with azobenzene are also described briefly.

  12. Repeated DNA sequences in fungi

    PubMed Central

    Dutta, S.K.

    1974-01-01

    Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10-20% repeated DNA sequences. There are approximately 100-110 copies of repeated DNA sequences of approximately 4 × 107 daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5°C difference of Te50 (temperature at which 50% duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. PMID:10793700

  13. DNA Restriction

    NSDL National Science Digital Library

    The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragment at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends. This animation from Cold Spring Harbor Laboratory's Dolan DNA Learning Center presents DNA restriction through a series of illustrations of processes involved.

  14. DNA-repair measurements by use of the modified comet assay: an inter-laboratory comparison within the European Comet Assay Validation Group (ECVAG).

    PubMed

    Godschalk, Roger W L; Ersson, Clara; Riso, Patrizia; Porrini, Marisa; Langie, Sabine A S; van Schooten, Frederik-Jan; Azqueta, Amaya; Collins, Andrew R; Jones, George D D; Kwok, Rachel W L; Phillips, David H; Sozeri, Osman; Allione, Alessandra; Matullo, Giuseppe; Möller, Lennart; Forchhammer, Lykke; Loft, Steffen; Møller, Peter

    2013-09-18

    The measurement of DNA-repair activity by extracts from cells or tissues by means of the single-cell gel electrophoresis (comet) assay has a high potential to become widely used in biomonitoring studies. We assessed the inter-laboratory variation in reported values of DNA-repair activity on substrate cells that had been incubated with Ro19-8022 plus light to generate oxidatively damaged DNA. Eight laboratories assessed the DNA-repair activity of three cell lines (i.e. one epithelial and two fibroblast cell lines), starting with cell pellets or with cell extracts provided by the coordinating laboratory. There was a large inter-laboratory variation, as evidenced by the range in the mean level of repair incisions between the laboratory with the lowest (0.002incisions/10(6)bp) and highest (0.988incisions/10(6)bp) incision activity. Nevertheless, six out of eight laboratories reported the same cell line as having the highest level of DNA-repair activity. The two laboratories that reported discordant results (with another cell line having the highest level of DNA-repair activity) were those that reported to have little experience with the modified comet assay to assess DNA repair. The laboratories were also less consistent in ordering the repair activity of the other two cell lines, probably because the DNA-repair activity by extracts from these cell lines were very similar (on average approximately 60-65% of the cell line with the highest repair capacity). A significant correlation was observed between the repair activity found in the provided and the self-made cell extracts (r=0.71, P<0.001), which indicates that the predominant source for inter-laboratory variation is derived from the incubation of the extract with substrate cells embedded in the gel. Overall, we conclude that the incubation step of cell extracts with the substrate cells can be identified as a major source of inter-laboratory variation in the modified comet assay for base-excision repair. PMID:23830929

  15. Extracting DNA

    NSDL National Science Digital Library

    Science Netlinks

    2002-03-28

    This lesson for students in grades 9-12 introduces DNA, genes, chromosomes, the chemicals that make up DNA. After the basic information, students will do an experiment in which they will separate out DNA from peas. Knowing that DNA can be separated will give them a base of understanding for future lessons in biology, evolution, biotechnology, and health technology.

  16. DNA DNA [1]. 1994

    E-print Network

    , . , , DNA Abstract The Monkey and Banana Problem is an example commonly used for illustrating simple problem, the Monkey and Banana Problem can be solved effectively without weakening the fundamental aims above and Banana Problem, which was implemented from the conventional point of view, gives us only one optimal

  17. Human methionine synthase: cDNA cloning and identification of mutations in patients of the cblG complementation group of folate\\/cobalamin disorders

    Microsoft Academic Search

    D. Leclerc; E. Campeau; P. Goyette; C. E. Adjalla; B. Christensen; M. Ross; P. Eydoux; D. S. Rosenblatt; R. Rozen; R. A. Gravel

    1996-01-01

    Methionine synthase catalyzes the remethylation of homocysteine to methionine in a methylcobalamin-depend- ent reaction. We used specific regions of homology within the methionine synthase sequences of several lower organisms to clone a human methionine synthase cDNA by a combination of RT-PCR and inverse PCR. The enzyme is 1265 amino acids in length and contains the seven residue structure-based sequence fingerprint

  18. Nanoparticle bridge DNA biosensor

    NASA Astrophysics Data System (ADS)

    Huang, Hong-Wen

    A new DNA sensing method is demonstrated in which DNA hybridization events lead to the formation of nanoparticle satellites that bridge two electrodes and are detected electrically. The hybridization events are exclusively carried out only on specific locations, the surfaces of C-ssDNA modified 50 nm GNPs. The uniqueness of this work is that only a small number of T-ccDNA molecules (<10) is required to form the nanoparticle satellites, allowing ultra-sensitive DNA sensing. The principle of this new DNA sensing technique has been demonstrated using target DNA and three-base-pair-mismatched DNA in 20nM concentrations. Three single-stranded DNA (ssDNA) system is used in our experiment which includes Capture-ssDNA (C-ssDNA), Target-ssDNA (T-ssDNA) and Probe-ssDNA (P-ssDNA). Both C-ssDNA and P-ssDNA are modified by a thiol group and can hybridize with different portions of T-ssDNA. T-ssDNA requires no modification in three ssDNA system, which is beneficial in many applications. C-ssDNA modified 50nm gold nanoparticle (C-50au) and P-ssDNA modified 30nm gold nanoparticle (P-30au) are prepared through the reaction of thiol-gold chemical bonding between thiolated ssDNA and gold nanoparticle (GNP) (C-ssDNA with 50nm GNP, P-ssDNA with 30nm GNP). We controllably place the C-50au only on the SiO2 band surface (˜ 90nm width) between two gold electrodes (source and drain electrodes) by forming positively- and negatively-charged self-assembled monolayers (SAMs) on SiO2 and gold surface, respectively. DNA modified GNP is negatively charged due to ionization of phosphate group on DNA back bone. C-50au therefore is negatively charged and can only be attracted toward SiO2 area (repelled by negatively charged gold electrode surface). The amine group of positively-charged SAMs on SiO2 surface is then passivated by converting to non-polar methyl functional group after C-50au placement. P-30au is first hybridized with T-ssDNA in the solution phase (T-P- 30au formed) and is introduced into DNA detection device in which C-50au are immobilized on ˜90nm width SiO2 band (between two gold electrodes). The passivation step ensures every TP-30au are attached only to C-50au through hybridization (T-P-30au will not be attracted toward SiO2 surface or gold electrodes). GNP bridges are formed across the electrodes and provide an electrical path between two gold electrodes. We ensure that every T-P-30au only hybridizes on the surface of C-50au by (1) accurately controlling C-50au placement between two gold electrodes, (2) passivating positively-charged SAMs on SiO2 surface after C-50au immobilization. When T-P-30au hybridize with C-50au on ˜90nm wide SiO 2 surface, GNP bridges form and provide an electrical path between two gold electrodes even with only a few hybridization events. Experimental results show that even a few GNP bridges formed on SiO2 band can provide a significant conductance change from an open circuit to a conductive circuit (current = 0.5 uA at voltage = 0.1 V with four GNP bridge). We also used 3-base-pair-mismatched ssDNA (3mm-ssDNA) as a control experiment, which always resulted in an open circuit (no GNP bridge formed). Our detection device is compatible with current CMOS fabrication technology and can be manufactured on a wafer scale. The direct electrical output of this DNA detection technique provides a promising basis for high-throughput screening (can be fabricated on a wafer scale) with no expensive equipment required.

  19. DNA Interactive

    NSDL National Science Digital Library

    2004-01-05

    DNA Interactive is an educational site celebrating the 50th anniversary of the discovery of the double-helical structure of DNA by James Watson and Francis Crick. The web site features interactive modules about the history of DNA science; discovering and reading the DNA code; manipulating the code to create tailored molecules; studying the human genome; applications of DNA research; and a chronicle of the eugenics movement. These modules feature rare video interviews with scientists, 3D animations, and narrative text to present and explain DNA science. Other materials include a teacher's guide with downloadable, printable lessons, an online teaching community, and information on further resources.

  20. [Evaluation of the relative contribution of Caucasoid and Mongoloid components in the formation of ethnic groups of the Volga-Ural region according to data of DNA polymorphism].

    PubMed

    Khusnutdinova, E K; Viktorova, T V; Fatkhlislamova, R I; Galeeva, A R

    1999-08-01

    For the first time, an attempt was made to quantitatively estimate the relative contributions of major racial components to populations of the Volga-Ural region based on the data on allelic polymorphisms of nine loci of the mitochondrial and nuclear genomes. Comparison of the proportions of Caucasoid and Mongoloid characteristics in the gene pools of Bashkirs, Tatars, Chuvashes, Maris, Mordovians, Udmurts, and Komi revealed a heterogeneous pattern. Data on the proportions of major racial components in the nuclear genome indicated that the Caucasoid component was maximum in Mordovians, Komis, and Udmurts. Mongoloid characters were most prevalent in Bashkirs, Maris, Tatars, and Chuvashes. Data on restriction-deletion polymorphism of mitochondrial DNA (mtDNA) also indicated an increased Caucasoid contribution to Mordovian, Udmurt, and Komi gene pools and an increased Mongoloid component in Chuvashes and Tatars. In general, the results obtained agree with ethnic anthropological data indicating the greatest Caucasoid contribution to the Mordovian and Komi gene pools and an increased Mongoloid component in Turkic populations of the Volga-Ural region (Bashkirs, Tatars, and Chuvashes). PMID:10546116

  1. DNA Replication

    NSDL National Science Digital Library

    American Society For Microbiology

    2002-01-01

    This animation, which shows DNA replication and the interactions of the various enzymes, can be used to illustrate to students the order of events in DNA replication, as well as emphasize which enzymes are involved in the process.

  2. DNA Detectives

    NSDL National Science Digital Library

    BEGIN:VCARD VERSION:2.1 FN:Suzanne Black N:Black; Suzanne ORG:Inglemoor High School REV:2005-04-09 END:VCARD

    1995-06-30

    Many of the revolutionary changes that have occurred in biology since 1970 can be attributed directly to the ability to manipulate DNA in defined ways. The principal tools for this recombinant DNA technology are enzymes that can "cut and "paste" DNA. Restriction enzymes are the "chemical scissors" of the molecular biologist; these enzymes cut DNA at specific nucleotide sequences. A sample of someone's DNA, incubated with restriction enzymes, is reduced to millions of DNA fragments of varying sizes. A DNA sample from a different person would have a different nucleotide sequence and would thus be enzymatically "chopped up" into a very different collection of fragments. We have been asked to apply DNA fingerprinting to determine which suspect should be charged with a crime perpetrated in our city.

  3. DNA Copyright

    E-print Network

    Torrance, Andrew W.

    2011-01-01

    of architecture and computer software. Sequences of DNA should also be acknowledged as eligible for copyright protection. Unaltered genomic DNA sequences would seem poor candidates for copyright protection. The case is stronger for copyright protection...

  4. DNA Nanotechnology

    NSDL National Science Digital Library

    2014-06-10

    In this activity, learners explore deoxyribonucleic acid (DNA), a nanoscale structure that occurs in nature. Learners extract a sample of DNA from split peas and put the sample in an Eppendorf tube to take home. Learners discover that nanoscientists study DNA to understand its biological function and use it to make other nanoscale materials and devices.

  5. Cinnamate-based DNA photolithography

    PubMed Central

    Romulus, Joy; Li, Minfeng; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin

    2013-01-01

    As demonstrated by means of DNA nanoconstructs[1], as well as DNA functionalization of nanoparticles[2-4] and micrometre-scale colloids[5-8], complex self-assembly processes require components to associate with particular partners in a programmable fashion. In many cases the reversibility of the interactions between complementary DNA sequences is an advantage[9]. However, permanently bonding some or all of the complementary pairs may allow for flexibility in design and construction[10]. Here, we show that the substitution of a pair of complementary bases by a cinnamate group provides an efficient, addressable, UV light-based method to covalently bond complementary DNA. To show the potential of this approach, we wrote micrometre-scale patterns on a surface via UV light and demonstrate the reversible attachment of conjugated DNA and DNA-coated colloids. Our strategy enables both functional DNA photolithography and multi-step, specific binding in self-assembly processes. PMID:23685865

  6. Algorithmic Self-Assembly DNA (Layered

    E-print Network

    Hagiya, Masami

    DNA DNA Algorithmic Self-Assembly DNA DNA DNA DNA DNA 2 DNA (Layered Tile Model) [1] LTM Fig.1-Origami 4 DNA (Fig.1) DNA Fig.2 [2] DNA DNA Fig. 2 DNA ( ( ), SEM )) DNA DNA DNA DNA DNA DNA DNA RecA 1 DNA 2 DNA ATP DNA 3 DNA (Fig. ) DNA DNA DNA RecA 1 DNA 3 #12;Fig. 4 AFM image of triple strand DNA

  7. DNA demethylation by DNA repair

    E-print Network

    Gehring, Mary

    Active DNA demethylation underlies key facets of reproduction in flowering plants and mammals and serves a general genome housekeeping function in plants. A family of 5-methylcytosine DNA glycosylases catalyzes plant ...

  8. DNA Relatedness among Strains of Leptospira biflexa

    Microsoft Academic Search

    P. RAMADASS; B. D. W. JARVIS; R. J. CORNER; M. CINC; R. B. MARSHALL

    1990-01-01

    The slot blot method of DNA hybridization was used to study 38 strains of Leptospira bijiexa belonging to 38 serovars. Fifteen of these serovars were placed into six groups. The remaining 23 serovars were generally too diverse to show significant DNA relatedness either to these groups or to one another. Serovar thracia was related to Group 5, but it was

  9. Radiation damage to DNA

    SciTech Connect

    Miller, J.H.

    1992-04-01

    Our goal is to calculate the probability to eject electrons from DNA by charged particles that pass near the macromolecule as they slow down in an aqueous medium that contains DNA in low concentration. This process is illustrated for a particle of charge Ze and velocity v, where impact parameters b{sub 1}, b{sub 2}, and b{sub 3} indicate the distances between the trajectory and a phosphate group, a base, and a sugar moiety, respectively. In the present state of our theoretical development, we must treat each of these components of DNA as an independent impurity site occupied by electrons in a Slater-type orbital with a characteristic orbital radius and band gap. Determination of these parameters will be discussed below; however, before we turn to that part of the discussion, it is interesting to address the question of multiple ionizations of DNA by the passage of a single charged particle.

  10. A DNA-fuelled molecular machine made of DNA.

    PubMed

    Yurke, B; Turberfield, A J; Mills, A P; Simmel, F C; Neumann, J L

    2000-08-10

    Molecular recognition between complementary strands of DNA allows construction on a nanometre length scale. For example, DNA tags may be used to organize the assembly of colloidal particles, and DNA templates can direct the growth of semiconductor nanocrystals and metal wires. As a structural material in its own right, DNA can be used to make ordered static arrays of tiles, linked rings and polyhedra. The construction of active devices is also possible--for example, a nanomechanical switch, whose conformation is changed by inducing a transition in the chirality of the DNA double helix. Melting of chemically modified DNA has been induced by optical absorption, and conformational changes caused by the binding of oligonucleotides or other small groups have been shown to change the enzymatic activity of ribozymes. Here we report the construction of a DNA machine in which the DNA is used not only as a structural material, but also as 'fuel'. The machine, made from three strands of DNA, has the form of a pair of tweezers. It may be closed and opened by addition of auxiliary strands of 'fuel' DNA; each cycle produces a duplex DNA waste product. PMID:10949296

  11. Solution confirmation of the (-)-trans-anti-5-Methylchrysene-dG adduct oppposite dC in a DNA duplex: DNA bending associated with wedging of the Methyl group of 5-Methylchrysene to the 3{prime}-side of the modification site

    SciTech Connect

    Cosman, M.; Patel, D.J. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1995-05-09

    This paper reports on NMR-molecular mechanics structural studies of the (-)-trans-anti-[MC]dG adduct positioned opposite dC in the sequence context of the d(Cl-C2-A3-T4-C5-[MC]G6-C7-T8-A9-C10-C11){sm_bullet}d(G12-G13-T14-A15-G16-C17-G 18-A19-T20-G21-G22) duplex [designated (-)-trans-anti-[MC]dG{sm_bullet}dC 11-mer duplex]. This adduct is derived from the trans addition at C{sup 4} of (-)-anti-1(S),2(R)-dihydroxy-3(R),4(S)-epoxy-1,2,3,4-tetrahydro-5-methylchrysene [(-)-anti-5-MeCDE] to the N{sup 2} position of dG6 in this duplex sequence. The 5-methyl group is located adjacent to the MC(C{sup 4}) binding site, with these groups juxtaposed in a sterically crowded bay region in the adduct duplex. The 5-methylchrysenyl and the nucleic acid exchangeable and nonexchangeable protons were assigned following analysis of two-dimensional NMR data sets in H{sub 2}O and D{sub 2}O buffer solution. The solution structure of the trans-anti-[MC]dG{sm_bullet}dC 11-mer duplex has been determined by incorporating DNA-DNA and carcinogen-DNA proton-proton distances defined by lower and upper bounds deduced from NOESY data sets as restraints in molecular mechanics computations in torsion angle space. The results establish that the [MC]dG6{sm_bullet}dC17 base pair and flanking dC5{sm_bullet}dG18 and dC7{sm_bullet}dG16 base pairs retain Watson-Crick alignments upon adduct formation. 61 refs., 9 figs., 2 tabs.

  12. Development of a DNA vaccine for chicken infectious anemia and its immunogenicity studies using high mobility group box 1 protein as a novel immunoadjuvant indicated induction of promising protective immune responses.

    PubMed

    Sawant, Pradeep Mahadev; Dhama, Kuldeep; Rawool, Deepak Bhiva; Wani, Mohd Yaqoob; Tiwari, Ruchi; Singh, Shambhu Dayal; Singh, Raj Kumar

    2015-01-01

    Chicken infectious anaemia (CIA) is an economically important and emerging poultry disease reported worldwide. Current CIA vaccines have limitations like, the inability of the virus to grow to high titres in embryos/cell cultures, possession of residual pathogenicity and a risk of reversion to virulence. In the present study, a DNA vaccine, encoding chicken infectious anaemia virus (CIAV) VP1 and VP2 genes, was developed and co-administered with truncated chicken high mobility group box 1 (HMGB1?C) protein in young chicks for the evaluation of vaccine immune response. CIAV VP1 and VP2 genes were cloned in pTARGET while HMGB1?C in PET32b vector. In vitro expression of these gene constructs was evaluated by Western blotting. Further, recombinant HMGB1?C was evaluated for its biological activity. The CIAV DNA vaccine administration in specific pathogen free chicks resulted in moderately protective ELISA antibody titres in the range of 4322.87 ± 359.72 to 8288.19 ± 136.38, increased CD8(+) cells, and a higher titre was observed by co-administration of novel adjuvant (HMGB1?C) and booster immunizations. The use of vaccine with adjuvant showed achieving antibody titres nearly 8500, titre considered as highly protective, which indicates that co-immunization of HMGB1?C may have a strong adjuvant activity on CIAV DNA vaccine induced immune responses. The able potential of HMGB1 protein holding strong adjuvant activity could be exploited further with trials with vaccines for other important pathogens for achieving the required protective immune responses. PMID:25448094

  13. Genetic variation and demographic history of the Haplochromis laparogramma group of Lake Victoria--An analysis based on SINEs and mitochondrial DNA

    E-print Network

    Genetic variation and demographic history of the Haplochromis laparogramma group of Lake Victoria More than 500 endemic haplochromine cichlid species inhabit Lake Victoria. This striking species and population structure of closely related Lake Victoria cichlids and in showing the importance of applying

  14. Recombinant DNA means and method

    SciTech Connect

    Alford, B.L.; Mao, J.I.; Moir, D.T.; Taunton-Rigby, A.; Vovis, G.F.

    1987-05-19

    This patent describes a transformed living cell selected from the group consisting of fungi, yeast and bacteria, and containing genetic material derived from recombinant DNA material and coding for bovine rennin.

  15. DNA Testing & Cetaceans Bibliography

    NSDL National Science Digital Library

    Burns, Wil.

    The American Society of International Law Wildlife Interest Group has posted the searchable DNA Testing & Cetaceans Bibliography, with dozens of resources from recent years to the 1970s (most resources are recent). Listed in alphabetical order, resources may be browsed online or searched using the internal search mechanism.

  16. Patterning nanocrystals using DNA

    SciTech Connect

    Williams, Shara Carol

    2003-09-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices to a length greater than 20 {micro}m, and collecting atomic force microscopy (AFM) images up to 30 {micro}m. We found the lattices' requirement of divalent magnesium cations to stabilize Holliday junctions to be incompatible with the stability of charge-stabilized gold nanoparticles used for the experiments here, and gold particles added indiscriminately to the lattice surface through non-specific binding. Redesigning the lattices to avoid magnesium may improve results.

  17. Identification of novel cluster groups in pediatric high-risk B-precursor acute lymphoblastic leukemia with gene expression profiling: correlation with genome-wide DNA copy number alterations, clinical characteristics, and outcome

    PubMed Central

    Harvey, Richard C.; Mullighan, Charles G.; Wang, Xuefei; Dobbin, Kevin K.; Davidson, George S.; Bedrick, Edward J.; Chen, I-Ming; Atlas, Susan R.; Kang, Huining; Ar, Kerem; Wilson, Carla S.; Wharton, Walker; Murphy, Maurice; Devidas, Meenakshi; Carroll, Andrew J.; Borowitz, Michael J.; Bowman, W. Paul; Downing, James R.; Relling, Mary; Yang, Jun; Bhojwani, Deepa; Carroll, William L.; Camitta, Bruce; Reaman, Gregory H.; Smith, Malcolm; Hunger, Stephen P.

    2010-01-01

    To resolve the genetic heterogeneity within pediatric high-risk B-precursor acute lymphoblastic leukemia (ALL), a clinically defined poor-risk group with few known recurring cytogenetic abnormalities, we performed gene expression profiling in a cohort of 207 uniformly treated children with high-risk ALL. Expression profiles were correlated with genome-wide DNA copy number abnormalities and clinical and outcome features. Unsupervised clustering of gene expression profiling data revealed 8 unique cluster groups within these high-risk ALL patients, 2 of which were associated with known chromosomal translocations (t(1;19)(TCF3-PBX1) or MLL), and 6 of which lacked any previously known cytogenetic lesion. One unique cluster was characterized by high expression of distinct outlier genes AGAP1, CCNJ, CHST2/7, CLEC12A/B, and PTPRM; ERG DNA deletions; and 4-year relapse-free survival of 94.7% ± 5.1%, compared with 63.5% ± 3.7% for the cohort (P = .01). A second cluster, characterized by high expression of BMPR1B, CRLF2, GPR110, and MUC4; frequent deletion of EBF1, IKZF1, RAG1-2, and IL3RA-CSF2RA; JAK mutations and CRLF2 rearrangements (P < .0001); and Hispanic ethnicity (P < .001) had a very poor 4-year relapse-free survival (21.0% ± 9.5%; P < .001). These studies reveal striking clinical and genetic heterogeneity in high-risk ALL and point to novel genes that may serve as new targets for diagnosis, risk classification, and therapy. PMID:20699438

  18. The High Mobility Group Protein HMG I(Y) Can Stimulate or Inhibit DNA Binding of Distinct Transcription Factor ATF-2 Isoforms

    Microsoft Academic Search

    Wei Du; Tom Maniatis

    1994-01-01

    The high mobility group protein HMG I(Y) stimulates the binding of a specific isoform of the activating transcription factor 2 (ATF-2195) to the interferon beta (IFN-beta) gene promoter. HMG I(Y) specifically interacts with the basic-leucine zipper region of ATF-2195, and HMG I(Y) binds to two sites immediately flanking the ATF-2 binding site of the IFN-beta promoter. Here, we show that

  19. Probe Design for Compressive Sensing DNA Microarrays

    E-print Network

    1 Probe Design for Compressive Sensing DNA Microarrays Wei Dai, Mona A. Sheikh, Olgica Milenkovic, and Richard G. Baraniuk Abstract--Compressive Sensing Microarrays (CSM) are DNA- based sensors that operate are allowed. Index Terms--Compressive sensing, DNA microarray, group testing, hybridization affinity, probe

  20. DNA barcodes for ecology, evolution, and conservation

    E-print Network

    Uriarte, Maria

    DNA barcodes for ecology, evolution, and conservation W. John Kress1 , Carlos Garci´a-Robledo1 10027, USA The use of DNA barcodes, which are short gene sequences taken from a standardized portion of natural systems. The suite of DNA barcode markers now applied to specific taxonomic groups of organisms

  1. DNA Chips

    NSDL National Science Digital Library

    Science Netlinks

    2003-02-23

    In this lesson from Science NetLinks, students will conduct activities from a module called "DNA Chips: A Genetics Lab in the Palm of Your Hand." This module is part of the National Institutes of Health Snapshots series, which focuses on a single area of biomedical research to help students understand how science, people, ethics, and history all fit together. The module for this lesson is about the DNA microarray, also known as a DNA chip.

  2. Interstrand DNA–DNA Cross-Link Formation Between Adenine Residues and Abasic Sites in Duplex DNA

    PubMed Central

    2015-01-01

    The loss of a coding nucleobase from the structure of DNA is a common event that generates an abasic (Ap) site (1). Ap sites exist as an equilibrating mixture of a cyclic hemiacetal and a ring-opened aldehyde. Aldehydes are electrophilic functional groups that can form covalent adducts with nucleophilic sites in DNA. Thus, Ap sites present a potentially reactive aldehyde as part of the internal structure of DNA. Here we report evidence that the aldehyde group of Ap sites in duplex DNA can form a covalent adduct with the N6-amino group of adenine residues on the opposing strand. The resulting interstrand DNA–DNA cross-link occurs at 5?-ApT/5?-AA sequences in remarkably high yields (15–70%) under physiologically relevant conditions. This naturally occurring DNA-templated reaction has the potential to generate cross-links in the genetic material of living cells. PMID:24506784

  3. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam

    PubMed Central

    2010-01-01

    Background During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A) among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. Results In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. Conclusions The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1) the geographic distribution, which is potentially spreading along the Vietnam, China, Laos, and Myanmar borders; (2) morphological and ecological characteristics; and (3) vectorial capacity of this newly identified cryptic species of An. dirus, which is one of the most important malaria vectors in the mainland of Southeast Asia, are necessary for planning efficient malaria vector control programs in this region. PMID:20433694

  4. DNA nanomachines

    Microsoft Academic Search

    Jonathan Bath; Andrew J. Turberfield

    2007-01-01

    We are learning to build synthetic molecular machinery from DNA. This research is inspired by biological systems in which individual molecules act, singly and in concert, as specialized machines: our ambition is to create new technologies to perform tasks that are currently beyond our reach. DNA nanomachines are made by self-assembly, using techniques that rely on the sequence-specific interactions that

  5. DNA Pendant

    E-print Network

    Hacker, Randi; Tsutsui, William

    2007-11-14

    Broadcast Transcript: It's a symbol of commitment. It's a memento mori. It's the DNA pendant offered by Japan's Eiwa Industry and it's two, two, two things in one. Using genetic extraction, Eiwa removes the DNA from, say, a strand of hair or a...

  6. DNA Tutorial

    NSDL National Science Digital Library

    Yvette

    This site is an excellent resource on the structure and function of DNA as well as its role in genes and chromosomes. It also covers DNA replication, RNA structure and function, RNA synthesis, the genetic code, and protein synthesis. The site includes a tutorial that tests comprehension of the covered subjects.

  7. Ten polymorphic DNA loci, including five in the rat MHC (RT1) region, form a single linkage group on rat chromosome 20

    SciTech Connect

    Remmers, E.F.; Du, Y.; Zha, H.; Goldmuntz, E.A.; Wilder, R.L. [National Institutes of Health, Bethesda, MD (United States)

    1995-03-01

    We have described ten markers for polymorphic loci on rat chromosome 20, including five in the rat MHC (RT1) region. These markers formed a single linkage group spanning a recombination distance of 0.40. The markers identified five expressed gene loci - RT1.N1 (thymus leukemia antigen 1), Tnfa (tumor necrosis factor {alpha}), Hspa1 (heat shock protein 70), Ggt1 ({gamma} glutamyl-transferase 1), and Prkacn2 (protein kinase C catalytic subunit binding inhibitor 2), two loci with sequences that are related to expressed genes - RT1.Aw2 (sequence related to a non-RT1A class I {alpha} chain) and Mt21 (sequence related to metallothionein 2), and three anonymous loci - D20Arb548, D20Arb234, and D20Arb249. These polymorphic markers should facilitate mapping studies and genetic monitoring of inbred rat strains. 18 refs., 2 figs., 3 tabs.

  8. Combustion Group Group members

    E-print Network

    Wang, Wei

    Combustion Group Group members: Thierry Poinsot, Emilien Courtine, Luc Vervisch, Benjamin Farcy 2014 #12;Combustion Group Combustion Physics and Modeling Pollutants, Emissions, and Soot Formation Thermoacoustics and Combustion Dynamics Research focus § Examine mechanisms responsible for flame stabilization

  9. The Association of the Xeroderma Pigmentosum Group D DNA Helicase (XPD) with Transcription Factor IIH Is Regulated by the Cytosolic Iron-Sulfur Cluster Assembly Pathway.

    PubMed

    Vashisht, Ajay A; Yu, Clarissa C; Sharma, Tanu; Ro, Kevin; Wohlschlegel, James A

    2015-05-29

    Xeroderma pigmentosum group D (XPD) helicase is a component of the transcription factor IIH (TFIIH) transcription complex and plays essential roles in transcription and nucleotide excision repair. Although iron-sulfur (Fe-S) cluster binding by XPD is required for activity, the process mediating Fe-S cluster assembly remains poorly understood. We recently identified a cytoplasmic Fe-S cluster assembly (CIA) targeting complex composed of MMS19, CIAO1, and FAM96B that is required for the biogenesis of extramitochondrial Fe-S proteins including XPD. Here, we use XPD as a prototypical Fe-S protein to further characterize how Fe-S assembly is facilitated by the CIA targeting complex. Multiple lines of evidence indicate that this process occurs in a stepwise fashion in which XPD acquires a Fe-S cluster from the CIA targeting complex before assembling into TFIIH. First, XPD was found to associate in a mutually exclusive fashion with either TFIIH or the CIA targeting complex. Second, disrupting Fe-S cluster assembly on XPD by either 1) depleting cellular iron levels or 2) utilizing XPD mutants defective in either Fe-S cluster or CIA targeting complex binding blocks Fe-S cluster assembly and prevents XPD incorporation into TFIIH. Finally, subcellular fractionation studies indicate that the association of XPD with the CIA targeting complex occurs in the cytoplasm, whereas its association with TFIIH occurs largely in the nucleus where TFIIH functions. Together, these data establish a sequential assembly process for Fe-S assembly on XPD and highlight the existence of quality control mechanisms that prevent the incorporation of immature apoproteins into their cellular complexes. PMID:25897079

  10. DNA Methylation and Its Basic Function

    PubMed Central

    Moore, Lisa D; Le, Thuc; Fan, Guoping

    2013-01-01

    In the mammalian genome, DNA methylation is an epigenetic mechanism involving the transfer of a methyl group onto the C5 position of the cytosine to form 5-methylcytosine. DNA methylation regulates gene expression by recruiting proteins involved in gene repression or by inhibiting the binding of transcription factor(s) to DNA. During development, the pattern of DNA methylation in the genome changes as a result of a dynamic process involving both de novo DNA methylation and demethylation. As a consequence, differentiated cells develop a stable and unique DNA methylation pattern that regulates tissue-specific gene transcription. In this chapter, we will review the process of DNA methylation and demethylation in the nervous system. We will describe the DNA (de)methylation machinery and its association with other epigenetic mechanisms such as histone modifications and noncoding RNAs. Intriguingly, postmitotic neurons still express DNA methyltransferases and components involved in DNA demethylation. Moreover, neuronal activity can modulate their pattern of DNA methylation in response to physiological and environmental stimuli. The precise regulation of DNA methylation is essential for normal cognitive function. Indeed, when DNA methylation is altered as a result of developmental mutations or environmental risk factors, such as drug exposure and neural injury, mental impairment is a common side effect. The investigation into DNA methylation continues to show a rich and complex picture about epigenetic gene regulation in the central nervous system and provides possible therapeutic targets for the treatment of neuropsychiatric disorders. PMID:22781841

  11. Biophysical characterization of DNA binding from single molecule force measurements

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-09-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function.

  12. Dancing DNA.

    ERIC Educational Resources Information Center

    Pennisi, Elizabeth

    1991-01-01

    An imaging technique that uses fluorescent dyes and allows scientists to track DNA as it moves through gels or in solution is described. The importance, opportunities, and implications of this technique are discussed. (KR)

  13. DNA Dynamics.

    ERIC Educational Resources Information Center

    Warren, Michael D.

    1997-01-01

    Explains a method to enable students to understand DNA and protein synthesis using model-building and role-playing. Acquaints students with the triplet code and transcription. Includes copies of the charts used in this technique. (DDR)

  14. DNA Computers

    Microsoft Academic Search

    Nuno Crato

    \\u000a On April 25, 1953, James D. Watson and Francis Crick published an article in the journal Nature that was less than two pages long. In this study they presented the famous double-helix structure of DNA, and as a consequence\\u000a the world today has changed. The discovery of DNA has opened up new paths in biology, medicine, agriculture, forensic science,\\u000a and

  15. DNA Sequencing

    NSDL National Science Digital Library

    Teachers' Domain presents this interactive, adapted from the Dolan DNA Learning Center, with reading material and animations to help students learn the basics of DNA sequencing. The lesson is divided two parts: Sanger Sequencing and Cycle Sequencing. The processes for both techniques are covered and animations help students visualize the material presented. On the site, visitors will also find a supplemental background essay, discussion questions, and standards alignment from Teachers' Domain.

  16. DNA Extraction

    NSDL National Science Digital Library

    Teachers' Domain presents this interactive, adapted from the University of Nebraska's Plant and Soil Science eLibrary, with reading material and animations to help students learn the basics of DNA extraction. The lesson is divided into and introduction and the four processes involved: cell lysis, dismantling the cell membrane, removing unwanted cell parts, and precipitating the DNA. On the site, visitors will also find a supplemental background essay, discussion questions, and standards alignment from Teachers' Domain.

  17. DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics

    E-print Network

    DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics Soo­Yong Shin 1 , Eun Jeong the complexity of DNA computing. The complexity of any computational algorithm is typically measured in terms of time and space. In DNA computing, the time complexity can be measured by the total reaction time

  18. DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics

    E-print Network

    DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics Soo-Yong Shin1 , Eun Jeong of DNA computing. The complexity of any computational algorithm is typically measured in terms of time and space. In DNA computing, the time complexity can be measured by the total reaction time

  19. DNA adductomics.

    PubMed

    Balbo, Silvia; Turesky, Robert J; Villalta, Peter W

    2014-03-17

    Systems toxicology is a broad-based approach to describe many of the toxicological features that occur within a living system under stress or subjected to exogenous or endogenous exposures. The ultimate goal is to capture an overview of all exposures and the ensuing biological responses of the body. The term exposome has been employed to refer to the totality of all exposures, and systems toxicology investigates how the exposome influences health effects and consequences of exposures over a lifetime. The tools to advance systems toxicology include high-throughput transcriptomics, proteomics, metabolomics, and adductomics, which is still in its infancy. A well-established methodology for the comprehensive measurement of DNA damage resulting from every day exposures is not fully developed. During the past several decades, the (32)P-postlabeling technique has been employed to screen the damage to DNA induced by multiple classes of genotoxicants; however, more robust, specific, and quantitative methods have been sought to identify and quantify DNA adducts. Although triple quadrupole and ion trap mass spectrometry, particularly when using multistage scanning (LC-MS(n)), have shown promise in the field of DNA adductomics, it is anticipated that high-resolution and accurate-mass LC-MS(n) instrumentation will play a major role in assessing global DNA damage. Targeted adductomics should also benefit greatly from improved triple quadrupole technology. Once the analytical MS methods are fully mature, DNA adductomics along with other -omics tools will contribute greatly to the field of systems toxicology. PMID:24437709

  20. DNA Adductomics

    PubMed Central

    2015-01-01

    Systems toxicology is a broad-based approach to describe many of the toxicological features that occur within a living system under stress or subjected to exogenous or endogenous exposures. The ultimate goal is to capture an overview of all exposures and the ensuing biological responses of the body. The term exposome has been employed to refer to the totality of all exposures, and systems toxicology investigates how the exposome influences health effects and consequences of exposures over a lifetime. The tools to advance systems toxicology include high-throughput transcriptomics, proteomics, metabolomics, and adductomics, which is still in its infancy. A well-established methodology for the comprehensive measurement of DNA damage resulting from every day exposures is not fully developed. During the past several decades, the 32P-postlabeling technique has been employed to screen the damage to DNA induced by multiple classes of genotoxicants; however, more robust, specific, and quantitative methods have been sought to identify and quantify DNA adducts. Although triple quadrupole and ion trap mass spectrometry, particularly when using multistage scanning (LC–MSn), have shown promise in the field of DNA adductomics, it is anticipated that high-resolution and accurate-mass LC–MSn instrumentation will play a major role in assessing global DNA damage. Targeted adductomics should also benefit greatly from improved triple quadrupole technology. Once the analytical MS methods are fully mature, DNA adductomics along with other -omics tools will contribute greatly to the field of systems toxicology. PMID:24437709

  1. Neurodegeneration-associated instability of ribosomal DNA

    PubMed Central

    Hallgren, Justin; Pietrzak, Maciej; Rempala, Grzegorz; Nelson, Peter T.; Hetman, Michal

    2014-01-01

    Homologous recombination (HR)-mediated instability of the repetitively organized ribosomal DNA (rDNA) has been proposed as a mediator of cell senescence in yeast triggering the DNA damage response. High individual variability in the content of human rDNA suggests that this genomic region remained relatively unstable throughout evolution. Therefore, quantitative real time PCR was used to determine the genomic content of rDNA in post mortem samples of parietal cortex from 14 young- and 9 elderly individuals with no diagnosis of a chronic neurodegenerative/neurological disease. In addition, rDNA content in that brain region was compared between 10 age-matched control individuals and 10 patients with dementia with Lewy bodies (DLB) which involves neurodegeneration of the cerebral cortex. Probing rRNA-coding regions of rDNA revealed no effects of aging on the rDNA content. Elevated rDNA content was observed in DLB. Conversely, in the DLB pathology-free cerebellum, lower genomic content of rDNA was present in the DLB group. In the parietal cortex, such a DLB-associated instability of rDNA was not accompanied by any major changes of CpG methylation of the rDNA promoter. As increased cerebro-cortical rDNA content was previously reported in Alzheimer's diseases, neurodegeneration appears to be associated with instability of rDNA. The hypothetical origins and consequences of this phenomenon are discussed including possibilities that the DNA damage-induced recombination destabilizes rDNA and that differential content of rDNA affects heterochromatin formation, gene expression and/or DNA damage response. PMID:24389328

  2. Local Group(s)

    E-print Network

    Eva K. Grebel

    2006-05-22

    The properties of the galaxies of the Local Group are reviewed, followed by a brief discussion of nearby groups. The galaxy groups in our vicinity - the M81 group, the Cen A group, and the IC 342/Maffei group - are in many respects Local Group analogs: Their luminosity functions, galaxy content, fractional galaxy type distribution, crossing times, masses, and zero-velocity surface radii are similar to those of the Local Group. Also, the nearby groups usually consist of two subgroups, some of which approach each other and may ultimately merge to form a fossil group. These poor groups contrast with the less evolved, loose and extended galaxy ``clouds'' such as the Scl group and the CVn I cloud. These are characterized by long crossing times, are dominated by gas-rich, late-type galaxies, and lack gas-deficient, low luminosity early-type dwarfs. These clouds may be groups still in formation. The local Hubble flow derived from the clouds and groups is very cold.

  3. DNA unwinding and inhibition of T4 DNA ligase by anthracyclines.

    PubMed

    Montecucco, A; Pedrali-Noy, G; Spadari, S; Zanolin, E; Ciarrocchi, G

    1988-05-11

    The ability to alter DNA tertiary structure of ten anthracycline derivatives whose antitumor potency is known was studied by an assay that makes use of nicked circular DNA and bacteriophage T4 DNA ligase. This assay allows the detection of tertiary structure alterations caused by DNA binding of both intercalating and non-intercalating drugs. The determination of these events can be obtained at different temperatures in the range of activity of DNA ligase. The results indicate that anthracyclines alter the DNA tertiary structure but this property does not correlate with their cytotoxic or antitumor activities. An additional interesting finding was that several anthracyclines inhibit T4 DNA ligase. The inhibition can be complete and is a cubic function of drug concentration. The inhibition of DNA ligase does not correlate with the ability of anthracyclines to alter the tertiary structure of DNA but is dependent from the presence of an amino group on the sugar ring. PMID:3287337

  4. DNA unwinding and inhibition of T4 DNA ligase by anthracyclines.

    PubMed Central

    Montecucco, A; Pedrali-Noy, G; Spadari, S; Zanolin, E; Ciarrocchi, G

    1988-01-01

    The ability to alter DNA tertiary structure of ten anthracycline derivatives whose antitumor potency is known was studied by an assay that makes use of nicked circular DNA and bacteriophage T4 DNA ligase. This assay allows the detection of tertiary structure alterations caused by DNA binding of both intercalating and non-intercalating drugs. The determination of these events can be obtained at different temperatures in the range of activity of DNA ligase. The results indicate that anthracyclines alter the DNA tertiary structure but this property does not correlate with their cytotoxic or antitumor activities. An additional interesting finding was that several anthracyclines inhibit T4 DNA ligase. The inhibition can be complete and is a cubic function of drug concentration. The inhibition of DNA ligase does not correlate with the ability of anthracyclines to alter the tertiary structure of DNA but is dependent from the presence of an amino group on the sugar ring. Images PMID:3287337

  5. Effect of foscarnet induction treatment on quantitation of human cytomegalovirus (HCMV) DNA in peripheral blood polymorphonuclear leukocytes and aqueous humor of AIDS patients with HCMV retinitis. The Italian Foscarnet Study Group.

    PubMed

    Gerna, G; Baldanti, F; Sarasini, A; Furione, M; Percivalle, E; Revello, M G; Zipeto, D; Zella, D

    1994-01-01

    The aim of this study was to investigate peripheral blood polymorphonuclear leukocytes and, whenever possible, aqueous humor from 65 AIDS patients with ophthalmoscopically diagnosed human cytomegalovirus (HCMV) retinitis to determine (i) whether patients consistently carry viral DNA and (ii) to what extent foscarnet induction treatment decreases viral DNA levels. HCMV DNA was quantified by PCR using densitometric analysis of hybridization products obtained from external standards and a standard curve from which the number of genome equivalents of test samples, normalized by using an internal amplification control, was interpolated. Results showed that 56 of 65 patients (86.1%) were positive for HCMV DNA prior to induction treatment. Of 41 of the 56 patients (73.2%) whose blood had become DNA negative after induction, only 5 had a high viral load (> 5,000 genome equivalents per 2 x 10(5) polymorphonuclear leukocytes) prior to induction, whereas as many as 13 of the 15 (26.8%) patients remaining DNA positive after induction had a high viral load prior to induction. Finally, of the nine patients (13.8%) with DNA-negative blood prior to induction treatment, three were shifted to foscarnet from ganciclovir, while six were erroneously enrolled in the study. Pre- and postinduction aqueous humor samples were obtained from 12 patients; all of these were DNA positive prior to induction, whereas after induction, 4 became negative, 6 showed a marked decrease in viral DNA, and 2 had nearly stable low DNA levels. In conclusion, PCR is a valuable tool for etiologic diagnosis and monitoring of HCMV retinitis treatment in AIDS patients. HCMV DNA is consistently present in the blood and aqueous humor of all patients with HCMV retinitis. Foscarnet induction treatment is highly effective in suppressing or reducing DNA levels in both blood leukocytes and aqueous humor. PMID:8141577

  6. Effect of foscarnet induction treatment on quantitation of human cytomegalovirus (HCMV) DNA in peripheral blood polymorphonuclear leukocytes and aqueous humor of AIDS patients with HCMV retinitis. The Italian Foscarnet Study Group.

    PubMed Central

    Gerna, G; Baldanti, F; Sarasini, A; Furione, M; Percivalle, E; Revello, M G; Zipeto, D; Zella, D

    1994-01-01

    The aim of this study was to investigate peripheral blood polymorphonuclear leukocytes and, whenever possible, aqueous humor from 65 AIDS patients with ophthalmoscopically diagnosed human cytomegalovirus (HCMV) retinitis to determine (i) whether patients consistently carry viral DNA and (ii) to what extent foscarnet induction treatment decreases viral DNA levels. HCMV DNA was quantified by PCR using densitometric analysis of hybridization products obtained from external standards and a standard curve from which the number of genome equivalents of test samples, normalized by using an internal amplification control, was interpolated. Results showed that 56 of 65 patients (86.1%) were positive for HCMV DNA prior to induction treatment. Of 41 of the 56 patients (73.2%) whose blood had become DNA negative after induction, only 5 had a high viral load (> 5,000 genome equivalents per 2 x 10(5) polymorphonuclear leukocytes) prior to induction, whereas as many as 13 of the 15 (26.8%) patients remaining DNA positive after induction had a high viral load prior to induction. Finally, of the nine patients (13.8%) with DNA-negative blood prior to induction treatment, three were shifted to foscarnet from ganciclovir, while six were erroneously enrolled in the study. Pre- and postinduction aqueous humor samples were obtained from 12 patients; all of these were DNA positive prior to induction, whereas after induction, 4 became negative, 6 showed a marked decrease in viral DNA, and 2 had nearly stable low DNA levels. In conclusion, PCR is a valuable tool for etiologic diagnosis and monitoring of HCMV retinitis treatment in AIDS patients. HCMV DNA is consistently present in the blood and aqueous humor of all patients with HCMV retinitis. Foscarnet induction treatment is highly effective in suppressing or reducing DNA levels in both blood leukocytes and aqueous humor. Images PMID:8141577

  7. Combustion Group Group members

    E-print Network

    Wang, Wei

    Combustion Group Group members: Thierry Poinsot, Emilien Courtine, Luc Vervisch, Benjamin Farcy § New combustion and energy-conversion concepts #12;Introduction Combustion research thrusts Combustion Dynamics and Flame-Stabilization Research objectives § Obtain fundamental understanding of combustion

  8. DNA vaccines

    NASA Astrophysics Data System (ADS)

    Gregersen, Jens-Peter

    2001-12-01

    Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

  9. Packaged DNA. An elastic model.

    PubMed

    Manning, G S

    1985-03-01

    We review and deepen a theory of elastic bending of DNA on a persistence length scale. In a regime of extensive charge neutralization the axis of the double helix is elastically unstable when straight. Its stable bent conformation allows nucleation of DNA toruses and in principle could direct the supercoiled (solenoid) form of a polynucleosome. The Euler theory of elastic instability of macroscopic rods gives a partial description of the intrinsic ability of DNA to form locally stable bends. A different, quasi-Eulerian theory can be based on what is probably the dominant bending mechanism of DNA in solution-flexible kinking at the sites of open base pairs. This predictive theory is in quantitative agreement with the observed value (about 16 nm) for the minimum radius of torus holes. Stability of the inner torus ring is achieved when DNA phosphate groups are about 90% neutralized by trivalent cations, another prediction that is consistent with the observed formation of toruses in these conditions. The predicted stable radius of curvature of charge-neutralized DNA is also equal to the radial dimension of a maximally contracted polynucleosome supercoil as measured by neutron scattering (17 nm), but further experimental investigation of the geometrical disposition of the spacer DNA regions in the solenoid will be necessary to rule out the possibility of accidental agreement for this complex system. We stress again the experimental reality and probable importance of open base pairs in the equilibrium solution conformation of DNA. PMID:2408756

  10. ##### SAT Engine ####### _ ############ DNA ###### _

    E-print Network

    Hagiya, Masami

    ##### SAT Engine ####### _ ############ DNA ###### _ # # # #y # # #yy # # # #yy ###### DNA #################################### ############### ##################### 6 ## 10 ##### ### DNA ############### (Sakamoto et al., Science, Vol.288, pp.1223-122* *6

  11. Neandertal DNA

    NSDL National Science Digital Library

    The view of some scientists that modern humans did not descend from the Neandertals gained support when scientists from Munich, Germany analyzed DNA from a Neandertal. A news article from Archeology Online News discusses the recent research and provides links to additional news clips. This site covers one of the top ten scientific breakthroughs of 1997, compiled in the December 19, 1997 issue of Science. The top scientific breakthrough of 1997 was the cloning of a sheep, resulting in a lamb named Dolly. The nine runners up were: the Pathfinder mission to Mars, synchrotrons, biological clock genes, gamma ray bursts, Neandertal DNA, nanotubes, Europa's ocean, whole genome sequencing, and neurons.

  12. Comparison of three DNA extraction methods for recovery of soil protist DNA.

    PubMed

    Santos, Susana S; Nielsen, Tue Kjærgaard; Hansen, Lars H; Winding, Anne

    2015-08-01

    The use of molecular methods to investigate protist communities in soil is in rapid development this decade. Molecular analysis of soil protist communities is usually dependant on direct genomic DNA extraction from soil and inefficient or differential DNA extraction of protist DNA can lead to bias in downstream community analysis. Three commonly used soil DNA extraction methods have been tested on soil samples from three European Long-Term Observatories (LTOs) with different land-use and three protist cultures belonging to different phylogenetic groups in different growth stages. The methods tested were: ISOm-11063 (a version of the ISO-11063 method modified to include a FastPrep ®-24 mechanical lysis step), GnS-GII (developed by the GenoSol platform to extract soil DNA in large-scale soil surveys) and a commercial DNA extraction kit - Power Lyzer™ PowerSoil® DNA Isolation Kit (MoBio). DNA yield and quality were evaluated along with DNA suitability for amplification of 18S rDNA fragments by PCR. On soil samples, ISOm-11063 yields significantly higher DNA for two of the three soil samples, however, MoBio extraction favors DNA quality. This method was also more effective to recover copies of 18S rDNA numbers from all soil types. In addition and despite the lower yields, higher DNA quality was observed with DNA extracted from protist cultures with the MoBio method. Likewise, a bead-beating step shows to be a good solution for DNA extraction of soil protists, since the recovery of DNA from protist cultures and from the different soil samples with the ISOm method proved to be efficient in recovering PCR-amplifiable DNA. This study showed that soil DNA extraction methods provide biased results towards the cyst stages of protist organism. PMID:25966645

  13. DNA nanostructure immobilization to lithographic DNA arrays

    NASA Astrophysics Data System (ADS)

    Negrete, Omar D.

    Although DNA is well known for its genetic role in biology, DNA has also been sought-after as a material for the self-assembly of biological and electronic devices. Examples of DNA nanostructure construction include DNA tiled self-assembly and DNA Origami, where by controlling the sequence and concentration of DNA molecules, the rational design of geometric DNA nanostructures is possible. The assembly of DNA nanostructures takes place in solution and thus they are in disorder and require further organization to construct circuitry or devices. Hence, it is essential for future applications of this technology to develop methods to direct the placement of DNA nanostructures on a surface. To address this challenge my research examines the use of DNA microarrays to capture DNA nanostructures via DNA hybridization. Modern DNA arrays offer a high-density of sequence-specific molecular recognition sites where the addressable placement of DNA nanostructures can be achieved. Using Maskless Array Synthesizer (MAS) technology, I have characterized photolithographic DNA arrays for the hybridization of DNA complexes like large DNA molecules (> 1 kb), DNA-gold nanoparticle conjugates, and DNA Origami. Although modern photolithographic DNA arrays can possess a high-density of sequence (106/cm2), the printed DNA areas are on the order of tens of microns. Thus, I have also developed a method to reduce the DNA array spot size to nanoscale dimensions through the combined use of electron beam lithography with photolithographic DNA synthesis. This work addresses the key elements towards developing a surface patterning technology that takes advantage of DNA base-pairing for both molecular sub-assembly and surface patterning.

  14. DNA Methylation

    PubMed Central

    Marinus, M.G.; Løbner-Olesen, A.

    2014-01-01

    The DNA of E. coli contains 19,120 6-methyladenines and 12,045 5-methylcytosines in addition to the four regular bases and these are formed by the postreplicative action of three DNA methyltransferases. The majority of the methylated bases are formed by the Dam and Dcm methyltransferases encoded by the dam (DNA adenine methyltransferase) and dcm (DNA cytosine methyltransferase) genes. Although not essential, Dam methylation is important for strand discrimination during repair of replication errors, controlling the frequency of initiation of chromosome replication at oriC, and regulation of transcription initiation at promoters containing GATC sequences. In contrast, there is no known function for Dcm methylation although Dcm recognition sites constitute sequence motifs for Very Short Patch repair of T/G base mismatches. In certain bacteria (e.g., Vibrio cholerae, Caulobacter crescentus) adenine methylation is essential and in C. crescentus, it is important for temporal gene expression which, in turn, is required for coordinating chromosome initiation, replication and division. In practical terms, Dam and Dcm methylation can inhibit restriction enzyme cleavage; decrease transformation frequency in certain bacteria; decrease the stability of short direct repeats; are necessary for site-directed mutagenesis; and to probe eukaryotic structure and function. PMID:25405210

  15. Adleman[1] 1994 DNA Hamiltonian Path Problem , DNA

    E-print Network

    1. Adleman[1] 1994 DNA Hamiltonian Path Problem , DNA DNA [2]. DNA DNA , . , , 2 , DNA 4 . DNA 4 A(Adenine), C(Cytosine), G(Guanine), T(Thymine) 2 4 . , . 1 mole 6x10 23 DNA DNA . , . DNA NP-complete [1, 2], [2

  16. DNA Topology: Fundamentals

    E-print Network

    Mirkin, Sergei

    DNA Topology: Fundamentals Sergei M Mirkin, University of Illinois at Chicago, Illinois, USA Topological characteristics of DNA and specifically DNA supercoiling influence all major DNA transactions in living cells. DNA supercoiling induces the formation of unusual secondary structure by specific DNA

  17. Polymer microspheres carrying fluorescent DNA probes

    NASA Astrophysics Data System (ADS)

    Chen, Xiaoyu; Dai, Zhao; Zhang, Jimei; Xu, Shichao; Wu, Chunrong; Zheng, Guo

    2010-07-01

    A polymer microspheres carried DNA probe, which was based on resonance energy transfer, was presented in this paper when CdTe quantum dots(QDs) were as energy donors, Au nanoparticles were as energy accepters and poly(4- vinylpyrindine-co-ethylene glycol dimethacrylate) microspheres were as carriers. Polymer microspheres with functional group on surfaces were prepared by distillation-precipitation polymerization when ethylene glycol dimethacrylate was as crosslinker in acetonitrile. CdTe QDs were prepared when 3-mercaptopropionic acid(MPA) was as the stabilizer in aqueous solution. Because of the hydrogen-bonding between the carboxyl groups of MPA on QDs and the pyrindine groups on the microspheres, the QDs were self-assembled onto the surfaces of microspheres. Then, the other parts of DNA probe were finished according to the classic method. The DNA detection results indicated that this novel fluorescent DNA probe system could recognize the existence of complementary target DNA or not.

  18. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, Karin D. (Salt Lake City, UT); Chu, Tun-Jen (Salt Lake City, UT); Pitt, William G. (Orem, UT)

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  19. Distinct DNA methylomes of newborns and centenarians

    PubMed Central

    Heyn, Holger; Li, Ning; Ferreira, Humberto J.; Moran, Sebastian; Pisano, David G.; Gomez, Antonio; Diez, Javier; Sanchez-Mut, Jose V.; Setien, Fernando; Carmona, F. Javier; Puca, Annibale A.; Sayols, Sergi; Pujana, Miguel A.; Serra-Musach, Jordi; Iglesias-Platas, Isabel; Formiga, Francesc; Fernandez, Agustin F.; Fraga, Mario F.; Heath, Simon C.; Valencia, Alfonso; Gut, Ivo G.; Wang, Jun; Esteller, Manel

    2012-01-01

    Human aging cannot be fully understood in terms of the constrained genetic setting. Epigenetic drift is an alternative means of explaining age-associated alterations. To address this issue, we performed whole-genome bisulfite sequencing (WGBS) of newborn and centenarian genomes. The centenarian DNA had a lower DNA methylation content and a reduced correlation in the methylation status of neighboring cytosine—phosphate—guanine (CpGs) throughout the genome in comparison with the more homogeneously methylated newborn DNA. The more hypomethylated CpGs observed in the centenarian DNA compared with the neonate covered all genomic compartments, such as promoters, exonic, intronic, and intergenic regions. For regulatory regions, the most hypomethylated sequences in the centenarian DNA were present mainly at CpG-poor promoters and in tissue-specific genes, whereas a greater level of DNA methylation was observed in CpG island promoters. We extended the study to a larger cohort of newborn and nonagenarian samples using a 450,000 CpG-site DNA methylation microarray that reinforced the observation of more hypomethylated DNA sequences in the advanced age group. WGBS and 450,000 analyses of middle-age individuals demonstrated DNA methylomes in the crossroad between the newborn and the nonagenarian/centenarian groups. Our study constitutes a unique DNA methylation analysis of the extreme points of human life at a single-nucleotide resolution level. PMID:22689993

  20. EMPOP—the EDNAP mtDNA population database concept for a new generation, high-quality mtDNA database

    Microsoft Academic Search

    Walther Parson; Anita Brandstätter; Martin Pircher; Martin Steinlechner; Richard Scheithauer

    2004-01-01

    The European DNA Profiling Group (EDNAP) MtDNA Population Database (EMPOP) is an international collaborative project between DNA laboratories performing mtDNA analysis and the DNA laboratory of the Institute of Legal Medicine (GMI) in Innsbruck, Austria. The goal is to set up a directly accessible mtDNA population database, which can be used in routine forensic casework for frequency investigations.Most forensic laboratories

  1. Deciphering the Positional Influence of the Hydroxyl Group in the Cinnamoyl Part of 3-Hydroxy Flavonoids for Structural Modification and Their Interaction with the Protonated and B Form of Calf Thymus DNA Using Spectroscopic and Molecular Modeling Studies.

    PubMed

    Pradhan, Ankur Bikash; Haque, Lucy; Bhuiya, Sutanwi; Ganguly, Aniruddha; Das, Suman

    2015-06-11

    Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M. PMID:25978104

  2. Compaction of DNA by Gemini Surfactants: Effects of Surfactant Architecture

    Microsoft Academic Search

    Lisa Karlsson; Marcel C. P. van Eijk; Olle Söderman

    2002-01-01

    The interaction between bacteriophage T4 DNA and cationic gemini surfactants was studied by the use of fluorescence microscopy. Upon addition of surfactant, DNA undergoes a transition from random coil to globule, with an intermediate coexistence region. The state behavior of a DNA–gemini surfactant system was found to depend on spacer length, valency, head group size, and tail length. A series

  3. Benchmarking DNA barcodes: an assessment using available primate sequences

    Microsoft Academic Search

    Mehrdad Hajibabaei; Gregory A. C. Singer; Donal A. Hickey

    2006-01-01

    DNA barcoding has been recently promoted as a method for both assigning specimens to known species and for discovering new and cryptic species. Here we test both the potential and the limitations of DNA barcodes by analysing a group of well-studied organisms—the primates. Our results show that DNA barcodes provide enough information to efficiently identify and delineate primate species, but

  4. DNA Microarrays

    NASA Astrophysics Data System (ADS)

    Nguyen, C.; Gidrol, X.

    Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

  5. DNA/RNA Detection Using DNA-Templated Few-Atom Silver Nanoclusters.

    PubMed

    Obliosca, Judy M; Liu, Cong; Batson, Robert Austin; Babin, Mark C; Werner, James H; Yeh, Hsin-Chih

    2013-01-01

    DNA-templated few-atom silver nanoclusters (DNA/Ag NCs) are a new class of organic/inorganic composite nanomaterials whose fluorescence emission can be tuned throughout the visible and near-IR range by simply programming the template sequences. Compared to organic dyes, DNA/Ag NCs can be brighter and more photostable. Compared to quantum dots, DNA/Ag NCs are smaller, less prone to blinking on long timescales, and do not have a toxic core. The preparation of DNA/Ag NCs is simple and there is no need to remove excess precursors as these precursors are non-fluorescent. Our recent discovery of the fluorogenic and color switching properties of DNA/Ag NCs have led to the invention of new molecular probes, termed NanoCluster Beacons (NCBs), for DNA detection, with the capability to differentiate single-nucleotide polymorphisms by emission colors. NCBs are inexpensive, easy to prepare, and compatible with commercial DNA synthesizers. Many other groups have also explored and taken advantage of the environment sensitivities of DNA/Ag NCs in creating new tools for DNA/RNA detection and single-nucleotide polymorphism identification. In this review, we summarize the recent trends in the use of DNA/Ag NCs for developing DNA/RNA sensors. PMID:25586126

  6. Preparation and characterization of imogolite/DNA hybrid hydrogels.

    PubMed

    Jiravanichanun, Nattha; Yamamoto, Kazuya; Kato, Kenichi; Kim, Jungeun; Horiuchi, Shin; Yah, Weng-On; Otsuka, Hideyuki; Takahara, Atsushi

    2012-01-01

    Imogolite is one of the clay minerals contained in volcanic ash soils. The novel hybrid hydrogels were prepared from imogolite nanofibers and DNA by utilizing strong interaction between the aluminol groups on imogolite surface and phosphate groups of DNA. The hybrid hydrogels of imogolite and DNA were prepared in various feed ratios, and their physicochemical properties and molecular aggregation states were investigated in both dispersion and gel states. The maximum DNA content in the hybrid gels was shown in equivalent molar ratio of imogolite and DNA. The physical properties of the hybrid gels were changed by varying DNA blend ratios. In the dispersion state, the hybrid gels showed a fibrous structure of imogolite, whereas a continuous network structure was observed in pure imogolite, indicating that the hybrid with DNA enhanced the dispersion of imogolite. In the gel state, DNA and imogolite nanofibers formed a 3D network structure. PMID:22148683

  7. Energy transport in crystalline DNA composites

    SciTech Connect

    Xu, Zaoli; Xu, Shen; Tang, Xiaoduan; Wang, Xinwei, E-mail: xwang3@iastate.edu [Department of Mechanical Engineering, 2010 Black Engineering Building Iowa State University, Ames, IA 50011 (United States)] [Department of Mechanical Engineering, 2010 Black Engineering Building Iowa State University, Ames, IA 50011 (United States)

    2014-01-15

    This work reports on the synthesis of crystalline DNA-composited films and microfibers, and details the study of thermal energy transport in them. The transient electro-thermal technique is used to characterize the thermal transport in DNA composite microfibers, and the photothermal technique is used to explore the thermal transport in the thickness direction of DNA films. Compared with microfibers, the DNA films are found to have a higher thermal transport capacity, largely due to the carefully controlled crystallization process in film synthesis. In high NaCl concentration solutions, the bond of the Na{sup +} ion and phosphate group aligns the DNA molecules with the NaCl crystal structure during crystallization. This results in significant enhancement of thermal transport in the DNA films with aligned structure.

  8. INTRODUCTION Environmental DNA

    E-print Network

    Rieseberg, Loren

    scientific community, at least by facilitating bibliographic surveys. For example, the term `DNA barcoding. 2010), environmental barcoding (Hajibabaei et al. 2011) or DNA metabarcoding (Pompanon et al. 2011INTRODUCTION Environmental DNA PIERRE TABERLET,* ERIC COISSAC,* MEHRDAD HAJIBABAEI and LOREN H

  9. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P. (Danville, CA)

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  10. DNA, Genes and Chromosomes

    NSDL National Science Digital Library

    Mrs. Fomby

    2007-11-07

    Today you will learn about the parts of DNA and what DNA, genes and chromosomes are. Today you will learn what DNA, genes and chromosomes are and the parts of the DNA molecule. Look at all of the websites, take whatever notes you need to. At the end of the assignment, be able to describle DNA, the parts of DNA, genes and chromosomes. Covers Biology Core Curriculum, ...

  11. Design and applicability of DNA arrays and DNA barcodes in biodiversity monitoring

    Microsoft Academic Search

    Mehrdad Hajibabaei; Gregory AC Singer; Elizabeth L Clare; Paul DN Hebert

    2007-01-01

    BACKGROUND: The rapid and accurate identification of species is a critical component of large-scale biodiversity monitoring programs. DNA arrays (micro and macro) and DNA barcodes are two molecular approaches that have recently garnered much attention. Here, we compare these two platforms for identification of an important group, the mammals. RESULTS: Our analyses, based on the two commonly used mitochondrial genes

  12. Irradiation-induced binding of metallothionein to DNA

    NASA Astrophysics Data System (ADS)

    Fang, Xingwang; Wu, Jilan; Wei, Genshuan

    1997-11-01

    The present communication reveals that metallothionein (MT), whose thiolate groups are partially oxidized to disulfides by hydroxyl radicals generated by ?-irradiation, is readily to be bound to DNA. Hydroxyl-radical-induced oxidation to MT results in unsaturated coordination of metal ions and exposure of some lysine residues. Thus we propose that oxygen atoms in the phosphate functional group of DNA, take part in metal coordination in MT, and the strongly positively charged terminal amino groups of lysine residues in MT attract negatively charged DNA, which both lead to the binding of MT to DNA.

  13. Developmental validation of the ParaDNA(®) Intelligence System-A novel approach to DNA profiling.

    PubMed

    Blackman, Stephen; Dawnay, Nick; Ball, Glyn; Stafford-Allen, Beccy; Tribble, Nicholas; Rendell, Paul; Neary, Kelsey; Hanson, Erin K; Ballantyne, Jack; Kallifatidis, Beatrice; Mendel, Julian; Mills, DeEtta K; Wells, Simon

    2015-07-01

    DNA profiling through the analysis of STRs remains one of the most widely used tools in human identification across the world. Current laboratory STR analysis is slow, costly and requires expert users and interpretation which can lead to instances of delayed investigations or non-testing of evidence on budget grounds. The ParaDNA(®) Intelligence System has been designed to provide a simple, fast and robust way to profile DNA samples in a lab or field-deployable manner. The system analyses 5-STRs plus amelogenin to deliver a DNA profile that enables users to gain rapid investigative leads and intelligent prioritisation of samples in human identity testing applications. Utilising an innovative sample collector, minimal training is required to enable both DNA analysts and nonspecialist personnel to analyse biological samples directly, without prior processing, in approximately 75min. The test uses direct PCR with fluorescent HyBeacon(®) detection of STR allele lengths to provide a DNA profile. The developmental validation study described here followed the Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines and tested the sensitivity, reproducibility, accuracy, inhibitor tolerance, and performance of the ParaDNA Intelligence System on a range of mock evidence items. The data collected demonstrate that the ParaDNA Intelligence System displays useful DNA profiles when sampling a variety of evidence items including blood, saliva, semen and touch DNA items indicating the potential to benefit a number of applications in fields such as forensic, military and disaster victim identification (DVI). PMID:25980941

  14. DNA encoding a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  15. DNA Paternity Testing: Public Perceptions And The Influence Of Gender

    Microsoft Academic Search

    Michael Gilding; Christine Critchley; Penelope Shields; Lisa Bakacs; Kerrie-Anne Butler

    This article reports on the findings of the Swinburne National Technology and Society Monitor in relation to public perceptions of DNA paternity testing, with particular reference to the effects of gender. The Monitor included a large-scale random survey and focus groups. Taken together, the survey and focus groups suggest that most Australians are 'comfortable' with DNA paternity testing in a

  16. Label-free detection of DNA hybridization with EIS measurements

    Microsoft Academic Search

    Chaker Tlili; H. Korri-Youssoufi; Laurence Ponsonnet; Claude Martelet; N. Jaffrezic-Renault

    2005-01-01

    We report a new approach for detecting DNA hybridisation using nonFaradaic electrochemical impedance spectroscopy. The technique was applied to a system of DNA probes bearing amine groups that are immobilized by covalent grafting on a supporting polypyrrole matrix functionalised with activated ester groups. Results show a significant modification in the Nyquist plot upon addition of the complementary target whereas, in

  17. DNA Binding Hydroxyl Radical Probes

    PubMed Central

    Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

    2011-01-01

    The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA. PMID:22125376

  18. Endogenous RNA-Directed DNA Polymerase Activity in Uninfected Chicken Embryos

    Microsoft Academic Search

    Chil-Yong Kang; Howard M. Temin

    1972-01-01

    Early chicken embryos that are either positive or negative for group-specific antigens of avian leukosis viruses contained endogenous RNA-directed DNA polymerase activity. This endogenous DNA polymerase activity was not increased after mixture of soluble DNA polymerases isolated from chicken embryos with disrupted chicken embryo cells. The endogenous activity was resistant to treatment with deoxyribonuclease, and the initial rate of DNA

  19. Compressive Sensing DNA Microarrays Wei Dai, Mona A. Sheikh, Olgica Milenkovic, and Richard G. Baraniuk

    E-print Network

    1 Compressive Sensing DNA Microarrays Wei Dai, Mona A. Sheikh, Olgica Milenkovic, and Richard G--Compressive sensing, DNA microarray, group testing, hybridization affinity, probe design I. INTRODUCTION Accurate problem. DNA microarrays are a frequently applied solution for microbe DNA detection and classification [1

  20. Identification and Development of Sex Specific DNA Markers in the Ostrich Using Polymerase Chain Reaction

    Microsoft Academic Search

    2005-01-01

    The objective of this study was to identify and develop DNA markers that can be used for sex diagnosis in the ostrich (Struthio camelus) using polymerase chain reaction (PCR) technology. DNA was isolated from 15 male and 15 female, year old, crossbred ostriches. Two bulked DNA samples were prepared by grouping sexes. Random amplified polymorphic DNA (RAPD) analysis was used

  1. DNA restriction patterns and DNA-DNA solution hybridization studies of Frankia isolates from Myrica pennsylvanica (bayberry).

    PubMed Central

    Bloom, R A; Mullin, B C; Tate, R L

    1989-01-01

    Sixteen Frankia strains were isolated from Myrica pennsylvanica (bayberry) root nodules collected at diverse sites in New Jersey. Restriction pattern analysis of total genomic DNA was used to group the isolates into gel groups, and the genetic relatedness among the isolates was evaluated by DNA-DNA solution hybridization studies. Restriction pattern analysis provided a distinctive reproducible fingerprint for each isolate. Isolates fell into nine separate groups (strain types). More than one strain type was isolated from most sites. Isolates from two different gel groups were found in 3 of 10 nodules examined. Of the 16 isolates, 10 contained extrachromosomal DNA. Six different extrachromosomal DNA banding patterns were found. Genomically similar isolates carried related, but different, banding patterns. DNA hybridization studies indicated that isolates from a single plant species can be minimally related as determined by total genome homology. Homology ranged from 12 to 99%. Highly divergent strains were isolated from the same plant and found to cohabit the same nodule. Thus, this study demonstrated that Frankia strains which infect the same host plant are not only phenotypically different but also genetically diverse. Images PMID:2802599

  2. Melanesian mtDNA Complexity

    PubMed Central

    Friedlaender, Jonathan S.; Friedlaender, Françoise R.; Hodgson, Jason A.; Stoltz, Matthew; Koki, George; Horvat, Gisele; Zhadanov, Sergey; Schurr, Theodore G.; Merriwether, D. Andrew

    2007-01-01

    Melanesian populations are known for their diversity, but it has been hard to grasp the pattern of the variation or its underlying dynamic. Using 1,223 mitochondrial DNA (mtDNA) sequences from hypervariable regions 1 and 2 (HVR1 and HVR2) from 32 populations, we found the among-group variation is structured by island, island size, and also by language affiliation. The more isolated inland Papuan-speaking groups on the largest islands have the greatest distinctions, while shore dwelling populations are considerably less diverse (at the same time, within-group haplotype diversity is less in the most isolated groups). Persistent differences between shore and inland groups in effective population sizes and marital migration rates probably cause these differences. We also add 16 whole sequences to the Melanesian mtDNA phylogenies. We identify the likely origins of a number of the haplogroups and ancient branches in specific islands, point to some ancient mtDNA connections between Near Oceania and Australia, and show additional Holocene connections between Island Southeast Asia/Taiwan and Island Melanesia with branches of haplogroup E. Coalescence estimates based on synonymous transitions in the coding region suggest an initial settlement and expansion in the region at ?30–50,000 years before present (YBP), and a second important expansion from Island Southeast Asia/Taiwan during the interval ?3,500–8,000 YBP. However, there are some important variance components in molecular dating that have been overlooked, and the specific nature of ancestral (maternal) Austronesian influence in this region remains unresolved. PMID:17327912

  3. Preparation and characterization of DNA/allophane composite hydrogels.

    PubMed

    Kawachi, Takuya; Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; Okamoto, Masami

    2013-12-01

    The preparation and characterization of the composite hydrogels based on double-stranded deoxyribonucleic acid (DNA) and natural allophane (AK70) were reported. To understand the propensity of the natural allophane to adsorb the DNA molecules, using zeta potential measurement, Fourier transform infrared spectroscopy (FTIR) and electrophoresis analyses assessed the adsorption characteristics. The freeze-dried DNA/AK70 hydrogels were demonstrated that the DNA bundle structure with a width of ?2?m and a length of ?15-20?m was wrapped around the clustered allophane particles as revealed by FE-SEM/EDX analysis. The incorporation of AK70 in hydrogels induced the increase in the enthalpy of the helix-coil transition of DNA duplex due to the restricted molecular motions of the DNA duplex facilitated by the interaction between the phosphate groups of DNA and the protonated (+)(OH2)Al(OH2) groups on the wall perforations of the allophane. PMID:24041573

  4. Quantitative DNA fiber mapping

    DOEpatents

    Gray, Joe W. (San Francisco, CA); Weier, Heinz-Ulrich G. (Oakland, CA)

    1998-01-01

    The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

  5. Groups32

    NSDL National Science Digital Library

    A group theory calculator. Groups32 computes information about groups of orders 1-32; has a permutation group package; and provides a search for groups with given generators and relations. Site includes documentation as well as course handouts in PDF format.

  6. Proactive Groups.

    ERIC Educational Resources Information Center

    Galassi, John P., Ed.

    Several authors describe group counseling programs provided by a university counseling center to meet student needs for developing interpersonal communication skills and self-assertion behavior. In response to these needs, the counseling center provided personal growth groups, a proactive black group, a women's group, a marriage growth group, and…

  7. Amplified DNA Biosensors

    Microsoft Academic Search

    Itamar Willner; Bella Shlyahovsky; Bilha Willner; Maya Zayats

    2009-01-01

    \\u000a Amplified detection of DNA is a central research topic in modern bioanalytical science. Electronic or optical transduction\\u000a of DNA recognition events provides readout signals for DNA biosensors. Amplification of the DNA analysis is accomplished by\\u000a the coupling of nucleic acid-functionalized enzymes or nucleic acid-functionalized nanoparticles (NP) as labels for the DNA\\u000a duplex formation. This chapter discusses the amplified amperometric analysis

  8. Chemical methods of DNA and RNA fluorescent labeling.

    PubMed Central

    Proudnikov, D; Mirzabekov, A

    1996-01-01

    Several procedures have been described for fluorescent labeling of DNA and RNA. They are based on the introduction of aldehyde groups by partial depurination of DNA or oxidation of the 3'-terminal ribonucleoside in RNA by sodium periodate. Fluorescent labels with an attached hydrazine group are efficiently coupled with the aldehyde groups and the hydrazone bonds are stabilized by reduction with sodium cyanoborohydride. Alternatively, DNA can be quantitatively split at the depurinated sites with ethylenediamine. The aldimine bond between the aldehyde group in depurinated DNA or oxidized RNA and ethylenediamine is stabilized by reduction with sodium cyanoborohydride and the primary amine group introduced at these sites is used for attachment of isothiocyanate or succinimide derivatives of fluorescent dyes. The fluorescent DNA labeling can be carried out either in solution or on a reverse phase column. These procedures provide simple, inexpensive methods of multiple DNA labeling and of introducing one fluorescent dye molecule per RNA, as well as quantitative DNA fragmentation and incorporation of one label per fragment. These methods of fluorophore attachment were shown to be efficient for use in the hybridization of labeled RNA, DNA and DNA fragments with oligonucleotide microchips. PMID:8948646

  9. DNA bar-coding for phytoplasma identification.

    PubMed

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta; Bertaccini, Assunta; Nyskjold, Henriette; Nicolaisen, Mogens

    2013-01-01

    Phytoplasma identification has proved difficult due to their inability to be maintained in vitro. DNA barcoding is an identification method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identification. While other sequence-based methods may be well adapted to identification of particular strains of phytoplasmas, often they cannot be used for the simultaneous identification of phytoplasmas from different groups. The phytoplasma DNA barcoding protocol in this chapter, based on the tuf and 16SrRNA genes, can be used to identify the following phytoplasma groups: 16SrI, 16SrII, 16SrIII, 16SrIV, 16SrV, 16SrVI, 16SrVII, 16SrIX, 16SrX, 16SrXI, 16SrXII, 16SrXV, 16SrXX, 16SrXXI. PMID:22987426

  10. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  11. A genetic study of mycelial compatibility groups of Sclerotium rolfsii

    E-print Network

    Nalim, F. Ameena

    1995-01-01

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 Fungal collection 9 Mycelial compatibility groups?, . . . . . . . . . . . . . . . . . . . . . , . . . . . . . . . . . . . . . . . , . . . . 9 DNA extraction. 13 NK2 amplification using a oligonucleotide primer. . . . . . . . . 14 PCR... corresspond to previously identified MCG. DNA extraction. Liquid growth media, inoculum type, incubation temperature, and other parameters were varied to identify the optimal conditions for growth of S. rolfsii and extraction of DNA. Isolates were grown...

  12. Nucleotide sequence of cassava latent virus DNA

    Microsoft Academic Search

    John Stanley; Michael R. Gay

    1983-01-01

    Only two groups of plant viruses, the caulimoviruses1,2 and the geminiviruses3, are known to contain a genome of DNA. Unlike that of the caulimoviruses, the genome of the geminivinises is composed of single-stranded, covalently-closed circles of DNA. There is evidence that the geminiviruses, specifically bean golden mosaic virus4 and tomato golden mosaic virus5, have a genome composed of two similar-sized

  13. Circulating DNA in systemic lupus erythematosus. Isolation and characterization.

    PubMed Central

    Steinman, C R

    1984-01-01

    Immunoprecipitable double-stranded (dsDNA) was previously shown to persist in the circulation of a clinically recognizable subgroup of patients with systemic lupus erythematosus (SLE). Plasma from 10 such patients was subjected to a DNA isolation procedure that used a combination of proteolysis, phenol extraction, and hydroxylapatite adsorption and elution in the presence of urea. The isolated dsDNA was radiolabeled by nick translation and then characterized by isopyknic ultracentrifugation in CsCl under both neutral and alkaline conditions, as well as after digestion with S1-endonuclease. These experiments demonstrated essential identity in nucleotide base composition between the plasma-derived DNA and human genomic DNA. The presence of specific human base sequences in the plasma DNA was demonstrated by finding that authentic human genomic DNA accelerated the renaturation of plasma DNA when compared with the effect of nonhuman, control DNA. The proportion of such sequences in plasma DNA was estimated by attempting to renature the plasma DNA in the presence of human DNA under conditions shown to result in complete renaturation of human DNA in model experiments. In this way, a minimum of 47% of plasma DNA base sequences could be shown also to be present in human genomic DNA. However, an average of 10-20% of the plasma-derived DNA failed to renature under these conditions, a result that was further confirmed by comparing the renaturation of the tritium-labeled plasma DNA specimens, in double-label experiments, with internal controls consisting of 14C-labeled authentic human DNA. Attempts to drive the reaction to completion with human DNA led to a similar conclusion. The relative nonrenaturability of this fraction of plasma DNA did not appear to be attributable to extensive chain breakage, although adequate analysis of this DNA subfraction was limited by reagent availability. It was therefore concluded that, in this group of SLE patients, persistently circulating DNA consisted largely of base sequences also found in human genomic DNA. The additional presence in plasma of a DNA subfraction that differed in its renaturation behavior from human genomic DNA was recognized, although its significance could not be established with certainty. PMID:6323528

  14. DNA methylation: bisulphite modification and analysis.

    PubMed

    Patterson, Kate; Molloy, Laura; Qu, Wenjia; Clark, Susan

    2011-01-01

    Epigenetics describes the heritable changes in gene function that occur independently to the DNA sequence. The molecular basis of epigenetic gene regulation is complex, but essentially involves modifications to the DNA itself or the proteins with which DNA associates. The predominant epigenetic modification of DNA in mammalian genomes is methylation of cytosine nucleotides (5-MeC). DNA methylation provides instruction to gene expression machinery as to where and when the gene should be expressed. The primary target sequence for DNA methylation in mammals is 5'-CpG-3' dinucleotides (Figure 1). CpG dinucleotides are not uniformly distributed throughout the genome, but are concentrated in regions of repetitive genomic sequences and CpG "islands" commonly associated with gene promoters (Figure 1). DNA methylation patterns are established early in development, modulated during tissue specific differentiation and disrupted in many disease states including cancer. To understand the biological role of DNA methylation and its role in human disease, precise, efficient and reproducible methods are required to detect and quantify individual 5-MeCs. This protocol for bisulphite conversion is the "gold standard" for DNA methylation analysis and facilitates identification and quantification of DNA methylation at single nucleotide resolution. The chemistry of cytosine deamination by sodium bisulphite involves three steps (Figure 2). (1) Sulphonation: The addition of bisulphite to the 5-6 double bond of cytosine (2) Hydrolic Deamination: hydrolytic deamination of the resulting cytosine-bisulphite derivative to give a uracil-bisulphite derivative (3) Alkali Desulphonation: Removal of the sulphonate group by an alkali treatment, to give uracil. Bisulphite preferentially deaminates cytosine to uracil in single stranded DNA, whereas 5-MeC, is refractory to bisulphite-mediated deamination. Upon PCR amplification, uracil is amplified as thymine while 5-MeC residues remain as cytosines, allowing methylated CpGs to be distinguished from unmethylated CpGs by presence of a cytosine "C" versus thymine "T" residue during sequencing. DNA modification by bisulphite conversion is a well-established protocol that can be exploited for many methods of DNA methylation analysis. Since the detection of 5-MeC by bisulphite conversion was first demonstrated by Frommer et al. and Clark et al., methods based around bisulphite conversion of genomic DNA account for the majority of new data on DNA methylation. Different methods of post PCR analysis may be utilized, depending on the degree of specificity and resolution of methylation required. Cloning and sequencing is still the most readily available method that can give single nucleotide resolution for methylation across the DNA molecule. PMID:22042230

  15. Mitochondrial DNA inherited variants are associated with successful aging and longevity in humans

    Microsoft Academic Search

    G. DE BENEDICTIS; G. ROSE; G. CARRIERI; M. DE LUCA; E. FALCONE; G. PASSARINO; M. BONAFE; D. MONTI; G. BAGGIO; S. BERTOLINI; D. MARI; R. MATTACE; C. FRANCESCHI

    Mitochondrial DNA (mtDNA) is char- acterized by high variability, maternal inheritance, and absence of recombination. Studies of human populations have revealed ancestral associated poly- morphisms whose combination defines groups of mtDNA types (haplogroups) that are currently used to reconstruct human evolution lineages. We used such inherited mtDNA markers to compare mtDNA population pools between a sample of individuals selected for

  16. Inherited Mendelian defects of nuclear–mitochondrial communication affecting the stability of mitochondrial DNA

    Microsoft Academic Search

    Anna Limongelli; Valeria Tiranti

    2002-01-01

    The presence of mtDNA abnormalities inherited as Mendelian traits indicates the existence of mutations in nuclear genes affecting the integrity of the mitochondrial genome. Two groups of nucleus-driven abnormalities have been described: qualitative alterations of mtDNA, i.e. multiple large-scale deletions of mtDNA, and quantitative decrease of the mtDNA copy number, i.e. tissue-specific depletion of mtDNA. Autosomal dominant or recessive (adPEO),

  17. Food Groups

    MedlinePLUS

    Welcome to the Five Food Groups MyPlate illustrates the five food groups that are the building blocks for a healthy diet using a familiar image – ... half your grains whole. >> See Grains Group Protein Foods Go lean with protein. >> See Protein Foods Group ...

  18. Synthesis of site-specific DNA-protein conjugates and their effects on DNA replication.

    PubMed

    Yeo, Jung Eun; Wickramaratne, Susith; Khatwani, Santoshkumar; Wang, Yen-Chih; Vervacke, Jeffrey; Distefano, Mark D; Tretyakova, Natalia Y

    2014-08-15

    DNA-protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA-protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases ?, ?, ?, and ?. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  19. Synthesis of Site-Specific DNA–Protein Conjugates and Their Effects on DNA Replication

    PubMed Central

    2015-01-01

    DNA–protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA–protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases ?, ?, ?, and ?. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  20. Photoelectrochemical synthesis of DNA microarrays

    PubMed Central

    Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

    2009-01-01

    Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

  1. Oswald Avery (c.1930), still imageSite: DNA Interactive (www.dnai.org)

    NSDL National Science Digital Library

    2008-10-06

    Oswald Avery, circa 1930. In a very simple experiment, Oswald Avery's group showed that DNA was the "transforming principle." When isolated from one strain of bacteria, DNA was able to transform another strain and confer characteristics onto that second strain. DNA was carrying hereditary information. With DNA as the hereditary molecule, the stage was set for one of the most exciting periods in DNA science: understanding DNA structure and function. Now use the buttons along the top to explore some of the other sections in this module. Solve the structure of DNA!

  2. Structural Organization of DNA.

    ERIC Educational Resources Information Center

    Banfalvi, Gaspar

    1986-01-01

    Explains the structural organization of DNA by providing information on the primary, secondary, tertiary, and higher organization levels of the molecule. Also includes illustrations and descriptions of sign-inversion and rotating models for supercoiling of DNA. (ML)

  3. Make a DNA Model

    NSDL National Science Digital Library

    American Museum of Natural History

    2012-06-26

    In this activity, learners make a 3-D model of DNA using paper and toothpicks. While constructing this model, learners will explore the composition and structure of DNA. The activity also gives suggestions for alternate materials and challenges to explore.

  4. Meta-DNA: synthetic biology via DNA nanostructures and

    E-print Network

    Reif, John H.

    Meta-DNA: synthetic biology via DNA nanostructures and hybridization reactions Harish Chandran1 of DNA manipulations achieved by protein enzymes be simulated via simple DNA hybridization chemistry? In this work, we develop a biochemical system which we call meta-DNA (abbreviated as mDNA), based on strands

  5. Perspectives On DNA Looping

    Microsoft Academic Search

    Laura Finzi

    DNA looping is a ubiquitous regulatorymechanism which can be involved in DNA transcription, ecombination, repair, etc. Here,\\u000a I will focus on protein-mediated DNA looping as a mechanism of tran-scriptional regulation. Indeed, such topological change\\u000a in DNA is known to repress and\\/or activate many prokaryotic and viral genes [1–4] and is believed to mediate interaction between\\u000a promoters and enhancers as well

  6. Comparative studies of UV-induced DNA cleavage by structural isomers of an iodinated DNA ligand

    SciTech Connect

    Martin, R.F.; Green, A.; Denison, L.; Pardee, M.; Kelly, D.P.; Roberts, M.; Rose, M.; Reum, M.

    1994-06-15

    The purpose was to evaluate the importance of the position of the halogen atom in iodinated DNA-binding bibenzimidazoles, with respect to sensitization of UV-A-induced DNA breakage. Three analogues of iodoHoechst 33258, denoted ortho-, meta- and paraiodoHoechst, according to the site of iodine substitution, were synthesized. Plasmid DNA (pBR322) was used to assay UV-A-induced DNA single-strand breaks (ssbs). The location of the sites of strand breakage was determined by DNA sequencing gel analysis, using a [sup 32]P-endlabelled oligoDNA with a single binding site for the ligands. A clear trend in decreasing activity of sensitization of UV-induced DNA ssbs was established: Ortho- > meta-, para- > iodoHoechst 33258. The sequencing gel studies showed that orthoiodoHoechst was distinct from the other three compounds, with respect to the sites of DNA strand breakage and the chemistry of the cleavage reaction. The position of iodine substitution in iodinated bibenzimidazoles determines the location of the carbon-centered radical on the ligand in the minor groove of DNA. DNA strand cleavage is mediated by abstraction of a nearby deoxyribosyl H-atom. Hence, the position of the radical species determines: which deoxyribosyl group is attacked (i.e., site of cleavage relative to the ligand binding site); which H-atom is abstracted, more specifically which of the five deoxyribosyl carbons is involved (i.e., the chemistry of the cleavage reaction), and the stereochemistry of the transition state for the H-atom abstraction (and hence the efficiency or extent of strand breakage). The ortho-compound represents the best example to date of iodinated DNA ligands designed as potential radiation sensitizers, as an extension of the well-established sensitization by halogenated DNA precursors. 30 refs., 3 figs.

  7. From Cell to DNA

    NSDL National Science Digital Library

    Dexter Pratt (AAAS; Science Netlinks)

    2008-01-01

    This animation takes the students through a tour of a typical human cell, moving from larger to smaller cell structures (i.e., from nucleus to chromosomes to DNA strands and their bases). It briefly describes some of these structures and describes how DNA strands are constructed. This animation can be used as an introduction to the study of chromosomes and DNA.

  8. Human DNA Repair Genes

    Microsoft Academic Search

    Richard D. Wood; Michael Mitchell; John Sgouros; Tomas Lindahl

    2001-01-01

    Cellular DNA is subjected to continual attack, both by reactive species inside cells and by environmental agents. Toxic and mutagenic consequences are minimized by distinct pathways of repair, and 130 known human DNA repair genes are described here. Notable features presently include four enzymes that can remove uracil from DNA, seven recombination genes related to RAD51, and many recently discovered

  9. Northwestern University Recombinant DNA

    E-print Network

    Shull, Kenneth R.

    Northwestern University Recombinant DNA Safety Program Office of Research Safety Office of the Vice deoxyribonucleic acid (DNA) shall comply with the National Institute of Health's "Guidelines for Research Involving Recombinant DNA Molecules" (NIH Guidelines) as published in the Federal Register (www

  10. DNA barcoding for ecologists

    Microsoft Academic Search

    Alice Valentini; Francois Pompanon; Pierre Taberlet

    2008-01-01

    DNA barcoding - taxon identification using a standar- dized DNA region - has received much attention recently, and is being further developed through an international initiative. We anticipate that DNA barcod- ing techniques will be increasingly used by ecologists. They will be able to not only identify a single species from a specimen or an organism's remains but also determine

  11. Mechanism of DNA Translocation in a Replicative Hexameric Helicase

    SciTech Connect

    Enemark,E.; Joshua-Tor, L.

    2006-01-01

    The E1 protein of papillomavirus is a hexameric ring helicase belonging to the AAA + family. The mechanism that couples the ATP cycle to DNA translocation has been unclear. Here we present the crystal structure of the E1 hexamer with single-stranded DNA discretely bound within the hexamer channel and nucleotides at the subunit interfaces. This structure demonstrates that only one strand of DNA passes through the hexamer channel and that the DNA-binding hairpins of each subunit form a spiral 'staircase' that sequentially tracks the oligonucleotide backbone. Consecutively grouped ATP, ADP and apo configurations correlate with the height of the hairpin, suggesting a straightforward DNA translocation mechanism. Each subunit sequentially progresses through ATP, ADP and apo states while the associated DNA-binding hairpin travels from the top staircase position to the bottom, escorting one nucleotide of single-stranded DNA through the channel. These events permute sequentially around the ring from one subunit to the next.

  12. DNA-Catalyzed Hydrolysis of Esters and Aromatic Amides

    PubMed Central

    Brandsen, Benjamin M.; Hesser, Anthony R.; Castner, Marissa A.; Chandra, Madhavaiah

    2013-01-01

    We previously reported that DNA catalysts (deoxyribozymes) can hydrolyze DNA phosphodiester linkages, but DNA-catalyzed amide bond hydrolysis has been elusive. Here we used in vitro selection to identify DNA catalysts that hydrolyze ester linkages as well as DNA catalysts that hydrolyze aromatic amides, for which the leaving group is an aniline moiety. The aromatic amide-hydrolyzing deoxyribozymes were examined using linear free energy relationship analysis. The hydrolysis reaction is unaffected by substituents on the aromatic ring (? ? 0), suggesting general acid-catalyzed elimination as the likely rate-determining step of the addition-elimination hydrolysis mechanism. These findings establish that DNA has the catalytic ability to achieve hydrolysis of esters and aromatic amides as carbonyl-based substrates, and they suggest a mechanism-based approach to achieve DNA-catalyzed aliphatic amide hydrolysis. PMID:24127695

  13. [Comparison of DNA adducts between oral, pharyngeal and larynx cancer].

    PubMed

    Pabiszczak, M; Banaszewski, J; Szmeja, Z; Szyfter, K; Szyfter, W

    2001-01-01

    The results concerning examination of DNA adducts in oral (23 patients), pharyngeal (23 patients) and larynx cancer (10 patients) subjects are presented. DNA adduct levels were compared in respect to anatomical structure (primary tumour location), number of cigarettes smoked, TNM stage, and age of patients. DNA was isolated from removed tissue (tumour and non-tumour surrounding tissue) using detergent/phenol extraction. 32P-postlabelling assay including nuclease P1-enhancement modification was applied. Aromatic DNA adducts were found in all studied tissues. Total DNA adduct levels (tumour and non-tumour tissues) was lowest in larynx cancer, higher in oral cancer and highest in pharyngeal cancer. There were no influence of age into formation of DNA adducts. The higher level of DNA adducts was found in tumour tissue of oral cancer in the group of smokers with metastasis into lymph nodes. PMID:11868331

  14. Evaluation of DNAstable for DNA storage at ambient temperature.

    PubMed

    Howlett, Susanne E; Castillo, Hilda S; Gioeni, Lora J; Robertson, James M; Donfack, Joseph

    2014-01-01

    Preserving DNA is important for validation of prospective and retrospective analyses, requiring many expensive types of equipment (e.g., freezers and back-up generators) and energy. While freezing is the most common method for storing extracted DNA evidence or well-characterized DNA samples for validation studies, DNAstable (Biomatrica), a commercially available medium for room temperature storage of DNA extracts was evaluated in this study. Two groups of samples consisting of different DNA quantities were investigated, one ranging from 20 to 400 ng (group 1) and the other one ranging from 1.4 to 20 ng (group 2). The DNA samples with and without DNAstable were stored at four different temperatures [?25 °C (room temperature), -20 °C, 37 °C or 50 °C]. DNA degradation over several months was monitored by SYBR Green-based qPCR assays and by PCR amplification of the core CODIS STR markers for group 1 and 2 DNA samples, respectively. For the time points tested in this study (up to 365 days), the findings indicate that the -20 °C controls and the DNAstable protected samples at room temperature provided similar DNA recoveries that were higher compared to the unprotected controls kept at RT, 37 °C or 50 °C. These results suggest that DNAstable can protect DNA samples with effectiveness similar to that of the traditional -20 °C freezing method. In addition, extrapolations from accelerated aging experiments conducted at high temperatures support that DNAstable is an effective technology for preserving purified DNA at room temperature with a larger protective impact on DNA samples of low quantity (<20 ng). PMID:24315605

  15. Nuclear DNA content variation within the genus Taraxacum ( Asteraceae )

    Microsoft Academic Search

    Lud?k Záveský; Vlasta Jarolímová; Jan Št?pánek

    2005-01-01

    Nuclear DNA content was estimated using flow cytometry in 13 sections represented by 18 species of the genusTaraxacum using propidium iodide as the DNA stain. Investigated plants represented diploid, triploid and tetraploid species from sections\\u000a considered both primitive and advanced, i.e.,T. sect.Dioszegia, Piesis, Glacialia, Mongolica, Scariosa, Obovata, T. pyrenaicum group,T. sect.Coronata, Palustria, Taraxacum (=Crocea),Kashmirana, Ruderalia andErythrosperma. Estimated nuclear 2C DNA

  16. Hot Groups.

    ERIC Educational Resources Information Center

    Vail, Kathleen

    1996-01-01

    Collaborators sparked by creative ideas and obsessed by a common task may not realize they're part of a "hot group"--a term coined by business professors Harold J. Leavitt and Jean Lipman-Blumen. Spawned by group decision making and employee empowerment, hot groups can flourish in education settings. They're typically small, short lived, and goal…

  17. DNA binding to proteolytically activated TLR9 is sequence-independent and enhanced by DNA curvature

    PubMed Central

    Li, Yue; Berke, Ian C; Modis, Yorgo

    2012-01-01

    Toll-like receptor 9 (TLR9) recognizes microbial DNA in endolysosomal compartments. The ectodomain of TLR9 must be proteolytically cleaved by endosomal proteases to produce the active receptor capable of inducing an innate immune signal. We show that the cleaved TLR9 ectodomain is a monomer in solution and that DNA ligands with phosphodiester backbones induce TLR9 dimerization in a sequence-independent manner. Ligands with phosphorothioate (PS) backbones induce the formation of large TLR9–DNA aggregates, possibly due to the propensity of PS ligands to self-associate. DNA curvature-inducing proteins including high-mobility group box 1 and histones H2A and H2B significantly enhance TLR9 binding, suggesting that TLR9 preferentially recognizes curved DNA backbones. Our work sheds light on the molecular mechanism of TLR9 activation by endogenous protein–nucleic acid complexes, which are associated with autoimmune diseases including systemic lupus erythematosus. PMID:22258621

  18. Syndromes associated with mitochondrial DNA depletion

    PubMed Central

    2014-01-01

    Mitochondrial dysfunction accounts for a large group of inherited metabolic disorders most of which are due to a dysfunctional mitochondrial respiratory chain (MRC) and, consequently, deficient energy production. MRC function depends on the coordinated expression of both nuclear (nDNA) and mitochondrial (mtDNA) genomes. Thus, mitochondrial diseases can be caused by genetic defects in either the mitochondrial or the nuclear genome, or in the cross-talk between the two. This impaired cross-talk gives rise to so-called nuclear-mitochondrial intergenomic communication disorders, which result in loss or instability of the mitochondrial genome and, in turn, impaired maintenance of qualitative and quantitative mtDNA integrity. In children, most MRC disorders are associated with nuclear gene defects rather than alterations in the mtDNA itself. The mitochondrial DNA depletion syndromes (MDSs) are a clinically heterogeneous group of disorders with an autosomal recessive pattern of transmission that have onset in infancy or early childhood and are characterized by a reduced number of copies of mtDNA in affected tissues and organs. The MDSs can be divided into least four clinical presentations: hepatocerebral, myopathic, encephalomyopathic and neurogastrointestinal. The focus of this review is to offer an overview of these syndromes, listing the clinical phenotypes, together with their relative frequency, mutational spectrum, and possible insights for improving diagnostic strategies. PMID:24708634

  19. Fern spore extracts can damage DNA.

    PubMed

    Simán, S E; Povey, A C; Ward, T H; Margison, G P; Sheffield, E

    2000-07-01

    The carcinogenicity of the vegetative tissues of bracken fern (Pteridium) has long been established. More recently, the carcinogenic effects of the spores of bracken have also been recognized. Both vegetative tissues and spores of bracken can induce adducts in DNA in animal tissues, but the possible genotoxic or carcinogenic effects of spores from fern species other than bracken are unknown. The single-cell gel electrophoresis ('comet') assay was used to investigate whether fern spores can cause DNA damage in vitro. Extracts of spores from six fern species were administered to cultured human premyeloid leukaemia (K562) cells. Spore extracts of five fern species: Anemia phyllitidis, Dicksonia antarctica, Pteridium aquilinum, Pteris vittata and Sadleria pallida, induced significantly more DNA strand breaks than those in the control groups. Only in one species, Osmunda regalis, was the effect no different from that in the control groups. Using extracts from A. phyllitidis and P. vittata, the extent of DNA damage was increased by increasing the original dose 10 times, whereas an experiment in which exposure times were varied suggested that the highest levels of strand breaks appear after 2 h exposure. Simultaneous incubation with human S9 liver enzyme mix ablated the damaging effect of the extracts. Our data show that fern spore extracts can cause DNA damage in human cells in vitro. Considering the strong correlation between DNA damage and carcinogenic events, the observations made in this report may well have some implications for human health. PMID:10883670

  20. Characterization of human control region sequences of the African American SWGDAM forensic mtDNA data set

    Microsoft Academic Search

    Marc W. Allard; Deborah Polanskey; Kevin Miller; Mark R. Wilson; Keith L. Monson; Bruce Budowle

    2005-01-01

    The scientific working group on DNA analysis Methods (SWGDAM) mitochondrial DNA (mtDNA) population data set is used to infer the relative rarity of control region mtDNA profiles obtained from evidence samples and of profiles used for identification of missing persons. In this study, the African American haplogroup patterns in the SWGDAM data were analyzed in a phylogenetic context to determine

  1. Likelihood ratios for DNA identification.

    PubMed Central

    Collins, A; Morton, N E

    1994-01-01

    Likelihood ratio (LR) tests are provided for the three alternatives to DNA identity: exclusion, coincidence, and kinship. The coincidence test uses the radius of coalescence to conserve the observed frequency of single band phenotypes. Genotype probabilities under kinship are derived for mating groups, specified relatives, and structured populations; and unbiased estimates of the genetic parameters are provided. The LR is made robust to gene frequency errors by specifying the mean matching probability, and the tolerable loss of information this entails is determined by LR theory. This straightforward application of the seminal work of Jerzy Neyman and Sewall Wright strongly supports the use of LRs and kinship for presentation of DNA evidence by expert witnesses and committees. PMID:8016106

  2. Simulation of Dna-Nanotube Interactions

    NASA Astrophysics Data System (ADS)

    Gao, Huajian; Kong, Yong

    2004-08-01

    Carbon nanotubes functionalized with biological molecules (such as protein peptides and nucleic acids) show great potential for application in bioengineering and nanotechnology. Fundamental understanding, description, and regulation of such bio-nano-systems will ultimately lead to a new generation of integrated systems that combine unique properties of the carbon nanotube (CNT) with biological recognition capabilities. In this review, we describe recent advances in understanding the interactions between deoxyribonucleic acids (DNA) and CNT, as well as relevant simulation techniques. We also review progress in simulating DNA noncovalent interactions with CNTs in an aqueous environment. Molecular dynamics simulations indicate that DNA molecules may be encapsulated inside or wrap around CNT owing to van der Waals attraction between DNA and CNT. We focus on the dynamics and energetics of DNA encapsulation inside nanotubes and discuss the mechanism of encapsulation and the effects of nanotube size, nanotube end-group, DNA base sequence, solvent temperature and pressure on the encapsulation process. Finally, we discuss the likely impact of DNA encapsulation on bioengineering and nanotechnology, as well as other potential applications.

  3. DNA Mapping Made Simple

    NSDL National Science Digital Library

    Isabel Chagas

    2004-02-01

    The universality of the genetic code has allowed DNA isolated from a specific organism to be transferred and incorporated in another organism, transforming bacterial, yeast, plant, and animal cells. This transformation ability is the essence of recombinant DNA technology. Recombinant DNA has been used to make medically useful proteins that would otherwise have been difficult to obtain in necessary amounts, or to engineer plants to be herbicide or insect resistant. The following activity, which focuses on mapping DNA using restriction enzymes, can help students gain a better understanding about DNA and its manipulation. The activity is designed for high school and college biology students.

  4. Thermal degradation of DNA.

    PubMed

    Karni, Moshe; Zidon, Dolev; Polak, Pazit; Zalevsky, Zeev; Shefi, Orit

    2013-06-01

    In this article, we investigate the thermal degradation of deoxyribonucleic acid (DNA). We find that under dry conditions, complete DNA degradation occurs at above 190°C. In addition, as the boiling temperature of water is pressure dependent, we have investigated the thermal degradation of the DNA in water for different applied partial pressures. This information is important for fundamental understanding of DNA structure and energetics, and can be useful for biomedical applications such as thermal targeting of DNA in cancer cells, as well as for basic research. PMID:23621849

  5. DNA: structure, dense phases, charges, interactions

    E-print Network

    Potsdam, Universität

    DNA: structure, dense phases, charges, interactions #12;Outline 1. DNA: structure, charges, dense phases 2. Counterion and DNA condensation 3. ES DNA-DNA interactions 4. DNA toroidal structures 5. Interactions of real DNA helices 6. DNA-DNA ES recognition 7. DNA melting in aggregates 8. Azimuthal

  6. Binding of HIV-1 Vpr protein to the human homolog of the yeast DNA repair protein RAD23 (hHR23A) requires its xeroderma pigmentosum complementation group C binding (XPCB) domain as well as the ubiquitin-associated 2 (UBA2) domain.

    PubMed

    Jung, Jinwon; Byeon, In-Ja L; DeLucia, Maria; Koharudin, Leonardus M I; Ahn, Jinwoo; Gronenborn, Angela M

    2014-01-31

    The human homolog of the yeast DNA repair protein RAD23, hHR23A, has been found previously to interact with the human immunodeficiency virus, type 1 accessory protein Vpr. hHR23A is a modular protein containing an N-terminal ubiquitin-like (UBL) domain and two ubiquitin-associated domains (UBA1 and UBA2) separated by a xeroderma pigmentosum complementation group C binding (XPCB) domain. All domains are connected by flexible linkers. hHR23A binds ubiquitinated proteins and acts as a shuttling factor to the proteasome. Here, we show that hHR23A utilizes both the UBA2 and XPCB domains to form a stable complex with Vpr, linking Vpr directly to cellular DNA repair pathways and their probable exploitation by the virus. Detailed structural mapping of the Vpr contacts on hHR23A, by NMR, revealed substantial contact surfaces on the UBA2 and XPCB domains. In addition, Vpr binding disrupts an intramolecular UBL-UBA2 interaction. We also show that Lys-48-linked di-ubiquitin, when binding to UBA1, does not release the bound Vpr from the hHR23A-Vpr complex. Instead, a ternary hHR23A·Vpr·di-Ub(K48) complex is formed, indicating that Vpr does not necessarily abolish hHR23A-mediated shuttling to the proteasome. PMID:24318982

  7. Somatic mitochondrial DNA mutations in adult-onset leukaemia

    Microsoft Academic Search

    L He; L Luo; S J Proctor; P G Middleton; E L Blakely; R W Taylor; D M Turnbull

    2003-01-01

    Mitochondrial genome instability has recently been demonstrated in a wide variety of human tumours and is implicated in the development of the myelodysplastic syndromes, a heterogeneous group of haematological disorders with an increased risk of malignant transformation. We therefore investigated the incidence of somatic mitochondrial DNA (mtDNA) mutations in patients with adult-onset leukaemia. We sequenced the entire mitochondrial genome from

  8. Absorption of UV radiation by DNA: Spatial and temporal features

    Microsoft Academic Search

    Dimitra Markovitsi; Thomas Gustavsson; Akos Banyasz

    2010-01-01

    The present review focuses on studies carried out by our group on the interaction of UV radiation with DNA. In particular, we examine the way that the energy acquired by DNA helices following direct absorption of UVC radiation is extended spatially and how its effects evolve during the time. These effects depend on the base sequence and can be revealed

  9. First Nuclear DNA C-values for 25 Angiosperm Families

    Microsoft Academic Search

    Lynda Hanson; Kathryn A. McMahon; Margaret A. T. Johnson; Michael D. Bennett

    2001-01-01

    DNA amount is a widely used biodiversity character. As known DNA C-values represent the global angiosperm flora poorly, better coverage of taxonomic groups is needed, including at the familial level. A workshop, sponsored byAnnals of Botany , was held at the Royal Botanic Gardens, Kew in 1997. Its key aim was to identify major gaps in our knowledge of plant

  10. Membrane-spanning DNA nanopores with cytotoxic effect.

    PubMed

    Burns, Jonathan R; Al-Juffali, Noura; Janes, Sam M; Howorka, Stefan

    2014-11-10

    DNA-based cytotoxic agents: Nanopores composed of folded DNA featuring a hydrophobic belt of ethyl phosphorothioate groups insert into bilayer membranes and kill cancer cells. The mode by which the pores achieve cell killing is elucidated with confocal microscopy. PMID:25294680

  11. Thymidylate synthase gene polymorphisms and markers of DNA methylation capacity

    Microsoft Academic Search

    Vikki Ho; Thomas E. Massey; Will D. King

    2011-01-01

    BackgroundDNA methylation plays a critical role in gene regulation and has been implicated in the etiology of chronic disease including atherosclerosis, neural degeneration and cancer. One-carbon metabolism serves two critically important functions: one concerning the production of purines and thymidine for DNA synthesis and the other related to the provision of methyl groups through the metabolism of methionine. Critical intermediates

  12. Whitehead Groups of Spinor Groups

    NASA Astrophysics Data System (ADS)

    Monastyrny?, A. P.; Yanchevski?, V. I.

    1991-02-01

    The Whitehead groups of spinor groups are studied. The known Kneser-Tits conjecture for spinor groups is reduced to a spinor analogue of the Tannaka-Artin problem, namely, to the question of whether the group K1Spin(D), where D is a division ring of exponent 2 , is trivial. A counterexample to the Kneser-Tits problem is constructed in the class of spinor groups. The group K1Spin(D) is computed. The stability of the Whitehead groups of spinor groups under purely transcendental extensions of the ground field is established. The R-equivalence on the k-points of spinor groups and the weak approximation problem are considered. The study of spinor group completes the study of the Whitehead groups of algebraic groups of classical type, that was started in studying reduced K-theory (V.P. Platonov) and was continued for reduced unitary K-theory (V.I. Yanchevski?) and Hermitian K-theory (Platonov and Yanchevski?). Bibliography: 50 titles.

  13. Homogeneous Grouping and Heterogeneous Grouping.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    This paper discusses how to group students for reading instruction. The paper first considers the reasons for heterogeneous grouping, where there are mixed levels of reading achievement among the students in the classroom. It then discusses some weaknesses in advocating heterogeneous grouping. There are individualized plans for reading instruction…

  14. A general approach for DNA encapsulation in degradable polymer microcapsules.

    PubMed

    Zelikin, Alexander N; Becker, Alisa L; Johnston, Angus P R; Wark, Kim L; Turatti, Fabio; Caruso, Frank

    2007-08-01

    We report a general and facile method for the encapsulation of DNA in nanoengineered, degradable polymer microcapsules. Single-stranded (ss), linear double-stranded (ds), and plasmid DNA were encapsulated into disulfide-cross-linked poly(methacrylic acid) (PMA) capsules. The encapsulation procedure involves four steps: adsorption of DNA onto amine-functionalized silica (SiO(2)(+)) particles; sequential deposition of thiolated PMA (PMA (SH)) and poly(vinylpyrrolidone) to form multilayers; cross-linking of the thiol groups of the PMA (SH) in the multilayers into disulfide linkages; and removal of the sacrificial SiO(2)(+) particles. Multilayer growth was dependent on the surface coverage of DNA on the SiO(2)(+) particles, with stable capsules formed from particles with up to 50% DNA surface coverage. The encapsulation strategy applies to nucleic acids with varied size and conformation and allows DNA to be concentrated over 100-fold from dilute solutions into monodisperse, uniformly loaded polymer capsules. The capsule loading can be controlled by the DNA:SiO(2)(+)particle ratio, and for 1 microm diameter capsules, loadings of approximately 1000 chains of 800 bp dsDNA and more than 10,000 chains of 20-mer ssDNA can be achieved. The encapsulated DNA was released and successfully used in polymerase chain reactions as both templates (linear dsDNA and plasmid DNA) and primer sequences (ssDNA), confirming the functionality and structural integrity of the encapsulated DNA. These DNA-loaded polymer microcapsules hold promise as delivery vehicles for gene therapy and diagnostic applications. PMID:19203131

  15. Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

    PubMed Central

    Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

    2013-01-01

    DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2?-deoxyadenosine and 2?-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2?-deoxycytidine lesions form the base pair with guanine while the 2?-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

  16. Identification of a dehydration and ABA-responsive promoter regulon and isolation of corresponding DNA binding proteins for the group 4 LEA gene CpC2 from C. plantagineum

    Microsoft Academic Search

    Andrea Ditzer; Dorothea Bartels

    2006-01-01

    The resurrection plant Craterostigma plantagineum (Scrophulariaceae) is used as a model system to investigate the molecular and biochemical basis of desiccation tolerance.\\u000a Genes which contribute to desiccation tolerance are expressed during dehydration of this plant. One of the dehydration-induced\\u000a genes is CpC2, a group 4 LEA gene. The CpC2 promoter was analysed and a core promoter region (CPR) was identified

  17. Using optical tweezers to study protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Smith, Douglas E.; Gemmen, Gregory J.; Millin, Rachel; Rickgauer, John P.; Schweitzer, Allan L.; Fuller, Derek N.

    2005-08-01

    Mechanical manipulation of single DNA molecules can provide novel information about protein-DNA interactions. Here we review two examples studied by our group. First, we have studied the forced unraveling of nucleosomes assembled on heterogeneous DNA using core histones, the histone chaperone NAP-1, and ATP-dependent chromatin assembly and remodeling factor (ACF). We measure abrupt events releasing ~55 to 95 base pairs of DNA, which are attributable to non-equilibrium unraveling of individual nucleosomes. Wide variations observed in the unraveling force and sudden DNA re-wrapping events may have an important regulatory influence on DNA directed biochemical processes. Second, we have studied the mechanics and dynamics of single DNA looping and cleavage by "two-site" restriction enzymes. Cleavage is measured as a function of DNA tension, incubation time, and enzyme concentration, distinguishing enzymes that require DNA looping from ones that do not. Forced disruption of fixed DNA loops formed in the absence of Mg2+ is observed, allowing the distribution of number of loops, loop length, and disruption force to be measured as a function of time, DNA tension, and ionic conditions.

  18. Complementary addressed modification and cleavage of a single stranded DNA fragment with alkylating oligonucleotide derivatives.

    PubMed Central

    Vlassov, V V; Zarytova, V F; Kutiavin, I V; Mamaev, S V; Podyminogin, M A

    1986-01-01

    A single stranded DNA fragment was modified with alkylating derivatives of oligonucleotides complementary to a certain nucleotide sequences in the fragment. The derivatives carried aromatic 2-chloroethylamino groups at their 3'- or 5'-terminal nucleotide residues. Some of the derivatives carried both alkylating group and intercalating phenazine group which stabilized complementary complexes. It was found that these oligonucleotide derivatives modify the DNA fragment in a specific way near the target complementary nucleotide sequences, and the DNA fragment can be cleaved at the alkylated nucleotides positions. Alkylating derivatives carrying phenazine groups were found to be the most efficient in reaction with the DNA fragment. Images PMID:3714471

  19. Ku entry into DNA inhibits inward DNA transactions in vitro.

    PubMed

    Frit, P; Li, R Y; Arzel, D; Salles, B; Calsou, P

    2000-11-17

    Association of the DNA end-binding Ku70/Ku80 heterodimer with the 460-kDa serine/threonine kinase catalytic subunit forms the DNA-dependent protein kinase (DNA-PK) that is required for double-strand break repair by non-homologous recombination in mammalian cells. Recently, we have proposed a model in which the kinase activity is required for translocation of the DNA end-binding subunit Ku along the DNA helix when DNA-PK assembles on DNA ends. Here, we have questioned the consequences of Ku entry into DNA on local DNA processes by using human nuclear cell extracts incubated in the presence of linearized plasmid DNA. As two model processes, we have chosen nucleotide excision repair (NER) of UVC DNA lesions and transcription from viral promoters. We show that although NER efficiency is strongly reduced on linear DNA, it can be fully restored in the presence of DNA-PK inhibitors. Simultaneously, the amount of NER proteins bound to the UVC-damaged linear DNA is increased and the amount of Ku bound to the same DNA molecules is decreased. Similarly, the poor transcription efficiency exhibited by viral promoters on linear DNA is enhanced in the presence of DNA-PK inhibitor concentrations that prevent Ku entry into the DNA substrate molecule. The present results show that DNA-PK catalytic activity can regulate DNA transactions including transcription in the vicinity of double-strand breaks by controlling Ku entry into DNA. PMID:10945984

  20. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA

    PubMed Central

    Hayner, Jaclyn N.; Douma, Lauren G.; Bloom, Linda B.

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3?OH (3?DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3?DNA, fluorescent ? and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5?phosphate (5?P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5?DNA). The 5?P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3?DNA. Interestingly, the ? subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5?DNA, showing that ?·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3?DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. PMID:25159615

  1. Colliding Groups

    Microsoft Academic Search

    Steven Murray

    2001-01-01

    ACIS-I observations of the X-ray groups around NGC6868 and NGC6861 will allow us to investigate the possible merger of these groups into a larger system. Both groups have extended, symmetric X-ray emission, centered on the bright NGC galaxies. Both have been extensively studied at other wavelengths. Of note, NGC6868 has a central radio source and studies of the stellar and

  2. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L. (Pleasanton, CA)

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  3. Molecular biology - Methylation talk between histones and DNA 

    E-print Network

    Bird, Adrian P

    2001-01-01

    The addition of methyl groups to DNA or histones is a way to directly or indirectly silence gene expression. Although the two events are conceivably connected, they have always been studied separately. In his Perspective, ...

  4. Original Article Using DNA to Test the Utility of

    E-print Network

    Ickert-Bond, Steffi

    -tailed deer (Odocoileus hemionus sitkensis) during a 3-year study (2006­2008) in 3 watersheds in southeast The Wildlife Society. KEY WORDS Alaska, DNA, fecal pellets, Odocoileus hemionus sitkensis, pellet-group counts

  5. The centipede genus Eupolybothrus Verhoeff, 1907 (Chilopoda: Lithobiomorpha: Lithobiidae) in North Africa, a cybertaxonomic revision, with a key to all species in the genus and the first use of DNA barcoding for the group.

    PubMed

    Stoev, Pavel; Akkari, Nesrine; Zapparoli, Marzio; Porco, David; Enghoff, Henrik; Edgecombe, Gregory D; Georgiev, Teodor; Penev, Lyubomir

    2010-01-01

    The centipede genus Eupolybothrus Verhoeff, 1907 in North Africa is revised. A new cavernicolous species, Eupolybothruskahfi Stoev & Akkari, sp. n., is described from a cave in Jebel Zaghouan, northeast Tunisia. Morphologically, it is most closely related to Eupolybothrusnudicornis (Gervais, 1837) from North Africa and Southwest Europe but can be readily distinguished by the long antennae and leg-pair 15, a conical dorso-median protuberance emerging from the posterior part of prefemur 15, and the shape of the male first genital sternite. Molecular sequence data from the cytochrome c oxidase I gene (mtDNA-5' COI-barcoding fragment) exhibit 19.19% divergence between Eupolybothruskahfi and Eupolybothrusnudicornis, an interspecific value comparable to those observed among four other species of Eupolybothrus which, combined with a low intraspecific divergence (0.3-1.14%), supports the morphological diagnosis of Eupolybothruskahfi as a separate species. This is the first troglomorphic myriapod to be found in Tunisia, and the second troglomorph lithobiomorph centipede known from North Africa. Eupolybothrusnudicornis is redescribed based on abundant material from Tunisia and its post-embryonic development, distribution and habitat preferences recorded. Eupolybothruscloudsley-thompsoni Turk, 1955, a nominal species based on Tunisian type material, is placed in synonymy with Eupolybothrusnudicornis. To comply with the latest technological developments in publishing of biological information, the paper implements new approaches in cybertaxonomy, such as fine granularity XML tagging validated against the NLM DTD TaxPub for PubMedCentral and dissemination in XML to various aggregators (GBIF, EOL, Wikipedia), vizualisation of all taxa mentioned in the text via the dynamically created Pensoft Taxon Profile (PTP) page, data publishing, georeferencing of all localities via Google Earth, and ZooBank, GenBank and MorphBank registration of datasets. An interactive key to all valid species of Eupolybothrus is made with DELTA software. PMID:21594115

  6. The centipede genus Eupolybothrus Verhoeff, 1907 (Chilopoda: Lithobiomorpha: Lithobiidae) in North Africa, a cybertaxonomic revision, with a key to all species in the genus and the first use of DNA barcoding for the group

    PubMed Central

    Stoev, Pavel; Akkari, Nesrine; Zapparoli, Marzio; Porco, David; Enghoff, Henrik; Edgecombe, Gregory D.; Georgiev, Teodor; Penev, Lyubomir

    2010-01-01

    Abstract The centipede genus Eupolybothrus Verhoeff, 1907 in North Africa is revised. A new cavernicolous species, Eupolybothrus kahfi Stoev & Akkari, sp. n., is described from a cave in Jebel Zaghouan, northeast Tunisia. Morphologically, it is most closely related to Eupolybothrus nudicornis (Gervais, 1837) from North Africa and Southwest Europe but can be readily distinguished by the long antennae and leg-pair 15, a conical dorso-median protuberance emerging from the posterior part of prefemur 15, and the shape of the male first genital sternite. Molecular sequence data from the cytochrome c oxidase I gene (mtDNA–5’ COI-barcoding fragment) exhibit 19.19% divergence between Eupolybothrus kahfi and Eupolybothrus nudicornis, an interspecific value comparable to those observed among four other species of Eupolybothrus which, combined with a low intraspecific divergence (0.3–1.14%), supports the morphological diagnosis of Eupolybothrus kahfi as a separate species. This is the first troglomorphic myriapod to be found in Tunisia, and the second troglomorph lithobiomorph centipede known from North Africa. Eupolybothrus nudicornis is redescribed based on abundant material from Tunisia and its post-embryonic development, distribution and habitat preferences recorded. Eupolybothrus cloudsley-thompsoni Turk, 1955, a nominal species based on Tunisian type material, is placed in synonymy with Eupolybothrus nudicornis. To comply with the latest technological developments in publishing of biological information, the paper implements new approaches in cybertaxonomy, such as fine granularity XML tagging validated against the NLM DTD TaxPub for PubMedCentral and dissemination in XML to various aggregators (GBIF, EOL, Wikipedia), vizualisation of all taxa mentioned in the text via the dynamically created Pensoft Taxon Profile (PTP) page, data publishing, georeferencing of all localities via Google Earth, and ZooBank, GenBank and MorphBank registration of datasets. An interactive key to all valid species of Eupolybothrus is made with DELTA software. PMID:21594115

  7. (2) DNA O(n^5) Quorum-Sensing Lux

    E-print Network

    Hagiya, Masami

    - 1 - ( ) ( ) DNA RNA DNA RNA DNA DNA 2 DNA #12;- 2 - 17 6 (1) (2) DNA O(n^5) (3) Quorum-Sensing Lux (4) (5) LMNtal ambient LMNtal (1) (2) DNA (3) DNA (4) DNA (5) DNA (1) DNA ANP-96 (Precision System Science ) (2) RTRACS DNA RTRACS (3) in vivo in vivo (4) DNA trans cis 1/10 (5) DNA-PNA DNA DNA DNA DNA DNA

  8. DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

    PubMed Central

    Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

    2014-01-01

    Background Many studies have shown the suitability of sequence variation in the 5? region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

  9. Correlation between anthracycline structure and human DNA ligase inhibition.

    PubMed Central

    Ciarrocchi, G; Lestingi, M; Fontana, M; Spadari, S; Montecucco, A

    1991-01-01

    A total of 19 anthracycline derivatives were tested for their ability to interfere in vitro with the action of the human replicative DNA ligase. Only those with the sugar devoid of unmodified amino groups or with large configurational modifications were found to be inactive. Maximal inhibition of DNA-joining activity was found to require a 4'-deoxy-3'-amino sugar. Self-adenylation of DNA ligase was largely insensitive to these drugs. An important general finding is that slight modifications of the anthracycline structure have pronounced effects on DNA-ligase-inhibitory activity and might be related to the specificity of anthracycline anti-tumour activity. PMID:1930131

  10. Photocleavable ligands for protein decoration of DNA nanostructures.

    PubMed

    Brglez, Josipa; Ahmed, Ishtiaq; Niemeyer, Christof M

    2015-05-14

    This work describes the synthesis of amino-reactive, photocleavable hapten-modifiers and their application as affinity tags for DNA nanostructures. In particular, N-hydroxysuccinimide-activated linkers containing an ?-methyl-nitroveratryl-butyric acid group and carboxyfluorescein or biotin were synthesized and coupled to alkyl-amino-modified DNA oligonucleotides. The resulting conjugates were then incorporated into DNA origami nanostructures. As demonstrated by electrophoresis and AFM imaging, the functionalized nanostructures were capable to bind cognate proteins which could then be cleaved-off by irradiation. Owing to its modularity, this approach to control protein binding should be useful for a wide variety of functional DNA nanostructures. PMID:25858452

  11. Recombinant DNA technology in apple.

    PubMed

    Gessler, Cesare; Patocchi, Andrea

    2007-01-01

    This review summarizes the achievements of almost 20 years of recombinant DNA technology applied to apple, grouping the research results into the sections: developing the technology, insect resistance, fungal disease resistance, self-incompatibility, herbicide resistance, fire blight resistance, fruit ripening, allergens, rooting ability, and acceptance and risk assessment. The diseases fire blight, caused by Erwinia amylovora, and scab, caused by Venturia inaequalis, were and still are the prime targets. Shelf life improvement and rooting ability of rootstocks are also relevant research areas. The tools to create genetically modified apples of added value to producers, consumers, and the environment are now available. PMID:17522823

  12. Presence of HSV1 DNA in semen and menstrual blood

    Microsoft Academic Search

    Nadia El Borai; Christophe LeFèvre; Masato Inoue; Elena N. Naumova; Kaoru Sato; Shihoko Suzuki; Kimiyoshi Tsuji; Masaichi Yamamura

    1998-01-01

    Using a specifically designed diagnostic PCR assay with nested primers the following could be achieved: (1) a group of 22 clinically indistinguishable women attending an infertility clinic, 18 with repeated embryo transfer failure, and asymptomatic for HSV-1 could be divided into two subgroups after testing their menstrual blood. An HSV-DNA positive (50%) and HSV-DNA negative group (50%) could be distinguished.

  13. Novobiocin and Coumermycin Inhibit DNA Supercoiling Catalyzed by DNA Gyrase

    Microsoft Academic Search

    Martin Gellert; Mary H. O'Dea; Tateo Itoh; Jun-Ichi Tomizawa

    1976-01-01

    Novobiocin and coumermycin are known to inhibit the replication of DNA in Escherichia coli. We show that these drugs inhibit the supercoiling of DNA catalyzed by E. coli DNA gyrase, a recently discovered enzyme that introduces negative superhelical turns into covalently circular DNA. The activity of DNA gyrase purified from a coumermycin-resistant mutant strain is resistant to both drugs. The

  14. DNA Gyrase: An Enzyme that Introduces Superhelical Turns into DNA

    Microsoft Academic Search

    Martin Gellert; Kiyoshi Mizuuchi; Mary H. O'Dea; Howard A. Nash

    1976-01-01

    Relaxed closed-circular DNA is converted to negatively supercoiled DNA by DNA gyrase. This enzyme has been purified from Escherichia coli cells. The reaction requires ATP and Mg++ and is stimulated by spermidine. The enzyme acts equally well on relaxed closed-circular colicin E1, phage lambda , and simian virus 40 DNA. The final superhelix density of the DNA can be considerably

  15. DNA microarray technologies for measuring proteinDNA interactions

    E-print Network

    Bulyk, Martha L.

    DNA microarray technologies for measuring protein­DNA interactions Martha L Bulyk DNA approach to analyse the in vitro binding of proteins directly to double-stranded DNA microarrays (protein binding microarrays; PBMs), permits rapid characterization of their DNA binding site sequence

  16. Electrochemical DNA Hybridization Detection Using DNA Dohyoung Kwon,a

    E-print Network

    Kwak, Juhyoun

    Full Paper Electrochemical DNA Hybridization Detection Using DNA Cleavage Dohyoung Kwon,a Kyuwon method for detection of DNA hybridization using enzymatic cleavage. The strategy is based on that S1 nuclease is able to specifically cleave only single strand DNA, but not double strand DNA. The capture

  17. Bradley Group

    NSDL National Science Digital Library

    Visitors can discover Professor Mark Bradley's and company's use of combinatorial chemistry to synthesize many compounds efficiently. The website features concise summaries, lists of publications, and information on the collaborators involved with the group's numerous research projects. The Research section offers brief summaries, with well-presented images and diagrams, of the group's various research interests, including Antibacterials, Pigments, and Biological Screening.

  18. PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

    Microsoft Academic Search

    JEAN B. RISTAINO; MICHAEL MADRITCH; CAROL L. TROUT; GREGORY PARRA

    1998-01-01

    We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA

  19. Highly efficient remote controlled release system based on light-driven DNA nanomachine functionalized mesoporous silica.

    PubMed

    Wen, Yongqiang; Xu, Liping; Wang, Wenqian; Wang, Danyang; Du, Hongwu; Zhang, Xueji

    2012-08-01

    An intelligent photoswitchable single-molecule nanomachine with DNA hairpin-loop structure was designed by the incorporation of azobenzene groups in DNA sequences, which was studied by fluorescence resonance energy transfer (FRET) and attached onto the surface of mesoporous silica. Based on the photo-induced conformational transformation of DNA, highly efficient controlled release was realized. PMID:22751906

  20. genomic DNA was isolated from these centrifuged cell pellets and used for am-

    E-print Network

    Paris-Sud XI, Université de

    of the V3 region of the 16S rDNA were compared for samples from animals fed the grass-legume hay diet of this group from rumen- extracted DNA. Restriction enzyme cleav- age of the PCR product yields profiles in #12;samples from seven animals, accounting for 30-80% of total Bacteroides- Prevotella rDNA or 5

  1. Make a DNA Model

    NSDL National Science Digital Library

    By building their own DNA model in this OLogy activity, kids learn about the unique genetic code that's found in every cell of their bodies. The activity begins with a brief look at how all living things are made of cells, and that what makes them unique is DNA. Then, using toothpicks, colored paper, and other common supplies, students create a 3-D model of DNA and "do the DNA twist" to make it look like a double spiral. Interspersed throughout the activity are kid-friendly descriptions of the discovery of DNA and where it's found. The experiment ends with additional challenges for students, such as making a DNA mobile with pipe cleaners or some other flexible material.

  2. DNA interactive code

    NSDL National Science Digital Library

    Dolan DNA Learning Center. Cold Spring Harbor Laboratory

    2005-01-01

    This four-part, interactive module treats teachers to a direct look at the people involved in breaking the mystery behind the code of life. The modules are arranged by topics that focus on how the structure of DNA was determined, how DNA is copied, how DNA is read, and how DNA is controlled. Each module is subdivided into additional parts. These parts include images of scientists who contributed to the history of DNA discoveries. By clicking on the images, teachers are taken to a new window to watch short videos by or about the scientists. Teachers can also click on links to computer simulations, such as an activity to create a model of DNA using cardboard cutouts, just as James Watson did. Copyright 2005 Eisenhower National Clearinghouse

  3. Colliding Groups

    NASA Astrophysics Data System (ADS)

    Murray, Steven

    2001-09-01

    ACIS-I observations of the X-ray groups around NGC6868 and NGC6861 will allow us to investigate the possible merger of these groups into a larger system. Both groups have extended, symmetric X-ray emission, centered on the bright NGC galaxies. Both have been extensively studied at other wavelengths. Of note, NGC6868 has a central radio source and studies of the stellar and ionized gas show unusual kinematics, particularly in the core. With Chandra we will search for interactions in the region between the groups, map the gas temperature and abundance within each group and study the morphology and gas temperature in the central regions to determine if cooling flows are present. GTO Priority "A"

  4. TheABO blood group system and Plasmodium falciparum malaria

    Microsoft Academic Search

    Christine M. Cserti; Walter H. Dzik

    2007-01-01

    In the century since the discovery of the ABO blood groups, numerous associa- tions between ABO groups and disease have been noted. However, the selection pressures defining the ABO distributions remain uncertain. We review published information on Plasmodium falciparum infection and ABO blood groups. DNA sequence information dates the emer- gence and development of the group O allele to a

  5. DNA Hydrolyzing Autoantibodies

    Microsoft Academic Search

    Alexander M. Shuster; Gennady V. Gololobov; Oksana A. Kvashuk; Anastasiya E. Bogomolova; Ivan V. Smirnov; Alexander G. Gabibov

    1992-01-01

    A DNA-nicking activity was detected in the sera of patients with various autoimmune pathologies and was shown to be a property of autoantibodies. The DNA hydrolyzing activity, which was purified by affinity and high-performance liquid chromatography, corresponded in size to immunoglobulin M (IgM) and IgG and had a positive response to antibodies to human IgG. The DNA hydrolyzing autoantibodies were

  6. Density Functional Molecular Orbital Calculations on Longer DNA–DNA and PNA–DNA Double Strands

    Microsoft Academic Search

    Takayuki Natsume; Yasuyuki Ishikawa; Kenichi Dedachi; Noriyuki Kurita

    Summary. Stable structures and electronic properties of hybridized DNA–DNA and PNA–DNA double strands with common base sequences were theoretically investigated by molecular orbital calculations based on the density functional theory. The computed hybridization energy in PNA–DNA is greater than that in the DNADNA double strand. The origin of the larger stability of PNA–DNA double strand is ascribed to the

  7. DNA Damage Response

    PubMed Central

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damage can occur at any time on any genomic location, a specialized spatio-temporal orchestration of this defense apparatus is required. PMID:20980439

  8. Bisulfite Sequencing of DNA

    PubMed Central

    Darst, Russell P.; Pardo, Carolina E.; Ai, Lingbao; Brown, Kevin D.; Kladde, Michael P.

    2010-01-01

    Exact positions of 5-methylcytosine (m5C) on a single strand of DNA can be determined by bisulfite genomic sequencing (BGS). Treatment with bisulfite ion preferentially deaminates unmethylated cytosines, which then convert to uracil upon desulfonation. Amplifying regions of interest from deaminated DNA and sequencing products cloned from amplicons permits determination of methylation at single nucleotide resolution along single DNA molecules, which is not possible with other methylation analysis techniques. This unit describes a BGS technique suitable for most DNA sources, including formaldehyde-fixed tissue. Considerations for experimental design and common sources of error are discussed. PMID:20583099

  9. DNA Overview Learning Module

    NSDL National Science Digital Library

    2010-03-02

    The Southwest Center for Microsystems Education is a Regional Advanced Technology Education Center funded in part by the National Science Foundation. These resources provide an overview on the topic of DNA. Users will learn the role of DNA as genetic material, the molecular components of DNA and the structure and replication of DNA. A comprehensive PowerPoint presentation is included along with instructor and participant guides. Visitors are encouraged to create an account and log in in order to access the full set of resources.

  10. DNA polymerase. delta. and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase. delta

    SciTech Connect

    Nishida, C.H.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase {alpha}, while binding to HeLa DNA polymerase {alpha}, did not bind to the HeLa DNA polymerase {delta}. Moreover, at micromolar concentrations N{sup 2}-(p-n-butylphenyl)-2{prime}-deoxyguanosine 5{prime}-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2{prime}-deoxyadenosine 5{prime}-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase {alpha}, but did not inhibit the DNA polymerase {delta}. Neither purified DNA polymerase {alpha} nor {beta} could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase {alpha} BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition.

  11. Multiprotein DNA looping

    E-print Network

    Jose M. G. Vilar; Leonor Saiz

    2006-06-19

    DNA looping plays a fundamental role in a wide variety of biological processes, providing the backbone for long range interactions on DNA. Here we develop the first model for DNA looping by an arbitrarily large number of proteins and solve it analytically in the case of identical binding. We uncover a switch-like transition between looped and unlooped phases and identify the key parameters that control this transition. Our results establish the basis for the quantitative understanding of fundamental cellular processes like DNA recombination, gene silencing, and telomere maintenance.

  12. A new structural insight into XPA–DNA interactions

    PubMed Central

    Hilton, Benjamin; Shkriabai, Nick; Musich, Phillip R.; Kvaratskhelia, Mamuka; Shell, Steven; Zou, Yue

    2014-01-01

    XPA (xeroderma pigmentosum group A) protein is an essential factor for NER (nucleotide excision repair) which is believed to be involved in DNA damage recognition/verification, NER factor recruiting and stabilization of repair intermediates. Past studies on the structure of XPA have focused primarily on XPA interaction with damaged DNA. However, how XPA interacts with other DNA structures remains unknown though recent evidence suggest that these structures could be important for its roles in both NER and non-NER activities. Previously, we reported that XPA recognizes undamaged DNA ds/ssDNA (double-strand/single-strandDNA) junctions with a binding affinity much higher than its ability to bind bulky DNA damage. To understand how this interaction occurs biochemically we implemented a structural determination of the interaction using a MS-based protein footprinting method and limited proteolysis. By monitoring surface accessibility of XPA lysines to NHS-biotin modification in the free protein and the DNA junction-bound complex we show that XPA physically interacts with the DNA junctions via two lysines, K168 and K179, located in the previously known XPA(98–219) DBD (DNA-binding domain). Importantly, we also uncovered new lysine residues, outside of the known DBD, involved in the binding. We found that residues K221, K222, K224 and K236 in the C-terminal domain are involved in DNA binding. Limited proteolysis analysis of XPA–DNA interactions further confirmed this observation. Structural modelling with these data suggests a clamp-like DBD for the XPA binding to ds/ssDNA junctions. Our results provide a novel structure-function view of XPA–DNA junction interactions. PMID:25385088

  13. Inferring ethnicity from mitochondrial DNA sequence

    PubMed Central

    2011-01-01

    Background The assignment of DNA samples to coarse population groups can be a useful but difficult task. One such example is the inference of coarse ethnic groupings for forensic applications. Ethnicity plays an important role in forensic investigation and can be inferred with the help of genetic markers. Being maternally inherited, of high copy number, and robust persistence in degraded samples, mitochondrial DNA may be useful for inferring coarse ethnicity. In this study, we compare the performance of methods for inferring ethnicity from the sequence of the hypervariable region of the mitochondrial genome. Results We present the results of comprehensive experiments conducted on datasets extracted from the mtDNA population database, showing that ethnicity inference based on support vector machines (SVM) achieves an overall accuracy of 80-90%, consistently outperforming nearest neighbor and discriminant analysis methods previously proposed in the literature. We also evaluate methods of handling missing data and characterize the most informative segments of the hypervariable region of the mitochondrial genome. Conclusions Support vector machines can be used to infer coarse ethnicity from a small region of mitochondrial DNA sequence with surprisingly high accuracy. In the presence of missing data, utilizing only the regions common to the training sequences and a test sequence proves to be the best strategy. Given these results, SVM algorithms are likely to also be useful in other DNA sequence classification applications. PMID:21554759

  14. DNA damage caused by lipid peroxidation products.

    PubMed

    ?uczaj, Wojciech; Skrzydlewska, Elzbieta

    2003-01-01

    Lipid peroxidation is a process involving the oxidation of polyunsaturated fatty acids (PUFAs), which are basic components of biological membranes. Reactive electrophilic compounds are formed during lipid peroxidation, mainly alpha, beta-unsaturated aldehydes. These compounds yield a number of adducts with DNA. Among them, propeno and substituted propano adducts of deoxyguanosine with malondialdehyde (MDA), acrolein, crotonaldehyde and etheno adducts, resulting from the reactions of DNA bases with epoxy aldehydes, are a very important group of adducts. The epoxy aldehydes are more reactive towards DNA than the parent unsaturated aldehydes. The compounds resulting from lipid peroxidation mostly react with DNA showing both genotoxic and mutagenic action; among them, 4-hydroxynonenal is the most genotoxic, while MDA is the most mutagenic. DNA damage caused by the adducts of lipid peroxidation products with DNA can be removed by the repairing action of glycosylases. The formed adducts have been hitherto analyzed using the IPPA (Imunopurification-(32)P-postlabelling assay) method and via gas chromatography/electron capture negtive chemical ionization/mass spectrometry (GC/EC NCI/MS). A combination of liquid chromatography with electrospray tandem mass spectrometry (LC/ES-MSMS) with labelled inner standard has mainly been used in recent years. PMID:12813574

  15. Characterization of group A Streptococcus strains recovered from Mexican children with pharyngitis by automated DNA sequencing of virulence-related genes: unexpectedly large variation in the gene (sic) encoding a complement-inhibiting protein.

    PubMed Central

    Mejia, L M; Stockbauer, K E; Pan, X; Cravioto, A; Musser, J M

    1997-01-01

    Sequence variation was studied in several target genes in 54 strains of group A Streptococcus (GAS) cultured from children with pharyngitis in Mexico City. Although 16 distinct emm alleles were identified, only 4 had not been previously described. Virtually all bacteria (31 of 33 [94%] with the streptococcal pyrogenic exotoxin gene (speA) had emm1-related, emm3, or emm6 alleles. The gene (sic) encoding an extracellular GAS protein that inhibits complement function was unusually variable among isolates with the emm1 family of alleles, with a total of seven variants identified. The data suggest that many GAS strains infecting Mexican children are genetically similar to organisms commonly encountered in the United States and western Europe. Sequence variation in the sic gene is useful for rapid differentiation among GAS isolates with the emm1 family of alleles. PMID:9399523

  16. Nanoparticle-based detection and quantification of DNA with single nucleotide polymorphism (SNP) discrimination selectivity

    PubMed Central

    Qin, Wei Jie; Yung, Lin Yue Lanry

    2007-01-01

    Sequence-specific DNA detection is important in various biomedical applications such as gene expression profiling, disease diagnosis and treatment, drug discovery and forensic analysis. Here we report a gold nanoparticle-based method that allows DNA detection and quantification and is capable of single nucleotide polymorphism (SNP) discrimination. The precise quantification of single-stranded DNA is due to the formation of defined nanoparticle-DNA conjugate groupings in the presence of target/linker DNA. Conjugate groupings were characterized and quantified by gel electrophoresis. A linear correlation between the amount of target DNA and conjugate groupings was found. For SNP detection, single base mismatch discrimination was achieved for both the end- and center-base mismatch. The method described here may be useful for the development of a simple and quantitative DNA detection assay. PMID:17720714

  17. Support Groups

    MedlinePLUS

    ... North Carolina | Ohio | Oklahoma | Oregon | Pennsylvania | Puerto Rico | Rhode Island | South Carolina | Tennessee | Texas | Utah | Vermont | Virginia | Washington | ... 3882, email lordrealty@lordrealty.com . Back to top Rhode Island For more information about support groups in Rhode ...

  18. Plane Groups

    NSDL National Science Digital Library

    Dexter Perkins

    This is a lengthy PDF document (60 pages+) about plane groups and symmetry. It includes colorful images of each of the 17 plane groups, in several different forms. Additionally, there are some summarizing graphics that show unit cells, lattices, symmetry elements, etc. There is lots here to choose from -- I doubt that anyone will want to use all of the images. Studying plane groups is a good way to introduce crystal systems, point groups, lattices, symmetry operators, etc. All is in 2-D, but it is easy to tell students that the principles are the same in 3-D. For those who like to make changes, the PDF document was created from individual EPS files. This means that the files can be opened in Adobe Illustrator, Corel Draw, etc., and modified to fit your own needs.

  19. Replicative DNA Polymerases

    PubMed Central

    Johansson, Erik; Dixon, Nicholas

    2013-01-01

    In 1959, Arthur Kornberg was awarded the Nobel Prize for his work on the principles by which DNA is duplicated by DNA polymerases. Since then, it has been confirmed in all branches of life that replicative DNA polymerases require a single-stranded template to build a complementary strand, but they cannot start a new DNA strand de novo. Thus, they also depend on a primase, which generally assembles a short RNA primer to provide a 3?-OH that can be extended by the replicative DNA polymerase. The general principles that (1) a helicase unwinds the double-stranded DNA, (2) single-stranded DNA-binding proteins stabilize the single-stranded DNA, (3) a primase builds a short RNA primer, and (4) a clamp loader loads a clamp to (5) facilitate the loading and processivity of the replicative polymerase, are well conserved among all species. Replication of the genome is remarkably robust and is performed with high fidelity even in extreme environments. Work over the last decade or so has confirmed (6) that a common two-metal ion-promoted mechanism exists for the nucleotidyltransferase reaction that builds DNA strands, and (7) that the replicative DNA polymerases always act as a key component of larger multiprotein assemblies, termed replisomes. Furthermore (8), the integrity of replisomes is maintained by multiple protein–protein and protein–DNA interactions, many of which are inherently weak. This enables large conformational changes to occur without dissociation of replisome components, and also means that in general replisomes cannot be isolated intact. PMID:23732474

  20. Target DNA induced switches of DNA polymerase activity.

    PubMed

    Park, Ki Soo; Lee, Chang Yeol; Park, Hyun Gyu

    2015-06-01

    A novel concept that target DNA can induce switching of DNA polymerase activity is devised. The method relies on the finding that a DNA aptamer can undergo conformational change upon hybridization with a complementary target DNA, which leads to activation or inactivation of DNA polymerase. This strategy is utilized to identify the presence of target DNA with high levels of sensitivity and selectivity. PMID:25959533

  1. Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA.

    PubMed

    Lukinavicius, Grazvydas; Lapinaite, Audrone; Urbanaviciute, Giedre; Gerasimaite, Ruta; Klimasauskas, Saulius

    2012-12-01

    DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA-M.HhaI-AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683

  2. Voltammetric detection of damage to DNA caused by nitro derivatives of fluorene using an electrochemical DNA biosensor.

    PubMed

    Vyskocil, Vlastimil; Labuda, Ján; Barek, Jirí

    2010-05-01

    An electrochemical DNA biosensor based on the screen printed carbon paste electrode (SPCPE) with an immobilized layer of calf thymus double-stranded DNA has been used for in vitro investigation of the interaction between genotoxic nitro derivatives of fluorene (namely 2-nitrofluorene and 2,7-dinitrofluorene) and DNA. Two types of DNA damage have been detected at the DNA/SPCPE biosensor: first, that caused by direct association of the nitrofluorenes, for which an intercalation association has been found using the known DNA intercalators [Cu(phen)(2)](2+) and [Co(phen)(3)](3+) as competing agents, and, second, that caused by short-lived radicals generated by electrochemical reduction of the nitro group (observable under specific conditions only). PMID:20186538

  3. Dietary and lifestyle factors of DNA methylation.

    PubMed

    Lim, Unhee; Song, Min-Ae

    2012-01-01

    Lifestyle factors, such as diet, smoking, physical activity, and body weight management, are known to constitute the majority of cancer causes. Epigenetics has been widely proposed as a main mechanism that mediates the reversible effects of dietary and lifestyle factors on carcinogenesis. This chapter reviews human studies on potential dietary and lifestyle determinants of DNA methylation. Apart from a few prospective investigations and interventions of limited size and duration, evidence mostly comes from cross-sectional observational studies and supports some associations. Studies to date suggest that certain dietary components may alter genomic and gene-specific DNA methylation levels in systemic and target tissues, affecting genomic stability and transcription of tumor suppressors and oncogenes. Most data and supportive evidence exist for folate, a key nutritional factor in one-carbon metabolism that supplies the methyl units for DNA methylation. Other candidate bioactive food components include alcohol and other key nutritional factors of one-carbon metabolism, polyphenols and flavonoids in green tea, phytoestrogen, and lycopene. Some data also support a link of DNA methylation with physical activity and energy balance. Effects of dietary and lifestyle exposures on DNA methylation may be additionally modified by common genetic variants, environmental carcinogens, and infectious agents, an aspect that remains largely unexplored. In addition, growing literature supports that the environmental conditions during critical developmental stages may influence later risk of metabolic disorders in part through persistent programming of DNA methylation. Further research of these modifiable determinants of DNA methylation will improve our understanding of cancer etiology and may present certain DNA methylation markers as attractive surrogate endpoints for prevention research. Considering the plasticity of epigenetic marks and correlated nature of lifestyle factors, more longitudinal studies of healthy individuals of varying age, sex, and ethnic groups are warranted, ideally with comprehensive data collection on various lifestyle factors. PMID:22359306

  4. Comprehensive analysis of DNA polymerase III ? subunits and their homologs in bacterial genomes

    PubMed Central

    Timinskas, K?stutis; Balvo?i?t?, Monika; Timinskas, Albertas; Venclovas, ?eslovas

    2014-01-01

    The analysis of ?2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III ?-subunit (PolIII?) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

  5. Identification of sex-specific DNA markers in betel vine ( Piper betle L.)

    Microsoft Academic Search

    Sanghamitra Samantaray; Arunkumar Phurailatpam; Ashok Kumar Bishoyi; K. A. Geetha; Satyabrata Maiti

    The Random Amplified Polymorphic DNA (RAPD) technique was used to amplify DNA segments, with the objective of finding markers\\u000a linked to sex determination in male and female plants of Piper betle L. Two bulks of DNA were made drawing one each from male and female, by pooling an equal volume of DNA samples from each\\u000a group of individual contributing to

  6. Radiation of human mitochondria DNA types analyzed by restriction endonuclease cleavage patterns

    Microsoft Academic Search

    M. J. Johnson; D. C. Wallace; S. D. Ferris; M. C. Rattazzi; L. L. Cavalli-Sforza

    1983-01-01

    Summary Human mitochondrial DNA (mtDNA) restriction endonuclease fragment patterns were analyzed using total blood cell DNA isolated from 200 individuals representing five different populations. Thirty-two fragment patterns (morphs) were observed with the enzymes Hpa I, Bam HI, Hae II, Msp I and Ava II yielding thirty-five different combinations of fragment patterns (mt DNA types). The major ethnic groups exhibit quantitative

  7. Studying DNA in the Classroom.

    ERIC Educational Resources Information Center

    Zarins, Silja

    1993-01-01

    Outlines a workshop for teachers that illustrates a method of extracting DNA and provides instructions on how to do some simple work with DNA without sophisticated and expensive equipment. Provides details on viscosity studies and breaking DNA molecules. (DDR)

  8. Visualizing DNA What is it?

    E-print Network

    Rose, Michael R.

    Visualizing DNA #12;What is it? Gel electrophoresis is one of the techniques scientists use to look at the DNA they have. This technique separates DNA by size. #12;How does it work? First a gel is prepared. Gels

  9. DNA templates silver clusters with magic sizes and colors for multi-cluster fluorescent assemblies

    NASA Astrophysics Data System (ADS)

    Copp, Stacy

    2015-03-01

    The natural inclusion of information in DNA, a vital part of life's rich complexity, can also be exploited to create diverse structures with multiple scales of complexity. Now emerging in novel photonic applications, DNA-stabilized silver clusters (AgN-DNA) are compelling examples of multi-scale DNA-directed assembly: individual fluorescent clusters, each templated by specific DNA base motifs, can then be arranged together in DNA-mediated multi-cluster assemblies with nanoscale precision. We discuss how DNA imbues AgN-DNA with unique features. Our optical data on pure AgN-DNA show that DNA base-cationic silver ligands impose rod-like shapes for neutral silver clusters, whose length primarily determines fluorescence color. This shape anisotropy leads to the aspherical AgN-DNA magic number cluster sizes and ``magic color'' groupings. We exploit DNA's sequence properties to extract multi-base motifs that select certain magic cluster sizes, using machine learning algorithms applied to large data sets. With these base motifs, we design DNA scaffolds to arrange multiple atomically precise AgN together in nanoscale proximity. We demonstrate that clusters are stable when held at separations below 10 nm, both in bicolor, dual cluster DNA clamp assemblies and in one-dimensional assemblies of atomically precise clusters arrayed on DNA nanotubes. Supported by NSF-CHE-1213895 and NSF-DMR-1309410. SMC acknowledges NSF-DGE-1144085, a NSF GRFP.

  10. PLATFORMS FOR DNA BANKING

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The accelerated use of genomic technology in biological research portends a changing pattern in the use of genetic resource collections and fuels the desire among researchers to establish DNA banks. DNA sequencing of herbarium sheet specimens, cell cultures and germplasm offers a new approach to st...

  11. Routine DNA testing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

  12. Nanotechnology: Deadly DNA

    NASA Astrophysics Data System (ADS)

    Krishnan, Swati; Simmel, Friedrich C.

    2015-01-01

    DNA self-assembly has previously been used to create channel-like structures that can penetrate through lipid bilayer membranes. However, such assemblies have not been shown to cause cell death before. Now a DNA nanopore has been shown to exert a cytotoxic effect when administered to cells.

  13. Design of DNA origami

    Microsoft Academic Search

    Paul W. K. Rothemund

    2005-01-01

    The generation of arbitrary patterns and shapes at very small scales is at the heart of our effort to miniaturize circuits and is fundamental to the development of nanotechnology. Here I review a recently developed method for folding long single strands of DNA into arbitrary two-dimensional shapes using a raster fill technique - 'scaffolded DNA origami'. Shapes up to 100

  14. MICROWAVE RESONANCES IN DNA

    EPA Science Inventory

    This report describes spectroscopic studies of DNA which were undertaken to better understand a physical basis for microwave absorption by this molecule. hree types of studies are described. ) The low frequency scattered light spectrum of DNA was studied by two methods. irst, Ram...

  15. Modeling DNA Replication Intermediates

    SciTech Connect

    Broyde, S.; Roy, D.; Shapiro, R.

    1997-06-01

    While there is now available a great deal of information on double stranded DNA from X-ray crystallography, high resolution NMR and computer modeling, very little is known about structures that are representative of the DNA core of replication intermediates. DNA replication occurs at a single strand/double strand junction and bulged out intermediates near the junction can lead to frameshift mutations. The single stranded domains are particularly challenging. Our interest is focused on strategies for modeling the DNA of these types of replication intermediates. Modeling such structures presents special problems in addressing the multiple minimum problem and in treating the electrostatic component of the force field. We are testing a number of search strategies for locating low energy structures of these types and we are also investigating two different distance dependent dielectric functions in the coulombic term of the force field. We are studying both unmodified DNA and DNA damaged by aromatic amines, carcinogens present in the environment in tobacco smoke, barbecued meats and automobile exhaust. The nature of the structure adopted by the carcinogen modified DNA at the replication fork plays a key role in determining whether the carcinogen will cause a mutation during replication that can initiate the carcinogenic process. In the present work results are presented for unmodified DNA.

  16. Electrochemical DNA sensors

    Microsoft Academic Search

    T Gregory Drummond; Michael G Hill; Jacqueline K Barton

    2003-01-01

    Electrochemistry-based sensors offer sensitivity, selectivity and low cost for the detection of selected DNA sequences or mutated genes associated with human disease. DNA-based electrochemical sensors exploit a range of different chemistries, but all take advantage of nanoscale interactions between the target in solution, the recognition layer and a solid electrode surface. Numerous approaches to electrochemical detection have been developed, including

  17. Isolating Microsatellite DNA Loci

    Microsoft Academic Search

    Travis C. Glenn; Nancy A. Schable

    2005-01-01

    A series of techniques are presented to construct genomic DNA libraries highly enriched for microsatellite DNA loci. The individual techniques used here derive from several published protocols but have been optimized and tested in our research laboratories as well as in classroom settings at the University of South Carolina and University of Georgia, with students achieving nearly 100% success. Reducing

  18. Signal-on impedimetric electrochemical DNA sensor using dithiothreitol modified gold nanoparticle tag for highly sensitive DNA detection.

    PubMed

    Wang, Cuiping; Yuan, Xiaqing; Liu, Xuhui; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2013-10-17

    A signal-on impedimetric electrochemical DNA (E-DNA) sensor using gold nanoparticles (AuNPs) as tag was developed for highly sensitive detection of DNA hybridization. A probe ssDNA (PDNA) was immobilized by forming an amide between the -NH2 moiety at the 5'-terminus of PDNA and the -COOH group at self-assembled 11-mercaptoundecanoic acid on a gold electrode. Subsequently, AuNPs were attached to the -SH moiety at the 3'-terminus of the immobilized PDNA by S-Au interaction, and then functionalized with -OH by immersing the electrode in dithiothreitol solution. In the absence of the target DNA, the flexible single-stranded PDNA supports efficient contact between AuNP tag and electrode, ensuring a low electron transfer resistance (Ret) of the E-DNA sensor using the [Fe(CN)6](3-/4-) redox probe. Upon hybridization, a rigid probe-target duplex is formed, which pushes the AuNP tag away from the electrode and increases the distance between AuNP tag and the electrode, thereby increasing the Ret of the E-DNA sensor. Based on hybridization-induced conformational changes, the E-DNA sensor shows an increased Ret response when the target DNA concentration is increased from 5 fM to 500 pM. Furthermore, the E-DNA sensor showed differentiation abilities for single-base mismatch. PMID:24091372

  19. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  20. Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

    Microsoft Academic Search

    L. Lagace; M. Pitre; M. Jacques; D. Roy

    2004-01-01

    The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was

  1. DNA Replicating Itself

    NSDL National Science Digital Library

    Access Excellence

    2005-03-12

    A simplified representation of a DNA molecule separating to form two new molecules.   To reproduce, a cell must copy and transmit its genetic information (DNA) to all of its progeny. To do so, DNA replicates, following the process of semiconservative replication. Each strand of the original molecule acts as a template for the synthesis of a new complementary DNA molecule. The two strands of the double helix are first separated by enzymes. With the assistance of other enzymes, spare parts available inside the cell are bound to the individual strands following the rules of complementary base pairing: adenine (A) to thymine (T) and guanine (G) to cytosine (C). Two strands of DNA are obtained from one, having produced two daughter molecules which are identical to one another and to the parent molecule.

  2. Eukaryotic DNA polymerase ?.

    PubMed

    Makarova, Alena V; Burgers, Peter M

    2015-05-01

    This review focuses on eukaryotic DNA polymerase ? (Pol ?), the enzyme responsible for the bulk of mutagenesis in eukaryotic cells in response to DNA damage. Pol ? is also responsible for a large portion of mutagenesis during normal cell growth, in response to spontaneous damage or to certain DNA structures and other blocks that stall DNA replication forks. Novel insights in mutagenesis have been derived from recent advances in the elucidation of the subunit structure of Pol ?. The lagging strand DNA polymerase ? shares the small Pol31 and Pol32 subunits with the Rev3-Rev7 core assembly giving a four subunit Pol ? complex that is the active form in mutagenesis. Furthermore, Pol ? forms essential interactions with the mutasome assembly factor Rev1 and with proliferating cell nuclear antigen (PCNA). These interactions are modulated by posttranslational modifications such as ubiquitination and phosphorylation that enhance translesion synthesis (TLS) and mutagenesis. PMID:25737057

  3. Recombinant DNA in Medicine

    PubMed Central

    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.

    1984-01-01

    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been extensively and successfully tested in humans and insulin has been licensed for sale. Mass production of bacterial and viral antigens with recombinant DNA technology is likely to provide safe and effective vaccines for some disorders for which there is no prevention. The cloned probes for the human ?- and ?-globin loci, for specific disease genes, such as the Z allele of ?-antitrypsin, and for random genomic sequences are proving useful for prenatally diagnosing human genetic disorders and preventing their clinical consequences. Images PMID:6208695

  4. Method to purify mitochondrial DNA directly from yeast total DNA.

    PubMed

    Zhou, Jingwen; Liu, Liming; Chen, Jian

    2010-11-01

    During the purification of total DNA from yeast, both nuclear and mitochondrial DNA (mtDNA) molecules are obtained. Here, we describe a simple enzymatic method using a combination of ? exonuclease and RecJ(f) to obtain pure and intact mtDNA by removing linear DNA from total DNA isolated from yeast cells. The combination of the two enzymes efficiently removed linear DNA from the total DNA of Candida (Torulopsis) glabrata, leaving the mtDNA intact. The purity and integrity of mtDNA was assayed by PCR amplification of ARG1/2/5/8, URA3 and COX1, and by RFLP analysis, respectively. This method can be used to prepare mtDNA for PCR amplification or RFLP analysis without the need for purification of mitochondria by gradient ultracentrifugation or fractional precipitation. The method was also successfully applied to the yeast species Saccharomyces cerevisiae, Candida utilis, Pichia pastoris and Yarrowia lypolytica. PMID:20600282

  5. Study on the relation between occupational fenvalerate exposure and spermatozoa DNA damage of pesticide factory workers

    PubMed Central

    Bian, Q; Xu, L; Wang, S; Xia, Y; Tan, L; Chen, J; Song, L; Chang, H; Wang, X

    2004-01-01

    Aims: To determine sperm nuclear DNA integrity and to investigate the relation between fenvalerate (FE) exposure and spermatozoa DNA damage. Methods: Sperm DNA fragmentation was detected by a modified alkaline single cell gel electrophoresis (Comet) assay and a terminal deoxynucleotidyl transferase mediated dUTP nick end labelling (TUNEL) assay. The olive tail moment (OTM) and percentage tail DNA were measured by the Comet assay, and cell positive percentage was measured by the TUNEL assay for DNA damage evaluation. Results: The DNA integrity of spermatozoa of external and internal control groups were both significantly greater than that of the FE exposed group. The median value of tail DNA percentage in the exposure group was 11.30, which was significantly higher than 5.60 in the internal control group and 5.10 in the external control group. The median value of OTM was 3.80 in the exposure group, significantly higher than 1.50 in the internal control group and 2.00 in the external control group. Mean cell positive was 31.2% in the exposure group, significantly higher than 17.4% in the internal control and 19.6% in the external control groups. Cell positive (%) was significantly correlated with tail DNA percentage and with OTM of whole subjects (n = 63). Conclusions: Results showed that occupational FE exposure is associated with an increase in sperm DNA damage. A combination of the Comet and TUNEL assays would offer more comprehensive information for a better understanding of sperm DNA damage, and the biological significance of sperm DNA damage in sperm function and male infertility. PMID:15550606

  6. Damage-specific DNA-binding proteins from human cells

    SciTech Connect

    Kanjilal, S.

    1992-01-01

    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1% NP-40.

  7. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L. (Pleasanton, CA)

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  8. DNA Align Editor: DNA Alignment Editor Tool

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The SNPAlignEditor is a DNA sequence alignment editor that runs on Windows platforms. The purpose of the program is to provide an intuitive, user-friendly tool for manual editing of multiple sequence alignments by providing functions for input, editing, and output of nucleotide sequence alignments....

  9. Chitosan-DNA nanoparticles as gene carriers: synthesis, characterization and transfection efficiency

    Microsoft Academic Search

    Hai-Quan Mao; Krishnendu Roy; Vu L. Troung-Le; Kevin A. Janes; Kevin Y. Lin; Yan Wang; J. Thomas August; Kam W. Leong

    2001-01-01

    Chitosan-DNA nanoparticles were prepared using a complex coacervation process. The important parameters for the nanoparticle synthesis were investigated, including the concentrations of DNA, chitosan and sodium sulfate, temperature of the solutions, pH of the buffer, and molecular weights of chitosan and DNA. At an amino group to phosphate group ratio (N\\/P ratio) between 3 and 8 and a chitosan concentration

  10. Independent versus Cooperative Binding in Polyethylenimine–DNA and Poly(L-lysine)–DNA Polyplexes

    PubMed Central

    Ketola, Tiia-Maaria; Hanzlíková, Martina; Leppänen, Linda; Raviña, Manuela; Bishop, Corey J.; Green, Jordan J.; Urtti, Arto; Lemmetyinen, Helge; Yliperttula, Marjo; Vuorimaa-Laukkanen, Elina

    2013-01-01

    The mechanism of polyethylenimine–DNA and poly(L-lysine)–DNA complex formation at pH 5.2 and 7.4 was studied by a time-resolved spectroscopic method. The formation of a polyplex core was observed to be complete at approximately N/P = 2, at which point nearly all DNA phosphate groups were bound by polymer amine groups. The data were analyzed further both by an independent binding model and by a cooperative model for multivalent ligand binding to multisubunit substrate. At pH 5.2, the polyplex formation was cooperative at all N/P ratios, whereas for pH 7.4 at N/P < 0.6 the polyplex formation followed independent binding changing to cooperative binding at higher N/Ps. PMID:23941196

  11. DFT study of the electronic properties of DNA-DNA and PNA-DNA double strands

    Microsoft Academic Search

    Takayuki Natsume; Yasuyuki Ishikawa; Kenichi Dedachi; Takayuki Tsukamoto; Noriyuki Kurita

    2006-01-01

    The electronic properties of DNA-DNA and PNA-DNA double strands having 3-6 base pairs (bp) were investigated by density functional theory (DFT) calculations. The binding energies and the highest occupied molecular orbital-lowest unoccupied molecular orbital (HOMO-LUMO) energy gaps for the PNA-DNA hybrids in the vapor phase are found to be greater than those for the DNA-DNA hybrids, regardless of the number

  12. Tyrosyl-DNA phosphodiesterase I resolves both naturally and chemically induced DNA adducts and its potential as a therapeutic target.

    PubMed

    Comeaux, Evan Q; van Waardenburg, Robert C A M

    2014-11-01

    DNA is subject to a wide range of insults, resulting from endogenous and exogenous sources that need to be metabolized/resolved to maintain genome integrity. Tyrosyl-DNA phosphodiesterase I (Tdp1) is a eukaryotic DNA repair enzyme that catalyzes the removal of covalent 3'-DNA adducts. As a phospholipase D superfamily member Tdp1 utilizes two catalytic histidines each within a His-Lys-Asn motif. Tdp1 was discovered for its ability to hydrolyze the 3'-phospho-tyrosyl that in the cell covalently links DNA Topoisomerase I (Topo1) and DNA. Tdp1's list of substrates has since grown and can be divided into two groups: protein-DNA adducts, such as camptothecin stabilized Topo1-DNA adducts, and modified nucleotides, including oxidized nucleotides and chain terminating nucleoside analogs. Since many of Tdp1's substrates are generated by clinically relevant chemotherapeutics, Tdp1 became a therapeutic target for molecularly targeted small molecules. Tdp1's unique catalytic cycle allows for two different targeting strategies: (1) the intuitive inhibition of Tdp1 catalysis to prevent Tdp1-mediated repair of chemotherapeutically induced DNA adducts, thereby enhancing their toxicity and (2) stabilization of the Tdp1-DNA covalent reaction intermediate, prevents resolution of Tdp1-DNA adduct and increases the half-life of this potentially toxic DNA adduct. This concept is best illustrated by a catalytic Tdp1 mutant that forms the molecular basis of the autosomal recessive neurodegenerative disease spinocerebellar ataxia with axonal neuropathy, and results in an increased stability of its Tdp1-DNA reaction intermediate. Here, we will discuss Tdp1 catalysis from a structure-function perspective, Tdp1 substrates and Tdp1 potential as a therapeutic target. PMID:25327705

  13. Ancient DNA reveals traces of Iberian Neolithic and Bronze Age lineages in modern Iberian horses

    E-print Network

    Ancient DNA reveals traces of Iberian Neolithic and Bronze Age lineages in modern Iberian horses this hypothesis, we analysed mitochondrial DNA from 22 ancient Iberian horse remains belonging to the Neolithic sequence appeared in the D1 group. Neolithic and Bronze Age sequences grouped in other clusters, one

  14. Innovations. DNA detectives.

    PubMed

    May, M

    1999-01-01

    To understand the many potential causes and resulting consequences of DNA damage, scientists first need methods to detect it. Canadian scientists X. Chris Le and Michael Weinfeld, with help from U.S. molecular biologist Steven Leadon, developed a selective, sensitive technique for measuring DNA damage. The scientists combined a thymine glycol antibody with thymine glycol to selectively tag a specific type of DNA damage. They then added a second antibody with fluorescing properties, and used laser-induced fluorescence to identify the damaged portion of the tagged DNA. The fluorescence can be quantified, with higher levels of fluorescence indicating higher DNA damage. The technique was shown to find 1 damaged base in 1 billion normal bases. This level of sensitivity could allow the measurement of DNA damage resulting from clinical levels of radiation, and may allow scientists to establish a day-to-day baseline for DNA damage. From this baseline, it would be possible to ascertain the levels of damage that a cell can tolerate, as well as how much damaged it is capable of repairing on a daily basis. PMID:9872726

  15. DNA Polymerase ? Ribonucleotide Discrimination

    PubMed Central

    Cavanaugh, Nisha A.; Beard, William A.; Wilson, Samuel H.

    2010-01-01

    DNA polymerases must select nucleotides that preserve Watson-Crick base pairing rules and choose substrates with the correct (deoxyribose) sugar. Sugar discrimination represents a great challenge because ribonucleotide triphosphates are present at much higher cellular concentrations than their deoxy-counterparts. Although DNA polymerases discriminate against ribonucleotides, many therapeutic nucleotide analogs that target polymerases have sugar modifications, and their efficacy depends on their ability to be incorporated into DNA. Here, we investigate the ability of DNA polymerase ? to utilize nucleotides with modified sugars. DNA polymerase ? readily inserts dideoxynucleoside triphosphates but inserts ribonucleotides nearly 4 orders of magnitude less efficiently than natural deoxynucleotides. The efficiency of ribonucleotide insertion is similar to that reported for other DNA polymerases. The poor polymerase-dependent insertion represents a key step in discriminating against ribonucleotides because, once inserted, a ribonucleotide is easily extended. Likewise, a templating ribonucleotide has little effect on insertion efficiency or fidelity. In contrast to insertion and extension of a ribonucleotide, the chemotherapeutic drug arabinofuranosylcytosine triphosphate is efficiently inserted but poorly extended. These results suggest that the sugar pucker at the primer terminus plays a crucial role in DNA synthesis; a 3?-endo sugar pucker facilitates nucleotide insertion, whereas a 2?-endo conformation inhibits insertion. PMID:20519499

  16. Organization of DNA Replication

    PubMed Central

    Chagin, Vadim O.; Stear, Jeffrey H.; Cardoso, M. Cristina

    2010-01-01

    The discovery of the DNA double helix structure half a century ago immediately suggested a mechanism for its duplication by semi-conservative copying of the nucleotide sequence into two DNA daughter strands. Shortly after, a second fundamental step toward the elucidation of the mechanism of DNA replication was taken with the isolation of the first enzyme able to polymerize DNA from a template. In the subsequent years, the basic mechanism of DNA replication and its enzymatic machinery components were elucidated, mostly through genetic approaches and in vitro biochemistry. Most recently, the spatial and temporal organization of the DNA replication process in vivo within the context of chromatin and inside the intact cell are finally beginning to be elucidated. On the one hand, recent advances in genome-wide high throughput techniques are providing a new wave of information on the progression of genome replication at high spatial resolution. On the other hand, novel super-resolution microscopy techniques are just starting to give us the first glimpses of how DNA replication is organized within the context of single intact cells with high spatial resolution. The integration of these data with time lapse microscopy analysis will give us the ability to film and dissect the replication of the genome in situ and in real time. PMID:20452942

  17. Quantitive DNA Fiber Mapping

    SciTech Connect

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  18. Interaction of DNA and DNA-anti-DNA complexes to fibronectin

    SciTech Connect

    Gupta, R.C.; Simpson, W.A.; Raghow, R.; Hasty, K.

    1986-03-01

    Fibronectin (Fn) is a large multidomain glycoprotein found in the basement membrane, on cell surface and in plasma. The interactions of Fn with DNA may be significant in glomerular deposition of DNA-anti-DNA complexes in patients with systemic lupus erythematosus (SLE). The authors examined the binding of DNA and DNA-anti-DNA complexes to Fn by a solid phase assay in which Fn was coated to microtiter plates and reacted with (/sup 3/H)DNA or DNA complexes with a monoclonal anti-DNA antibody. The optimal interaction of DNA with Fn occurs at <0.1M NaCl suggesting that the binding is charge dependent; the specificity of this binding was shown by competitive inhibition and locking experiments using anti-Fn. The binding was maximum at pH 6.5 and in the absence of Ca/sup 2 +/. The addition of Clq enhanced the binding of DNA and DNA-anti-DNA complexes to Fn, whereas heparan sulfate inhibited such binding. The monomeric or aggregated IgC did not bind Fn but aggregated IgG bound to Fn in the presence of Clq. Furthermore, DNA-anti-DNA complexes in sera from active SLE patients bound Fn which was enhanced in the presence of Clq; DNase abolished this binding indicating that the interaction of these complexes was mediated by DNA. These observations may partially explain the molecular mechanism(s) of the deposition of DNA-anti-DNA complexes in basement membrane.

  19. Group Learning.

    ERIC Educational Resources Information Center

    Black, Susan

    1992-01-01

    Research suggests that cooperative learning works best when students are first taught group-processing skills, such as leadership, decision making, communication, trust building, and conflict management. Inadequate teacher training and boring assignments can torpedo cooperative learning efforts. Administrators should reassure teachers with…

  20. Automata groups

    E-print Network

    Muntyan, Yevgen

    2010-01-16

    to thank Dr. Volodymyr Nekrashevych and Dr. Vitaliy Sushchansky from Kyiv Taras Shevchenko University for having introduced me to the world of algebra and group theory and guidance through the first years of my studies. All my scientific successes are due...

  1. Thermodynamics of Cro protein-DNA interactions.

    PubMed

    Takeda, Y; Ross, P D; Mudd, C P

    1992-09-01

    Using a highly sensitive pulsed-flow microcalorimeter, we have measured the changes in enthalpy and determined the thermodynamic parameters delta H, delta S degree, delta G degree, and delta C(p) for Cro protein-DNA association reactions. The reactions studied include sequence-nonspecific DNA association and sequence-specific DNA associations involving single- and multiple-base alterations and/or single-amino acid alteration mutants. (i) The association of Cro protein with nonspecific DNA at 15 degrees C is characterized by delta H = +4.4 kcal.mol-1 (1 cal = 4.18J), delta S degrees = 49 cal.mol-1.K-1, delta G degrees = -9.7 kcal.mol-1, and delta Cp congruent to 0; the association with specific high-affinity operator OR3 DNA is characterized by delta H = +0.8 kcal.mol-1, delta S degree = 59 cal.mol-1.K-1, delta G degree = -16.1 kcal.mol-1, and delta Cp = -360 cal.mol-1.K-1, respectively. Both nonspecific and specific Cro-DNA associations are entropy-driven. (ii) Plots of delta H vs. delta Cp and delta S degree vs. delta Cp for the 20 association reactions studied fall into two correlation groups with linear slopes of +9.4 K and -20.5 K and of -0.03 and -0.14, respectively. These regression lines have common intercepts, at the delta H and delta S degree values of nonspecific association (where delta Cp congruent to 0). The results suggest that there are, at least, two distinct conformational subclasses in specific Cro-DNA complexes, stabilized by different combinations of enthalpic and entropic contributions. The delta G degree and delta Cp values form an approximately single linear correlation group as a consequence of compensatory contributions from delta H and delta S degree to delta G degree and to delta Cp. Cro protein-DNA associations share some similar thermodynamic properties with protein folding, but their overall energetics are quite different. Although the nonspecific complex is stabilized predominantly by electrostatic forces, it appears that H bonds, van der Waals contacts, hydrophobic effects, and charge interactions all contribute to the stability (delta G degree and delta Cp) of the specific complex. (iii) The variations in the values of the thermodynamic parameters are in general accord with our knowledge of the structure of the Cro-DNA complex. PMID:1518844

  2. DNA-PK assay

    DOEpatents

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  3. DNA damage, mutation and fine structure DNA repair in aging

    Microsoft Academic Search

    Vilhelm A. Bohr; R. Michael Anson

    1995-01-01

    The primary focus of this review is on correlations found between DNA damage, repair, and aging. New techniques for the measurement of DNA damage and repair at the level of individual genes, in individual DNA strands and in individual nucleotides will allow us to gain information regarding the nature of these correlations. Fine structure studies of DNA damage and repair

  4. DNA topoisomerases in mtDNA maintenance and ageing.

    PubMed

    Sobek, Stefan; Boege, Fritz

    2014-08-01

    DNA topoisomerases pass DNA strands through each other, a function essential for all DNA metabolic processes that create supercoils or entanglements of DNA. Topoisomerases play an ambivalent role in nuclear genome maintenance: Deficiency compromises gene transcription, replication and chromosome segregation, while the inherent DNA-cleavage activity of the enzymes endangers DNA integrity. Indeed, many DNA-damaging agents act through enhancing topoisomerase DNA cleavage. Mitochondrial DNA (mtDNA) clearly requires topoisomerase activity for transcription and replication, because it is a closed, double-stranded DNA molecule. Three topoisomerases have so far been found in mammalian mitochondria (I, II?, III?), but their precise role in mtDNA metabolism, mitochondrial maintenance and respiratory function remains mostly unclear. It is a reasonable surmise that these enzymes exhibit similar ambiguity with respect to genome maintenance and gene transcription as their nuclear counterparts. Here, we review what is known about the physiological roles of mitochondrial topoisomerases and draft three scenarios of how these enzymes possibly contribute to ageing-related mtDNA attrition and respiratory chain dysfunction. These scenarios are: mtDNA attrition by exogenously stimulated topoisomerase DNA cleavage, unbalancing of mitochondrial and nuclear transcription by direct effects on mitochondrial transcription, and contributions to enhanced mtDNA entanglement and recombination. PMID:24440386

  5. Analysis of DNA Recombination Proteins in DNA Damage Response

    Microsoft Academic Search

    T. L. R. Tan

    2005-01-01

    Chromosomes are the carriers of our genome. All the information for a cell's survival and propagation is stored there in the base sequence of the DNA. Unfortunately, our DNA is under continuous attack from DNA damaging agents, of which some are produced during a cell's own metabolic processes, while others may be of exogenous origin. DNA damage leads to mutations

  6. DNA chips --Integrated Chemical Circuits for DNADiagnosis and DNA computers

    E-print Network

    Hagiya, Masami

    DNA chips -- Integrated Chemical Circuits for DNADiagnosis and DNA computers Akira Suyama, Associate Professor Institute of Physics, Graduate School of Arts and Sciences, The University of Tokyo DNA chips are si l i con­ or glass­based smal l surfaces on which many DNA ol i gonuc l eotides are i

  7. Molecular characterization of races and vegetative compatibility groups in Fusarium oxysporum f. sp. vasinfectum.

    PubMed

    Fernandez, D; Assigbese, K; Dubois, M P; Geiger, J P

    1994-11-01

    Restriction fragment length polymorphism (RFLP) and vegetative compatibility analyses were undertaken to assess genetic relationships among 52 isolates of Fusarium oxysporum f. sp. vasinfectum of worldwide origin and representing race A, 3, or 4 on cotton plants. Ten distinct vegetative compatibility groups (VCGs) were obtained, and isolates belonging to distinct races were never in the same VCG. Race A isolates were separated into eight VCGs, whereas isolates of race 3 were classified into a single VCG (0113), as were those of race 4 (0114). Ribosomal and mitochondrial DNA (rDNA and mtDNA) RFLPs separated four rDNA haplotypes and seven mtDNA haplotypes. Race A isolates displayed the most polymorphism, with three rDNA haplotypes and four mtDNA haplotypes; race 4 isolates formed a single rDNA group but exhibited three mtDNA haplotypes, while race 3 isolates had unique rDNA and mtDNA haplotypes. Two mtDNA molecules with distinct sizes were identified; the first (45-kb mtDNA) was found in all race A isolates and seven race 4 isolates, and the second (55-kb mtDNA) was found in all race 3 isolates and in two isolates of race 4. These two mtDNA molecules were closely related to mtDNAs of F. oxysporum isolates belonging to other formae speciales (conglutinans, lycopersici, matthioli, and raphani). Isolates within a VCG shared the same rDNA and mtDNA haplotypes, with the exception of VCG0114, in which three distinct mtDNA haplotypes were observed. Genetic relationships among isolates inferred from rDNA or mtDNA site restriction data were different, and there was not a strict correlation between race and RFLPs.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7993090

  8. Focus: DNA probes

    SciTech Connect

    Not Available

    1986-11-01

    Progress in the development of DNA probes for the identification and quantitation of specific genetic sequences in biological samples is reviewed. Current research efforts in the development of DNA probes for the diagnosis of a wide variety of bacterial, viral, and other infectious diseases, such as herpes simplex and cytomegalovirus, and inherited genetic diseases such as cystic fibrosis and sickle cell anemia are discussed. Progress in development of DNA probe assays for cancer diagnosis, detection of Salmonella food poisoning, tissue typing (detection of histocompatibility antigens), mutagen screening, and animal diseases, among other applications is included.

  9. Complete mitochondrial DNA replacement in a Lake Tanganyika cichlid fish.

    PubMed

    Nevado, B; Koblmüller, S; Sturmbauer, C; Snoeks, J; Usano-Alemany, J; Verheyen, E

    2009-10-01

    We used nuclear and mitochondrial DNA (mtDNA) sequences from specimens collected throughout Lake Tanganyika to clarify the evolutionary relationship between Lamprologus callipterus and Neolamprologus fasciatus. The nuclear data support the reciprocal monophyly of these two shell-breeding lamprologine cichlids. However, mtDNA sequences show that (i) L. callipterus includes two divergent and geographically disjunct (North-South) mtDNA lineages; and that (ii) N. fasciatus individuals cluster in a lineage sister group to the northern lineage of L. callipterus. The two mtDNA lineages of L. callipterus diverged c. 684 kya to 1.2 Ma, coinciding with a major water level low stand in Lake Tanganyika, which divided the lake into isolated sub-lakes. This suggests that the two mtDNA lineages originated as the result of the separation of L. callipterus populations in different sub-basins. The incongruent phylogenetic position of N. fasciatus can best be explained by an ancient unidirectional introgression from L. callipterus into N. fasciatus. Remarkably, our data indicate that this event resulted in the complete mtDNA replacement in N. fasciatus. Our data suggest that hybridization occurred soon after the divergence of the two L. callipterus mtDNA lineages, probably still during the water level low stand, and that subsequently the invading mtDNA lineage spread throughout the lake. PMID:19780975

  10. Is DNA a non-draining, swollen coil?

    NASA Astrophysics Data System (ADS)

    Muralidhar, Abhiram; Tree, Douglas; Doyle, Patrick; Dorfman, Kevin

    2014-03-01

    Double-stranded DNA has long been used as a model polymer in a wide variety of experiments, particularly in single molecule studies. However, there is little consensus about whether molecules used commonly in experiments, such as ?-DNA (48.5 kbp, kilo base pairs) and T4-DNA (169 kbp), are long enough to exhibit universal, long-chain behavior. To resolve this point of contention, we use Pruned-Enriched Rosenbluth Method (PERM) simulations to calculate static and near-equilibrium dynamic properties of DNA ranging from a molecular weight of 100 bp to nearly 1 Mbp (mega base pairs). By evaluating metrics such as the end-to-end distance, and comparing these results with renormalization group theory predictions, we show that molecules such as ?-DNA and T4-DNA are far from the swollen coil limit. Our results indicate that DNA exhibits flexible swollen coil behavior when the contour length is approximately 1 Mbp. Moreover, computation of the Kirkwood diffusivity from equilibrium configurations reveals that DNA is partially draining to chain lengths as big as 1 Mbp. We attribute this slow transition to universal behavior to the semiflexible nature of DNA, that gives rise to weak intramolecular excluded volume and hydrodynamic interactions.

  11. Biomimetic DNA nanoballs for oligonucleotide delivery.

    PubMed

    Kim, Mi-Gyeong; Park, Joo Yeon; Shim, Gayong; Choi, Han-Gon; Oh, Yu-Kyoung

    2015-09-01

    Here, we designed biomimetic DNA nanoballs for delivery of multiple antisense oligonucleotides (ASOs). DNA templates with ASOs-complementary sequences were amplified by rolling circle amplification (RCA). RCA products were loaded with two types of ASOs by hybridization, condensed using adenovirus-derived Mu peptide, and coated with hyaluronic acid (HA) for delivery into CD44-overexpressing tumor cells. HA-coated, Mu peptide-condensed, dual ASO-loaded DNA nanoballs (HMA nanoballs) showed considerable cellular entry of Cy5-incorporated RCA product DNA and fluorescent ASOs, whereas Mu peptide-condensed, dual ASO-loaded DNA nanoballs (MA nanoballs) revealed limited uptake. Dual ASOs, Dz13 and OGX-427, delivered by HMA nanoballs could reduce the levels of protein targets and exert anticancer effects. Enhanced tumor distribution was observed for fluorescent HMA nanoballs than the corresponding MA nanoballs. Upon intravenous co-administration with doxorubicin, HMA nanoballs exerted the greatest anti-tumor effects among the groups. These results suggest HMA nanoballs as a nanoplatform for sequence-specific delivery of multiple ASOs and other functional oligonucleotides. PMID:26056726

  12. Structural heterogeneity of mitochondrial DNA molecules within the genus Drosophila.

    PubMed Central

    Fauron, C M; Wolstenholme, D R

    1976-01-01

    We have determined by electron microscopy the molecular weight of circular mitochondrial DNA (mtDNA) molecules from 39 species representing 13 groups of five subgenera of the genus Drosophila. mtDNA molecules of all species examined, other than members of the melanogaster group, had, with one exception, molecular weights in the rather narrow range 9.90 X 10(6). The one exception was D. robusta, which had a molecular weight of 10.61 X 10(6). In contrast, mtDNA molecules from species within the melanogaster group had molecular weights covering the considerably greater range 9.92 X 10(6) to 12.35 X 10(6). Applying the electron microscope denaturation mapping technique of Inman to mtDNA molecules of eight species of the melanogaster group, we found each of them to contain a region [presumably rich in adenine and thymine (A+T)] which denatured at a specific temperature (40 degrees) at which most of the remainder of the molecule remained undenatured. The size of the A+T-rich region was constant for mtDNA molecules of a species, but varied from 0.62 X 10(6) to 3.41 X 10(6) for mtDNA molecules of different species. It was demonstrated that the differences in molecular weights of the A+T-rich regions can almost completely account for the differences in total molecular weights of the mtDNA molecules from species of the melanogaster group. Images PMID:1068475

  13. Symmetry of electrostatic interaction between pyrophosphate DNA molecules.

    PubMed

    Golo, V L; Kats, E I; Kuznetsova, S A; Volkov, Yu S

    2010-01-01

    We study chiral electrostatic interaction between artificial ideal homopolymer DNA-like molecules in which a number of phosphate groups of the sugar-phosphate backbone are exchanged for the pyrophosphate ones. We employ a model in which the DNA is considered as a one-dimensional lattice of dipoles and charges corresponding to base pairs and (pyro)phosphate groups, respectively. The interaction between molecules of the DNA is described by a pair potential U of electrostatic forces between the two sets of dipoles and charges belonging to respective lattices describing the molecules. Minima of the potential U indicate orientational ordering of the molecules and thus liquid crystalline phases of the DNA. We use numerical methods for finding the set of minima in conjunction with symmetries verified by the potential U . The symmetries form a non-commutative group of 8th order, S . Using the group S we suggest a classification of liquid crystalline phases of the DNA, which allows several cholesteric phases, that is polymorphism. Pyrophosphate forms of the DNA could clarify the role played by charges in their liquid crystalline phases, and open experimental research, important for nano-technological and bio-medical applications. PMID:20087624

  14. Abelian groups 

    E-print Network

    Bolen, James Cordell

    1956-01-01

    groups. In order to d. o this, we will need the aid. of some vector space theorys D~ef ~tp 4s10 A vector ~sac 7 over the field. P is an abelian group which admits mult1plicatlon by elements of t' he field. such that, for a, b e P and. x, y s V& (l) a(x... (antisymmetry), (c) x & y, y & z implies that x & z (transitivity). Let S be a partially ordered set and T a subset. Defin1tion 4s2 The element x is an ~u er bound. of T if x & y for every y in T. The element x may or may not be in T. Definition 4...

  15. Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters

    E-print Network

    Bolshoy, Alexander

    Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters Alexander Bolshoy1 of the distribution of predicted intrinsic curvature along all available complete prokaryotic genomes, the genomes were divided into two groups. Curvature distribution in all prokaryotes of the first group indicated

  16. Streptococcus raffinozactis Orla- Jensen and Hansen, a Group N Streptococcus Found in Raw Milk

    Microsoft Academic Search

    ELLEN I. GARVIE

    1978-01-01

    The properties of the lactate dehydrogenases, percent guanine plus cytosine in the deoxyribonucleic acid (DNA), and DNA\\/DNA hybridization studies have shown that three strains of group N streptococci do not belong to either Strep- tococcus Zactis or Streptococcus cremoris. The biochemical properties of the three strains were published about 25 years ago, and at that time the strains were not

  17. Structural analysis of DNA complexation with cationic lipids

    PubMed Central

    Marty, Regis; N'soukpoé-Kossi, Christophe N.; Charbonneau, David; Weinert, Carl Maximilian; Kreplak, Laurent; Tajmir-Riahi, Heidar-Ali

    2009-01-01

    Complexes of cationic liposomes with DNA are promising tools to deliver genetic information into cells for gene therapy and vaccines. Electrostatic interaction is thought to be the major force in lipid–DNA interaction, while lipid-base binding and the stability of cationic lipid–DNA complexes have been the subject of more debate in recent years. The aim of this study was to examine the complexation of calf-thymus DNA with cholesterol (Chol), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), dioctadecyldimethylammoniumbromide (DDAB) and dioleoylphosphatidylethanolamine (DOPE), at physiological condition, using constant DNA concentration and various lipid contents. Fourier transform infrared (FTIR), UV-visible, circular dichroism spectroscopic methods and atomic force microscopy were used to analyse lipid-binding site, the binding constant and the effects of lipid interaction on DNA stability and conformation. Structural analysis showed a strong lipid–DNA interaction via major and minor grooves and the backbone phosphate group with overall binding constants of KChol = 1.4 (±0.5) × 104 M?1, KDDAB = 2.4 (±0.80) × 104 M?1, KDOTAP = 3.1 (±0.90) × 104 M?1 and KDOPE = 1.45 (± 0.60) × 104 M?1. The order of stability of lipid–DNA complexation is DOTAP>DDAB>DOPE>Chol. Hydrophobic interactions between lipid aliphatic tails and DNA were observed. Chol and DOPE induced a partial B to A-DNA conformational transition, while a partial B to C-DNA alteration occurred for DDAB and DOTAP at high lipid concentrations. DNA aggregation was observed at high lipid content. PMID:19103664

  18. -DNA 1217 BK21-IT,

    E-print Network

    - DNA 1217 BK21-IT, (MEC) (NRL) . . : : : : syshin@bi.snu.ac.kr ihlee@bi.snu.ac.kr btzhang@bi.snu.ac.kr 2004 9 16 2005 10 14 - DNA (DNA Sequence Design using -Multiobjective Evolutionary Algorithm) (Soo-Yong Shin) (In-Hee Lee) (Byoung-Tak Zhang) DNA

  19. Electronic Anthrax DNA Biosensor Review

    Microsoft Academic Search

    Tim Damrow; Brent Hagemeyer; Hassan Ismail; Ryan Oldham

    We introduce preliminary design specifications for an electronic anthrax deoxyribonucleic acid (DNA) biosensor using the principle of DNA displacement. Upon hybridization, the sample DNA displaces a ferrocene-marked signal probe, which induces an increased redox current that is amperometrically measured and relayed. I. INTRODUCTION The purpose of this article is to propose a design of a Lab- On-Chip DNA biosensor that

  20. Close encounters with DNA.

    PubMed

    Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A

    2014-10-15

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  1. Kink solitons in DNA

    E-print Network

    Zdravkovi?, S; Daniel, M

    2012-01-01

    We here examine the nonlinear dynamics of artificial homogeneous DNA chain relying on the plain-base rotator model. It is shown that such dynamics can exhibit kink and antikink solitons of sine-Gordon type. In that respect we propose possible experimental assays based on single molecule micromanipulation techniques. The aim of these experiments is to excite the rotational waves and to determine their speeds along excited DNA. We propose that these experiments should be conducted either for the case of double stranded (DS) or single stranded (SS) DNA. A key question is to compare the corresponding velocities of the rotational waves indicating which one is bigger. The ratio of these velocities appears to be related with the sign of the model parameter representing ratio of the hydrogen-bonding and the covalent-bonding interaction within the considered DNA chain.

  2. Automating DNA processing

    E-print Network

    Wienen, Michael Jan

    1994-01-01

    and resources must be spent in laboratory research to determine the genetic structure of the relevant organisms. DNA processing is riddled with time intensive laboratory techniques that must be improved or replaced if genotyping large numbers of samples...

  3. Shear Unzipping of DNA

    E-print Network

    Buddhapriya Chakrabarti; David R. Nelson

    2009-04-09

    We study theoretically the mechanical failure of a simple model of double stranded DNA under an applied shear. Starting from a more microscopic Hamiltonian that describes a sheared DNA, we arrive at a nonlinear generalization of a ladder model of shear unzipping proposed earlier by deGennes [deGennes P. G. C. R. Acad. Sci., Ser. IV; Phys., Astrophys. 2001, 1505]. Using this model and a combination of analytical and numerical methods, we study the DNA "unzipping" transition when the shearing force exceeds a critical threshold at zero temperature. We also explore the effects of sequence heterogeneity and finite temperature and discuss possible applications to determine the strength of colloidal nanoparticle assemblies functionalized by DNA.

  4. Multiplex analysis of DNA

    DOEpatents

    Church, George M. (Boston, MA); Kieffer-Higgins, Stephen (Dorchester, MA)

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  5. Engineering DNA self-assemblies as templates for functional nanostructures.

    PubMed

    Wang, Zhen-Gang; Ding, Baoquan

    2014-06-17

    CONSPECTUS: DNA is a well-known natural molecule that carries genetic information. In recent decades, DNA has been used beyond its genetic role as a building block for the construction of engineering materials. Many strategies, such as tile assembly, scaffolded origami and DNA bricks, have been developed to design and produce 1D, 2D, and 3D architectures with sophisticated morphologies. Moreover, the spatial addressability of DNA nanostructures and sequence-dependent recognition enable functional elements to be precisely positioned and allow for the control of chemical and biochemical processes. The spatial arrangement of heterogeneous components using DNA nanostructures as the templates will aid in the fabrication of functional materials that are difficult to produce using other methods and can address scientific and technical challenges in interdisciplinary research. For example, plasmonic nanoparticles can be assembled into well-defined configurations with high resolution limit while exhibiting desirable collective behaviors, such as near-field enhancement. Conducting metallic or polymer patterns can be synthesized site-specifically on DNA nanostructures to form various controllable geometries, which could be used for electronic nanodevices. Biomolecules can be arranged into organized networks to perform programmable biological functionalities, such as distance-dependent enzyme-cascade activities. DNA nanostructures can carry multiple cytoactive molecules and cell-targeting groups simultaneously to address medical issues such as targeted therapy and combined administration. In this Account, we describe recent advances in the functionalization of DNA nanostructures in different fashions based on our research efforts in nanophotonics, nanoelectronics, and nanomedicine. We show that DNA origami nanostructures can guide the assembly of achiral, spherical, metallic nanoparticles into nature-mimicking chiral geometries through hybridization between complementary DNA strands on the surface of nanoparticles and DNA scaffolds, to generate circular dichroism (CD) response in the visible light region. We also show that DNA nanostructures, on which a HRP-mimicking DNAzyme acts as the catalyst, can direct the site-selective growth of conductive polymer nanomaterials with template configuration-dependent doping behaviors. We demonstrate that DNA origami nanostructures can act as an anticancer-drug carrier, loading drug through intercalation, and can effectively circumvent the drug resistance of cultured cancer cells. Finally, we show a label-free strategy for probing the location and stability of DNA origami nanocarriers in cellular environments by docking turn-off fluorescence dyes in DNA double helices. These functionalizations require further improvement and expansion for realistic applications. We discuss the future opportunities and challenges of DNA based assemblies. We expect that DNA nanostructures as engineering materials will stimulate the development of multidisciplinary and interdisciplinary research. PMID:24588320

  6. DNA Barcoding Bromeliaceae: Achievements and Pitfalls

    PubMed Central

    Franco, Luciana Ozório; Cardoso, Mônica Aires; Cardoso, Sérgio Ricardo Sodré; Hemerly, Adriana Silva; Ferreira, Paulo Cavalcanti Gomes

    2012-01-01

    Background DNA barcoding has been successfully established in animals as a tool for organismal identification and taxonomic clarification. Slower nucleotide substitution rates in plant genomes have made the selection of a DNA barcode for land plants a much more difficult task. The Plant Working Group of the Consortium for the Barcode of Life (CBOL) recommended the two-marker combination rbcL/matK as a pragmatic solution to a complex trade-off between universality, sequence quality, discrimination, and cost. Methodology/Principal Findings It is expected that a system based on any one, or a small number of plastid genes will fail within certain taxonomic groups with low amounts of plastid variation, while performing well in others. We tested the effectiveness of the proposed CBOL Plant Working Group barcoding markers for land plants in identifying 46 bromeliad species, a group rich in endemic species from the endangered Brazilian Atlantic Rainforest. Although we obtained high quality sequences with the suggested primers, species discrimination in our data set was only 43.48%. Addition of a third marker, trnH–psbA, did not show significant improvement. This species identification failure in Bromeliaceaecould also be seen in the analysis of the GenBank's matK data set. Bromeliaceae's sequence divergence was almost three times lower than the observed for Asteraceae and Orchidaceae. This low variation rate also resulted in poorly resolved tree topologies. Among the three Bromeliaceae subfamilies sampled, Tillandsioideae was the only one recovered as a monophyletic group with high bootstrap value (98.6%). Species paraphyly was a common feature in our sampling. Conclusions/Significance Our results show that although DNA barcoding is an important tool for biodiversity assessment, it tends to fail in taxonomy complicated and recently diverged plant groups, such as Bromeliaceae. Additional research might be needed to develop markers capable to discriminate species in these complex botanical groups. PMID:22253812

  7. Molecular mechanism of calcium-induced adsorption of DNA on zwitterionic phospholipid membranes.

    PubMed

    Antipina, Alexandra Yu; Gurtovenko, Andrey A

    2015-06-01

    Interaction of DNA with zwitterionic phospholipids is an important long-standing problem in the field of liposome-based gene delivery. Although it is well-established that divalent cations can promote formation of stable DNA-phospholipid complexes, the underlying molecular mechanism remains largely unknown. Here we employ computer simulations to gain atomistically resolved insight into the kinetics of calcium-induced adsorption of DNA on zwitterionic phosphatidylcholine membranes as well as into the structure and stability of the resulting complexes. Overall, our findings show that calcium ions play a dual role in DNA-phospholipid systems. First, binding of divalent cations to the lipid-water interface turns the surface of the zwitterionic membrane positively charged, promoting thereby the initial electrostatic attraction of a polyanionic DNA molecule. Second, we show that calcium ions are crucial for stabilizing the DNA-lipid membrane complex as they bridge together phosphate groups of DNA and lipid molecules. In contrast to previous hypotheses, we demonstrate that direct interactions between choline groups of phospholipids and DNA phosphates play only a rudimentary role as they are relatively short-lived and unstable: typical residence times for such interactions are 2 orders of magnitude smaller than those for Ca-mediated bridges between DNA and lipid phosphate groups. The results of our study can serve as a basis for a deeper understanding of molecular mechanisms behind noncovalent binding of DNA and DNA-based nanodevices to complex surfaces such as cell membranes. PMID:25856084

  8. Degradation of poly(glycoamidoamine) DNA delivery vehicles: polyamide hydrolysis at physiological conditions promotes DNA release.

    PubMed

    Liu, Yemin; Reineke, Theresa M

    2010-02-01

    Poly(glycoamidoamine)s (PGAAs) are a group of efficient and degradable gene delivery vehicles that consist of three main functionalities: carbohydrate groups, secondary amines, and amide bonds. Herein, we have created nonhydroxylated models to these structures by polymerizing oxylate, succinate, or adipate groups with pentaethylenehexamine. The resulting polymers (named O4, S4, and A4, respectively) were created to understand how the absence of hydroxyl groups and changes in the amide bond spacing affect polymer degradation, plasmid DNA (pDNA) complexation, toxicity, and transfection efficiency in vitro. An additional model was also created that retains a galactaramide unit, but we have replaced the secondary amines with ethyleneoxide units (GO2) to understand the effects of the amine groups on polymer degradation. We have found that the secondary amines and hydroxyls are necessary to facilitate rapid degradation of these polymers, and analogues lacking hydroxyls or amines did not degrade over the time course of the study. Through electron-withdrawing and hydrogen bonding, the hydroxyls appear to activate the carbonyls of the amide bond to hydrolysis via an inductive electron withdrawing effect. Through titration experiments, PGAA degradation appears not to affect the polymer buffering capacity. Furthermore, we have found that PGAA degradation may enhance gene expression by releasing pDNA from polyplexes (polymer-pDNA complexes) and, thus, exposing it to undergo transcription and translation. The difference in the optimal pH that promotes degradation of the PGAAs and the hydroxyl-free analogues may prove to be a useful means to achieve pH-regulated DNA release from polyplexes by specifically modulating the chemical structures. PMID:20058913

  9. Evidence for two groups of banana bunchy top virus isolates

    Microsoft Academic Search

    Mirko Karan; Robert M. Harding; James L. Dale

    1994-01-01

    Banana bunchy top virus (BBTV) DNA component 1 from isolates from 10 different countries was cloned and sequenced and the sequences were aligned and com- pared. This analysis indicated two groups: the South Pacific group (isolates from Australia, Burundi, Egypt, Fiji, India, Tonga and Western Samoa) and the Asian group (isolates from the Philippines, Taiwan and Vietnam). The mean sequence

  10. Forensic DNA Fingerprinting

    NSDL National Science Digital Library

    CLIMB: Cornell's Learning Initiative in Medicine and Bioengineering

    In this module, developed as part of Cornell's Learning Initiative in Medicine and Bioengineering (CLIMB), students will understand the process of synthetic DNA replication by polymerase chain reaction. They will also understand agarose gel electrophoresis and the capability to separate DNA according to its size. This module contains a teacher's guide, laboratory activity, and student worksheets for the laboratory. CLIMB is part of the NSF GK-12 program.

  11. DNA-based Nanosystems

    Microsoft Academic Search

    Satoshi Murata; Milan N. Stojanovic

    2008-01-01

    DNA-based nanosystems have emerged as an interdisciplinary field that draws on computer science, biochemistry, material science,\\u000a and engineering. Although the field is still in its infancy, fundamental methodologies to build up large-scale complex nanosystems\\u000a have been already established. In this paper, we review several recent topics in the DNA-based nanosystems, as they were presented\\u000a on Kavli Japanese-American Frontier of Science

  12. Ancient DNA Damage

    PubMed Central

    Dabney, Jesse; Meyer, Matthias; Pääbo, Svante

    2013-01-01

    Under favorable conditions DNA can survive for thousands of years in the remains of dead organisms. The DNA extracted from such remains is invariably degraded to a small average size by processes that at least partly involve depurination. It also contains large amounts of deaminated cytosine residues that are accumulated toward the ends of the molecules, as well as several other lesions that are less well characterized. PMID:23729639

  13. Technology evaluation: naked DNA.

    PubMed

    Ilan, Y

    1999-02-01

    Vical and Merck are investigating vaccines against hepatitis B which use Vical's patented naked DNA technology. Both therapeutic and prophylactic vaccines are under development [177132], [268397]. The technology, and subsequent collaboration, stems from the observation by Vical that by directly injecting exogenous cDNA into muscle tissue, protein is expressed which gives rise to a strong immune response and protective immunity [163222]. PMID:11249676

  14. Defects of mitochondrial DNA replication.

    PubMed

    Copeland, William C

    2014-09-01

    Mitochondrial DNA is replicated by DNA polymerase ? in concert with accessory proteins such as the mitochondrial DNA helicase, single-stranded DNA binding protein, topoisomerase, and initiating factors. Defects in mitochondrial DNA replication or nucleotide metabolism can cause mitochondrial genetic diseases due to mitochondrial DNA deletions, point mutations, or depletion, which ultimately cause loss of oxidative phosphorylation. These genetic diseases include mitochondrial DNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mitochondrial DNA deletion disorders, such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. This review focuses on our current knowledge of genetic defects of mitochondrial DNA replication (POLG, POLG2, C10orf2, and MGME1) that cause instability of mitochondrial DNA and mitochondrial disease. PMID:24985751

  15. DNA bending facilitates the error-free DNA damage tolerance pathway and upholds genome integrity.

    PubMed

    Gonzalez-Huici, Victor; Szakal, Barnabas; Urulangodi, Madhusoodanan; Psakhye, Ivan; Castellucci, Federica; Menolfi, Demis; Rajakumara, Eerappa; Fumasoni, Marco; Bermejo, Rodrigo; Jentsch, Stefan; Branzei, Dana

    2014-02-18

    DNA replication is sensitive to damage in the template. To bypass lesions and complete replication, cells activate recombination-mediated (error-free) and translesion synthesis-mediated (error-prone) DNA damage tolerance pathways. Crucial for error-free DNA damage tolerance is template switching, which depends on the formation and resolution of damage-bypass intermediates consisting of sister chromatid junctions. Here we show that a chromatin architectural pathway involving the high mobility group box protein Hmo1 channels replication-associated lesions into the error-free DNA damage tolerance pathway mediated by Rad5 and PCNA polyubiquitylation, while preventing mutagenic bypass and toxic recombination. In the process of template switching, Hmo1 also promotes sister chromatid junction formation predominantly during replication. Its C-terminal tail, implicated in chromatin bending, facilitates the formation of catenations/hemicatenations and mediates the roles of Hmo1 in DNA damage tolerance pathway choice and sister chromatid junction formation. Together, the results suggest that replication-associated topological changes involving the molecular DNA bender, Hmo1, set the stage for dedicated repair reactions that limit errors during replication and impact on genome stability. PMID:24473148

  16. Defects in mitochondrial DNA replication and oxidative damage in muscle of mtDNA mutator mice.

    PubMed

    Kolesar, Jill E; Safdar, Adeel; Abadi, Arkan; MacNeil, Lauren G; Crane, Justin D; Tarnopolsky, Mark A; Kaufman, Brett A

    2014-10-01

    A causal role for mitochondrial dysfunction in mammalian aging is supported by recent studies of the mtDNA mutator mouse ("PolG" mouse), which harbors a defect in the proofreading-exonuclease activity of mitochondrial DNA polymerase gamma. These mice exhibit accelerated aging phenotypes characteristic of human aging, including systemic mitochondrial dysfunction, exercise intolerance, alopecia and graying of hair, curvature of the spine, and premature mortality. While mitochondrial dysfunction has been shown to cause increased oxidative stress in many systems, several groups have suggested that PolG mutator mice show no markers of oxidative damage. These mice have been presented as proof that mitochondrial dysfunction is sufficient to accelerate aging without oxidative stress. In this study, by normalizing to mitochondrial content in enriched fractions we detected increased oxidative modification of protein and DNA in PolG skeletal muscle mitochondria. We separately developed novel methods that allow simultaneous direct measurement of mtDNA replication defects and oxidative damage. Using this approach, we find evidence that suggests PolG muscle mtDNA is indeed oxidatively damaged. We also observed a significant decrease in antioxidants and expression of mitochondrial biogenesis pathway components and DNA repair enzymes in these mice, indicating an association of maladaptive gene expression with the phenotypes observed in PolG mice. Together, these findings demonstrate the presence of oxidative damage associated with the premature aging-like phenotypes induced by mitochondrial dysfunction. PMID:25106705

  17. Measurement of chromosomal aberrations, sister chromatid exchange, hprt mutations, and DNA adducts in peripheral lymphocytes of human populations at increased risk for cancer

    Microsoft Academic Search

    D. Jacobson-Kram; R. J. Albertini; R. F. Branda

    1993-01-01

    We have measured various indicators of DNA damage in peripheral lymphocytes of human populations potentially at increased risk for cancer. Sister chromatid exchanges (SCE) and polycyclic aromatic hydrocarbon (PAH)-DNA adducts were evaluated in a group of firefighters; chromosomal aberrations and hprt mutations were evaluated in a group of cancer patients undergoing radioimmunoglobulin therapy (RIT); SCE and acrolein-modified DNA were measured

  18. Electrically controlled DNA adhesion

    NASA Astrophysics Data System (ADS)

    Erdmann, Matthias; David, Ralf; Fornof, Ann; Gaub, Hermann E.

    2010-02-01

    The ability to control the interaction of polyelectrolytes, such as DNA or proteins, with charged surfaces is of pivotal importance for a multitude of biotechnological applications. Previously, we measured the desorption forces of single polymers on charged surfaces using an atomic force microscope. Here, we show that the adhesion of DNA on gold electrodes modified with self-assembled monolayers can be biased by the composition of the monolayer and externally controlled by means of the electrode potential. Positive potentials induced DNA adsorption onto OH-terminated electrodes with adhesion forces up to 25 pN (at +0.5 V versus Ag/AgCl), whereas negative potentials suppressed DNA adsorption. The measured contributions of the DNA backbone phosphate charges and the doubly charged terminal phosphate on adsorption agreed with a model based on the Gouy-Chapman theory. Experiments on an NH2-terminated electrode revealed a similar force modulation range of the coulomb component of the desorption force. These findings are important for the development of new DNA-based biochips or supramolecular structures.

  19. DNA methylation and differentiation.

    PubMed Central

    Michalowsky, L A; Jones, P A

    1989-01-01

    The methylation of specific cytosine residues in DNA has been implicated in regulating gene expression and facilitating functional specialization of cellular phenotypes. Generally, the demethylation of certain CpG sites correlates with transcriptional activation of genes. 5-Azacytidine is an inhibitor of DNA methylation and has been widely used as a potent activator of suppressed genetic information. Treatment of cells with 5-azacytidine results in profound phenotypic alterations. The drug-induced hypomethylation of DNA apparently perturbs DNA-protein interactions that may consequently alter transcriptional activity and cell determination. The inhibitory effect of cytosine methylation may be exerted via altered DNA-protein interactions specifically or may be transduced by a change in the conformation of chromatin. Recent studies have demonstrated that cytosine methylation also plays a central role in parental imprinting, which in turn determines the differential expression of maternal and paternal genomes during embryogenesis. In other words, methylation is the mechanism whereby the embryo retains memory of the gametic origin of each component of genetic information. A memory of this type would probably persist during DNA replication and cell division as methylation patterns are stable and heritable. PMID:2466640

  20. DNA biosensors that reason.

    PubMed

    Sainz de Murieta, Iñaki; Rodríguez-Patón, Alfonso

    2012-08-01

    Despite the many designs of devices operating with the DNA strand displacement, surprisingly none is explicitly devoted to the implementation of logical deductions. The present article introduces a new model of biosensor device that uses nucleic acid strands to encode simple rules such as "IF DNA_strand(1) is present THEN disease(A)" or "IF DNA_strand(1) AND DNA_strand(2) are present THEN disease(B)". Taking advantage of the strand displacement operation, our model makes these simple rules interact with input signals (either DNA or any type of RNA) to generate an output signal (in the form of nucleotide strands). This output signal represents a diagnosis, which either can be measured using FRET techniques, cascaded as the input of another logical deduction with different rules, or even be a drug that is administered in response to a set of symptoms. The encoding introduces an implicit error cancellation mechanism, which increases the system scalability enabling longer inference cascades with a bounded and controllable signal-noise relation. It also allows the same rule to be used in forward inference or backward inference, providing the option of validly outputting negated propositions (e.g. "diagnosis A excluded"). The models presented in this paper can be used to implement smart logical DNA devices that perform genetic diagnosis in vitro. PMID:22406690

  1. DNA methylation and differentiation

    SciTech Connect

    Michalowky, L.A.; Jones, P.A. (USC Cancer Center, Los Angeles, CA (USA))

    1989-03-01

    The methylation of specific cytosine residues in DNA has been implicated in regulating gene expression and facilitating functional specialization of cellular phenotypes. Generally, the demethylation of certain CpG sites correlates with transcriptional activation of genes. 5-Azacytidine is an inhibitor of DNA methylation and has been widely used as a potent activator of suppressed genetic information. Treatment of cells with 5-azacytidine results in profound phenotypic alterations. The drug-induced hypomethylation of DNA apparently perturbs DNA-protein interactions that may consequently alter transcriptional activity and cell determination. The inhibitory effect of cytosine methylation may be exerted via altered DNA-protein interactions specifically or may be transduced by a change in the conformation of chromatin. Recent studies have demonstrated that cytosine methylation also plays a central role in parental imprinting, which in turn determines the differential expression of maternal and paternal genomes during embryogenesis. In other words, methylation is the mechanism whereby the embryo retains memory of the gametic origin of each component of genetic information. A memory of this type would probably persist during DNA replication and cell division as methylation patterns are stable and heritable.

  2. Detection of human cytomegalovirus DNA: how, when and where?

    PubMed

    Gerna, G; Baldanti, F; Zella, D; Furione, M

    1995-01-01

    Although several methods have been utilized for the detection and quantification of human cytomegalovirus (HCMV) DNA, all of them can be divided into three groups: (i) detection of HCMV DNA directly in tissues by in situ hybridization or in situ polymerase chain reaction (PCR); (ii) detection of HCMV DNA in cell or tissue lysates by hybridization with DNA or RNA probes differently labelled-labels were progressively modified in order to provide an increasing sensitivity (hybridization products were revealed by radioactive, colorimetric or chemiluminescent procedures); (iii) detection of HCMV DNA in cell or tissue lysates by qualitative (single-step and nested) and quantitative (semiquantitative, competitive or noncompetitive) PCR. The selection of the methods to be employed depends primarily on the clinical situation which must be evaluated. Clinical samples for HCMV genome detection must vary accordingly. PMID:8668932

  3. Highly sensitive DNA sensor based on polypyrrole nanowire

    NASA Astrophysics Data System (ADS)

    Mai, Anh Tuan; Duc, Thanh Pham; Thi, Xuan Chu; Nguyen, Minh Hieu; Nguyen, Hoang Hai

    2014-08-01

    This paper describes the development of a DNA sensor based on polypyrrole nanowire. By using potentiostatic technique, in the presence of gelatin as the soft mold, the polypyrrole nanowires were synthesized on the surface of the micro-sensor. The surface enhanced Raman spectroscopy shows that the Nsbnd H ends of the polypyrrole nanowires orientate upward from the surface facilitating the DNA probe immobilization through the simple linkage with the phosphate groups of the probe DNA. The label-free signal readout was carried out by lock-in amplifier technique. The response time of the DNA sensor is 10 s and the measurement time was 5 min. The lowest detectable concentration of Escherichia coli DNA was 0.1 nM.

  4. Topographical distribution of 5-methylcytosine in animal and plant DNA.

    PubMed Central

    Naveh-Many, T; Cedar, H

    1982-01-01

    The topographical distribution of 5-methylcytosine on animal and plant cell DNA has been examined with methyl-sensitive restriction enzymes and gel electrophoresis analysis. These DNAs digested with the enzyme HpaII have a partially bimodal size distribution, indicating the existence of clusters of methylated and unmethylated CCGG sites in the DNA. By analyzing the methylation state of all CG moieties in restricted DNA fractions, it was possible to show that these genomes are, in general, arranged as clusters of relatively highly methylated and undermethylated regions. Plant DNA also contains 5-methylcytosine in the prototype sequence C-X-G. Restriction of this DNA with EcoRII revealed that these methyl groups are also distributed in clusters, suggesting that this is a general phenomenon. The undermethylated areas may correspond to the active fraction of the genome. PMID:6927792

  5. Forensic DNA Profiling and Database

    PubMed Central

    Panneerchelvam, S.; Norazmi, M.N.

    2003-01-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection. PMID:23386793

  6. How Proteins Slide on DNA

    Microsoft Academic Search

    Daniel Barsky; Ted A. Laurence; ?eslovas Venclovas

    \\u000a Protein–DNA interactions are required for all the major functions of DNA: ­transcription and regulation, replication and repair,\\u000a even the packaging of DNA into chromosomes. Not only are protein–DNA interactions crucial for all these cellular activities,\\u000a but they are also, in our view, among the most fascinating macromolecular­ interactions because of their dynamics. In this\\u000a chapter, we focus on DNA sliding

  7. Thermal cycle dideoxy DNA sequencing

    Microsoft Academic Search

    Barton E. Slatko

    1996-01-01

    Thermal cycle dideoxy DNA sequencing eliminates the requirements for independent primer annealing and double-stranded DNA\\u000a denaturation steps. The method enables sequencing from nanogram amounts of DNA from double-stranded and single-stranded PCR\\u000a products, and plasmid or phage DNA templates. Thermal cycle sequencing also enables direct sequencing from bacterial colonies\\u000a or phage plaques. Protocols using the Vent exo? DNA polymerase, helpful suggestions,

  8. Lymphocyte DNA damage in Turkish asphalt workers detected by the comet assay.

    PubMed

    Bacaksiz, Aysegul; Kayaalti, Zeliha; Soylemez, Esma; Tutkun, Engin; Soylemezoglu, Tulin

    2014-01-01

    Asphalt has a highly complex structure and it contains several organic compounds including polycyclic aromatic hydrocarbons and heterocyclic compounds. In this study, comet assay was used to detect the DNA damage in blood lymphocytes of 30 workers exposed to asphalt fumes and 30 nonexposed controls. This is the first report on Turkish asphalt workers' investigated DNA damage using the alkaline single cell gel electrophoresis (SCGE). The DNA damage was evaluated by the percentage of DNA in the comet tail (% tail DNA) for each cell. According to our results, workers exposed to asphalt fumes had higher DNA damage than the control group (p?DNA damage and the comet assay is a suitable method for determining DNA damage in asphalt workers. PMID:23638654

  9. Repeated DNA sequences and kangaroo phylogeny.

    PubMed

    Peacock, W J; Dennis, E S; Elizur, A; Calaby, J H

    1981-01-01

    Three highly repeated DNA sequences have been used to determine relationships of species within the Macropodidae (kangaroos and wallabies). Two highly repeated DNA sequences were isolated as buoyant density satellites in the red-necked wallaby and in the wallaroo-euro group. The third probe was a cloned representative of one class of highly repeated species from the red kangaroo. Radioactively labelled probes of these three repeated sequences were used to determine the incidence and distribution of each in number of macropodid species. The results were consistent with a monophyletic origin of the macropodid species and showed in particular, that the red-necked wallaby is closely related to the red kangaroo and to the euro-wallaroo group. In addition, the data indicated that the tammar and the agile wallaby were closely related. The results also favour the current taxonomic status of the eastern and western grey kangaroos as closely related but separate species. PMID:7295212

  10. Intermediate DNA at low added salt: DNA bubbles slow the diffusion of short DNA fragments

    E-print Network

    Tomislav Vuletic; Sanja Dolanski Babic; Ticijana Ban; Joachim Raedler; Francoise Livolant; Silvia Tomic

    2011-01-05

    We report a study of DNA (150 bp fragments) conformations in very low added salt $DNA concentration range $0.0015\\leq c \\leq 8$~mM (bp). We found an intermediate DNA conformation in the region $0.05 DNA has the diffusion coefficient, $D_p$ reduced below the values for both ssDNA coils and native dsDNA helices of similar polymerization degree $N$. Thus, this DNA population can not be a simple mix of dsDNA and of ssDNA which results from DNA melting. Here, melting occurs due to a reduction in screening concomitant with DNA concentration being reduced, in already very low salt conditions. The intermediate DNA is rationalized through the well known concept of fluctuational openings (DNA bubbles) which we postulate to form in AT-rich portions of the sequence, without the strands coming apart. Within the bubbles, DNA is locally stretched, while the whole molecule remains rod-like due to very low salt environment. Therefore, such intermediate DNA is elongated, in comparison to dsDNA, which accounts for its reduced $D_p$.

  11. Supramolecular Complexes of DNA

    NASA Astrophysics Data System (ADS)

    Zuber, G.; Scherman, D.

    Deoxyribose nucleic acid or DNA is a linear polymer in the form of a double strand, synthesised by sequential polymerisation of a large number of units chosen from among the nucleic bases called purines (adenosine A and guanosine G) and pyrimidines (cytosine C and thymidine T). DNA contains all the genetic information required for life. It exists in the form of a limited number (a few dozen) of very big molecules, called chromosomes. This genetic information is first of all transcribed. In this process, a restricted fragment of the DNA called a gene is copied in the form of ribonucleic acid, or RNA. This RNA is itself a polymer, but with a single strand in which the sequence of nucleic acids is schematically analogous to the sequence on one of the two strands of the transcribed DNA. Finally, this RNA is translated into a protein, yet another linear polymer. The proteins make up the main part of the active constituents ensuring the survival of the cell. Any loss of information, either by mutation or by deletion of the DNA, will cause an imbalance in the cell's metabolism that may in turn lead to incurable pathologies. Several strategies have been developed to reduce the consequences of such genetic deficiencies or, more generally, to act, by amplifying or suppressing them, on the mechanisms leading from the reading of the genetic information to the production of proteins: Strategies aiming to introduce synthetic DNA or RNA, which selectively block the expression of certain genes, are now being studied by an increasing number of research scientists and pharmacologists. They use antisense oligodeoxyribonucleotides or interfering oligoribonucleotides and they already have clinical applications. This kind of therapy is often called gene pharmacology. Other, more ambitious strategies aim to repair in situ mutated or incomplete DNA within the chromosomes themselves, by introducing short sequences of DNA or RNA which recognise and take the place of mutations. This is the underlying principle of genetic correction. Yet other strategies aim to reintroduce the deficient DNA fragments into the cells in the form of genes. Indeed, in certain diseases, the only solution is to bring genetic information back into the cells by transferring exogeneous DNA into the cell nucleus. This approach goes by the name of gene therapy.

  12. DNA Hybridization in Solution for Mutation Detection

    Microsoft Academic Search

    ANTON A. BUZDIN

    This group of methods is aimed at the identification of single nucleotide-scale differences between the comparing DNA samples.\\u000a Mutation and polymorphism detection is of increasing importance in the field of molecular genetics because the study of mutations\\u000a reveals the normal functions of genes, proteins, noncoding RNAs, the causes of many malignancies, and the variability of responses\\u000a among individuals. A plethora

  13. Calibration of mitochondrial DNA evolution in geese

    Microsoft Academic Search

    Gerald F. Shields; Allan C. Wilson

    1987-01-01

    Summary Mitochondrial DNA was purified from five American species of geese representing the generaAnser andBranta, which have fossil records. The results of electrophoretic comparisons of about 75 fragments per individual produced by 14 restriction enzymes imply that the mean extent of sequence divergence between species ofAnser andBranta is about 9%. Fossil evidence suggests that these two groups of geese had

  14. DNA Damage Response: Three Levels of DNA Repair Regulation

    PubMed Central

    Sirbu, Bianca M.; Cortez, David

    2013-01-01

    Genome integrity is challenged by DNA damage from both endogenous and environmental sources. This damage must be repaired to allow both RNA and DNA polymerases to accurately read and duplicate the information in the genome. Multiple repair enzymes scan the DNA for problems, remove the offending damage, and restore the DNA duplex. These repair mechanisms are regulated by DNA damage response kinases including DNA-PKcs, ATM, and ATR that are activated at DNA lesions. These kinases improve the efficiency of DNA repair by directly phosphorylating repair proteins to modify their activities, by initiating a complex series of changes in the local chromatin structure near the damage site, and by altering the overall cellular environment to make it more conducive to repair. In this review, we focus on these three levels of regulation to illustrate how the DNA damage kinases promote efficient repair to maintain genome integrity and prevent disease. PMID:23813586

  15. Strandwise translocation of a DNA glycosylase on undamaged DNA

    SciTech Connect

    Qi, Yan; Nam, Kwangho; Spong, Marie C.; Banerjee, Anirban; Sung, Rou-Jia; Zhang, Michael; Karplus, Martin; Verdine, Gregory L. (Harvard)

    2012-05-14

    Base excision repair of genotoxic nucleobase lesions in the genome is critically dependent upon the ability of DNA glycosylases to locate rare sites of damage embedded in a vast excess of undamaged DNA, using only thermal energy to fuel the search process. Considerable interest surrounds the question of how DNA glycosylases translocate efficiently along DNA while maintaining their vigilance for target damaged sites. Here, we report the observation of strandwise translocation of 8-oxoguanine DNA glycosylase, MutM, along undamaged DNA. In these complexes, the protein is observed to translocate by one nucleotide on one strand while remaining untranslocated on the complementary strand. We further report that alterations of single base-pairs or a single amino acid substitution (R112A) can induce strandwise translocation. Molecular dynamics simulations confirm that MutM can translocate along DNA in a strandwise fashion. These observations reveal a previously unobserved mode of movement for a DNA-binding protein along the surface of DNA.

  16. cDNA selection: efficient PCR approach for the selection of cDNAs encoded in large chromosomal DNA fragments.

    PubMed Central

    Parimoo, S; Patanjali, S R; Shukla, H; Chaplin, D D; Weissman, S M

    1991-01-01

    Identification of coding segments in large fragments of genomic DNA is a recurrent problem in genome mapping and positional cloning studies. We have developed a rapid and efficient protocol to achieve this goal, based on hybridization of cDNA fragments to immobilized DNA and recovery of the selected cDNAs by the PCR. The procedure permits rapid cloning of cDNA fragments encoded by large genomic DNA fragments, groups of yeast artificial chromosomes, or cosmids and has the potential to directly enrich cDNAs encoded in chromosome segments. By this approach we have been able to identify several non-major histocompatibility complex class I clones from a yeast artificial chromosome that includes the HLA-A locus. Images PMID:1946377

  17. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

  18. Removal of DNA curving by DNA ligands: gel electrophoresis study.

    PubMed

    Barcelo, F; Muzard, G; Mendoza, R; Révet, B; Roques, B P; Le Pecq, J B

    1991-05-21

    The removal of inherent curving in Crithidia fasciculata kinetoplast DNA by various small DNA ligands, groove binders and mono- and bisintercalators, has been studied by gel retardation and electron microscopy. The migration of the kinetoplast DNA fragment is highly retarded during gel electrophoresis. We demonstrate that this retardation is suppressed by DNA ligands such as distamycin and ditercalinium, which have different modes of binding and sequence specificities. Observation by electron microscopy confirms that the effect of ditercalinium on gel migration of curved DNA is linked to DNA uncurving. As the drug is progressively added to DNA, a large broadening of the retarded band is observed during gel electrophoresis for distamycin and ditercalinium. In the case of distamycin, the retarded DNA band splits into two broad bands, whereas the noncurved DNA bands remain homogeneous. This indicates that the drug-DNA exchange is extremely slow in the gel and that a limited number of specific sites on DNA are critical for the removal of bending. GC-specific quinomycin, monointercalators, and bisintercalators act in a manner similar to that of AT-specific distamycin. This indicates that direct drug binding at the dAn tracts is not required for DNA uncurving. We propose that the uncurving of kinetoplast DNA by drugs is caused by a global alteration of DNA structure; subsequent increased flexibility leads to the suppression of rigid bending at the AT tract junctions. PMID:1645181

  19. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    SciTech Connect

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-05

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone.

  20. Detection of DNA hybridization on indium tin oxide surfaces

    Microsoft Academic Search

    Selina Moses; Scott H. Brewer; Stephan Kraemer; Ryan R. Fuierer; Lisa B. Lowe; Chiamaka Agbasi; Marc Sauthier; Stefan Franzen

    2007-01-01

    Indium tin oxide (ITO) surfaces were modified with ssDNA by coupling oligonucleotides to a monolayer of 12-phosphonododecanoic acid (12-PDA) on ITO surfaces. This coupling involved the formation of an amide bond between the carboxylic acid moiety of 12-PDA to the amine group of a 5?-aminopropyl-labeled single strand of DNA. The self-assembled monolayer of 12-PDA and surface-attached oligonucleotides were characterized by

  1. Native American mtDNA prehistory in the American Southwest

    Microsoft Academic Search

    Ripan S. Malhi; Holly M. Mortensen; Jason A. Eshleman; Brian M. Kemp; Joseph G. Lorenz; Frederika A. Kaestle; John R. Johnson; Clara Gorodezky; David Glenn Smith

    2003-01-01

    This study examines the mtDNA diver- sity of the proposed descendants of the multiethnic Ho- hokam and Anasazi cultural traditions, as well as Uto- Aztecan and Southern-Athapaskan groups, to investigate hypothesized migrations associated with the Southwest region. The mtDNA haplogroups of 117 Native Americans from southwestern North America were determined. The hypervariable segment I (HVSI) portion of the control region

  2. Molecular Cloning and Protein Structure of a Human Blood Group Rh Polypeptide

    Microsoft Academic Search

    Baya Cherif-Zahar; Christian Bloy; Caroline Le van Kim; Dominique Blanchard; Pascal Bailly; Patricia Hermand; Charles Salmon; Jean-Pierre Cartron; Yves Colin

    1990-01-01

    cDNA clones encoding a human blood group Rh polypeptide were isolated from a human bone marrow cDNA library by using a polymerase chain reaction-amplified DNA fragment encoding the known common N-terminal region of the Rh proteins. The entire primary structure of the Rh polypeptide has been deduced from the nucleotide sequence of a 1384-base-pair-long cDNA clone. Translation of the open

  3. Gallus gallus aggrecan gene-based phylogenetic analysis of selected avian taxonomic groups

    Microsoft Academic Search

    Edward J. Smith; Li Shi; Zhijian Tu

    2005-01-01

    Mitochondrial DNA (mtDNA) sequences remain the most widely used for phylogenetic analysis in birds. A major limitation of mtDNA sequences, however, is that mitochondria genes are inherited as a single linkage group. Here we describe the use of a 540-bp DNA sequence corresponding to the G3 domain of Gallus gallus nuclear aggrecan gene (AGC1) for phylogenetic analysis of the main

  4. Interactions of the Escherichia coli DnaB–DnaC Protein Complex with Nucleotide Cofactors. 1. Allosteric Conformational Transitions of the Complex†

    PubMed Central

    Roychowdhury, Anasuya; Szymanski, Michal R.; Jezewska, Maria J.; Bujalowski, Wlodzimierz

    2011-01-01

    Interactions of nucleotide cofactors with both protein components of the Escherichia coli DnaB helicase complex with the replication factor, the DnaC protein, have been examined using MANT-nucleotide analogues. At saturation, in all examined stationary complexes, including the binary, DnaB–DnaC, and tertiary, DnaB–DnaC–ssDNA, complexes, the helicase binds six cofactor molecules. Thus, protein–protein and protein–DNA interactions do not affect the maximum stoichiometry of the helicase–nucleotide interactions. The single-stranded DNA dramatically increases the ATP analogue affinity, while it has little effect on the affinity of the NDP analogues, indicating that stationary complexes reflect allosteric interactions between the DNA- and NTP-binding site prior to the cofactor hydrolysis step and subsequent to product release. In the binary complex, the DnaC protein diminishes the intrinsic affinity and increases the negative cooperativity in the cofactor binding to the helicase; an opposite effect of the protein on the cofactor–helicase interactions occurs in the tertiary complex. The DnaC protein retains its nucleotide binding capability in the binary and tertiary complexes with the helicase. Surprisingly, the DnaC protein–nucleotide interactions, in the binary and tertiary complexes, are characterized by positive cooperativity. The DnaC assembles on the helicase as a hexamer, which exists in two conformational states and undergoes an allosteric transition, induced by the cofactor. Cooperativity of the allosteric transition depends on the structure of the phosphate group of the nucleotide. The significance of the results for the DnaB–DnaC complex activities is discussed. PMID:19569622

  5. Bacterial Species Determination from DNA-DNA Hybridization by Using Genome Fragments and DNA Microarrays

    Microsoft Academic Search

    JAE-CHANG CHO; JAMES M. TIEDJE

    2001-01-01

    Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments

  6. Introducing foreign DNA into tiger shrimp (Penaeus monodon) by electroporation.

    PubMed

    Tseng, F S; Tsai, H J; Liao, I C; Song, Y L

    2000-12-01

    Electroporation was used to introduce pFLAG-CMV-1-BAP, a DNA fragment that includes a bacterial alkaline phosphatase gene driven by a human cytomegalovirus (CMV) promoter, into Penaeus monodon zygotes. The transgenic tiger shrimp was achievedby using 10kV, 28 pulses, 120 g sec pulse time, 10 cycles, and a DNA concentration of 37.5 microg/mL. The hatching rate of electroporated zygotes (46%) was significantly lower than that of zygotes in the untreated group (89%). The survival rate of postlarvae in the electroporated group using a DNA concentration of 37.5 microg/mL decreased from 0.6% for postlarva 45 to 0.4% for postlarva 120. Based on dot blot analysis, the rate of gene transfer was 37% in mysis-stage, 23% postlarva 15(PL15), 19% postlarva 45(PL45), and 21% 4-month-old (about PL120). Genomic Southern blotting demonstrated that DNA from transgenic tiger shrimp contained fragments of exogenous DNA that were smaller, larger and of the same molecular size as pFLAG-CMV-1-BAP. Transferred DNA fragments were integrated into the genomes of 31% of the transgenic tiger shrimp. The exogenous DNA was mosaically distributed in a wide variety of tissues. Immunohistochemical staining revealed that the FLAG-BAP fused-protein encoded by pFLAG-CMV-1-BAP was present in the ovaries of some transgenic tiger shrimp. PMID:11191866

  7. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage.

    PubMed

    Coughlan, Carol; Clarke, Helen; Cutting, Rachel; Saxton, Jane; Waite, Sarah; Ledger, William; Li, Tinchiu; Pacey, Allan A

    2015-01-01

    Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM). To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF) following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control) were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD) test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests. PMID:25814156

  8. Quality Assessment of Human Mitochondrial DNA Quantification: MITONAUTS, an International Multicentre Survey

    PubMed Central

    Côté, Hélène C.F.; Gerschenson, Mariana; Walker, Ulrich A.; Miro, Oscar; Garrabou, Gloria; Hammond, Emma; Villarroya, Joan; Giralt, Marta; Villarroya, Francesc; Cinque, Paola; Garcia-Arumi, Elena; Periz, Antonio L. Andreu; Pinti, Marcello; Cossarizza, Andrea

    2011-01-01

    Mitochondrial DNA quantification by qPCR is used in the context of many diseases and toxicity studies but comparison of results between laboratories is challenging. Through two multigroup distributions of DNA samples from human cell lines, the MITONAUTS group anonymously compared mtDNA/nDNA quantification across nine laboratories involved in HIV research worldwide. Eight of the nine sites showed significant correlation between them (mean raw data R2=0.664; log10-transformed data R2=0.844). Although mtDNA/nDNA values were well correlated between sites, the inter-site variability on the absolute measurements remained high with a mean (range) coefficient of variation of 71 (37–212)%. Some variability appeared cell line-specific, probably due to chromosomal alterations or pseudogenes affecting the quantification of certain genes, while within cell line variability was likely due to differences in calibration of the standard curves. The use of two mtDNA and two single copy nDNA genes with highly specific primers to quantify each genome would help address copy number variants. Our results indicate that sample shipment must be done frozen and that absolute mtDNA/nDNA ratio values cannot readily be compared between laboratories, especially if assessing cultured cell mtDNA content. However, within laboratory and relative mtDNA/nDNA comparisons between laboratories should be reliable. PMID:21303702

  9. Structural basis of replication origin recognition by the DnaA protein.

    PubMed

    Fujikawa, Norie; Kurumizaka, Hitoshi; Nureki, Osamu; Terada, Takaho; Shirouzu, Mikako; Katayama, Tsutomu; Yokoyama, Shigeyuki

    2003-04-15

    Escherichia coli DnaA binds to 9 bp sequences (DnaA boxes) in the replication origin, oriC, to form a complex initiating chromosomal DNA replication. In the present study, we determined the crystal structure of its DNA-binding domain (domain IV) complexed with a DnaA box at 2.1 A resolution. DnaA domain IV contains a helix-turn-helix motif for DNA binding. One helix and a loop of the helix- turn-helix motif are inserted into the major groove and 5 bp (3' two-thirds of the DnaA box sequence) are recognized through base-specific hydrogen bonds and van der Waals contacts with the C5-methyl groups of thymines. In the minor groove, Arg399, located in the loop adjacent to the motif, recognizes three more base pairs (5' one-third of the DnaA box sequence) by base-specific hydrogen bonds. DNA bending by approximately 28 degrees was also observed in the complex. These base-specific interactions explain how DnaA exhibits higher affinity for the strong DnaA boxes (R1, R2 and R4) than the weak DnaA boxes (R3 and M) in the replication origin. PMID:12682358

  10. Oxidized extracellular DNA as a stress signal that may modify response to anticancer therapy.

    PubMed

    Glebova, Kristina; Veiko, Natalya; Kostyuk, Svetlana; Izhevskaya, Vera; Baranova, Ancha

    2015-01-01

    An increase in the levels of oxidation is a universal feature of genomic DNA of irradiated or aged or even malignant cells. In case of apoptotic death of stressed cells, oxidized DNA can be released in circulation (cfDNA). According to the results of the studies performed in vitro by our group and other researchers, the oxidized cfDNA serves as a biomarker for a stress and a stress signal that is transmitted from the "stressed" area i.e. irradiated cells or cells with deficient anti-oxidant defenses to distant (bystander) cells. In recipient cells, oxidized DNA stimulates biosynthesis of ROS that is followed up by an increase in the number of single strand and double strand breaks (SSBs and DSBs), and activation of DNA Damage Response (DDR) pathway. Effects of oxidized DNA are considered similar to that of irradiation. It seems that downstream effects of irradiation, in part, depend on the release of oxidized DNA fragments that mediate the effects in distant cells. The responses of normal and tumor cell to oxidized DNA may differ. It seems that tumor cells are more sensitive to oxidized DNA-dependent DNA damage, while developing pronounced adaptive response. This may suggest that in chemotherapy or irradiation-treated human body, the release of oxidized DNA from dying cancer cells may give a boost to remaining malignant cells by augmenting their survival and stress resistance. Further studies of the effects of oxidized DNA in both in vitro and in vivo systems are warranted. PMID:24045040

  11. Coarse-graining DNA for simulations of DNA nanotechnology

    E-print Network

    Doye, Jonathan P K; Louis, Ard A; Romano, Flavio; Sulc, Petr; Matek, Christian; Snodin, Benedict E K; Rovigatti, Lorenzo; Schreck, John S; Harrison, Ryan M; Smith, William P J

    2013-01-01

    To simulate long time and length scale processes involving DNA it is necessary to use a coarse-grained description. Here we provide an overview of different approaches to such coarse graining, focussing on those at the nucleotide level that allow the self-assembly processes associated with DNA nanotechnology to be studied. OxDNA, our recently-developed coarse-grained DNA model, is particularly suited to this task, and has opened up this field to systematic study by simulations. We illustrate some of the range of DNA nanotechnology systems to which the model is being applied, as well as the insights it can provide into fundamental biophysical properties of DNA.

  12. Anti-idiotypic antibody against anti-DNA in sera of laboratory personnel exposed to lupus sera or nucleic acids.

    PubMed Central

    Hatfield, M; Evans, M; Suenaga, R; Hassanein, K M; Abdou, N I

    1987-01-01

    We tested for anti-DNA, anti-idiotypic, antinuclear, and lymphocytotoxic antibodies in the sera of three groups of normals: volunteers never exposed to lupus sera or nucleic acids (group I), research personnel handling nucleic acids (group II), and laboratory personnel handling lupus sera (group III). There was no significant differences among the groups with respect to levels of either single stranded or double stranded anti-DNA. Group I showed no significant differences in binding to F(ab')2 fragments of lupus anti-DNA, lupus non-anti-DNA or normal IgG. Compared to group I, groups II and III bound significantly higher to anti-DNA F(ab')2 fragments compared to non-anti-DNA F(ab')2 or normal F(ab')2 fragments. Sera from the three groups were negative for antibodies and all but one individual from group III had normal antinuclear antibody titres. These results indicate that sera of normals exposed to lupus sera or to nucleic acids contain an anti-idiotype directed against anti-DNA antibody. The possible role of these anti-idiotypes in regulating the anti-DNA antibody is discussed. PMID:3500815

  13. Towards single molecule DNA sequencing

    NASA Astrophysics Data System (ADS)

    Liu, Hao

    Single molecule DNA Sequencing technology has been a hot research topic in the recent decades because it holds the promise to sequence a human genome in a fast and affordable way, which will eventually make personalized medicine possible. Single molecule differentiation and DNA translocation control are the two main challenges in all single molecule DNA sequencing methods. In this thesis, I will first introduce DNA sequencing technology development and its application, and then explain the performance and limitation of prior art in detail. Following that, I will show a single molecule DNA base differentiation result obtained in recognition tunneling experiments. Furthermore, I will explain the assembly of a nanofluidic platform for single strand DNA translocation, which holds the promised to be integrated into a single molecule DNA sequencing instrument for DNA translocation control. Taken together, my dissertation research demonstrated the potential of using recognition tunneling techniques to serve as a general readout system for single molecule DNA sequencing application.

  14. [Analysis of mitochondrial DNA haplotypes in yakut population].

    PubMed

    Fedorova, S A; Bermisheva, M A; Villems, R; Maksimova, N R; Khusnutdinova, E K

    2003-01-01

    To study the mitochondrial gene pool structure in Yakuts, polymorphism of mtDNA hypervariable segment I (16,024-16,390) was analyzed in 191 people sampled from the indigenous population of the Sakha Republic. In total, 67 haplotypes of 14 haplogroups were detected. Most (91.6%) haplotypes belonged to haplogroups A, B, C, D, F, G, M*, and Y, which are specific for East Eurasian ethnic groups; 8.4% haplotypes represented Caucasian haplogroups H, HV1, J, T, U, and W. A high frequency of mtDNA types belonging to Asian supercluster M was peculiar for Yakuts: mtDNA types belonging to haplogroup C, D, or G and undifferentiated mtDNA types of haplogroup M (M*) accounted for 81% of all haplotypes. The highest diversity was observed for haplogroups C and D, which comprised respectively 22 (44%) and 18 (30%) haplotypes. Yakuts showed the lowest genetic diversity (H = 0.964) among all Turkic ethnic groups. Phylogenetic analysis testified to a common genetic substrate of Yakuts, Mongols, and Central Asian (Kazakh, Kyrgyz, Uigur) populations. Yakuts proved to share 21 (55.5%) mtDNA haplogroups with the Central Asian ethnic groups and Mongols. Comparisons with modern paleo-Asian populations (Chukcha, Itelmen, Koryaks) revealed three (8.9%) haplotypes common for Yakuts and Koryaks. The results of mtDNA analysis disagree with the hypothesis of an appreciable paleo-Asian contribution to the modern Yakut gene pool. PMID:12942638

  15. Assessing the effects of high methionine intake on DNA methylation.

    PubMed

    Waterland, Robert A

    2006-06-01

    Methylation of DNA occurs at cytosines within CpG (cytosine-guanine) dinucleotides and is 1 of several epigenetic mechanisms that serve to establish and maintain tissue-specific patterns of gene expression. The methyl groups transferred in mammalian DNA methylation reactions are ultimately derived from methionine. High dietary methionine intake might therefore be expected to increase DNA methylation. Because of the circular nature of the methionine cycle, however, methionine excess may actually impair DNA methylation by inhibiting remethylation of homocysteine. Although little is known regarding the effect of dietary methionine supplementation on mammalian DNA methylation, the available data suggest that methionine supplementation can induce hypermethylation of DNA in specific genomic regions. Because locus-specific DNA hypomethylation is implicated in the etiology of various cancers and developmental syndromes, clinical trials of "promethylation" dietary supplements are already under way. However, aberrant hypermethylation of DNA could be deleterious. It is therefore important to determine whether dietary supplementation with methionine can effectively support therapeutic maintenance of DNA methylation without causing excessive and potentially adverse locus-specific hypermethylation. In the viable yellow agouti (Avy) mouse, maternal diet affects the coat color distribution of offspring by perturbing the establishment of methylation at the Avy metastable epiallele. Hence, the Avy mouse can be employed as a sensitive epigenetic biosensor to assess the effects of dietary methionine supplementation on locus-specific DNA methylation. Recent developments in epigenomic approaches that survey locus-specific DNA methylation on a genome-wide scale offer broader opportunities to assess the effects of high methionine intake on mammalian epigenomes. PMID:16702343

  16. Abelian groups

    E-print Network

    Bolen, James Cordell

    1956-01-01

    s a 1-1 mapping. Also (na + ma)c' [(n + m)a]c ge (n + m)b ra nb + mb gt (na)c + (ma)o. Thus a is a homomorphism, and th1s together with the above tells us that a is an isomorphism. Hence (2) is proved, and thus the theorem, Definition 2e6 If a... as 0. But z 0 + 0 ~ 0, This tells us a is an isomorphism. Iet (Si) be any finite or infin1te set of subgroups of a group G. In this thesis, the general way that we w111 show G 1s a d. lrect sum of these subgroups will be to (l) show every element...

  17. Identification of Birds through DNA Barcodes

    PubMed Central

    2004-01-01

    Short DNA sequences from a standardized region of the genome provide a DNA barcode for identifying species. Compiling a public library of DNA barcodes linked to named specimens could provide a new master key for identifying species, one whose power will rise with increased taxon coverage and with faster, cheaper sequencing. Recent work suggests that sequence diversity in a 648-bp region of the mitochondrial gene, cytochrome c oxidase I (COI), might serve as a DNA barcode for the identification of animal species. This study tested the effectiveness of a COI barcode in discriminating bird species, one of the largest and best-studied vertebrate groups. We determined COI barcodes for 260 species of North American birds and found that distinguishing species was generally straightforward. All species had a different COI barcode(s), and the differences between closely related species were, on average, 18 times higher than the differences within species. Our results identified four probable new species of North American birds, suggesting that a global survey will lead to the recognition of many additional bird species. The finding of large COI sequence differences between, as compared to small differences within, species confirms the effectiveness of COI barcodes for the identification of bird species. This result plus those from other groups of animals imply that a standard screening threshold of sequence difference (10× average intraspecific difference) could speed the discovery of new animal species. The growing evidence for the effectiveness of DNA barcodes as a basis for species identification supports an international exercise that has recently begun to assemble a comprehensive library of COI sequences linked to named specimens. PMID:15455034

  18. Excision-amplification of mitochondrial DNA during senescence in Podospora anserina. DNA sequence analysis of three unique "plasmids".

    PubMed

    Cummings, D J; MacNeil, I A; Domenico, J; Matsuura, E T

    1985-10-20

    During senescence in the filamentous fungus Podospora anserina, specific regions of the mitochondrial genome, termed senDNA are excised, ligated and amplified. We have cloned in their entirety three such autonomously replicating plasmids, alpha, beta and epsilon senDNA. None of these plasmids displayed cross-hybridization nor did we detect any significant DNA homology by computer analysis. The complete DNA sequence of the 2.5 kb alpha, the 5.5 kb epsilon and about 3.4 kb of the 9.8 kb beta senDNA is presented (kb = 10(3) base-pairs). These sequences were analyzed for the presence of consensus sequences common to introns, and it was found that alpha senDNA has the characteristics of a group II intron, epsilon senDNA contains three group I introns, and beta senDNA did not show relevant sequences in the 3.4 kb examined. Comparison of the 5' and 3'-flanking sequences of alpha senDNA with oxi 3 (Co I) amino acid sequences from Neurospora crassa and Saccharomyces cerevisiae revealed significant homology and provided strong support that the excised alpha senDNA itself consists entirely of an intron. Upstream from the oxi 3 gene a transfer RNA cysteine sequence was detected. beta senDNA contained four tRNA sequences, aspartic acid, serine, valine and tryptophan, and sequences homologous to URFC (untranslated reading frame C) as well as two new URFs. epsilon senDNA contained sequences homologous to ATPase 8 and URFl; URFl was interrupted by three group I introns. The excision site sequences, as located by S1 nuclease mapping were unique for each senDNA. Analysis for repeated units showed that each plasmid contained elements which could be involved in secondary structure required for the alignment of distal ends preparatory to excision. These results are interpreted in terms of the structural requirements of mobile elements including the possible involvement of reverse transcriptase in the excision-ligation-amplification process. PMID:2997455

  19. DNA banking and DNA databanking by academic and commercial laboratories

    SciTech Connect

    McEwen, J.E. [Eunice Kennedy Shriver Center, Waltham, MA (United States)]|[Boston College Law School, Newton, MA (United States); Reilly, P.R. [Eunice Kennedy Shriver Center, Waltham, MA (United States)

    1994-09-01

    The advent of DNA-based testing is giving rise to DNA banking (the long-term storage of cells, transformed cell lines, or extracted DNA for subsequent retrieval and analysis) and DNA data banking (the indefinite storage of information derived from DNA analysis). Large scale acquisition and storage of DNA and DNA data has important implications for the privacy rights of individuals. A survey of 148 academically based and commercial DNA diagnostic laboratories was conducted to determine: (1) the extent of their DNA banking activities; (2) their policies and experiences regarding access to DNA samples and data; (3) the quality assurance measures they employ; and (4) whether they have written policies and/or depositor`s agreements addressing specific issues. These issues include: (1) who may have access to DNA samples and data; (2) whether scientists may have access to anonymous samples or data for research use; (3) whether they have plans to contact depositors or retest samples if improved tests for a disorder become available; (4) disposition of samples at the end of the contract period if the laboratory ceases operations, if storage fees are unpaid, or after a death or divorce; (5) the consequence of unauthorized release, loss, or accidental destruction of samples; and (6) whether depositors may share in profits from the commercialization of tests or treatments developed in part from studies of stored DNA. The results suggest that many laboratories are banking DNA, that many have already amassed a large number of samples, and that a significant number plan to further develop DNA banking as a laboratory service over the next two years. Few laboratories have developed written policies governing DNA banking, and fewer still have drafted documents that define the rights and obligations of the parties. There may be a need for increased regulation of DNA banking and DNA data banking and for better defined policies with respect to protecting individual privacy.

  20. A modification free hybridization biosensor for detection of DNA sequence based on Zr(IV) ion glue mediated the adsorption on Au–MPA SAM electrode

    Microsoft Academic Search

    Reza Karimi Shervedani; Sima Pourbeyram

    A simple method is developed for electrochemical detection of DNA sequence. The probe DNA (p-DNA) is immobilized onto Au–MPA SAM electrode modified with zirconium ion, Zr(IV). The electrochemical results imply that immobilization is performed effectively via the phosphate groups with no implication of the p-DNA bases in the immobilization stage, ensuring that the bases of the p-DNA have appropriate alignment

  1. Oxidative DNA damage in placentas from normal and pre-eclamptic pregnancies

    Microsoft Academic Search

    Henryk Wiktor; Marta Kankofer; Ivo Schmerold; Agnes Dadak; Maciej Lopucki; Hans Niedermüller

    2004-01-01

    Placental oxidative stress was suggested to play a role in the pathogenesis of pre-eclampsia (PE). In this study, levels of 8-hydroxy-2?-deoxyguanosine (8-OH-dG), a well-established marker of oxidative DNA damage, were analysed in placental cellular DNA from normal (group NP) and pre-eclamptic (group PE) pregnancies as well as from PE pregnancies complicated by intrauterine growth restriction (group PE-IUGR). Placental samples obtained

  2. DNA fingerprinting in Falconidae.

    PubMed

    Rychlík, I; Kubícek, O; Holcák, V; Bárta, J; Pavlík, I

    1994-01-01

    This paper describes the use of the oligonucleotide probe (GTG)5 to reveal high polymorphic DNA regions in falcons (Falco peregrinus, F. rusticolus, F. cherrug and their interspecies hybrids). Ten microliters of the blood samples were immobilized, lysed and digested in low-melting point agarose. Oligonucleotide probe (GTG)5 gave rise to the great number of different fragments. Some of them were genus specific, another female specific and approx. 5-10% of the fragments were individual specific. Restriction endonucleases with 4 bp recognition sequences were preferred (Hinf I, Hae III and Msp I). After the use of such enzymes the DNA fingerprints were individual specific and allowed us to confirm known relations among individual birds. The results indicate, that DNA fingerprinting with oligonucleotide (GTG)5 as a probe could be a powerful method for differentiating among closely related falcon birds. PMID:8184523

  3. Hypoxia and DNA Repair

    PubMed Central

    Glazer, Peter M.; Hegan, Denise C.; Lu, Yuhong; Czochor, Jennifer; Scanlon, Susan E.

    2013-01-01

    Hypoxia is a characteristic feature of solid tumors and occurs very early in neoplastic development. Hypoxia transforms cell physiology in multiple ways, with profound changes in cell metabolism, cell growth, susceptibility to apoptosis, induction of angiogenesis, and increased motility. Over the past 20 years, our lab has determined that hypoxia also induces genetic instability. We have conducted a large series of experiments revealing that this instability occurs through the alteration of DNA repair pathways, including nucleotide excision repair, DNA mismatch repair, and homology dependent repair. Our work suggests that hypoxia, as a key component of solid tumors, can drive cancer progression through its impact on genomic integrity. However, the acquired changes in DNA repair that are induced by hypoxia may also render hypoxic cancer cells vulnerable to tailored strategies designed to exploit these changes. PMID:24348208

  4. DNA encoding human CGRP

    SciTech Connect

    Evans, R.M.; Rosenfeld, M.G.

    1988-04-05

    This patent describes DNA encoding a precursor of human CGRP which includes a 37-codon nucleotide sequence that encodes a 37-amino acid residue CGRP peptide sequence, connected to DNA including at least the sequence CGG-CGG-AAG-AGA coding for the peptide sequence Arg-Arg-Arg-Arg-linked to the amino-terminus of the CGRP sequence peptide, and connected to DNA including at least the sequence GGC-CGC or GGC-AGG coding for a peptide segment including Gly-Arg linked to the carboxyl-terminus of the CGRP peptide sequence, the terminal peptide segments including signal segments for directing their enzymatic removal from said CGRP peptide sequence and for directing enzymatic amidation of the carboxyl-terminus of the CGRP peptide sequence.

  5. The effect of ascorbate and a-tocopherol supplementation in vitro on DNA integrity and hydrogen peroxide-induced DNA damage in human spermatozoa

    Microsoft Academic Search

    Eilish T. Donnelly; Neil McClure; Sheena E. M. Lewis

    1999-01-01

    The aim of this study was to determine the effects of supplementation with ascorbate and a-tocopherol, both singly and in combination, during sperm preparation on subsequent sperm DNA integrity, induced DNA damage and reactive oxygen species (ROS) generation. Semen samples with normozoospermic and asthenozoospermic profiles (n J 15 for each control and antioxidant group) were prepared by Percoll density centrifugation

  6. Spectroscopic study on the interaction between naphthalimide-polyamine conjugates and DNA.

    PubMed

    Tian, Zhiyong; Zhao, Zhonghua; Zang, Fenglei; Wang, Yueqiao; Wang, Chaojie

    2014-09-01

    The interaction of naphthalimide-polyamine conjugates with herring sperm DNA was studied by UV/vis absorption and fluorescent spectra under physiological conditions (pH=7.4). The observed spectral quenching of compounds by DNA and the displacement of EB from DNA-EB complex by compounds indicated that these naphthalimide-polyamine conjugates could intercalate into the DNA base pairs. The UV test also showed that these compounds caused the conformational alteration of DNA. Further caloric fluorescent tests revealed that the quenching mechanism was a static type, which Ksv of 1-DNA, 2-DNA and 1-DNA-EB, 2-DNA-EB 3-DNA-EB was 1.208×10(4), 7.792×10(3) and 1.712×10(4), 1.287×10(4), 2.874×10(4), respectively, at room temperature. The obtained quenching constant, binding constant and thermodynamic parameters suggested that binding strength was associated with substituted groups on naphthalene backbone, and the type of interaction force included mainly hydrogen bonding and weak van der Waals. The binding process was mainly driven by hydrogen bond and van der Waals. Additionally, the effect of NaCl on compounds-DNA interaction provided further evidence that their interaction modes were dependent on substituted groups. PMID:24976624

  7. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  8. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, Stanley (Cambridge, MA); Richardson, Charles (Chestnut Hill, MA)

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  9. The Structure of DNA within Cationic Lipid/DNA Complexes

    E-print Network

    Braun, Chad S.; Jas, Gouri S.; Choosakoonriang, Sirirat; Koe, Gary S.; Smith, Janet G.; Middaugh, C. Russell

    2003-02-01

    The structure of DNA within CLDCs used for gene delivery is controversial. Previous studies using CD have been interpreted to indicate that the DNA is converted from normal B to C form in complexes. This investigation reexamines this interpretation...

  10. DNA templated magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Kinsella, Joseph M.

    Recent discoveries in nanoscience are predicted to potentially revolutionize future technologies in an extensive number of fields. These developments are contingent upon discovering new and often unconventional methods to synthesize and control nanoscale components. Nature provides several examples of working nanotechnology such as the use of programmed self assembly to build and deconstruct complex molecular systems. We have adopted a method to control the one dimensional assembly of magnetic nanoparticles using DNA as a scaffold molecule. With this method we have demonstrated the ability to organize 5 nm particles into chains that stretch up to ˜20 mum in length. One advantage of using DNA compared is the ability of the molecule to interact with other biomolecules. After assembling particles onto DNA we have been able to cleave the molecule into smaller fragments using restriction enzymes. Using ligase enzymes we have re-connected these fragments, coated with either gold or iron oxide, to form long one-dimensional arrangements of the two different types of nanoparticles on a single molecular guide. We have also created a sensitive magnetic field sensor by incorporating magnetic nanoparticle coated DNA strands with microfabricated electrodes. The IV characteristics of the aligned nanoparticles are dependant on the magnitude of an externally applied magnetic field. This transport phenomenon known as tunneling magnetoresistance (TMR) shows room temperature resistance of our devices over 80% for cobalt ferrite coated DNA when a field of 20 kOe is applied. In comparison, studies using two dimensional nanoparticle films of irox oxides xii only exhibit a 35% MR effect. Confinement into one dimension using the DNA guide produces a TMR mechanism which produces significant increases in magnetoresistance. This property can be utilized for applications in magnetic field sensing, data storage, and logic elements.

  11. Maternal plasma fetal DNA fractions in pregnancies with low and high risks for fetal chromosomal aneuploidies.

    PubMed

    Hudecova, Irena; Sahota, Daljit; Heung, Macy M S; Jin, Yongjie; Lee, Wing S; Leung, Tak Y; Lo, Yuk Ming Dennis; Chiu, Rossa W K

    2014-01-01

    Recently published international guidelines recommend the clinical use of noninvasive prenatal test (NIPT) for aneuploidy screening only among pregnant women whose fetuses are deemed at high risk. The applicability of NIPT to aneuploidy screening among average risk pregnancies requires additional supportive evidence. A key determinant of the reliability of aneuploidy NIPT is the fetal DNA fraction in maternal plasma. In this report, we investigated if differences in fetal DNA fractions existed between different pregnancy risk groups. One hundred and ninety-five singleton pregnancies with male fetuses divided into 3 groups according to first trimester screening parameters were examined for fetal DNA percentage by counting Y chromosome DNA sequences using massively parallel sequencing. Fetal DNA fractions were compared between risk groups and assessed for correlations with first trimester screening parameters. There was no statistically significant difference in fetal DNA fractions across the high, intermediate and low risk groups. Fetal DNA fraction showed a strong negative correlation with maternal weight. Fetal DNA fraction also showed weak but significant correlations with gestational age, crown-rump length, multiple of medians of free ?-subunit of human chorionic gonadotropin and pregnancy-associated plasma protein A. Similar fetal DNA fractions in maternal plasma between high, intermediate and low risk pregnant women is a precondition for uniform performance of the aneuploidy NIPTs for the general population. This study thus shows that the aneuploidy screening by NIPT is likely to offer similar analytical reliability without respect to the a priori fetal aneuploidy risk. PMID:24586333

  12. Maternal Plasma Fetal DNA Fractions in Pregnancies with Low and High Risks for Fetal Chromosomal Aneuploidies

    PubMed Central

    Heung, Macy M. S.; Jin, Yongjie; Lee, Wing S.; Leung, Tak Y.; Lo, Yuk Ming Dennis; Chiu, Rossa W.K.

    2014-01-01

    Recently published international guidelines recommend the clinical use of noninvasive prenatal test (NIPT) for aneuploidy screening only among pregnant women whose fetuses are deemed at high risk. The applicability of NIPT to aneuploidy screening among average risk pregnancies requires additional supportive evidence. A key determinant of the reliability of aneuploidy NIPT is the fetal DNA fraction in maternal plasma. In this report, we investigated if differences in fetal DNA fractions existed between different pregnancy risk groups. One hundred and ninety-five singleton pregnancies with male fetuses divided into 3 groups according to first trimester screening parameters were examined for fetal DNA percentage by counting Y chromosome DNA sequences using massively parallel sequencing. Fetal DNA fractions were compared between risk groups and assessed for correlations with first trimester screening parameters. There was no statistically significant difference in fetal DNA fractions across the high, intermediate and low risk groups. Fetal DNA fraction showed a strong negative correlation with maternal weight. Fetal DNA fraction also showed weak but significant correlations with gestational age, crown-rump length, multiple of medians of free ?-subunit of human chorionic gonadotropin and pregnancy-associated plasma protein A. Similar fetal DNA fractions in maternal plasma between high, intermediate and low risk pregnant women is a precondition for uniform performance of the aneuploidy NIPTs for the general population. This study thus shows that the aneuploidy screening by NIPT is likely to offer similar analytical reliability without respect to the a priori fetal aneuploidy risk. PMID:24586333

  13. Visual detection of single-stranded target DNA using pyrroloquinoline-quinone-loaded liposomes as a tracer

    Microsoft Academic Search

    Laura B. Zimmerman; Kyung-Dall Lee; Mark E. Meyerhoff

    2010-01-01

    The preparation of DNA-tagged liposomes containing an encapsulated prosthetic group tracer, pyrroloquinoline quinone (PQQ), and their application to the development of a sandwich-type hybridization assay for the visual detection of single-stranded DNA are described. Capture DNA is conjugated to the surface of microtiter plate wells through a biotin–streptavidin interaction. Target DNA is incubated with the plate in high salt concentrations.

  14. Ecological diversification in the Bacillus cereus Group.

    PubMed

    Guinebretière, Marie-Hélène; Thompson, Fabiano L; Sorokin, Alexei; Normand, Philippe; Dawyndt, Peter; Ehling-Schulz, Monika; Svensson, Birgitta; Sanchis, Vincent; Nguyen-The, Christophe; Heyndrickx, Marc; De Vos, Paul

    2008-04-01

    The Bacillus cereus Group comprises organisms that are widely distributed in the environment and are of health and economic interest. We demonstrate an 'ecotypic' structure of populations in the B. cereus Group using (i) molecular data from Fluorescent Amplified Fragment Length Polymorphism patterns, ribosomal gene sequences, partial panC gene sequences, 'psychrotolerant' DNA sequence signatures and (ii) phenotypic and descriptive data from range of growth temperature, psychrotolerance and thermal niches. Seven major phylogenetic groups (I to VII) were thus identified, with ecological differences that provide evidence for a multiemergence of psychrotolerance in the B. cereus Group. A moderate thermotolerant group (VII) was basal to the mesophilic group I, from which in turn distinct thermal lineages have emerged, comprising two mesophilic groups (III, IV), an intermediate group (V) and two psychrotolerant groups (VI, II). This stepwise evolutionary transition toward psychrotolerance was particularly well illustrated by the relative abundance of the 'psychrotolerant' rrs signature (as defined by Pruss et al.) copies accumulated in strains that varied according to the phylogenetic group. The 'psychrotolerant' cspA signature (as defined by Francis et al.) was specific to group VI and provided a useful way to differentiate it from the psychrotolerant group II. This study illustrates how adaptation to novel environments by the modification of temperature tolerance limits has shaped historical patterns of global ecological diversification in the B. cereus Group. The implications for the taxonomy of this Group and for the human health risk are discussed. PMID:18036180

  15. Structure of DNA

    NSDL National Science Digital Library

    Access Excellence

    2005-03-12

    Illustration of the double helical structure of the DNA molecule. The structure of DNA is illustrated by a right handed double helix, with about 10 nucleotide pairs per helical turn. Each spiral strand, composed of a sugar phosphate backbone and attached bases, is connected to a complementary strand by hydrogen bonding (non- covalent) between paired bases, adenine (A) with thymine (T) and guanine (G) with cytosine (C). Adenine and thymine are connected by two hydrogen bonds (non-covalent) while guanine and cytosine are connected by three. This structure was first described by James Watson and Francis Crick in 1953.

  16. Dielectrophoretic manipulation of DNA.

    PubMed

    Hölzel, R; Bier, F F

    2003-11-01

    The characterisation and spatial manipulation of cells by AC electrokinetic methods such as dielectrophoresis and electrorotation is well established. However, applications to submicroscopical objects like viruses and molecules have been rare. Only recently has the number of such studies risen more quickly due to the availability of suitable electrodes and a growing need for single molecule techniques. Of special interest is the spatial control of single DNA molecules for genetic investigations as well as for the building of well defined structures with nanometre resolution. Here a review is given of dielectrophoretic studies dealing with single and double stranded DNA emphasising single molecule aspects. PMID:16468930

  17. [From pendulum to DNA].

    PubMed

    Iakushevich, L V

    2013-01-01

    In the review the results on the modeling of angular oscillations of the nitrous bases in short and long (in the limit - infinite) fragments of polynucleotide DNA chains are collected and systematized. The material is arranged so to represent the results of investigations in the course of development beginning from those obtained first for elementary models as the pendulum or a pair of coupled unequal pendulums, and then for more complex DNA models. The description of dynamic behavior features of all considered model systems is executed in the uniform mathematical language representing a state of model system as a point, moving along a certain trajectory in the phase space. PMID:24159808

  18. DNA vaccines against anthrax.

    PubMed

    Galloway, Darrell R; Baillie, Les

    2004-10-01

    DNA vaccination is vaccination at its simplest. Due to renewed interest in vaccination against anthrax and other biothreat agents, a genetic immunisation approach offers attractive possibilities for rapid, responsive vaccine development. DNA vaccination against anthrax is an active area of research showing promising results at present, which in the short-term and in the future could form the basis for new advances in multi-agent vaccine development. The anthrax 'model' constitutes an important experimental system for genetic immunisation technology development. PMID:15461577

  19. DNA Separation on Surfaces

    SciTech Connect

    Braiman, Avital [ORNL; Rudakov, Fedor M [ORNL; Thundat, Thomas George [ORNL

    2010-01-01

    Recent experimental work on DNA separation on surfaces reveals a power law behavior of the mobility with size. We employed a simple model that elucidates the observed power law trend. When the external electric field is barely larger than the critical value required for initiating translational motion, the mobility is approximately inversely proportional to the DNA size. At larger fields, mobility scales as N{sup -{alpha}} with 0 < {alpha} < 1, while showing oscillatory structure. Finally, at very large fields, mobility becomes size independent. Our model provides insight into separation mechanisms and presents numerical results that explain power law scaling.

  20. Diversity of Prophage DNA Regions of Streptococcus agalactiae Clonal Lineages from Adults and Neonates with Invasive Infectious Disease

    PubMed Central

    Salloum, Mazen; van der Mee-Marquet, Nathalie; Valentin-Domelier, Anne-Sophie; Quentin, Roland

    2011-01-01

    The phylogenetic position and prophage DNA content of the genomes of 142 S. agalactiae (group-B streptococcus, GBS) isolates responsible for bacteremia and meningitis in adults and neonates were studied and compared. The distribution of the invasive isolates between the various serotypes, sequence types (STs) and clonal complexes (CCs) differed significantly between adult and neonatal isolates. Use of the neighbor-net algorithm with the PHI test revealed evidence for recombination in the population studied (PHI, P?=?2.01×10?6), and the recombination-mutation ratio (R/M) was 6?7. Nevertheless, the estimated R/M ratio differed between CCs. Analysis of the prophage DNA regions of the genomes of the isolates assigned 90% of the isolates to five major prophage DNA groups: A to E. The mean number of prophage DNA fragments amplified per isolate varied from 2.6 for the isolates of prophage DNA group E to 4.0 for the isolates of prophage DNA group C. The isolates from adults and neonates with invasive diseases were distributed differently between the various prophage DNA groups (P<0.00001). Group C prophage DNA fragments were found in 52% of adult invasive isolates, whereas 74% of neonatal invasive isolates had prophage DNA fragments of groups A and B. Differences in prophage DNA content were also found between serotypes, STs and CCs (P<0.00001). All the ST-1 and CC1 isolates, mostly of serotype V, belonged to the prophage DNA group C, whereas 84% of the ST-17 and CC17 isolates, all of serotype III, belonged to prophage DNA groups A and B. These data indicate that the transduction mechanisms, i.e., gene transfer from one bacterium to another by a bacteriophage, underlying genetic recombination in S. agalactiae species, are specific to each intraspecies lineage and population of strains responsible for invasive diseases in adults and neonates. PMID:21633509

  1. RFLP-based genetic maps of wheat homoeologous group 7 chromosomes

    Microsoft Academic Search

    S. Chao; P. J. Sharp; A. J. Worland; E. J. Warham; R. M. D. Koebner; M. D. Gale

    1989-01-01

    Restriction fragment length polymorphism (RFLP) mapping was attempted using 18 cDNA clones, 14 anonymous and 4 of known function, which had been shown to have homologous DNA sequences on the group 7 chromosomes of wheat. The loci identified by these probes have been mapped on one or more chromosomes in this homoeologous group using linkage data derived from various F2,

  2. Polycitone A, a novel and potent general inhibitor of retroviral reverse transcriptases and cellular DNA polymerases.

    PubMed

    Loya, S; Rudi, A; Kashman, Y; Hizi, A

    1999-11-15

    Polycitone A, an aromatic alkaloid isolated from the ascidian Polycitor sp. exhibits potent inhibitory capacity of both RNA- and DNA-directed DNA polymerases. The drug inhibits retroviral reverse transcriptase (RT) [i.e. of human immunodeficiency virus type 1 (HIV), murine leukaemia virus (MLV) and mouse mammary tumour virus (MMTV)] as efficiently as cellular DNA polymerases (i.e. of both DNA polymerases alpha and beta and Escherichia coli DNA polymerase I). The mode and mechanism of inhibition of the DNA-polymerase activity associated with HIV-1 RT by polycitone A have been studied. The results suggest that the inhibitory capacity of the DNA polymerase activity is independent of the template-primer used. The RNase H function, on the other hand, is hardly affected by this inhibitor. Polycitone A has been shown to interfere with DNA primer extension as well as with the formation of the RT-DNA complex. Steady-state kinetic studies demonstrate that this inhibitor can be considered as an allosteric inhibitor of HIV-1 RT. The target site on the enzyme may be also spatially related to the substrate binding site, since this inhibitor behaves competitively with respect to dTTP with poly(rA).oligo(dT) as template primer. Chemical transformations of the five phenol groups of polycitone A by methoxy groups have a determinant effect on the inhibitory potency. Thus, the pentamethoxy derivative which is devoid of all hydroxy moieties, loses significantly, by 40-fold, the ability to inhibit the DNA polymerase function. Furthermore, this analogue lacks the ability to inhibit DNA primer extension as well as the formation of the RT-DNA complex. Indeed, inhibition of the first step in DNA polymerization, the formation of the RT-DNA complex, and hence, of the overall process, could serve as a model for a universal inhibitor of the superfamily of DNA polymerases. PMID:10548537

  3. Group evaporation

    NASA Technical Reports Server (NTRS)

    Shen, Hayley H.

    1991-01-01

    Liquid fuel combustion process is greatly affected by the rate of droplet evaporation. The heat and mass exchanges between gas and liquid couple the dynamics of both phases in all aspects: mass, momentum, and energy. Correct prediction of the evaporation rate is therefore a key issue in engineering design of liquid combustion devices. Current analytical tools for characterizing the behavior of these devices are based on results from a single isolated droplet. Numerous experimental studies have challenged the applicability of these results in a dense spray. To account for the droplets' interaction in a dense spray, a number of theories have been developed in the past decade. Herein, two tasks are examined. One was to study how to implement the existing theoretical results, and the other was to explore the possibility of experimental verifications. The current theoretical results of group evaporation are given for a monodispersed cluster subject to adiabatic conditions. The time evolution of the fluid mechanic and thermodynamic behavior in this cluster is derived. The results given are not in the form of a subscale model for CFD codes.

  4. Searching for DNA Lesions: Structural Evidence for Lower- and Higher-Affinity DNA Binding Conformations of Human Alkyladenine DNA Glycosylase

    E-print Network

    Drennan, Catherine L.

    To efficiently repair DNA, human alkyladenine DNA glycosylase (AAG) must search the million-fold excess of unmodified DNA bases to find a handful of DNA lesions. Such a search can be facilitated by the ability of glycosylases, ...

  5. DNA diversity of human populations from Eastern Europe and Siberia studied by multilocus DNA fingerprinting.

    PubMed

    Shabrova, E V; Khusnutdinova, E K; Tarskaia, L A; Mikulich, A I; Abolmasov, N N; Limborska, S A

    2004-04-01

    We used DNA fingerprinting with M13 phage DNA as a probe to estimate the degree of genomic variability and genetic relationships in a heterogeneous group of 13 populations from Eastern Europe and Siberia. The popultaions belong to three language families: Indo-European (Slavonic: Russians, Byelorussians), Uralic (Finno-Ugric: Maris, Mordvinians, Udmurts), and Altaic (Turkic: Bashkirs, Tatars, Chuvashes, Yakuts). Multivariate statistical analyses were used (multidimensional scaling, cluster, and multiple correspondence analyses), and coefficients of gene differentiation ( Gst') were evaluated. The level of interpopulation subdivision in the various ethnic groups appeared to be different: the Byelorussian populations revealed no regional differences, in contrast to the Bashkir populations, which formed a heterogeneous group. The populations subdivided into three general clusters: Slavonic populations formed a separate tight cluster characterized by a minimal level of interpopulation diversity, Bashkir and Yakut populations formed the second cluster, and the Finno-Ugric and several populations of the Turkic linguistic groups formed the third cluster. The robustness of these results obtained by different statistical data treatments reveals that multilocus DNA fingerprinting can be reliably used for population studies. PMID:14986107

  6. Fluorescence of DNA Duplexes: From Model Helices to Natural DNA

    E-print Network

    Paris-Sud XI, Université de

    for the understanding of the primary processes induced by UV radiation, ultimately leading to carcinogenic mutations.1Fluorescence of DNA Duplexes: From Model Helices to Natural DNA Dimitra Markovitsi,* Thomas/Saclay, 91191 Gif-sur-Yvette, France Abstract Recent fluorescence studies of DNA duplexes with simple repetitive

  7. Borrowing Nuclear DNA Helicases to Protect Mitochondrial DNA

    PubMed Central

    Ding, Lin; Liu, Yilun

    2015-01-01

    In normal cells, mitochondria are the primary organelles that generate energy, which is critical for cellular metabolism. Mitochondrial dysfunction, caused by mitochondrial DNA (mtDNA) mutations or an abnormal mtDNA copy number, is linked to a range of human diseases, including Alzheimer’s disease, premature aging? and cancer. mtDNA resides in the mitochondrial lumen, and its duplication requires the mtDNA replicative helicase, Twinkle. In addition to Twinkle, many DNA helicases, which are encoded by the nuclear genome and are crucial for nuclear genome integrity, are transported into the mitochondrion to also function in mtDNA replication and repair. To date, these helicases include RecQ-like helicase 4 (RECQ4), petite integration frequency 1 (PIF1), DNA replication helicase/nuclease 2 (DNA2) and suppressor of var1 3-like protein 1 (SUV3). Although the nuclear functions of some of these DNA helicases have been extensively studied, the regulation of their mitochondrial transport and the mechanisms by which they contribute to mtDNA synthesis and maintenance remain largely unknown. In this review, we attempt to summarize recent research progress on the role of mammalian DNA helicases in mitochondrial genome maintenance and the effects on mitochondria-associated diseases. PMID:25984607

  8. Submicron patterning of DNA oligonucleotides on silicon

    PubMed Central

    Yin, H. B.; Brown, T.; Wilkinson, J. S.; Eason, R. W.; Melvin, T.

    2004-01-01

    The covalent attachment of DNA oligonucleotides onto crystalline silicon (100) surfaces, in patterns with submicron features, in a straightforward, two-step process is presented. UV light exposure of a hydrogen-terminated silicon (100) surface coated with alkenes functionalized with N-hydroxysuccinimide ester groups resulted in the covalent attachment of the alkene as a monolayer on the surface. Submicron-scale patterning of surfaces was achieved by illumination with an interference pattern obtained by the transmission of 248 nm excimer laser light through a phase mask. The N-hydroxysuccinimide ester surface acted as a template for the subsequent covalent attachment of aminohexyl-modified DNA oligonucleotides. Oligonucleotide patterns, with feature sizes of 500 nm, were reliably produced over large areas. The patterned surfaces were characterized with atomic force microscopy, scanning electron microscopy, epifluorescence microscopy and ellipsometry. Complementary oligonucleotides were hybridized to the surface-attached oligonucleotides with a density of 7 × 1012 DNA oligonucleotides per square centimetre. The method will offer much potential for the creation of nano- and micro-scale DNA biosensor devices in silicon. PMID:15314186

  9. Interaction of zanamivir with DNA and RNA: Models for drug DNA and drug RNA bindings

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Kahangi, Fatemeh Ghoreyshi; Azizi, Ebrahim; Zebarjad, Nader; Tajmir-Riahi, Heidar-Ali

    2007-03-01

    Zanamivir (ZAN) is the first of a new generation of influenza virus-specific drugs known as neuraminidase inhibitors, which acts by interfering with life cycles of influenza viruses A and B. It prevents the virus spreading infection to other cells by blocking the neuraminidase enzyme present on the surface of the virus. The aim of this study was to examine the stability and structural features of calf thymus DNA and yeast RNA complexes with zanamivir in aqueous solution, using constant DNA or RNA concentration (12.5 mM) and various zanamivir/polynucleotide ( P) ratios of 1/20, 1/10, 1/4, and 1/2. FTIR and UV-visible spectroscopy are used to determine the drug external binding modes, the binding constant and the stability of zanamivir-DNA and RNA complexes in aqueous solution. Structural analysis showed major interaction of zanamivir with G-C (major groove) and A-T (minor groove) base pairs and minor perturbations of the backbone PO 2 group with overall binding constants of Kzanamivir-DNA = 1.30 × 10 4 M -1 and Kzanamivir-RNA = 1.38 × 10 4 M -1. The drug interaction induces a partial B to A-DNA transition, while RNA remains in A-conformation.

  10. Effect of afobazole on DNA damage in patients with systemic lupus erythematosus.

    PubMed

    Zhanataev, A K; Lisitsyna, T A; Durnev, A D; Nasonov, E L; Seredenin, S B

    2009-10-01

    Using comet assay we studied the effect of anxiolytic afobazole, exhibiting also antioxidant and antimutagenic properties, on spontaneous and ex-vivo hydrogen peroxide-induced DNA damage in blood cells from patients with systemic lupus erythematosus. Afobazole treatment (30-60 mg/day for 1 month) in addition to standard therapy decreased spontaneous level of DNA damage in blood cells. The level of ex vivo hydrogen peroxide-induced DNA damage decreased by 49% in this group of patients. The number of cells hypersensitive to hydrogen peroxide yielding DNA comets with highly damaged DNA also decreased by 51%. No significant changes in the analyzed parameters were found in the placebo group. Addition of afobazole to complex therapy of patients with systemic lupus erythematosus reduced the level of DNA damage in blood cells and improved cell resistance to oxidative genotoxic exposure. PMID:20396750

  11. Identification, mapping and linkage analysis of randomly amplified DNA polymorphisms in Tetrahymena thermophila

    SciTech Connect

    Brickner, J.H.; Lynch, T.J.; Zeilinger, D.; Orias, E. [Univ. of California, Santa Barbara, CA (United States)

    1996-06-01

    Using the random amplified polymorphic DNA (RAPD) technique and exploiting the unique genetics of Tetrahymena thermophila, we have identified and characterized 40 DNA polymorphisms occurring between two inbred strains (B and C3) of this ciliated protozoan. These RAPD markers permit the PCR amplification of a DNA species using template DNA from SB1969 (B strain) but fail to do so using DNA from C3-368-5 (C3 strain). Polymorphisms were mapped to chromosomes using a panel of monosomic strains constructed by crossing B strain-derived nullisomic strains to inbred strain C3. They map to all five chromosomes and appear to be evenly distributed throughout the genome. Chromosomal groups were then analyzed for linkage using meiotic segregants; four linkage groups were identified in chromosomes 1R, 2L, 3 and 5. The RAPD method appears useful for the construction of a genetic map of the Tetrahymena genome based on DNA polymorphisms. 37 refs., 4 figs., 6 tabs.

  12. Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA

    PubMed Central

    Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

    2014-01-01

    Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus–Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20–500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair. PMID:24371279

  13. mtDNA Mutations and Their Role in Aging, Diseases and Forensic Sciences.

    PubMed

    Zapico, Sara C; Ubelaker, Douglas H

    2013-01-01

    Mitochondria are independent organelles with their own DNA. As a primary function, mitochondria produce the energy for the cell through Oxidative Phosphorylation (OXPHOS) in the Electron Transport Chain (ETC). One of the toxic products of this process is Reactive Oxygen Species (ROS), which can induce oxidative damage in macromolecules like lipids, proteins and DNA. Mitochondrial DNA (mtDNA) is less protected and has fewer reparation mechanisms than nuclear DNA (nDNA), and as such is more exposed to oxidative, mutation-inducing damage. This review analyzes the causes and consequences of mtDNA mutations and their relationship with the aging process. Neurodegenerative diseases, related with the aging, are consequences of mtDNA mutations resulting in a decrease in mitochondrial function. Also described are "mitochondrial diseases", pathologies produced by mtDNA mutations and whose symptoms are related with mitochondrial dysfunction. Finally, mtDNA haplogroups are defined in this review; these groups are important for determination of geographical origin of an individual. Additionally, different haplogroups exhibit variably longevity and risk of certain diseases. mtDNA mutations in aging and haplogroups are of special interest to forensic science research. Therefore this review will help to clarify the key role of mtDNA mutations in these processes and support further research in this area. PMID:24307969

  14. Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

    PubMed

    Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

    2014-04-01

    Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair. PMID:24371279

  15. Mitochondrial dna evolution in mice

    Microsoft Academic Search

    STEPHEN D. FERRIS; RICHARD D. SAGE; ELLEN M. PRAGER; U Ritte; A C Wilson

    1983-01-01

    This study extends knowledge of mitochondrial DNA (mtDNA) diversity in mice to include 208 animals belonging to eight species in the subgenus Mus. Highly purified mtDNA from each has been subjected to high-resolution re- striction mapping with respect to the known sequence of one mouse mtDNA. Variation attributed to base substitutions was encountered at about 200 of the 300 cleavage

  16. Strain softening in stretched DNA

    PubMed Central

    Luan, Binquan; Aksimentiev, Aleksei

    2010-01-01

    The microscopic mechanics of DNA stretching was characterized using extensive molecular dynamics simulations. By employing an anisotropic pressure control method, realistic force-extension dependences of effectively infinite DNA molecules were obtained. A coexistence of B- and S-DNA domains was observed during the overstretching transition. The simulations revealed that strain softening may occur in the process of stretching torsionally constrained DNA. The latter observation was qualitatively reconciled with available experimental data using a random-field Ising model. PMID:18851334

  17. Pursuing DNA catalysts for protein modification.

    PubMed

    Silverman, Scott K

    2015-05-19

    Catalysis is a fundamental chemical concept, and many kinds of catalysts have considerable practical value. Developing entirely new catalysts is an exciting challenge. Rational design and screening have provided many new small-molecule catalysts, and directed evolution has been used to optimize or redefine the function of many protein enzymes. However, these approaches have inherent limitations that prompt the pursuit of different kinds of catalysts using other experimental methods. Nature evolved RNA enzymes, or ribozymes, for key catalytic roles that in modern biology are limited to phosphodiester cleavage/ligation and amide bond formation. Artificial DNA enzymes, or deoxyribozymes, have great promise for a broad range of catalytic activities. They can be identified from unbiased (random) sequence populations as long as the appropriate in vitro selection strategies can be implemented for their identification. Notably, in vitro selection is different in key conceptual and practical ways from rational design, screening, and directed evolution. This Account describes the development by in vitro selection of DNA catalysts for many different kinds of covalent modification reactions of peptide and protein substrates, inspired in part by our earlier work with DNA-catalyzed RNA ligation reactions. In one set of studies, we have sought DNA-catalyzed peptide backbone cleavage, with the long-term goal of artificial DNA-based proteases. We originally anticipated that amide hydrolysis should be readily achieved, but in vitro selection instead surprisingly led to deoxyribozymes for DNA phosphodiester hydrolysis; this was unexpected because uncatalyzed amide bond hydrolysis is 10(5)-fold faster. After developing a suitable selection approach that actively avoids DNA hydrolysis, we were able to identify deoxyribozymes for hydrolysis of esters and aromatic amides (anilides). Aliphatic amide cleavage remains an ongoing focus, including via inclusion of chemically modified DNA nucleotides in the catalyst, which we have recently found to enable this cleavage reaction. In numerous other efforts, we have investigated DNA-catalyzed peptide side chain modification reactions. Key successes include nucleopeptide formation (attachment of oligonucleotides to peptide side chains) and phosphatase and kinase activities (removal and attachment of phosphoryl groups to side chains). Through all of these efforts, we have learned the importance of careful selection design, including the frequent need to develop specific "capture" reactions that enable the selection process to provide only those DNA sequences that have the desired catalytic functions. We have established strategies for identifying deoxyribozymes that accept discrete peptide and protein substrates, and we have obtained data to inform the key choice of random region length at the outset of selection experiments. Finally, we have demonstrated the viability of modular deoxyribozymes that include a small-molecule-binding aptamer domain, although the value of such modularity is found to be minimal, with implications for many selection endeavors. Advances such as those summarized in this Account reveal that DNA has considerable catalytic abilities for biochemically relevant reactions, specifically including covalent protein modifications. Moreover, DNA has substantially different, and in many ways better, characteristics than do small molecules or proteins for a catalyst that is obtained "from scratch" without demanding any existing information on catalyst structure or mechanism. Therefore, prospects are very strong for continued development and eventual practical applications of deoxyribozymes for peptide and protein modification. PMID:25939889

  18. A DNA Virus of Drosophila

    PubMed Central

    Unckless, Robert L.

    2011-01-01

    Little is known about the viruses infecting most species. Even in groups as well-studied as Drosophila, only a handful of viruses have been well-characterized. A viral metagenomic approach was used to explore viral diversity in 83 wild-caught Drosophila innubila, a mushroom feeding member of the quinaria group. A single fly that was injected with, and died from, Drosophila C Virus (DCV) was added to the sample as a control. Two-thirds of reads in the infected sample had DCV as the best BLAST hit, suggesting that the protocol developed is highly sensitive. In addition to the DCV hits, several sequences had Oryctes rhinoceros Nudivirus, a double-stranded DNA virus, as a best BLAST hit. The virus associated with these sequences was termed Drosophila innubila Nudivirus (DiNV). PCR screens of natural populations showed that DiNV was both common and widespread taxonomically and geographically. Electron microscopy confirms the presence of virions in fly fecal material similar in structure to other described Nudiviruses. In 2 species, D. innubila and D. falleni, the virus is associated with a severe (?80–90%) loss of fecundity and significantly decreased lifespan. PMID:22053195

  19. DNA adsorption on graphene

    NASA Astrophysics Data System (ADS)

    Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

    2013-11-01

    Here we use classical applied mathematical modeling to determine surface binding energies between both single-strand and double-strand DNA molecules interacting with a graphene sheet. We adopt basic mechanical principles to exploit the 6-12 Lennard-Jones potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic line or surface densities. The minimum binding energy occurs when the single-strand DNA molecule is centred 20.2 Å from the surface of the graphene and the double-strand DNA molecule is centred 20.3 Å from the surface, noting that these close values apply for the case when the axis of the helix is perpendicular to the surface of graphene. For the case when the axis of the helix is parallel to the surface, the minimum binding energy occurs when the axis of the single-strand molecule is 8.3 Å from the surface, and the double-strand molecule has axis 13.3 Å from the surface. For arbitrary tilted axis, we determine the optimal angles ? of the axis of the helix, which give the minimum values of the binding energies, and we observe that the optimal angles tend to occur in the intervals ? ? ( ? /4 ,?/2) and ? ? ( ? /7 ,?/5) for the single and double-strand DNA molecules, respectively.

  20. Enzymatic DNA molecules

    NASA Technical Reports Server (NTRS)

    Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

    1998-01-01

    The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.