These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

DNA and Natural Algorithms Group  

NSDL National Science Digital Library

This research group at the California Institute of Technology is studying the capability of DNA and other biomolecules to process information and implement algorithms. A general overview of the group's purpose and motivation is provided, as well as a number of publications.

2008-01-04

2

Pyrophosphate Groups in Liquid Crystalline Phases of the DNA  

E-print Network

We study electrostatic interaction between molecules of the DNA in which a number of phosphate groups of the sugar-phosphate backbone are exchanged for the pyrophosphate ones. We employ a model in which the DNA is considered as a one-dimensional lattice of dipoles and charges corresponding to base pairs and (pyro)phosphate groups, respectively. The interaction between molecules of the DNA is described by a pair potential $U$ of electrostatic forces between the two sets of dipoles and charges belonging to respective lattices describing the molecules. Minima of potential $U$ indicate orientational ordering of the molecules and thus liquid crystalline phases of the DNA. We use numerical methods for finding the set of minima in conjunction with symmetries verified by potential $U$. The symmetries form a noncommutative group of 8-th order, ${\\cal S}$. Using the group ${\\cal S}$ we suggest a classification of liquid crystalline phases of the DNA, which allows of several cholesteric phases, that is polymorphism. Pyrophosphate forms of the DNA could clarify the part played by charges in its liquid crystalline phases, and make for experimental research, important for nano-technological and bio-medical applications.

V. L. Golo; E. I. Kats; S. A. Kuznetsova; Yu. S. Volkov

2008-08-07

3

Finding human promoter groups based on DNA physical properties  

NASA Astrophysics Data System (ADS)

DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong

2009-10-01

4

Group C adenovirus DNA sequences in human lymphoid cells.  

PubMed Central

Human peripheral blood lymphocytes from healthy adults, cord blood lymphocytes, and lymphoblastoid cell lines were screened by hybridization for the presence of group C adenovirus DNA sequences. In 13 of 17 peripheral blood lymphocyte samples from adults, 1 of 10 cord blood samples, and seven of seven lymphoblastoid cell lines tested, results were positive for Group C adenovirus DNA (adenovirus 1 [Ad1], Ad2, Ad5, or Ad6). About 1 to 2% of the lymphocytes carried 50 to 100 viral genome copies per positive cell, as estimated by in situ hybridization. Infectious virus representing all members of group C were recovered, but cultivation in the presence of adenovirus antibody did not cure the cells of free viral genomes. Viral DNA was found in B, T, and N cells but only in 1 of 10 cord blood samples. The results suggest that group C adenovirus infections in childhood result in the persistence of the viral genome in circulating lymphocytes. Images PMID:3486983

Horvath, J; Palkonyay, L; Weber, J

1986-01-01

5

Group C adenovirus DNA sequences in human lymphoid cells  

SciTech Connect

Human peripheral blood lymphocytes from healthy adults, cord blood lymphocytes, and lymphoblastoid cell lines were screened by hybridization for the presence of group C adenovirus DNA sequences. In 13 of 17 peripheral blood lymphocyte samples from adults, 1 of 10 cord blood samples, and seven of seven lymphoblastoid cell lines tested, results were positive for Group C adenovirus DNA (adenovirus 1 (Ad1), Ad2, Ad5, or Ad6). About 1 to 2% of the lymphocytes carried 50 to 100 viral genome copies per positive cell, as estimated by in situ hybridization. Infectious virus representing all members of group C were recovered, but cultivation in the presence of adenovirus antibody did not cure the cells of free viral genomes. Viral DNA was found in B, T, and N cells but only in 1 of 10 cord blood samples. The results suggest that group C adenovirus infectious in childhood result in the persistence of the viral genome in circulating lymphocytes.

Horvath, J.; Palkonyay, L.; Weber, J.

1986-07-01

6

The Polycomb group protein EZH2 directly controls DNA methylation  

Microsoft Academic Search

The establishment and maintenance of epigenetic gene silencing is fundamental to cell determination and function. The essential epigenetic systems involved in heritable repression of gene activity are the Polycomb group (PcG) proteins and the DNA methylation systems. Here we show that the corresponding silencing pathways are mechanistically linked. We find that the PcG protein EZH2 (Enhancer of Zeste homolog 2)

Emmanuelle Viré; Carmen Brenner; Rachel Deplus; Loïc Blanchon; Mario Fraga; Céline Didelot; Lluis Morey; Aleyde van Eynde; David Bernard; Jean-Marie Vanderwinden; Mathieu Bollen; Manel Esteller; Luciano di Croce; Yvan de Launoit; François Fuks

2006-01-01

7

Mitochondrial DNA evolution in the Anaxyrus boreas species group  

USGS Publications Warehouse

The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrus exsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. ?? 2008 Elsevier Inc.

Goebel, A.M.; Ranker, T.A.; Corn, P.S.; Olmstead, R.G.

2009-01-01

8

Genetic Kinship Investigation from Blood Groups to DNA Markers.  

PubMed

The forensic application of hereditary characteristics became possible after the discovery of human blood groups by Karl Landsteiner in 1901. The foundation for their use in kinship investigation was laid by Emil von Dungern and Ludwig Hirschfeld in 1910 by clarification of the inheritance of the ABO groups. Up to the middle of the 20th century further red cell membrane systems were discovered. From the 1920s Fritz Schiff and Georg Strassmann fought for the introduction of blood groups into forensic kinship investigation. A new era of hemogenetics was opened from 1955 as genetic polymorphisms were described in serum proteins. Starting in 1958 there followed the complex HLA system of white blood cells, which from 1963 was joined by polymophisms in erythrocyte enzymes. Therefore, from the 1980s, it was possible to clarify the majority of kinship cases with a combination of conventional markers. From 1990 to 2000 the conventional markers were gradually replaced by the more effective DNA markers. Simultaneously typing shifted from the phenotype level to the genotype level. The genomic structure of conventional genetic markers could also now be explained. As a reflection of scientific progress the legal situation also changed, particularly in the form of the official guidelines for kinship investigation. PMID:22851931

Geserick, Gunther; Wirth, Ingo

2012-06-01

9

Genetic Kinship Investigation from Blood Groups to DNA Markers  

PubMed Central

The forensic application of hereditary characteristics became possible after the discovery of human blood groups by Karl Landsteiner in 1901. The foundation for their use in kinship investigation was laid by Emil von Dungern and Ludwig Hirschfeld in 1910 by clarification of the inheritance of the ABO groups. Up to the middle of the 20th century further red cell membrane systems were discovered. From the 1920s Fritz Schiff and Georg Strassmann fought for the introduction of blood groups into forensic kinship investigation. A new era of hemogenetics was opened from 1955 as genetic polymorphisms were described in serum proteins. Starting in 1958 there followed the complex HLA system of white blood cells, which from 1963 was joined by polymophisms in erythrocyte enzymes. Therefore, from the 1980s, it was possible to clarify the majority of kinship cases with a combination of conventional markers. From 1990 to 2000 the conventional markers were gradually replaced by the more effective DNA markers. Simultaneously typing shifted from the phenotype level to the genotype level. The genomic structure of conventional genetic markers could also now be explained. As a reflection of scientific progress the legal situation also changed, particularly in the form of the official guidelines for kinship investigation. PMID:22851931

Geserick, Gunther; Wirth, Ingo

2012-01-01

10

In most Bradyrhizobium groups sequence comparison of 16S-23S rDNA internal transcribed spacer regions corroborates DNA-DNA hybridizations.  

PubMed

In an extension of a previous small-scale test to assess the use of 16S-23S rDNA internal transcribed spacer (ITS) sequences for rapid grouping of bradyrhizobia, we have sequenced the ITS region of 32 isolates of Bradyrhizobium that had previously been studied using AFLP and DNA-DNA hybridizations. We also included representatives of Afipia and Rhodopseudomonas. Our results indicate that ITS sequences are very diverse among bradyrhizobia. Nevertheless, for most of the bradyrhizobia, the grouping of ITS sequences was in line with AFLP results and DNA-DNA hybridization data. Strains that have at least 95.5% ITS sequence similarity belong to the same genospecies, i.e. they have more than 60% DNA-DNA hybridization values. The ITS sequences can therefore provide a relatively fast way to guide strain identification and aid selection of the reference groups that should be included in DNA-DNA hybridization experiments for precise genotypic identification. The Bradyrhizobium strains isolated from Aeschynomene species showed a much larger diversity in ITS sequences than other bradyrhizobia, possibly as a result of lateral exchange. The above ITS sequence similarity criterion for genospecies therefore does not apply to them, but they can easily be distinguished from other Bradyrhizobium genospecies because they have a distinct tRNA(ala) gene. PMID:12866847

Willems, Anne; Munive, Antonio; de Lajudie, Philippe; Gillis, Monique

2003-06-01

11

Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA  

ERIC Educational Resources Information Center

Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

Altiparmak, Melek; Nakiboglu Tezer, Mahmure

2009-01-01

12

Hands on group work paper model for teaching DNA structure, central dogma and recombinant DNA  

Microsoft Academic Search

Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate students typically lack a coherent view of concepts and their relationships

Melek ALTIPARMAK; Mahmure NAKIBOGLU TEZER

2009-01-01

13

Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein.  

PubMed Central

Cells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xeroderma pigmentosum groups or in XP-E cells that contain the activity. These results provide direct evidence that defective DDB activity causes the repair defect in a subset of XP-E patients, which in turn establishes a role for this activity in nucleotide-excision repair in vivo. Images PMID:8171034

Keeney, S; Eker, A P; Brody, T; Vermeulen, W; Bootsma, D; Hoeijmakers, J H; Linn, S

1994-01-01

14

[Mitochondrial DNA variability in populations and ethnic groups of Tatars of the Tobol-Irtysh basin].  

PubMed

The data on mitochondrial DNA diversity in seven local populations (villages) and four territorial groups of Tatars of the Tobol-Irtysh basin are presented. In the Turkic-speaking populations from the Tobol and Irtysh river basins, high levels of intergroup and interpopulation mtDNA variation were observed. It was demonstrated that genetic diversity of the territorial groups of Tatars of the Tobol-Irtysh basin resulted from various interethnic relationships and different ethnic components integrated into these groups. PMID:19824547

Naumova, O Iu; Rychkov, S Iu; Zhukova, O V

2009-09-01

15

2006 Nature Publishing Group DNA primase acts as a molecular brake in DNA  

E-print Network

. This synchronization requires a precisely timed series of enzymatic steps that control the synthesis of an RNA primer synthesize RNA primers at a rate that is orders of magnitude lower2­4 than the rate of DNA synthesis)-long duplex l phage DNA molecule is attached to the bottom surface of a glass flow cell using a biotin

Xie, Xiaoliang Sunney

16

A Fuzzy Classifier to Taxonomically Group DNA Fragments within a Metagenome  

E-print Network

Drainage metagenome into classes to represent the major Archea and Bacteria groups. The classification DNA is the building block of all life on this planet, from single cell microscopic bacteria to more of cultivation- free methods has been implied. In the past, microbial DNA was sequenced by culturing

Nicolescu, Monica

17

Xeroderma pigmentosum group A protein loads as a separate factor onto DNA lesions  

Microsoft Academic Search

Nucleotide excision repair (NER) is the main DNA repair pathway in mammals for removal of UV-induced lesions. NER involves the concerted action of more than 25 polypeptides in a coordinated fashion. The xeroderma pigmentosum group A protein (XPA) has been suggested to function as a central organizer and damage verifier in NER. How XPA reaches DNA lesions and how the

Suzanne Rademakers; Marcel Volker; Deborah Hoogstraten; Alex L. Nigg; Martijn J. Mone; Albert A. van Zeeland; A. B. Houtsmuller; W. Vermeulen; J. H. J. Hoeijmakers

2003-01-01

18

Phylogenetic analyses suggest reverse splicing spread of group I introns in fungal ribosomal DNA  

Microsoft Academic Search

BACKGROUND: Group I introns have spread into over 90 different sites in nuclear ribosomal DNA (rDNA) with greater than 1700 introns reported in these genes. These ribozymes generally spread through endonuclease-mediated intron homing. Another putative pathway is reverse splicing whereby a free group I intron inserts into a homologous or heterologous RNA through complementary base-pairing between the intron and exon

Debashish Bhattacharya; Valérie Reeb; Dawn M Simon; François Lutzoni

2005-01-01

19

Hydrogel with chains functionalized with carboxyl groups as universal 3D platform in DNA biosensors.  

PubMed

Application of hydrogel based on N-isopropylacrylamide with carboxyl groups grafted to the chains enabled the immobilization of DNA at an extent exceeding that for flat surfaces by at least one order of magnitude. The probe DNA strands in the 3D platform were fully available for the hybridization process. The examination of the gels containing different amounts of grafted carboxyl groups (1-10%) was done using quartz crystal microbalance, electrochemical impedance spectroscopy, chronoamperometry and ionic coupled plasma with laser ablation. The optimal carboxyl group content was determined to be 5%. A very good agreement of the data obtained with independent techniques on content of DNA in the gel was obtained. In comparison to the other methods of immobilization of DNA the new platform enabled complete removal of DNA after the measurements and analysis and, therefore, could be used many times. After a 10-fold exchange of the DNA-sensing layer the efficiency of hybridization and analytical signal did not change by more than 5%. The sensor response increased linearly with logarithm of concentration of target DNA in the range 1×10(-13)-1×10(-6) M. The obtained detection limit was circa 8×10(-13) M of target DNA in the sample which is a substantial improvement over the planar sensing layers. PMID:24287408

Kowalczyk, Agata; Fau, Michal; Karbarz, Marcin; Donten, Mikolaj; Stojek, Zbigniew; Nowicka, Anna M

2014-04-15

20

Efimov like phase of a three stranded DNA (Efimov-DNA) and the renormalization group limit cycle  

E-print Network

A three-stranded DNA with short range base pairings only is known to exhibit a classical analog of the quantum Efimov effect, viz., a three chain bound state at the two chain melting point where no two are bound. By using a non-perturbative renormalization group method for a rigid duplex DNA and a flexible third strand, with base pairings and strand exchange, we show that the Efimov-DNA is associated with a limit cycle type behavior of the flow of an effective three chain interaction. The analysis also shows that thermally generated bubbles play an essential role in producing the effect. A toy model for the flow equations shows the limit cycle in an extended three dimensional parameter space of the two-chain coupling and a complex three chain interaction.

Tanmoy Pal; Poulomi Sadhukhan; Somendra M. Bhattacharjee

2014-09-29

21

Xeroderma Pigmentosum Group F Caused by a Defect in a Structure-Specific DNA Repair Endonuclease  

Microsoft Academic Search

Nucleotide excision repair, which is defective in xeroderma pigmentosum (XP), involves incision of a DNA strand on each side of a lesion. We isolated a human gene homologous to yeast Rad1 and found that it corrects the repair defects of XP group F as well as rodent groups 4 and 11. Causative mutations and strongly reduced levels of encoded protein

Anneke M Sijbers; Wouter L de Laat; Rafael R Ariza; Maureen Biggerstaff; Ying-Fei Wei; Jonathan G Moggs; Kenneth C Carter; Brenda K Shell; Elizabeth Evans; Mariska C de Jong; Suzanne Rademakers; Johan de Rooij; Nicolaas G. J Jaspers; Jan H. J Hoeijmakers; Richard D Wood

1996-01-01

22

DNA DNA DNA (d)DNA DNA DNA  

E-print Network

DNA DNA DNA DNA DNA DNA DNA DNA [ 2008] (d)DNA DNA DNA DNA 2 3 DNA DNA DNA DNA DNA DNA DNA (a) (c) (b) (d) #12;DNA DNA DNA DNA DNA DNA DNA DNA (b) DNA [Tanaka et al.2008] DNA DNA DNA DNA DNA DNA DNA #12;iGEM MIT MIT

Hagiya, Masami

23

A mitochondrial DNA based phylogeny of weakfish species of the Cynoscion group (Pisces: Sciaenidae).  

PubMed

We infer the phylogeny of fishes in the New World Cynoscion group (Cynoscion, Isopisthus, Macrodon, Atractoscion, Plagioscion) using 1603bp of DNA sequence data from three mitochondrial genes. With the exception of Plagioscion, whose position was ambiguous, the Cynoscion group is monophyletic. However, several genera examined are not monophyletic. Atlantic and Pacific species of Cynoscion are interspersed in the tree and geminate species pairs are identified. Intergeneric relationships in the group are clarified. Our analysis is the first comprehensive phylogeny for the Cynoscion group based on molecular data and provides a baseline for future comparative studies of this important group. PMID:19573613

Vergara-Chen, Carlos; Aguirre, Windsor E; González-Wangüemert, Mercedes; Bermingham, Eldredge

2009-11-01

24

DNA Polymorphism and Molecular Subtyping of the Capsular Gene Cluster of Group B Streptococcus†  

PubMed Central

Serotyping and other phenotypic methods are often used to characterize the capsular polysaccharide of group B streptococci (GBS). We describe a capsular genotyping method that utilizes PCR of capsular polysaccharide synthesis genes (cps) and restriction enzyme digestion. This method facilitates the detection of DNA polymorphism in cps genes and correlates well with serotyping. PMID:16333106

Manning, Shannon D.; Lacher, David W.; Davies, H. Dele; Foxman, Betsy; Whittam, Thomas S.

2005-01-01

25

Are the Platyhelminthes a Monophyletic Primitive Group? An Assessment Using 18s rDNA Sequences  

E-print Network

Are the Platyhelminthes a Monophyletic Primitive Group? An Assessment Using 18s rDNA Sequences. Universitat de Barcelona, Spain In most zoological textbooks, Platyhelminthes are depicted as an early "Turbellaria," 3 species of parasitic Platyhelminthes, and several diploblastic and deuterostome and protostome

Carranza, Salvador

26

Distinct Structural Features of the Peroxide Response Regulator from Group A Streptococcus Drive DNA Binding  

PubMed Central

Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators. PMID:24586487

Hammel, Michal; Nix, Jay C.; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

2014-01-01

27

Distinct structural features of the peroxide response regulator from group A Streptococcus drive DNA binding.  

PubMed

Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators. PMID:24586487

Lin, Chang Sheng-Huei; Chao, Shi-Yu; Hammel, Michal; Nix, Jay C; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

2014-01-01

28

Anticancer and DNA binding activities of platinum (IV) complexes; importance of leaving group departure rate.  

PubMed

The two six-coordinate Pt(IV) complexes, containing bidentate nitrogen donor/methyl ligands with general formula [Pt(X)2Me2((t)bu2bpy)], where (t)bu2bpy = 4,4'-ditert-butyl-2,2'-bipyridine and X = Cl (C1) or Br (C2), serving as the leaving groups were synthesized for evaluation of their anticancer activities and DNA binding properties. To examine anticancer activities of the synthetic complexes, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and ethidium bromide/acridine orange (EB/AO) staining method were performed. The binding properties of these complexes to DNA and purine nucleotides were examined, using different spectroscopic techniques. These complexes demonstrated significant anticancer activities against three cancer cell lines Jurkat, K562, and MCF-7. On the basis of the results of EB/AO staining, C1 and C2 were also capable to induce apoptosis in cancer cells. These complexes comprise halide leaving groups, displaying different departure rates; accordingly, they demonstrated slightly dissimilar anticancer activity and significantly different DNA/purine nucleotide binding properties. The results of DNA interaction studies of these complexes suggest a mixed-binding mode, comprising partial intercalation and groove binding. Overall, the results presented herein indicate that the newly synthesized Pt(IV) complexes are promising class of the potential anticancer agents which can be considered as molecular templates in designing novel platinum anticancer drugs. This study also highlights the importance of leaving group in anticancer activity and DNA binding properties of Pt(IV) complexes. PMID:24414990

Pouryasin, Zahra; Yousefi, Reza; Nabavizadeh, S Masoud; Rashidi, Mehdi; Hamidizadeh, Peyman; Alavianmehr, Mohammad-Mehdi; Moosavi-Movahedi, Ali Akbar

2014-03-01

29

Ternary DNA chip based on a novel thymine spacer group chemistry.  

PubMed

A novel thymine-based surface chemistry suitable for label-free electrochemical DNA detection is described. It involves a simple two-step sequential process: immobilization of 9-mer thymine-terminated probe DNAs followed by backfilling with 9-mer thymine-based spacers (T9). As compared to commonly used organic spacer groups like 2-mercaptoethanol, 3-mercapto-1-propanol and 6-mercapto-1-hexanol, the 9-mer thymine-based spacers offer a 10-fold improvement in discriminating between complementary and non-complementary target hybridization, which is due mainly to facilitated transport of the redox probes through the probe-DNA/T9 layers. Electrochemical measurements, complemented with Surface Plasmon Resonance (SPR) and Quartz Crystal Microbalance (QCM-D) binding analyses, reveal that optimum selectivity between complementary and non-complementary hybridization is obtained for a sensing surface prepared using probe-DNA and backfiller T9 at equimolar concentration (1:1). At this particular ratio, the probe-DNAs are preferentially oriented and easily accessible to yield a sensing surface with favorable hybridization and electron transfer characteristics. Our findings suggest that oligonucleotide-based spacer groups offer an attractive alternative to short organic thiol spacers in the design of future DNA biochips. PMID:25465760

Yang, Yanli; Yildiz, Umit Hakan; Peh, Jaime; Liedberg, Bo

2015-01-01

30

Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia  

PubMed Central

A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks). PMID:25051224

Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W.; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

2014-01-01

31

Single step plasmid DNA purification using methacrylate monolith bearing combination of ion-exchange and hydrophobic groups.  

PubMed

Purification of high quantities of human grade plasmid DNA is one of the most intensive production steps. Because of that several methods have been proposed, among them also chromatographic purification using methacrylate monoliths. Recently, a process comprising the combination of hydrophobic interaction (HIC) monolith and ion-exchange monolith was developed. In this work both chemistries were tried to be introduced on a single monolith. Methacrylate monoliths bearing octylamine groups, combination of butyl (C4) grafted methacrylate groups and diethylaminoethyl (DEAE) groups as well as grafted chains bearing both C4 and DEAE groups were prepared. All monoliths were investigated for their ionic and protein capacity and compared to conventional epoxy, C4, and DEAE methacrylate monoliths. Octylamine monolith and monolith bearing combination of C4 grafted methacrylate groups and DEAE groups were found to be the most promising candidates and were further tested for plasmid DNA (pDNA) dynamic binding capacity under ion-exchange (IEX) and HIC binding conditions and ability to separate open circular (OC) from supercoiled (SC) pDNA forms and RNA from pDNA. Since monolith bearing combination of grafted C4 methacrylate groups and DEAE groups was superior in all three tested features, exhibiting pDNA dynamic binding capacity of 4.7 mg/ml under IEX conditions and 2.1mg/ml under HIC conditions, it was used for the development of a single step purification method and tested with pure pDNA as well as with cell lysate. Developed method removed over 99% of RNA, host cell proteins (HCP) and genomic DNA (gDNA) demonstrating capacity to purify around 1.5mg of pDNA/ml of monolith from cell lysate. PMID:23305854

Smrekar, Vida; Smrekar, Franc; Strancar, Aleš; Podgornik, Aleš

2013-02-01

32

The Polycomb Group Protein EZH2 Impairs DNA Repair in Breast Epithelial Cells1  

PubMed Central

Abstract The Polycomb group protein EZH2 is a transcriptional repressor involved in controlling cellular memory and has been linked to aggressive and metastatic breast cancer. Here we report that EZH2 decreased the expression of five RAD51 paralog proteins involved in homologous recombination (HR) repair of DNA double-strand breaks (RAD51B/RAD51L1, RAD51C/RAD51L2, RAD51D/RAD51L3, XRCC2, and XRCC3), but did not affect the levels of DMC1, a gene that only functions in meiosis. EZH2 overexpression impaired the formation of RAD51 repair foci at sites of DNA breaks. Overexpression of EZH2 resulted in decreased cell survival and clonogenic capacity following DNA damage induced independently by etoposide and ionizing radiation. We suggest that EZH2 may contribute to breast tumorigenesis by specific downregulation of RAD51-like proteins and by impairment of HR repair. We provide mechanistic insights into the function of EZH2 in mammalian cells and uncover a link between EZH2, a regulator of homeotic gene expression, and HR DNA repair. Our study paves the way for exploring the blockade of EZH2 overexpression as a novel approach for the prevention and treatment of breast cancer. PMID:16331887

Zeidler, Michael; Varambally, Sooryanarayana; Cao, Qi; Chinnaiyan, Arul M.; Ferguson, David O.; Merajver, Sofia D.; Kleer, Celina G.

2005-01-01

33

Specialization of the DNA-Cleaving Activity of a Group I Ribozyme Through In Vitro Evolution  

NASA Technical Reports Server (NTRS)

In an earlier study, an in vitro evolution procedure was applied to a large population of variants of the Tetrahymena group 1 ribozyme to obtain individuals with a 10(exp 5)-fold improved ability to cleave a target single-stranded DNA substrate under simulated physiological conditions. The evolved ribozymes also showed a twofold improvement, compared to the wild-type, in their ability to cleave a single-stranded RNA substrate. Here, we report continuation of the in vitro evolution process using a new selection strategy to achieve both enhanced DNA and diminished RNA-cleavage activity. Our strategy combines a positive selection for DNA cleavage with a negative selection against RNA binding. After 36 "generations" of in vitro evolution, the evolved population showed an approx. 100-fold increase in the ratio of DNA to RNA-cleavage activity. Site-directed mutagenesis experiment confirmed the selective advantage of two covarying mutations within the catalytic core of ribozyme that are largely responsible for this modified behavior. The population of ribozymes has now undergone a total of 63 successive generations of evolution, resulting in an average 28 mutations relative to the wild-type that are responsible for the altered phenotype.

Tsang, Joyce; Joyce, Gerald F.

1996-01-01

34

Primary and secondary structure analyses of the rDNA group-I introns of the Zygnematales (Charophyta)  

Microsoft Academic Search

The Zygnematales (Charophyta) contain a group-I intron (subgroup ICl) within their nuclear-encoded small subunit ribosomal DNA (SSU rDNA) coding region. This intron, which is inserted after position 1506 (relative to the SSU rDNA ofEscherichia coli), is proposed to have been vertically inherited since the origin of the Zygnematales approximately 350–400 million years ago. Primary and secondary structure analyses were carried

Debashish Bhattacharya; Simon Damberger; Barbara Surek; Michael Melkonian

1996-01-01

35

The Polycomb Group Protein EZH2 Impairs DNA Repair in Breast Epithelial Cells1  

Microsoft Academic Search

The Polycomb group protein EZH2 is a transcriptional repressor involved in controlling cellular memory and has been linked to aggressive and metastatic breast cancer. Here we report that EZH2 decreased the ex- pression of five RAD51 paralog proteins involved in homologous recombination (HR) repair of DNA double- strand breaks (RAD51B\\/RAD51L1, RAD51C\\/RAD51L2, RAD51D\\/RAD51L3, XRCC2, and XRCC3), but did not affect the

Michael Zeidler; Sooryanarayana Varambally; Qi Cao; Arul M. Chinnaiyan; David O. Ferguson; Sofia D. Merajver; Celina G. Kleer

36

Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species  

NASA Astrophysics Data System (ADS)

Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1?g) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288?A. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35?A) and for the noncomplementary oligonucleotide (5.77?A). The drop in current after each event was clearly noticeable and it proved to be effective.

Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

2009-05-01

37

Strand- and site-specific DNA lesion demarcation by the xeroderma pigmentosum group D helicase.  

PubMed

The most detrimental responses of the UV-exposed skin are triggered by cyclobutane pyrimidine dimers (CPDs). Although placental mammals rely solely on nucleotide excision repair (NER) to eliminate CPDs, none of the core NER factors are apparently able to distinguish this hazardous lesion from native DNA, raising the question of how CPDs are circumscribed to define correct excision boundaries. A key NER intermediate involves unwinding of the damaged duplex by transcription factor TFIIH, a reaction that requires xeroderma pigmentosum group D (XPD) protein. This study was prompted by the observation that the ATPase/helicase activity of XPD is necessary for an effective anchoring of this subunit to UV lesions in mammalian nuclei. The underlying mechanism by which XPD impinges on damaged DNA has been probed with a monomeric archaeal homolog, thus revealing that the collision with a single CPD inhibits the helicase but stimulates its ATPase activity. Restriction and glycosylase protection assays show that the XPD helicase remains firmly bound to a CPD situated in the translocated strand along which the enzyme moves with 5'-3' polarity. Competition assays confirm that a stable complex is formed when the XPD helicase encounters a CPD in the translocated strand. Instead, the enzyme dissociates from the substrate after running into a CPD in the complementary 3'-5' strand. These results disclose a damage verification and demarcation process that takes place by strand-selective immobilization of the XPD helicase and its conversion to a site-specific ATPase at DNA lesions. PMID:20876134

Mathieu, Nadine; Kaczmarek, Nina; Naegeli, Hanspeter

2010-10-12

38

The reactivity of sulfhydryl groups of yeast DNA dependent RNA polymerase I.  

PubMed Central

The number of reactive cysteine residues of yeast RNA polymerase I was determined and their function was studied using parachloromercury benzoate (pCMB), dithiobisnitrobenzoate (DTNB) and N-ethyl-maleimide (NEM) as modifying agents. By treatment with DTNB about 45 sulfhydryl groups react in the presence of 8M urea. Under non-denaturing conditions only 20 sulfhydryl groups are reactive with pCMB and DTNB. Both reagents completely inactivate the enzyme and this effect can be reversed by reducing agents. The sedimentation coefficient and the subunit composition are not affected when the enzyme is inactivated. Two of the most reactive sulfhydryl groups are necessary for activity. The modification of these groups is partially protected by substrates and DNA, suggesting that they are involved either in catalysis or in the maintenance of the conformation of the active site. Experiments with 14C-NEM indicate that the most reactive groups are located in subunits of 185,000, 137,000 and 41,000 daltons. Images PMID:6755393

Bull, P; Wyneken, U; Valenzuela, P

1982-01-01

39

FastGroupII: A web-based bioinformatics platform for analyses of large 16S rDNA libraries  

PubMed Central

Background High-throughput sequencing makes it possible to rapidly obtain thousands of 16S rDNA sequences from environmental samples. Bioinformatic tools for the analyses of large 16S rDNA sequence databases are needed to comprehensively describe and compare these datasets. Results FastGroupII is a web-based bioinformatics platform to dereplicate large 16S rDNA libraries. FastGroupII provides users with the option of four different dereplication methods, performs rarefaction analysis, and automatically calculates the Shannon-Wiener Index and Chao1. FastGroupII was tested on a set of 16S rDNA sequences from coral-associated Bacteria. The different grouping algorithms produced similar, but not identical, results. This suggests that 16S rDNA datasets need to be analyzed in multiple ways when being used for community ecology studies. Conclusion FastGroupII is an effective bioinformatics tool for the trimming and dereplication of 16S rDNA sequences. Several standard diversity indices are calculated, and the raw sequences are prepared for downstream analyses. PMID:16464253

Yu, Yanan; Breitbart, Mya; McNairnie, Pat; Rohwer, Forest

2006-01-01

40

Genetic Diversity within Schistosoma haematobium: DNA Barcoding Reveals Two Distinct Groups  

PubMed Central

Background Schistosomiasis in one of the most prevalent parasitic diseases, affecting millions of people and animals in developing countries. Amongst the human-infective species S. haematobium is one of the most widespread causing urogenital schistosomiasis, a major human health problem across Africa, however in terms of research this human pathogen has been severely neglected. Methodology/Principal Findings To elucidate the genetic diversity of Schistosoma haematobium, a DNA ‘barcoding’ study was performed on parasite material collected from 41 localities representing 18 countries across Africa and the Indian Ocean Islands. Surprisingly low sequence variation was found within the mitochondrial cytochrome oxidase subunit I (cox1) and the NADH-dehydrogenase subunit 1 snad1). The 61 haplotypes found within 1978 individual samples split into two distinct groups; one (Group 1) that is predominately made up of parasites from the African mainland and the other (Group 2) that is made up of samples exclusively from the Indian Ocean Islands and the neighbouring African coastal regions. Within Group 1 there was a dominance of one particular haplotype (H1) representing 1574 (80%) of the samples analyzed. Population genetic diversity increased in samples collected from the East African coastal regions and the data suggest that there has been movement of parasites between these areas and the Indian Ocean Islands. Conclusions/Significance The high occurrence of the haplotype (H1) suggests that at some point in the recent evolutionary history of S. haematobium in Africa the population may have passed through a genetic ‘bottleneck’ followed by a population expansion. This study provides novel and extremely interesting insights into the population genetics of S. haematobium on a large geographic scale, which may have consequence for control and monitoring of urogenital schistosomiasis. PMID:23145200

Webster, Bonnie L.; Emery, Aiden M.; Webster, Joanne P.; Gouvras, Anouk; Garba, Amadou; Diaw, Oumar; Seye, Mohmoudane M.; Tchuente, Louis Albert Tchuem; Simoonga, Christopher; Mwanga, Joseph; Lange, Charles; Kariuki, Curtis; Mohammed, Khalfan A.; Stothard, J. Russell; Rollinson, David

2012-01-01

41

Group-specific primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents.  

PubMed

Group-specific, degenerate polymerase chain reaction primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents have been developed for the first time. Primers were designed from 18S rDNA and amplified fragments of 272 bp and 177 bp from 17 springtail species collected in agricultural habitats. Specificity tests against 41 nontarget species revealed no cross-reactivity. Group-specific polymerase chain reaction is advantageous when working in species-rich habitats and these primers could facilitate studies of trophic links between springtails and generalist arthropod predators worldwide. PMID:21585869

Kuusk, A K; Agustí, N

2008-05-01

42

DNA  

NSDL National Science Digital Library

In this activity, students extract DNA from their cheek cells and relate the steps in the procedure to the characteristics of cells and biological molecules. Students learn key concepts about the function of DNA during the intervals required for the extraction procedure. A second optional section develops student understanding of the fundamentals of DNA structure, function and replication; this section includes hands-on modeling of DNA replication. This activity, together with our activity, "From Gene to Protein - Transcription and Translation", can be used to teach the basic concepts of molecular biology.

Doherty, Jennifer; Waldron, Ingrid

43

DNA.  

ERIC Educational Resources Information Center

Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

Felsenfeld, Gary

1985-01-01

44

One-step conjugation of aminoferrocene to phosphate groups as electroactive probes for electrochemical detection of sequence-specific DNA.  

PubMed

A straightforward electrochemical DNA biosensing approach based on exploiting organometallic compound, aminoferrocene (AFC), as electroactive probes was firstly demonstrated, where the probes could be directly labeled to the free phosphate groups of the hybridized PNA/DNA heteroduplexes merely through one-step conjugation in the presence of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and imidazole. Briefly, mercapto-terminated peptide nucleic acid (PNA) was firstly immobilized onto gold electrode and used as the capture probes for the specific recognition of target single-stranded DNA (ssDNA). After hybridization, AFC probes were directly labeled to the free 5'-terminal phosphate groups, which were activated by EDC and imidazole, of the hybridized PNA/DNA heteroduplexes, and then they were exploited as the electroactive probes to monitor the hybridization. As the captured ssDNA was labeled with AFC in the stoichiometric ratio of 1:1, thus the electrochemical analysis of the proportionally labeled AFC based on differential pulse voltammetry (DPV) enabled a quantitative determination of sequence-specific DNA. Under optimal conditions, the approach presented a good linear relationship between the current intensities and logarithm of ssDNA concentrations in the range from 0.1nM to 100nM with a detection limit of 93pM, and it rendered satisfactory analytical performance in serum samples. Furthermore, it exhibited excellent specificity toward single-nucleotide polymorphism (SNP) and precluded complicated protocols. More importantly, the simplicity of this approach together with its compatibility with standard micro-fabrication techniques makes it great potential in practical applications, especially in microarray areas where simple procedures are preferred. PMID:25461140

Hu, Qiong; Deng, Xianbao; Yu, Xuehua; Kong, Jinming; Zhang, Xueji

2014-10-21

45

cvsdoc Tue Aug 29 18:18:39 2006 1 CVS Basics (written for the dna group by Joseph Schaeffer)  

E-print Network

cvsdoc Tue Aug 29 18:18:39 2006 1 CVS Basics (written for the dna group by Joseph Schaeffer) 1) The first thing you need to do in order to use the CVS system is to make sure the CVSROOT environment variable is set to the right location. Under tcsh, the command is: > setenv CVSROOT /research/CVS Under

Winfree, Erik

46

Reproducibility of mtDNA analysis between laboratories: a report of the European DNA profiling group (EDNAP)  

Microsoft Academic Search

The aim of this collaborative exercise was to determine whether uniformity of mtDNA sequencing results could be achieved among different EDNAP laboratories. Laboratories were asked to sequence mtDNAHV1 region (16024–16365) from three bloodstains, proceeding in accordance with the protocol and strategies currently used in each individual laboratory. Cycle sequencing was used by 11 laboratories and solid phase single stranded sequencing

A. Carracedo; E. D'Aloja; B. Dupuy; A. Jangblad; M. Karjalainen; C. Lambert; W. Parson; H. Pfeiffer; H. Pfitzinger; M. Sabatier; D. Syndercombe Court; C. Vide

1998-01-01

47

The Q Motif of Fanconi Anemia Group J Protein (FANCJ) DNA Helicase Regulates Its Dimerization, DNA Binding, and DNA Repair Function*  

PubMed Central

The Q motif, conserved in a number of RNA and DNA helicases, is proposed to be important for ATP binding based on structural data, but its precise biochemical functions are less certain. FANCJ encodes a Q motif DEAH box DNA helicase implicated in Fanconi anemia and breast cancer. A Q25A mutation of the invariant glutamine in the Q motif abolished its ability to complement cisplatin or telomestatin sensitivity of a fancj null cell line and exerted a dominant negative effect. Biochemical characterization of the purified recombinant FANCJ-Q25A protein showed that the mutation disabled FANCJ helicase activity and the ability to disrupt protein-DNA interactions. FANCJ-Q25A showed impaired DNA binding and ATPase activity but displayed ATP binding and temperature-induced unfolding transition similar to FANCJ-WT. Size exclusion chromatography and sedimentation velocity analyses revealed that FANCJ-WT existed as molecular weight species corresponding to a monomer and a dimer, and the dimeric form displayed a higher specific activity for ATPase and helicase, as well as greater DNA binding. In contrast, FANCJ-Q25A existed only as a monomer, devoid of helicase activity. Thus, the Q motif is essential for FANCJ enzymatic activity in vitro and DNA repair function in vivo. PMID:22582397

Wu, Yuliang; Sommers, Joshua A.; Loiland, Jason A.; Kitao, Hiroyuki; Kuper, Jochen; Kisker, Caroline; Brosh, Robert M.

2012-01-01

48

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds  

SciTech Connect

Nanostructures constructed from metal and semiconductor nanocrystals conjugated to, and organized by DNA are an emerging class of material with collective optical properties. We created discrete pyramids of DNA with gold nanocrystals at the tips. By taking small angle X-ray scattering (SAXS) measurments from solutions of these pyramids we confirmed that this pyramidal geometry creates structures which are more rigid in solution than linear DNA. We then took advantage of the tetrahedral symmetry to demonstrate construction of chiral nanostructures.

Mastroianni, Alexander; Claridge, Shelley; Alivisatos, A. Paul

2009-03-30

49

Remarkable stabilization of antiparallel DNA triplexes by strong stacking effects of consecutively modified nucleobases containing thiocarbonyl groups.  

PubMed

The consecutive arrangement of 2'-deoxy-6-thioguanosines (s(6)Gs) and 4-thiothymidines (s(4)Ts) in antiparallel triplex-forming oligonucleotides (TFOs) considerably stabilized the resulting antiparallel triplexes with high base recognition ability by the strong stacking effects of thiocarbonyl groups. This result was remarkable because chemical modifications of the sugar moieties and nucleobases of antiparallel TFOs generally destabilize triplex structures. Moreover, in comparison with unmodified TFOs, it was found that TFOs containing s(6)Gs and s(4)Ts could selectively bind to the complementary DNA duplex but not to mismatched DNA duplexes or single-stranded RNA. PMID:23287737

Yamada, Kenji; Hattori, Yusaku; Inde, Takeshi; Kanamori, Takashi; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2013-02-01

50

Mitochondrial DNA polymorphisms in nine aboriginal groups of Taiwan: implications for the population history of aboriginal Taiwanese.  

PubMed

Mitochondrial DNA (mtDNA) polymorphisms in the D-loop region and the intergenic COII/tRNA(Lys) 9-bp deletion were examined in 180 individuals from all nine aboriginal Taiwanese groups: Atayal, Saisiat, Bunun, Tsou, Rukai, Paiwan, Ami, Puyuma, and Yami. A comparison of 563-bp sequences showed that there were 61 different sequence types, of which 42 types were specific to respective aboriginal groups. D-loop sequence variation and phylogenetic analysis enabled the 180 aboriginal lineages to be classified into eight monophyletic clusters (designated C1-C8). Phylogeographic analysis revealed that two (C2 and C4) of the eight clusters were new characteristic clusters of aboriginal Taiwanese and accounted for 8.3% and 13.9% of the aboriginal lineages, respectively. From the estimated coalescent times for the two unique clusters, the mtDNA lineages leading to such clusters were inferred to have been introduced into Taiwan approximately 11,000-26,000 years ago, suggesting ancient immigrations of the two mtDNA lineages. Genetic distances, based on net nucleotide diversities between populations, revealed three distinct clusters that were comprised of northern mountain (Atayal and Saisiat), southern mountain (Rukai and Paiwan), and middle mountain/east coast (Bunun, Tsou, Ami, Puyuma, and Yami) groups, respectively. Furthermore, phylogenetic analysis of 16 human populations (including six other Asian populations and one African population) confirmed that the three clusters for aboriginal Taiwanese had remained largely intact. Each of the clusters (north, south, and middle-east coast) was characterized by a high frequency of a particular lineage (C4, C2, and 9-bp deletion, respectively). This may result from random genetic drift among the aboriginal groups after a single introduction of all the mtDNA lineages into Taiwan, but another plausible explanation is that at least three genetically distinct ancestral populations have contributed to the maternal gene pool of aboriginal Taiwanese. PMID:12687351

Tajima, Atsushi; Sun, Cheih-Shan; Pan, I-Hung; Ishida, Takafumi; Saitou, Naruya; Horai, Satoshi

2003-07-01

51

DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar  

Microsoft Academic Search

The role of DNA barcoding as a tool to accelerate the inventory and analysis of diversity for hyperdiverse arthropods is tested using ants in Madagascar. We demonstrate how DNA barcoding helps address the failure of current inventory methods to rapidly respond to pressing biodiversity needs, specifically in the assessment of richness and turnover across landscapes with hyperdiverse taxa. In a

M. Alex Smith; Brian L. Fisher; Paul D. N. Hebert

2005-01-01

52

Differentiation and grouping of isolates of the Ganoderma lucidum complex by random amplified polymorphic DNA-PCR compared with grouping on the basis of internal transcribed spacer sequences.  

PubMed Central

Laccate polypores of the Ganoderma lucidum species complex are widespread white rot fungi of economic importance, but isolates cannot be identified by traditional taxonomic methods. Parsimony analysis of nucleotide sequences from the internal transcribed spacers (ITS) of the ribosomal gene (rDNA) distinguished six lineages in this species complex. Each ITS lineage may represent one or more putative species. While some isolates have identical ITS sequences, all of them could be clearly differentiated by genetic fingerprinting using random amplified polymorphic DNA (RAPD). To investigate the suitability of RAPD markers for taxonomic identification and grouping of isolates of the G. lucidum complex, RAPD fragments (RAPDs) were used as phenotypic characters in numerical and parsimony analyses. Results show that data from RAPDS do not distinguish the same clades as ITS data do. Groupings based on analysis of RAPD data were very sensitive to the choice of the grouping method used, and no consistent grouping of isolates could be proposed. However, analysis with RAPDs did resolve several robust terminal clades containing putatively conspecific isolates, suggesting that RAPDs might be helpful for systematics at the lower taxonomic levels that are unresolved by ITS sequence data. The limitations of RAPDs for systematics are briefly discussed. The conclusion of this study is that ITS sequences can be used to identify isolates of the G. lucidum complex, whereas RAPDs can be used to differentiate between isolates having identical ITS sequences. The practical implications of these results are briefly illustrated. PMID:8919797

Hseu, R S; Wang, H H; Wang, H F; Moncalvo, J M

1996-01-01

53

Detection of group B rotavirus in fecal specimens by dot hybridization with a cloned cDNA probe.  

PubMed

Cloned cDNA copies were synthesized from the genomic RNA of the IDIR strain of group B rotavirus (GBR) isolated in Baltimore, Md. These clones were screened for hybridization with heterologous GBR to identify cDNA for use in dot hybridization experiments. In multiple screening experiments, cDNA clones derived from gene segment 3 provided the most intense hybridization signals. 32P-labeled probes were produced from one of the gene 3 clones, and these were employed in dot hybridization assays. Purified preparations of bovine GBR were detected in concentrations of greater than or equal to 0.5 ng, and GBR was detected in fecal specimens obtained from five of six infected calves. Four of six human fecal specimens containing the Baltimore strain of GBR were also positive in the hybridization assay, while GBR was identified in only one of the six specimens by means of immunoelectron microscopy. A fecal specimen obtained from a patient infected with the adult diarrhea rotavirus strain of GBR was also positive in the dot hybridization assay. Fecal specimens from uninfected humans, calves, and rats, as well as specimens containing group A rotaviruses, did not hybridize with the cloned cDNA probe. PMID:2541164

Eiden, J J; Firoozmand, F; Sato, S; Vonderfecht, S L; Yin, F Z; Yolken, R H

1989-03-01

54

Detection of group B rotavirus in fecal specimens by dot hybridization with a cloned cDNA probe.  

PubMed Central

Cloned cDNA copies were synthesized from the genomic RNA of the IDIR strain of group B rotavirus (GBR) isolated in Baltimore, Md. These clones were screened for hybridization with heterologous GBR to identify cDNA for use in dot hybridization experiments. In multiple screening experiments, cDNA clones derived from gene segment 3 provided the most intense hybridization signals. 32P-labeled probes were produced from one of the gene 3 clones, and these were employed in dot hybridization assays. Purified preparations of bovine GBR were detected in concentrations of greater than or equal to 0.5 ng, and GBR was detected in fecal specimens obtained from five of six infected calves. Four of six human fecal specimens containing the Baltimore strain of GBR were also positive in the hybridization assay, while GBR was identified in only one of the six specimens by means of immunoelectron microscopy. A fecal specimen obtained from a patient infected with the adult diarrhea rotavirus strain of GBR was also positive in the dot hybridization assay. Fecal specimens from uninfected humans, calves, and rats, as well as specimens containing group A rotaviruses, did not hybridize with the cloned cDNA probe. Images PMID:2541164

Eiden, J J; Firoozmand, F; Sato, S; Vonderfecht, S L; Yin, F Z; Yolken, R H

1989-01-01

55

DNA  

ERIC Educational Resources Information Center

This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

Stent, Gunther S.

1970-01-01

56

Suppression of a DNA polymerase ? mutation by the absence of the high mobility group protein Hmo1 in Saccharomyces cerevisiae  

Microsoft Academic Search

The deletion of the gene encoding the high mobility group protein Hmo1 suppresses the growth retardation of the DNA pol ?\\u000a mutation, pol3-14, at the restrictive temperature. pol3-14 mutant cells undergo cell cycle arrest, and hmo1? alleviates the arrest permitting continual division of the double mutant. Bypass of cell cycle control occurs with an increased\\u000a rate of mutation. Both pol3-14

Haeyoung Kim; Dennis M. Livingston

2009-01-01

57

Comparative analysis of cultivated melon groups ( Cucumis melo L.) using random amplified polymorphic DNA and simple sequence repeat markers  

Microsoft Academic Search

Random amplified polymorphic DNA (RAPD) and simple sequence repeat (SSR) markers were used to characterize genetic relationships\\u000a among 46 accessions in two C. melo L. subsp. melo (Cantalupensis, Inodorus) and subsp.agrestis (Conomon, and Flexuosus) groups. Genetic distance (GD) estimates were made among and between accessions in four melon market\\u000a classes [Galia, Ogen, Charentais, and Shipper (European and U.S. types)] of

Jack E. Staub; Yael Danin-Poleg; Gennaro Fazio; Thomas Horejsi; Noa Reis; Nurit Katzir

2000-01-01

58

Mahanine, a DNA minor groove binding agent exerts cellular cytotoxicity with involvement of C-7-OH and -NH functional groups.  

PubMed

Mahanine, a carbazole alkaloid is a potent anticancer molecule. To recognize the structure-activity correlation, mahanine was chemically modified. Antiproliferative activity of these derivatives was determined in 19 cancer cell lines from 7 different origins. Mahanine showed enhanced apoptosis compared to dehydroxy-mahanine-treated cells, indicating significant contribution of the C-7-OH group. O-Methylated-mahanine and N-methylated dehydroxy-mahanine-treated cells exhibited apoptosis only at higher concentrations, suggesting additional contribution of 9-NH group. Using biophysical techniques, we demonstrated that mahanine interacts with DNA through strong association with phosphate backbone compared to other derivatives but is unable to induce any conformational change in DNA, hence suggesting the possibility of being a minor groove binder. This was corroborated by molecular modeling and isothermal titration calorimetry studies. Taken together, the results of the current study represent the first evidence of involvement of C-7-OH and 9-NH group of mahanine for its cytotoxicity and its minor groove binding ability with DNA. PMID:23829449

Samanta, Suman K; Dutta, Devawati; Roy, Sarita; Bhattacharya, Kaushik; Sarkar, Sayantani; Dasgupta, Anjan K; Pal, Bikas C; Mandal, Chhabinath; Mandal, Chitra

2013-07-25

59

Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity.  

PubMed

Cockayne Syndrome is a segmental premature aging syndrome, which can be caused by loss of function of the CSB protein. CSB is essential for genome maintenance and has numerous interaction partners with established roles in different DNA repair pathways including transcription coupled nucleotide excision repair and base excision repair. Here, we describe a new interaction partner for CSB, the DNA glycosylase NEIL2. Using both cell extracts and recombinant proteins, CSB and NEIL2 were found to physically interact independently of DNA. We further found that CSB is able to stimulate NEIL2 glycosylase activity on a 5-hydroxyl uracil lesion in a DNA bubble structure substrate in vitro. A novel 4,6-diamino-5-formamidopyrimidine (FapyA) specific incision activity of NEIL2 was also stimulated by CSB. To further elucidate the biological role of the interaction, immunofluorescence studies were performed, showing an increase in cytoplasmic CSB and NEIL2 co-localization after oxidative stress. Additionally, stalling of the progression of the transcription bubble with ?-amanitin resulted in increased co-localization of CSB and NEIL2. Finally, CSB knockdown resulted in reduced incision of 8-hydroxyguanine in a DNA bubble structure using whole cell extracts. Taken together, our data supports a biological role for CSB and NEIL2 in transcription associated base excision repair. PMID:24406253

Aamann, Maria D; Hvitby, Christina; Popuri, Venkateswarlu; Muftuoglu, Meltem; Lemminger, Lasse; Skeby, Cecilie K; Keijzers, Guido; Ahn, Byungchan; Bjørås, Magnar; Bohr, Vilhelm A; Stevnsner, Tinna

2014-01-01

60

Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity  

PubMed Central

Cockayne Syndrome is a segmental premature aging syndrome, which can be caused by loss of function of the CSB protein. CSB is essential for genome maintenance and has numerous interaction partners with established roles in different DNA repair pathways including transcription coupled nucleotide excision repair and base excision repair. Here, we describe a new interaction partner for CSB, the DNA glycosylase NEIL2. Using both cell extracts and recombinant proteins, CSB and NEIL2 was found to physically interact independently of DNA. We further found that CSB is able to stimulate NEIL2 glycosylase activity on a 5-hydroxyl uracil lesion in a DNA bubble structure substrate in vitro. A novel 4,6-diamino-5-formamidopyrimidine (FapyA) specific incision activity of NEIL2 was also stimulated by CSB. To further elucidate the biological role of the interaction, immunofluorescence studies were performed, showing an increase in cytoplasmic CSB and NEIL2 co-localization after oxidative stress. Additionally, stalling of the progression of the transcription bubble with ?-amanitin resulted in increased co-localization of CSB and NEIL2. Finally, CSB knockdown resulted in reduced incision of 8-hydroxyguanine in a DNA bubble structure using whole cell extracts. Taken together, our data supports a biological role for CSB and NEIL2 in transcription associated base excision repair. PMID:24406253

Aamann, Maria D.; Hvitby, Christina; Popuri, Venkateswarlu; Muftuoglu, Meltem; Lemminger, Lasse; Skeby, Cecilie K.; Keijzers, Guido; Ahn, Byungchan; Bjørås, Magnar; Bohr, Vilhelm A.; Stevnsner, Tinna

2014-01-01

61

Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.  

PubMed

Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU) ribosomal DNA (rDNA) sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF) for encoding the homing endonuclease (HE), whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron) and genotype IV (Bdo.S1199-B) were each found in only one strain, whereas genotype I (Bdo.S1199-A) and genotype II (Bdo.S943 and Bdo.S1506) occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea. PMID:23844098

Xu, Chao; Wang, Chunsheng; Sun, Xinyao; Zhang, Rong; Gleason, Mark L; Eiji, Tanaka; Sun, Guangyu

2013-01-01

62

DNA barcoding reveals both known and novel taxa in the Albitarsis Group (Anopheles: Nyssorhynchus) of Neotropical malaria vectors  

PubMed Central

Background Mosquitoes belonging to the Albitarsis Group (Anopheles: Nyssorhynchus) are of importance as malaria vectors across the Neotropics. The Group currently comprises six known species, and recent studies have indicated further hidden biodiversity within the Group. DNA barcoding has been proposed as a highly useful tool for species recognition, although its discriminatory utility has not been verified in closely related taxa across a wide geographic distribution. Methods DNA barcodes (658 bp of the mtDNA Cytochrome c Oxidase - COI) were generated for 565 An. albitarsis s.l. collected in Argentina, Brazil, Colombia, Paraguay, Trinidad and Venezuela over the past twenty years, including specimens from type series and type localities. Here we test the utility of currently advocated barcoding methodologies, including the Kimura-two-parameter distance model (K2P) and Neighbor-joining analysis (NJ), for determining species delineation within mosquitoes of the Neotropical Albitarsis Group of malaria vectors (Anopheles: Nyssorhynchus), and compare results with Bayesian analysis. Results Species delineation through barcoding analysis and Bayesian phylogenetic analysis, fully concur. Analysis of 565 sequences (302 unique haplotypes) resolved nine NJ tree clusters, with less than 2% intra-node variation. Mean intra-specific variation (K2P) was 0.009 (range 0.002 - 0.014), whereas mean inter-specific divergence were several-fold higher at 0.041 (0.020 - 0.056), supporting the reported "barcoding gap". These results show full support for separate species status of the six known species in the Albitarsis Group (An. albitarsis s.s., An. albitarsis F, An. deaneorum, An. janconnae, An. marajoara and An. oryzalimnetes), and also support species level status for two previously detected lineages - An. albitarsis G &An. albitarsis I (designated herein). In addition, we highlight the presence of a unique mitochondrial lineage close to An. deaneorum and An. marajoara (An. albitarsis H) from Rondônia and Mato Grosso in southwestern Brazil. Further integrated studies are required to confirm the status of this lineage. Conclusions DNA barcoding provides a reliable means of identifying both known and undiscovered biodiversity within the closely related taxa of the Albitarsis Group. We advocate its usage in future studies to elucidate the vector competence and respective distributions of all eight species in the Albitarsis Group and the novel mitochondrial lineage (An. albitarsis H) recovered in this study. PMID:22353437

2012-01-01

63

Are clownfish groups composed of close relatives? An analysis of microsatellite DNA variation in Amphiprion percula  

Microsoft Academic Search

A central question of evolutionary ecology is: why do animals live in groups? Answering this question requires that the costs and benefits of group living are measured from the perspective of each individual in the group. This, in turn, requires that the group's genetic structure is elucidated, because genetic relatedness can modulate the individuals' costs and benefits. The clown anemonefish,

PETER M. B USTON; STEVEN M. BOGDANOWICZ; ALEX WONG; RICHARD G. H ARRISON

64

Complete mtDNA genomes of Filipino ethnolinguistic groups: a melting pot of recent and ancient lineages in the Asia-Pacific region  

PubMed Central

The Philippines is a strategic point in the Asia-Pacific region for the study of human diversity, history and origins, as it is a cross-road for human migrations and consequently exhibits enormous ethnolinguistic diversity. Following on a previous in-depth study of Y-chromosome variation, here we provide new insights into the maternal genetic history of Filipino ethnolinguistic groups by surveying complete mitochondrial DNA (mtDNA) genomes from a total of 14 groups (11 groups in this study and 3 groups previously published) including previously published mtDNA hypervariable segment (HVS) data from Filipino regional center groups. Comparison of HVS data indicate genetic differences between ethnolinguistic and regional center groups. The complete mtDNA genomes of 14 ethnolinguistic groups reveal genetic aspects consistent with the Y-chromosome, namely: diversity and heterogeneity of groups, no support for a simple dichotomy between Negrito and non-Negrito groups, and different genetic affinities with Asia-Pacific groups that are both ancient and recent. Although some mtDNA haplogroups can be associated with the Austronesian expansion, there are others that associate with South Asia, Near Oceania and Australia that are consistent with a southern migration route for ethnolinguistic group ancestors into the Asia-Pacific, with a timeline that overlaps with the initial colonization of the Asia-Pacific region, the initial colonization of the Philippines and a possible separate post-colonization migration into the Philippine archipelago. PMID:23756438

Delfin, Frederick; Min-Shan Ko, Albert; Li, Mingkun; Gunnarsdóttir, Ellen D; Tabbada, Kristina A; Salvador, Jazelyn M; Calacal, Gayvelline C; Sagum, Minerva S; Datar, Francisco A; Padilla, Sabino G; De Ungria, Maria Corazon A; Stoneking, Mark

2014-01-01

65

Primary organization of nucleosomes. Interaction of non-histone high mobility group proteins 14 and 17 with nucleosomes, as revealed by DNA-protein crosslinking and immunoaffinity isolation.  

PubMed

The binding sites for histones and high mobility group proteins (HMG) 14 and 17 have been located on DNA in the nucleosomal cores and H1/H5-containing nucleosomes. The nucleosomes were specifically associated with two molecules of the non-histone proteins HMG 14 and/or HMG 17 when followed by DNA-protein crosslinking and immunoaffinity isolation of the crosslinked HMG-DNA complexes. HMGs 14 and 17 were shown to be crosslinked in a similar manner to each core DNA strand at four sites: to both 3' and 5' DNA ends and also at distances of about 25 and 125 nucleotides from the 5' termini of the DNA. These sites are designated as HMG(143), (0), (25) and (125). The site HMG(125) is located at the place where no significant histone-DNA crosslinking was observed. The HMG(125) and HMG(25) sites lie opposite one another on the complementary DNA strands across the minor DNA groove and are placed, similarly to histones, on the inner side of the DNA superhelix in the nucleosome. The crosslinking of HMG 17 to the 3' ends of the DNA is much weaker than that of HMG 14. These data indicate that each of two molecules of HMG 14 and/or HMG 17 is bound to the double-stranded core DNA at two discrete sites: to the 3' and 5' ends of the DNA and at a distance of 20 to 25 base-pairs from each DNA terminus inside the nucleosome on a histone-free DNA region. Binding of HMG 14 or 17 does not induce any detectable rearrangement of histones on DNA and both HMGs seem to choose the same sites for attachment in nucleosomal cores and H1/H5-containing nucleosomes. PMID:4057250

Shick, V V; Belyavsky, A V; Mirzabekov, A D

1985-09-20

66

Previously unrecognized vaccine candidates against group B meningococcus identified by DNA microarrays  

Microsoft Academic Search

We have used DNA microarrays to follow Neisseria meningitidis serogroup B (MenB) gene regulation during interaction with human epithelial cells. Host-cell contact induced changes in the expression of 347 genes, more than 30% of which encode proteins with unknown function. The upregulated genes included transporters of iron, chloride, amino acids, and sulfate, many virulence factors, and the entire pathway of

Renata Grifantini; Erika Bartolini; Alessandro Muzzi; Monia Draghi; Elisabetta Frigimelica; Joel Berger; Giulio Ratti; Roberto Petracca; Giuliano Galli; Mauro Agnusdei; Marzia Monica Giuliani; Laura Santini; Brunella Brunelli; Hervé Tettelin; Rino Rappuoli; Filippo Randazzo; Guido Grandi

2002-01-01

67

Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses.  

PubMed

Phase-contrast light microscopy revealed that only one of eight cultivated strains belonging to the Sphaerotilus-Leptothrix group of sheathed bacteria actually produced a sheath in standard growth media. Two Sphaerotilus natans strains produced branched cells, but other morphological characteristics that were used to identify these bacteria were consistent with previously published descriptions. Genomic fingerprints, which were obtained by performing PCR amplification with primers corresponding to enterobacterial repetitive intergenic consensus sequences, were useful for distinguishing between the genera Sphaerotilus and Leptothrix, as well as among individual strains. The complete 16S ribosomal DNA (rDNA) sequences of two strains of "Leptothrix discophora" (strains SP-6 and SS-1) were determined. In addition, partial sequences (approximately 300 nucleotides) of one strain of Leptothrix cholodnii (strain LMG 7171), an unidentified Leptothrix strain (strain NC-1), and four strains of Sphaerotilus natans (strains ATCC 13338T [T = type strain], ATCC 15291, ATCC 29329, and ATCC 29330) were determined. We found that two of the S. natans strains (ATCC 15291 and ATCC 13338T), which differed in morphology and in their genomic fingerprints, had identical sequences in the 300-nucleotide region sequenced. Both parsimony and distance matrix methods were used to infer the evolutionary relationships of the eight strains in a comparison of the 16S rDNA sequences of these organisms with 16S rDNA sequences obtained from ribosomal sequence databases. All of the strains clustered in the Rubrivivax subdivision of the beta subclass of the Proteobacteria, which confirmed previously published conclusions concerning selected individual strains. Additional analyses revealed that all of the S. natans strains clustered in one closely related group, while the Leptothrix strains clustered in two separate lineages that were approximately equidistant from the S. natans cluster. This finding suggests that the tentative species "L. discophora" needs to be more clearly defined and compared with other species belonging to the genus Leptothrix. PMID:8573492

Siering, P L; Ghiorse, W C

1996-01-01

68

Chromosome 9: gene for blood group, Matt RidleySite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

Interviewee: Matt Ridley DNAi Location:Genome>tour>genome spots>Blood groups Location: chromosome 9 gene name: ABO (galactosyl transferase) The ABO gene codes for an enzyme called galactosyl transferase and determines your blood group. In people with A and B blood groups, the gene differs by seven basepairs, four of which have an effect on the type, shape and activity of the enzyme. People with O blood group have a single deletion in the gene that causes an inactive protein to be made.

2008-10-06

69

Are clownfish groups composed of close relatives? An analysis of microsatellite DNA variation in Amphiprion percula.  

PubMed

A central question of evolutionary ecology is: why do animals live in groups? Answering this question requires that the costs and benefits of group living are measured from the perspective of each individual in the group. This, in turn, requires that the group's genetic structure is elucidated, because genetic relatedness can modulate the individuals' costs and benefits. The clown anemonefish, Amphiprion percula, lives in groups composed of a breeding pair and zero to four nonbreeders. Both breeders and nonbreeders stand to gain by associating with relatives: breeders might prefer to tolerate nonbreeders that are relatives because there is little chance that relatives will survive to breed elsewhere; nonbreeders might prefer to associate with breeders that are relatives because of the potential to accrue indirect genetic benefits by enhancing anemone and, consequently, breeder fitness. Given the potential benefits of associating with relatives, we use microsatellite loci to investigate whether or not individuals within groups of A. percula are related. We develop seven polymorphic microsatellite loci, with a number of alleles (range 2-24) and an observed level of heterozygosity (mean = 0.5936) sufficient to assess fine-scale genetic structure. The mean coefficient of relatedness among group members is 0.00 +/- 0.10 (n = 9 groups), and there are no surprising patterns in the distribution of pairwise relatedness. We conclude that A. percula live in groups of unrelated individuals. This study lays the foundation for further investigations of behavioural, population and community ecology of anemonefishes which are emerging as model systems for evolutionary ecology in the marine environment. PMID:17845439

Buston, Peter M; Bogdanowicz, Steven M; Wong, Alex; Harrison, Richard G

2007-09-01

70

Fanconi Anemia Group J Helicase and MRE11 Nuclease Interact To Facilitate the DNA Damage Response  

PubMed Central

FANCJ mutations are linked to Fanconi anemia (FA) and increase breast cancer risk. FANCJ encodes a DNA helicase implicated in homologous recombination (HR) repair of double-strand breaks (DSBs) and interstrand cross-links (ICLs), but its mechanism of action is not well understood. Here we show with live-cell imaging that FANCJ recruitment to laser-induced DSBs but not psoralen-induced ICLs is dependent on nuclease-active MRE11. FANCJ interacts directly with MRE11 and inhibits its exonuclease activity in a specific manner, suggesting that FANCJ regulates the MRE11 nuclease to facilitate DSB processing and appropriate end resection. Cells deficient in FANCJ and MRE11 show increased ionizing radiation (IR) resistance, reduced numbers of ?H2AX and RAD51 foci, and elevated numbers of DNA-dependent protein kinase catalytic subunit foci, suggesting that HR is compromised and the nonhomologous end-joining (NHEJ) pathway is elicited to help cells cope with IR-induced strand breaks. Interplay between FANCJ and MRE11 ensures a normal response to IR-induced DSBs, whereas FANCJ involvement in ICL repair is regulated by MLH1 and the FA pathway. Our findings are discussed in light of the current model for HR repair. PMID:23530059

Suhasini, Avvaru N.; Sommers, Joshua A.; Muniandy, Parameswary A.; Coulombe, Yan; Cantor, Sharon B.; Masson, Jean-Yves; Seidman, Michael M.

2013-01-01

71

Critical effect of the N2 amino group on structure, dynamics, and elasticity of DNA polypurine tracts.  

PubMed Central

Unrestrained 5-20-ns explicit-solvent molecular dynamics simulations using the Cornell et al. force field have been carried out for d[GCG(N)11GCG]2 (N, purine base) considering guanine*cytosine (G*C), adenine*thymine (A*T), inosine*5-methyl-cytosine (I*mC), and 2-amino-adenine*thymine (D*T) basepairs. The simulations unambiguously show that the structure and elasticity of N-tracts is primarily determined by the presence of the amino group in the minor groove. Simulated A-, I-, and AI-tracts show almost identical structures, with high propeller twist and minor groove narrowing. G- and D-tracts have small propeller twisting and are partly shifted toward the A-form. The elastic properties also differ between the two groups. The sequence-dependent electrostatic component of base stacking seems to play a minor role. Our conclusions are entirely consistent with available experimental data. Nevertheless, the propeller twist and helical twist in the simulated A-tract appear to be underestimated compared to crystallographic studies. To obtain further insight into the possible force field deficiencies, additional multiple simulations have been made for d(A)10, systematically comparing four major force fields currently used in DNA simulations and utilizing B and A-DNA forms as the starting structure. This comparison shows that the conclusions of the present work are not influenced by the force field choice. PMID:11964246

Lankas, Filip; Cheatham, Thomas E; Spacková, Nad'a; Hobza, Pavel; Langowski, Jörg; Sponer, Jirí

2002-01-01

72

Structural studies of the high mobility group globular domain and basic tail of HMG-D bound to disulfide cross-linked DNA.  

PubMed

HMG-D is an abundant high mobility group chromosomal protein present during early embryogenesis in Drosophila melanogaster. It is a non-sequence-specific member of a protein family that uses the HMG domain for binding to DNA in the minor groove. The highly charged C-terminal tail of HMG-D contains AK motifs that contribute to high-affinity non-sequence-specific DNA binding. To understand the interactions of the HMG domain and C-terminal tail of HMG-D with DNA in solution, a complex between a high-affinity truncated form of the protein and a disulfide cross-linked DNA fragment was studied using heteronuclear NMR techniques. Despite its relatively high affinity for the single "prebent" site on the DNA, K(d) = 1.4 nM, HMG-D forms a non-sequence-specific complex with the DNA as indicated by exchange broadening of the protein resonances at the DNA interface in solution. The secondary structural elements of the protein are preserved when the protein is complexed with the DNA, and the DNA-binding interface maps to the regions of the protein where the largest chemical shift differences occur. The C-terminal tail of HMG-D confers high-affinity DNA binding, has an undefined structure, and appears to make direct contacts in the major groove of DNA via residues that are potentially regulated by phosphorylation. We conclude that while the HMG domain of HMG-D recognizes DNA with a mode of binding similar to that used by the sequence-specific HMG domain transcription factors, there are noteworthy differences in the structure and interactions of the C-terminal end of the DNA-binding domain and the C-terminal tail. PMID:10933789

Dow, L K; Jones, D N; Wolfe, S A; Verdine, G L; Churchill, M E

2000-08-15

73

Complex evolution of tandem-repetitive DNA in the Chironomus thummi species group.  

PubMed

The subspecies Chironomus thummi thummi and C. t. piger display dramatic differences in the copy number and chromosomal localization of a tandemly repeated DNA family (Cla elements). In order to analyze the evolutionary dynamics of this repeat family, we studied the organization of Cla elements in the related outgroup species C. luridus. We find three different patterns of Cla element organization in C. luridus, showing that Cla elements may be either strictly tandem-repetitive or be an integral part of two higher-order tandem repeats (i.e., Hinf[lur] elements, Sal[lur] elements). All three types of Cla-related repeats are localized in the centromeres of C. luridus chromosomes. This suggests that the dispersed chromosomal localization of Cla elements in C. t. thummi may be the result of an amplification and transposition during evolution of this subspecies. PMID:9060398

Ross, R; Hankeln, T; Schmidt, E R

1997-03-01

74

Modulation of the DNA-binding activity of Saccharomyces cerevisiae MSH2-MSH6 complex by the high-mobility group protein NHP6A, in vitro.  

PubMed

DNA mismatch repair corrects mispaired bases and small insertions/deletions in DNA. In eukaryotes, the mismatch repair complex MSH2-MSH6 binds to mispairs with only slightly higher affinity than to fully paired DNA in vitro. Recently, the high-mobility group box1 protein, (HMGB1), has been shown to stimulate the mismatch repair reaction in vitro. In yeast, the closest homologs of HMGB1 are NHP6A and NHP6B. These proteins have been shown to be required for genome stability maintenance and mutagenesis control. In this work, we show that MSH2-MSH6 and NHP6A modulate their binding to DNA in vitro. Binding of the yeast MSH2-MSH6 to homoduplex regions of DNA significantly stimulates the loading of NHP6A. Upon binding of NHP6A to DNA, MSH2-MSH6 is excluded from binding unless a mismatch is present. A DNA binding-impaired MSH2-MSH6F337A significantly reduced the loading of NHP6A to DNA, suggesting that MSH2-MSH6 binding is a requisite for NHP6A loading. MSH2-MSH6 and NHP6A form a stable complex, which is responsive to ATP on mismatched substrates. These results suggest that MSH2-MSH6 binding to homoduplex regions of DNA recruits NHP6A, which then prevents further binding of MSH2-MSH6 to these sites unless a mismatch is present. PMID:19843605

Labazi, Mohamed; Jaafar, Lahcen; Flores-Rozas, Hernan

2009-12-01

75

Modulation of the DNA-binding activity of Saccharomyces cerevisiae MSH2–MSH6 complex by the high-mobility group protein NHP6A, in vitro  

PubMed Central

DNA mismatch repair corrects mispaired bases and small insertions/deletions in DNA. In eukaryotes, the mismatch repair complex MSH2–MSH6 binds to mispairs with only slightly higher affinity than to fully paired DNA in vitro. Recently, the high-mobility group box1 protein, (HMGB1), has been shown to stimulate the mismatch repair reaction in vitro. In yeast, the closest homologs of HMGB1 are NHP6A and NHP6B. These proteins have been shown to be required for genome stability maintenance and mutagenesis control. In this work, we show that MSH2–MSH6 and NHP6A modulate their binding to DNA in vitro. Binding of the yeast MSH2–MSH6 to homoduplex regions of DNA significantly stimulates the loading of NHP6A. Upon binding of NHP6A to DNA, MSH2–MSH6 is excluded from binding unless a mismatch is present. A DNA binding-impaired MSH2–MSH6F337A significantly reduced the loading of NHP6A to DNA, suggesting that MSH2–MSH6 binding is a requisite for NHP6A loading. MSH2–MSH6 and NHP6A form a stable complex, which is responsive to ATP on mismatched substrates. These results suggest that MSH2–MSH6 binding to homoduplex regions of DNA recruits NHP6A, which then prevents further binding of MSH2–MSH6 to these sites unless a mismatch is present. PMID:19843605

Labazi, Mohamed; Jaafar, Lahcen; Flores-Rozas, Hernan

2009-01-01

76

Group I introns in small subunit ribosomal DNA of several Phaeosphaeria species  

Technology Transfer Automated Retrieval System (TEKTRAN)

In a study of small subunit ribosomal RNA (SSU-rRNA) gene sequences in Phaeosphaeria species, group I introns were found in 9 of 10 P. avenaria f.sp. avenaria (Paa) isolates, 1 of 2 Phaeosphaeria sp. (P-rye) isolates from Polish rye (Sn48-1), 1 Phaeosphaeria sp. from dallis grass (P-dg) (S-93-48) an...

77

Control region sequences for East Asian individuals in the Scientific Working Group on DNA Analysis Methods forensic mtDNA data set.  

PubMed

The Scientific Working Group on DNA Analysis Methods (SWGDAM) mitochondrial DNA (mtDNA) population data set is used to infer the relative rarity of mtDNA profiles obtained from evidence samples and of profiles used to identify missing persons. In this study, the East Asian haplogroup patterns in the SWGDAM data sets were analyzed in a phylogenetic context to determine relevant single nucleotide polymorphisms (SNPs) and to describe haplogroup distributions for Asians (n = 753; with a breakdown of individuals from China n = 356, Korea n = 182, Japan n = 163, and Thailand n = 52). We focus on the patterns observed in the SWGDAM Chinese data set and refer to interesting differences in the smaller subgroup data sets for the other East Asian populations (Japanese, Korean, and Thai). A total of 218 SNPs were observed in the data set, including 37 observed positions not previously reported. In the largest of the East Asian SWGDAM data sets (Chinese), these SNPs ranged from having 1 to 29 changes in the phylogenetic tree, with site 16519 being the most variable. On average there were 4.5 changes for a character on the tree. The most variable sites (with 14 or more changes each listed from fastest to slowest) observed were 16519 (L = 29), 16311 (L = 27), 152 (L = 24), 146 (L = 21), 16172 (L = 17), 16189 (L = 17), 195 (L = 16), 16362 (L = 15), 16093 (L = 14), 16129 (L = 14) and 150 (L = 14). These rapidly changing sites are consistent with other published analyses. Only 28 SNPs are needed to identify all clusters containing 1% (n = 7) or more individuals in the East Asian data set. All 36 haplogroups previously observed in East Asian populations were also seen in the SWGDAM data sets and include: A, B, B4, B4a, B4b, B5a, B5b, C, D, D4, D4a, D4b, D5, D5a, F, F1, F1a, F1b, F1c, F2a, G2, G2a, M, M7a1, M7b, M7b1, M7b2, M7c, M8a, M9, M10, N9a, R, R9a, Y, and Z. Haplogroups A, B4a, D4, and F1a were the most commonly observed clusters in the Chinese data set (the largest of the data sets) with each of these occurring in more than 6% of the samples in the data set. The next most common haplogroups in the Chinese data set include the clusters C, M7b1, and N9a with each observed at frequencies greater than or equal to 4%. European Caucasian, and African haplogroups were rarely observed within the East Asian data sets. The various analyses revealed that the data set was similar to published East Asian data sets such as those from Han Chinese. PMID:15177069

Allard, Marc W; Wilson, Mark R; Monson, Keith L; Budowle, Bruce

2004-03-01

78

Effect of pendant group on pDNA delivery by cationic-?-cyclodextrin:alkyl-PVA-PEG pendant polymer complexes.  

PubMed

We have previously shown that cationic-?-cyclodextrin:R-poly(vinyl alcohol)-poly(ethylene glycol) (CD+:R-PVA-PEG) pendant polymer host:guest complexes are safe and efficient vehicles for nucleic acid delivery, where R = benzylidene-linked adamantyl or cholesteryl esters. Herein, we report the synthesis and biological performance of a family of PVA-PEG pendant polymers whose pendant groups have a wide range of different affinities for the ?-CD cavity. Cytotoxicity studies revealed that all of the cationic-?-CD:pendant polymer host:guest complexes have 100-1000-fold lower toxicity than branched polyethylenimine (bPEI), with pDNA transfection efficiencies that are comparable to bPEI and Lipofectamine 2000. Complexes formed with pDNA at N/P ratios greater than 5 produced particles with diameters in the 100-170 nm range and ?-potentials of 15-35 mV. Gel shift and heparin challenge experiments showed that the complexes are most stable at N/P ? 10, with adamantyl- and noradamantyl-modified complexes displaying the best resistance toward heparin-induced decomplexation. Disassembly rates of fluoresceinated-pDNA:CD(+):R-PVA-PEG-rhodamine complexes within HeLa cells showed a modest dependence on host:guest binding constant, with adamantyl-, noradamantyl-, and dodecyl-based complexes showing the highest loss in FRET efficiency 9 h after cellular exposure. These findings suggest that the host:guest binding constant has a significant impact on the colloidal stability in the presence of serum and cellular uptake efficiency, whereas endosomal disassembly and transfection performance of cationic-?-CD:R-poly(vinyl alcohol)-poly(ethylene glycol) pendant polymer complexes appears to be controlled by the hydrolysis rates of the acetal grafts onto the PVA main chain. PMID:24295406

Kulkarni, Aditya; Badwaik, Vivek; DeFrees, Kyle; Schuldt, Ryan A; Gunasekera, Dinara S; Powers, Cory; Vlahu, Alexander; VerHeul, Ross; Thompson, David H

2014-01-13

79

Cloning, expression, and analysis of a cDNA coding for the Dermatophagoides farinae group 21 (Der f 21) allergen  

PubMed Central

Domestic mite species like Dermatophagoides farinae induce allergies in people worldwide. Here, the cDNA coding for group 21 allergen of Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) from China was cloned, sequenced, and expressed in E. coli to aid in the development of diagnostic and treatment options for domestic mite hypersensitivity. First, the Der f 21 cDNA fragment was synthesized by RT-PCR; the confirmed full-length sequence comprised 411 nucleotides. The cDNA was ligated to the vector pCold-TF to construct an expression plasmid, pCold-TF-Der f 21. pCold-Tf-Der f 21 was transformed into E. coli BL21 cells, and its expression was induced by IPTG treatment. SDS-PAGE showed a specific band at the predicted molecular weight of Der f 21, demonstrating its successful expression. The recombinant fusion protein was obtained and its structure and molecular weight were confirmed by MALDI-TOF/TOF. Bioinformatics analysis revealed that the protein contained a signal peptide of 17 amino acids. The molecular weight of the mature Der f 21 allergen was approximately 14.16 kDa with a theoretical pI of 4.87. Its predicted secondary structure comprises a-helix (84.03%), extension chain (1.68%), and random coil (14.29%). The successful cloning of Der f 21 and a basic bioinformatics analysis of the protein provide a foundation for further study of this allergen in diagnosis and treatment of domestic mite hypersensitivity.

Cui, Yubao; Jiang, Yongqian; Ji, Youlin; Zhou, Ying; Yu, Lili; Wang, Nan; Yang, Li; Zhang, Chengbo

2014-01-01

80

Microsatellite DNA analysis shows that greater sage grouse leks are not kin groups.  

PubMed

The spectacular social courtship displays of lekking birds are thought to evolve via sexual selection, but this view does not easily explain the participation of many males that apparently fail to mate. One of several proposed solutions to this 'lek skew paradox' is that kin selection favours low-ranking males joining leks to increase the fitness of closely related breeders. We investigated the potential for kin selection to operate in leks of the greater sage grouse, Centrocercus urophasianus, by estimating relatedness between lekking males using microsatellite DNA markers. We also calibrated these estimates using data from known families. Mean relatedness within leks was statistically indistinguishable from zero. We also found no evidence for local clustering of kin during lek display, although males tended to range closer to kin when off the lek. These results make kin selection an unlikely solution to the lek skew paradox in sage grouse. Together with other recent studies, they also raise the question of why kin selection apparently promotes social courtship in some lekking species, but not in others. PMID:16313605

Gibson, Robert M; Pires, Debra; Delaney, Kathleen S; Wayne, Robert K

2005-12-01

81

A Gynecologic Oncology Group Study of Platinum-DNA Adducts and Excision Repair Cross-Complementation Group 1 Expression in Optimal, Stage III Epithelial Ovarian Cancer Treated with Platinum-Taxane Chemotherapy  

Microsoft Academic Search

To determine whether platinum-DNA adducts and\\/or mRNA expression of the excision nuclease excision repair cross- complementation group 1 (ERCC1) from peripheral blood leukocytes (PBL) were associated with clinical outcome in women with epithelial ovarian cancer (EOC), participants that had previously untreated, optimally resected, stage III EOC were randomized to paclitaxel plus cisplatin or carboplatin. DNA and RNA were extracted from

Kathleen M. Darcy; Chunqiao Tian; Eddie Reed

82

Sequence-length variation of mtDNA HVS-I C-stretch in Chinese ethnic groups*  

PubMed Central

The purpose of this study was to investigate mitochondrial DNA (mtDNA) hypervariable segment-I (HVS-I) C-stretch variations and explore the significance of these variations in forensic and population genetics studies. The C-stretch sequence variation was studied in 919 unrelated individuals from 8 Chinese ethnic groups using both direct and clone sequencing approaches. Thirty eight C-stretch haplotypes were identified, and some novel and population specific haplotypes were also detected. The C-stretch genetic diversity (GD) values were relatively high, and probability (P) values were low. Additionally, C-stretch length heteroplasmy was observed in approximately 9% of individuals studied. There was a significant correlation (r=?0.961, P<0.01) between the expansion of the cytosine sequence length in the C-stretch of HVS-I and a reduction in the number of upstream adenines. These results indicate that the C-stretch could be a useful genetic maker in forensic identification of Chinese populations. The results from the Fst and dA genetic distance matrix, neighbor-joining tree, and principal component map also suggest that C-stretch could be used as a reliable genetic marker in population genetics. PMID:19816995

Chen, Feng; Dang, Yong-hui; Yan, Chun-xia; Liu, Yan-ling; Deng, Ya-jun; Fulton, David J. R.; Chen, Teng

2009-01-01

83

Organization of the BcgI restriction–modification protein for the transfer of one methyl group to DNA  

PubMed Central

The Type IIB restriction–modification protein BcgI contains A and B subunits in a 2:1 ratio: A has the active sites for both endonuclease and methyltransferase functions while B recognizes the DNA. Like almost all Type IIB systems, BcgI needs two unmethylated sites for nuclease activity; it cuts both sites upstream and downstream of the recognition sequence, hydrolyzing eight phosphodiester bonds in a single synaptic complex. This complex may incorporate four A2B protomers to give the eight catalytic centres (one per A subunit) needed to cut all eight bonds. The BcgI recognition sequence contains one adenine in each strand that can be N6-methylated. Although most DNA methyltransferases operate at both unmethylated and hemi-methylated sites, BcgI methyltransferase is only effective at hemi-methylated sites, where the nuclease component is inactive. Unlike the nuclease, the methyltransferase acts at solitary sites, functioning catalytically rather than stoichiometrically. Though it transfers one methyl group at a time, presumably through a single A subunit, BcgI methyltransferase can be activated by adding extra A subunits, either individually or as part of A2B protomers, which indicates that it requires an assembly containing at least two A2B units. PMID:23147004

Smith, Rachel M.; Jacklin, Alistair J.; Marshall, Jacqueline J. T.; Sobott, Frank; Halford, Stephen E.

2013-01-01

84

DNA methylation of polycomb group target genes in cores taken from breast cancer centre and periphery  

Microsoft Academic Search

We previously demonstrated that methylation of neugogenic differentiation 1 (NEUROD1) gene, a polycomb group target (PCGT) gene is a predictor of response to neoadjuvant chemotherapy in breast cancer. Here,\\u000a we address the question whether NEUROD1 methylation provides clinical information independent from its expression level, and whether PCGT methylation is homogeneous\\u000a in breast cancer. We examined: (1) NEUROD1 methylation and mRNA

Evangelia-Ourania Fourkala; Cornelia Hauser-Kronberger; Sophia Apostolidou; Matthew Burnell; Allison Jones; Johannes Grall; Roland Reitsamer; Heidi Fiegl; Ian Jacobs; Usha Menon; Martin Widschwendter

2010-01-01

85

Mitochondrial DNA diversity in two ethnic groups in southeastern Kenya: perspectives from the northeastern periphery of the Bantu expansion  

PubMed Central

The Bantu languages are widely distributed throughout sub-Saharan Africa. Genetic research supports linguists and historians who argue that migration played an important role in the spread of this language family, but the genetic data also indicates a more complex process involving substantial gene flow with resident populations. In order to understand the Bantu expansion process in east Africa, mtDNA hypervariable region I variation in 352 individuals from the Taita and Mijikenda ethnic groups was analyzed, and we evaluated the interactions that took place between the Bantu- and non-Bantu-speaking populations in east Africa. The Taita and Mijikenda are Bantu-speaking agropastoralists from southeastern Kenya, at least some of whose ancestors probably migrated into the area as part of Bantu migrations that began around 3,000 BCE. Our analyses indicate that they show some distinctive differences that reflect their unique cultural histories. The Taita are genetically more diverse than the Mijikenda with larger estimates of genetic diversity. The Taita cluster with other east African groups, having high frequencies of haplogroups from that region, while the Mijikenda have high frequencies of central African haplogroups and cluster more closely with central African Bantu-speaking groups. The non-Bantu speakers who lived in southeastern Kenya before Bantu speaking groups arrived were at least partially incorporated into what are now Bantu-speaking Taita groups. In contrast, gene flow from non-Bantu speakers into the Mijikenda was more limited. These results suggest a more complex demographic history where the nature of Bantu and non-Bantu interactions varied throughout the area. PMID:23382080

Batai, Ken; Babrowski, Kara B.; Arroyo, Juan Pablo; Kusimba, Chapurukha M.; Williams, Sloan R.

2013-01-01

86

No Differences in DNA Damage and Antioxidant Capacity Between Intervention Groups of Healthy, Nonsmoking Men Receiving 2, 5, or 8 Servings\\/Day of Vegetables and Fruit  

Microsoft Academic Search

The effects of different intake levels of vegetables and fruit (VF) on some cancer-relevant biomarkers such as DNA damage and oxidative stress were investigated. In a randomized controlled trial, 64 nonsmoking male subjects were asked to consume a diet with 2 servings of VF\\/day for 4 wk. Then subjects were randomly assigned to 1 of 3 groups with either a

Karlis Briviba; Achim Bub; Jutta Möseneder; Tanja Schwerdtle; Andrea Hartwig; Sabine Kulling; Bernhard Watzl

2008-01-01

87

Genetic linkage relationships between the Xg blood group system and two X chromosome DNA polymorphisms in families with Duchenne and Becker muscular dystrophy  

Microsoft Academic Search

The existence of linkage has been investigated between the Xg blood group system, two DNA restriction fragment length polymorphisms (RFLPs) located on the short arm of the X chromosome, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD). No linkage was found between the Xg locus and the more proximal RFLP (L1.28); close linkage between Xg and the more distal

M. Sarfarazi; P. S. Harper; H. M. Kingston; J. M. Murray; T. O'Brien; K. E. Davies; R. Williamson; P. Tippett; R. Sanger

1983-01-01

88

A DNA vaccine encoding a chimeric allergen derived from major group 1 allergens of dust mite can be used for specific immunotherapy  

PubMed Central

Immunization with DNA-based constructs has been shown to be against the antigen and the response is skewed in such a way as to ameliorate the symptoms of allergic disease. This approach is particularly useful in the treatment of allergic inflammatory diseases, such as asthma. The major group 1 allergen from house dust mites is one of the triggers of allergic asthma. This study explores whether a chimeric gene R8, derived from the major group 1 allergen of house dust mite species (Dermatophagoides farinae and Dermatophagoides pteronyssinus), can be expressed in Human Embryonic Kidney 293 cells (HEK 293T) and whether such a construct can be used as a DNA vaccine in asthma therapy. The eukaryotic expression vector pcDNA3.1 was used to express the R8 molecule in HEK 293T cells and successful expression of R8 was confirmed using a fluorescence microscope and western blot analysis. The efficacy of R8 as DNA vaccine was also assessed in a mouse asthma model. The in vivo data showed that R8 rectified the TH1/TH2 imbalance typical of allergic inflammation and stimulated the proliferation of regulatory T (Treg) cells. Immunization with the R8 construct also decreased serum allergen-specific IgE production in this mouse asthma model. Our findings suggest that R8 may be a feasible potential DNA vaccine for specific immunotherapy (SIT) in the treatment of allergic asthma. PMID:25337189

Sun, Tong; Yin, Kang; Wu, Lu-Yi; Jin, Wen-Jie; Li, Yang; Sheng, Bin; Jiang, Yu-Xin

2014-01-01

89

Induction of cytokine production in cholesteatoma keratinocytes by extracellular high-mobility group box chromosomal protein 1 combined with DNA released by apoptotic cholesteatoma keratinocytes.  

PubMed

High-mobility group box chromosomal protein 1 (HMGB-1), a nuclear DNA binding protein, was recently rediscovered as a new proinflammatory cytokine. The purpose of this study was to determine HMGB-1 expression in vivo and to identify the effect of extracellular HMGB-1 in inflammatory process associated with bone destruction in cholesteatoma. We investigated the expression and location of HMGB-1 in the cholesteatoma and healthy skin using an immunofluorescence assay. We also detected apoptosis and DNA fragments in the cholesteatoma by TUNEL staining. HMGB-1 concentration in apoptotic supernatants from UV light-treated cells, culture supernatants and its translocation in cholesteatoma keratinocytes stimulated by supernatants from UV light-treated cells were measured by immunoblot analysis and immunofluorescence assay. Cultures of human cholesteatoma keratinocytes were exposed to CpG-DNA, HMGB-1, or CpG-DNA complexed to HMGB-1 for 24 h. Cytokines in the culture supernatant were measured by ELISA. In addition, levels of proinflammatory cytokines released by cholesteatoma keratinocytes stimulated by supernatants from UV light-treated cells with or without anti-HMGB-1 antibodies and supernatants from UV light-treated cells with DNase 1 were measured by enzyme-linked immunosorbent assay. The expression of HMGB-1 in cholesteatoma increased and it translocated both to the cytoplasm and extracellular space. Furthermore, the HMGB-1 concentration in supernatants increased significantly after addition of supernatants from UV light-treated cells. TNF-? and IL-1? can be induced by purified HMGB-1 combined with CpG-DNA in the cholesteatoma keratinocytes. In addition, supernatants of apoptotic cells containing HMGB-1-DNA were effective in inducing TNF-? and IL-1? secretion. This study suggested that persistent expression of extracellular HMGB-1 and DNA fragments in cholesteatoma leads to TNF-? and IL-1? production, causing bone resorption and destruction. Thus, we have implicated that HMGB-1-DNA complexes might act as a key molecule involved in bone resorption associated with cholesteatoma. PMID:25416861

Chi, Zhangcai; Wang, Zhengmin; Liang, Qiong; Zhu, Yaying; du, Qiang

2015-02-01

90

Conjugative plasmids of enteric bacteria from many different incompatibility groups have similar genes for single-stranded DNA-binding proteins.  

PubMed Central

Among 30 conjugative plasmids of enteric bacteria from 23 incompatibility (Inc) groups, we found 19 (from 12 Inc groups) which can complement defects caused by a defective single-stranded DNA-binding protein of Escherichia coli K-12. The genes which are responsible for the complementation from three of these plasmids (Inc groups I1, Y, and 9) were cloned. These genes showed extensive homology with each other and with the E. coli F factor ssb gene (formerly denoted ssf), which codes for a single-stranded DNA binding protein. The proteins coded for by the cloned genes bound tightly to single-stranded DNA. Six other ssb- -complementing plasmids were tested for homology to the F factor ssb gene, and all of these showed homology, as did one of the ssb- -noncomplementing plasmids. Plasmids from a total of 13 different Inc groups of enteric bacteria were found to be likely to have genes with some homology to the ssb gene of the F factor. For plasmids from several different Inc groups, we found no evidence for strong homology with ssb of the F factor. Images PMID:3884590

Golub, E I; Low, K B

1985-01-01

91

mtDNA G10398A variation provides risk to type 2 diabetes in population group from the Jammu region of India  

PubMed Central

Mitochondrion plays an integral role in glucose metabolism and insulin secretion. Mitochondrial electron-transport chain (ETC) is involved in adenosine triphosphate (ATP) generation and ATP mediated insulin secretion in pancreatic ?-cells. ?-cell dysfunction is a critical component in the pathogenesis of type 2 diabetes (T2D). The mtDNA G10398A variation (amino acid change: Alanine ? Threonine) within the NADH dehydrogenase (ND3) subunit of complex I of mtDNA ETC, has emerged as a variation of clinical significance in various disorders including T2D. This variation is supposed to result in altered complex I function, leading to an increased rate of electron leakage and reactive oxygen species (ROS) production, which might cause ?-cell damage and impaired insulin secretion. The aim of the study was to explore the association of mtDNA G10398A variation with T2D in a total of 439 samples (196 T2D cases and 243 healthy controls) belonging to the Jammu region of Jammu and Kashmir (J&K). The candidate gene association analyses showed significant association of mtDNA G10398A variant with T2D and the estimated odds ratio (OR) was 2.83 (1.64–4.90 at 95% CI) in the studied population group. The extent of genetic heterogeneity in T2D and diversity of the Indian population groups, make such replication studies pertinent to understand the etiology of T2D in these population groups. PMID:25606409

Sharma, Varun; Sharma, Indu; Singh, Vishav Pratap; Verma, Sonali; Pandita, Anil; Singh, Vinod; Rai, Ekta; Sharma, Swarkar

2014-01-01

92

DNA Build  

NSDL National Science Digital Library

Students reinforce their knowledge that DNA is the genetic material for all living things by modeling it using toothpicks and gumdrops that represent the four biochemicals (adenine, thiamine, guanine, and cytosine) that pair with each other in a specific pattern, making a double helix. They investigate specific DNA sequences that code for certain physical characteristics such as eye and hair color. Student teams trade DNA "strands" and de-code the genetic sequences to determine the physical characteristics (phenotype) displayed by the strands (genotype) from other groups. Students extend their knowledge to learn about DNA fingerprinting and recognizing DNA alterations that may result in genetic disorders.

Integrated Teaching And Learning Program

93

DNA conjugation andDNA conjugation and reversibility onreversibility on  

E-print Network

DNA conjugation andDNA conjugation and reversibility onreversibility on chitosan surfaceschitosan surfaceschitosan surfaceschitosan surfaces Rubloff Research Group Accomplishments #12;DNA conjugation and reversibility onDNA conjugation and reversibility on chitosan surfaceschitosan surfaces Accomplishment Single

Rubloff, Gary W.

94

Cloning of glycoprotein D cDNA, which encodes the major subunit of the Duffy blood group system and the receptor for the Plasmodium vivax malaria parasite.  

PubMed Central

cDNA clones encoding the major subunit of the Duffy blood group were isolated from a human bone marrow cDNA library using a PCR-amplified DNA fragment encoding an internal peptide sequence of glycoprotein D (gpD) protein. The open reading frame of the 1267-bp cDNA clone indicated that gpD protein was composed of 338 amino acids, predicting a M(r) of 35,733, which was the same as a deglycosylated gpD protein. Portions of the predicted amino acid sequence, matched with six CNBr/pepsin peptides obtained from affinity-purified gpD protein. In ELISA analysis, an anti-Duffy murine monoclonal antibody reacted with a synthetic peptide deduced from the cDNA clone. Hydropathy analysis suggested the presence of 9 membrane-spanning alpha-helices. In bone marrow RNA blot analysis, the gpD cDNA detected a 1.27-kb mRNA in Duffy-positive but not in Duffy-negative individuals. It also identified the same size mRNA in adult kidney, adult spleen, and fetal liver; in brain, it detected a prominent 8.5-kb and a minor 2.2-kb mRNA. In Southern blot analysis, gpD cDNA identified a single gene in Duffy-positive and -negative individuals. Duffy-negative individuals, therefore, have the gpD gene, but it is not expressed in bone marrow. The same or a similar gene is active in adult kidney, adult spleen, and fetal liver of Duffy-positive individuals. Whether this is true in Duffy-negative individuals remains to be demonstrated. A GenBank sequence search yielded a significant protein sequence homology to human and rabbit interleukin-8 receptors. Images Fig. 3 Fig. 4 PMID:8248172

Chaudhuri, A; Polyakova, J; Zbrzezna, V; Williams, K; Gulati, S; Pogo, A O

1993-01-01

95

A Feasible Approach to Evaluate the Relative Reactivity of NHS-Ester Activated Group with Primary Amine-Derivatized DNA Analogue and Non-Derivatized Impurity.  

PubMed

Synthetic DNA analogues with improved stability are widely used in life science. The 3'and/or 5' equivalent terminuses are often derivatized by attaching an active group for further modification, but a certain amount of non-derivatized impurity often remains. It is important to know to what extent the impurity would influence further modification. The reaction of an NHS ester with primary amine is one of the most widely used options to modify DNA analogues. In this short communication, a 3'-(NH2-biotin)-derivatized morpholino DNA analogue (MORF) was utilized as the model derivatized DNA analogue. Inclusion of a biotin concomitant with the primary amine at the 3'-terminus allows for the use of streptavidin to discriminate between the products from the derivatized MORF and non-derivatized MORF impurity. To detect the MORF reaction with NHS ester, S-acetyl NHS-MAG3 was conjugated to the DNA analogue for labeling with (99m)Tc, a widely used nuclide in the clinic. It was found that the non-derivatized MORF also reacted with the S-acetyl NHS-MAG3. Radiolabeling of the product yielded an equally high labeling efficiency. Nevertheless, streptavidin binding indicated that under the conditions of this investigation, the non-derivatized MORF was five times less reactive than the amine-derivatized MORF. PMID:25621701

Dou, Shuping; Virostko, John; Greiner, Dale L; Powers, Alvin C; Liu, Guozheng

2015-02-01

96

[Genetic diversity and relatives of the goitered gazelle (Gazella subgutturosa) groups from Uzbekistan, Turkmenistan, and Azerbaijan: analysis of the D-loop of mitochondrial DNA].  

PubMed

Polymorphism of the nucleotide sequence of a hypervariable fragment of the D-loop (985 bp) of mtDNA in 76 Goitered gazelles of subspecies Gazella subgutturosa subgutturosa from Uzbekistan, Turkmenistan, and Azerbaijan was studied. The genetic similarity of gazelles from Turkmenistan and Uzbekistan has been identified. The population of gazelles from Shirvanskaya steppe reserve (Azerbaijan) is unique and strictly isolated from other groups studied. A high haplotypic (H = 0.9649 +/- 0.0091) and relatively low nucleotide diversity (pi = 0.0212 +/- 0.0105) were noted for all investigated groups of gazelle based on this mtDNA fragment, which is probably related to ecological peculiarities of the species and the history of formation of regional populations. PMID:22292288

Sorokin, P A; Soldatova, N V; Lukarevski?, V S; Kholodova, M V

2011-01-01

97

The SRY High-Mobility-Group Box Recognizes DNA by Partial Intercalation in the Minor Groove: A Topological Mechanism of Sequence Specificity  

Microsoft Academic Search

SRY, a putative transcription factor encoded by the sex-determining region of the human Y chromosome, regulates a genetic switch in male development. Impairment of this switch leads to intersex abnormalities of the newborn and is observed in association with mutations in the SRY DNA-binding domain [the high-mobility-group (HMG) box]. Here we show that the SRY HMG box exhibits a novel

Chih-Yen King; Michael A. Weiss

1993-01-01

98

Analysis of body fluid mixtures by mtDNA sequencing: An inter-laboratory study of the GEP-ISFG working group.  

PubMed

The mitochondrial DNA (mtDNA) working group of the GEP-ISFG (Spanish and Portuguese Group of the International Society for Forensic Genetics) carried out an inter-laboratory exercise consisting of the analysis of mtDNA sequencing patterns in mixed stains (saliva/semen and blood/semen). Mixtures were prepared with saliva or blood from a female donor and three different semen dilutions (pure, 1:10 and 1:20) in order to simulate forensic casework. All labs extracted the DNA by preferential lysis and amplified and sequenced the first mtDNA hypervariable region (HVS-I). Autosomal and Y-STR markers were also analysed in order to compare nuclear and mitochondrial results from the same DNA extracts. A mixed stain prepared using semen from a vasectomized individual was also analysed. The results were reasonably consistent among labs for the first fractions but not for the second ones, for which some laboratories reported contamination problems. In the first fractions, both the female and male haplotypes were generally detected in those samples prepared with undiluted semen. In contrast, most of the mixtures prepared with diluted semen only yielded the female haplotype, suggesting that the mtDNA copy number per cell is smaller in semen than in saliva or blood. Although the detection level of the male component decreased in accordance with the degree of semen dilution, it was found that the loss of signal was not consistently uniform throughout each electropherogram. Moreover, differences between mixtures prepared from different donors and different body fluids were also observed. We conclude that the particular characteristics of each mixed stain can deeply influence the interpretation of the mtDNA evidence in forensic mixtures (leading in some cases to false exclusions). In this sense, the implementation of preliminary tests with the aim of identifying the fluids involved in the mixture is an essential tool. In addition, in order to prevent incorrect conclusions in the interpretation of electropherograms we strongly recommend: (i) the use of additional sequencing primers to confirm the sequencing results and (ii) interpreting the results to the light of the phylogenetic perspective. PMID:16899347

Montesino, M; Salas, A; Crespillo, M; Albarrán, C; Alonso, A; Alvarez-Iglesias, V; Cano, J A; Carvalho, M; Corach, D; Cruz, C; Di Lonardo, A; Espinheira, R; Farfán, M J; Filippini, S; García-Hirschfeld, J; Hernández, A; Lima, G; López-Cubría, C M; López-Soto, M; Pagano, S; Paredes, M; Pinheiro, M F; Rodríguez-Monge, A M; Sala, A; Sóñora, S; Sumita, D R; Vide, M C; Whittle, M R; Zurita, A; Prieto, L

2007-05-01

99

DNA Fingerprinting  

NSDL National Science Digital Library

In this forensics activity, learners solve a mystery using “DNA” taken from the scene of the crime. This activity describes how to collect a “DNA sample” (learner-invented DNA sequence on a roll of paper) from the culprit and from each learner in the group, then run the DNA on a “gel” that covers the floor of the classroom, a hallway, or gymnasium. The crime-scene investigation aspect can become as elaborate as you wish by including additional “clues” such as fingerprints, a ransom note written in a specific type of ink, cloth fibers, eyewitness accounts and more.

Irene Salter

2012-06-26

100

A complex array of DNA-binding proteins required for pairing-sensitive silencing by a polycomb group response element from the Drosophila engrailed gene.  

PubMed Central

Regulatory DNA from the Drosophila gene engrailed causes silencing of a linked reporter gene (mini-white) in transgenic Drosophila. This silencing is strengthened in flies homozygous for the transgene and has been called "pairing-sensitive silencing." The pairing-sensitive silencing activities of a large fragment (2.6 kb) and a small subfragment (181 bp) were explored. Since pairing-sensitive silencing is often associated with Polycomb group response elements (PREs), we tested the activities of each of these engrailed fragments in a construct designed to detect PRE activity in embryos. Both fragments were found to behave as PREs in a bxd-Ubx-lacZ reporter construct, while the larger fragment showed additional silencing capabilities. Using the mini-white reporter gene, a 139-bp minimal pairing-sensitive element (PSE) was defined. DNA mobility-shift assays using Drosophila nuclear extracts suggested that there are eight protein-binding sites within this 139-bp element. Mutational analysis showed that at least five of these sites are important for pairing-sensitive silencing. One of the required sites is for the Polycomb group protein Pleiohomeotic and another is GAGAG, a sequence bound by the proteins GAGA factor and Pipsqueak. The identity of the other proteins is unknown. These data suggest a surprising degree of complexity in the DNA-binding proteins required for PSE function. PMID:11973310

Americo, Jeffrey; Whiteley, Mary; Brown, J Lesley; Fujioka, Miki; Jaynes, James B; Kassis, Judith A

2002-01-01

101

[Gene pool of ethnic groups of the caucasus: results of integrated study of the Y chromosome and mitochondrial DNA and genome-wide data].  

PubMed

Genetic diversity has been analyzed in 22 ethnic groups of the Caucasus on the basis of data on Y-chromosome and mitochondrial DNA (mtDNA) markers, as well as genome-wide data on autosomal single-nucleotide polymorphisms (SNPs). It has been found that the West Asian component is prevailing in all ethnic groups studied except for Nogays. This Near Eastern ancestral component has proved to be characteristic of Caucasian populations and almost entirely absent in their northern neighbors inhabiting the Eastern European Plain. Turkic-speaking populations, except Nogays, did not exhibit an increased proportion of Eastern Eurasian mtDNA or Y-chromosome haplogroups compared to some Abkhaz-Adyghe populations (Adygs and Kabardians). Genome-wide SNP analysis has also shown substantial differences of Nogays from all other Caucasian populations studied. However, the characteristic difference of Nogays from other populations of the Caucasus seems somewhat ambiguous in terms of the R1a1a-M17(M198) and R1b1b1-M73 haplogroups of the Y chromosome. The state of these haplogroups in Turkic-speaking populations of the Caucasus requires further study. PMID:22946333

Khusnutdinova, E K; Litvinov, S S; Kutuev, I A; Iunusbaev, B B; Khusainova, R I; Akhmetova, V L; Ahatova, F S; Metspalu, E; Rootsi, S; Villems, R

2012-06-01

102

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.  

PubMed

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications. PMID:23697550

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

2013-07-01

103

European Mitochondrial DNA Haplogroups and Metabolic Changes during Antiretroviral Therapy in AIDS Clinical Trials Group Study A5142  

PubMed Central

Background Mitochondrial DNA (mtDNA) influences metabolic diseases and perhaps antiretroviral therapy (ART) complications. We explored associations between European mtDNA haplogroups and metabolic changes among A5142 participants. Methods 757 ART-naïve subjects were randomized to one of three class-sparing ART regimens including efavirenz and/or lopinavir/ritonavir with or without nucleoside reverse transcriptase inhibitors (NRTIs). Non-randomized NRTIs included stavudine, tenofovir, or zidovudine, each with lamivudine. Fasting lipid profiles and whole-body dual-energy X-ray absorptiometry (DEXA) were performed. Nine European mtDNA haplogroups were determined for 231 self-identified non-Hispanic white subjects. Metabolic changes from baseline to 96 weeks were analyzed by haplogroup. Results Median age was 39 years, 9% were female, and 37%, 32%, and 30% were randomized to NRTI-containing regimens with either efavirenz or lopinavir/ritonavir, and an NRTI-sparing regimen respectively. Among NRTI-containing regimens, 51% included zidovudine, 28% tenofovir, and 21% stavudine. Compared with other haplogroups, mtDNA haplogroup I (N=10) had higher baseline non-HDL cholesterol (160 mg/dL [interquartile range 137–171] vs. 120 mg/dL [104–136]; p=0.005), a decrease in non-HDL cholesterol over 96 weeks (?14% [?20-+6] vs. +25% [+8-+51]; p<0.001), tended to have more baseline extremity fat, and had more extremity fat loss by DEXA (?13% [?31-+12] vs. +9% [?13-+26]; p=0.08) and lipoatrophy (50% vs. 20%; p=0.04). Haplogroup W (N=5; all randomized to NRTI-sparing regimens) had the greatest increase in extremity fat (+35.5% [+26.8 - +54.9]; P=0.02). Conclusions Lipids and extremity fat were associated with European mtDNA haplogroups in this HIV-infected population. These preliminary results suggest that mitochondrial genomics may influence metabolic parameters before and during ART. PMID:20871389

Hulgan, Todd; Haubrich, Richard; Riddler, Sharon A.; Tebas, Pablo; Ritchie, Marylyn D.; McComsey, Grace A.; Haas, David W.; Canter, Jeffrey A.

2010-01-01

104

International Standards in Forensic DNA  

E-print Network

2014: "Minimum Requirements for DNA Collection, Analysis, and Interpretation" US & Canada Europe Groups · ISFG DNA Commission (International) · FBI DNA Advisory Board (U.S.) · SWGDAM (U.S.) · ENFSI DNA/NZ) · Asian Forensic Science Network DNA WG (Asia) · NCFS and OSAC (U.S.) Butler, J.M. (2013) Forensic DNA

105

Nuclear ribosomal DNA internal transcribed spacer regions (ITS1 and ITS2) define discrete biogeographic groups in Cladophora albida (Chlorophyta)  

Microsoft Academic Search

Nucleotide sequences of the nuclear ribosomal DNA internal transcribed spacers (ITS1 and ITS2), the 5.8S, and short stretches of the adjacent 18S and 26S coding regions were determined in isolates from four disjunct Cladophora albida (Huds.) Kütz. populations (NE-America, W-Europe, Japan, and W-Australia). The two Pacific isolates share nearly identical ITS sequences as do the two Atlantic isolates. In contrast,

Freek T. Bakker; Jeanine L. Olsen; Wytze T. Stam; Hoek van den C

1992-01-01

106

Architectural DNA Binding by a High-Mobility-Group\\/Kinesin-Like Subunit in Mammalian SWI\\/SNF-Related Complexes  

Microsoft Academic Search

The SWI\\/SNF complex in yeast and Drosophila is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. The mechanism by which it is targeted to specific genes is poorly understood and may involve direct DNA binding and\\/or interactions with specific or general transcription factors. We have previously purified a mammalian complex by using antibodies against BRG1,

Weidong Wang; Tianhuai Chi; Yutong Xue; Sharleen Zhou; Ann Kuo; Gerald R. Crabtree

1998-01-01

107

Longitudinal changes in total, 2-LTR circular, and integrated HIV-1 DNA during the first year of HIV-1 infection in CD4Low and CD4High patient groups with HIV-1 subtype AE.  

PubMed

The level of viral DNA in early HIV-1 infection is an important parameter in the prediction of disease progression. Few data have been published on the dynamics of HIV-1 DNA during the first year of HIV infection. In this study, two distinct HIV-1 patient groups were enrolled. Group 1 (CD4High group) maintained their CD4 above 450 cells/?L within 1 year, while Group 2 (CD4Low group) progressed to CD4 below 300 cells/?L. The amounts of total, 2-long terminal repeat (2-LTR) circular, and integrated HIV-1 DNA were determined in the peripheral blood mononuclear cells at 1, 3, 6, and 12 months after HIV infection. Reductions in the amount of total and integrated HIV-1 DNA were detected in the CD4High group during the first year of HIV infection but not in the CD4Low group. Disease progression may be related to the body's ability to control HIV-1 DNA during early HIV-1 infection. PMID:25188292

Zhang, Haihong; Jiao, Yanmei; Li, Hongjun; Zhu, Weijun; Li, Wei; Huang, Xiaojie; Zhang, Yonghong; Zhang, Tong; Lian, Shi; Wu, Hao

2014-11-01

108

RecQ4 facilitates UV light-induced DNA damage repair through interaction with nucleotide excision repair factor xeroderma pigmentosum group A (XPA).  

PubMed

Mutations in the RECQL4 helicase gene have been linked to Rothmund-Thomson syndrome, which is characterized by genome instability, cancer susceptibility, and premature aging. To better define the cellular function of the RecQ4 protein, we investigated the subcellular localization of RecQ4 upon treatment of cells with different DNA-damaging agents including UV irradiation, 4-nitroquinoline 1-oxide, camptothecin, etoposide, hydroxyurea, and H(2)O(2). We found that RecQ4 formed discrete nuclear foci specifically in response to UV irradiation and 4-nitroquinoline 1-oxide. We demonstrated that functional RecQ4 was required for the efficient removal of UV lesions and could rescue UV sensitivity of RecQ4-deficient Rothmund-Thomson syndrome cells. Furthermore, UV treatment also resulted in the colocalization of the nuclear foci formed with RecQ4 and xeroderma pigmentosum group A in human cells. Consistently, RecQ4 could directly interact with xeroderma pigmentosum group A, and this interaction was stimulated by UV irradiation. By fractionating whole cell extracts into cytoplasmic, soluble nuclear, and chromatin-bound fractions, we observed that RecQ4 protein bound more tightly to chromatin upon UV irradiation. Taken together, our findings suggest a role of RecQ4 in the repair of UV-induced DNA damages in human cells. PMID:18693251

Fan, Wei; Luo, Jianyuan

2008-10-24

109

Phylogenetic analysis of LSU and SSU rDNA group I introns of lichen photobionts associated with the genera Xanthoria and Xanthomendoza (Teloschistaceae, lichenized Ascomycetes)  

PubMed Central

We studied group I introns in sterile cultures of selected groups of lichen photobionts, focusing on Trebouxia species associated with Xanthoria s. lat. (including Xanthomendoza spp.; lichen-forming ascomycetes). Group I introns were found inserted after position 798 (Escherichia coli numbering) in the large subunit (LSU) rRNA in representatives of the green algal genera Trebouxia and Asterochloris. The 798 intron was found in about 25% of Xanthoria photobionts including several reference strains obtained from algal culture collections. An alignment of LSU-encoded rDNA intron sequences revealed high similarity of these sequences allowing their phylogenetic analysis. The 798 group I intron phylogeny was largely congruent with a phylogeny of the Internal Transcribed Spacer Region (ITS), indicating that the insertion of the intron most likely occurred in the common ancestor of the genera Trebouxia and Asterochloris. The intron was vertically inherited in some taxa, but lost in others. The high sequence similarity of this intron to one found in Chlorella angustoellipsoidea suggests that the 798 intron was either present in the common ancestor of Trebouxiophyceae, or that its present distribution results from more recent horizontal transfers, followed by vertical inheritance and loss. Analysis of another group I intron shared by these photobionts at small subunit (SSU) position 1512 supports the hypothesis of repeated lateral transfers of this intron among some taxa, but loss among others. Our data confirm that the history of group I introns is characterized by repeated horizontal transfers, and suggests that some of these introns have ancient origins within Chlorophyta. PMID:24415800

Nyati, Shyam; Bhattacharya, Debashish; Werth, Silke; Honegger, Rosmarie

2013-01-01

110

DNA evidence on the phylogenetic systematics of New World monkeys: support for the sister-grouping of Cebus and Saimiri from two unlinked nuclear genes.  

PubMed

Previous inferences from epsilon-globin gene sequences on cladistic relationships among the 16 extant genera of Ceboidea (the New World monkeys) were tested by strength of grouping and bootstrap values for the clades in the most parsimonious trees found: for this epsilon data set enlarged with additional Cebus and Saimiri orthologues; for another nuclear DNA sequence data set consisting of IRBP (interstitial retinol-binding protein gene) intron 1 orthologues; and for tandemly combined epsilon and IRBP sequences. Different ceboid species of the same genus always grouped strongly together as demonstrated by results on Cebus (capuchin monkeys), Saimiri (squirrel monkeys), Callicebus (titi monkeys), Aotus (night monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys). Other strong groupings that could be represented as monophyletic taxa in a cladistic classification were: Cebuella (pygmy marmoset) and Callithrix (marmoset) into subtribe Callitrichina; Callitrichina, Callimico (Goeldi's monkey), Leontopithecus (lion tamarin), and Saguinus (tamarin) into subfamily Callitrichinae; Callitrichinae, Aotus, Cebus, and Saimiri into family Cebidae; Cacajao (uakari monkey) and Chiropotes (saki) into subtribe Chiropotina; Chiropotina and Pithecia (bearded saki) into tribe Pitheciini; Pitheciini and Callicebus into subfamily Pitheciinae; Brachyteles (woolly spider monkey), Lagothrix (woolly monkey), and Ateles into tribe Atelini; and Atelini and Alouatta into subfamily Atelinae. In addition the epsilon and IRBP results congruently grouped (but at lesser strengths) Brachyteles and Lagothrix into subtribe Brachytelina within Atelini, and also Cebus and Saimiri into subfamily Cebinae within Cebidae. Because the IRBP results weakly grouped Pitheciinae with Cebidae, whereas the epsilon results weakly grouped Pitheciinae with Atelinae, the present evidence is best represented in an interim cladistic classification of ceboids by dividing the superfamily Ceboidea into three families: Atelidae, Pitheciidae, and Cebidae. PMID:8845968

Harada, M L; Schneider, H; Schneider, M P; Sampaio, I; Czelusniak, J; Goodman, M

1995-09-01

111

Cytogenetic monitoring of a group of Italian floriculturists: no evidence of DNA damage related to pesticide exposure  

Microsoft Academic Search

The induction of sister chromatid exchanges (SCE), structural chromosome aberrations (CA) or micronuclei (MN) was investigated in peripheral lymphocytes of a group of Italian floriculturists exposed to a mixture of pesticides. No statistically significant difference in the frequencies of cytogenetic damage was detected between exposed and control subjects. Assessment of the effect of confounding factors indicated that smoking affected both

R. Scarpato; L. Migliore; G. Angotzi; A. Fedi; L. Miligi; N. Loprieno

1996-01-01

112

High-Mobility Group 1/2 Proteins Are Essential for Initiating Rolling-Circle-Type DNA Replication at a Parvovirus Hairpin Origin  

PubMed Central

Rolling-circle replication is initiated by a replicon-encoded endonuclease which introduces a single-strand nick into specific origin sequences, becoming covalently attached to the 5? end of the DNA at the nick and providing a 3? hydroxyl to prime unidirectional, leading-strand synthesis. Parvoviruses, such as minute virus of mice (MVM), have adapted this mechanism to amplify their linear single-stranded genomes by using hairpin telomeres which sequentially unfold and refold to shuttle the replication fork back and forth along the genome, creating a continuous, multimeric DNA strand. The viral initiator protein, NS1, then excises individual genomes from this continuum by nicking and reinitiating synthesis at specific origins present within the hairpin sequences. Using in vitro assays to study ATP-dependent initiation within the right-hand (5?) MVM hairpin, we have characterized a HeLa cell factor which is absolutely required to allow NS1 to nick this origin. Unlike parvovirus initiation factor (PIF), the cellular complex which activates NS1 endonuclease activity at the left-hand (3?) viral origin, the host factor which activates the right-hand hairpin elutes from phosphocellulose in high salt, has a molecular mass of around 25 kDa, and appears to bind preferentially to structured DNA, suggesting that it might be a member of the high-mobility group 1/2 (HMG1/2) protein family. This prediction was confirmed by showing that purified calf thymus HMG1 and recombinant human HMG1 or murine HMG2 could each substitute for the HeLa factor, activating the NS1 endonuclease in an origin-specific nicking reaction. PMID:9765384

Cotmore, Susan F.; Tattersall, Peter

1998-01-01

113

PolA1, a Putative DNA Polymerase I, Is Coexpressed with PerR and Contributes to Peroxide Stress Defenses of Group A Streptococcus  

PubMed Central

The peroxide stress response regulator PerR coordinates the oxidative-stress defenses of group A Streptococcus (GAS). We now show that PerR is expressed from an operon encoding a putative DNA polymerase I (PolA1), among other GAS products. A polA1 deletion mutant exhibited wild-type growth but showed reduced capacity to repair DNA damage caused by UV light or ciprofloxacin. Mutant bacteria were hypersensitive to H2O2, compared with the wild type or a complemented mutant strain, and remained severely attenuated even after adaptation at sublethal H2O2 levels, whereas wild-type bacteria could adapt to withstand peroxide challenge under identical conditions. The hypersensitivity of the mutant was reversed when bacteria were grown in iron-depleted medium and challenged in the presence of a hydroxyl radical scavenger, results that indicated sensitivity to hydroxyl radicals generated by Fenton chemistry. The peroxide resistance of a perR polA1 double mutant following adaptation at sublethal H2O2 levels was decreased 9-fold relative to a perR single mutant, thus implicating PolA1 in PerR-mediated defenses against peroxide stress. Cultures of the polA1 mutant grown with or without prior H2O2 exposure yielded considerably lower numbers of rifampin-resistant mutants than cultures of the wild type or the complemented mutant strain, a finding consistent with PolA1 lacking proofreading activity. We conclude that PolA1 promotes genome sequence diversity while playing an essential role in oxidative DNA damage repair mechanisms of GAS, dual functions predicted to confer optimal adaptive capacity and fitness in the host. Together, our studies reveal a unique genetic and functional relationship between PerR and PolA1 in streptococci. PMID:23204468

Toukoki, Chadia

2013-01-01

114

The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics  

PubMed Central

Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ?155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit

2004-01-01

115

Functional constraints and evolutionary dynamics of the repeats in the rDNA internal transcribed spacer 2 of members of the Anopheles barbirostris group  

PubMed Central

Background The Anopheles barbirostris group is widely distributed in Southeast Asia. Although seven species have been formally described, a molecular analysis of the rDNA ITS2 and the mitochondrial cytochrome oxidase I gene suggests that the group includes species that are morphologically very similar or identical. We have previously shown that species in the Anopheles barbirostris Subgroup have an exceptionally large ITS2 (>1.5 kb), greater than in any other Anopheline group. However, the molecular processes responsible for generating such a large ITS2 have not previously been explored. Methods To determine the processes by which this large ITS2 is generated, we examined the sequence and secondary structure of the ITS2 of 51 specimens from five species of the Anopheles barbirostris Subgroup. These include the anthropophilic species An. campestris and three morphospecies of the Barbirostris Complex: An. vanderwulpi, An. barbirostris I and III, together with a previously undescribed member of this group (Clade IV). Results and conclusions All the specimens were found to have an ITS2 greater than 1.5 kb in length. The possibility that the spacer sequences amplified were pseudogenes was examined and discarded. The large size of ITS2 in the species studied is due to the presence of internal repeats of approximately 110 bp in length, confined to the central region of the spacer. Repeats varied markedly between the species examined, with respect to their organization, number and sequence similarity. The nucleotide diversity increased in direct relation to size variation and the presence of non-repeated elements. A secondary structure analysis showed that the repeats form hairpin structures with a wide range of free energy values. These hairpin structures are known to facilitate the subsequent processing of mature rRNA. An analysis of the repeats from the different species suggests they originate from a common ancestor, with the repeats appearing before speciation of the Barbirostris Group. PMID:24646478

2014-01-01

116

Review of the Eulamprotes wilkella species-group based on morphology and DNA barcodes, with descriptions of new taxa (Lepidoptera, Gelechiidae).  

PubMed

The Eulamprotes wilkella species-group is revised based on morphological characters and on DNA barcodes of the mtCOI (Cytochrome c Oxidase 1) gene. Adult morphology combined with sequence information for 9 species supports the existence of 12 species, 7 of which are described as new to science: E. mirusella Huemer & Karsholt sp. nov. (France), E. baldizzonei Karsholt & Huemer sp. nov. (Italy, Slovenia, Croatia), E. atrifrontella Karsholt & Huemer sp. nov. (Turkey), E. wieseri Huemer & Karsholt sp. nov. (Kyrgizia), E. altaicella Huemer & Karsholt sp. nov. (Russia: Altai, Buryatia, Tuva Republic), E. kailai Karsholt & Huemer sp. nov. (Kazakhstan, Kyrgizia, Russia: Buryatia, Tuva Republic) and E. gemerensis Elsner sp. nov. (Slovakia). E. buvati Leraut, 1991 syn. nov. is synonymized with E. ochricapilla (Rebel, 1903). PMID:25113469

Huemer, Peter; Elsner, Gustav; Karsholt, Ole

2013-01-01

117

DNA DNA [1]. 1994  

E-print Network

1. 1) DNA DNA [1]. 1994 * Molecular Evolutionary Computing(MEC) . ** *** : DNA / : 151-742 56-1 : 02)880-1847 FAX: 02)875-2240 : {ejpark, ihlee, btzhang}@bi.snu.ac.kr (L. M. Adleman) DNA (Hamiltonian Path Problem) [2] , NP- (NP-complete) [3]. DNA

118

Variations of SSU rDNA group I introns in different isolates of Cordyceps militaris and the loss of an intron during cross-mating.  

PubMed

Cordyceps militaris, the type species of genus Cordyceps, is one of the most popular mushrooms and a nutraceutical in eastern Asia. It is considered a model organism for the study of Cordyceps species because it can complete its life cycle when cultured in vitro. In the present study, the occurrence and sequence variation of SSU rDNA group I introns, Cmi.S943 and Cmi.S1199, among different isolates of C. militaris were analyzed. Based on the secondary structure predictions, the Cmi.S943 intron has been placed in subgroup IC1, and the Cmi.S1199 intron has been placed in subgroup IE. No significant similarity between Cmi.S943 and Cmi.S1199 suggested different origins. Three genotypes, based on the frequency and distribution of introns, were described to discriminate the 57 surveyed C. militaris strains. It was found that the genotype was related to the stroma characteristics. The stromata of all of the genotype II strains, which possessed only Cmi.S943, could produce perithecium. In contrast, the stromata of all genotype III strains, which had both Cmi.S943 and Cmi.S1199, could not produce perithecium. Cmi.S1199 showed the lowest level of intra-specific variation among the tested strains. Group I introns can be lost during strain cross-mating. Therefore, we presumed that during cross-mating and recombination, intron loss could be driven by positive Darwinian selection due to the energetic cost of transcribing long introns. PMID:24996897

Lian, Tiantian; Yang, Tao; Sun, Junde; Guo, Suping; Yang, Huaijun; Dong, Caihong

2014-08-01

119

Mucosal Immunization with High-Mobility Group Box 1 in Chitosan Enhances DNA Vaccine-Induced Protection against Coxsackievirus B3-Induced Myocarditis  

PubMed Central

Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei

2013-01-01

120

DNA extraction for short tandem repeat typing from mixed samples using anti-human leukocyte CD45 and ABO blood group antibodies.  

PubMed

DNA testing from mixed cell samples can be difficult to use successfully in criminal investigations. Here, we present a method for the extraction of DNA from mixed bloodstains involving plural contributors, after antibody-microbead captured cell separation. This method, together with the multiplex short tandem repeat typing presented, has proven highly successful in the recovery of DNA profiles corresponding to the ABO blood type. Methodological steps include magnetic separation using leukocyte specific CD45 antibody-coated microbeads and centrifugal separation of leukocyte agglutination by ABO antibody. The detection results of variable mixed ratio showed that the target DNA was detected accurately as low as 1:512 mixed ratio, regardless of the large amount of the background DNA present. The method presented here is applicable to PCR-based identification for various kinds of mixed samples. PMID:24680125

Yano, Shizue; Honda, Katsuya; Kaminiwa, Junko; Nishi, Takeki; Iwabuchi, Yayoi; Sugano, Yukiko; Kurosu, Akira; Suzuki, Yasuhito

2014-05-01

121

Group 13 HOX proteins interact with the MH2 domain of R-Smads and modulate Smad transcriptional activation functions independent of HOX DNA-binding capability.  

PubMed

Interactions with co-factors provide a means by which HOX proteins exert specificity. To identify candidate protein interactors of HOXA13, we created and screened an E11.5-E12.5, distal limb bud yeast two-hybrid prey library. Among the interactors, we isolated the BMP-signaling effector Smad5, which interacted with the paralogous HOXD13 but not with HOXA11 or HOXA9, revealing unique interaction capabilities of the AbdB-like HOX proteins. Using deletion mutants, we determined that the MH2 domain of Smad5 is necessary for HOXA13 interaction. This is the first report demonstrating an interaction between HOX proteins and the MH2 domain of Smad proteins. HOXA13 and HOXD13 also bind to other BMP and TGF-beta/Activin-regulated Smad proteins including Smad1 and Smad2, but not Smad4. Furthermore, HOXD13 could be co-immunoprecipitated with Smad1 from cells. Expression of HOXA13, HOXD13 or a HOXD13 homeodomain mutant (HOXD13(IQN>AAA)) antagonized TGF-beta-stimulated transcriptional activation of the pAdtrack-3TP-Lux reporter vector in Mv1Lu cells as well as the Smad3/Smad4-activated pTRS6-E1b promoter in Hep3B cells. Finally, using mammalian one-hybrid assay, we show that transcriptional activation by a GAL4/Smad3-C-terminus fusion protein is specifically inhibited by HOXA13. Our results identify a new co-factor for HOX group 13 proteins and suggest that HOX proteins may modulate Smad-mediated transcriptional activity through protein-protein interactions without the requirement for HOX monomeric DNA-binding capability. PMID:16087734

Williams, Thomas M; Williams, Melissa E; Heaton, Joanne H; Gelehrter, Thomas D; Innis, Jeffrey W

2005-01-01

122

Detection of human papillomavirus (HPV) DNA prevalence and p53 codon 72 (Arg72Pro) polymorphism in prostate cancer in a Greek group of patients.  

PubMed

Prostate cancer is the most common neoplasm found in males and the second most frequent cause of cancer-related mortality in males in Greece. Among other pathogens, the detection frequency of human papillomavirus (HPV) has been found to be significantly increased in tumor tissues among patients with sexually transmitted diseases (STDs), depending on the geographical distribution of each population studied. The present study focused on the detection of HPV and the distribution of Arg72Pro p53 polymorphism in a cohort of healthy individuals, as well as prostate cancer patients. We investigated the presence of HPV in 50 paraffin-embedded prostate cancer tissues, as well as in 30 physiological tissue samples from healthy individuals by real-time PCR. Furthermore, the same group of patients was also screened for the presence of the Arg72Pro polymorphism of the p53 gene, a p53 polymorphism related to HPV. Out of the 30 control samples, only 1 was found positive for HPV (3.33 %). On the contrary, HPV DNA was detected in 8 out of the total 50 samples (16 %) in the prostate cancer samples. The distribution of the three genotypes, Arg/Arg, Arg/Pro, and Pro/Pro, was 69.6, 21.7, and 8.7 % in the cancer patients and 75.0, 17.86, and 7.14 % in healthy controls, respectively. No statistically significant association was observed between the HPV presence and the age, stage, p53 polymorphism status at codon 72, or PSA. The increased prevalence of HPV detected in the prostate cancer tissues is in agreement with that reported in previous studies, further supporting the association of HPV infection and prostate cancer. PMID:25213701

Michopoulou, Vasiliki; Derdas, Stavros P; Symvoulakis, Emmanouil; Mourmouras, Nikolaos; Nomikos, Alexandros; Delakas, Dimitris; Sourvinos, George; Spandidos, Demetrios A

2014-12-01

123

DNA sequence and secondary structure of the mitochondrial small subunit ribosomal RNA coding region including a group-IC2 intron from the cultivated basidiomycete Agrocybe aegerita.  

PubMed

Due to their structural complexity and their evolutionary dimension, rRNAs are the most investigated nucleic acids in prokaryotes, eukaryotes and organelles. However, no complete sequence of a mitochondrial small subunit (SSU) rRNA was available in the basidiomycotina subdivision. The mitochondrial gene encoding the SSU rRNA of the cultivated basidiomycete Agrocybe aegerita was cloned and its complete nucleotide sequence achieved; the 5'- and 3'-ends were localized by nuclease SI mapping, leading to a size of 3277 nt. The secondary structure of the SSU rRNA (1906 nt in size) possessed all the helices and loops of the prokaryotic model; a unique modification was found in a conserved nucleotide predicted by the model: the nt 487 was A instead of C. The same modification, has been found in all the partial basidiomycete mitochondrial sequences available in databases. The Agrocybe aegerita SSU rRNA was characterized by large and unusual extensions leading to additional helices in the variable domains V4, V6 and V9, which were the longest of the known prokaryotic or mitochondrial SSU rRNAs. Nucleotide sequence analysis indicated a 1371-bp intron, belonging to subgroup-IC2, located in a conserved loop in the 3'-part of the SSU rRNA. This intron, which is the second example reported in a fungal mitochondrial SSU rDNA, encoded a putative protein (407 aa) sharing homologies with endonucleases involved in group-I intron mobility. This report constitutes the first complete mitochondrial SSU rRNA sequence and secondary structure of any member of the basidiomycotina subdivision. PMID:9016953

Gonzalez, P; Barroso, G; Labarère, J

1997-01-01

124

A 127 kDa component of a UV-damaged DNA-binding complex, which is defective in some xeroderma pigmentosum group E patients, is homologous to a slime mold protein.  

PubMed Central

A cDNA which encodes a approximately 127 kDa UV-damaged DNA-binding (UV-DDB) protein with high affinity for (6-4)pyrimidine dimers [Abramic', M., Levine, A.S. & Protic', M., J. Biol. Chem. 266: 22493-22500, 1991] has been isolated from a monkey cell cDNA library. The presence of this protein in complexes bound to UV-damaged DNA was confirmed by immunoblotting. The human cognate of the UV-DDB gene was localized to chromosome 11. UV-DDB mRNA was expressed in all human tissues examined, including cells from two patients with xeroderma pigmentosum (group E) that are deficient in UV-DDB activity, which suggests that the binding defect in these cells may reside in a dysfunctional UV-DDB protein. Database searches have revealed significant homology of the UV-DDB protein sequence with partial sequences of yet uncharacterized proteins from Dictyostelium discoideum (44% identity over 529 amino acids) and Oryza sativa (54% identity over 74 residues). According to our results, the UV-DDB polypeptide belongs to a highly conserved, structurally novel family of proteins that may be involved in the early steps of the UV response, e.g., DNA damage recognition. Images PMID:8371985

Takao, M; Abramic, M; Moos, M; Otrin, V R; Wootton, J C; McLenigan, M; Levine, A S; Protic, M

1993-01-01

125

Stereospecific Nuclear Magnetic Resonance Assignments of the Methyl Groups of Valine and Leucine in the DNA-Binding Domain of the 434 Repressor by Biosynthetically Directed Fractional 13C Labeling  

Microsoft Academic Search

Stereospecific 'H and 13C NMR assignments were made for the two diastereotopic methyl groups of the 14 valyl and leucyl residues in the DNA-binding domain 1-69 of the 434 repressor. These results were obtained with a novel method, biosynthetically directed fractional 13C labeling, which should be quite widely applicable for peptides and proteins. The method is based on the use

Dario Neri; Thomas Szyperski; Gottfried Otting; Hans Senn; Kurt Wiithrich

126

Reactions of glyceraldehyde 3-phosphate dehydrogenase sulfhydryl groups with bis-electrophiles produce DNA-protein cross-links but not mutations.  

PubMed

The environmental contaminant 1,2-dibromoethane and diepoxybutane, an oxidation product of the important industrial chemical butadiene, are bis-functional electrophiles and are known to be mutagenic and carcinogenic. One mechanism by which bis-electrophiles can exert their toxic effects is through the induction of genotoxic and mutagenic DNA-peptide cross-links. This mechanism has been shown in systems overexpressing the DNA repair protein O6 -alkylguanine DNA-alkyltransferase (AGT) or glutathione S-transferase and involves reactions with nucleophilic cysteine residues. The hypothesis that DNA-protein cross-link formation is a more general mechanism for genotoxicity by bis-electrophiles was investigated by screening nuclear proteins for reactivity with model monofunctional electrophiles. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was identified as a candidate because of the nucleophilicity of two cysteine residues (Cys152 and Cys246) in reaction screens with model electrophiles (Dennehy, M. K. et al. (2006) Chem. Res. Toxicol. 19, 20-29). Incubation of GAPDH with bis-electrophiles resulted in inhibition of its catalytic activity, but only at high concentrations of diepoxybutane. In vitro assays indicated DNA-GAPDH cross-link formation in the presence of diepoxybutane, and bis-electrophile reactivity at Cys246 was confirmed using mass spectral analysis. In contrast to AGT, overexpression of human GAPDH in Escherichia coli did not enhance mutagenesis by diepoxybutane. We propose that the lack of mutational enhancement is in part due to the inherently lower reactivity of GAPDH toward bis-electrophiles as well as the reduced DNA binding ability relative to AGT, preventing the in vivo formation of DNA-protein cross-links and enhanced mutagenesis. PMID:18163542

Loecken, Elisabeth M; Guengerich, F Peter

2008-02-01

127

DNA microarray (spot) .  

E-print Network

1. DNA microarray DNA (spot) . DNA probe , probe (hybridization) . DNA microarray cDNA oligonucleotide oligonucleotide cDNA probe . oligonucleotide microarray , DNA , probe . oligonucleotide microarray probe

128

Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses  

PubMed Central

Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types. PMID:24939392

Krupovic, Mart; Koonin, Eugene V.

2014-01-01

129

Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses  

NASA Astrophysics Data System (ADS)

Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types.

Krupovic, Mart; Koonin, Eugene V.

2014-06-01

130

Rates and Patterns of scnDNA and mtDNA Divergence Within the Drosophila melanogaster Subgroup  

Microsoft Academic Search

Levels of DNA divergence among the eight species of the Drosophila melanogaster subgroup and D. takahashii have been determined using the technique of DNA-DNA hybridization. Two types of DNA were used: single-copy nuclear DNA (scnDNA) and mitochondrial DNA (mtDNA). The major findings are: (1) A phylogeny has been derived for the group based on scnDNA which is congruent with chromosomal

Adalgisa Caccone; George D. Amato; Jeffrey R. Powell

1988-01-01

131

DNA barcoding for plants.  

PubMed

DNA barcoding uses specific regions of DNA in order to identify species. Initiatives are taking place around the world to generate DNA barcodes for all groups of living organisms and to make these data publically available in order to help understand, conserve, and utilize the world's biodiversity. For land plants the core DNA barcode markers are two sections of coding regions within the chloroplast, part of the genes, rbcL and matK. In order to create high quality databases, each plant that is DNA barcoded needs to have a herbarium voucher that accompanies the rbcL and matK DNA sequences. The quality of the DNA sequences, the primers used, and trace files should also be accessible to users of the data. Multiple individuals should be DNA barcoded for each species in order to check for errors and allow for intraspecific variation. The world's herbaria provide a rich resource of already preserved and identified material and these can be used for DNA barcoding as well as by collecting fresh samples from the wild. These protocols describe the whole DNA barcoding process, from the collection of plant material from the wild or from the herbarium, how to extract and amplify the DNA, and how to check the quality of the data after sequencing. PMID:25373752

de Vere, Natasha; Rich, Tim C G; Trinder, Sarah A; Long, Charlotte

2015-01-01

132

DNA Computing Hamiltonian path  

E-print Network

2014 DNA DNA #12;DNA Computing · Feynman · Adleman · DNASIMD · ... · · · · · DNADNA #12;DNA · DNA · · · · DNA · · #12;2000 2005 2010 1995 Hamiltonian path DNA tweezers DNA tile DNA origami DNA box Sierpinski DNA tile self assembly DNA logic gates Whiplash PCR DNA automaton DNA spider MAYA

Hagiya, Masami

133

Report of the European DNA profiling group (EDNAP): an investigation of the complex STR loci D21S11 and HUMFIBRA (FGA)  

Microsoft Academic Search

This paper describes a collaborative exercise which was intended to demonstrate whether uniformity of DNA profiling results could be achieved between European laboratories using two complex short tandem repeat (STR) loci. The loci D21S11 and HUMFIBRA (FGA) were chosen because they are commonly used by different European laboratories. D21S11 has approximately 14 common alleles (f>0.001), whereas HUMFIBRA has 19 common

Peter Gill; E d'Aloja; J Andersen; B Dupuy; M Jangblad; V Johnsson; A. D Kloosterman; A Kratzer; M. V Lareu; M Meldegaard; C Phillips; H Pfitzinger; S Rand; M Sabatier; R Scheithauer; H Schmitter; P Schneider; M. C Vide

1997-01-01

134

(gene expression) DNA (DNA microarrays).  

E-print Network

µ µ DNA . , µ . , µ . , . µ µµ µ µ (gene expression) . µ, µ µ DNA (DNA microarrays). µ µ µ µ µ µ µ DNA µ . µ µµ: ) . . µ µ µ µ. B) µ. µ µ (Support Vector Machines) µ µ. µ µ µ µ DNA. 62 µ (40 22 ) µ

Athens, University of

135

DNA Transformation  

NSDL National Science Digital Library

Stanley Cohen and Herbert Boyer's historic experiment used techniques to cut and paste DNA to create the first custom-made organism containing recombined or 'recombinant' DNA. Cohen and Boyer inserted the recombinant DNA molecule they created into E. coli bacteria by means of a plasmid, thereby inducing the uptake and expression of a foreign DNA sequence known as 'transformation.' This animation from Cold Spring Harbor Laboratory's Dolan DNA Learning Center presents DNA transformation through a series of illustrations of the processes involved.

2012-04-06

136

DNA Restriction  

NSDL National Science Digital Library

The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragment at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends. This animation from Cold Spring Harbor Laboratory's Dolan DNA Learning Center presents DNA restriction through a series of illustrations of processes involved.

2011-11-25

137

Molecular Cloning, Sequence, and Expression of a Human GDP-L-Fucose: beta-D-Galactoside 2-alpha-L-Fucosyltransferase cDNA that can Form the H Blood Group Antigen  

Microsoft Academic Search

We have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase [alpha(1,2)FT EC 2.4.1.69]. Although this fragment determined expression of an alpha(1, 2)FT whose kinetic properties mirror those of the human H blood group alpha(1,2)FT, their precise nature remained undefined. We describe here the molecular cloning, sequence, and expression of

Robert D. Larsen; Linda K. Ernst; Rajan P. Nair; John B. Lowe

1990-01-01

138

Isolation and sequence of cDNA clones coding for a member of the family of high mobility group proteins (HMG-T) in trout and analysis of HMG-T-mRNA's in trout tissues.  

PubMed Central

A specific oligonucleotide has been used to isolate a cDNA prepared from the mRNA for a trout High Mobility Group (HMG) protein closely related to trout HMG-T and bovine HMG 1 and 2 proteins. The sequence isolated more closely resembles bovine HMG-1 than the previously sequenced HMG-T protein in regions corresponding to the N terminal half of the protein. Northern blot analysis at low stringency indicated that 2 related sequences are expressed in total trout testis mRNA. Southern blots of total trout DNA indicate that several different forms of the homologous sequence are present in the trout genome and an estimate of copy number by dot-blot shows 4 HMG-T genes per trout sperm DNA equivalent. Analysis of mRNA from several trout tissues, including testis, liver and kidney indicates that expression of genes for histones and the larger HMG proteins in trout is not closely coupled. Images PMID:4022777

Pentecost, B T; Wright, J M; Dixon, G H

1985-01-01

139

[Evaluation of the relative contribution of Caucasoid and Mongoloid components in the formation of ethnic groups of the Volga-Ural region according to data of DNA polymorphism].  

PubMed

For the first time, an attempt was made to quantitatively estimate the relative contributions of major racial components to populations of the Volga-Ural region based on the data on allelic polymorphisms of nine loci of the mitochondrial and nuclear genomes. Comparison of the proportions of Caucasoid and Mongoloid characteristics in the gene pools of Bashkirs, Tatars, Chuvashes, Maris, Mordovians, Udmurts, and Komi revealed a heterogeneous pattern. Data on the proportions of major racial components in the nuclear genome indicated that the Caucasoid component was maximum in Mordovians, Komis, and Udmurts. Mongoloid characters were most prevalent in Bashkirs, Maris, Tatars, and Chuvashes. Data on restriction-deletion polymorphism of mitochondrial DNA (mtDNA) also indicated an increased Caucasoid contribution to Mordovian, Udmurt, and Komi gene pools and an increased Mongoloid component in Chuvashes and Tatars. In general, the results obtained agree with ethnic anthropological data indicating the greatest Caucasoid contribution to the Mordovian and Komi gene pools and an increased Mongoloid component in Turkic populations of the Volga-Ural region (Bashkirs, Tatars, and Chuvashes). PMID:10546116

Khusnutdinova, E K; Viktorova, T V; Fatkhlislamova, R I; Galeeva, A R

1999-08-01

140

The mitochondrial LSU rDNA of the brown alga Pylaiella littoralis reveals alpha-proteobacterial features and is split by four group IIB introns with an atypical phylogeny.  

PubMed

The mitochondrial DNA region coding for the large ribosomal RNA subunit from the brown alga Pylaiella littoralis (L.) Kjellm was sequenced. The LSU rRNA was folded into a secondary structure and aligned with homologous, mitochondrial and eubacterial sequences. Taking into account the primary and secondary structure levels, the mitochondrial LSU rRNA of P. littoralis shares more structural features with alpha-proteobacterial genes than do those of the green alga Prototheca wickerhamii and land plants. In phylogenetic trees, branches leading to brown algae, red algae, the protozoan Acanthamoeba castellanii and land plants, respectively, emerge approximately at the same time, as they do in nuclear-gene based phylogenies. This suggests that there is only one origin for the mitochondrial rRNA genes found in these lineages. The LSU rDNA is split by four group IIB introns. The first two introns each contain one open reading frame which encodes a reverse transcriptase-like protein. Comparison of their amino acid sequences with those of other reverse transcriptase-like genes contained in group II introns shows that these genes are more closely related to plastid and cyanobacterial homologous genes than to any known mitochondrial intronic reverse transcriptase. PMID:7544414

Fontaine, J M; Rousvoal, S; Leblanc, C; Kloareg, B; Loiseaux-de Goër, S

1995-08-18

141

DNA condensation  

Microsoft Academic Search

Recent progress in our understanding of DNA condensation includes the observation of the collapse of single DNA molecules, greater insights into the intermolecular forces driving condensation, the recognition of helix-structure perturbation in condensed DNA, and the increasing recognition of the likely biological consequences of condensation. DNA condensed with cationic liposomes is an efficient agent for the transfection of eukaryotic cells,

Victor A Bloomfield

1996-01-01

142

DNA vaccines  

Microsoft Academic Search

DNA vaccines use eukaryotic expression vectors to produce immunizing proteins in the vaccinated host. Popular methods of delivery are intramuscular and intradermal saline injections of DNA and gene gun bombardment of skin with DNA-coated gold beads. The method of DNA inoculation (gene gun versus intramuscular injection) and the form of the DNA-expressed antigen (cell-associated versus secreted) determine whether T-cell help

Harriet L. Robinson; Celia Aurora Tiglao Torres

1997-01-01

143

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.  

PubMed

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets. PMID:15291564

Marchán, Vicente; Cie?lak, Jacek; Livengood, Victor; Beaucage, Serge L

2004-08-11

144

The 1998-1999 collaborative exercises and proficiency testing program on DNA typing of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG).  

PubMed

A total of 28 laboratories (labs) submitted results for the 1998 collaborative exercise and the proficiency testing program of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG) group. This number increased to 46 labs in 1999. Six bloodstains were submitted, each one with 200 microl soaked in cotton except the sample no. 6 submitted for DNA quantification which had 2 microl. One of the samples was a mixed stain. A paternity testing case and a criminal case in the 1998 trial (GEP'98) and two paternity testing cases in 1999 (GEP'99) were included and the statistical evaluation of the evidence was requested in both cases. In the GEP'99 trial, a theoretical paternity testing case was included. A total of 52 DNA genetic markers were used by the participants in the GEP'98 trial, which increased to 101 in GEP'99. Despite this increasing number of participating labs, results remained quite satisfactory. All the labs used PCR-based DNA polymorphisms with an increasing number of markers, obtaining good results. SLPs were used by a decreasing number of labs but the results indicated a good level of expertise despite the different protocols used. Good results were also obtained for mtDNA despite the difficulties presented by the samples due to the presence of length heteroplasmy in some samples in both trials. The detection of heteroplasmy should, however, be improved. Similar conclusions were reached for both, the paternity and the criminal case by all the labs. Common methodologies for the statistical evaluation of the paternity case were used and the paternity index and the probability of paternity (with an a priori value of 0.5) reported by most of the labs. Also, a great uniformity was found in the evaluation of the criminal case despite the lack of a specific hypothesis in the design of the exercise. Some errors in statistical programs or in calculations were detected in a theoretical paternity case included in the GEP'99 trial for statistical analysis. PMID:10924847

Gómez, J; Carracedo, A

2000-10-01

145

Compressive Sensing DNA Microarrays  

Microsoft Academic Search

Abstract—Compressive,Sensing Microarrays,(CSM) are DNA- based sensors that operate,using group,testing and,compressive sensing (CS) principles. In contrast to conventional DNA microar- rays, in which each genetic sensor is designed to respond to a single target, in a CSM each sensor responds to a set of targets. We study the problem,of designing,CSMs that simultaneously account for both the constraints from,compressive,sensing theory and,the biochemistry,of

Wei Dai; Mona A. Sheikh; Olgica Milenkovic; Richard G. Baraniukyy

2009-01-01

146

Genetic variation and demographic history of the Haplochromis laparogramma group of Lake Victoria--An analysis based on SINEs and mitochondrial DNA  

E-print Network

Genetic variation and demographic history of the Haplochromis laparogramma group of Lake Victoria More than 500 endemic haplochromine cichlid species inhabit Lake Victoria. This striking species and population structure of closely related Lake Victoria cichlids and in showing the importance of applying

147

DNA translocation by human uracil DNA glycosylase: role of DNA phosphate charge.  

PubMed

Human DNA repair glycosylases must encounter and inspect each DNA base in the genome to discover damaged bases that may be present at a density of <1 in 10 million normal base pairs. This remarkable example of specific molecular recognition requires a reduced dimensionality search process (facilitated diffusion) that involves both hopping and sliding along the DNA chain. Despite the widely accepted importance of facilitated diffusion in protein-DNA interactions, the molecular features of DNA that influence hopping and sliding are poorly understood. Here we explore the role of the charged DNA phosphate backbone in sliding and hopping by human uracil DNA glycosylase (hUNG), which is an exemplar that efficiently locates rare uracil bases in both double-stranded DNA and single-stranded DNA. Substitution of neutral methylphosphonate groups for anionic DNA phosphate groups weakened nonspecific DNA binding affinity by 0.4-0.5 kcal/mol per substitution. In contrast, sliding of hUNG between uracil sites embedded in duplex and single-stranded DNA substrates persisted unabated when multiple methylphosphonate linkages were inserted between the sites. Thus, a continuous phosphodiester backbone negative charge is not essential for sliding over nonspecific DNA binding sites. We consider several alternative mechanisms for these results. A model consistent with previous structural and nuclear magnetic resonance dynamic results invokes the presence of open and closed conformational states of hUNG. The open state is short-lived and has weak or nonexistent interactions with the DNA backbone that are conducive for sliding, and the populated closed state has stronger interactions with the phosphate backbone. These data suggest that the fleeting sliding form of hUNG is a distinct weakly interacting state that facilitates rapid movement along the DNA chain and resembles the transition state for DNA dissociation. PMID:23506309

Schonhoft, Joseph D; Kosowicz, John G; Stivers, James T

2013-04-16

148

DNA Interactive  

NSDL National Science Digital Library

DNA Interactive is an educational site celebrating the 50th anniversary of the discovery of the double-helical structure of DNA by James Watson and Francis Crick. The web site features interactive modules about the history of DNA science; discovering and reading the DNA code; manipulating the code to create tailored molecules; studying the human genome; applications of DNA research; and a chronicle of the eugenics movement. These modules feature rare video interviews with scientists, 3D animations, and narrative text to present and explain DNA science. Other materials include a teacher's guide with downloadable, printable lessons, an online teaching community, and information on further resources.

2004-01-05

149

DNA Copyright  

E-print Network

of architecture and computer software. Sequences of DNA should also be acknowledged as eligible for copyright protection. Unaltered genomic DNA sequences would seem poor candidates for copyright protection. The case is stronger for copyright protection...

Torrance, Andrew W.

2011-01-01

150

DNA Workshop  

NSDL National Science Digital Library

How does DNA perform those all-important functions of replication and protein synthesis? This interactive feature from the A Science Odyssey Web site will help you explore and understand the secrets of DNA.

Foundation, Wgbh E.

2003-09-26

151

DNA Replication  

NSDL National Science Digital Library

This animation, which shows DNA replication and the interactions of the various enzymes, can be used to illustrate to students the order of events in DNA replication, as well as emphasize which enzymes are involved in the process.

American Society For Microbiology;

2002-01-01

152

DNA Detectives  

NSDL National Science Digital Library

Many of the revolutionary changes that have occurred in biology since 1970 can be attributed directly to the ability to manipulate DNA in defined ways. The principal tools for this recombinant DNA technology are enzymes that can "cut and "paste" DNA. Restriction enzymes are the "chemical scissors" of the molecular biologist; these enzymes cut DNA at specific nucleotide sequences. A sample of someone's DNA, incubated with restriction enzymes, is reduced to millions of DNA fragments of varying sizes. A DNA sample from a different person would have a different nucleotide sequence and would thus be enzymatically "chopped up" into a very different collection of fragments. We have been asked to apply DNA fingerprinting to determine which suspect should be charged with a crime perpetrated in our city.

BEGIN:VCARD VERSION:2.1 FN:Suzanne Black N:Black;Suzanne ORG:Inglemoor High School REV:2005-04-09 END:VCARD

1995-06-30

153

DNA Banking  

SciTech Connect

The author is involved in the ethical, legal, and social issues of banking of DNA and data from DNA analysis. In his attempt to determine the extent of DNA banking in the U.S., the author surveyed some commercial companies performing DNA banking services. This article summarizes the results of that survey, with special emphasis on the procedures the companies use to protect the privacy of individuals. 4 refs.

Reilly, P.R. (Eunice Kennedy Shriver Center for Mental Retardation, Waltham, MA (United States))

1992-11-01

154

Identification of novel cluster groups in pediatric high-risk B-precursor acute lymphoblastic leukemia with gene expression profiling: correlation with genome-wide DNA copy number alterations, clinical characteristics, and outcome  

PubMed Central

To resolve the genetic heterogeneity within pediatric high-risk B-precursor acute lymphoblastic leukemia (ALL), a clinically defined poor-risk group with few known recurring cytogenetic abnormalities, we performed gene expression profiling in a cohort of 207 uniformly treated children with high-risk ALL. Expression profiles were correlated with genome-wide DNA copy number abnormalities and clinical and outcome features. Unsupervised clustering of gene expression profiling data revealed 8 unique cluster groups within these high-risk ALL patients, 2 of which were associated with known chromosomal translocations (t(1;19)(TCF3-PBX1) or MLL), and 6 of which lacked any previously known cytogenetic lesion. One unique cluster was characterized by high expression of distinct outlier genes AGAP1, CCNJ, CHST2/7, CLEC12A/B, and PTPRM; ERG DNA deletions; and 4-year relapse-free survival of 94.7% ± 5.1%, compared with 63.5% ± 3.7% for the cohort (P = .01). A second cluster, characterized by high expression of BMPR1B, CRLF2, GPR110, and MUC4; frequent deletion of EBF1, IKZF1, RAG1-2, and IL3RA-CSF2RA; JAK mutations and CRLF2 rearrangements (P < .0001); and Hispanic ethnicity (P < .001) had a very poor 4-year relapse-free survival (21.0% ± 9.5%; P < .001). These studies reveal striking clinical and genetic heterogeneity in high-risk ALL and point to novel genes that may serve as new targets for diagnosis, risk classification, and therapy. PMID:20699438

Harvey, Richard C.; Mullighan, Charles G.; Wang, Xuefei; Dobbin, Kevin K.; Davidson, George S.; Bedrick, Edward J.; Chen, I-Ming; Atlas, Susan R.; Kang, Huining; Ar, Kerem; Wilson, Carla S.; Wharton, Walker; Murphy, Maurice; Devidas, Meenakshi; Carroll, Andrew J.; Borowitz, Michael J.; Bowman, W. Paul; Downing, James R.; Relling, Mary; Yang, Jun; Bhojwani, Deepa; Carroll, William L.; Camitta, Bruce; Reaman, Gregory H.; Smith, Malcolm; Hunger, Stephen P.

2010-01-01

155

Stretching DNA  

NSDL National Science Digital Library

Explore stretching just a single strand of DNA using optical tweezers or fluid flow. Experiment with the forces involved and measure the relationship between the stretched DNA length and the force required to keep it stretched. Is DNA more like a rope or like a spring?

Simulations, Phet I.; Perkins, Kathy; Malley, Chris; Perkins, Tom; Dubson, Mike; Adams, Wendy

2007-12-01

156

DNA demethylation by DNA repair  

E-print Network

Active DNA demethylation underlies key facets of reproduction in flowering plants and mammals and serves a general genome housekeeping function in plants. A family of 5-methylcytosine DNA glycosylases catalyzes plant ...

Gehring, Mary

157

Dna Sequencing  

DOEpatents

A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

1995-04-25

158

Designer DNA Nanoarchitectures†  

PubMed Central

Naturally existing biological systems, from the simplest unicellular diatom to the most sophisticated organ such as human brain, are functional self-assembled architectures. Scientists have long been dreaming about building artificial nanostructures that can mimic such elegance in nature. Structural DNA nanotechnology, which uses DNA as blueprint and building material to organize matter with nanometer precision, represents an appealing solution to this challenge. Based on the knowledge of helical DNA structure and Watson-Crick base pairing rules, scientists have constructed a number of DNA nanoarchitectures with a large variety of geometries, topologies and periodicities with considerably high yields. Modified by functional groups, those DNA nanostructures can serve as scaffolds to control the positioning of other molecular species, which opens opportunities to study intermolecular synergies, such as protein-protein interactions, as well as to build artificial multi-component nano-machines. In this review, we summarize the principle of DNA self-assembly, describe the exciting progress of structural DNA nanotechnology in recent years and discuss the current frontier. PMID:19199428

Lin, Chenxiang; Liu, Yan; Yan, Hao

2009-01-01

159

Mitochondrial DNA analysis of Exophiala spinifera  

Microsoft Academic Search

Restriction fragment length polymorphism (RFLP) of mitochondrial DNA (mtDNA) was examined in 36 isolates ofExophiala spinifera (8 isolates from Brazil, 9 from China, 15 from Columbia, 1 from the United States and 2 from Venezuela).E. spinifera isolates displayed a high degree of mtDNA diversity in RFLP patterns and were clustered into six genetically heterogeneous groups (Group 1 through Group 6).

H. Ishizaki; M. Kawasaki; K. Nishimura; M. Miyaji

1995-01-01

160

Unnatural nucleotides for DNA sequencing  

E-print Network

, VentR(exo-)@ DNA polymerase and rTth. DNA polymerase. This demonstrates the possible role of 3'-O-methyl-dTTP as an alternative terminator to ddTTP. A fluorescent 3'safety-catch linker nucleoside with a photolabile protecting group was prepared via a...

Jacutin, Swanee E

2012-06-07

161

The Symbolic DNA of Terrorism  

Microsoft Academic Search

Understanding what causes terrorists to conduct mass-casualty attacks is essential. In this essay, we argue that religious terrorist groups and terrorist groups embracing an ideological\\/mythic pattern similar to religion that conduct such attacks are motivated by what we label the symbolic DNA of terrorism. Terrorist groups such as al Qaeda perceive that their identity is threatened, and believe that the

Robert C. Rowland; Kirsten Theye

2008-01-01

162

Comparison of enzyme immunoassay, PCR, and type-specific cDNA probe techniques for identification of group A rotavirus gene 4 types (P types).  

PubMed Central

This study was designed to evaluate three techniques most commonly used to identify the VP4 (P) types of human group A fecal rotaviruses. The techniques included PCR with nested primers and hybridization with PCR-generated probes (to determine the P genotypes). The results obtained by these genetic techniques were evaluated against those obtained by an enzyme immunoassay (EIA) incorporating neutralizing monoclonal antibodies (N-MAbs) reacting with three major human P serotypes (serotypes P1A, P1B, and P2A). The P types of the rotaviruses present in 102 fecal specimens were determined under code by each of the three assays. The specificity of each assay was evaluated against a "gold standard" putative P type (P serotype and genotype) deduced from knowledge of the VP7 (G) type and the origin of the fecal specimen. Overall comparison of the results showed respective sensitivities and specificities of 92 and 92% for reverse transcription-PCR, 80 and 99% for hybridization, and 73 and 91% for EIA with N-MAbs. The hybridization assay retained high sensitivity with specimens stored for > or = 10 years. Hybridization assays with nonradioactive probes are relatively inexpensive and are suited for use in developing countries. In summary, both genetic assays showed high sensitivities and specificities in assigning a P type to human fecal rotavirus strains. Further evaluation of the EIA with N-MAbs is required, together with incorporation of new N-MAbs for the detection of the additional P types detected in developing countries. PMID:9399502

Masendycz, P J; Palombo, E A; Gorrell, R J; Bishop, R F

1997-01-01

163

DNA Barcoding  

NSDL National Science Digital Library

This is a two-part animation. Â?DNA Barcoding, Part 1,Â? provides an overview of how DNA barcoding of animals can be used to identify an unknown sample or discover a new species. Cytochrome c oxidase subunit 1 (COI) is found in the mitochondria as part of the electron transport chain. The COI gene is used for DNA barcoding. Just like a barcode on an item in a grocery store identifies a product, a DNA barcode (determined by DNA sequencing) is used to identify species. Part 1 run time: 1 minute, 40 seconds. Â?DNA Barcoding, Part 2Â? details how small tissue samples are used for DNA barcoding, including a review of the laboratory and bioinformatics steps used in barcoding: DNA purification, polymerase chain reaction (PCR), agarose gel electrophoresis, DNA sequencing and analysis, and DNA sequence identification using the Basic Local Alignment Search Tool (BLAST) or the Barcode of Life Database (BOLD). Part 2 run time: 4 minutes, 15 seconds. Animation is closed captioned.

2012-10-22

164

Recombinant DNA means and method  

SciTech Connect

This patent describes a transformed living cell selected from the group consisting of fungi, yeast and bacteria, and containing genetic material derived from recombinant DNA material and coding for bovine rennin.

Alford, B.L.; Mao, J.I.; Moir, D.T.; Taunton-Rigby, A.; Vovis, G.F.

1987-05-19

165

DNA Testing & Cetaceans Bibliography  

NSDL National Science Digital Library

The American Society of International Law Wildlife Interest Group has posted the searchable DNA Testing & Cetaceans Bibliography, with dozens of resources from recent years to the 1970s (most resources are recent). Listed in alphabetical order, resources may be browsed online or searched using the internal search mechanism.

Burns, Wil.

166

Patterning nanocrystals using DNA  

SciTech Connect

One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices to a length greater than 20 {micro}m, and collecting atomic force microscopy (AFM) images up to 30 {micro}m. We found the lattices' requirement of divalent magnesium cations to stabilize Holliday junctions to be incompatible with the stability of charge-stabilized gold nanoparticles used for the experiments here, and gold particles added indiscriminately to the lattice surface through non-specific binding. Redesigning the lattices to avoid magnesium may improve results.

Williams, Shara Carol

2003-09-01

167

DNA Extraction  

NSDL National Science Digital Library

In this activity related to plant biotechnology, learners extract DNA from fruit to investigate how it looks and feels. The procedure is similar to what scientists have to do before they can use information contained in this DNA. This lesson guide includes procedure and discussion questions to help learners reflect on the process and purpose of DNA extraction. Modifications for younger learners are included in a related PDF (see related resources).

2012-06-26

168

Reading DNA  

NSDL National Science Digital Library

Students use edible models of the DNA molecule to transcribe an mRNA se- quence, then translate it into a protein. At the end of the lesson, understand that information within the DNA molecule is divided into segments called genes and learn that each gene contains the instructions for assembling a unique protein that performs a specialized function in the cell. A basic knowledge of DNA structure and function is required.

2012-05-31

169

DNA Immunization  

PubMed Central

DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

Wang, Shixia; Lu, Shan

2013-01-01

170

DNA Libraries  

NSDL National Science Digital Library

Teachers' Domain presents this interactive, adapted from the Dolan DNA Learning Center, to help students learn about DNA Libraries, "the tools scientists use to store and reproduce genetic information that they can later access for their research." After an introduction, students can explore more about the different types of DNA libraries by clicking on any of the five DNA vectors: Yeast Artificial Chromosomes, Bacterial Artificial Chromosomes, Cosmids, Bacteriophage Lambda, and Plasmids. On the site, visitors will also find a supplemental background essay, discussion questions, and standards alignment from Teachers' Domain.

171

DNA Pendant  

E-print Network

Broadcast Transcript: It's a symbol of commitment. It's a memento mori. It's the DNA pendant offered by Japan's Eiwa Industry and it's two, two, two things in one. Using genetic extraction, Eiwa removes the DNA from, say, a strand of hair or a...

Hacker, Randi; Tsutsui, William

2007-11-14

172

DNA Vaccines  

Microsoft Academic Search

In just a few years, injection of plasmid DNA to elicit immune responses in vivo has developed from an interesting observation to a viable vaccine strategy. DNA vaccines have been shown to elicit both cellular and humoral immune responses and to be effective in a variety of preclinical bacterial, viral, and parasitic animal models. This review will discuss the current

Donna L. Montgomery; Jeffrey B. Ulmer; John J. Donnelly; Margaret A. Liu

1997-01-01

173

DNA ALTERATIONS  

EPA Science Inventory

The exposure of an organism to genotoxic chemicals may induce a cascade of genetic events. nitially, structural alterations to DNA are formed. ext, the DNA damage is processed and subsequently expressed in mutant gene products. inally, diseases result from the genetic damage. he ...

174

DNA Tutorial  

NSDL National Science Digital Library

This site is an excellent resource on the structure and function of DNA as well as its role in genes and chromosomes. It also covers DNA replication, RNA structure and function, RNA synthesis, the genetic code, and protein synthesis. The site includes a tutorial that tests comprehension of the covered subjects.

Yvette; Cf

175

Thermal Stability of DNA Functionalized Gold Nanoparticles  

PubMed Central

Therapeutic uses of DNA functionalized gold nanoparticles (DNA-AuNPs) have shown great potential and exciting opportunities for disease diagnostics and treatment. Maintaining stable conjugation between DNA oligonucleotides and gold nanoparticles under thermally stressed conditions is one of the critical aspects for any of the practical applications. We systematically studied the thermal stability of DNA-AuNPs as affected by organosulfur anchor groups and packing densities. Using a fluorescence assay to determine the kinetics of releasing DNA molecules from DNA-AuNPs, we observed an opposite trend between the temperature-induced and chemical-induced release of DNA from DNA-AuNPs when comparing the DNA-AuNPs that were constructed with different anchor groups. Specifically, the bidentate Au–S bond formed with cyclic disulfide was thermally less stable than those formed with thiol or acyclic disulfide. However, the same bidentate Au–S bond was chemically more stable under the treatment of competing thiols (mercaptohexanol or dithiothreitol). DNA packing density on AuNPs influenced the thermal stability of DNA-AuNPs at 37 °C, but this effect was minimum as temperature increased to 85 °C. With the improved understanding from these results, we were able to design a strategy to enhance the stability of DNA-AuNPs by conjugating double-stranded DNA to AuNPs through multiple thiol anchors. PMID:24102258

2013-01-01

176

[DNA computing].  

PubMed

Biocomputers can be an alternative for traditional "silicon-based" computers, which continuous development may be limited due to further miniaturization (imposed by the Heisenberg Uncertainty Principle) and increasing the amount of information between the central processing unit and the main memory (von Neuman bottleneck). The idea of DNA computing came true for the first time in 1994, when Adleman solved the Hamiltonian Path Problem using short DNA oligomers and DNA ligase. In the early 2000s a series of biocomputer models was presented with a seminal work of Shapiro and his colleguas who presented molecular 2 state finite automaton, in which the restriction enzyme, FokI, constituted hardware and short DNA oligomers were software as well as input/output signals. DNA molecules provided also energy for this machine. DNA computing can be exploited in many applications, from study on the gene expression pattern to diagnosis and therapy of cancer. The idea of DNA computing is still in progress in research both in vitro and in vivo and at least promising results of these research allow to have a hope for a breakthrough in the computer science. PMID:21735816

B?asiak, Janusz; Krasi?ski, Tadeusz; Pop?awski, Tomasz; Sakowski, Sebastian

2011-01-01

177

Inside DNA  

NSDL National Science Digital Library

In this activity (on pages 34-39), learners make a fairly detailed model of DNA using licorice and gumdrops. The sugar and phosphate backbone of DNA is represented by alternating red and black licorice, and the base pairs are represented by gumdrops arranged so that gumdrop colors are paired. After a pair of learners have made a DNA section, they find another team and link them up to make a model of a gene. They then split the model and "copy" it using the base pair rules from earlier, comparing their copy to the original to see if there are any differences (mutations).

2014-01-28

178

Fast DNA Translocation through a Solid-State Nanopore  

E-print Network

Fast DNA Translocation through a Solid-State Nanopore Arnold J. Storm, Cornelis Storm,,§ Jianghua of translocation of double-strand DNA through a siliconoxide nanopore. Long DNA molecules with different lengths of oligonucleotides.2-6 Recently, various groups have started to use solid-state nanopores for DNA translocation

Dekker, Cees

179

A Phosphate Bound Universal Linker for DNA Synthesis  

Microsoft Academic Search

A uridine-based linker immobilized onto polystyrene beads at the 5? terminus via a phosphodiester group and then used as a universal DNA synthesis support gives post synthesis DNA cleavage in 8 hrs or less without alkali metal salts. DNA produced with the new support was analyzed by HPLC, MALDI mass spectroscopy and PAGE. Each analysis showed DNA of equivalent quality

Matthew H. Lyttle; Daren J. Dick; Derek Hudson; Ronald M. Cook

1999-01-01

180

Dancing DNA.  

ERIC Educational Resources Information Center

An imaging technique that uses fluorescent dyes and allows scientists to track DNA as it moves through gels or in solution is described. The importance, opportunities, and implications of this technique are discussed. (KR)

Pennisi, Elizabeth

1991-01-01

181

DNA Adductomics  

PubMed Central

Systems toxicology is a broad-based approach to describe many of the toxicological features that occur within a living system under stress or subjected to exogenous or endogenous exposures. The ultimate goal is to capture an overview of all exposures and the ensuing biological responses of the body. The term exposome has been employed to refer to the totality of all exposures, and systems toxicology investigates how the exposome influences health effects and consequences of exposures over a lifetime. The tools to advance systems toxicology include high-throughput transcriptomics, proteomics, metabolomics, and adductomics, which is still in its infancy. A well-established methodology for the comprehensive measurement of DNA damage resulting from every day exposures is not fully developed. During the past several decades, the 32P-postlabeling technique has been employed to screen the damage to DNA induced by multiple classes of genotoxicants; however, more robust, specific, and quantitative methods have been sought to identify and quantify DNA adducts. Although triple quadrupole and ion trap mass spectrometry, particularly when using multistage scanning (LC–MSn), have shown promise in the field of DNA adductomics, it is anticipated that high-resolution and accurate-mass LC–MSn instrumentation will play a major role in assessing global DNA damage. Targeted adductomics should also benefit greatly from improved triple quadrupole technology. Once the analytical MS methods are fully mature, DNA adductomics along with other -omics tools will contribute greatly to the field of systems toxicology. PMID:24437709

2015-01-01

182

DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics  

E-print Network

DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics Soo­Yong Shin 1 , Eun Jeong the complexity of DNA computing. The complexity of any computational algorithm is typically measured in terms of time and space. In DNA computing, the time complexity can be measured by the total reaction time

183

DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics  

E-print Network

DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics Soo-Yong Shin1 , Eun Jeong of DNA computing. The complexity of any computational algorithm is typically measured in terms of time and space. In DNA computing, the time complexity can be measured by the total reaction time

184

Short noncoding DNA fragments improve the immune potency of electroporation-mediated HBV DNA vaccination.  

PubMed

Electroporation (EP)-mediated DNA immunization can elicit effective immune responses in a variety of animals, and is widely used in research studies and clinical trials. However, high-pulse voltage, high DNA dose and multiple immunizations are still required to achieve considerable immune responses. To further improve the efficiency of EP-mediated DNA immunization, many parameters have been tried and optimized in recent years. In our early research, we found that the short noncoding DNA fragments (sf-DNA) can significantly enhance EP-mediated transgene expression of reporter genes. In this study, we tested the effect of sf-DNA on the immune potency of EP-mediated hepatitis B virus (HBV) DNA vaccination in a mouse model. The results show that the use of sf-DNA in EP-mediated HBV DNA vaccination leads to an enhanced expression of the HBV surface antigen, resulting in higher cellular and humoral responses. Furthermore, the immune responses in the sf-DNA-mediated 120?V cm(-1) EP immunization group were higher than that of the 200?V?cm(-1) EP without sf-DNA groups. These data suggest that the sf-DNA can be used as an effective helper molecule to improve the immune response of EP-mediated HBV DNA vaccination, which may make the EP-mediated DNA vaccination more effective and suitable for animal and clinical application. PMID:24830435

Peng, J; Shi, S; Yang, Z; Ding, Q; Hai, W; Tang, H; Yang, Y; Bernstein, J R; Peyda, P; Xu, Y

2014-07-01

185

Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family  

PubMed Central

Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae. PMID:23717188

Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, José Rubens; Antonelli, Alexandre

2012-01-01

186

DNA phosphorothioate modifications influence the global transcriptional response and protect DNA from double-stranded breaks  

PubMed Central

The modification of DNA by phosphorothioate (PT) occurs when the non-bridging oxygen in the sugar-phosphate backbone of DNA is replaced with sulfur. This DNA backbone modification was recently discovered and is governed by the dndABCDE genes in a diverse group of bacteria and archaea. However, the biological function of DNA PT modifications is poorly understood. In this study, we employed the RNA-seq analysis to characterize the global transcriptional changes in response to PT modifications. Our results show that DNA without PT protection is susceptible to DNA damage caused by the dndFGHI gene products. The DNA double-stranded breaks then trigger the SOS response, cell filamentation and prophage induction. Heterologous expression of dndBCDE conferring DNA PT modifications at GPSA and GPST prevented the damage in Salmonella enterica. Our data provide insights into the physiological role of the DNA PT system. PMID:25319634

Gan, Rui; Wu, Xiaolin; He, Wei; Liu, Zhenhua; Wu, Shuangju; Chen, Chao; Chen, Si; Xiang, Qianrong; Deng, Zixin; Liang, Dequan; Chen, Shi; Wang, Lianrong

2014-01-01

187

DNA vaccines  

NASA Astrophysics Data System (ADS)

Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

Gregersen, Jens-Peter

2001-12-01

188

Adleman DNA ([14], [15])  

E-print Network

­ 1 Adleman DNA " " PCR PCR DNA DNA RNA " " " " 1 #12;PCR DNA 2 1. ([10]) DNA DNA DNA RNA RNA GFP RNA RNA RNA RNA GFP 2. DNA S S+ ([14], [15]) S+ ([17]) n (m ) S+ O(m6 n6 ) 2 #12;3. Abstract Rewriting System on Multisets, ARMS P53 DNA P53 4 " ()self-reinforcement reaction)" ARMS P Systems P Systems 4

Hagiya, Masami

189

PhD studentship in DNA biophysics Imperial College London  

E-print Network

PhD studentship in DNA biophysics Imperial College London Department of Chemistry, Faculty groups on chemical biology, chemical physics and biophysics, complex fluids, liquid crystals, nanoscience unique experience in DNA biophysics, doing research and attending lecture courses of choice

van der Heijden, Gert

190

##### SAT Engine ####### _ ############ DNA ###### _  

E-print Network

##### SAT Engine ####### _ ############ DNA ###### _ # # # #y # # #yy # # # #yy ###### DNA #################################### ############### ##################### 6 ## 10 ##### ### DNA ############### (Sakamoto et al., Science, Vol.288, pp.1223-122* *6

Hagiya, Masami

191

Synthesizing human insulin using recombinant DNA, 3D animation with no audioSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

DNAi Location: Manipulation>Production>pieces of the puzzle>Synthesizing the DNA In order to synthesize human insulin using recombinant DNA technology, the human DNA sequence for insulin was needed. The amino acid sequence of human insulin was known. The Genentech group deduced the human DNA sequence of insulin based on its amino acid sequence. They then used the DNA nucleotides and synthesized the human DNA sequence. This sequence was then inserted into a plasmid and transformed into bacteria to produce insulin. By synthesizing the DNA sequence, the Genentech group assembled a human DNA sequence of insulin without ever having to use \\"real\\" human DNA. They thus bypassed some of the restrictions on human recombinant DNA work resulting from the Asilomar conference.

2008-10-06

192

Studies on bacteriophage T7 DNA synthesis in vitro  

Microsoft Academic Search

DNA synthesis in vitro using intact duplex T7 DNA as template is dependent on a novel group of three phage T7-induced proteins: DNA-priming protein (activity which complements a cell extract lacking the T7 gene 4-protein), T7 DNA polymerase (gene 5-protein plus host factor), and T7 DNA-binding protein. The reaction requires, in addition to the four deoxyribonucleoside triphosphates, all four ribonucleoside

Eberhard Scherzinger; Giinther Klotz

1975-01-01

193

Neandertal DNA  

NSDL National Science Digital Library

The view of some scientists that modern humans did not descend from the Neandertals gained support when scientists from Munich, Germany analyzed DNA from a Neandertal. A news article from Archeology Online News discusses the recent research and provides links to additional news clips. This site covers one of the top ten scientific breakthroughs of 1997, compiled in the December 19, 1997 issue of Science. The top scientific breakthrough of 1997 was the cloning of a sheep, resulting in a lamb named Dolly. The nine runners up were: the Pathfinder mission to Mars, synchrotrons, biological clock genes, gamma ray bursts, Neandertal DNA, nanotubes, Europa's ocean, whole genome sequencing, and neurons.

1997-01-01

194

Synthetic DNA  

PubMed Central

With world wide data predicted to exceed 40 trillion gigabytes by 2020, big data storage is a very real and escalating problem. Herein, we discuss the utility of synthetic DNA as a robust and eco-friendly archival data storage solution of the future. PMID:23514938

O’ Driscoll, Aisling; Sleator, Roy D.

2013-01-01

195

DNA Music.  

ERIC Educational Resources Information Center

Describes an activity in which students reverse-translate proteins from their amino acid sequences back to their DNA sequences then assign musical notes to represent the adenine, guanine, cytosine, and thymine bases. Data is obtained from the National Institutes of Health (NIH) on the Internet. (DDR)

Miner, Carol; della Villa, Paula

1997-01-01

196

Origami DNA  

NSDL National Science Digital Library

In this activity, learners create an origami model of DNA, demonstrating its double helix structure. Two templates are available as PDFs: a standard template with the base pairs already colored or a blank template where the learners have to color the four bases A, C, T and G and mark them in the correct location on the template.

Alex Bateman

2012-06-26

197

DNA Methylation  

PubMed Central

The DNA of E. coli contains 19,120 6-methyladenines and 12,045 5-methylcytosines in addition to the four regular bases and these are formed by the postreplicative action of three DNA methyltransferases. The majority of the methylated bases are formed by the Dam and Dcm methyltransferases encoded by the dam (DNA adenine methyltransferase) and dcm (DNA cytosine methyltransferase) genes. Although not essential, Dam methylation is important for strand discrimination during repair of replication errors, controlling the frequency of initiation of chromosome replication at oriC, and regulation of transcription initiation at promoters containing GATC sequences. In contrast, there is no known function for Dcm methylation although Dcm recognition sites constitute sequence motifs for Very Short Patch repair of T/G base mismatches. In certain bacteria (e.g., Vibrio cholerae, Caulobacter crescentus) adenine methylation is essential and in C. crescentus, it is important for temporal gene expression which, in turn, is required for coordinating chromosome initiation, replication and division. In practical terms, Dam and Dcm methylation can inhibit restriction enzyme cleavage; decrease transformation frequency in certain bacteria; decrease the stability of short direct repeats; are necessary for site-directed mutagenesis; and to probe eukaryotic structure and function. PMID:25405210

Marinus, M.G.; Løbner-Olesen, A.

2014-01-01

198

DNA vaccines  

Microsoft Academic Search

Preclinical DNA vaccine development has continued apace during the past year, with the investigation of several new infectious and non-infectious disease targets as well as advances in our understanding of some of the basic immunologic mechanisms, such as effector cells, responsible for conferring protection. The coming year promises to be at least as exciting, as initial human clinical studies have

Jeffrey B Ulmer; Jerald C Sadoff; Margaret A Liu

1996-01-01

199

STRBase and Information Resources on Forensic DNA  

E-print Network

Journal of Forensic Sciences DNA publications vs total articles 0 3 0 6 9 11 14 15 18 26 34 35 43 44 43 51 of the technique · DNA is often referred to as the "gold standard" in forensic science because of the scientific of Journals in Our Group Library We now have on-line access to all forensic DNA journals #12;Applied Genetics

Perkins, Richard A.

200

Adleman[1] 1994 DNA Hamiltonian Path Problem , DNA  

E-print Network

1. Adleman[1] 1994 DNA Hamiltonian Path Problem , DNA DNA [2]. DNA DNA , . , , 2 , DNA 4 . DNA 4 A(Adenine), C(Cytosine), G(Guanine), T(Thymine) 2 4 . , . 1 mole 6x10 23 DNA DNA . , . DNA NP-complete [1, 2], [2

201

DNA Topology: Fundamentals  

E-print Network

DNA Topology: Fundamentals Sergei M Mirkin, University of Illinois at Chicago, Illinois, USA Topological characteristics of DNA and specifically DNA supercoiling influence all major DNA transactions in living cells. DNA supercoiling induces the formation of unusual secondary structure by specific DNA

Mirkin, Sergei

202

DNA sequencing using fluorescence background electroblotting membrane  

DOEpatents

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

Caldwell, Karin D. (Salt Lake City, UT); Chu, Tun-Jen (Salt Lake City, UT); Pitt, William G. (Orem, UT)

1992-01-01

203

Nanomechanical molecular devices made of DNA origami.  

PubMed

CONSPECTUS: Eight years have passed since the striking debut of the DNA origami technique ( Rothemund, P. W. K. Nature 2006 , 440 , 297 - 302 ), in which long single-stranded DNA is folded into a designed nanostructure, in either 2D or 3D, with the aid of many short staple strands. The number of proposals for new design principles for DNA origami structures seems to have already reached a peak. It is apparent that DNA origami study is now entering the second phase of creating practical applications. The development of functional nanomechanical molecular devices using the DNA origami technique is one such application attracting significant interest from researchers in the field. Nanomechanical DNA origami devices, which maintain the characteristics of DNA origami structures, have various advantages over conventional DNA nanomachines. Comparatively high assembly yield, relatively large size visible via atomic force microscopy (AFM) or transmission electron microscopy (TEM), and the capability to assemble multiple functional groups with precision using multiple staple strands are some of the advantages of the DNA origami technique for constructing sophisticated molecular devices. This Account describes the recent developments of such nanomechanical DNA origami devices and reviews the emerging target of DNA origami studies. First, simple "dynamic" DNA origami structures with transformation capability, such as DNA origami boxes and a DNA origami hatch with structure control, are briefly summarized. More elaborate nanomechanical DNA origami devices are then reviewed. The first example describes DNA origami pinching devices that can be used as "single-molecule" beacons to detect a variety of biorelated molecules, from metal ions at the size of a few tens of atomic mass number units to relatively gigantic proteins with a molecular mass greater than a hundred kilodaltons, all on a single platform. Clamshell-like DNA nanorobots equipped with logic gates can discriminate different cell lines, open their shell, and bind to their target. An intelligent DNA origami "sheath" can mimic the function of suppressors in a transcription regulation system to control the expression of a loaded gene. DNA origami "rolls" are created to construct precisely arranged plasmonic devices with metal nanoparticles. All of their functions are derived from their nanomechanical movement, which is programmable by designing the DNA sequence or by using the significant repository of technical achievements in nucleic acid chemistry. Finally, some studies on detailed structural parameters of DNA origami or their mechanical properties in nanoscale are discussed, which may be useful and inspiring for readers who intend to design new nanomechanical DNA origami devices. PMID:24772996

Kuzuya, Akinori; Ohya, Yuichi

2014-06-17

204

Groups32  

NSDL National Science Digital Library

A group theory calculator. Groups32 computes information about groups of orders 1-32; has a permutation group package; and provides a search for groups with given generators and relations. Site includes documentation as well as course handouts in PDF format.

2007-11-08

205

Original article Ribosomal DNA and chloroplast DNA  

E-print Network

Original article Ribosomal DNA and chloroplast DNA polymorphisms in a mixed stand of Quercus robur in western France. The ribosomal DNA repeat was characterized by a high level of length polymorphism; while chloro- plast DNA in our sample was nearly fixed at 2 previously identified polymorphic regions. Overall

Boyer, Edmond

206

Prognostic Significance of DNA and Histone Methylation  

Cancer.gov

Nutritional Science Research Group Recently Funded Projects Prognostic Significance of DNA and Histone Methylation Principal Investigator: Piyathilake, Chandrika J Institution: University of Alabama at Birmingham   NCI/DCP Program Director: Ross, Sharon

207

Grouping Dinosaurs  

NSDL National Science Digital Library

In this classroom activity, young students are introduced to sets and subsets. The activity opens with background information for teachers about cladistics. After brainstorming different ways to group the class itself, students work in small groups to identify subsets of coins. The groups then complete a worksheet that challenges them to group dinosaurs into sets and subsets and share their results with the class.

208

DNA/RNA Detection Using DNA-Templated Few-Atom Silver Nanoclusters  

PubMed Central

DNA-templated few-atom silver nanoclusters (DNA/Ag NCs) are a new class of organic/inorganic composite nanomaterials whose fluorescence emission can be tuned throughout the visible and near-IR range by simply programming the template sequences. Compared to organic dyes, DNA/Ag NCs can be brighter and more photostable. Compared to quantum dots, DNA/Ag NCs are smaller, less prone to blinking on long timescales, and do not have a toxic core. The preparation of DNA/Ag NCs is simple and there is no need to remove excess precursors as these precursors are non-fluorescent. Our recent discovery of the fluorogenic and color switching properties of DNA/Ag NCs have led to the invention of new molecular probes, termed NanoCluster Beacons (NCBs), for DNA detection, with the capability to differentiate single-nucleotide polymorphisms by emission colors. NCBs are inexpensive, easy to prepare, and compatible with commercial DNA synthesizers. Many other groups have also explored and taken advantage of the environment sensitivities of DNA/Ag NCs in creating new tools for DNA/RNA detection and single-nucleotide polymorphism identification. In this review, we summarize the recent trends in the use of DNA/Ag NCs for developing DNA/RNA sensors. PMID:25586126

Obliosca, Judy M.; Liu, Cong; Batson, Robert Austin; Babin, Mark C.; Werner, James H.; Yeh, Hsin-Chih

2013-01-01

209

Energy transport in crystalline DNA composites  

SciTech Connect

This work reports on the synthesis of crystalline DNA-composited films and microfibers, and details the study of thermal energy transport in them. The transient electro-thermal technique is used to characterize the thermal transport in DNA composite microfibers, and the photothermal technique is used to explore the thermal transport in the thickness direction of DNA films. Compared with microfibers, the DNA films are found to have a higher thermal transport capacity, largely due to the carefully controlled crystallization process in film synthesis. In high NaCl concentration solutions, the bond of the Na{sup +} ion and phosphate group aligns the DNA molecules with the NaCl crystal structure during crystallization. This results in significant enhancement of thermal transport in the DNA films with aligned structure.

Xu, Zaoli; Xu, Shen; Tang, Xiaoduan; Wang, Xinwei, E-mail: xwang3@iastate.edu [Department of Mechanical Engineering, 2010 Black Engineering Building Iowa State University, Ames, IA 50011 (United States)] [Department of Mechanical Engineering, 2010 Black Engineering Building Iowa State University, Ames, IA 50011 (United States)

2014-01-15

210

Preparation and characterization of imogolite/DNA hybrid hydrogels.  

PubMed

Imogolite is one of the clay minerals contained in volcanic ash soils. The novel hybrid hydrogels were prepared from imogolite nanofibers and DNA by utilizing strong interaction between the aluminol groups on imogolite surface and phosphate groups of DNA. The hybrid hydrogels of imogolite and DNA were prepared in various feed ratios, and their physicochemical properties and molecular aggregation states were investigated in both dispersion and gel states. The maximum DNA content in the hybrid gels was shown in equivalent molar ratio of imogolite and DNA. The physical properties of the hybrid gels were changed by varying DNA blend ratios. In the dispersion state, the hybrid gels showed a fibrous structure of imogolite, whereas a continuous network structure was observed in pure imogolite, indicating that the hybrid with DNA enhanced the dispersion of imogolite. In the gel state, DNA and imogolite nanofibers formed a 3D network structure. PMID:22148683

Jiravanichanun, Nattha; Yamamoto, Kazuya; Kato, Kenichi; Kim, Jungeun; Horiuchi, Shin; Yah, Weng-On; Otsuka, Hideyuki; Takahara, Atsushi

2012-01-01

211

DNA adsorption characteristics of hollow spherical allophane nano-particles  

NASA Astrophysics Data System (ADS)

To understand the propensity of the natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against a natural allophane, using single-stranded DNA (ss-DNA) and adenosine 5'-monophosphate (5'-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5'-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al-OH groups on the wall perforations through deprotonation, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the allophane clustered particle was successfully observed through TEM analysis.

Matsuura, Yoko; Iyoda, Fumitoshi; Hayashi, Shuhei; Arakawa, Shuichi; Okamoto, Masami; Hayashi, Hidetomo

2014-05-01

212

mtDNA / Y chromosome pedigree, animated imageSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

DNAi location:Applications>gene genealogy>Tracing ancestries>Using genetic tools together Studies following the male lineage (using the Y chromosome) have been compared to studies following the female lineage (using mitochondrial DNA (mtDNA)). The results suggest that men and women have had different roles in the peopling of the planet and in the mixing of genes among population groups. A pedigree illustrating maternal inheritance of mtDNA and paternal inheritance of the Y chromosome.

2008-10-06

213

Taxonomy of the Lacto bacillus acidophilus Group  

Microsoft Academic Search

A total of 89 strains designated Lactobtrcillus acidophilus were examined for physiological properties, type of lactic acid produced, cell wall sugar pattern, guanine plus cytosine content of deoxyribonucleic acid (DNA), and DNA homol- ogy values compared with selected reference strains. Immunological reactions among a group of the strains were determined by gel diffusion tests, using antiserum to purified lactic acid

J. L. JOHNSON; C. F. PHELPS; C. S. CUMMINS; F. GASSER

1980-01-01

214

Advance the DNA computing  

E-print Network

It has been previously shown that DNA computing can solve those problems currently intractable on even the fastest electronic computers. The algorithm design for DNA computing, however, is not straightforward. A strong background in both the DNA...

Qiu, Zhiquan Frank

2004-09-30

215

Characterization and PCR performance of a family B-type DNA polymerase from the hyperthermophilic crenarchaeon Staphylothermus marinus  

Microsoft Academic Search

The gene encoding Staphylothermus marinus DNA polymerase (Sma DNA polymerase) was cloned and sequenced. The Sma DNA polymerase gene consists of 2406bp coding for a protein with 801 amino acid residues. The deduced amino acid sequence of Sma DNA polymerase exhibited a high degree of similarity with archaeal family B-type DNA polymerase homologues found in both crenarchaeotes and euryarchaeotes (Group

Jung Min Song; Jeong Jin Choi; Tae Ook Kim; Moo Seok Seo; Mi Sun Lee; Hyun-Kyu Kim; Suk-Tae Kwon

2007-01-01

216

Synthesis of DNA  

DOEpatents

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Mariella, Jr., Raymond P. (Danville, CA)

2008-11-18

217

Hole transfer kinetics of DNA.  

PubMed

Not long after the discovery of the double-helical structure of DNA in 1952, researchers proposed that charge transfer along a one-dimensional ?-array of nucleobases might be possible. At the end of the 1990s researchers discovered that a positive charge (a hole) generated in DNA migrates more than 200 Å along the structure, a discovery that ignited interest in the charge-transfer process in DNA. As a result, DNA became an interesting potential bottom-up material for constructing nanoelectronic sensors and devices because DNA can form various complex two-dimensional and three-dimensional structures, such as smiley faces and cubes. From the fundamental aspects of the hole transfer process, DNA is one of the most well-studied organic molecules with many reports on the synthesis of artificial nucleobase analogues. Thus, DNA offers a unique system to study how factors such as the HOMO energy and molecular flexibility affect hole transfer kinetics. Understanding the hole transfer mechanism requires a discussion of the hole transfer rate constants (kHT). This Account reviews the kHT values determined by our group and by Lewis and Wasielewski's group, obtained by a combination of the synthesis of modified DNA and time-resolved spectroscopy. DNA consists of G/C and A/T base pairs; the HOMO localizes on the purine bases G and A, and G has a lower oxidation potential and a higher energy HOMO. Typically, long-range hole transfer proceeded via sequential hole transfer between G/C's. The kinetics of this process in DNA sequences, including those with mismatches, is reproducible via kinetic modeling using the determined kHT for each hole transfer step between G/C's. We also determined the distance dependence parameter (?), which describes the steepness of the exponential decrease of kHT. Because of this value, >0.6 Å(-1) for hole transfer in DNA, DNA itself does not serve as a molecular wire. Interestingly, hole transfer proceeded exceptionally fast for some sequences in which G/C's are located close to each other, an observation that we cannot explain by a simple sequential hole transfer between G/C's but rather through hole delocalization over the nucleobases. To further investigate and refine the factors that affect kHT, we examined various artificial nucleobases. We clearly demonstrated that kHT depends strongly on the HOMO energy gap between the bases (?HOMO), and that kHT can be increased with decreasing ?HOMO. We reduced ?HOMO between the two type of base pairs by replacing adenines (A's) with deazaadenines ((z)A's) or diaminopurines (D's) and showed that the hole transfer rate through the G/C and A/T mix sequence increased by more than 3 orders of magnitude. We also investigated how DNA flexibility affects kHT. Locked nucleic acid (LNA) modification, which makes DNA more rigid, lowered kHT by more than 2 orders of magnitude. On the other hand, 5-Me-2'-deoxyzebularine (B) modification, which increases DNA flexibility, increased kHT by more than 1 order of magnitude. These new insights in hole transfer kinetics obtained from modified DNAs may aid in the design of new molecular-scale conducting materials. PMID:23805774

Kawai, Kiyohiko; Majima, Tetsuro

2013-11-19

218

DNA modifications: Another stable base in DNA  

NASA Astrophysics Data System (ADS)

Oxidation of 5-methylcytosine has been proposed to mediate active and passive DNA demethylation. Tracking the history of DNA modifications has now provided the first solid evidence that 5-hydroxymethylcytosine is a stable epigenetic modification.

Brazauskas, Pijus; Kriaucionis, Skirmantas

2014-12-01

219

Group Signatures  

Microsoft Academic Search

Abstract. In this paper we present a new type of signature for a group of persons, called a group signature, which has the following propertjes: (i) only members,of the group can sign messages; (ii) the receiver can verify that it is a valid group signaa~e, but cannot discover which gr~up member made (i) if necessary, the signature can be \\

David Chaum; Eugène Van Heyst

1991-01-01

220

The 1998–1999 collaborative exercises and proficiency testing program on DNA typing of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG)  

Microsoft Academic Search

A total of 28 laboratories (labs) submitted results for the 1998 collaborative exercise and the proficiency testing program of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG) group. This number increased to 46 labs in 1999. Six bloodstains were submitted, each one with 200?l soaked in cotton except the sample no. 6 submitted for

Josefina Gómez; Angel Carracedo

2000-01-01

221

Thermodynamic Simulation of DNA/DNA Bimolecular Two-State Hybridization  

E-print Network

DNA DNA/DNA Thermodynamic Simulation of DNA/DNA Bimolecular Two-State Hybridization 2004 2/05/18 10:58:50 #12;DNA DNA/DNA Thermodynamic Simulation of DNA/DNA Bimolecular Two; , . DNA DNA . single base mismatch dangling ends NN DNA DNA , DNA artificial

222

DNA Binding Hydroxyl Radical Probes  

PubMed Central

The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA. PMID:22125376

Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

2011-01-01

223

Aberrant DNA methylation patterns in diabetic nephropathy  

PubMed Central

Background The aim of this study was to evaluate whether global levels of DNA methylation status were associated with albuminuria and progression of diabetic nephropathy in a case-control study of 123 patients with type 2 diabetes- 53 patients with albuminuria and 70 patients without albuminuria. Methods The 5-methyl cytosine content was assessed by reverse phase high pressure liquid chromatography (RP-HPLC) of peripheral blood mononuclear cells to determine individual global DNA methylation status in two groups. Results Global DNA methylation levels were significantly higher in patients with albuminuria compared with those in normal range of albuminuria (p?=?0.01). There were significant differences in global levels of DNA methylation in relation to albuminuria (p?=?0.028) and an interesting pattern of increasing global levels of DNA methylation in terms of albuminuria severity. In patients with micro- and macro albuminuria, we found no significant correlations between global DNA methylation levels and duration of diabetes (p?>?0.05). In both sub groups, there were not significant differences between global DNA methylation levels with good and poor glycaemic control (p?>?0.05). In addition, in patients with albuminuria, no differences in DNA methylation levels were observed between patients with and without other risk factors including age, gender, hypertension, dyslipidaemia and obesity. Conclusions These data may be helpful in further studies to develop novel biomarkers and new strategies for clinical care of patients at risk of diabetic nephropathy. PMID:25028646

2014-01-01

224

Galaxy Groups  

NASA Astrophysics Data System (ADS)

Galaxy groups can be characterized by the radius of decoupling from cosmic expansion, the radius of the caustic of second turnaround, and the velocity dispersion of galaxies within this latter radius. These parameters can be a challenge to measure, especially for small groups with few members. In this study, results are gathered pertaining to particularly well-studied groups over four decades in group mass. Scaling relations anticipated from theory are demonstrated and coefficients of the relationships are specified. There is an update of the relationship between light and mass for groups, confirming that groups with mass of a few times {{10}12}{{M}? } are the most lit up while groups with more and less mass are darker. It is demonstrated that there is an interesting one-to-one correlation between the number of dwarf satellites in a group and the group mass. There is the suggestion that small variations in the slope of the luminosity function in groups are caused by the degree of depletion of intermediate luminosity systems rather than variations in the number per unit mass of dwarfs. Finally, returning to the characteristic radii of groups, the ratio of first to second turnaround depends on the dark matter and dark energy content of the universe and a crude estimate can be made from the current observations of {{?}matter}˜ 0.15 in a flat topology, with a 68% probability of being less than 0.44.

Tully, R. Brent

2015-02-01

225

DNA restriction patterns and DNA-DNA solution hybridization studies of Frankia isolates from Myrica pennsylvanica (bayberry).  

PubMed Central

Sixteen Frankia strains were isolated from Myrica pennsylvanica (bayberry) root nodules collected at diverse sites in New Jersey. Restriction pattern analysis of total genomic DNA was used to group the isolates into gel groups, and the genetic relatedness among the isolates was evaluated by DNA-DNA solution hybridization studies. Restriction pattern analysis provided a distinctive reproducible fingerprint for each isolate. Isolates fell into nine separate groups (strain types). More than one strain type was isolated from most sites. Isolates from two different gel groups were found in 3 of 10 nodules examined. Of the 16 isolates, 10 contained extrachromosomal DNA. Six different extrachromosomal DNA banding patterns were found. Genomically similar isolates carried related, but different, banding patterns. DNA hybridization studies indicated that isolates from a single plant species can be minimally related as determined by total genome homology. Homology ranged from 12 to 99%. Highly divergent strains were isolated from the same plant and found to cohabit the same nodule. Thus, this study demonstrated that Frankia strains which infect the same host plant are not only phenotypically different but also genetically diverse. Images PMID:2802599

Bloom, R A; Mullin, B C; Tate, R L

1989-01-01

226

newDNA-Prot: Prediction of DNA-binding proteins by employing support vector machine and a comprehensive sequence representation.  

PubMed

Identification of DNA-binding proteins is essential in studying cellular activities as the DNA-binding proteins play a pivotal role in gene regulation. In this study, we propose newDNA-Prot, a DNA-binding protein predictor that employs support vector machine classifier and a comprehensive feature representation. The sequence representation are categorized into 6 groups: primary sequence based, evolutionary profile based, predicted secondary structure based, predicted relative solvent accessibility based, physicochemical property based and biological function based features. The mRMR, wrapper and two-stage feature selection methods are employed for removing irrelevant features and reducing redundant features. Experiments demonstrate that the two-stage method performs better than the mRMR and wrapper methods. We also perform a statistical analysis on the selected features and results show that more than 95% of the selected features are statistically significant and they cover all 6 feature groups. The newDNA-Prot method is compared with several state of the art algorithms, including iDNA-Prot, DNAbinder and DNA-Prot. The results demonstrate that newDNA-Prot method outperforms the iDNA-Prot, DNAbinder and DNA-Prot methods. More specific, newDNA-Prot improves the runner-up method, DNA-Prot for around 10% on several evaluation measures. The proposed newDNA-Prot method is available at http://sourceforge.net/projects/newdnaprot/ PMID:25240115

Zhang, Yanping; Xu, Jun; Zheng, Wei; Zhang, Chen; Qiu, Xingye; Chen, Ke; Ruan, Jishou

2014-10-01

227

GROUP INEQUALITY  

PubMed Central

We explore the combined effect of segregation in social networks, peer effects, and the relative size of a historically disadvantaged group on the incentives to invest in market-rewarded skills and the dynamics of inequality between social groups. We identify conditions under which group inequality will persist in the absence of differences in ability, credit constraints, or labor market discrimination. Under these conditions, group inequality may be amplified even if initial group differences are negligible. Increases in social integration may destabilize an unequal state and make group equality possible, but the distributional and human capital effects of this depend on the demographic composition of the population. When the size of the initially disadvantaged group is sufficiently small, integration can lower the long-run costs of human capital investment in both groups and result in an increase the aggregate skill share. In contrast, when the initially disadvantaged group is large, integration can induce a fall in the aggregate skill share as the costs of human capital investment rise in both groups. We consider applications to concrete cases and policy implications.

Bowles, Samuel; Loury, Glenn C.; Sethi, Rajiv

2014-01-01

228

DNA Repair by Reversal of DNA Damage  

PubMed Central

Endogenous and exogenous factors constantly challenge cellular DNA, generating cytotoxic and/or mutagenic DNA adducts. As a result, organisms have evolved different mechanisms to defend against the deleterious effects of DNA damage. Among these diverse repair pathways, direct DNA-repair systems provide cells with simple yet efficient solutions to reverse covalent DNA adducts. In this review, we focus on recent advances in the field of direct DNA repair, namely, photolyase-, alkyltransferase-, and dioxygenase-mediated repair processes. We present specific examples to describe new findings of known enzymes and appealing discoveries of new proteins. At the end of this article, we also briefly discuss the influence of direct DNA repair on other fields of biology and its implication on the discovery of new biology. PMID:23284047

Yi, Chengqi; He, Chuan

2013-01-01

229

Attitudes on DNA ancestry tests.  

PubMed

The DNA ancestry testing industry is more than a decade old, yet details about it remain a mystery: there remain no reliable, empirical data on the number, motivations, and attitudes of customers to date, the number of products available and their characteristics, or the industry customs and standard practices that have emerged in the absence of specific governmental regulations. Here, we provide preliminary data collected in 2009 through indirect and direct participant observation, namely blog post analysis, generalized survey analysis, and targeted survey analysis. The attitudes include the first available data on attitudes of those of individuals who have and have not had their own DNA ancestry tested as well as individuals who are members of DNA ancestry-related social networking groups. In a new and fluid landscape, the results highlight the need for empirical data to guide policy discussions and should be interpreted collectively as an invitation for additional investigation of (1) the opinions of individuals purchasing these tests, individuals obtaining these tests through research participation, and individuals not obtaining these tests; (2) the psychosocial and behavioral reactions of individuals obtaining their DNA ancestry information with attention given both to expectations prior to testing and the sociotechnical architecture of the test used; and (3) the applications of DNA ancestry information in varying contexts. PMID:21698460

Wagner, Jennifer K; Weiss, Kenneth M

2012-01-01

230

Quantitative DNA fiber mapping  

DOEpatents

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

Gray, Joe W. (San Francisco, CA); Weier, Heinz-Ulrich G. (Oakland, CA)

1998-01-01

231

Preparation and characterization of DNA/allophane composite hydrogels.  

PubMed

The preparation and characterization of the composite hydrogels based on double-stranded deoxyribonucleic acid (DNA) and natural allophane (AK70) were reported. To understand the propensity of the natural allophane to adsorb the DNA molecules, using zeta potential measurement, Fourier transform infrared spectroscopy (FTIR) and electrophoresis analyses assessed the adsorption characteristics. The freeze-dried DNA/AK70 hydrogels were demonstrated that the DNA bundle structure with a width of ?2?m and a length of ?15-20?m was wrapped around the clustered allophane particles as revealed by FE-SEM/EDX analysis. The incorporation of AK70 in hydrogels induced the increase in the enthalpy of the helix-coil transition of DNA duplex due to the restricted molecular motions of the DNA duplex facilitated by the interaction between the phosphate groups of DNA and the protonated (+)(OH2)Al(OH2) groups on the wall perforations of the allophane. PMID:24041573

Kawachi, Takuya; Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; Okamoto, Masami

2013-12-01

232

Chemical method for introducing haptens on to DNA probes  

SciTech Connect

The authors developed a versatile chemical method of attaching hapten moieties onto DNA, for the construction of nonisotopic DNA probes. The DNA is reacted with N-bromosuccinimide at alkaline pH, resulting in bromination of a fraction of the thymine, guanine, and cytosine residues, with adenine modified to a lesser extent. The bromine is subsequently displaced by a primary amino group, attached to a linker arm. The other end of the linker arm has a detectable group preattached to it. They have labeled cloned hepatitis B viral (HBV) DNA with the hapten 2,4-dinitrophenyl (DNP) and used it in combination with a high affinity rabbit anti-DNP antibody, for the detection of hepatitis B DNA by slot blotting. This probe was sensitive enough to specifically detect 1 x 10/sup -17/ mol (1 x 10/sup 6/ copies) of HBV DNA in total DNA from human serum.

Keller, G.H.; Cumming, C.U.; Huang, D.P.; Manak, M.M.; Ting, R.

1988-05-01

233

Molecular Mechanisms of DNA Polymerase Clamp Loaders  

NASA Astrophysics Data System (ADS)

Clamp loaders are ATP-driven multiprotein machines that couple ATP hydrolysis to the opening and closing of a circular protein ring around DNA. This ring-shaped clamp slides along DNA, and interacts with numerous proteins involved in DNA replication, DNA repair and cell cycle control. Recently determined structures of clamp loader complexes from prokaryotic and eukaryotic DNA polymerases have revealed exciting new details of how these complex AAA+ machines perform this essential clamp loading function. This review serves as background to John Kuriyan's lecture at the 2010 Erice School, and is not meant as a comprehensive review of the contributions of the many scientists who have advanced this field. These lecture notes are derived from recent reviews and research papers from our groups.

Kelch, Brian; Makino, Debora; Simonetta, Kyle; O'Donnell, Mike; Kuriyan, John

234

Grouping Fireflies  

NSDL National Science Digital Library

In this lesson, students will explore the way fireflies are grouped in the text Ten Flashing Fireflies by Philomen Sturges. Students will represent all of the ways fireflies can be grouped so that some are in a jar and some are left to fly in the night sky.

Brown, Kathleen

2012-07-25

235

High-Fidelity DNA Hybridization Using Programmable Molecular DNA Devices  

E-print Network

High-Fidelity DNA Hybridization Using Programmable Molecular DNA Devices Nikhil Gopalkrishnan specific high-fidelity DNA hybridization reactions for tar- get strands of arbitrary length. Our protocol stranded DNA into duplex DNA that help overcome kinetic energy traps, similar to DNA walkers. Keywords: DNA

Reif, John H.

236

Tumorigenic DNA viruses  

SciTech Connect

The eighth volume of Advances in Viral Oncology focuses on the three major DNA virus groups with a postulated or proven tumorigenic potential: papillomaviruses, animal hepatitis viruses, and the Epstein-Bar virus. In the opening chapters, the contributors analyze the evidence that papillomaviruses and animal hepatitis viruses are involved in tumorigenesis and describe the mechanisms that trigger virus-host cell interactions. A detailed section on the Epstein-Barr virus (EBV) - comprising more than half the book - examines the transcription and mRNA processing patterns of the virus genome; the mechanisms by which EBV infects lymphoid and epithelial cells; the immunological aspects of the virus; the actions of EBV in hosts with Acquired Immune Deficiency Syndrome; and the involvement of EBV in the etiology of Burkitt's lymphoma.

Klein, G.

1989-01-01

237

Nucleotide sequence of cassava latent virus DNA  

Microsoft Academic Search

Only two groups of plant viruses, the caulimoviruses1,2 and the geminiviruses3, are known to contain a genome of DNA. Unlike that of the caulimoviruses, the genome of the geminivinises is composed of single-stranded, covalently-closed circles of DNA. There is evidence that the geminiviruses, specifically bean golden mosaic virus4 and tomato golden mosaic virus5, have a genome composed of two similar-sized

John Stanley; Michael R. Gay

1983-01-01

238

Plane Groups  

NSDL National Science Digital Library

This is a lengthy PDF document (60 pages+) about plane groups and symmetry. It includes colorful images of each of the 17 plane groups, in several different forms. Additionally, there are some summarizing graphics that show unit cells, lattices, symmetry elements, etc. There is lots here to choose from -- I doubt that anyone will want to use all of the images. Studying plane groups is a good way to introduce crystal systems, point groups, lattices, symmetry operators, etc. All is in 2-D, but it is easy to tell students that the principles are the same in 3-D. For those who like to make changes, the PDF document was created from individual EPS files. This means that the files can be opened in Adobe Illustrator, Corel Draw, etc., and modified to fit your own needs.

Perkins, Dexter

239

Research Groups  

Cancer.gov

This group provides key consultations across NCI, developing and using statistical analysis of biological data, computer and mathematical models, and conducting research in biostatistical and epidemiological methodologies and mathematical modeling of processes.

240

Extracellular DNA: the tip of root defenses?  

PubMed

This review discusses how extracellular DNA (exDNA) might function in plant defense, and at what level(s) of innate immunity this process might operate. A new role for extracellular factors in mammalian defense has been described in a series of studies. These studies reveal that cells including neutrophils, eosinophils, and mast cells produce 'extracellular traps' (ETs) consisting of histone-linked exDNA. When pathogens are attracted to such ETs, they are trapped and killed. When the exDNA component of ETs is degraded, trapping is impaired and resistance against invasion is reduced. Conversely, mutation of microbial genes encoding exDNases that degrade exDNA results in loss of virulence. This discovery that exDNases are virulence factors opens new avenues for disease control. In plants, exDNA is required for defense of the root tip. Innate immunity-related proteins are among a group of >100 proteins secreted from the root cap and root border cell populations. Direct tests revealed that exDNA also is rapidly synthesized and exported from the root tip. When this exDNA is degraded by the endonuclease DNase 1, root tip resistance to fungal infection is lost; when the polymeric structure is degraded more slowly, by the exonuclease BAL31, loss of resistance to fungal infection is delayed accordingly. The results suggest that root border cells may function in a manner analogous to that which occurs in mammalian cells. PMID:21497709

Hawes, Martha C; Curlango-Rivera, Gilberto; Wen, Fushi; White, Gerard J; Vanetten, Hans D; Xiong, Zhongguo

2011-06-01

241

DNA damage in peripheral blood leukocytes in tobacco users  

PubMed Central

Aim: To Quantify the DNA single-stranded breaks in the peripheral blood leukocytes (PBLs) of tobacco-habituated individuals with clinically normal mucosa and patients with oral carcinoma. Objectives: To evaluate DNA damage levels in PBLs of tobacco-habituated individuals with clinically normal mucosa and patients with oral carcinoma and compare with a control group of healthy volunteers. To evaluate the extent of DNA damage in PBLs using Single Cell Gel Electrophoresis (SCGE) in the above groups. Materials and Methods: Patients who were attending the outpatient department were enrolled in this study. A control group of 30 healthy volunteers included in Group I were selected from various age groups who are not tobacco users in any form. Thirty patients with tobacco habituation but with clinically normal mucosa were included in Group II, while 30 tobacco-habituated patients with oral squamous carcinoma were included in Group III. A biopsy was taken from the representative area and confirmed histologically. Intravenous blood samples were collected from all the groups for evaluation of the extent of DNA damage using ethidium bromide-stained slides under fluorescent microscope. The DNA tail length was calculated by subtracting the diameter from the total length. Twenty-five randomly selected cells per slide were analyzed and mean calculated. Results: The mean DNA damage levels in patients with tobacco habits were compared with that of the control group and the results were found to be statistically significant. The mean DNA damage level in PBLs between tobacco-habituated patients with normal mucosa and oral cancer patients was found to be statistically significant. The DNA damage in cancer patients was compared with the control group and the results were found to be statistically significant. Conclusion: DNA damage evaluation in PBLs by SCGE technique is a sensitive and reliable indicator of tobacco insult. PMID:25364170

Guttikonda, Venkateswara Rao; Patil, Rekha; Kumar, GS

2014-01-01

242

DNA base composition of species of the genus Saccharomyces  

Microsoft Academic Search

DNA base compositions (GC content) ofSaccharomyces species are reported and discussed. Several amendments of the four groups given by van der Walt are suggested, viz. the transfer\\u000a ofS. kluyveri to group 1, and ofS. eupagycus, S. cidri, S. montanus, S. microellipsodes andS. florentinus to group 2. The synonomy ofS. amurcae andS. cidri is suggested. The DNA base compositions revealed two

D. Yarrow; T. Nakase

1975-01-01

243

LCAT DNA shearing.  

PubMed

We present a novel method to fragment DNA by using lateral cavity acoustic transducers (LCATs). DNA solution is placed within a microfluidic device containing LCATs. The LCATs cause microstreaming, which fragments DNA within the solution without any need for purification or downstream processing. The LCAT-based DNA fragmentation method offers an easy-to-use, low-cost, low-energy way to fragment DNA that is amenable to integration on microfluidic platforms to further automate DNA processing. Furthermore, the LCAT microdevice requires less than 10 µL of sample, and no external equipment is needed besides a piezoelectric transducer. PMID:23850863

Okabe, Yuka; Lee, Abraham P

2014-04-01

244

Radiation can cause DNA mutations, 3D animation with narrationSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

DNAi Location: Application>Human Origins>gene geneaolgoy>A molecular clock>DNA mutation Mutations and the molecular clock Mutations are the grist of evolution, and have accumulated in our DNA over time. When populations separate, each group accumulates their own unique set of DNA mutations. Because mutations in a particular sequence of DNA occur at a constant rate, the number of accumulated mutations in that sequence is proportional to the length of time that two groups have been separated. This concept is often known as the "molecular clock."

2008-10-06

245

Mitochondrial DNA inherited variants are associated with successful aging and longevity in humans  

Microsoft Academic Search

Mitochondrial DNA (mtDNA) is char- acterized by high variability, maternal inheritance, and absence of recombination. Studies of human populations have revealed ancestral associated poly- morphisms whose combination defines groups of mtDNA types (haplogroups) that are currently used to reconstruct human evolution lineages. We used such inherited mtDNA markers to compare mtDNA population pools between a sample of individuals selected for

G. DE BENEDICTIS; G. ROSE; G. CARRIERI; M. DE LUCA; E. FALCONE; G. PASSARINO; M. BONAFE; D. MONTI; G. BAGGIO; S. BERTOLINI; D. MARI; R. MATTACE; C. FRANCESCHI

246

Small Molecules, Inhibitors of DNA-PK, Targeting DNA Repair, and Beyond  

PubMed Central

Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining a major mechanism for the repair of double-strand breaks (DSB) in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK). The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA-PK. Computer based drug design will not only assist in identifying novel functional moieties to replace the metabolically labile morpholino group but will also facilitate the design of molecules to target the DNA-PKcs/Ku80 interface or one of the autophosphorylation sites. PMID:23386830

Davidson, David; Amrein, Lilian; Panasci, Lawrence; Aloyz, Raquel

2012-01-01

247

Group dynamics.  

PubMed

Group dynamics play a significant role within any organization, culture, or unit. The important thing to remember with any of these structures is that they are made up of people--people with different ideas, motivations, background, and sometimes different agendas. Most groups, formal or informal, look for a leader in an effort to maintain cohesiveness of the unit. At times, that cultural bond must be developed; once developed, it must be nurtured. There are also times that one of the group no longer finds the culture comfortable and begins to act out behaviorally. It is these times that become trying for the leader as she or he attempts to remain objective when that which was once in the building phase of group cohesiveness starts to fall apart. At all times, the manager must continue to view the employee creating the disturbance as an integral part of the group. It is at this time that it is beneficial to perceive the employee exhibiting problem behaviors as a special employee, as one who needs the benefit of your experience and skills, as one who is still part of the group. It is also during this time that the manager should focus upon her or his own views in the area of power, communication, and the corporate culture of the unit that one has established before attempting to understand another's point of view. Once we understand our own motivation and accept ourselves, it is then that we may move on to offer assistance to another. Once we understand our insecurities recognizing staff dysfunction as a symptom of system dysfunction will not be so threatening to the concept of the manager that we perceive ourselves to be. It takes a secure person to admit that she or he favors staff before deciding to do something to change things. The important thing to know is that it can be done. The favored staff can find a new way of relating to others, the special employee can find new modes of behavior (and even find self-esteem in the process), the group can find new ways of interacting, and the corporate culture can boast of a leader with new views at the helm. In marriage, it takes only two; in a group, it takes a lot more. The dynamics of many people interacting may present difficulties at times; however, the birth of the bond of that group is well worth the effort. Ask any manager. PMID:2081114

Scandiffio, A L

1990-12-01

248

Epidemiologic typing of Staphylococcus aureus by DNA restriction fragment length polymorphisms of rRNA genes: elucidation of the clonal nature of a group of bacteriophage-nontypeable, ciprofloxacin-resistant, methicillin-susceptible S. aureus isolates.  

PubMed Central

Analysis of DNA restriction fragment length polymorphisms of rRNA genes (ribotyping) was employed to assist in the epidemiologic investigation of the emergence and spread of ciprofloxacin-resistant Staphylococcus aureus at the Atlanta VA Medical Center because many isolates of interest were nontypeable by phages and harbored few plasmids useful as strain markers. Chromosomal DNAs of selected S. aureus isolates were digested initially with 20 different restriction enzymes. EcoRI appeared to give the best discrimination of hybridization banding patterns (ribotypes) and was used with all study isolates. Overall, 15 different ribotypes were seen among the 50 S. aureus isolates studied (7 ribotypes among 13 methicillin-susceptible S. aureus [MSSA] isolates and 9 ribotypes among 37 methicillin-resistant S. aureus [MRSA] isolates). Seven of eight ciprofloxacin-resistant MSSA (CR-MSSA) patient isolates had identical antibiograms, were nontypeable by phages, and had a single 22-MDa plasmid. Six of these seven CR-MSSA isolates had an identical ribotype pattern. Ribotyping distinguished this CR-MSSA strain or clone from MRSA and other MSSA isolates, including nontypeable isolates that contained a 22-MDa plasmid. Five ciprofloxacin-susceptible MSSA isolates studied had five ribotypes; one pattern was identical to the CR-MSSA clone. Twenty-three CR-MRSA isolates recovered from the Atlanta VA Medical Center had four different ribotypes. Ribotyping proved to be a useful molecular epidemiologic tool in the study of S. aureus because it differentiated isolates which were indistinguishable by more traditional methods. In addition, this technique demonstrated that at our institution, ciprofloxacin resistance emerged in multiple strains of MRSA, as opposed to primarily a single strain or clone of MSSA. Images PMID:1371517

Blumberg, H M; Rimland, D; Kiehlbauch, J A; Terry, P M; Wachsmuth, I K

1992-01-01

249

Photoelectrochemical synthesis of DNA microarrays  

PubMed Central

Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

2009-01-01

250

HPV DNA test  

MedlinePLUS

The HPV DNA test is used to check for high-risk HPV infection in women. HPV infection around the genitals is ... warts spread when you have sex. The HPV-DNA test is generally not recommended for detecting low- ...

251

The Structure of DNA  

NSDL National Science Digital Library

This animation adapted from Garland Science Publishing takes a close look at the DNA double helix and its individual components, describing their chemical structures and how they function together to make the DNA molecule unique.

WGBH Educational Foundation

2011-12-30

252

Surreptitious DNA Testing  

MedlinePLUS

Most states do not have laws restricting surreptitious DNA testing. Those that do generally place restrictions only ... of states have laws that broadly restrict surreptitious DNA testing for both health and non-health-related ...

253

Structural Organization of DNA.  

ERIC Educational Resources Information Center

Explains the structural organization of DNA by providing information on the primary, secondary, tertiary, and higher organization levels of the molecule. Also includes illustrations and descriptions of sign-inversion and rotating models for supercoiling of DNA. (ML)

Banfalvi, Gaspar

1986-01-01

254

DNA Replication Animation  

NSDL National Science Digital Library

This resource is an animation to explain DNA replication. It is an interactive simulation activity for students. See also "Transcription and Translation Animation" to get all of the steps from DNA to protein.

Littell, Mcdougal

2012-07-19

255

Unusual DNA structures  

SciTech Connect

The contents of this book are: Unusual DNS Structures and the Probes Used for Their Detection; The Specificity of Single Strand Specific Endonucleases; Chromatin STructure and DNA Structure at the hsp 26 Locus of Drosophilia; Cruciform Extrusion in Supercoiled DNA-Mechanisms and Contextual Influence; Torsional Stress, Unusual DNA Structures, and Eukaryotic Gene Expression; DNA Sequence and Structure: Bending to Biology. Cruciform Transitions Assayed Using a Psoralen Cross-linking Method: Applications to Measurements of DNA Torisonal Tension; NMR-Distance Geometry Studies of Helical Errors and Sequence Dependent Conformations of DNA in Solution; Hyperreactivity of the B-Z Junctions Probed by Two Aromatic Chemical Carcinogens; Inherently Curved DNA and Its Structural Elements; and DNA Flexibility Under Control: The Juma Algorithm and its Application to BZ Junctions.

Wells, R.D.; Harvey, S.C.

1988-01-01

256

Dietary Berries and Ellagic Acid Prevent Oxidative DNA Damage and Modulate Expression of DNA Repair Genes  

PubMed Central

DNA damage is a pre-requisite for the initiation of cancer and agents that reduce this damage are useful in cancer prevention. In this study, we evaluated the ability of whole berries and berry phytochemical, ellagic acid to reduce endogenous oxidative DNA damage. Ellagic acid was selected based on >95% inhibition of 8-oxodeoxyguosine (8-oxodG) and other unidentified oxidative DNA adducts induced by 4-hydroxy-17ß-estradiol and CuCl2 in vitro. Inhibition of the latter occurred at lower concentrations (10 ?M) than that for 8-oxodG (100 ?M). In the in vivo study, female CD-1 mice (n=6) were fed either a control diet or diet supplemented with ellagic acid (400 ppm) and dehydrated berries (5% w/w) with varying ellagic acid contents – blueberry (low), strawberry (medium) and red raspberry (high), for 3 weeks. Blueberry and strawberry diets showed moderate reductions in endogenous DNA adducts (25%). However, both red raspberry and ellagic acid diets showed a significant reduction of 59% (p < 0.001) and 48% (p < 0.01), respectively. Both diets also resulted in a 3–8 fold over-expression of genes involved in DNA repair such as xeroderma pigmentosum group A complementing protein (XPA), DNA excision repair protein (ERCC5) and DNA ligase III (DNL3). These results suggest that red raspberry and ellagic acid reduce endogenous oxidative DNA damage by mechanisms which may involve increase in DNA repair. PMID:19325752

Aiyer, Harini S.; Vadhanam, Manicka V.; Stoyanova, Radka; Caprio, Gerard D.; Clapper, Margie L.; Gupta, Ramesh C.

2008-01-01

257

Promiscuous DNA synthesis by human DNA polymerase ?  

PubMed Central

The biological role of human DNA polymerase ? (POLQ) is not yet clearly defined, but it has been proposed to participate in several cellular processes based on its translesion synthesis capabilities. POLQ is a low-fidelity polymerase capable of efficient bypass of blocking lesions such as abasic sites and thymine glycols as well as extension of mismatched primer termini. Here, we show that POLQ possesses a DNA polymerase activity that appears to be template independent and allows efficient extension of single-stranded DNA as well as duplex DNA with either protruding or multiply mismatched 3?-OH termini. We hypothesize that this DNA synthesis activity is related to the proposed role for POLQ in the repair or tolerance of double-strand breaks. PMID:22135286

Hogg, Matthew; Sauer-Eriksson, A. Elisabeth; Johansson, Erik

2012-01-01

258

Meta-DNA: synthetic biology via DNA nanostructures and  

E-print Network

Meta-DNA: synthetic biology via DNA nanostructures and hybridization reactions Harish Chandran1 of DNA manipulations achieved by protein enzymes be simulated via simple DNA hybridization chemistry? In this work, we develop a biochemical system which we call meta-DNA (abbreviated as mDNA), based on strands

Reif, John H.

259

The Many Sides of DNA.  

ERIC Educational Resources Information Center

Explores the meaning of DNA. Discusses histories of DNA, literature on DNA, the contributions of Max Delbruck and Barbara McClintock, life, views of control, current research, and the language of DNA. Contains 24 references. (JRH)

Flannery, Maura C.

1997-01-01

260

SYBR Green I: fluorescence properties and interaction with DNA.  

PubMed

In this study, we have investigated the fluorescence properties of SYBR Green I (SG) dye and its interaction with double-stranded DNA (dsDNA). SG/dsDNA complexes were studied using various spectroscopic techniques, including fluorescence resonance energy transfer and time-resolved fluorescence techniques. It is shown that SG quenching in the free state has an intrinsic intramolecular origin; thus, the observed >1,000-fold SG fluorescence enhancement in complex with DNA can be explained by a dampening of its intra-molecular motions. Analysis of the obtained SG/DNA binding isotherms in solutions of different ionic strength and of SG/DNA association in the presence of a DNA minor groove binder, Hoechst 33258, revealed multiple modes of interaction of SG inner groups with DNA. In addition to interaction within the DNA minor groove, both intercalation between base pairs and stabilization of the electrostatic SG/DNA complex contributed to increased SG affinity to double-stranded DNA. We show that both fluorescence and the excited state lifetime of SG dramatically increase in viscous solvents, demonstrating an approximate 200-fold enhancement in 100 % glycerol, compared to water, which also makes SG a prospective fluorescent viscosity probe. A proposed structural model of the SG/DNA complex is compared and discussed with results recently reported for the closely related PicoGreen chromophore. PMID:22534954

Dragan, A I; Pavlovic, R; McGivney, J B; Casas-Finet, J R; Bishop, E S; Strouse, R J; Schenerman, M A; Geddes, C D

2012-07-01

261

DNA Nanorobotics Harish Chandran  

E-print Network

DNA Nanorobotics Harish Chandran Department of Computer Science, Duke University Nikhil University This chapter overviews the current state of the emerging discipline of DNA nanorobotics that make use of synthetic DNA to self-assemble operational molecular-scale devices. Recently there have been

Reif, John H.

262

Theoretische Informatik DNA -Computing  

E-print Network

Abteilung Theoretische Informatik DNA - Computing Biologische Makromoleküle lassen sich als Projekt sollen DNA-Moleküle zum Rechnen auf einer adressierbaren Chipoberfläche fixiert werden. verwendet Bits, durchgeführt. Die Operationen werden durch eine kleine Anzahl von Reaktionen auf DNA

Ulm, Universität

263

Onion DNA Extraction  

NSDL National Science Digital Library

This laboratory exercise is designed to show learners how DNA can easily be extracted from onion cells using simple materials. Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Lana Hays

2009-01-01

264

Wheat Germ DNA Extraction  

NSDL National Science Digital Library

This laboratory exercise is designed to show learners how DNA can easily be extracted from wheat germ using simple materials. Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Lana Hays

2009-01-01

265

Northwestern University Recombinant DNA  

E-print Network

Northwestern University Recombinant DNA Safety Program Office of Research Safety Office of the Vice deoxyribonucleic acid (DNA) shall comply with the National Institute of Health's "Guidelines for Research Involving Recombinant DNA Molecules" (NIH Guidelines) as published in the Federal Register (www

Shull, Kenneth R.

266

Yeast DNA Extraction  

NSDL National Science Digital Library

This laboratory exercise is designed to show learners how DNA can easily be extracted from yeast using simple materials. Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Lana Hays

2009-01-01

267

DNA and Quantum Computers  

Microsoft Academic Search

Both DNA and quantum computers have the potential to exceed the power of con- ventional digital computers, though substan- tial technical difficulties first must be over- come. Through coherent superposition of states, quantum computers are more pow- erful than classical Turing machines. DNA computers are evolvable through biotechnol- ogy techniques. By combining DNA and quantum computers, both of these charac-

Russell Deaton

268

Sequence specificity of DNA cleavage by Micrococcus luteus. gamma. endonuclease  

SciTech Connect

DNA fragments of defined sequence have been used to determine the sites of cleavage by ..gamma..-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus ..gamma.. endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to ..gamma.. radiation.

Hentosh, P.; Henner, W.D.; Reynolds, R.J.

1985-04-01

269

DNA-Catalyzed Hydrolysis of Esters and Aromatic Amides  

PubMed Central

We previously reported that DNA catalysts (deoxyribozymes) can hydrolyze DNA phosphodiester linkages, but DNA-catalyzed amide bond hydrolysis has been elusive. Here we used in vitro selection to identify DNA catalysts that hydrolyze ester linkages as well as DNA catalysts that hydrolyze aromatic amides, for which the leaving group is an aniline moiety. The aromatic amide-hydrolyzing deoxyribozymes were examined using linear free energy relationship analysis. The hydrolysis reaction is unaffected by substituents on the aromatic ring (? ? 0), suggesting general acid-catalyzed elimination as the likely rate-determining step of the addition-elimination hydrolysis mechanism. These findings establish that DNA has the catalytic ability to achieve hydrolysis of esters and aromatic amides as carbonyl-based substrates, and they suggest a mechanism-based approach to achieve DNA-catalyzed aliphatic amide hydrolysis. PMID:24127695

Brandsen, Benjamin M.; Hesser, Anthony R.; Castner, Marissa A.; Chandra, Madhavaiah

2013-01-01

270

Repeated DNA sequences and species relatedness in the genus Equisetum  

Microsoft Academic Search

The kinetics with which DNA reassociates and the thermal stability of rapidly reassociating (repetitive) DNA sequences have been monitored for six species in the genusEquisetum. Using the kinetic complexity for each of two repeated DNA sequence components as the basis for comparison, species in the subgenusEquisetum (E. arvense, E. fluviatile andE. telmateia) form one group and species in the subgenusHippochaete

Arnold J. Bendich; Robert S. Anderson

1983-01-01

271

Evaluation of DNAstable for DNA storage at ambient temperature.  

PubMed

Preserving DNA is important for validation of prospective and retrospective analyses, requiring many expensive types of equipment (e.g., freezers and back-up generators) and energy. While freezing is the most common method for storing extracted DNA evidence or well-characterized DNA samples for validation studies, DNAstable (Biomatrica), a commercially available medium for room temperature storage of DNA extracts was evaluated in this study. Two groups of samples consisting of different DNA quantities were investigated, one ranging from 20 to 400 ng (group 1) and the other one ranging from 1.4 to 20 ng (group 2). The DNA samples with and without DNAstable were stored at four different temperatures [?25 °C (room temperature), -20 °C, 37 °C or 50 °C]. DNA degradation over several months was monitored by SYBR Green-based qPCR assays and by PCR amplification of the core CODIS STR markers for group 1 and 2 DNA samples, respectively. For the time points tested in this study (up to 365 days), the findings indicate that the -20 °C controls and the DNAstable protected samples at room temperature provided similar DNA recoveries that were higher compared to the unprotected controls kept at RT, 37 °C or 50 °C. These results suggest that DNAstable can protect DNA samples with effectiveness similar to that of the traditional -20 °C freezing method. In addition, extrapolations from accelerated aging experiments conducted at high temperatures support that DNAstable is an effective technology for preserving purified DNA at room temperature with a larger protective impact on DNA samples of low quantity (<20 ng). PMID:24315605

Howlett, Susanne E; Castillo, Hilda S; Gioeni, Lora J; Robertson, James M; Donfack, Joseph

2014-01-01

272

Composite model for DNA torsion dynamics.  

PubMed

DNA torsion dynamics is essential in the transcription process; a simple model for it, in reasonable agreement with experimental observations, has been proposed by Yakushevich (Y) and developed by several authors; in this, the nucleotides (the DNA subunits made of a sugar-phosphate group and the attached nitrogen base) are described by a single degree of freedom. In this paper we propose and investigate, both analytically and numerically, a "composite" version of the Y model, in which the sugar-phosphate group and the base are described by separate degrees of freedom. The model proposed here contains as a particular case the Y model and shares with it many features and results, but represents an improvement from both the conceptual and the phenomenological point of view. It provides a more realistic description of DNA and possibly a justification for the use of models which consider the DNA chain as uniform. It shows that the existence of solitons is a generic feature of the underlying nonlinear dynamics and is to a large extent independent of the detailed modeling of DNA. The model we consider supports solitonic solutions, qualitatively and quantitatively very similar to the Y solitons, in a fully realistic range of all the physical parameters characterizing the DNA. PMID:17358379

Cadoni, Mariano; De Leo, Roberto; Gaeta, Giuseppe

2007-02-01

273

Syndromes associated with mitochondrial DNA depletion  

PubMed Central

Mitochondrial dysfunction accounts for a large group of inherited metabolic disorders most of which are due to a dysfunctional mitochondrial respiratory chain (MRC) and, consequently, deficient energy production. MRC function depends on the coordinated expression of both nuclear (nDNA) and mitochondrial (mtDNA) genomes. Thus, mitochondrial diseases can be caused by genetic defects in either the mitochondrial or the nuclear genome, or in the cross-talk between the two. This impaired cross-talk gives rise to so-called nuclear-mitochondrial intergenomic communication disorders, which result in loss or instability of the mitochondrial genome and, in turn, impaired maintenance of qualitative and quantitative mtDNA integrity. In children, most MRC disorders are associated with nuclear gene defects rather than alterations in the mtDNA itself. The mitochondrial DNA depletion syndromes (MDSs) are a clinically heterogeneous group of disorders with an autosomal recessive pattern of transmission that have onset in infancy or early childhood and are characterized by a reduced number of copies of mtDNA in affected tissues and organs. The MDSs can be divided into least four clinical presentations: hepatocerebral, myopathic, encephalomyopathic and neurogastrointestinal. The focus of this review is to offer an overview of these syndromes, listing the clinical phenotypes, together with their relative frequency, mutational spectrum, and possible insights for improving diagnostic strategies. PMID:24708634

2014-01-01

274

DNA Sequencing apparatus  

DOEpatents

An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

1992-01-01

275

DNA-Mediated Electrochemistry  

PubMed Central

The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

Gorodetsky, Alon A.; Buzzeo, Marisa C.

2009-01-01

276

DNA Mapping Made Simple  

NSDL National Science Digital Library

The universality of the genetic code has allowed DNA isolated from a specific organism to be transferred and incorporated in another organism, transforming bacterial, yeast, plant, and animal cells. This transformation ability is the essence of recombinant DNA technology. Recombinant DNA has been used to make medically useful proteins that would otherwise have been difficult to obtain in necessary amounts, or to engineer plants to be herbicide or insect resistant. The following activity, which focuses on mapping DNA using restriction enzymes, can help students gain a better understanding about DNA and its manipulation. The activity is designed for high school and college biology students.

Isabel Chagas

2004-02-01

277

Characterization of human control region sequences of the African American SWGDAM forensic mtDNA data set  

Microsoft Academic Search

The scientific working group on DNA analysis Methods (SWGDAM) mitochondrial DNA (mtDNA) population data set is used to infer the relative rarity of control region mtDNA profiles obtained from evidence samples and of profiles used for identification of missing persons. In this study, the African American haplogroup patterns in the SWGDAM data were analyzed in a phylogenetic context to determine

Marc W. Allard; Deborah Polanskey; Kevin Miller; Mark R. Wilson; Keith L. Monson; Bruce Budowle

2005-01-01

278

DNA Catalysts with Tyrosine Kinase Activity  

PubMed Central

We show that DNA catalysts (deoxyribozymes, DNA enzymes) can phosphorylate tyrosine residues of peptides. Using in vitro selection, we identified deoxyribozymes that transfer the ?-phosphoryl group from a 5?-triphosphorylated donor (a pppRNA oligonucleotide or GTP) to the tyrosine hydroxyl acceptor of a tethered hexapeptide. Tyrosine kinase deoxyribozymes that use pppRNA were identified from each of N30, N40, and N50 random-sequence pools. Each deoxyribozyme requires Zn2+, and most additionally require Mn2+. The deoxyribozymes have little or no selectivity for the amino acid identities near the tyrosine, but they are highly selective for phosphorylating tyrosine rather than serine. Analogous GTP-dependent DNA catalysts were identified and found to have apparent Km(GTP) as low as ca. 20 ?M. These findings establish that DNA has the fundamental catalytic ability to phosphorylate the tyrosine side chain of a peptide substrate. PMID:24066831

Walsh, Shannon M.; Sachdeva, Amit; Silverman, Scott K.

2013-01-01

279

Cationic porphyrins as probes of DNA structure.  

PubMed Central

The DNA binding specificity of a group of cationic manganese porphyrin complexes has been examined using DNase I footprinting methodology and by observing the sites of porphyrin-induced DNA strand scission in the presence of potassium superoxide. The compounds, which possess systematic changes in total charge, its distribution on the periphery on the macrocycle and ligand shape, bind in the minor groove of AT rich regions of DNA. While changes in total charge and charge arrangement do not significantly influence specificity, a shape change which blocks close ligand contact with the minor groove relaxes the original AT specificity causing the compound to cleave at both AT and GC sites. The observed changes in binding sequence specificity were interpreted in terms of electrostatic and steric factors associated with both the compounds and DNA. PMID:3786148

Bromley, S D; Ward, B W; Dabrowiak, J C

1986-01-01

280

Whole DNA methylome profiling in mice exposed to secondhand smoke.  

PubMed

Aberration of DNA methylation is a prime epigenetic mechanism of carcinogenesis. Aberrant DNA methylation occurs frequently in lung cancer, with exposure to secondhand smoke (SHS) being an established risk factor. The causal role of SHS in the genesis of lung cancer, however, remains elusive. To investigate whether SHS can cause aberrant DNA methylation in vivo, we have constructed the whole DNA methylome in mice exposed to SHS for a duration of 4 mo, both after the termination of exposure and at ensuing intervals post-exposure (up to 10 mo). Our genome-wide and gene-specific profiling of DNA methylation in the lung of SHS-exposed mice revealed that all groups of SHS-exposed mice and controls share a similar pattern of DNA methylation. Furthermore, the methylation status of major repetitive DNA elements, including long-interspersed nuclear elements (LINE L1), intracisternal A particle long-terminal repeat retrotransposons (IAP-LTR), and short-interspersed nuclear elements (SINE B1), in the lung of all groups of SHS-exposed mice and controls remains comparable. The absence of locus-specific gain of DNA methylation and global loss of DNA methylation in the lung of SHS-exposed mice within a timeframe that precedes neoplastic-lesion formation underscore the challenges of lung cancer biomarker development. Identifying the initiating events that cause aberrant DNA methylation in lung carcinogenesis may help improve future strategies for prevention, early detection and treatment of this highly lethal disease. PMID:23051858

Tommasi, Stella; Zheng, Albert; Yoon, Jae-In; Li, Arthur Xuejun; Wu, Xiwei; Besaratinia, Ahmad

2012-11-01

281

DNA: structure, dense phases, charges, interactions  

E-print Network

DNA: structure, dense phases, charges, interactions #12;Outline 1. DNA: structure, charges, dense phases 2. Counterion and DNA condensation 3. ES DNA-DNA interactions 4. DNA toroidal structures 5. Interactions of real DNA helices 6. DNA-DNA ES recognition 7. DNA melting in aggregates 8. Azimuthal

Potsdam, Universität

282

ASSESSING THE EFFECTS OF HIGH METHIONINE INTAKE ON DNA METHYLATION  

Technology Transfer Automated Retrieval System (TEKTRAN)

Methylation of DNA occurs at cytosines within CpG (cytosine-guanine) dinucleotides and is one of several epigenetic mechanisms that serve to establish and maintain tissue-specific patterns of gene expression. The methyl groups transferred in mammalian DNA methylation reactions are ultimately derived...

283

First Nuclear DNA C-values for 25 Angiosperm Families  

Microsoft Academic Search

DNA amount is a widely used biodiversity character. As known DNA C-values represent the global angiosperm flora poorly, better coverage of taxonomic groups is needed, including at the familial level. A workshop, sponsored byAnnals of Botany , was held at the Royal Botanic Gardens, Kew in 1997. Its key aim was to identify major gaps in our knowledge of plant

Lynda Hanson; Kathryn A. McMahon; Margaret A. T. Johnson; Michael D. Bennett

2001-01-01

284

Reproductive & Cardiovascular Disease Research Group  

NSDL National Science Digital Library

The Reproductive & Cardiovascular Disease Research Group is "based in the Department of Biochemistry and Immunology at St. George's, University of London." The Group's "research interests include a number of areas concerned with reproductive and cardiovascular diseases such as trophoblast biology, nitric oxide and apoptosis, with particular emphasis on the role of these subjects in diseases of pregnancy such as pre-eclampsia." This website contains descriptions of protocols commonly utilized by the Research Group such as DNA laddering, Comet Assay, Immunoprecipitation, and Caspase Assay, to name a few. This site also contains informative sections concerning Nitric Oxide, Apoptosis, and Trophoblasts. The website includes a list of publications, and email addresses of group members as well.

Dash, Phil.

285

DNA reviews: low level DNA profiling  

Microsoft Academic Search

Low copy number (LCN) DNA profiling has recently been scrutinized in the United Kingdom following the comments of Mr Justice\\u000a Weir made during the trial of suspected terrorist Sean Hoey. Mr Hoey was acquitted of all charges related to the Omagh bombing\\u000a of 1998, following the inadmissibility of key DNA evidence during this trial. The Association of Chief Police Officers

Eleanor A. M. Graham

2008-01-01

286

Effects of hypoxanthine substitution on bleomycin-mediated DNA strand degradation in DNA-RNA hybrids.  

PubMed Central

We have reported on the differences in site-specific cleavage between DNA and DNA-RNA hybrids by various prototypic DNA cleavers (accompanying paper). In the case of bleomycin (BLM), degradation at 5'-GC-3'sites was suppressed relative to the same sequence in double-stranded DNA, while 5'-GT-3' damage remained constant. We now present results of our further investigation on the chemical and conformational factors that contribute to BLM-mediated DNA strand cleavage of DNA-RNA hybrids. Substitution of guanine by hypoxanthine on the RNA strand of hybrids resulted in a significant enhancement of 5'-GC-3' site damage on the DNA strand relative to double-stranded DNA, thus reversing the suppression noted at these sites. Additionally, 5'-AT-3' sites, which are damaged significantly more in the hybrid than in DNA, exhibit decreased product formation when hypoxanthine is present on the RNA strand of hybrids. However, when hypoxanthine is substituted for guanine on the DNA strand (a GC cleavage site becomes IC), 5'-IT-3' and 5'-IC-3' site cleavage is almost completely suppressed, whereas AT site cleavage is dramatically enhanced. The priority in metallobleomycin site-specific cleavage of hybrids changes with hypoxanthine substitution: the cleavage priority is AT > GT > GC in native hybrid; GC > GT > AT in hybrids substituted with hypoxanthine in the RNA strand; AT >> GT approximately GC in hybrids substituted with hypoxanthine in the DNA strand. The results of kinetic isotope effect studies on BLM cleavage are presented and, in most cases, the values are larger for the hypoxanthine-substituted hybrid. The results suggest that the 2-amino groups of guanine residues on both strands of the nucleic acid play an important role in modulation of the binding and cleavage specificity of BLM. PMID:9108170

Bansal, M; Stubbe, J; Kozarich, J W

1997-01-01

287

Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells  

PubMed Central

Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (<100 ?M) formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

2014-01-01

288

Toxoplasma gondii infection can induce retinal DNA damage: an experimental study  

PubMed Central

AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

2014-01-01

289

Structural features of DNA interaction with caffeine and theophylline  

NASA Astrophysics Data System (ADS)

Caffeine and theophylline are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these xanthine derivatives with individual DNA at molecular level. The aim of this study was to examine the stability and structural features of calf-thymus DNA complexes with caffeine and theophylline in aqueous solution, using constant DNA concentration (6.25 mM) and various caffeine or theophylline/DNA(P) ratios of 1/80, 1/40, 1/20, 1/10, 1/5, 1/2 and 1/1. FTIR, UV-visible spectroscopic methods were used to determine the ligand external binding modes, the binding constant and the stability of caffeine, theophylline-DNA complexes in aqueous solution. Spectroscopic evidence showed that the complexation of caffeine and theophylline with DNA occurred via G-C and A-T and PO 2 group with overall binding constants of K(caffeine-DNA) = 9.7 × 10 3 M -1 and K(theophylline-DNA) = 1.7 × 10 4 M -1. The affinity of ligand-DNA binding is in the order of theophylline > caffeine. A partial B to A-DNA transition occurs upon caffeine and theophylline complexation.

Nafisi, Shohreh; Manouchehri, Firouzeh; Tajmir-Riahi, Heidar-Ali; Varavipour, Maryam

2008-03-01

290

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches  

DOEpatents

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

McCutchen-Maloney, Sandra L. (Pleasanton, CA)

2002-01-01

291

lambda DNA Fingerprinting Simulation  

NSDL National Science Digital Library

The purpose of this lab activity is to demonstrate (through simulation) how DNA fingerprinting (or DNA profiling) might be used to solve a crime. Learners perform restriction digests on DNA samples from four individuals, and then search for similarities between the individuals by running the restriction fragments on an electrophoresis gel. This activity does not do a true DNA fingerprint. It simulates two of the three steps of DNA fingerprinting: restriction of DNA sample and separation by electrophoresis. This activity does not make use of the third step, the radioactive probes. In order to make DNA fingerprinting affordable, lambda DNA is used instead of plasmids. This means that the instructor has to switch the labels on the samples given to the learners. What is labeled DNA is actually the different restriction enzymes and what is labeled restriction enzyme is the lambda DNA. Although there is some deception on the part of the instructor, learners are able to do a restriction digest that simulates a crime scene which adds interest for the learner.

Conley, Thomas J.

2009-01-01

292

DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)  

PubMed Central

Background Many studies have shown the suitability of sequence variation in the 5? region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

2014-01-01

293

"Photoclick" postsynthetic modification of DNA.  

PubMed

A new DNA building block bearing a push-pull-substituted diaryltetrazole linked to the 5-position of 2'-deoxyuridine through an aminopropynyl group was synthesized. The accordingly modified oligonucleotide allows postsynthetic labeling with a maleimide-modified sulfo-Cy3 dye, N-methylmaleimide, and methylmethacrylate as dipolarophiles by irradiation at 365?nm (LED). The determined rate constant of (23±7)?M(-1) ?s(-1) is remarkably high with respect to other copper-free bioorthogonal reactions and comparable with the copper-catalyzed cycloaddition between azides and acetylenes. PMID:25359534

Arndt, Stefanie; Wagenknecht, Hans-Achim

2014-12-22

294

(2) DNA O(n^5) Quorum-Sensing Lux  

E-print Network

- 1 - ( ) ( ) DNA RNA DNA RNA DNA DNA 2 DNA #12;- 2 - 17 6 (1) (2) DNA O(n^5) (3) Quorum-Sensing Lux (4) (5) LMNtal ambient LMNtal (1) (2) DNA (3) DNA (4) DNA (5) DNA (1) DNA ANP-96 (Precision System Science ) (2) RTRACS DNA RTRACS (3) in vivo in vivo (4) DNA trans cis 1/10 (5) DNA-PNA DNA DNA DNA DNA DNA

Hagiya, Masami

295

Electrochemical DNA Hybridization Detection Using DNA Dohyoung Kwon,a  

E-print Network

Full Paper Electrochemical DNA Hybridization Detection Using DNA Cleavage Dohyoung Kwon,a Kyuwon method for detection of DNA hybridization using enzymatic cleavage. The strategy is based on that S1 nuclease is able to specifically cleave only single strand DNA, but not double strand DNA. The capture

Kwak, Juhyoun

296

DNA interactive applications  

NSDL National Science Digital Library

This site offers four interactive modules that investigate the applications of DNA science to improve medicine and society. The modules focus on forensic analysis, such as DNA fingerprinting, solving the mystery of Anastasia Romanov, and using DNA to determine human origins, as well as using DNA to advance human health. Each module is subdivided into additional parts. These parts include videos of scientists, computer simulations, and tutorials. One tutorial covers The Innocence Project,a non-profit legal clinic that uses DNA evidence to help convicted criminals prove their innocence. In one simulation, visitors can match DNA samples between a convicted criminal and those collected from the scene of the crime. Copyright 2005 Eisenhower National Clearinghouse

Laboratory, Dolan D.

2005-01-01

297

Ribonucleotides in bacterial DNA.  

PubMed

Abstract In all living cells, DNA is the storage medium for genetic information. Being quite stable, DNA is well-suited for its role in storage and propagation of information, but RNA is also covalently included in DNA through various mechanisms. Recent studies also demonstrate useful aspects of including ribonucleotides in the genome during repair. Therefore, our understanding of the consequences of RNA inclusion into bacterial genomic DNA is just beginning, but with its high frequency of occurrence the consequences and potential benefits are likely to be numerous and diverse. In this review, we discuss the processes that cause ribonucleotide inclusion in genomic DNA, the pathways important for ribonucleotide removal and the consequences that arise should ribonucleotides remain nested in genomic DNA. PMID:25387798

Schroeder, Jeremy W; Randall, Justin R; Matthews, Lindsay A; Simmons, Lyle A

2014-11-12

298

Electrocatalysis in DNA Sensors.  

PubMed

Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

Furst, Ariel; Hill, Michael G; Barton, Jacqueline K

2014-12-14

299

DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information  

NSDL National Science Digital Library

The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code.

Mccallister, Gary

2005-03-01

300

DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information  

ERIC Educational Resources Information Center

The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code. (Contains 6 figures.)

McCallister, Gary

2005-01-01

301

SEQUENTIAL METHODS FOR DNA SEQUENCING Nicholas M. Haan and Simon J. Godsill  

E-print Network

to encode the genetic information within each of us. For our purposes, DNA can be thought of as a sequenceSEQUENTIAL METHODS FOR DNA SEQUENCING Nicholas M. Haan and Simon J. Godsill Signal Processing Group for determining the letters of our genetic code, known as DNA sequencing, currently depend on clever use

Godsill, Simon

302

DNA-based machines.  

PubMed

The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H?/OH?), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications. PMID:24647836

Wang, Fuan; Willner, Bilha; Willner, Itamar

2014-01-01

303

DNA Isolation from Onion  

NSDL National Science Digital Library

Many students find studying DNA difficult because it is so small that the concepts are quite abstract. This lab enables students to work with DNA concretely by easily isolating chromosomal DNA using the same basic tools and methods that scientists use. The lab is a good introduction to using pipets and to using the metric system. If the chemistry of the solutions is taught it is also a great practical application.

Kate Dollard (Cambridge Rindge and Latin REV)

1994-07-30

304

Thymus DNA Extractions  

NSDL National Science Digital Library

This laboratory exercise is designed to show learners how DNA can be extracted from a chunk of thymus (sweetbread) or liver. This experiment requires the use of a centrifuge (not included in cost of materials). Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Lana Hays

2009-01-01

305

DNA Extraction Virtual Lab  

NSDL National Science Digital Library

This virtual lab from the Genetic Science Learning Center at the University of Utah provides a simple overview of DNA extraction, including what it's used for, illustrations, and an activity using cheek cells and laboratory equipment to isolate DNA. The lab is followed by a classroom activity that allows students and teachers to Extract DNA from Anything Living, using household items like spinach but not little sister's big toe.

2007-02-02

306

Density Functional Molecular Orbital Calculations on Longer DNA–DNA and PNA–DNA Double Strands  

Microsoft Academic Search

Summary. Stable structures and electronic properties of hybridized DNA–DNA and PNA–DNA double strands with common base sequences were theoretically investigated by molecular orbital calculations based on the density functional theory. The computed hybridization energy in PNA–DNA is greater than that in the DNADNA double strand. The origin of the larger stability of PNA–DNA double strand is ascribed to the

Takayuki Natsume; Yasuyuki Ishikawa; Kenichi Dedachi; Noriyuki Kurita

307

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA  

NASA Technical Reports Server (NTRS)

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

308

Bisulfite Sequencing of DNA  

PubMed Central

Exact positions of 5-methylcytosine (m5C) on a single strand of DNA can be determined by bisulfite genomic sequencing (BGS). Treatment with bisulfite ion preferentially deaminates unmethylated cytosines, which then convert to uracil upon desulfonation. Amplifying regions of interest from deaminated DNA and sequencing products cloned from amplicons permits determination of methylation at single nucleotide resolution along single DNA molecules, which is not possible with other methylation analysis techniques. This unit describes a BGS technique suitable for most DNA sources, including formaldehyde-fixed tissue. Considerations for experimental design and common sources of error are discussed. PMID:20583099

Darst, Russell P.; Pardo, Carolina E.; Ai, Lingbao; Brown, Kevin D.; Kladde, Michael P.

2010-01-01

309

Tiny telomere DNA  

PubMed Central

We describe the design, synthesis and biophysical characterization of a novel DNA construct in which a folded quadruplex structure is joined to a standard double helix. Circular dichroism, gel electrophoresis, three-dimensional UV melting and differential scanning calorimetry were all used to characterize the structure. Rigorous molecular dynamics simulations were used to build a plausible atomic-level structural model of the DNA construct. This novel DNA construct provides a model for the duplex–quadruplex junction region at the end of chromosomal DNA and offers a system for the study of structure-selective ligand binding. PMID:12034817

Ren, Jinsong; Qu, Xiaogang; Trent, John O.; Chaires, Jonathan B.

2002-01-01

310

DNA Jewelry Models  

NSDL National Science Digital Library

Making DNA Jewelry Models is a portion of a unit on molecular genetics. Using the directions for this hands-on activity/lab helps students construct a model of DNA to learn DNA structure and decode it to better understand protein synthesis. They also have an actual badge of their DNA literacy to wear or use. Whether a key ring, earrings, bracelet, or necklace, students from fourth grade through adult can do and enjoy this activity. (Even visually impaired students made a model using larger beads.)

BEGIN:VCARD VERSION:2.1 FN:Catherine Sheils Ross N:Sheils Ross; Catherine ORG:Berkley High School (retired-6/98) REV:2005-04-09 END:VCARD

1995-06-30

311

Multiprotein DNA looping  

E-print Network

DNA looping plays a fundamental role in a wide variety of biological processes, providing the backbone for long range interactions on DNA. Here we develop the first model for DNA looping by an arbitrarily large number of proteins and solve it analytically in the case of identical binding. We uncover a switch-like transition between looped and unlooped phases and identify the key parameters that control this transition. Our results establish the basis for the quantitative understanding of fundamental cellular processes like DNA recombination, gene silencing, and telomere maintenance.

Jose M. G. Vilar; Leonor Saiz

2006-06-19

312

Multiprotein DNA Looping  

NASA Astrophysics Data System (ADS)

DNA looping plays a fundamental role in a wide variety of biological processes, providing the backbone for long range interactions on DNA. Here we develop the first model for DNA looping by an arbitrarily large number of proteins and solve it analytically in the case of identical binding. We uncover a switchlike transition between looped and unlooped phases and identify the key parameters that control this transition. Our results establish the basis for the quantitative understanding of fundamental cellular processes like DNA recombination, gene silencing, and telomere maintenance.

Vilar, Jose M. G.; Saiz, Leonor

2006-06-01

313

Imaging DNA Structure  

NSDL National Science Digital Library

Students are introduced to the latest imaging methods used to visualize molecular structures and the method of electrophoresis that is used to identify and compare genetic code (DNA). Students should already have basic knowledge of genetics, DNA (DNA structure, nucleotide bases), proteins and enzymes. The lesson begins with a discussion to motivate the need for imaging techniques and DNA analysis, which prepares students to participate in the associated two-part activity: 1) students each choose an imaging method to research (from a provided list of molecular imaging methods), 2) they research basic information about electrophoresis.

University Of Houston

314

Many Ways to Loop DNA  

PubMed Central

In the 1960s, I developed methods for directly visualizing DNA and DNA-protein complexes using an electron microscope. This made it possible to examine the shape of DNA and to visualize proteins as they fold and loop DNA. Early applications included the first visualization of true nucleosomes and linkers and the demonstration that repeating tracts of adenines can cause a curvature in DNA. The binding of DNA repair proteins, including p53 and BRCA2, has been visualized at three- and four-way junctions in DNA. The trombone model of DNA replication was directly verified, and the looping of DNA at telomeres was discovered. PMID:24005675

Griffith, Jack D.

2013-01-01

315

DNA Timeline: A Scavenger Hunt  

NSDL National Science Digital Library

This is a DNA timeline to illustrate the discovery of DNA. There is also some resources to get a brief understanding of DNA, then a song to reinforce your learning of DNA. Print out this worksheet to use while reading the DNA timeline website. Worksheet DNA timeline worksheet to print This is the website to use while filling out the DNA timeline worksheet. DNA timeline website writeInsertLink('projectBody','DNA timeline website'); After accessing this page, you need to go to 'timeline' to begin the assignment. Print this worksheet Finding the Structure: pieces of the ...

Mrs. Clemons

2010-09-28

316

Restriction Enzymes and DNA Fingerprinting  

NSDL National Science Digital Library

The discovery of restriction enzymes and their applications in DNA analysis has proven to be essential for biologists and chemists. This lesson focuses on restriction enzymes and their applications to DNA analysis and DNA fingerprinting. Use this lesson and its associated activity in conjunction with biology lessons on DNA analysis and DNA replication.

National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

317

A new structural insight into XPA-DNA interactions.  

PubMed

XPA (xeroderma pigmentosum group A) protein is an essential factor for NER (nucleotide excision repair) which is believed to be involved in DNA damage recognition/verification, NER factor recruiting and stabilization of repair intermediates. Past studies on the structure of XPA have focused primarily on XPA interaction with damaged DNA. However, how XPA interacts with other DNA structures remains unknown though recent evidence suggest that these structures could be important for its roles in both NER and non-NER activities. Previously, we reported that XPA recognizes undamaged DNA ds/ssDNA (double-strand/single-strandDNA) junctions with a binding affinity much higher than its ability to bind bulky DNA damage. To understand how this interaction occurs biochemically we implemented a structural determination of the interaction using a MS-based protein footprinting method and limited proteolysis. By monitoring surface accessibility of XPA lysines to NHS-biotin modification in the free protein and the DNA junction-bound complex we show that XPA physically interacts with the DNA junctions via two lysines, K168 and K179, located in the previously known XPA(98-219) DBD (DNA-binding domain). Importantly, we also uncovered new lysine residues, outside of the known DBD, involved in the binding. We found that residues K221, K222, K224 and K236 in the C-terminal domain are involved in DNA binding. Limited proteolysis analysis of XPA-DNA interactions further confirmed this observation. Structural modelling with these data suggests a clamp-like DBD for the XPA binding to ds/ssDNA junctions. Our results provide a novel structure-function view of XPA-DNA junction interactions. PMID:25385088

Hilton, Benjamin; Shkriabai, Nick; Musich, Phillip R; Kvaratskhelia, Mamuka; Shell, Steven; Zou, Yue

2014-01-01

318

A new structural insight into XPA–DNA interactions  

PubMed Central

XPA (xeroderma pigmentosum group A) protein is an essential factor for NER (nucleotide excision repair) which is believed to be involved in DNA damage recognition/verification, NER factor recruiting and stabilization of repair intermediates. Past studies on the structure of XPA have focused primarily on XPA interaction with damaged DNA. However, how XPA interacts with other DNA structures remains unknown though recent evidence suggest that these structures could be important for its roles in both NER and non-NER activities. Previously, we reported that XPA recognizes undamaged DNA ds/ssDNA (double-strand/single-strandDNA) junctions with a binding affinity much higher than its ability to bind bulky DNA damage. To understand how this interaction occurs biochemically we implemented a structural determination of the interaction using a MS-based protein footprinting method and limited proteolysis. By monitoring surface accessibility of XPA lysines to NHS-biotin modification in the free protein and the DNA junction-bound complex we show that XPA physically interacts with the DNA junctions via two lysines, K168 and K179, located in the previously known XPA(98–219) DBD (DNA-binding domain). Importantly, we also uncovered new lysine residues, outside of the known DBD, involved in the binding. We found that residues K221, K222, K224 and K236 in the C-terminal domain are involved in DNA binding. Limited proteolysis analysis of XPA–DNA interactions further confirmed this observation. Structural modelling with these data suggests a clamp-like DBD for the XPA binding to ds/ssDNA junctions. Our results provide a novel structure-function view of XPA–DNA junction interactions. PMID:25385088

Hilton, Benjamin; Shkriabai, Nick; Musich, Phillip R.; Kvaratskhelia, Mamuka; Shell, Steven; Zou, Yue

2014-01-01

319

2007 Nature Publishing Group Solid-state nanopore channels with  

E-print Network

© 2007 Nature Publishing Group Solid-state nanopore channels with DNA selectivity SAMIR M. IQBAL1 April 2007; doi:10.1038/nnano.2007.78 Solid-state nanopores have emerged as possible candidates for next the forces on the DNA molecules, and also the ion currents through the nanopore, change as the molecules pass

Bashir, Rashid

320

Theoretical and Experimental Investigations of DNA Open States  

E-print Network

This research is a review and assay of literature data on the properties of DNA open states. The states result from large fluctuations of a duplex and have a great influence on a wide range of biochemical processes, including electric charge transfer in DNA. A comparative analysis of kinetic and thermodynamic experimental data on DNA open states has been performed for a wide temperature range. Apparent contradictions between the data of different experiments have been explained. Based on differences in thermodynamic properties and other characteristics three different types of DNA open states have been identified; a modern definition of the term "open state" has been given. A brief review of simple mathematical models of DNA has been presented; in most of the models the state of every base pair is defined by one or two variables. The central problems of investigation of heterogeneous DNA within the approaches of the level considered are examined. The roles of every model group in experimental data interpretat...

Shigaev, A S; Lakhno, V D

2014-01-01

321

Group evaporation  

NASA Technical Reports Server (NTRS)

Liquid fuel combustion process is greatly affected by the rate of droplet evaporation. The heat and mass exchanges between gas and liquid couple the dynamics of both phases in all aspects: mass, momentum, and energy. Correct prediction of the evaporation rate is therefore a key issue in engineering design of liquid combustion devices. Current analytical tools for characterizing the behavior of these devices are based on results from a single isolated droplet. Numerous experimental studies have challenged the applicability of these results in a dense spray. To account for the droplets' interaction in a dense spray, a number of theories have been developed in the past decade. Herein, two tasks are examined. One was to study how to implement the existing theoretical results, and the other was to explore the possibility of experimental verifications. The current theoretical results of group evaporation are given for a monodispersed cluster subject to adiabatic conditions. The time evolution of the fluid mechanic and thermodynamic behavior in this cluster is derived. The results given are not in the form of a subscale model for CFD codes.

Shen, Hayley H.

1991-01-01

322

The DNA-bending protein HMG-1 enhances progesterone receptor binding to its target DNA sequences.  

PubMed Central

Steroid hormone receptors are ligand-dependent transcriptional activators that exert their effects by binding as dimers to cis-acting DNA sequences termed hormone response elements. When human progesterone receptor (PR), expressed as a full-length protein in a baculovirus system, was purified to homogeneity, it retained its ability to bind hormonal ligand and to dimerize but exhibited a dramatic loss in DNA binding activity for specific progesterone response elements (PREs). Addition of nuclear extracts from several cellular sources restored DNA binding activity, suggesting that PR requires a ubiquitous accessory protein for efficient interaction with specific DNA sequences. Here we have demonstrated that the high-mobility-group chromatin protein HMG-1, as a highly purified protein, dramatically enhanced binding of purified PR to PREs in gel mobility shift assays. This effect appeared to be highly selective for HMG-1, since a number of other nonspecific proteins failed to enhance PRE binding. Moreover, HMG-1 was effective when added in stoichiometric amounts with receptor, and it was capable of enhancing the DNA binding of both the A and B amino-terminal variants of PR. The presence of HMG-1 measurably increased the binding affinity of purified PR by 10-fold when a synthetic palindromic PRE was the target DNA. The increase in binding affinity for a partial palindromic PRE present in natural target genes was greater than 10-fold. Coimmunoprecipitation assays using anti-PR or anti-HMG-1 antibodies demonstrated that both PR and HMG-1 are present in the enhanced complex with PRE. HMG-1 protein has two conserved DNA binding domains (A and B), which recognize DNA structure rather than specific sequences. The A- or B-box domain expressed and purified from Escherichia coli independently stimulated the binding of PR to PRE, and the B box was able to functionally substitute for HMG-1 in enhancing PR binding. DNA ligase-mediated ring closure assays demonstrated that both the A and B binding domains mediate DNA flexure. It was also demonstrated in competition binding studies that the intact HMG-1 protein binds to tightly curved covalently closed or relaxed DNA sequences in preference to the same sequence in linear form. The finding that enhanced PRE binding was intrinsic to the HMG-1 box, combined with the demonstration that HMG-1 or its DNA binding boxes can flex DNA, suggests that HMG-1 facilitates the binding of PR by inducing a structural change in the target DNA. Images PMID:8164686

Oñate, S A; Prendergast, P; Wagner, J P; Nissen, M; Reeves, R; Pettijohn, D E; Edwards, D P

1994-01-01

323

Dietary and lifestyle factors of DNA methylation.  

PubMed

Lifestyle factors, such as diet, smoking, physical activity, and body weight management, are known to constitute the majority of cancer causes. Epigenetics has been widely proposed as a main mechanism that mediates the reversible effects of dietary and lifestyle factors on carcinogenesis. This chapter reviews human studies on potential dietary and lifestyle determinants of DNA methylation. Apart from a few prospective investigations and interventions of limited size and duration, evidence mostly comes from cross-sectional observational studies and supports some associations. Studies to date suggest that certain dietary components may alter genomic and gene-specific DNA methylation levels in systemic and target tissues, affecting genomic stability and transcription of tumor suppressors and oncogenes. Most data and supportive evidence exist for folate, a key nutritional factor in one-carbon metabolism that supplies the methyl units for DNA methylation. Other candidate bioactive food components include alcohol and other key nutritional factors of one-carbon metabolism, polyphenols and flavonoids in green tea, phytoestrogen, and lycopene. Some data also support a link of DNA methylation with physical activity and energy balance. Effects of dietary and lifestyle exposures on DNA methylation may be additionally modified by common genetic variants, environmental carcinogens, and infectious agents, an aspect that remains largely unexplored. In addition, growing literature supports that the environmental conditions during critical developmental stages may influence later risk of metabolic disorders in part through persistent programming of DNA methylation. Further research of these modifiable determinants of DNA methylation will improve our understanding of cancer etiology and may present certain DNA methylation markers as attractive surrogate endpoints for prevention research. Considering the plasticity of epigenetic marks and correlated nature of lifestyle factors, more longitudinal studies of healthy individuals of varying age, sex, and ethnic groups are warranted, ideally with comprehensive data collection on various lifestyle factors. PMID:22359306

Lim, Unhee; Song, Min-Ae

2012-01-01

324

Information Society Technologies Advisory Group Working Group  

E-print Network

. Technology Foresight Resources 6. Conclusions Working Group Members Chairman: Wolfgang Wahlster Rapporteur1 Information Society Technologies Advisory Group Working Group "Grand Challenges in the Evolution for research and technological development, the European Commission asked the IST Working Group on Grand

Wahlster, Wolfgang - Deutsche Forschungszentrum für Künstliche Intelligenz & FR 6.2

325

Evidence for two groups of banana bunchy top virus isolates  

Microsoft Academic Search

Banana bunchy top virus (BBTV) DNA component 1 from isolates from 10 different countries was cloned and sequenced and the sequences were aligned and com- pared. This analysis indicated two groups: the South Pacific group (isolates from Australia, Burundi, Egypt, Fiji, India, Tonga and Western Samoa) and the Asian group (isolates from the Philippines, Taiwan and Vietnam). The mean sequence

Mirko Karan; Robert M. Harding; James L. Dale

1994-01-01

326

Influence of killing method on Lepidoptera DNA barcode recovery.  

PubMed

The global DNA barcoding initiative has revolutionized the field of biodiversity research. Such large-scale sequencing projects require the collection of large numbers of specimens, which need to be killed and preserved in a way that is both DNA-friendly and which will keep voucher specimens in good condition for later study. Factors such as time since collection, correct storage (exposure to free water and heat) and DNA extraction protocol are known to play a role in the success of downstream molecular applications. Limited data are available on the most efficient, DNA-friendly protocol for killing. In this study, we evaluate the quality of DNA barcode (cytochrome oxidase I) sequences amplified from DNA extracted from specimens collected using three different killing methods (ethyl acetate, cyanide and freezing). Previous studies have suggested that chemicals, such as ethyl acetate and formaldehyde, degraded DNA and as such may not be appropriate for the collection of insects for DNA-based research. All Lepidoptera collected produced DNA barcodes of good quality, and our study found no clear difference in nucleotide signal strength, probability of incorrect base calling and phylogenetic utility among the three different treatment groups. Our findings suggest that ethyl acetate, cyanide and freezing can all be used to collect specimens for DNA analysis. PMID:25229871

Willows-Munro, Sandi; Schoeman, M Corrie

2014-09-17

327

Key transitions in animal evolution: a mitochondrial DNA perspective.  

PubMed

Animal mitochondrial DNA (mtDNA) is usually depicted as a small and very economically organized molecule with almost invariable gene content, stable gene order, a high rate of sequence evolution, and several unorthodox genetic features. Sampling across different animal phyla reveals that such a description applies primarily to mtDNA of bilaterian animals (such as arthropods or chordates). By contrast, mitochondrial genomes of nonbilaterian animals (phyla Cnidaria, Placozoa, and Porifera) display more variation in size and gene content and, in most cases, lack the genetic novelties associated with bilaterian mtDNA. Outside the Metazoa, mtDNA of the choanoflagellate Monosiga brevicollis, the closest unicellular out-group, is a much larger molecule that contains a large proportion of noncoding DNA, 1.5 times more genes, as well as several introns. Thus, changes in animal mtDNA organization appear to correlate with two main transitions in animal evolution: the origin of multicellularity and the origin of the Bilateria. Studies of mtDNA in nonbilaterian animals provide valuable insights into these transitions in the organization of mtDNA and also supply data for phylogenetic analyses of the relationships of early animals. Here I review recent progress in the understanding of nonbilaterian mtDNA and discuss the advantages and limitations of mitochondrial data sets for inferences about the phylogeny and evolution of animals. PMID:21669754

Lavrov, Dennis V

2007-11-01

328

Galactosylated chitosan– graft–dextran as hepatocyte-targeting DNA carrier  

Microsoft Academic Search

Lactobionic acid bearing galactose group was coupled with chitosan for liver specificity, and dextran was grafted to galactosylated chitosan (GC) for stability in water. Compared to the GC\\/DNA complex, the stability of the galactosylated chitosan–graft–dextran (GCD)\\/DNA complex could be enhanced. The particle size of the GCD\\/DNA complexes decreased as the charge ratio of GCD to DNA increased. Conformational change of

Y. K Park; Y. H Park; B. A Shin; E. S Choi; Y. R Park; T Akaike; C. S Cho

2000-01-01

329

Galactosylated chitosan- graft-poly(ethylene glycol) as hepatocyte-targeting DNA carrier  

Microsoft Academic Search

Lactobionic acid bearing galactose group was coupled with chitosan for liver specificity, and poly(ethylene glycol) (PEG) was grafted to galactosylated chitosan (GC) for stability in water and enhanced cell permeability. Complex formation of galactosylated chitosan-graft-PEG (GCP)\\/DNA complexes was confirmed by agarose gel electrophoresis. Compared to GC\\/DNA complex, the stability of GCP\\/DNA complex could be enhanced. Particle sizes of GCP\\/DNA complexes

I. K Park; T. H Kim; Y. H Park; B. A Shin; E. S Choi; E. H Chowdhury; T Akaike; C. S Cho

2001-01-01

330

Radiation of human mitochondria DNA types analyzed by restriction endonuclease cleavage patterns  

Microsoft Academic Search

Summary Human mitochondrial DNA (mtDNA) restriction endonuclease fragment patterns were analyzed using total blood cell DNA isolated from 200 individuals representing five different populations. Thirty-two fragment patterns (morphs) were observed with the enzymes Hpa I, Bam HI, Hae II, Msp I and Ava II yielding thirty-five different combinations of fragment patterns (mt DNA types). The major ethnic groups exhibit quantitative

M. J. Johnson; D. C. Wallace; S. D. Ferris; M. C. Rattazzi; L. L. Cavalli-Sforza

1983-01-01

331

Comprehensive analysis of DNA polymerase III ? subunits and their homologs in bacterial genomes  

PubMed Central

The analysis of ?2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III ?-subunit (PolIII?) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

Timinskas, K?stutis; Balvo?i?t?, Monika; Timinskas, Albertas; Venclovas, ?eslovas

2014-01-01

332

Behavior of supercoiled DNA.  

PubMed Central

We study DNA supercoiling in a quantitative fashion by micromanipulating single linear DNA molecules with a magnetic field gradient. By anchoring one end of the DNA to multiple sites on a magnetic bead and the other end to multiple sites on a glass surface, we were able to exert torsional control on the DNA. A rotating magnetic field was used to induce rotation of the magnetic bead, and reversibly over- and underwind the molecule. The magnetic field was also used to increase or decrease the stretching force exerted by the magnetic bead on the DNA. The molecule's degree of supercoiling could therefore be quantitatively controlled and monitored, and tethered-particle motion analysis allowed us to measure the stretching force acting on the DNA. Experimental results indicate that this is a very powerful technique for measuring forces at the picoscale. We studied the effect of stretching forces ranging from 0.01 pN to 100 pN on supercoiled DNA (-0.1 < sigma < 0.2) in a variety of ionic conditions. Other effects, such as stretching-relaxing hysteresis and the braiding of two DNA molecules, are discussed. PMID:9545060

Strick, T R; Allemand, J F; Bensimon, D; Croquette, V

1998-01-01

333

Color-Coded DNA  

NSDL National Science Digital Library

Many people now get their DNA tested for hereditary diseases, including Huntington's Disease and some cancers. But soon, DNA may also be used to diagnose infectious diseases, from salmonella to HIV. In this Science Update, you'll hear about a developing technology that could make this possible.

Science Update;

2002-04-29

334

Curating DNA specimens  

Technology Transfer Automated Retrieval System (TEKTRAN)

DNA data are used in a variety of ethnobiological disciplines including archaeology, conservation, ecology, medicinal plants and natural products research, taxonomy and systematics, crop evolution and domestication, and genetic diversity. It frequently is convenient to store and share DNA among coop...

335

DNA and Histone Model  

NSDL National Science Digital Library

In this activity, learners construct a 3-D paper model depicting how histone, acetyl and methyl molecules control access to DNA and affect gene DNA expression. This resource guide includes optional modifications and extensions along with instructions and cut-out pages for learners.

2008 Beyond the Central Dogma Master Teacher Summer Institute

2009-01-01

336

Nanotechnology: Deadly DNA  

NASA Astrophysics Data System (ADS)

DNA self-assembly has previously been used to create channel-like structures that can penetrate through lipid bilayer membranes. However, such assemblies have not been shown to cause cell death before. Now a DNA nanopore has been shown to exert a cytotoxic effect when administered to cells.

Krishnan, Swati; Simmel, Friedrich C.

2015-01-01

337

Recombinant DNA for Teachers.  

ERIC Educational Resources Information Center

A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

Duvall, James G., III

1992-01-01

338

Routine DNA testing  

Technology Transfer Automated Retrieval System (TEKTRAN)

Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

339

MICROWAVE RESONANCES IN DNA  

EPA Science Inventory

This report describes spectroscopic studies of DNA which were undertaken to better understand a physical basis for microwave absorption by this molecule. hree types of studies are described. ) The low frequency scattered light spectrum of DNA was studied by two methods. irst, Ram...

340

Characterization of muntjac DNA  

SciTech Connect

Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

Davis, R.C.

1981-05-27

341

A Simply Fruity DNA Extraction  

NSDL National Science Digital Library

In this activity, learners extract DNA from a strawberry and discover that DNA is in the food they eat. Learners use simple materials to break open the cells of a strawberry and see DNA with their very own eyes.

Mission Science Workshop

2012-01-01

342

Visualizing DNA What is it?  

E-print Network

Visualizing DNA #12;What is it? Gel electrophoresis is one of the techniques scientists use to look at the DNA they have. This technique separates DNA by size. #12;How does it work? First a gel is prepared. Gels

Rose, Michael R.

343

Studying DNA in the Classroom.  

ERIC Educational Resources Information Center

Outlines a workshop for teachers that illustrates a method of extracting DNA and provides instructions on how to do some simple work with DNA without sophisticated and expensive equipment. Provides details on viscosity studies and breaking DNA molecules. (DDR)

Zarins, Silja

1993-01-01

344

Simple & Safe Genomic DNA Isolation.  

ERIC Educational Resources Information Center

A procedure for purifying DNA using either bacteria or rat liver is presented. Directions for doing a qualitative DNA assay using diphenylamine and a quantitative DNA assay using spectroscopy are included. (KR)

Moss, Robert; Solomon, Sondra

1991-01-01

345

DNA gel particles: an overview.  

PubMed

A general understanding of interactions between DNA and oppositely charged compounds forms the basis for developing novel DNA-based materials, including gel particles. The association strength, which is altered by varying the chemical structure of the cationic cosolute, determines the spatial homogeneity of the gelation process, creating DNA reservoir devices and DNA matrix devices that can be designed to release either single- (ssDNA) or double-stranded (dsDNA) DNA. This review covers recent developments on the topic of DNA gel particles formed in water-water emulsion-type interfaces. The degree of DNA entrapment, particle morphology, swelling/dissolution behavior and DNA release responses are discussed as functions of the nature of the cationic agent used. On the basis of designing DNA gel particles for therapeutic purposes, recent studies on the determination of the surface hydrophobicity and the hemolytic and the cytotoxic assessments of the obtained DNA gel particles have been also reported. PMID:24119768

Morán, M Carmen; Vinardell, M Pilar; Infante, M Rosa; Miguel, M Graça; Lindman, Björn

2014-03-01

346

Archaeal DNA replication.  

PubMed

DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

Kelman, Lori M; Kelman, Zvi

2014-01-01

347

DNA: Mutations During Replication  

NSDL National Science Digital Library

In this unit you will learn the basics of genetics. Genetics is a subject regularly seen in the news, whether it is cloning sheep, looking for cures to diseases, controlling cancer, or stem cell research. The core is always in genetics. By studying this unit on genetics you will be better able to make important decisions regarding controversial issues as well as understand what makes us all what we are. OPTIONAL REVIEW In this activity we are going to review how DNA replicates. After watching the video, answer the following questions in your notebook. How DNA Replicates 1.What is the shape and what are the building blocks of the DNA molecule? 2.Which DNA bases pair with each other? What part of the DNA molecule do ...

Hektor, Mrs.

2007-10-29

348

Advances in DNA photonics  

NASA Astrophysics Data System (ADS)

In this paper we present our current research in exploring a DNA biopolymer for photonics applications. A new processing technique has been adopted that employs a modified soxhlet-dialysis (SD) rinsing technique to completely remove excess ionic contaminants from the DNA biopolymer, resulting in a material with greater mechanical stability and enhanced performance reproducibility. This newly processed material has been shown to be an excellent material for cladding layers in poled polymer electro-optic (EO) waveguide modulator applications. Thin film poling results are reported for materials using the DNA biopolymer as a cladding layer, as are results for beam steering devices also using the DNA biopolymer. Finally, progress on fabrication of a Mach Zehnder EO modulator with DNA biopolymer claddings using nanoimprint lithography techniques is reported.

Heckman, Emily M.; Aga, Roberto S.; Fehrman Cory, Emily M.; Ouchen, Fahima; Lesko, Alyssa; Telek, Brian; Lombardi, Jack; Bartsch, Carrie M.; Grote, James G.

2012-10-01

349

DNA Replicating Itself  

NSDL National Science Digital Library

A simplified representation of a DNA molecule separating to form two new molecules.   To reproduce, a cell must copy and transmit its genetic information (DNA) to all of its progeny. To do so, DNA replicates, following the process of semiconservative replication. Each strand of the original molecule acts as a template for the synthesis of a new complementary DNA molecule. The two strands of the double helix are first separated by enzymes. With the assistance of other enzymes, spare parts available inside the cell are bound to the individual strands following the rules of complementary base pairing: adenine (A) to thymine (T) and guanine (G) to cytosine (C). Two strands of DNA are obtained from one, having produced two daughter molecules which are identical to one another and to the parent molecule.

Excellence, Access

2005-03-12

350

DNA primase of plasmid ColIb is involved in conjugal DnA synthesis in donor and recipient bacteria.  

PubMed Central

The sog gene of the IncI alpha group plasmid ColIb is known to encode a DNA primase that can substitute for defective host primase in dnaG mutants of Escherichia coli during discontinuous DNA replication. The biological significance of this enzyme was investigated by using sog mutants, constructed from a derivative of ColIb by in vivo recombination of previously defined mutations in a cloned sog gene. The resultant Sog- plasmids failed to specify detectable primase activity and were unable to suppress a dnaG lesion. These mutants were maintained stably in E. coli, implying that the enzyme is not involved in vegetative replication of ColIb. However, the Sog- plasmids were partially transfer deficient in E. coli and Salmonella typhimurium matings, consistent with the hypothesis that the normal physiological role of this enzyme is in conjugation. This was confirmed by measurements of conjugal DNA synthesis. Studies of recipient cells have indicated that plasmid primase is required to initiate efficient synthesis of DNA complementary to the transferred strand, with the protein being supplied by the donor parent and probably transmitted between the mating cells. Primase specified by the dnaG gene of the recipient can substitute partially for the mutant enzyme, thus providing an explanation for the partial transfer proficiency of the mutant plasmids. Conjugal DNA synthesis in dnaB donor cells was deficient in the absence of plasmid primase, implying that the enzyme also initiates synthesis of DNA to replace the transferred material. PMID:6754700

Chatfield, L K; Orr, E; Boulnois, G J; Wilkins, B M

1982-01-01

351

Elevated level of DNA damage and impaired repair of oxidative DNA damage in patients with recurrent depressive disorder.  

PubMed

Background Depressive disorder (DD), including recurrent DD (rDD), is a severe psychological disease, which affects a large percentage of the world population. Although pathogenesis of the disease is not known, a growing body of evidence shows that inflammation together with oxidative stress may contribute to development of DD. Since reactive oxygen species produced during stress may damage DNA, we wanted to evaluate the extent of DNA damage and efficiency of DNA repair in patients with depression. Material and Methods We measured and compared the extent of endogenous DNA damage - single- and double-strand breaks, alkali-labile sites, and oxidative damage of the pyrimidines and purines - in peripheral blood mononuclear cells isolated from rDD patients (n=40) and healthy controls (n=46) using comet assay. We also measured DNA damage evoked by hydrogen peroxide and monitored changes in DNA damage during repair incubation. Results We found an increased number DNA breaks, alkali-labile sites, and oxidative modification of DNA bases in the patients compared to the controls. Exposure to hydrogen peroxide evoked the same increased damage in both groups. Examination of the repair kinetics of both groups revealed that the lesions were more efficiently repaired in the controls than in the patients. Conclusions For the first time we showed that patients with depression, compared with non-depresses individuals, had more DNA breaks, alkali-labile sites, and oxidative DNA damage, and that those lesions may be accumulated by impairments of the DNA repair systems. More studies must be conducted to elucidate the role of DNA damage and repair in depression. PMID:25656523

Czarny, Piotr; Kwiatkowski, Dominik; Kacperska, Dagmara; Kawczy?ska, Daria; Talarowska, Monika; Orzechowska, Agata; Bielecka-Kowalska, Anna; Szemraj, Janusz; Ga?ecki, Piotr; ?liwi?ski, Tomasz

2015-01-01

352

Elevated Level of DNA Damage and Impaired Repair of Oxidative DNA Damage in Patients with Recurrent Depressive Disorder  

PubMed Central

Background Depressive disorder (DD), including recurrent DD (rDD), is a severe psychological disease, which affects a large percentage of the world population. Although pathogenesis of the disease is not known, a growing body of evidence shows that inflammation together with oxidative stress may contribute to development of DD. Since reactive oxygen species produced during stress may damage DNA, we wanted to evaluate the extent of DNA damage and efficiency of DNA repair in patients with depression. Material/Methods We measured and compared the extent of endogenous DNA damage – single- and double-strand breaks, alkali-labile sites, and oxidative damage of the pyrimidines and purines – in peripheral blood mononuclear cells isolated from rDD patients (n=40) and healthy controls (n=46) using comet assay. We also measured DNA damage evoked by hydrogen peroxide and monitored changes in DNA damage during repair incubation. Results We found an increased number DNA breaks, alkali-labile sites, and oxidative modification of DNA bases in the patients compared to the controls. Exposure to hydrogen peroxide evoked the same increased damage in both groups. Examination of the repair kinetics of both groups revealed that the lesions were more efficiently repaired in the controls than in the patients. Conclusions For the first time we showed that patients with depression, compared with non-depresses individuals, had more DNA breaks, alkali-labile sites, and oxidative DNA damage, and that those lesions may be accumulated by impairments of the DNA repair systems. More studies must be conducted to elucidate the role of DNA damage and repair in depression. PMID:25656523

Czarny, Piotr; Kwiatkowski, Dominik; Kacperska, Dagmara; Kawczy?ska, Daria; Talarowska, Monika; Orzechowska, Agata; Bielecka-Kowalska, Anna; Szemraj, Janusz; Gaandlstrokecki, Piotr; ?liwi?ski, Tomasz

2015-01-01

353

Comparison of genetic and physical maps of group 7 chromosomes from Triticum aestivum L  

Microsoft Academic Search

We present a high density physical map of homoeologous group 7 chromosomes from Triticum aestivum L. using a series of 54 deletion lines, 6 random amplified polymorphic DNA (RAPD) markers and 91 cDNA or genomic DNA clones from wheat, barley and oat. So far, 51 chromosome segments have been distinguished by molecular markers, and 54 homoeoloci have been allocated among

Uwe Hohmann; Takashi R. Endo; Kulvinder S. Gill; Bikram S. Gill

1994-01-01

354

Streptococcus raffinozactis Orla- Jensen and Hansen, a Group N Streptococcus Found in Raw Milk  

Microsoft Academic Search

The properties of the lactate dehydrogenases, percent guanine plus cytosine in the deoxyribonucleic acid (DNA), and DNA\\/DNA hybridization studies have shown that three strains of group N streptococci do not belong to either Strep- tococcus Zactis or Streptococcus cremoris. The biochemical properties of the three strains were published about 25 years ago, and at that time the strains were not

ELLEN I. GARVIE

1978-01-01

355

76 FR 62816 - Office of Biotechnology Activities; Recombinant DNA Research: Action Under the NIH Guidelines for...  

Federal Register 2010, 2011, 2012, 2013

...updating Appendix B of the NIH Guidelines to specify the risk group (RG) classification for several common attenuated strains of bacteria and viruses that are frequently used in recombinant DNA research. OBA is also specifying the risk group for several...

2011-10-11

356

DNA Align Editor: DNA Alignment Editor Tool  

Technology Transfer Automated Retrieval System (TEKTRAN)

The SNPAlignEditor is a DNA sequence alignment editor that runs on Windows platforms. The purpose of the program is to provide an intuitive, user-friendly tool for manual editing of multiple sequence alignments by providing functions for input, editing, and output of nucleotide sequence alignments....

357

Study on the relation between occupational fenvalerate exposure and spermatozoa DNA damage of pesticide factory workers  

PubMed Central

Aims: To determine sperm nuclear DNA integrity and to investigate the relation between fenvalerate (FE) exposure and spermatozoa DNA damage. Methods: Sperm DNA fragmentation was detected by a modified alkaline single cell gel electrophoresis (Comet) assay and a terminal deoxynucleotidyl transferase mediated dUTP nick end labelling (TUNEL) assay. The olive tail moment (OTM) and percentage tail DNA were measured by the Comet assay, and cell positive percentage was measured by the TUNEL assay for DNA damage evaluation. Results: The DNA integrity of spermatozoa of external and internal control groups were both significantly greater than that of the FE exposed group. The median value of tail DNA percentage in the exposure group was 11.30, which was significantly higher than 5.60 in the internal control group and 5.10 in the external control group. The median value of OTM was 3.80 in the exposure group, significantly higher than 1.50 in the internal control group and 2.00 in the external control group. Mean cell positive was 31.2% in the exposure group, significantly higher than 17.4% in the internal control and 19.6% in the external control groups. Cell positive (%) was significantly correlated with tail DNA percentage and with OTM of whole subjects (n = 63). Conclusions: Results showed that occupational FE exposure is associated with an increase in sperm DNA damage. A combination of the Comet and TUNEL assays would offer more comprehensive information for a better understanding of sperm DNA damage, and the biological significance of sperm DNA damage in sperm function and male infertility. PMID:15550606

Bian, Q; Xu, L; Wang, S; Xia, Y; Tan, L; Chen, J; Song, L; Chang, H; Wang, X

2004-01-01

358

Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches  

DOEpatents

Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

McCutchen-Maloney, Sandra L. (Pleasanton, CA)

2002-01-01

359

Statistical analysis of molecular nanotemplate driven DNA adsorption on graphite.  

PubMed

In this work, we have studied the conformation of DNA molecules aligned on the nanotemplates of octadecylamine, stearyl alcohol, and stearic acid on highly oriented pyrolytic graphite (HOPG). For this purpose, fluctuations of contours of adsorbed biopolymers obtained from atomic force microscopy (AFM) images were analyzed using the wormlike chain model. Moreover, the conformations of adsorbed biopolymer molecules were characterized by the analysis of the scaling exponent ?, which relates the mean squared end-to-end distance and contour length of the polymer. During adsorption on octadecylamine and stearyl alcohol nanotemplates, DNA forms straight segments, which order along crystallographic axes of graphite. In this case, the conformation of DNA molecules can be described using two different length scales. On a large length scale (at contour lengths l > 200-400 nm), aligned DNA molecules have either 2D compact globule or partially relaxed 2D conformation, whereas on a short length scale (at l ? 200-400 nm) their conformation is close to that of rigid rods. The latter type of conformation can be also assigned to DNA adsorbed on a stearic acid nanotemplate. The different conformation of DNA molecules observed on the studied monolayers is connected with the different DNA-nanotemplate interactions associated with the nature of the functional group of the alkane derivative in the nanotemplate (amine, alcohol, or acid). The persistence length of ?-DNA adsorbed on octadecylamine nanotemplates is 31 ± 2 nm indicating the loss of DNA rigidity in comparison with its native state. Similar values of the persistence length (34 ± 2 nm) obtained for 24-times shorter DNA molecules adsorbed on an octadecylamine nanotemplate demonstrate that this rigidity change does not depend on biopolymer length. Possible reasons for the reduction of DNA persistence length are discussed in view of the internal DNA structure and DNA-surface interaction. PMID:25470069

Dubrovin, E V; Speller, S; Yaminsky, I V

2014-12-30

360

Estimation of the Nuclear DNA Content of Gossypium Species  

PubMed Central

• Background and Aims Gossypium is an economically important, globally distributed taxon comprising more than 50 species. DNA content estimates from about half of the species indicate over a 3-fold variation exists. However, the nine DNA content estimates for G. hirsutum reveal over a 2-fold difference for this species alone. Recent reports have shown that several plant compounds can bias DNA content estimates obtained by commonly used methods. The purpose of this research was to examine the standardization procedures used for DNA content determinations with flow cytometry as applied to Gossypium, and generate revised DNA content estimates for all available Gossypium species using best-standard practices. • Methods Flow cytometry was used to measure fluorescence of isolated Gossypium nuclei stained with propidium iodide. Fluorescence values were converted to DNA content estimates based on the nuclear fluorescence of standard genotypes of barley, corn and rice. Various combinations of nuclei preparations relative to the standards were evaluated for their influence on the estimates. • Key Results Both external standardization and internal standardization with Oryza sativa ‘IR36’ yielded statistically similar DNA content estimates for Gossypium. Internal standardization with Hordeum vulgare ‘Sultan’ resulted in a high estimate of DNA content. Nuclear DNA content estimates were generated for 37 Gossypium species using external standardization. Estimates of ancestral genome sizes reveal that both increases and decreases in nuclear DNA content have occurred. Variation in intraspecific and intragenomic DNA content was low, and the allopolyploid AD-genome size was nearly the additive of its progenitor genomes. • Conclusions Due to unknown factors, internal standardization with H. vulgare ‘Sultan’ may not be appropriate for DNA content determinations of Gossypium. The current DNA content estimates support accepted cytogenetic divisions of the genus. Gossypium is a genus that exhibits genome constancy both through speciation within genomic groups and allopolyploidization. PMID:15701660

HENDRIX, BILL; STEWART, JAMES McD.

2005-01-01

361

Independent versus cooperative binding in polyethylenimine-DNA and Poly(L-lysine)-DNA polyplexes.  

PubMed

The mechanism of polyethylenimine-DNA and poly(L-lysine)-DNA complex formation at pH 5.2 and 7.4 was studied by a time-resolved spectroscopic method. The formation of a polyplex core was observed to be complete at approximately N/P = 2, at which point nearly all DNA phosphate groups were bound by polymer amine groups. The data were analyzed further both by an independent binding model and by a cooperative model for multivalent ligand binding to multisubunit substrate. At pH 5.2, the polyplex formation was cooperative at all N/P ratios, whereas for pH 7.4 at N/P < 0.6 the polyplex formation followed independent binding changing to cooperative binding at higher N/Ps. PMID:23941196

Ketola, Tiia-Maaria; Hanzlíková, Martina; Leppänen, Linda; Raviña, Manuela; Bishop, Corey J; Green, Jordan J; Urtti, Arto; Lemmetyinen, Helge; Yliperttula, Marjo; Vuorimaa-Laukkanen, Elina

2013-09-12

362

Independent versus Cooperative Binding in Polyethylenimine–DNA and Poly(L-lysine)–DNA Polyplexes  

PubMed Central

The mechanism of polyethylenimine–DNA and poly(L-lysine)–DNA complex formation at pH 5.2 and 7.4 was studied by a time-resolved spectroscopic method. The formation of a polyplex core was observed to be complete at approximately N/P = 2, at which point nearly all DNA phosphate groups were bound by polymer amine groups. The data were analyzed further both by an independent binding model and by a cooperative model for multivalent ligand binding to multisubunit substrate. At pH 5.2, the polyplex formation was cooperative at all N/P ratios, whereas for pH 7.4 at N/P < 0.6 the polyplex formation followed independent binding changing to cooperative binding at higher N/Ps. PMID:23941196

Ketola, Tiia-Maaria; Hanzlíková, Martina; Leppänen, Linda; Raviña, Manuela; Bishop, Corey J.; Green, Jordan J.; Urtti, Arto; Lemmetyinen, Helge; Yliperttula, Marjo; Vuorimaa-Laukkanen, Elina

2013-01-01

363

Evaluation of DNA binding with some selected hydrazide and semicarbazide derivatives.  

PubMed

A group of hydrazide and semicarbazide derivatives containing isopropylidene, benzylidene, cyclohexylidene, and phospholidene groups was synthesized and characterized by spectroscopic techniques. These compounds were tested for DNA interaction studies monitored by UV-Vis and IR data as well as molecular docking. Investigations on interactions of these compounds with DNA revealed an intercalative mode of binding between them. It is interesting to note that semicarbazide derivatives with aliphatic substituents showed better DNA binding than the aromatic substituents. PMID:24723202

Janardan, Sannapaneni; Suman, Pothini; Swapna, G; Amrita, A; Priya, R; Siva, Ramamoorthy; Vijayakrishna, Kari; Sivaramakrishna, Akella

2014-05-01

364

Chitosan-DNA nanoparticles as gene carriers: synthesis, characterization and transfection efficiency  

Microsoft Academic Search

Chitosan-DNA nanoparticles were prepared using a complex coacervation process. The important parameters for the nanoparticle synthesis were investigated, including the concentrations of DNA, chitosan and sodium sulfate, temperature of the solutions, pH of the buffer, and molecular weights of chitosan and DNA. At an amino group to phosphate group ratio (N\\/P ratio) between 3 and 8 and a chitosan concentration

Hai-Quan Mao; Krishnendu Roy; Vu L. Troung-Le; Kevin A. Janes; Kevin Y. Lin; Yan Wang; J. Thomas August; Kam W. Leong

2001-01-01

365

DFT study of the electronic properties of DNA-DNA and PNA-DNA double strands  

Microsoft Academic Search

The electronic properties of DNA-DNA and PNA-DNA double strands having 3-6 base pairs (bp) were investigated by density functional theory (DFT) calculations. The binding energies and the highest occupied molecular orbital-lowest unoccupied molecular orbital (HOMO-LUMO) energy gaps for the PNA-DNA hybrids in the vapor phase are found to be greater than those for the DNA-DNA hybrids, regardless of the number

Takayuki Natsume; Yasuyuki Ishikawa; Kenichi Dedachi; Takayuki Tsukamoto; Noriyuki Kurita

2006-01-01

366

A biclustering algorithm based on a Bicluster Enumeration Tree: application to DNA microarray data  

Microsoft Academic Search

BACKGROUND: In a number of domains, like in DNA microarray data analysis, we need to cluster simultaneously rows (genes) and columns (conditions) of a data matrix to identify groups of rows coherent with groups of columns. This kind of clustering is called biclustering. Biclustering algorithms are extensively used in DNA microarray data analysis. More effective biclustering algorithms are highly desirable

Wassim Ayadi; Mourad Elloumi; Jin-Kao Hao

2009-01-01

367

DNA barcodes for ecology, evolution, and conservation.  

PubMed

The use of DNA barcodes, which are short gene sequences taken from a standardized portion of the genome and used to identify species, is entering a new phase of application as more and more investigations employ these genetic markers to address questions relating to the ecology and evolution of natural systems. The suite of DNA barcode markers now applied to specific taxonomic groups of organisms are proving invaluable for understanding species boundaries, community ecology, functional trait evolution, trophic interactions, and the conservation of biodiversity. The application of next-generation sequencing (NGS) technology will greatly expand the versatility of DNA barcodes across the Tree of Life, habitats, and geographies as new methodologies are explored and developed. PMID:25468359

Kress, W John; García-Robledo, Carlos; Uriarte, Maria; Erickson, David L

2015-01-01

368

Quantitive DNA Fiber Mapping  

SciTech Connect

Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

2008-01-28

369

What Controls DNA Looping?  

PubMed Central

The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional structures and fluctuations of protein and DNA allow us to examine the likely means of enhancing such communication. Here, we describe the application of these approaches to the looping of a 92 base-pair DNA segment between the headpieces of the tetrameric Escherichia coli Lac repressor protein. The distortions of the double helix induced by a second protein—the nonspecific nucleoid protein HU—increase the computed likelihood of looping by several orders of magnitude over that of DNA alone. Large-scale deformations of the repressor, sequence-dependent features in the DNA loop, and deformability of the DNA operators also enhance looping, although to lesser degrees. The correspondence between the predicted looping propensities and the ease of looping derived from gene-expression and single-molecule measurements lends credence to the derived structural picture. PMID:25167135

Perez, Pamela J.; Clauvelin, Nicolas; Grosner, Michael A.; Colasanti, Andrew V.; Olson, Wilma K.

2014-01-01

370

What controls DNA looping?  

PubMed

The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional structures and fluctuations of protein and DNA allow us to examine the likely means of enhancing such communication. Here, we describe the application of these approaches to the looping of a 92 base-pair DNA segment between the headpieces of the tetrameric Escherichia coli Lac repressor protein. The distortions of the double helix induced by a second protein--the nonspecific nucleoid protein HU--increase the computed likelihood of looping by several orders of magnitude over that of DNA alone. Large-scale deformations of the repressor, sequence-dependent features in the DNA loop, and deformability of the DNA operators also enhance looping, although to lesser degrees. The correspondence between the predicted looping propensities and the ease of looping derived from gene-expression and single-molecule measurements lends credence to the derived structural picture. PMID:25167135

Perez, Pamela J; Clauvelin, Nicolas; Grosner, Michael A; Colasanti, Andrew V; Olson, Wilma K

2014-01-01

371

Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA  

PubMed Central

Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

Watson, Claire L.; Lockwood, Diana N. J.

2009-01-01

372

DNA damage after long-term repetitive hyperbaric oxygen exposure.  

PubMed

A single exposure to hyperbaric oxygen (HBO), i.e., pure oxygen breathing at supra-atmospheric pressures, causes oxidative DNA damage in humans in vivo as well as in isolated lymphocytes of human volunteers. These DNA lesions, however, are rapidly repaired, and an adaptive protection is triggered against further oxidative stress caused by HBO exposure. Therefore, we tested the hypothesis that long-term repetitive exposure to HBO would modify the degree of DNA damage. Combat swimmers and underwater demolition team divers were investigated because their diving practice comprises repetitive long-term exposure to HBO over years. Nondiving volunteers with and without endurance training served as controls. In addition to the measurement of DNA damage in peripheral blood (comet assay), blood antioxidant enzyme activities, and the ratio of oxidized and reduced glutathione content, we assessed the DNA damage and superoxide anion radical (O(2)(*-)) production induced by a single ex vivo HBO exposure of isolated lymphocytes. All parameters of oxidative stress and antioxidative capacity in vivo were comparable in the four different groups. Exposure to HBO increased both the level of DNA damage and O(2)(*-) production in lymphocytes, and this response was significantly more pronounced in the cells obtained from the combat swimmers than in all the other groups. However, in all groups, DNA damage was completely removed within 1 h. We conclude that, at least in healthy volunteers with endurance training, long-term repetitive exposure to HBO does not modify the basal blood antioxidant capacity or the basal level of DNA strand breaks. The increased ex vivo HBO-related DNA damage in isolated lymphocytes from these subjects, however, may reflect enhanced susceptibility to oxidative DNA damage. PMID:19023023

Gröger, Michael; Oter, Sükrü; Simkova, Vladislava; Bolten, Markus; Koch, Andreas; Warninghoff, Volker; Georgieff, Michael; Muth, Claus-Martin; Speit, Günter; Radermacher, Peter

2009-01-01

373

Interaction of DNA and DNA-anti-DNA complexes to fibronectin  

SciTech Connect

Fibronectin (Fn) is a large multidomain glycoprotein found in the basement membrane, on cell surface and in plasma. The interactions of Fn with DNA may be significant in glomerular deposition of DNA-anti-DNA complexes in patients with systemic lupus erythematosus (SLE). The authors examined the binding of DNA and DNA-anti-DNA complexes to Fn by a solid phase assay in which Fn was coated to microtiter plates and reacted with (/sup 3/H)DNA or DNA complexes with a monoclonal anti-DNA antibody. The optimal interaction of DNA with Fn occurs at <0.1M NaCl suggesting that the binding is charge dependent; the specificity of this binding was shown by competitive inhibition and locking experiments using anti-Fn. The binding was maximum at pH 6.5 and in the absence of Ca/sup 2 +/. The addition of Clq enhanced the binding of DNA and DNA-anti-DNA complexes to Fn, whereas heparan sulfate inhibited such binding. The monomeric or aggregated IgC did not bind Fn but aggregated IgG bound to Fn in the presence of Clq. Furthermore, DNA-anti-DNA complexes in sera from active SLE patients bound Fn which was enhanced in the presence of Clq; DNase abolished this binding indicating that the interaction of these complexes was mediated by DNA. These observations may partially explain the molecular mechanism(s) of the deposition of DNA-anti-DNA complexes in basement membrane.

Gupta, R.C.; Simpson, W.A.; Raghow, R.; Hasty, K.

1986-03-01

374

Supramolecular DNA nanotechnology : discrete nanoparticle organization, three-dimensional DNA construction, and molecule templated DNA assembly.  

E-print Network

??The field of structural DNA nanotechnology utilizes DNA's powerful base-pairing molecular recognition criteria to help solve real challenges facing researchers in material science and nanotechnology,… (more)

Aldaye, Faisal A., 1979-

2008-01-01

375

Focus: DNA probes  

SciTech Connect

Progress in the development of DNA probes for the identification and quantitation of specific genetic sequences in biological samples is reviewed. Current research efforts in the development of DNA probes for the diagnosis of a wide variety of bacterial, viral, and other infectious diseases, such as herpes simplex and cytomegalovirus, and inherited genetic diseases such as cystic fibrosis and sickle cell anemia are discussed. Progress in development of DNA probe assays for cancer diagnosis, detection of Salmonella food poisoning, tissue typing (detection of histocompatibility antigens), mutagen screening, and animal diseases, among other applications is included.

Not Available

1986-11-01

376

High-Fidelity DNA Hybridization using Programmable Molecular DNA Devices  

E-print Network

High-Fidelity DNA Hybridization using Programmable Molecular DNA Devices Nikhil Gopalkrishnan on hybridization reactions. Our paper develops techniques for ensuring specific high-fidelity DNA hybridization reactions for target strands of arbitrary length. Given an in vitro solution which contains various DNA

Reif, John H.

377

DNA chips --Integrated Chemical Circuits for DNADiagnosis and DNA computers  

E-print Network

DNA chips -- Integrated Chemical Circuits for DNADiagnosis and DNA computers Akira Suyama, Associate Professor Institute of Physics, Graduate School of Arts and Sciences, The University of Tokyo DNA chips are si l i con­ or glass­based smal l surfaces on which many DNA ol i gonuc l eotides are i

Hagiya, Masami

378

DNA Display I. Sequence-Encoded Routing of DNA Populations  

Microsoft Academic Search

Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery

David R. Halpin; Pehr B. Harbury

2004-01-01

379

Braid groups of imprimitive reflection groups  

E-print Network

6/5/2012 1 Braid groups of imprimitive reflection groups Ruth Corran Cap Hornu May 30, 2012 Finite complex reflection groups V a vector space over C with dim(V) = r. A complex reflection s is a non) is the reflection hyperplane for the reflection s A (finite) complex reflection group W is a (finite) group

Digne, François

380

Molecular Cloning and Protein Structure of a Human Blood Group Rh Polypeptide  

Microsoft Academic Search

cDNA clones encoding a human blood group Rh polypeptide were isolated from a human bone marrow cDNA library by using a polymerase chain reaction-amplified DNA fragment encoding the known common N-terminal region of the Rh proteins. The entire primary structure of the Rh polypeptide has been deduced from the nucleotide sequence of a 1384-base-pair-long cDNA clone. Translation of the open

Baya Cherif-Zahar; Christian Bloy; Caroline Le van Kim; Dominique Blanchard; Pascal Bailly; Patricia Hermand; Charles Salmon; Jean-Pierre Cartron; Yves Colin

1990-01-01

381

DNA on rails: Combing DNA fibers on nanogratings  

NASA Astrophysics Data System (ADS)

Rectilinear deposition of elongated DNA molecules was achieved by the forced dewetting of a DNA solution droplet over a nanograting. Uncoiling of double stranded DNA is made by the conjunction of both DNA terminal anchoring on a functionalized substrate and capillary force acting throughout the forced dewetting of a DNA solution droplet. The deposition over a nanograting allows the molecule to be uncoiled on the edges of the grooves and to maintain a rectilinear conformation. This DNA deposition technique uses transparent nanograting obtained by laser interference lithography and has been developed for the specific need in observation dsDNA molecules in extended conformation.

Charlot, Benoit; Teissier, Roland; Drac, Marjorie; Schwob, Etienne

2014-12-01

382

Effect of salt concentration on the stability of heterogeneous DNA  

NASA Astrophysics Data System (ADS)

We study the role of cations on the stability of double stranded DNA (dsDNA) molecules. It is known that the two strands of double stranded DNA (dsDNA) have negative charge due to phosphate group. Cations in the form of salt in the solution, act as shielding agents thereby reducing the repulsion between these strands. We study several heterogeneous DNA molecules. We calculate the phase diagrams for DNA molecules in thermal as well as in force ensembles using Peyrard-Bishop-Dauxois (PBD) model. The dissociation and the stacking energies are the two most important factors that play an important role in the DNA stability. With suitable modifications in the model parameters we investigate the role of cation concentration on the stability of different heterogeneous DNA molecules. The objective of this work is to understand how these cations modify the strength of different pairs or bases along the strand. The phase diagram for the force ensemble case (a dsDNA is pulled from an end) is compared with the experimental results.

Singh, Amar; Singh, Navin

2015-02-01

383

Proteins tightly bound to DNA: new data and old problems.  

PubMed

Proteins tightly bound to DNA (TBP) comprise a group of proteins that remain bound to DNA after usual deproteinization procedures such as salting out and treatment with phenol or chloroform. TBP bind to DNA by covalent phosphotriester and noncovalent ionic and hydrogen bonds. Some TBP are conservative, and they are usually covalently bound to DNA. However, the TBP composition is very diverse and significantly different in different tissues and in different organisms. TBP include transcription factors, enzymes of the ubiquitin-proteasome system, phosphatases, protein kinases, serpins, and proteins of retrotransposons. Their distribution within the genome is nonrandom. However, the DNA primary structure or DNA curvatures do not define the affinity of TBP to DNA. But there are repetitive DNA sequences with which TBP interact more often. The TBP distribution within genes and chromosomes depends on a cell's physiological state, differentiation type, and stage of organism development. TBP do not interact with DNA in the sites of its association with nuclear matrix and most likely they are not components of the latter. PMID:21166641

Sjakste, N; Bagdoniene, L; Gutcaits, A; Labeikyte, D; Bielskiene, K; Trapi?a, I; Muižnieks, I; Vassetzky, Y; Sjakste, T

2010-10-01

384

Mitochondrial DNA variation in Tajiks living in Tajikistan.  

PubMed

This study aimed to characterize mtDNA control region (positions 16,024-576) of unrelated Tajiks living in Tajikistan. DNA was isolated from saliva specimens stored on FTA cards. The mtDNA fragments were amplified and directly sequenced in forward and reverse directions. Haplogroups were determined using HaploGrep and the diagnostic polymorphisms in the coding region of mtDNA. The Tajik mtDNA pool was characterized by substantial admixture of western and eastern Eurasian haplogroups, 62.6% and 26.4% sequences, respectively. It also contained 9.9% of South Asian and 1.1% of African haplotypes. The Tajik mtDNA sequences belonged to 90 different haplotypes defined by 148 transitions and 13 transversions in 156 of 1122 nucleotide sites. The Tajik mtDNA pool demonstrated the high genetic variation with genetic diversity of 0.999±0.002, nucleotide diversity of 0.014±0.007, and the mean number of pairwise nucleotide differences of 15.38±6.93. The random match probability and the power of discrimination were 0.0112 and 0.9888, respectively. Ethno-territorial groups of Tajiks demonstrated significant genetic differentiation with 2.67% of the genetic variance explained by differences between subpopulations. This study provides the insight into the mtDNA pool of Tajiks living in Tajikistan. The data should be taken into account in forensic identifications based on mtDNA. PMID:25155918

Ovchinnikov, Igor V; Malek, Mathew J; Drees, Kenneth; Kholina, Olga I

2014-11-01

385

Interaction of glycyrrhizin and glycyrrhetinic acid with DNA.  

PubMed

Glycyrrhizin (GL), a molecule of glycyrrhetinic acid (GA), is an aqueous extract from licorice root. These compounds are well known for their anti-inflammatory, hepatocarcinogenesis, antiviral, and interferon-inducing activities. This study is the first attempt to investigate the binding of GL and GA with DNA. The effect of ligand complexation on DNA aggregation and condensation was investigated in aqueous solution at physiological conditions, using constant DNA concentration (6.25?mM) and various ligands/polynucleotide (phosphate) ratios of 1/240, 1/120, 1/80, 1/40, 1/20, 1/10, 1/5, 1/2, and 1/1. Fourier transform infrared and ultraviolet (UV)-visible spectroscopic methods were used to determine the ligand binding modes, the binding constants, and the stability of ligand-DNA complexes in aqueous solution. Spectroscopic evidence showed that GL and GA bind DNA via major and minor grooves as well as the backbone phosphate group with overall binding constants of K(GL-DNA)=5.7×10(3) M(-1), K(GA-DNA)=5.1×10(3) M(-1). The affinity of ligand-DNA binding is in the order of GL>GA. DNA remained in the B-family structure, whereas biopolymer aggregation occurred at high triterpenoid concentrations. PMID:22074129

Nafisi, Shohreh; Bonsaii, Mahyar; Manouchehri, Firouzeh; Abdi, Khosrou

2012-01-01

386

Complete mitochondrial DNA replacement in a Lake Tanganyika cichlid fish.  

PubMed

We used nuclear and mitochondrial DNA (mtDNA) sequences from specimens collected throughout Lake Tanganyika to clarify the evolutionary relationship between Lamprologus callipterus and Neolamprologus fasciatus. The nuclear data support the reciprocal monophyly of these two shell-breeding lamprologine cichlids. However, mtDNA sequences show that (i) L. callipterus includes two divergent and geographically disjunct (North-South) mtDNA lineages; and that (ii) N. fasciatus individuals cluster in a lineage sister group to the northern lineage of L. callipterus. The two mtDNA lineages of L. callipterus diverged c. 684 kya to 1.2 Ma, coinciding with a major water level low stand in Lake Tanganyika, which divided the lake into isolated sub-lakes. This suggests that the two mtDNA lineages originated as the result of the separation of L. callipterus populations in different sub-basins. The incongruent phylogenetic position of N. fasciatus can best be explained by an ancient unidirectional introgression from L. callipterus into N. fasciatus. Remarkably, our data indicate that this event resulted in the complete mtDNA replacement in N. fasciatus. Our data suggest that hybridization occurred soon after the divergence of the two L. callipterus mtDNA lineages, probably still during the water level low stand, and that subsequently the invading mtDNA lineage spread throughout the lake. PMID:19780975

Nevado, B; Koblmüller, S; Sturmbauer, C; Snoeks, J; Usano-Alemany, J; Verheyen, E

2009-10-01

387

DNA relatedness among Bacillus thuringiensis serovars.  

PubMed

The genetic relationships of Bacillus cereus and of the Bacillus thuringiensis serovars were assessed from measurements of DNA reassociation. A study of 8 to 10 strains each of 13 of the most commonly encountered serovars revealed that the levels of intragroup DNA relatedness for most serovars ranged from 90 to 100%. In contrast, B. thuringiensis serovars canadensis and kenyae consisted of two DNA relatedness groups, each of which exhibited levels of intragroup relatedness of 80% or higher and levels of intergroup relatedness of 60 to 70%. Analyses of DNA relatedness performed with all of the serovars revealed that the taxa were segregated into 11 phena differentiated from each other at about the 65% level; within each phenon the level of relatedness was 80% or higher. Three phena contained strains belonging to more than one serovar; B. thuringiensis serovars alesti and dendrolimus clustered in phenon 1, serovars aizawai, kurstaki, galleriae, and morrisoni clustered in phenon 7, and serovar darmstadiensis and some strains of serovar kenyae clustered in phenon 11. The levels of DNA relatedness between B. cereus and B. thuringiensis strains ranged between 65 and 70%. My results suggest that many of the B. thuringiensis serovars are genetically distinct but closely related. PMID:8123555

Nakamura, L K

1994-01-01

388

Vaccination of goats with DNA vaccines encoding H11 and IL2 induces partial protection against Haemonchus contortus infection  

Microsoft Academic Search

DNA vaccines expressing Haemonchus contortus H11 antigen with or without interleukin (IL)-2 were tested for protection against H. contortus infection in goats. Sixteen goats (8–10months of age) were allocated into four trial groups. On days 0 and 14, group 1 was immunised with a DNA vaccine expressing H11 and IL-2 and group 2 was immunised with a DNA vaccine expressing

GuangWei Zhao; RuoFeng Yan; Charles I. Muleke; YanMing Sun; LiXin Xu; XiangRui Li

389

Structural heterogeneity of mitochondrial DNA molecules within the genus Drosophila.  

PubMed Central

We have determined by electron microscopy the molecular weight of circular mitochondrial DNA (mtDNA) molecules from 39 species representing 13 groups of five subgenera of the genus Drosophila. mtDNA molecules of all species examined, other than members of the melanogaster group, had, with one exception, molecular weights in the rather narrow range 9.90 X 10(6). The one exception was D. robusta, which had a molecular weight of 10.61 X 10(6). In contrast, mtDNA molecules from species within the melanogaster group had molecular weights covering the considerably greater range 9.92 X 10(6) to 12.35 X 10(6). Applying the electron microscope denaturation mapping technique of Inman to mtDNA molecules of eight species of the melanogaster group, we found each of them to contain a region [presumably rich in adenine and thymine (A+T)] which denatured at a specific temperature (40 degrees) at which most of the remainder of the molecule remained undenatured. The size of the A+T-rich region was constant for mtDNA molecules of a species, but varied from 0.62 X 10(6) to 3.41 X 10(6) for mtDNA molecules of different species. It was demonstrated that the differences in molecular weights of the A+T-rich regions can almost completely account for the differences in total molecular weights of the mtDNA molecules from species of the melanogaster group. Images PMID:1068475

Fauron, C M; Wolstenholme, D R

1976-01-01

390

Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters  

E-print Network

Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters Alexander Bolshoy1 of the distribution of predicted intrinsic curvature along all available complete prokaryotic genomes, the genomes were divided into two groups. Curvature distribution in all prokaryotes of the first group indicated

Bolshoy, Alexander

391

DNA Barcoding Bromeliaceae: Achievements and Pitfalls  

PubMed Central

Background DNA barcoding has been successfully established in animals as a tool for organismal identification and taxonomic clarification. Slower nucleotide substitution rates in plant genomes have made the selection of a DNA barcode for land plants a much more difficult task. The Plant Working Group of the Consortium for the Barcode of Life (CBOL) recommended the two-marker combination rbcL/matK as a pragmatic solution to a complex trade-off between universality, sequence quality, discrimination, and cost. Methodology/Principal Findings It is expected that a system based on any one, or a small number of plastid genes will fail within certain taxonomic groups with low amounts of plastid variation, while performing well in others. We tested the effectiveness of the proposed CBOL Plant Working Group barcoding markers for land plants in identifying 46 bromeliad species, a group rich in endemic species from the endangered Brazilian Atlantic Rainforest. Although we obtained high quality sequences with the suggested primers, species discrimination in our data set was only 43.48%. Addition of a third marker, trnH–psbA, did not show significant improvement. This species identification failure in Bromeliaceaecould also be seen in the analysis of the GenBank's matK data set. Bromeliaceae's sequence divergence was almost three times lower than the observed for Asteraceae and Orchidaceae. This low variation rate also resulted in poorly resolved tree topologies. Among the three Bromeliaceae subfamilies sampled, Tillandsioideae was the only one recovered as a monophyletic group with high bootstrap value (98.6%). Species paraphyly was a common feature in our sampling. Conclusions/Significance Our results show that although DNA barcoding is an important tool for biodiversity assessment, it tends to fail in taxonomy complicated and recently diverged plant groups, such as Bromeliaceae. Additional research might be needed to develop markers capable to discriminate species in these complex botanical groups. PMID:22253812

Franco, Luciana Ozório; Cardoso, Mônica Aires; Cardoso, Sérgio Ricardo Sodré; Hemerly, Adriana Silva; Ferreira, Paulo Cavalcanti Gomes

2012-01-01

392

FBI's DNA analysis program  

NASA Astrophysics Data System (ADS)

Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

Brown, John R.

1994-03-01

393

Close encounters with DNA  

NASA Astrophysics Data System (ADS)

Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.

Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

2014-10-01

394

Coffee and Your DNA  

MedlinePLUS Videos and Cool Tools

... DNA HealthDay October 7, 2014 Related MedlinePlus Pages Caffeine Genes and Gene Therapy Transcript Are you one ... Two of the new genes were linked to caffeine metabolism. Other regions were located near genes that ...

395

DNA sequencing conference, 2  

SciTech Connect

This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

1991-06-19

396

Shear Unzipping of DNA  

E-print Network

We study theoretically the mechanical failure of a simple model of double stranded DNA under an applied shear. Starting from a more microscopic Hamiltonian that describes a sheared DNA, we arrive at a nonlinear generalization of a ladder model of shear unzipping proposed earlier by deGennes [deGennes P. G. C. R. Acad. Sci., Ser. IV; Phys., Astrophys. 2001, 1505]. Using this model and a combination of analytical and numerical methods, we study the DNA "unzipping" transition when the shearing force exceeds a critical threshold at zero temperature. We also explore the effects of sequence heterogeneity and finite temperature and discuss possible applications to determine the strength of colloidal nanoparticle assemblies functionalized by DNA.

Buddhapriya Chakrabarti; David R. Nelson

2009-04-09

397

Making DNA Fingerprints.  

ERIC Educational Resources Information Center

Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

Nunley, Kathie F.

1996-01-01

398

Origami DNA model Mountain fold  

E-print Network

Origami DNA model Mountain fold Solid lines are "mountains" and are to be folded away from you solid lines. Valley folds along dashed lines. Making your DNA model Folds for your DNA model 1 Adapted from Yen, T., 1995, Make your own DNA. Trends in Biochemical Sciences, 20: 94. #12;At this point

Csürös, Miklós

399

Recombinational DNA Repair in Bacteria  

E-print Network

Recombinational DNA Repair in Bacteria: Postreplication Kevin P Rice,University of Wisconsin Recombinational DNA repair represents the primary function for homologous DNA recombination in bacteria. Most of this repair occurs at replication forks that are stalled at sites of DNA damage. Introduction Deoxyribonucleic

Cox, Michael M.

400

Isolation of DNA from Onion  

NSDL National Science Digital Library

This laboratory exercise is designed to show learners how DNA can easily be extracted from onion cells. It includes an optional test for the presence of DNA. Use this experiment to supplement any unit on DNA and genetics as well as to demonstrate how scientists study DNA. Adult supervision is recommended.

Ellen Averill

2009-01-01

401

-DNA 1217 BK21-IT,  

E-print Network

- DNA 1217 BK21-IT, (MEC) (NRL) . . : : : : syshin@bi.snu.ac.kr ihlee@bi.snu.ac.kr btzhang@bi.snu.ac.kr 2004 9 16 2005 10 14 - DNA (DNA Sequence Design using -Multiobjective Evolutionary Algorithm) (Soo-Yong Shin) (In-Hee Lee) (Byoung-Tak Zhang) DNA

402

Exploring DNA Extraction Erica Butts  

E-print Network

(By adding a protease) DNA Binding (DNA Binds to magnetic or silica beads and is washed) Precipitation;Applied Genetics Definition of Relative Extraction Efficiency · Recovery compared to another method to precipitate DNA · Rehydrated with 100 µL TE #12;Applied Genetics Blood Extracted DNA Cells Extraction

Perkins, Richard A.

403

DNA Cryptographic Algorithms  

Microsoft Academic Search

\\u000a DNA has a great cryptographic strength, its binding properties between nucleotides bases (A—T, C—G) offer the possibility\\u000a to create self-assembly structures which are an efficient means of executing parallel molecular computations; its storing\\u000a capabilities are enormous, a gram of DNA includes 1021 bases equivalent to 108 terra-bytes. Actual implementations don’t exceed laboratory level, are expensive and require time. Simple and

O. Tornea; M. E. Borda

404

Microfluidic DNA hybridization assays  

Microsoft Academic Search

DNA hybridization is one of the most powerful techniques applied in diagnostic assays. Microfluidics provides a promising\\u000a means to analyse small sample volumes, reduce reagent consumption and cost, shorten processing time as well as develop fast,\\u000a sensitive and portable diagnostic tools. By coupling with the microfluidic technology, DNA hybridization assay can achieve\\u000a high sensitivity, enhance hybridization kinetics and decrease the

Xuan WengHai; Hai Jiang; Dongqing Li

405

Forensic DNA Fingerprinting  

NSDL National Science Digital Library

In this module, developed as part of Cornell's Learning Initiative in Medicine and Bioengineering (CLIMB), students will understand the process of synthetic DNA replication by polymerase chain reaction. They will also understand agarose gel electrophoresis and the capability to separate DNA according to its size. This module contains a teacher's guide, laboratory activity, and student worksheets for the laboratory. CLIMB is part of the NSF GK-12 program.

Bioengineering, Climb: C.

406

Tightly bound to DNA proteins: possible universal substrates for intranuclear processes.  

PubMed

Tightly bound to DNA proteins (TBPs) are a protein group that remains attached to DNA after its deproteinization by phenol, chloroform or salting-out. TBP are bound to DNA with covalent phosphotriester or non-covalent ion and hydrogen bonds. They appear to be a vast protein group involved in numerous intranuclear processes. The TBPs fraction co-purified with DNA deproteinized by mild procedures is extremely heterogeneous, tissue and species-specific. The protein fraction co-purified with DNA after harsh deproteinization procedures appears to be formed from few polypeptides common to different species and tissues. Interaction sites between DNA and TBPs depend on the physiological status of the cell. The binding sites of TBPs to DNA do not co-localize with the nuclear matrix attachment regions. We hypothesize that TBPs form a universal substrate for intranuclear processes. PMID:22001404

Sjakste, N; Bielskiene, K; Bagdoniene, L; Labeikyte, D; Gutcaits, A; Vassetzky, Y; Sjakste, T

2012-01-15

407

A novel carbohydrate derived compound FCP5 causes DNA strand breaks and oxidative modifications of DNA bases in cancer cells.  

PubMed

1,5-Anhydro-6-deoxy-methane-sulfamido-d-glucitol (FCP5) is a functionalized carbohydrate containing functional groups that render it potentially therapeutically useful. According to our concept of 'functional carb-pharmacophores' (FCPs) incorporation of the methanesulfonamido pharmacophore to 1,5 glucitol could create a therapeutically useful compound. Our previous studies revealed that FCP5 was cytotoxic to cancer cells. Therefore, in this work we assessed the cytotoxic mechanisms of FCP5 in four cancer cell lines - HeLa, LoVo, A549 and MCF-7, with particular focus on DNA damage and repair. A broad spectrum of methods, including comet assay with modifications, DNA repair enzyme assay, plasmid relaxation assay, and DNA fragmentation assay, were used. We also checked the potential for FCP5 to induce apoptosis. The results show that FCP5 can induce DNA strand breaks as well as oxidative modifications of DNA bases. DNA lesions induced by FCP5 were not entirely repaired in HeLa cells and DNA repair kinetics differs from other cell lines. Results from molecular docking and plasmid relaxation assay suggest that FCP5 binds to the major groove of DNA with a preference for adenosine-thymine base pair sequences and directly induces DNA strand breaks. Thus, FCP5 may represent a novel lead for the design of new major groove-binding compounds. The results also confirmed the validity of functional carb-pharmacophores as a new source of innovative drugs. PMID:25557509

Czubatka, Anna; Sarnik, Joanna; Lucent, Del; Blasiak, Janusz; Witczak, Zbigniew J; Poplawski, Tomasz

2015-02-01

408

DNA biosensors that reason.  

PubMed

Despite the many designs of devices operating with the DNA strand displacement, surprisingly none is explicitly devoted to the implementation of logical deductions. The present article introduces a new model of biosensor device that uses nucleic acid strands to encode simple rules such as "IF DNA_strand(1) is present THEN disease(A)" or "IF DNA_strand(1) AND DNA_strand(2) are present THEN disease(B)". Taking advantage of the strand displacement operation, our model makes these simple rules interact with input signals (either DNA or any type of RNA) to generate an output signal (in the form of nucleotide strands). This output signal represents a diagnosis, which either can be measured using FRET techniques, cascaded as the input of another logical deduction with different rules, or even be a drug that is administered in response to a set of symptoms. The encoding introduces an implicit error cancellation mechanism, which increases the system scalability enabling longer inference cascades with a bounded and controllable signal-noise relation. It also allows the same rule to be used in forward inference or backward inference, providing the option of validly outputting negated propositions (e.g. "diagnosis A excluded"). The models presented in this paper can be used to implement smart logical DNA devices that perform genetic diagnosis in vitro. PMID:22406690

Sainz de Murieta, Iñaki; Rodríguez-Patón, Alfonso

2012-08-01

409

Variations in brain DNA  

PubMed Central

It is assumed that DNA sequences are conserved in the diverse cell types present in a multicellular organism like the human being. Thus, in order to compare the sequences in the genome of DNA from different individuals, nucleic acid is commonly isolated from a single tissue. In this regard, blood cells are widely used for this purpose because of their availability. Thus blood DNA has been used to study genetic familiar diseases that affect other tissues and organs, such as the liver, heart, and brain. While this approach is valid for the identification of familial diseases in which mutations are present in parental germinal cells and, therefore, in all the cells of a given organism, it is not suitable to identify sporadic diseases in which mutations might occur in specific somatic cells. This review addresses somatic DNA variations in different tissues or cells (mainly in the brain) of single individuals and discusses whether the dogma of DNA invariance between cell types is indeed correct. We will also discuss how single nucleotide somatic variations arise, focusing on the presence of specific DNA mutations in the brain. PMID:25505410

Avila, Jesús; Gómez-Ramos, Alberto; Soriano, Eduardo

2014-01-01

410

Multicolor and erasable DNA photolithography.  

PubMed

The immobilization of DNA molecules onto a solid support is a crucial step in biochip research and related applications. In this work, we report a DNA photolithography method based on photocleavage of 2-nitrobenzyl linker-modified DNA strands. These strands were subjected to ultraviolet light irradiation to generate multiple short DNA strands in a programmable manner. Coupling the toehold-mediated DNA strand-displacement reaction with DNA photolithography enabled the fabrication of a DNA chip surface with multifunctional DNA patterns having complex geometrical structures at the microscale level. The erasable DNA photolithography strategy was developed to allow different paintings on the same chip. Furthermore, the asymmetrical modification of colloidal particles was carried out by using this photolithography strategy. This strategy has broad applications in biosensors, nanodevices, and DNA-nanostructure fabrication. PMID:24988147

Huang, Fujian; Xu, Huaguo; Tan, Weihong; Liang, Haojun

2014-07-22

411

Defects in mitochondrial DNA replication and oxidative damage in muscle of mtDNA mutator mice.  

PubMed

A causal role for mitochondrial dysfunction in mammalian aging is supported by recent studies of the mtDNA mutator mouse ("PolG" mouse), which harbors a defect in the proofreading-exonuclease activity of mitochondrial DNA polymerase gamma. These mice exhibit accelerated aging phenotypes characteristic of human aging, including systemic mitochondrial dysfunction, exercise intolerance, alopecia and graying of hair, curvature of the spine, and premature mortality. While mitochondrial dysfunction has been shown to cause increased oxidative stress in many systems, several groups have suggested that PolG mutator mice show no markers of oxidative damage. These mice have been presented as proof that mitochondrial dysfunction is sufficient to accelerate aging without oxidative stress. In this study, by normalizing to mitochondrial content in enriched fractions we detected increased oxidative modification of protein and DNA in PolG skeletal muscle mitochondria. We separately developed novel methods that allow simultaneous direct measurement of mtDNA replication defects and oxidative damage. Using this approach, we find evidence that suggests PolG muscle mtDNA is indeed oxidatively damaged. We also observed a significant decrease in antioxidants and expression of mitochondrial biogenesis pathway components and DNA repair enzymes in these mice, indicating an association of maladaptive gene expression with the phenotypes observed in PolG mice. Together, these findings demonstrate the presence of oxidative damage associated with the premature aging-like phenotypes induced by mitochondrial dysfunction. PMID:25106705

Kolesar, Jill E; Safdar, Adeel; Abadi, Arkan; MacNeil, Lauren G; Crane, Justin D; Tarnopolsky, Mark A; Kaufman, Brett A

2014-10-01

412

Forensic DNA Profiling and Database  

PubMed Central

The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection. PMID:23386793

Panneerchelvam, S.; Norazmi, M.N.

2003-01-01

413

The endonuclease activity of the yeast Dna2 enzyme is essential in vivo  

PubMed Central

Dna2 is a multifunctional enzyme in yeast that possesses endonuclease activity well suited to remove RNA–DNA primers of Okazaki fragments, raising the question of whether endonuclease activity is essential for in vivo Dna2 function. Systematic site-directed mutations of amino acid residues in Saccharomyces cerevisiae DNA2 conserved in the central region of many eukaryotic DNA2 homologs allowed us to identify mutant dna2 alleles that were divided into three groups based on the viability of the mutant cells: (i) viable; (ii) inviable only when expression was repressed; (iii) inviable. Biochemical analyses of recombinant mutant Dna2 proteins isolated from the latter two groups revealed that they possessed normal ATPase/helicase activity, but were impaired in their endonuclease activity. Cells expressing mutant Dna2 enzymes partially impaired in endonuclease activity were viable, but were unable to grow when expression of their mutant Dna2 enzymes was further reduced. Their growth was restored when the mutant Dna2 proteins decreased in nuclease activity were induced to overexpress. In contrast, mutant Dna2 proteins lacking endonuclease activity did not allow cells to grow under any conditions tested. These in vivo and in vitro results demonstrate that the endonuclease activity of Dna2 is essential for Okazaki fragment processing. PMID:10908349

Lee, Kyoung-Hwa; Kim, Dong Wook; Bae, Sung-Ho; Kim, Jung-Ae; Ryu, Gi-Hyuck; Kwon, Young-Nam; Kim, Kyung-Ae; Koo, Hyeon-Sook; Seo, Yeon-Soo

2000-01-01

414

Intermediate DNA at low added salt: DNA bubbles slow the diffusion of short DNA fragments  

E-print Network

We report a study of DNA (150 bp fragments) conformations in very low added salt $DNA concentration range $0.0015\\leq c \\leq 8$~mM (bp). We found an intermediate DNA conformation in the region $0.05 DNA has the diffusion coefficient, $D_p$ reduced below the values for both ssDNA coils and native dsDNA helices of similar polymerization degree $N$. Thus, this DNA population can not be a simple mix of dsDNA and of ssDNA which results from DNA melting. Here, melting occurs due to a reduction in screening concomitant with DNA concentration being reduced, in already very low salt conditions. The intermediate DNA is rationalized through the well known concept of fluctuational openings (DNA bubbles) which we postulate to form in AT-rich portions of the sequence, without the strands coming apart. Within the bubbles, DNA is locally stretched, while the whole molecule remains rod-like due to very low salt environment. Therefore, such intermediate DNA is elongated, in comparison to dsDNA, which accounts for its reduced $D_p$.

Tomislav Vuletic; Sanja Dolanski Babic; Ticijana Ban; Joachim Raedler; Francoise Livolant; Silvia Tomic

2011-01-05

415

Supramolecular Complexes of DNA  

NASA Astrophysics Data System (ADS)

Deoxyribose nucleic acid or DNA is a linear polymer in the form of a double strand, synthesised by sequential polymerisation of a large number of units chosen from among the nucleic bases called purines (adenosine A and guanosine G) and pyrimidines (cytosine C and thymidine T). DNA contains all the genetic information required for life. It exists in the form of a limited number (a few dozen) of very big molecules, called chromosomes. This genetic information is first of all transcribed. In this process, a restricted fragment of the DNA called a gene is copied in the form of ribonucleic acid, or RNA. This RNA is itself a polymer, but with a single strand in which the sequence of nucleic acids is schematically analogous to the sequence on one of the two strands of the transcribed DNA. Finally, this RNA is translated into a protein, yet another linear polymer. The proteins make up the main part of the active constituents ensuring the survival of the cell. Any loss of information, either by mutation or by deletion of the DNA, will cause an imbalance in the cell's metabolism that may in turn lead to incurable pathologies. Several strategies have been developed to reduce the consequences of such genetic deficiencies or, more generally, to act, by amplifying or suppressing them, on the mechanisms leading from the reading of the genetic information to the production of proteins: Strategies aiming to introduce synthetic DNA or RNA, which selectively block the expression of certain genes, are now being studied by an increasing number of research scientists and pharmacologists. They use antisense oligodeoxyribonucleotides or interfering oligoribonucleotides and they already have clinical applications. This kind of therapy is often called gene pharmacology. Other, more ambitious strategies aim to repair in situ mutated or incomplete DNA within the chromosomes themselves, by introducing short sequences of DNA or RNA which recognise and take the place of mutations. This is the underlying principle of genetic correction. Yet other strategies aim to reintroduce the deficient DNA fragments into the cells in the form of genes. Indeed, in certain diseases, the only solution is to bring genetic information back into the cells by transferring exogeneous DNA into the cell nucleus. This approach goes by the name of gene therapy.

Zuber, G.; Scherman, D.

416

Lymphocyte DNA damage in Turkish asphalt workers detected by the comet assay.  

PubMed

Asphalt has a highly complex structure and it contains several organic compounds including polycyclic aromatic hydrocarbons and heterocyclic compounds. In this study, comet assay was used to detect the DNA damage in blood lymphocytes of 30 workers exposed to asphalt fumes and 30 nonexposed controls. This is the first report on Turkish asphalt workers' investigated DNA damage using the alkaline single cell gel electrophoresis (SCGE). The DNA damage was evaluated by the percentage of DNA in the comet tail (% tail DNA) for each cell. According to our results, workers exposed to asphalt fumes had higher DNA damage than the control group (p?DNA damage and the comet assay is a suitable method for determining DNA damage in asphalt workers. PMID:23638654

Bacaksiz, Aysegul; Kayaalti, Zeliha; Soylemez, Esma; Tutkun, Engin; Soylemezoglu, Tulin

2014-01-01

417

Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins.  

PubMed

Members of transcription factor families typically have similar DNA binding specificities yet execute unique functions in vivo. Transcription factors often bind DNA as multiprotein complexes, raising the possibility that complex formation might modify their DNA binding specificities. To test this hypothesis, we developed an experimental and computational platform, SELEX-seq, that can be used to determine the relative affinities to any DNA sequence for any transcription factor complex. Applying this method to all eight Drosophila Hox proteins, we show that they obtain novel recognition properties when they bind DNA with the dimeric cofactor Extradenticle-Homothorax (Exd). Exd-Hox specificities group into three main classes that obey Hox gene collinearity rules and DNA structure predictions suggest that anterior and posterior Hox proteins prefer DNA sequences with distinct minor groove topographies. Together, these data suggest that emergent DNA recognition properties revealed by interactions with cofactors contribute to transcription factor specificities in vivo. PMID:22153072

Slattery, Matthew; Riley, Todd; Liu, Peng; Abe, Namiko; Gomez-Alcala, Pilar; Dror, Iris; Zhou, Tianyin; Rohs, Remo; Honig, Barry; Bussemaker, Harmen J; Mann, Richard S

2011-12-01

418

DNA nucleotides: A case study of evolution  

NASA Astrophysics Data System (ADS)

The evolution in coding DNA sequences brings new flexibility and freedom to the codon words, even as the underlying nucleotides get significantly ordered. These curious contra-rules of gene organisation are observed from the distribution of words and the second moments of the nucleotide letters. We apply these statistical data to determine the relative positions of a few bacterial groups as per their divergence in the geological timescale.

Chattopadhyay, S.; Kanner, W. A.; Chakrabarti, J.

2002-04-01

419

Strandwise translocation of a DNA glycosylase on undamaged DNA  

SciTech Connect

Base excision repair of genotoxic nucleobase lesions in the genome is critically dependent upon the ability of DNA glycosylases to locate rare sites of damage embedded in a vast excess of undamaged DNA, using only thermal energy to fuel the search process. Considerable interest surrounds the question of how DNA glycosylases translocate efficiently along DNA while maintaining their vigilance for target damaged sites. Here, we report the observation of strandwise translocation of 8-oxoguanine DNA glycosylase, MutM, along undamaged DNA. In these complexes, the protein is observed to translocate by one nucleotide on one strand while remaining untranslocated on the complementary strand. We further report that alterations of single base-pairs or a single amino acid substitution (R112A) can induce strandwise translocation. Molecular dynamics simulations confirm that MutM can translocate along DNA in a strandwise fashion. These observations reveal a previously unobserved mode of movement for a DNA-binding protein along the surface of DNA.

Qi, Yan; Nam, Kwangho; Spong, Marie C.; Banerjee, Anirban; Sung, Rou-Jia; Zhang, Michael; Karplus, Martin; Verdine, Gregory L. (Harvard)

2012-05-14

420

Active DNA unwinding dynamics during processive DNA replication  

PubMed Central

Duplication of double-stranded DNA (dsDNA) requires a fine-tuned coordination between the DNA replication and unwinding reactions. Using optical tweezers, we probed the coupling dynamics between these two activities when they are simultaneously carried out by individual Phi29 DNA polymerase molecules replicating a dsDNA hairpin. We used the wild-type and an unwinding deficient polymerase variant and found that mechanical tension applied on the DNA and the DNA sequence modulate in different ways the replication, unwinding rates, and pause kinetics of each polymerase. However, incorporation of pause kinetics in a model to quantify the unwinding reaction reveals that both polymerases destabilize the fork with the same active mechanism and offers insights into the topological strategies that could be used by the Phi29 DNA polymerase and other DNA replication systems to couple unwinding and replication reactions. PMID:22573817

Morin, José A.; Cao, Francisco J.; Lázaro, José M.; Arias-Gonzalez, J. Ricardo; Valpuesta, José M.; Carrascosa, José L.; Salas, Margarita; Ibarra, Borja

2012-01-01

421

DNA endonuclease activities on psoralen plus ultraviolet light treated DNA  

SciTech Connect

Activities of nuclear DNA endonucleases (Endos) from normal human lymphoblastoid cells on DNA treated with the DNA interstrand cross-linking agents 4,5'8-trimethyl psoralen (TMP) or 8-methoxypsoralen (MOP) plus long-wavelength (320-400 nm) ultraviolet light (UVA) were examined. Chromatin-associated DNA Endos were isolated from both cell lines and subjected to isoelectric focusing (IF). Each IF fraction was assayed for DNA Endo activity. Peaks of activity were pooled and assayed for activity on undamaged PM2 bacteriophage DNA and on PM2 DNA that had been treated with 15 ..mu..g/ml TMP or MOP in the dark and then exposed to UVA light. Unbound psoralen was removed by dialysis and a second dose of UVA light was given in order to increase the number of DNA cross-links. Two Endo activities were found which were active on TMP- and MOP-DNA: a major one, pI 4.6, which is also active on intercalated DNA, and a second, lesser one, pI 7.6, which is active on UVC (254 nm) light irradiated DNA. These results indicate that there are two different DNA Endos which act on both TMP- and MOP-treated DNA and that the major activity recognizes the intercalation of, and/or the cross-link produced by interaction of, psoralen with DNA.

Lambert, M.W.; Clark, M.

1986-03-01

422

Group Cohesion in Experiential Growth Groups  

ERIC Educational Resources Information Center

This article explores the effect of web-based journaling on changes in group cohesion within experiential growth groups. Master's students were divided into 2 groups. Both used a web-based platform to journal after each session; however, only 1 of the groups was able to read each other's journals. Quantitative data collected before and…

Steen, Sam; Vasserman-Stokes, Elaina; Vannatta, Rachel

2014-01-01

423

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases  

PubMed Central

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-01-01

424

Ordered DNA arrays prepared via soft lithography  

NASA Astrophysics Data System (ADS)

This paper reports progress in an approach to create a general purpose platform to be used in the reproducible assembly of molecular electronic devices. We describe a method in which DNA molecules were immobilized on patterned neutravidin surfaces. First, a silicon wafer was functionalized with (3- aminopropyl)triethoxysilane (APTES) to produce an amine-terminated surface. The primary amine group was then reacted with the heterobifunctional linker molecule succinimidyl-6-(biotinamido)hexanoate which placed an active biotin group at the surface interface. These biotinylated surfaces were then patterned with the tetrameric protein neutravidin using microcontact printing (?CP) with relief features in polydimethylsiloxane (PDMS) stamps. The neutravidin proteins adsorb onto the surface and bind nearly irreversibly to one or two biotin groups leaving at least two biotin binding sites on each protein available for conjugation. Following neutravidin stamping, 1 ?m long DNA molecules functionalized on one end with biotin were attached to the patterned areas. Water contact angle (WCA) measurements were used to characterize wettability changes of the silicon surfaces for amine and biotin functionalization. Atomic force microscopy (AFM) was used to image the patterns of immobilized neutravidin and DNA.

Rahman, Mashiur; Day, B. Scott; Cao, Huan; Butts, Heather; Norton, Michael L.

2006-10-01

425

Measuring RNA:DNA ratios in individual Acartia tonsa (Copepoda)  

Microsoft Academic Search

Acartia tonsa Dana is a dominant copepod in coastal waters and is therefore an important link in the food web between microplankton and\\u000a higher trophic levels. RNA:DNA ratios have been used to describe growth and nutritional condition of field-collected copepods\\u000a and to show strong correlation between RNA:DNA ratios and group egg production (EP). A method was developed using a sensitive,

Christa L. Speekmann; B. Scott Nunez; Edward J. Buskey

2007-01-01

426

Analysis of one million base pairs of Neanderthal DNA  

Microsoft Academic Search

Neanderthals are the extinct hominid group most closely related to contemporary humans, so their genome offers a unique opportunity to identify genetic changes specific to anatomically fully modern humans. We have identified a 38,000-year-old Neanderthal fossil that is exceptionally free of contamination from modern human DNA. Direct high-throughput sequencing of a DNA extract from this fossil has thus far yielded

Richard E. Green; Johannes Krause; Susan E. Ptak; Adrian W. Briggs; Michael T. Ronan; Jan F. Simons; Lei Du; Michael Egholm; Jonathan M. Rothberg; Maja Paunovic; Svante Pääbo

2006-01-01

427

DNA melting induced by alcohols: Role of the solvent properties  

Microsoft Academic Search

Summary  The isothermal denaturation of calf thymus DNA, induced by the presence of some monohydric alcohols in the solution, was investigated.\\u000a Measurements were performed at a temperature (67.2°C) at which the denaturation, in the absence of alcohols, is about 20%\\u000a and melting profiles at varying temperatures were also recorded. Results show that with increasing alcohol concentration and\\u000a alkyl group size DNA

G. Baldini; Huang Fu-Hua; G. Varani; L. Cordone; S. L. Fornili; G. Onori

1985-01-01

428

Reversal of DNA alkylation damage by two human dioxygenases  

Microsoft Academic Search

The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the DNA lesions 1-methyladenine and 3-methylcytosine, which are generated in single-stranded stretches of DNA. AlkB is an -ketoglutarate- and Fe(II)-dependent dioxygenase that oxidizes the relevant methyl groups and releases them as formaldehyde. Here, we identify two human AlkB homologs, ABH2 and ABH3, by sequence and

Tod Duncan; Sarah C. Trewick; Pertti Koivisto; Paul A. Bates; Tomas Lindahl; Barbara Sedgwick

2002-01-01

429

Bacterial Species Determination from DNA-DNA Hybridization by Using Genome Fragments and DNA Microarrays  

Microsoft Academic Search

Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments

JAE-CHANG CHO; JAMES M. TIEDJE

2001-01-01

430

Coarse-graining DNA for simulations of DNA nanotechnology  

E-print Network

To simulate long time and length scale processes involving DNA it is necessary to use a coarse-grained description. Here we provide an overview of different approaches to such coarse graining, focussing on those at the nucleotide level that allow the self-assembly processes associated with DNA nanotechnology to be studied. OxDNA, our recently-developed coarse-grained DNA model, is particularly suited to this task, and has opened up this field to systematic study by simulations. We illustrate some of the range of DNA nanotechnology systems to which the model is being applied, as well as the insights it can provide into fundamental biophysical properties of DNA.

Doye, Jonathan P K; Louis, Ard A; Romano, Flavio; Sulc, Petr; Matek, Christian; Snodin, Benedict E K; Rovigatti, Lorenzo; Schreck, John S; Harrison, Ryan M; Smith, William P J

2013-01-01

431

Principles of DNA architectonics: design of DNA-based nanoobjects  

NASA Astrophysics Data System (ADS)

The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

Vinogradova, O. A.; Pyshnyi, D. V.

2012-02-01

432

Specificity of replicative and SOS-inducible DNA polymerases in frameshift mutagenesis: mutability of Salmonella typhimurium strains overexpressing SOS-inducible DNA polymerases to 30 chemical mutagens.  

PubMed

DNA replication is frequently hindered because of the presence of DNA lesions induced by endogenous and exogenous genotoxic agents. To circumvent the replication block, cells are endowed with multiple specialized DNA polymerases that can bypass a variety of DNA damage. To better understand the specificity of specialized DNA polymerases to bypass lesions, we have constructed a set of derivatives of Salmonella typhimurium TA1538 harboring plasmids carrying the polB, dinB or mucAB genes encoding Escherichia coli DNA polymerase II, DNA polymerase IV or DNA polymerase RI, respectively, and examined the mutability to 30 chemicals. The parent strain TA1538 possesses CGCGCGCG hotspot sequence for -2 frameshift. Interestingly, the chemicals could be classified into four groups based on the mutagenicity to the derivatives: group I whose mutagenicity was highest in strain YG5161 harboring plasmid carrying dinB; group II whose mutagenicity was almost equally high in strain YG5161 and strain TA98 harboring plasmid carrying mucAB; group III whose mutagenicity was highest in strain TA98; group IV whose mutagenicity was not affected by the introduction of any of the plasmids. Introduction of plasmid carrying polB did not enhance the mutagenicity except for benz[a]anthracene. We also introduced a plasmid carrying polA encoding E. coli DNA polymerase I to strain TA1538. Strikingly, the introduction of the plasmid reduced the mutagenicity of chemicals belonging to groups I, II and III, but not the chemicals of group IV, to the levels observed in the derivative whose SOS-inducible DNA polymerases were all deleted. These results suggest that (i) DNA polymerase IV and DNA polymerase RI possess distinct but partly overlapping specificity to bypass lesions leading to -2 frameshift, (ii) the replicative DNA polymerase, i.e., DNA polymerase III, participates in the mutagenesis and (iii) the enhanced expression of E. coli polA may suppress the access of Y-family DNA polymerases to the replication complex. PMID:16455311

Matsui, Keiko; Yamada, Masami; Imai, Masaru; Yamamoto, Kazuo; Nohmi, Takehiko

2006-04-01

433

Chromatin and DNA replication.  

PubMed

The size of a eukaryotic genome presents a unique challenge to the cell: package and organize the DNA to fit within the confines of the nucleus while at the same time ensuring sufficient dynamics to allow access to specific sequences and features such as genes and regulatory elements. This is achieved via the dynamic nucleoprotein organization of eukaryotic DNA into chromatin. The basic unit of chromatin, the nucleosome, comprises a core particle with 147 bp of DNA wrapped 1.7 times around an octamer of histones. The nucleosome is a highly versatile and modular structure, both in its composition, with the existence of various histone variants, and through the addition of a series of posttranslational modifications on the histones. This versatility allows for both short-term regulatory responses to external signaling, as well as the long-term and multigenerational definition of large functional chromosomal domains within the nucleus, such as the centromere. Chromatin organization and its dynamics participate in essentially all DNA-templated processes, including transcription, replication, recombination, and repair. Here we will focus mainly on nucleosomal organization and describe the pathways and mechanisms that contribute to assembly of this organization and the role of chromatin in regulating the DNA replication program. PMID:23751185

MacAlpine, David M; Almouzni, Geneviève

2013-08-01

434

Shear degradation of DNA.  

PubMed Central

A concentric-cylinder flow-birefringence instrument is used to generate sufficient shear fields to break T2 DNA (M = 1.2 X 10(8)) and E. coli DNA (M = 2.5 X 10(9)) in dilute solution. Breakage is monitored in situ by measuring the change in birefringence relaxation after the flow has been stopped. The breakage of T2 DNA follows first-order kinetics. Rate constants are obtained as functions of shear rate and viscosity (varied by adding glycerol). The data are fitted by a modified Arrhenius equation, assuming that stess increases the rate by lowering the activation energy. The rate increases with temperature, pH, and water concentration, and appears to be a base-catalyzed hydrolysis of the phosphate-ester linkage. La3+ ions catalyze the reaction. E. coli DNA was reduced to half molecules at a shear stress of 0.4 dynes/cm2, which is about 2500 times less than that required for T2. The difference in rates is accounted for in part by the difference in size of the two, but may also reflect the presence of many single-strand nicks in the coli DNA. PMID:19729

Adam, R E; Zimm, B H

1977-01-01

435

Nanopore-based assay for detection of methylation in double-stranded DNA fragments.  

PubMed

DNA methylation is an epigenetic modification of DNA in which methyl groups are added at the 5-carbon position of cytosine. Aberrant DNA methylation, which has been associated with carcinogenesis, can be assessed in various biological fluids and potentially can be used as markers for detection of cancer. Analytically sensitive and specific assays for methylation targeting low-abundance and fragmented DNA are needed for optimal clinical diagnosis and prognosis. We present a nanopore-based direct methylation detection assay that circumvents bisulfite conversion and polymerase chain reaction amplification. Building on our prior work, we used methyl-binding proteins (MBPs), which selectively label the methylated DNA. The nanopore-based assay selectively detects methylated DNA/MBP complexes through a 19 nm nanopore with significantly deeper and prolonged nanopore ionic current blocking, while unmethylated DNA molecules were not detectable due to their smaller diameter. Discrimination of hypermethylated and unmethylated DNA on 90, 60, and 30 bp DNA fragments was demonstrated using sub-10 nm nanopores. Hypermethylated DNA fragments fully bound with MBPs are differentiated from unmethylated DNA at 2.1- to 6.5-fold current blockades and 4.5- to 23.3-fold transport durations. Furthermore, these nanopore assays can detect the CpG dyad in DNA fragments and could someday profile the position of methylated CpG sites on DNA fragments. PMID:25569824

Shim, Jiwook; Kim, Younghoon; Humphreys, Gwendolyn I; Nardulli, Ann M; Kosari, Farhad; Vasmatzis, George; Taylor, William R; Ahlquist, David A; Myong, Sua; Bashir, Rashid

2015-01-27

436

Oxidized extracellular DNA as a stress signal that may modify response to anticancer therapy.  

PubMed

An increase in the levels of oxidation is a universal feature of genomic DNA of irradiated or aged or even malignant cells. In case of apoptotic death of stressed cells, oxidized DNA can be released in circulation (cfDNA). According to the results of the studies performed in vitro by our group and other researchers, the oxidized cfDNA serves as a biomarker for a stress and a stress signal that is transmitted from the "stressed" area i.e. irradiated cells or cells with deficient anti-oxidant defenses to distant (bystander) cells. In recipient cells, oxidized DNA stimulates biosynthesis of ROS that is followed up by an increase in the number of single strand and double strand breaks (SSBs and DSBs), and activation of DNA Damage Response (DDR) pathway. Effects of oxidized DNA are considered similar to that of irradiation. It seems that downstream effects of irradiation, in part, depend on the release of oxidized DNA fragments that mediate the effects in distant cells. The responses of normal and tumor cell to oxidized DNA may differ. It seems that tumor cells are more sensitive to oxidized DNA-dependent DNA damage, while developing pronounced adaptive response. This may suggest that in chemotherapy or irradiation-treated human body, the release of oxidized DNA from dying cancer cells may give a boost to remaining malignant cells by augmenting their survival and stress resistance. Further studies of the effects of oxidized DNA in both in vitro and in vivo systems are warranted. PMID:24045040

Glebova, Kristina; Veiko, Natalya; Kostyuk, Svetlana; Izhevskaya, Vera; Baranova, Ancha

2015-01-01

437

[Analysis of mitochondrial DNA haplotypes in yakut population].  

PubMed

To study the mitochondrial gene pool structure in Yakuts, polymorphism of mtDNA hypervariable segment I (16,024-16,390) was analyzed in 191 people sampled from the indigenous population of the Sakha Republic. In total, 67 haplotypes of 14 haplogroups were detected. Most (91.6%) haplotypes belonged to haplogroups A, B, C, D, F, G, M*, and Y, which are specific for East Eurasian ethnic groups; 8.4% haplotypes represented Caucasian haplogroups H, HV1, J, T, U, and W. A high frequency of mtDNA types belonging to Asian supercluster M was peculiar for Yakuts: mtDNA types belonging to haplogroup C, D, or G and undifferentiated mtDNA types of haplogroup M (M*) accounted for 81% of all haplotypes. The highest diversity was observed for haplogroups C and D, which comprised respectively 22 (44%) and 18 (30%) haplotypes. Yakuts showed the lowest genetic diversity (H = 0.964) among all Turkic ethnic groups. Phylogenetic analysis testified to a common genetic substrate of Yakuts, Mongols, and Central Asian (Kazakh, Kyrgyz, Uigur) populations. Yakuts proved to share 21 (55.5%) mtDNA haplogroups with the Central Asian ethnic groups and Mongols. Comparisons with modern paleo-Asian populations (Chukcha, Itelmen, Koryaks) revealed three (8.9%) haplotypes common for Yakuts and Koryaks. The results of mtDNA analysis disagree with the hypothesis of an appreciable paleo-Asian contribution to the modern Yakut gene pool. PMID:12942638

Fedorova, S A; Bermisheva, M A; Villems, R; Maksimova, N R; Khusnutdinova, E K

2003-01-01

438

Identification of Birds through DNA Barcodes  

PubMed Central

Short DNA sequences from a standardized region of the genome provide a DNA barcode for identifying species. Compiling a public library of DNA barcodes linked to named specimens could provide a new master key for identifying species, one whose power will rise with increased taxon coverage and with faster, cheaper sequencing. Recent work suggests that sequence diversity in a 648-bp region of the mitochondrial gene, cytochrome c oxidase I (COI), might serve as a DNA barcode for the identification of animal species. This study tested the effectiveness of a COI barcode in discriminating bird species, one of the largest and best-studied vertebrate groups. We determined COI barcodes for 260 species of North American birds and found that distinguishing species was generally straightforward. All species had a different COI barcode(s), and the differences between closely related species were, on average, 18 times higher than the differences within species. Our results identified four probable new species of North American birds, suggesting that a global survey will lead to the recognition of many additional bird species. The finding of large COI sequence differences between, as compared to small differences within, species confirms the effectiveness of COI barcodes for the identification of bird species. This result plus those from other groups of animals imply that a standard screening threshold of sequence difference (10× average intraspecific difference) could speed the discovery of new animal species. The growing evidence for the effectiveness of DNA barcodes as a basis for species identification supports an international exercise that has recently begun to assemble a comprehensive library of COI sequences linked to named specimens. PMID:15455034

2004-01-01

439

Mitochondrial DNA perspective of Serbian genetic diversity.  

PubMed

Although south-Slavic populations have been studied to date from various aspects, the population of Serbia, occupying the central part of the Balkan Peninsula, is still genetically understudied at least at the level of mitochondrial DNA (mtDNA) variation. We analyzed polymorphisms of the first and the second mtDNA hypervariable segments (HVS-I and HVS-II) and informative coding-region markers in 139 Serbians to shed more light on their mtDNA variability, and used available data on other Slavic and neighboring non-Slavic populations to assess their interrelations in a broader European context. The contemporary Serbian mtDNA profile is consistent with the general European maternal landscape having a substantial proportion of shared haplotypes with eastern, central, and southern European populations. Serbian population was characterized as an important link between easternmost and westernmost south-Slavic populations due to the observed lack of genetic differentiation with all other south-Slavic populations and its geographical positioning within the Balkan Peninsula. An increased heterogeneity of south Slavs, most likely mirroring turbulent demographic events within the Balkan Peninsula over time (i.e., frequent admixture and differential introgression of various gene pools), and a marked geographical stratification of Slavs to south-, east-, and west-Slavic groups, were also found. A phylogeographic analyses of 20 completely sequenced Serbian mitochondrial genomes revealed not only the presence of mtDNA lineages predominantly found within the Slavic gene pool (U4a2a*, U4a2a1, U4a2c, U4a2g, HV10), supporting a common Slavic origin, but also lineages that may have originated within the southern Europe (H5*, H5e1, H5a1v) and the Balkan Peninsula in particular (H6a2b and L2a1k). Am J Phys Anthropol, 2014. © 2014 Wiley Periodicals, Inc. PMID:25418795

Davidovic, Slobodan; Malyarchuk, Boris; Aleksic, Jelena M; Derenko, Miroslava; Topalovic, Vladanka; Litvinov, Andrey; Stevanovic, Milena; Kovacevic-Grujicic, Natasa

2014-11-24

440

DNA banking and DNA databanking by academic and commercial laboratories  

SciTech Connect

The advent of DNA-based testing is giving rise to DNA banking (the long-term storage of cells, transformed cell lines, or extracted DNA for subsequent retrieval and analysis) and DNA data banking (the indefinite storage of information derived from DNA analysis). Large scale acquisition and storage of DNA and DNA data has important implications for the privacy rights of individuals. A survey of 148 academically based and commercial DNA diagnostic laboratories was conducted to determine: (1) the extent of their DNA banking activities; (2) their policies and experiences regarding access to DNA samples and data; (3) the quality assurance measures they employ; and (4) whether they have written policies and/or depositor`s agreements addressing specific issues. These issues include: (1) who may have access to DNA samples and data; (2) whether scientists may have access to anonymous samples or data for research use; (3) whether they have plans to contact depositors or retest samples if improved tests for a disorder become available; (4) disposition of samples at the end of the contract period if the laboratory ceases operations, if storage fees are unpaid, or after a death or divorce; (5) the consequence of unauthorized release, loss, or accidental destruction of samples; and (6) whether depositors may share in profits from the commercialization of tests or treatments developed in part from studies of stored DNA. The results suggest that many laboratories are banking DNA, that many have already amassed a large number of samples, and that a significant number plan to further develop DNA banking as a laboratory service over the next two years. Few laboratories have developed written policies governing DNA banking, and fewer still have drafted documents that define the rights and obligations of the parties. There may be a need for increased regulation of DNA banking and DNA data banking and for better defined policies with respect to protecting individual privacy.

McEwen, J.E. [Eunice Kennedy Shriver Center, Waltham, MA (United States)]|[Boston College Law School, Newton, MA (United States); Reilly, P.R. [Eunice Kennedy Shriver Center, Waltham, MA (United States)

1994-09-01

441

Depurination of N7-methylguanine by DNA glycosylase AlkD is dependent on the DNA backbone  

PubMed Central

DNA glycosylase AlkD excises N7-methylguanine (7mG) by a unique but unknown mechanism, in which the damaged nucleotide is positioned away from the protein and the phosphate backbone distorted. Here, we show by methylphosphonate substitution that a phosphate proximal to the lesion has a significant effect on the rate enhancement of 7mG depurination by the enzyme. Thus, instead of a conventional mechanism whereby protein side chains participate in N-glycosidic bond cleavage, AlkD remodels the DNA into an active site composed exclusively of DNA functional groups that provide the necessary chemistry to catalyze depurination. PMID:24090276

Rubinson, Emily H.; Christov, Plamen P.; Eichman, Brandt F.

2013-01-01

442

Depurination of N7-methylguanine by DNA glycosylase AlkD is dependent on the DNA backbone.  

PubMed

DNA glycosylase AlkD excises N7-methylguanine (7mG) by a unique but unknown mechanism, in which the damaged nucleotide is positioned away from the protein and the phosphate backbone is distorted. Here, we show by methylphosphonate substitution that a phosphate proximal to the lesion has a significant effect on the rate enhancement of 7mG depurination by the enzyme. Thus, instead of a conventional mechanism whereby protein side chains participate in N-glycosidic bond cleavage, AlkD remodels the DNA into an active site composed exclusively of DNA functional groups that provide the necessary chemistry to catalyze depurination. PMID:24090276

Rubinson, Emily H; Christov, Plamen P; Eichman, Brandt F

2013-10-22

443

Sphingosine, a modulator of human translesion DNA polymerase activity.  

PubMed

Translesion (TLS) DNA polymerases are specialized, error-prone enzymes that synthesize DNA across bulky, replication-stalling DNA adducts. In so doing, they facilitate the progression of DNA synthesis and promote cell proliferation. To potentiate the effect of cancer chemotherapeutic regimens, we sought to identify inhibitors of TLS DNA polymerases. We screened five libraries of ? 3000 small molecules, including one comprising ? 600 nucleoside analogs, for their effect on primer extension activity of DNA polymerase ? (Pol ?). We serendipitously identified sphingosine, a lipid-signaling molecule that robustly stimulates the activity of Pol ? by ? 100-fold at low micromolar concentrations but inhibits it at higher concentrations. This effect is specific to the Y-family DNA polymerases, Pols ?, ?, and ?. The addition of a single phosphate group on sphingosine completely abrogates this effect. Likewise, the inclusion of other sphingolipids, including ceramide and sphingomyelin to extension reactions does not elicit this response. Sphingosine increases the rate of correct and incorrect nucleotide incorporation while having no effect on polymerase processivity. Endogenous Pol ? activity is modulated similarly as the recombinant enzyme. Importantly, sphingosine-treated cells exhibit increased lesion bypass activity, and sphingosine tethered to membrane lipids mimics the effects of free sphingosine. Our studies have uncovered sphingosine as a modulator of TLS DNA polymerase activity; this property of sphingosine may be associated with its known role as a signaling molecule in regulating cell proliferation in response to cellular stress. PMID:24928506

Kamath-Loeb, Ashwini S; Balakrishna, Sharath; Whittington, Dale; Shen, Jiang-Cheng; Emond, Mary J; Okabe, Takayoshi; Masutani, Chikahide; Hanaoka, Fumio; Nishimura, Susumu; Loeb, Lawrence A

2014-08-01

444

Small-molecule discovery from DNA-encoded chemical libraries.  

PubMed

Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this tutorial review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity. PMID:21674077

Kleiner, Ralph E; Dumelin, Christoph E; Liu, David R

2011-12-01

445

[DNA methylation in obesity].  

PubMed

The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes), have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA) synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described. PMID:25531701

Pokrywka, Ma?gorzata; Kie?-Wilk, Beata; Polus, Anna; Wybra?ska, Iwona

2014-01-01

446

Optimality in DNA repair  

PubMed Central

DNA within cells is subject to damage from various sources. Organisms have evolved a number of mechanisms to repair DNA damage. The activity of repair enzymes carries its own risk, however, because the repair of two nearby lesions may lead to the breakup of DNA and result in cell death. We propose a mathematical theory of the damage and repair process in the important scenario where lesions are caused in bursts. We use this model to show that there is an optimum level of repair enzymes within cells which optimises the cell's response to damage. This optimal level is explained