Note: This page contains sample records for the topic groupings usingbranched dna from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: August 15, 2014.
1

Directed assembly of discrete gold nanoparticle groupings usingbranched DNA scaffolds  

Microsoft Academic Search

The concept of self-assembled dendrimers is explored for the creation of discrete nanoparticle assemblies. Hybridization of branched DNA trimers and nanoparticle-DNA conjugates results in the synthesis of nanoparticle trimer and tetramer complexes. Multiple tetramer architectures are investigated, utilizing Au-DNA conjugates with varying secondary structural motifs. Hybridization products are analyzed by gel electrophoresis, and discrete bands are observed corresponding to structures

Shelley A. Claridge; Sarah L. Goh; Jean M. J. Frechet; Shara C. Williams; Christine M. Micheel; A. Paul Alivisatos

2004-01-01

2

DNA and Natural Algorithms Group  

NSDL National Science Digital Library

This research group at the California Institute of Technology is studying the capability of DNA and other biomolecules to process information and implement algorithms. A general overview of the group's purpose and motivation is provided, as well as a number of publications.

2008-01-04

3

Group II Introns: Mobile Ribozymes that Invade DNA  

PubMed Central

SUMMARY Group II introns are mobile ribozymes that self-splice from precursor RNAs to yield excised intron lariat RNAs, which then invade new genomic DNA sites by reverse splicing. The introns encode a reverse transcriptase that stabilizes the catalytically active RNA structure for forward and reverse splicing, and afterwards converts the integrated intron RNA back into DNA. The characteristics of group II introns suggest that they or their close relatives were evolutionary ancestors of spliceosomal introns, the spliceosome, and retrotransposons in eukaryotes. Further, their ribozyme-based DNA integration mechanism enabled the development of group II introns into gene targeting vectors (“targetrons”), which have the unique feature of readily programmable DNA target specificity.

Lambowitz, Alan M.; Zimmerly, Steven

2011-01-01

4

Finding human promoter groups based on DNA physical properties  

NASA Astrophysics Data System (ADS)

DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong

2009-10-01

5

Mitochondrial DNA Evolution in the Drosophila obscura Group  

Microsoft Academic Search

We report a restriction-site study of the mitochondrial DNA (mtDNA) of seven species of the Drosophila obscura group. One species (D. azteca) belongs to the afinis subgroup; the other six species are classified in the obscura subgroup, three of them being from the old-world species (D. obscura, D. ambigua, and D. subob- scura) and three from the new-world species (D.

Amparo Latorre; Andres Moya; Francisco J. Ayala

1988-01-01

6

Differentiation of some species of Neisseriaceae and other bacterial groups by DNA-DNA hybridization.  

PubMed

DNA-DNA hybridization using total genomic DNA probes may represent a way of differentiating between miscellaneous bacterial species. This was studied with type and reference strains of 20 species in Moraxella, Kingella, and other selected Gram-negative groups. Both radioactive and biotin labelling were employed. Most of the species examined were easily distinguished, such as Moraxella (Branhamella) catarrhalis, M.(B.) ovis, M. atlantae, M. phenylpyruvica, M. osloensis, Neisseria elongata, N. meningitidis, Kingella kingae, K. indologenes, K. dentrificans, Oligella urethralis, Eikenella corrodens, Cardiobacterium hominis, Haemophilus aphrophilus, Actinobacillus actinomycetemcomitans, Gardnerella vaginalis, and DF-2. This reflected the extent of the genetic distances between them as a basis for identification by hybridization. There was some clustering in the Moraxella group. Especially the closely related Moraxella nonliquefaciens, M. lacunata and M. bovis showed strong hybridization affinities. This leads to potential problems in distinguishing these three species from each other by DNA-DNA hybridization with total genomic probes alone. PMID:2730785

Tønjum, T; Bukholm, G; Bøvre, K

1989-05-01

7

Flexible automated platform for blood group genotyping on DNA microarrays.  

PubMed

The poor suitability of standard hemagglutination-based assay techniques for large-scale automated screening of red blood cell antigens severely limits the ability of blood banks to supply extensively phenotype-matched blood. With better understanding of the molecular basis of blood antigens, it is now possible to predict blood group phenotype by identifying single-nucleotide polymorphisms in genomic DNA. Development of DNA-typing assays for antigen screening in blood donation qualification laboratories promises to enable blood banks to provide optimally matched donations. We have designed an automated genotyping system using 96-well DNA microarrays for blood donation screening and a first panel of eight single-nucleotide polymorphisms to identify 16 alleles in four blood group systems (KEL, KIDD, DUFFY, and MNS). Our aim was to evaluate this system on 960 blood donor samples with known phenotype. Study data revealed a high concordance rate (99.92%; 95% CI, 99.77%-99.97%) between predicted and serologic phenotypes. These findings demonstrate that our assay using a simple protocol allows accurate, relatively low-cost phenotype prediction at the DNA level. This system could easily be configured with other blood group markers for identification of donors with rare blood types or blood units for IH panels or antigens from other systems. PMID:24726279

Paris, Sandra; Rigal, Dominique; Barlet, Valérie; Verdier, Martine; Coudurier, Nicole; Bailly, Pascal; Brès, Jean-Charles

2014-05-01

8

The Polycomb group protein EZH2 directly controls DNA methylation  

Microsoft Academic Search

The establishment and maintenance of epigenetic gene silencing is fundamental to cell determination and function. The essential epigenetic systems involved in heritable repression of gene activity are the Polycomb group (PcG) proteins and the DNA methylation systems. Here we show that the corresponding silencing pathways are mechanistically linked. We find that the PcG protein EZH2 (Enhancer of Zeste homolog 2)

Emmanuelle Viré; Carmen Brenner; Rachel Deplus; Loïc Blanchon; Mario Fraga; Céline Didelot; Lluis Morey; Aleyde van Eynde; David Bernard; Jean-Marie Vanderwinden; Mathieu Bollen; Manel Esteller; Luciano di Croce; Yvan de Launoit; François Fuks

2006-01-01

9

Mitochondrial DNA evolution in the Anaxyrus boreas species group  

USGS Publications Warehouse

The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrus exsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. ?? 2008 Elsevier Inc.

Goebel, A. M.; Ranker, T. A.; Corn, P. S.; Olmstead, R. G.

2009-01-01

10

Genetic Kinship Investigation from Blood Groups to DNA Markers  

PubMed Central

The forensic application of hereditary characteristics became possible after the discovery of human blood groups by Karl Landsteiner in 1901. The foundation for their use in kinship investigation was laid by Emil von Dungern and Ludwig Hirschfeld in 1910 by clarification of the inheritance of the ABO groups. Up to the middle of the 20th century further red cell membrane systems were discovered. From the 1920s Fritz Schiff and Georg Strassmann fought for the introduction of blood groups into forensic kinship investigation. A new era of hemogenetics was opened from 1955 as genetic polymorphisms were described in serum proteins. Starting in 1958 there followed the complex HLA system of white blood cells, which from 1963 was joined by polymophisms in erythrocyte enzymes. Therefore, from the 1980s, it was possible to clarify the majority of kinship cases with a combination of conventional markers. From 1990 to 2000 the conventional markers were gradually replaced by the more effective DNA markers. Simultaneously typing shifted from the phenotype level to the genotype level. The genomic structure of conventional genetic markers could also now be explained. As a reflection of scientific progress the legal situation also changed, particularly in the form of the official guidelines for kinship investigation.

Geserick, Gunther; Wirth, Ingo

2012-01-01

11

Ribosomal and Mitochondrial DNA Analyses of Xiphinema americanum-Group Populations  

PubMed Central

The 18S ribosomal DNA (rDNA) and cytochrome oxidase I region of mitochondrial DNA (mtDNA) were sequenced for 24 Xiphinema americanum-group populations sourced from a number of geographically disparate locations. Sequences were subjected to phylogenetic analysis and compared. 18S rDNA strongly suggested that only X. pachtaicum, X. simile (two populations) and a X. americanum s.l. population from Portugal were different from the other 20 populations studied, whereas mtDNA indicated some heterogeneity between populations. Phylogenetically, based on mtDNA, an apparent dichotomy existed amongst X. americanum-group populations from North America and those from Asia, South America and Oceania. Analyses of 18S rDNA and mtDNA sequences underpin the classical taxonomic issues of the X. americanum-group and cast doubt on the degree of speciation within the X. americanum-group.

Lazarova, Stela S.; Malloch, Gaynor; Oliveira, Claudio M.G.; Hubschen, Judith; Neilson, Roy

2006-01-01

12

Group Testing With DNA Chips: Generating Designs and Decoding Experiments  

Microsoft Academic Search

DNA microarrays are a valuable tool for massively parallel DNA-DNA hybridization experiments. Currently, most applications rely on the existence of sequence-specific oligonucleotide probes. In large families of closely re- lated target sequences, such as different virus subtypes, the high degree of similarity often makes it impossible to find a unique probe for every target. Fortunately, this is unneces- sary. We

Alexander Schliep; David C. Torney; Sven Rahmann

2003-01-01

13

Hands on group work paper model for teaching DNA structure, central dogma and recombinant DNA  

Microsoft Academic Search

Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate students typically lack a coherent view of concepts and their relationships

Melek ALTIPARMAK; Mahmure NAKIBOGLU TEZER

2009-01-01

14

Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA  

ERIC Educational Resources Information Center

Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

Altiparmak, Melek; Nakiboglu Tezer, Mahmure

2009-01-01

15

In most Bradyrhizobium groups sequence comparison of 16S-23S rDNA internal transcribed spacer regions corroborates DNA-DNA hybridizations.  

PubMed

In an extension of a previous small-scale test to assess the use of 16S-23S rDNA internal transcribed spacer (ITS) sequences for rapid grouping of bradyrhizobia, we have sequenced the ITS region of 32 isolates of Bradyrhizobium that had previously been studied using AFLP and DNA-DNA hybridizations. We also included representatives of Afipia and Rhodopseudomonas. Our results indicate that ITS sequences are very diverse among bradyrhizobia. Nevertheless, for most of the bradyrhizobia, the grouping of ITS sequences was in line with AFLP results and DNA-DNA hybridization data. Strains that have at least 95.5% ITS sequence similarity belong to the same genospecies, i.e. they have more than 60% DNA-DNA hybridization values. The ITS sequences can therefore provide a relatively fast way to guide strain identification and aid selection of the reference groups that should be included in DNA-DNA hybridization experiments for precise genotypic identification. The Bradyrhizobium strains isolated from Aeschynomene species showed a much larger diversity in ITS sequences than other bradyrhizobia, possibly as a result of lateral exchange. The above ITS sequence similarity criterion for genospecies therefore does not apply to them, but they can easily be distinguished from other Bradyrhizobium genospecies because they have a distinct tRNA(ala) gene. PMID:12866847

Willems, Anne; Munive, Antonio; de Lajudie, Philippe; Gillis, Monique

2003-06-01

16

Liquid-crystalline phases formed by DNA duplexes containing pyrophosphate groups  

NASA Astrophysics Data System (ADS)

We have studied the interaction between synthetic DNA molecules containing pyrophosphate (PP) groups in various positions, which makes it possible to control the charge distribution along the DNA chain. The PP groups were either symmetrically arranged at the ends or at the center of DNA molecules or uniformly distributed along these molecules. It is shown that, similar to nonmodified DNA, the synthetic PP-modified DNA molecules can form cholesteric liquid crystals. Minima of the pair interaction potential are found, conditions of the symmetry of this potential are formulated, and the dependence of conformation angles on the effective charge is determined. The results of calculations show that the system exhibits polymorphism (i.e., several phases of cholesteric liquid crystals can exist in DNA solutions).

Volkov, Yu. S.; Golo, V. L.; Kats, E. I.; Kuznetsova, S. A.

2009-03-01

17

Liquid-crystalline phases formed by DNA duplexes containing pyrophosphate groups  

SciTech Connect

We have studied the interaction between synthetic DNA molecules containing pyrophosphate (PP) groups in various positions, which makes it possible to control the charge distribution along the DNA chain. The PP groups were either symmetrically arranged at the ends or at the center of DNA molecules or uniformly distributed along these molecules. It is shown that, similar to nonmodified DNA, the synthetic PP-modified DNA molecules can form cholesteric liquid crystals. Minima of the pair interaction potential are found, conditions of the symmetry of this potential are formulated, and the dependence of conformation angles on the effective charge is determined. The results of calculations show that the system exhibits polymorphism (i.e., several phases of cholesteric liquid crystals can exist in DNA solutions)

Volkov, Yu. S., E-mail: yu.volkov@gmail.com; Golo, V. L. [Moscow State University (Russian Federation); Kats, E. I. [Russian Academy of Sciences Chernogolovka, Landau Institute for Theoretical Physics (Russian Federation); Kuznetsova, S. A. [Institut Laue-Langevin (France)

2009-03-15

18

Group II intron mobility using nascent strands at DNA replication forks to prime reverse transcription  

PubMed Central

The Lactococcus lactis Ll.LtrB group II intron uses a major retrohoming mechanism in which the excised intron RNA reverse splices into one strand of a DNA target site, while the intron-encoded protein uses a C-terminal DNA endonuclease domain to cleave the opposite strand and then uses the cleaved 3? end as a primer for reverse transcription of the inserted intron RNA. Here, experiments with mutant introns and target sites indicate that Ll.LtrB can retrohome without second-strand cleavage by using a nascent strand at a DNA replication fork as the primer for reverse transcription. This mechanism connecting intron mobility to target DNA replication may be used by group II intron species that encode proteins lacking the C-terminal DNA endonuclease domain and for group II intron retrotransposition to ectopic sites.

Zhong, Jin; Lambowitz, Alan M.

2003-01-01

19

Mitochondrial DNA sequence diversity in two groups of Italian Veneto speakers from Veneto.  

PubMed

Although frequencies of mitochondrial DNA (mtDNA) haplogroups in the different European populations are rather homogenous, there are a few European populations or linguistic isolates that show different mtDNA haplogroup distributions; examples are the Saami and Ladin speakers from the eastern Italian Alps. MtDNA sequence diversity was analysed from subjects from two villages in Veneto. The first, Posina, is situated in the Venetian Alps near Vicenza. The second, Barco di Pravisdomini is a village on the plains near Venice. In spite of their common Veneto dialect, the two group populations have not preserved a genetic homogeneity; particularly, they show differences in T and J haplogroups frequencies. MtDNA diversity in these two groups seems to depend more on their geographic situation. PMID:11427175

Mogentale-Profizi, N; Chollet, L; Stévanovitch, A; Dubut, V; Poggi, C; Pradié, M P; Spadoni, J L; Gilles, A; Béraud-Colomb, E

2001-03-01

20

Group II intron mobility occurs by target DNA-primed reverse transcription.  

PubMed

Mobile group II introns encode reverse transcriptases and insert site specifically into intronless alleles (homing). Here, in vitro experiments show that homing of the yeast mtDNA group II intron aI2 occurs by reverse transcription at a double-strand break in the recipient DNA. A site-specific endonuclease cleaves the antisense strand of recipient DNA at position +10 of exon 3 and the sense strand at the intron insertion site. Reverse transcription of aI2-containing pre-mRNA is primed by the antisense strand cleaved in exon 3 and results in cotransfer of the intron and flanking exon sequences. Remarkably, the DNA endonuclease that initiates homing requires both the aI2 reverse transcriptase protein and aI2 RNA. Parallels in their reverse transcription mechanisms raise the possibility that mobile group II introns were ancestors of nuclear non-long terminal repeat retrotransposons and telomerases. PMID:7664334

Zimmerly, S; Guo, H; Perlman, P S; Lambowitz, A M

1995-08-25

21

Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature  

PubMed Central

Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5? non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5? non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages.

Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya

2006-01-01

22

Results of a collaborative study of the EDNAP group regarding mitochondrial DNA heteroplasmy and segregation in hair shafts  

Microsoft Academic Search

A collaborative exercise was carried out by the European DNA Profiling Group (EDNAP) in order to evaluate the distribution of mitochondrial DNA (mtDNA) heteroplasmy amongst the hairs of an individual who displays point heteroplasmy in blood and buccal cells. A second aim of the exercise was to study reproducibility of mtDNA sequencing of hairs between laboratories using differing chemistries, further

G. Tully; S. m. Barritt; K. Bender; E. Brignon; C. Capelli; N. Dimo-simonin; C. Eichmann; C. m. Ernst; C. Lambert; M. v. Lareu; B. Ludes; B. Mevag; W. Parson; H. Pfeiffer; A. Salas; P. m. Schneider; E. Staalstrom

2004-01-01

23

Nuclear DNA and heterochromatin contents in the Scilla hohenackeri group, S. persica , and Puschkinia scilloides ( Liliaceae )  

Microsoft Academic Search

DNA contents (presented as 1C-values) have been determined cytophotometrically in 7 species of theScilla hohenackeri group (10.18 to 22.71 pg), and in the systematically more isolated taxaS. persica (21.02 pg) andPuschkinia scilloides (6.80 pg). The heterochromatin amount is not correlated with the nuclear DNA content. Euchromatin, therefore, is not a particularly “conservative” part of the genome. However, high C-values and

Johann Greilhuber

1977-01-01

24

'Protected DNA Probes' capable of strong hybridization without removal of base protecting groups  

PubMed Central

We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness.

Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

2008-01-01

25

Control of DNA minor groove width and Fis protein binding by the purine 2-amino group  

PubMed Central

The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis–DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis–DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.

Hancock, Stephen P.; Ghane, Tahereh; Cascio, Duilio; Rohs, Remo; Di Felice, Rosa; Johnson, Reid C.

2013-01-01

26

[Variability of mitochondrial DNA in three groups of indigenous inhabitants of Northern Asia].  

PubMed

Sequence variants of the hypervariable region I of human mitochondrial DNA (mtDNA) of 125 individuals from three aboriginal population groups of northern Asia (Yakuts, Evens, and Koryaks) were analyzed. Unique types of mtDNA (mitotypes) were discovered in 80% of Koryaks, 78% of Evens, and 59% of Yakuts. The mitotypes observed were clustered into nine phylogenetically related groups, two of which, according to the data on the comparative analysis of Siberian and east Asian populations, were Koryak-specific, and one was Even-specific. Koryaks and Evens exhibited mtDNAs that were highly frequent in Ainu. The results are discussed in terms of genetic differentiation and the ethnogenesis of ethnic groups of northern Asia. PMID:9719916

Derenko, M V; Shields, G F

1998-05-01

27

Spy: A New Group of Eukaryotic DNA Transposons without Target Site Duplications.  

PubMed

Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5'-AAA and TTT-3' host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. PMID:24966181

Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

2014-01-01

28

Effects of Trehalose Polycation End-group Functionalization on Plasmid DNA Uptake and Transfection  

PubMed Central

In this study, we have synthesized six analogs of a trehalose-pentaethylenehexamine glycopolymer (Tr4) that contain (1A) adamantane, (1B) carboxy, (1C) alkynyl-oligoethyleneamine, (1D) azido trehalose, (1E) octyl, or (1F) oligoethyleneamine end groups and evaluated the effects of polymer end group chemistry on the ability of these systems to bind, compact, and deliver pDNA in cultured HeLa cells. The polymers were synthesized in one-pot azide-alkyne cycloaddition reactions with an adaptation of the Carothers equation for step-growth polymerization to produce a series of polymers with similar degrees of polymerization. An excess of end-capping monomer was added at the end of the polymerizations to maximize functionalization efficiency, which was evaluated with GPC, NMR and MALDI-TOF. The polymers were all found to bind and compact pDNA at similarly low N/P ratios and form polyplexes with plasmid DNA. The effects of the different end group structures were most evident in the polyplex internalization and transfection assays completed in the presence of serum, as determined by flow cytometry and luciferase gene expression respectively. The Tr4 polymers end-capped with carboxyl groups (1B) (N/P = 7), octyne (1E) (N/P = 7), and oligoethyleneamine (1F) (N/P = 7), were taken into cells as polyplex and exhibited the highest levels of fluorescence, resulting from labeled reporter plasmid. Similarly, the polymers end-functionalized with the carboxyl groups (1E at N/P = 7), octyl groups (1E at N/P = 15) and, in particular, the oligoethyleneamine groups (F at N/P = 15) yielded dramatically higher reporter gene expression in the presence of serum. This study yields insight into how very subtle structural changes in the polymer chemistry such as end groups can yield very significant differences in the biological delivery efficiency and transgene expression of polymers used for pDNA delivery.

Anderson, Kevin; Sizovs, Antons; Cortez, Mallory; Waldron, Chris; Haddleton, D.M.; Reineke, Theresa M.

2012-01-01

29

Genetic Variation Among Vegetative Compatibility Groups of Fusarium oxysporum f. sp. cubense Analyzed by DNA Fingerprinting  

Microsoft Academic Search

Bentley, S., Pegg, K. G., Moore, N. Y., Davis, R. D., and Buddenhagen, I. W. 1998. Genetic variation among vegetative compatibility groups of Fusarium oxysporum f. sp. cubense analyzed by DNA fingerprinting. Phytopathology 88:1283-1293. Genetic variation within a worldwide collection of 208 isolates of Fu- sarium oxysporum f. sp. cubense, representing physiological r aces 1, 2, 3, and 4 and

S. Bentley; K. G. Pegg; N. Y. Moore; R. D. Davis; I. W. Buddenhagen

1998-01-01

30

A Survey on Combinatorial Group Testing Algorithms with Applications to DNA Library Screening  

Microsoft Academic Search

In this paper, we give an overview of Combinatorial Group Testing algo- rithms which are applicable to DNA Library Screening. Our survey focuses on several classes of constructions not discussed in previous surveys, provides a general view on pooling design constructions and poses several open questions arising from this view.

Hung Q. Ngo; Ding-Zhu Du

31

Evolutionary differentiation of bimaculatus group anoles based on analyses of mtDNA and microsatellite data  

Microsoft Academic Search

The bimaculatus group of anoles inhabit the northern Lesser Antilles, as far south as Dominica. This study uses 1005 base pairs (bp) of mitochondrial DNA sequence data from two genes, cytochrome b (521bp) and cytochrome oxidase subunit I (484bp) to reconstruct phylogenetic relationships between species and populations of anoles from all islands banks. Allele frequency data from nuclear microsatellite loci

Andrew G. Stenson; Roger S. Thorpe; Anita Malhotra

2004-01-01

32

The release of high mobility group box 1 in apoptosis is triggered by nucleosomal DNA fragmentation.  

PubMed

High mobility group box 1 (HMGB1) initially identified as a non-histone chromosomal protein, which mainly functions as chromatin structure and transcriptional regulation, has been recently reported to be secreted into extracellular milieu in necrosis and apoptosis, and act as a proinflammatory mediator. However, the mechanism by which apoptotic cells release HMGB1 is not clear. In this study, we found that staurosporine (apoptosis-inducer)-induced HMGB1 release was associated with nucleosomal DNA fragmentation catalyzed by caspase-activated DNase (CAD) in WEHI-231 cells. Importantly, this event was effectively attenuated by the treatment of a pan-caspase inhibitor, Z-VAD-fmk, and by the inhibition of CAD-mediated DNA fragmentation by the expression of caspase-resistant inhibitor of CAD (ICAD-CR). In WEHI-231/ICAD-CR and WEHI-231/Puro cells, DNase ?-catalyzed nucleosomal DNA fragmentation occurred by anti-IgM antibody treatment was critical for HMGB1 release. Furthermore, in DNase ? stably-expressing HeLa S3 cells (HeLa S3/?), the release of HMGB1 accompanied with nucleosomal DNA fragmentation was more apparent than that in parental HeLa S3 cells in which DNA fragmentation was scarcely observed. Taken together, these date suggest that nucleosomal DNA fragmentation catalyzed by CAD or DNase ? plays a pivotal role in HMGB1 release. PMID:21093407

Yamada, Yoichiro; Fujii, Taku; Ishijima, Rei; Tachibana, Haruki; Yokoue, Natsuki; Takasawa, Ryoko; Tanuma, Sei-ichi

2011-02-15

33

New reagents for the introduction of reactive functional groups into chemically synthesized DNA probes.  

PubMed

An efficient and versatile preparative approach is described, allowing for the preparation of DNA probes modified with an aldehyde group at the 3'- or 5'-end. The developed synthetic strategy allows for the preparation of a new family of phosphoramidites and solid supports compatible with the automated synthesis of modified oligonucleotide probes. These new reagents were prepared from intermediates 3 and 3a, obtained from the commercially available aleuritic acid 1. It was demonstrated that the new phosphoramidite reagents also could be used as new types of cleavable linkers. A new and efficient method for the production of 5' aldehyde-labeled DNA probes was developed. PMID:12757390

Skrzypczynski, Zbigniew; Wayland, Sarah

2003-01-01

34

Distinct Structural Features of the Peroxide Response Regulator from Group A Streptococcus Drive DNA Binding  

PubMed Central

Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators.

Hammel, Michal; Nix, Jay C.; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

2014-01-01

35

Multiparameter DNA content analysis identifies distinct groups in primary breast cancer  

PubMed Central

Background: Multiparameter flow cytometry is a robust and reliable method for determining tumour DNA content applicable to formalin-fixed paraffin-embedded (FFPE) tissue. This study examined the clinical and pathological associations of DNA content in primary breast cancer using an improved multiparametric technique. Methods: The FFPE tissue from 201 primary breast cancers was examined and the cancers categorised according to their DNA content using multiparametric flow cytometry incorporating differential labelling of stromal and tumour cell populations. Mathematical modelling software (ModFit 3.2.1) was used to calculate the DNA index (DI) and percentage S-phase fraction (SPF%) for each tumour. Independent associations with clinical and pathological parameters were sought using backward stepwise Binary Logistic Regression (BLR) and Cox's Regression (CR) analysis. Results: Tumours were grouped into four categories based on the DI of the tumour cell population. Low DI tumours (DI=0.76–1.14) associated with progesterone receptor-positive status (P=0.012, BLR), intermediate DI (DI=1.18–1.79) associated with p53 mutant tumours (P=0.001, BLR), high DI (DI?1.80) tumours with human epidermal growth factor receptor 2 (HER2)-positive status (P=0.004, BLR) and ‘multiploid tumours' (two or more tumour DNA peaks) did not show any significant associations. Tumours with high SPF% (?10%) independently associated with poor overall survival (P=0.027, CR). Conclusion: Multiparametric flow analysis of FFPE tissue can accurately assess tumour DNA content. Tumour sub-populations associated with biomarkers of prognosis or likely response to therapy. The alterations in DNA content present the potential for greater understanding of the mechanisms underlying clinically significant biomarker changes in primary breast cancer.

Dayal, J H S; Sales, M J; Corver, W E; Purdie, C A; Jordan, L B; Quinlan, P R; Baker, L; ter Haar, N T; Pratt, N R; Thompson, A M

2013-01-01

36

The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J  

Microsoft Academic Search

The protein predicted to be defective in individuals with Fanconi anemia complementation group J (FA-J), FANCJ, is a missing component in the Fanconi anemia pathway of genome maintenance. Here we identify pathogenic mutations in eight individuals with FA-J in the gene encoding the DEAH-box DNA helicase BRIP1, also called FANCJ. This finding is compelling evidence that the Fanconi anemia pathway

Marieke Levitus; Quinten Waisfisz; Barbara C Godthelp; Yne de Vries; Shobbir Hussain; Wouter W Wiegant; Elhaam Elghalbzouri-Maghrani; Jûrgen Steltenpool; Martin A Rooimans; Gerard Pals; Fré Arwert; Christopher G Mathew; Ma?gorzata Z Zdzienicka; Kevin Hiom; Johan P De Winter; Hans Joenje

2005-01-01

37

Conserved primary sequences of the DNA terminal proteins of five different human adenovirus groups.  

PubMed

The 31 human adenoviruses (Ad) from five groups (A-E) whose DNAs are <20% homologous by molecular hybridization. Ad5 (group C) DNA contains a 55,000-dalton protein probably covalently bound to each 5' terminus. This covalently bound protein may be analogous to polypeptides found in other viral and nonviral systems that are covalently bound to genomic DNAs or RNAs and that are thought to function in DNA or RNA replication. Because of the importance of proteins linked to nucleic acids, we have investigated whether DNAs from all five groups of human adenoviruses have terminal proteins, as well as the peptide relationships among the different terminal proteins. We show here that DNAs from Ad12, 7, 2, 19, and 4, representing Ad groups A-E, respectively, all contain covalently bound proteins of about 55,000 daltons. To investigate the peptide relatedness among the terminal proteins, we prepared microgram quantities of covalently bound protein from Ads in groups A-E and compared their chymotryptic and tryptic (125)I-labeled peptide maps. We find that the covalently bound protein maps of the five Ad groups are highly related and possibly identical. On the other hand, the tryptic and chymotryptic peptide maps of the major virion protein II and the core proteins V and VII of groups B, C, and E Ads show considerable heterology. Assuming that the covalently bound protein is virally coded, the conserved primary sequence of these proteins suggests a major functional role for the protein in Ad replication. Because the genetic origin of the Ad covalently bound proteins is not established, our data are also consistent with the possibility that the protein is coded by a cellular gene. PMID:228297

Green, M; Brackmann, K; Wold, W S; Cartas, M; Thornton, H; Elder, J H

1979-09-01

38

Microsatellite DNA Suggests that Group Size Affects Sex-biased Dispersal Patterns in Red Colobus Monkeys  

PubMed Central

Dispersal is a major life history trait of social organisms influencing the behavioral and genetic structure of their groups. Unfortunately, primate dispersal is difficult to quantify, because of the rarity of these events and our inability to ascertain if individuals dispersed or died when they disappear. Socioecological models have been partially developed to understand the ecological causes of different dispersal systems and their social consequences. However, these models have yielded confusing results when applied to folivores. The folivorous red colobus monkey (Procolobus rufomitratus) in Kibale National Park, Uganda is thought to exhibit female-biased dispersal, although both sexes have been observed to disperse and there remains considerable debate over the selective pressures favoring the transfers of males and females and the causes of variation in the proportion of each sex to leave the natal group. We circumvent this problem by using microsatellite DNA data to investigate the prediction that female dispersal will be more frequent in larger groups as compared to smaller ones. The rationale for this prediction is that red colobus exhibit increased within-group competition in bigger groups, which should favor higher female dispersal rates and ultimately lower female relatedness. Genetic data from two unequally sized neighboring groups of red colobus demonstrate increased female relatedness within the smaller group, suggesting females are less likely to disperse when there is less within-group competition. We suggest that the dispersal system is mediated to some degree by scramble competition and group size. Since red colobus group sizes have increased throughout Kibale by over 50% in the last decade, these changes may have major implications for the genetic structure and ultimately the population viability of this endangered primate.

Miyamoto, Michael M.; Allen, Julie M.; Gogarten, Jan F.; Chapman, Colin A.

2013-01-01

39

Role of Polycomb Group Proteins in the DNA Damage Response - A Reassessment  

PubMed Central

A growing body of evidence suggests that Polycomb group (PcG) proteins, key regulators of lineage specific gene expression, also participate in the repair of DNA double-strand breaks (DSBs) but evidence for direct recruitment of PcG proteins at specific breaks remains limited. Here we explore the association of Polycomb repressive complex 1 (PRC1) components with DSBs generated by inducible expression of the AsiSI restriction enzyme in normal human fibroblasts. Based on immunofluorescent staining, the co-localization of PRC1 proteins with components of the DNA damage response (DDR) in these primary cells is unconvincing. Moreover, using chromatin immunoprecipitation and deep sequencing (ChIP-seq), which detects PRC1 proteins at common sites throughout the genome, we did not find evidence for recruitment of PRC1 components to AsiSI-induced DSBs. In contrast, the S2056 phosphorylated form of DNA-PKcs and other DDR proteins were detected at a subset of AsiSI sites that are predominantly at the 5? ends of transcriptionally active genes. Our data question the idea that PcG protein recruitment provides a link between DSB repairs and transcriptional repression.

Chandler, Hollie; Patel, Harshil; Palermo, Richard; Brookes, Sharon; Matthews, Nik; Peters, Gordon

2014-01-01

40

Genetic polymorphism of six DNA loci in six population groups of India.  

PubMed

The genetic profile based on autosomal markers, four microsatellite DNA markers (D8S315, FES, D8S592, and D2S1328) and two minisatellite DNA markers (TPMT and PDGFA), were analyzed in six endogamous populations to examine the effect of geographic and linguistic affiliation on the genetic affinities among the groups. The six populations are from three different states of India and are linguistically different. Marathas from western India speak Marathi, an Indo-European language. Arayas, Muslims, Ezhavas, and Nairs from Kerala state of South India speak Malayalam, and Iyers from Tamil Nadu state speak Tamil. Genomic DNA was extracted from peripheral blood samples of random, normal, healthy individuals. Locus-specific PCR amplification was carried out, followed by electrophoresis of the amplicons and genotyping. All the loci were highly polymorphic and followed Hardy-Weinberg equilibrium, except for loci D8S315 and PDGFA in Iyers and Marathas, respectively. All six loci had high heterozygosity (average heterozygosity ranged from 0.73 to 0.76) and high polymorphism information content (0.57-0.90). The extent of gene differentiation among the six populations (G(ST) = 0.030) was greater than that for four Kerala populations (G(ST) = 0.011), suggesting proximity between the four Kerala populations. This result conforms with the cultural and linguistic background of the populations. The extent of diversity found among the populations probably resulted from the strict endogamous practices that they follow. PMID:18075006

Ahmad, Shazia; Seshadri, M

2007-08-01

41

Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species  

NASA Astrophysics Data System (ADS)

Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1?g) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288?A. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35?A) and for the noncomplementary oligonucleotide (5.77?A). The drop in current after each event was clearly noticeable and it proved to be effective.

Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

2009-05-01

42

The reactivity of sulfhydryl groups of yeast DNA dependent RNA polymerase I.  

PubMed Central

The number of reactive cysteine residues of yeast RNA polymerase I was determined and their function was studied using parachloromercury benzoate (pCMB), dithiobisnitrobenzoate (DTNB) and N-ethyl-maleimide (NEM) as modifying agents. By treatment with DTNB about 45 sulfhydryl groups react in the presence of 8M urea. Under non-denaturing conditions only 20 sulfhydryl groups are reactive with pCMB and DTNB. Both reagents completely inactivate the enzyme and this effect can be reversed by reducing agents. The sedimentation coefficient and the subunit composition are not affected when the enzyme is inactivated. Two of the most reactive sulfhydryl groups are necessary for activity. The modification of these groups is partially protected by substrates and DNA, suggesting that they are involved either in catalysis or in the maintenance of the conformation of the active site. Experiments with 14C-NEM indicate that the most reactive groups are located in subunits of 185,000, 137,000 and 41,000 daltons. Images

Bull, P; Wyneken, U; Valenzuela, P

1982-01-01

43

Molecular Cloning of a Mouse DNA Repair Gene that Complements the Defect of Group-A Xeroderma Pigmentosum  

Microsoft Academic Search

For isolation of the gene reponsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 × 105 pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV

Kiyoji Tanaka; Ichiro Satokata; Zenzaburo Ogita; Tsuyoshi Uchida; Yoshio Okada

1989-01-01

44

WRN exonuclease activity is blocked by DNA termini harboring 3' obstructive groups  

PubMed Central

SUMMARY Reactive oxygen species, generated either by cellular respiration or upon exposure to environmental agents such as ionizing radiation (IR), attack DNA to form a variety of oxidized base and sugar modifications. Accumulation of oxidative DNA damage has been associated with age-related disease as well as the aging process. Single-strand breaks harboring oxidative 3' obstructive termini, e.g. 3' phosphates and 3' phosphoglycolates, must be removed prior to DNA repair synthesis or ligation. In addition, 3' tyrosyl-linked protein damage, resulting from therapeutic agents such as camptothecin (CPT), must be processed to initiate repair. Several nucleases participate in DNA repair and the excision of 3' obstructive ends. As the protein defective in the segmental progeroid Werner syndrome (WRN) possesses 3' to 5' exonuclease activity, and Werner syndrome cells are hypersensitive to IR and CPT, we examined for WRN exonuclease activity on 3' blocking lesions. Moreover, we compared side-by-side the activity of four prominent human 3' to 5' exonucleases (WRN, APE1, TREX1, and p53) on substrates containing 3' phosphates, phosphoglycolates, and tyrosyl residues. Our studies reveal that while WRN degrades 3' hydroxyl containing substrates in a nonprocessive manner, it does not excise 3' phosphate, phosphoglycolate, or tyrosyl groups. In addition, we found that APE1 was most active at excising 3' blocking termini in comparison to the disease-related exonucleases TREX1, WRN, and p53 under identical physiological reaction conditions, and that TREX1 was the most powerful 3' to 5' exonuclease on undamaged oligonucleotide substrates.

Harrigan, Jeanine A.; Fan, Jinshui; Momand, Jamil; Perrino, Fred W.; Bohr, Vilhelm A.; Wilson, David M.

2007-01-01

45

Classification of herpesvirus saimiri into three groups based on extreme variation in a DNA region required for oncogenicity.  

PubMed Central

The leftmost 7 kilobase pairs of unique sequence L-DNA of herpesvirus saimiri was found to be highly variable among different strains as determined by restriction endonuclease analysis and blot hybridization. This region in one group of viruses (group A) showed only very weak hybridization with the DNA of two other groups. Similarly, a fragment of group B hybridized to DNA of its own group much more strongly than to group A. No homology was detected within a 1.2-kilobase-pair region between strain 11 (group A virus) and strain SMHI (group B) even under reduced stringency, and the adjacent 5.5-kilobase-pair segment of the region showed only a very weak intergroup hybridization. DNA of a third group of viruses (non-A, non-B) did not hybridize significantly with cloned fragments representing the leftmost 7-kilobase-pair region of either group A or group B. Since sequences in the highly variable region are required for the oncogenicity of the virus, these results raise interesting questions regarding the origin and function of this region of the genome. Images

Medveczky, P; Szomolanyi, E; Desrosiers, R C; Mulder, C

1984-01-01

46

High mobility group I(Y)-like DNA-binding domains on a bacterial transcription factor.  

PubMed Central

The bacterium Myxococcus xanthus responds to blue light by producing carotenoids. It also responds to starvation conditions by developing fruiting bodies, where the cells differentiate into myxospores. Each response entails the transcriptional activation of a separate set of genes. However, a single gene, carD, is required for the activation of both light- and starvation-inducible genes. Gene carD has now been sequenced. Its predicted amino acid sequence includes four repeats of a DNA-binding domain present in mammalian high mobility group I(Y) proteins and other nuclear proteins from animals and plants. Other peptide stretches on CarD also resemble functional domains typical of eukaryotic transcription factors, including a very acidic region and a leucine zipper. High mobility group yI(Y) proteins are known to bind the minor groove of A+T-rich DNA. CarD binds in vitro an A+T-rich element that is required for the proper operation of a carD-dependent promoter in vivo. Images Fig. 2 Fig. 3 Fig. 4

Nicolas, F J; Cayuela, M L; Martinez-Argudo, I M; Ruiz-Vazquez, R M; Murillo, F J

1996-01-01

47

The first high-mobility-group box of upstream binding factor assembles across-over DNA junction by basic residues.  

PubMed Central

Upstream binding factor (UBF) is a eukaryotic RNA polymerase I-specific transcription factor. Its predominant DNA-binding motif, ubfHMG box 1, preserves DNA assembling activity that can bind two or more DNA duplexes simultaneously to form a crossover DNA junction. Here we investigate the basis of crossover DNA-assembling activity of ubfHMG box 1 by extensive mutagenesis analyses and mobility shift assay. Although the ubfHMG box 1 preserves a high mobility group (HMG) core structure, changing a number of the consensus hydrophobic and aromatic residues to alanine did not inhibit its crossover-assembling activity. This indicates that these residues do not directly participate in protein-DNA interaction. However, altering a series of basic residues in the helices 1 and 2 regions or the N-terminal extended strand of the ubfHMG box 1 motif had severe effects on DNA-assembling activity; however, certain non-specific DNA binding activity still remained. This suggests that the ubfHMG box 1 motif might extensively contact the backbone of a crossover junction through its multiple basic residues. Mutating a hydrophobic residue in the terminal dimerization domain inhibited the association of truncated Xenopus UBF, but had little effect on its crossover-assembling activity. This indicates that the UBF-crossover DNA complex is not established by the association of individual DNA-bound peptides.

Hu, C H; Wang, J M; Tseng, H B

1998-01-01

48

Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.  

PubMed

The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays. PMID:20039128

Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

2010-03-01

49

Application of group specific amplified rDNA restriction analysis to characterize swine fecal and manure storage pit samples.  

PubMed

Group specific amplified ribosomal-DNA restriction analysis was evaluated as a method to rapidly assess microbial community structure in swine fecal and manure storage pit samples. PCR primer sequences were evaluated for their specificity to ribosomal DNA from selected bacterial groups by optimizing annealing temperatures and determining specificity using a set of primer target and non-target organisms. A number of primer sets were identified targeting the following groups: Bacteroides-Prevotella, clostridial clusters I and II, clostridial clusters IX and XI, clostridial clusters XIVa and XIVb, Lactobacillus, Desulfovibrionaceae and Streptococcus-Lactococcus, as well as an universal primer set to represent total populations. Each bacterial group was digested with at least three restriction enzymes. We applied the group specific amplified ribosomal-DNA restriction analysis to swine fecal and manure storage pit samples obtained on two separate occasions. Fecal and manure storage pit samples obtained on the same day were more similar to each other than to any other samples. Results were consistent with 16S ribosomal DNA sequencing data from bacterial isolates and clones obtained from swine feces and manure storage pit. The group specific amplified ribosomal-DNA restriction analysis technique was able to rapid detect gross bacterial community differences among swine fecal and manure storage pit samples and determine groups of interest for more detailed examination. PMID:16701521

Ziemer, C J; Cotta, M A; Whitehead, T R

2004-08-01

50

A Reduced Number of mtSNPs Saturates Mitochondrial DNA Haplotype Diversity of Worldwide Population Groups  

PubMed Central

Background The high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. Methodology/Principal Findings This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia) and two admixed populations (“African-Americans” and “Hispanics”) were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of “universal” mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. Conclusions/Significance The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given set of mtSNPs is more efficient than previous empirical approaches. In contrast to precedent findings, the results seem to indicate that only few mtSNPs are needed to reach high levels of discrimination power in a population, independently of its ancestral background.

Salas, Antonio; Amigo, Jorge

2010-01-01

51

Molecular Renormalization Group Coarse-Graining of Polymer Chains: Application to Double-Stranded DNA  

PubMed Central

Coarse-graining of atomistic force fields allows us to investigate complex biological problems, occurring at long timescales and large length scales. In this work, we have developed an accurate coarse-grained model for double-stranded DNA chain, derived systematically from atomistic simulations. Our approach is based on matching correlators obtained from atomistic and coarse-grained simulations, for observables that explicitly enter the coarse-grained Hamiltonian. We show that this requirement leads to equivalency of the corresponding partition functions, resulting in a one-step renormalization. Compared to prior works exploiting similar ideas, the main novelty of this work is the introduction of a highly compact set of Hamiltonian basis functions, based on molecular interaction potentials. We demonstrate that such compactification allows us to reproduce many-body effects, generated by one-step renormalization, at low computational cost. In addition, compact Hamiltonians greatly increase the likelihood of finding unique solutions for the coarse-grained force-field parameter values. By successfully applying our molecular renormalization group coarse-graining technique to double-stranded DNA, we solved, for the first time, a long-standing problem in coarse-graining polymer systems, namely, how to accurately capture the correlations among various polymeric degrees of freedom. Excellent agreement is found among atomistic and coarse-grained distribution functions for various structural observables, including those not included in the Hamiltonian. We also suggest higher-order generalization of this method, which may allow capturing more subtle correlations in biopolymer dynamics.

Savelyev, Alexey; Papoian, Garegin A.

2009-01-01

52

DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar  

PubMed Central

The role of DNA barcoding as a tool to accelerate the inventory and analysis of diversity for hyperdiverse arthropods is tested using ants in Madagascar. We demonstrate how DNA barcoding helps address the failure of current inventory methods to rapidly respond to pressing biodiversity needs, specifically in the assessment of richness and turnover across landscapes with hyperdiverse taxa. In a comparison of inventories at four localities in northern Madagascar, patterns of richness were not significantly different when richness was determined using morphological taxonomy (morphospecies) or sequence divergence thresholds (Molecular Operational Taxonomic Unit(s); MOTU). However, sequence-based methods tended to yield greater richness and significantly lower indices of similarity than morphological taxonomy. MOTU determined using our molecular technique were a remarkably local phenomenon—indicative of highly restricted dispersal and/or long-term isolation. In cases where molecular and morphological methods differed in their assignment of individuals to categories, the morphological estimate was always more conservative than the molecular estimate. In those cases where morphospecies descriptions collapsed distinct molecular groups, sequence divergences of 16% (on average) were contained within the same morphospecies. Such high divergences highlight taxa for further detailed genetic, morphological, life history, and behavioral studies.

Smith, M. Alex; Fisher, Brian L; Hebert, Paul D.N

2005-01-01

53

The Fanconi anemia complementation group C protein corrects DNA interstrand cross-link-specific apoptosis in HSC536N cells.  

PubMed

Fanconi anemia (FA) cells are hypersensitive to cytotoxicity, cell cycle arrest, and chromosomal aberrations induced by DNA cross-linking agents, such as mitomycin C (MMC) and nitrogen mustard (HN2). Although MMC hypersensitivity is complemented in a subset of FA cells (complementation group C [FA-C]) by wild-type FAC cDNA, the cytoprotective mechanism is unknown. In the current study, we tested the hypothesis that FAC protein functions in the suppression of DNA interstand cross-link (ISC)-induced cell cycle arrest and apoptosis. Comparison of HN2-induced cell cycle arrest and apoptosis with those of its non-cross-linking analogs, diethylaminoethyl chloride and 2-dimethylaminoethyl chloride, delineated the DNA ISC specificity of FAC-mediated cytoprotection. Overexpression of wild-type FAC cDNA in FA-C lymphoblasts (HSC536N cell line) prevented HN2-induced growth inhibition, G2 arrest, and DNA fragmentation that is characteristic of apoptosis. In contrast cytoprotection was not conferred against the effects of the non-cross-linking mustards. Our data show that DNA ISCs induce apoptosis more potently than do DNA monoadducts and suggest that FAC suppresses specifically DNA ISC-induced apoptosis in the G2 phase of the cell cycle. PMID:8822951

Marathi, U K; Howell, S R; Ashmun, R A; Brent, T P

1996-09-15

54

Genetic Diversity within Schistosoma haematobium: DNA Barcoding Reveals Two Distinct Groups  

PubMed Central

Background Schistosomiasis in one of the most prevalent parasitic diseases, affecting millions of people and animals in developing countries. Amongst the human-infective species S. haematobium is one of the most widespread causing urogenital schistosomiasis, a major human health problem across Africa, however in terms of research this human pathogen has been severely neglected. Methodology/Principal Findings To elucidate the genetic diversity of Schistosoma haematobium, a DNA ‘barcoding’ study was performed on parasite material collected from 41 localities representing 18 countries across Africa and the Indian Ocean Islands. Surprisingly low sequence variation was found within the mitochondrial cytochrome oxidase subunit I (cox1) and the NADH-dehydrogenase subunit 1 snad1). The 61 haplotypes found within 1978 individual samples split into two distinct groups; one (Group 1) that is predominately made up of parasites from the African mainland and the other (Group 2) that is made up of samples exclusively from the Indian Ocean Islands and the neighbouring African coastal regions. Within Group 1 there was a dominance of one particular haplotype (H1) representing 1574 (80%) of the samples analyzed. Population genetic diversity increased in samples collected from the East African coastal regions and the data suggest that there has been movement of parasites between these areas and the Indian Ocean Islands. Conclusions/Significance The high occurrence of the haplotype (H1) suggests that at some point in the recent evolutionary history of S. haematobium in Africa the population may have passed through a genetic ‘bottleneck’ followed by a population expansion. This study provides novel and extremely interesting insights into the population genetics of S. haematobium on a large geographic scale, which may have consequence for control and monitoring of urogenital schistosomiasis.

Webster, Bonnie L.; Emery, Aiden M.; Webster, Joanne P.; Gouvras, Anouk; Garba, Amadou; Diaw, Oumar; Seye, Mohmoudane M.; Tchuente, Louis Albert Tchuem; Simoonga, Christopher; Mwanga, Joseph; Lange, Charles; Kariuki, Curtis; Mohammed, Khalfan A.; Stothard, J. Russell; Rollinson, David

2012-01-01

55

New PCR primers for the selective amplification of 16S rDNA from different groups of actinomycetes.  

PubMed

Actinomycetes play a relevant role in soil ecology and are also of important biotechnological interest as they produce several bioactive metabolites. Within the filamentous actinomycetes, it would be desirable to recognize and characterize environmental samples containing unusual genera. To this end, we have developed selective primer sets for polymerase chain reaction (PCR) amplification of 16S rDNA from the Actinomycetales families Micromonosporaceae, Streptomycetaceae, Streptosporangiaceae and Thermomonosporaceae, and from the genus Dactylosporangium. Each primer set, evaluated on genomic DNA from reference strains, showed high specificity and good sensitivity. After amplification of DNA extracted from soil samples, the sequence of the cloned PCR products confirmed the specific amplification of the desired group of sequences in at least 95% of the clones for each primer set. The application of these primers to environmental samples showed the frequent occurrence of these groups in soil samples and also revealed sequences that can be attributed to new groups of actinomycetes. PMID:19709301

Monciardini, Paolo; Sosio, Margherita; Cavaletti, Linda; Chiocchini, Claudia; Donadio, Stefano

2002-12-01

56

Phylogenetic analysis of the Saccharomyces cerevisiae group based on polymorphisms of rDNA spacer sequences.  

PubMed

The phylogenetic relationships between species of yeasts assigned to the Saccharomyces sensu stricto group, which includes Saccharomyces cerevisiae and Saccharomyces bayanus, were studied together with Saccharomyces pastorianus and Saccharomyces paradoxus. The experimental approaches used were RFLP analysis of the PCR-amplified rDNA internal transcribed spacer (ITS) and intergenic spacer, and total ITS sequence analysis. Both RFLP and sequence analyses gave fairly similar results. The gene trees generated with either of the two data sets showed the distribution of the yeasts into two major, well-separated, phylogenetic clusters called 'cerevisiae' and 'bayanus'. The 'cerevisiae' cluster included the S. cerevisiae type strain, together with most of the species (16 out of 23), whereas the 'bayanus' cluster included the remaining seven type strains. Therefore, analysis of rDNA sequences confirmed S. cerevisiae and S. bayanus as two well-defined taxa. However, S. pastorianus and S. paradoxus, the two other usually accepted taxa of the now-defined Saccharomyces sensu stricto complex, could not be clearly separated from S. bayanus and S. cerevisiae, respectively. However, in both PCR-RFLP and ITS sequence analyses, S. paradoxus had the outermost position in the 'cerevisiae' cluster. PCR-RFLP analysis of the ribosomal spacer sequences was also carried out on 26 Saccharomyces strains isolated in various wine-growing regions of France in an attempt to clarify their positions in the Saccharomyces phylogenetic tree. Compared to the diversity of the Saccharomyces type strains, less genetic diversity was detected among these yeasts and several of them exhibited identical RFLP patterns. Most of the wine yeast strains (16 out of 26) were closely related to each other and were found within the 'cerevisiae' cluster. The remaining 10 wine yeast strains branched within the 'bayanus' cluster. PCR-RFLP analysis of ribosomal spacer sequences thus appears to be a useful and appropriate method for the correct characterization of Saccharomyces yeast strains used in food processing. PMID:9542100

Montrocher, R; Verner, M C; Briolay, J; Gautier, C; Marmeisse, R

1998-01-01

57

[Genetic analysis of Y chromosome and mitochondrial DNA poly-morphism of Mulam ethnic group in Guangxi, China].  

PubMed

In order to study the molecular genetic structure of Mulam ethnic group in Guangxi, China, Y chromosome and mitochondrial DNA(mtDNA)polymorphisms were genotyped. High frequencies of the Y chromosome haplogroups O1a1-P203 and O2a1*-M95 were found in Mulam, exhibiting a pattern similar to the neighboring indigenous populations, especially the Daic populations. MtDNA lineages F1a, M*, B4a, B5a, M7b, and N9a were found in Mulam, which always present at high frequencies among the populations of East Asia. Mulam exhibits genetic characteristics of southern Chinese in both paternal and maternal lineages. Multiplex detection of the 17 Y-STR loci and mtDNA HVS-I revealed the distribu-tion of highly genetic diversity in Mulam, which would have potential application in population genetics and forensic practice. PMID:23448929

Wang, Xiao-Qing; Wang, Chuan-Chao; Deng, Qiong-Ying; Li, Hui

2013-02-01

58

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds  

PubMed Central

Nanostructures constructed from metal and semiconductor nanocrystals conjugated to, and organized by DNA are an emerging class of material with collective optical properties. We created discrete pyramids of DNA with gold nanocrystals at the tips. By taking small angle X-ray scattering (SAXS) measurments from solutions of these pyramids we confirmed that this pyramidal geometry creates structures which are more rigid in solution than linear DNA. We then took advantage of the tetrahedral symmetry to demonstrate construction of chiral nanostructures.

Mastroianni, Alexander; Claridge, Shelley; Alivisatos, A. Paul

2009-01-01

59

Pyramidal and chiral groupings of gold nanocrystals assembled using DNA scaffolds.  

PubMed

Nanostructures constructed from metal and semiconductor nanocrystals conjugated to and organized by DNA are an emerging class of materials with collective optical properties. We created discrete pyramids of DNA with gold nanocrystals at the tips. By taking small-angle X-ray scattering measurements from solutions of these pyramids, we confirmed that this pyramidal geometry creates structures which are more rigid in solution than linear DNA. We then took advantage of the tetrahedral symmetry to demonstrate construction of chiral nanostructures. PMID:19331419

Mastroianni, Alexander J; Claridge, Shelley A; Alivisatos, A Paul

2009-06-24

60

Reproducibility of mtDNA analysis between laboratories: a report of the European DNA profiling group (EDNAP)  

Microsoft Academic Search

The aim of this collaborative exercise was to determine whether uniformity of mtDNA sequencing results could be achieved among different EDNAP laboratories. Laboratories were asked to sequence mtDNAHV1 region (16024–16365) from three bloodstains, proceeding in accordance with the protocol and strategies currently used in each individual laboratory. Cycle sequencing was used by 11 laboratories and solid phase single stranded sequencing

A. Carracedo; E. D'Aloja; B. Dupuy; A. Jangblad; M. Karjalainen; C. Lambert; W. Parson; H. Pfeiffer; H. Pfitzinger; M. Sabatier; D. Syndercombe Court; C. Vide

1998-01-01

61

Differentiation and grouping of isolates of the Ganoderma lucidum complex by random amplified polymorphic DNA-PCR compared with grouping on the basis of internal transcribed spacer sequences.  

PubMed Central

Laccate polypores of the Ganoderma lucidum species complex are widespread white rot fungi of economic importance, but isolates cannot be identified by traditional taxonomic methods. Parsimony analysis of nucleotide sequences from the internal transcribed spacers (ITS) of the ribosomal gene (rDNA) distinguished six lineages in this species complex. Each ITS lineage may represent one or more putative species. While some isolates have identical ITS sequences, all of them could be clearly differentiated by genetic fingerprinting using random amplified polymorphic DNA (RAPD). To investigate the suitability of RAPD markers for taxonomic identification and grouping of isolates of the G. lucidum complex, RAPD fragments (RAPDs) were used as phenotypic characters in numerical and parsimony analyses. Results show that data from RAPDS do not distinguish the same clades as ITS data do. Groupings based on analysis of RAPD data were very sensitive to the choice of the grouping method used, and no consistent grouping of isolates could be proposed. However, analysis with RAPDs did resolve several robust terminal clades containing putatively conspecific isolates, suggesting that RAPDs might be helpful for systematics at the lower taxonomic levels that are unresolved by ITS sequence data. The limitations of RAPDs for systematics are briefly discussed. The conclusion of this study is that ITS sequences can be used to identify isolates of the G. lucidum complex, whereas RAPDs can be used to differentiate between isolates having identical ITS sequences. The practical implications of these results are briefly illustrated.

Hseu, R S; Wang, H H; Wang, H F; Moncalvo, J M

1996-01-01

62

DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar  

Microsoft Academic Search

The role of DNA barcoding as a tool to accelerate the inventory and analysis of diversity for hyperdiverse arthropods is tested using ants in Madagascar. We demonstrate how DNA barcoding helps address the failure of current inventory methods to rapidly respond to pressing biodiversity needs, specifically in the assessment of richness and turnover across landscapes with hyperdiverse taxa. In a

M. Alex Smith; Brian L. Fisher; Paul D. N. Hebert

2005-01-01

63

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds  

Microsoft Academic Search

Nanostructures constructed from metal and semiconductor nanocrystals conjugated to, and organized by DNA are an emerging class of material with collective optical properties. We created discrete pyramids of DNA with gold nanocrystals at the tips. By taking small angle X-ray scattering (SAXS) measurments from solutions of these pyramids we confirmed that this pyramidal geometry creates structures which are more rigid

Alexander J. Mastroianni; Shelley A. Claridge; A. Paul Alivisatos

2009-01-01

64

Comparison of gyrB gene sequences, 16S rRNA gene sequences and DNA DNA hybridization in the Bacillus subtilis group  

Microsoft Academic Search

The Bacillus subtilis group comprises eight closely related species that are indistinguishable from one another by 16S rRNA gene sequence analysis. Therefore, the gyrB gene, which encodes the subunit B protein of DNA gyrase, was selected as an alternative phylogenetic marker. To determine whether gyrB gene sequence analysis could be used for phylogenetic analysis and species identification of members of

Li-Ting Wang; Fwu-Ling Lee; Chun-Ju Tai; Hiroaki Kasai

2007-01-01

65

Defining the function of xeroderma pigmentosum group F protein in psoralen interstrand cross-link-mediated DNA repair and mutagenesis.  

PubMed Central

Many commonly used drugs, such as psoralen and cisplatin, can generate a very unique type of DNA damage, namely ICL (interstrand cross-link). An ICL can severely block DNA replication and transcription and cause programmed cell death. The molecular mechanism of repairing the ICL damage has not been well established. We have studied the role of XPF (xeroderma pigmentosum group F) protein in psoralen-induced ICL-mediated DNA repair and mutagenesis. The results obtained from our mutagenesis studies revealed a very similar mutation frequency in both human normal fibroblast cells and XPF cells. The mutation spectra generated in both cells, however, were very different: most of the mutations generated in the normal fibroblast cells were T167-->A transversions, whereas most of the mutations generated in the XPF cells were T167-->G transversions. When a wild-type XPF gene cDNA was stably transfected into the XPF cells, the T167-->A mutations were increased and the T167-->G mutations were decreased. We also determined the DNA repair capability of the XPF cells using both the host-cell reactivation and the in vitro DNA repair assays. The results obtained from the host-cell reactivation experiments revealed an effective reactivation of a luciferase reporter gene from the psoralen-damaged plasmid in the XPF cells. The results obtained from the in vitro DNA repair experiments demonstrated that the XPF nuclear extract is normal in introducing dual incisions during the nucleotide excision repair process. These results suggest that the XPF protein has important roles in the psoralen ICL-mediated DNA repair and mutagenesis.

Chen, Zhiwen; Xu, Xiaoxin Susan; Harrison, Jason; Wang, Gan

2004-01-01

66

Crystal structure of the trithorax group protein ASH2L reveals a forkhead-like DNA binding domain  

SciTech Connect

Absent, small or homeotic discs-like 2 (ASH2L) is a trithorax group (TrxG) protein and a regulatory subunit of the SET1 family of lysine methyltransferases. Here we report that ASH2L binds DNA using a forkhead-like helix-wing-helix (HWH) domain. In vivo, the ASH2L HWH domain is required for binding to the {beta}-globin locus control region, histone H3 Lys4 (H3K4) trimethylation and maximal expression of the {beta}-globin gene (Hbb-1), validating the functional importance of the ASH2L DNA binding domain.

Sarvan, Sabina; Avdic, Vanja; Tremblay, Véronique; Chaturvedi, Chandra-Prakash; Zhang, Pamela; Lanouette, Sylvain; Blais, Alexandre; Brunzelle, Joseph S; Brand, Marjorie; Couture, Jean-François (Ottawa Hosp.); (Ottawa); (NWU)

2012-05-02

67

Aeromonas jandaei (formerly genospecies DNA group 9 A. sobria), a new sucrose-negative species isolated from clinical specimens.  

PubMed

A large numerical taxonomy study conducted in 1988 of 165 mostly clinical Aeromonas strains from diverse geographic sources produced a cluster (S = 84%, SSM) of four sucrose-negative strains that included the DNA definition strain for DNA group 9 A. sobria (CDC 0787-80). These four strains, together with five additional strains received in 1989, were subjected to DNA-DNA hybridization (hydroxyapatite, 32P, 60 and 75 degrees C), and all eight strains were closely related to the ninth labeled DNA group 9 definition strain CDC 0787-80 (73 to 86% relatedness at 60 degrees C and 68 to 80% relatedness at 75 degrees C; percent divergence, 2.0 to 3.5). Type strains and DNA definition strains for all other established Aeromonas species were only 35 to 72% related (60 degrees C) to CDC 0787-80. We propose the name Aeromonas jandaei for this highly related group of nine strains, formerly known as DNA group 9 A. sobria. The type strain was designated ATCC 49568 (CDC 0787-80). The nine strains were examined at 36 degrees C and were found to be resistant to 0/129 (vibriostatic agent) and uniformly positive for oxidase, gas production from glucose, indole, lysine decarboxylase, arginine dihydrolase, o-nitrophenyl-beta-D-galactopyranoside, motility (25 degrees C), nitrate reduction, citrate utilization, hemolysis on sheep blood agar, and growth in Trypticase soy broth with no added NaCl. They all fermented D-glucose, D-mannitol, and mannose but did not ferment sucrose, cellobiose, L-arabinose, inositol, salicin, or D-sorbitol. They were uniformly negative for esculin and urea hydrolysis, elastase production, ornithine decarboxylation, and the string test. The antibiogram of A. jandaei resembled that of other aeromonads (resistance to ampicillin and cephalothin), but it differed from most other aeromonads because of resistance to single dilution of colistin and differed from clinical A. veronii biogroup sorbria (formerly A. sobria) by its nearly uniform resistance to cephalothin. The esculin-, sucrose-, and cellobiose-negative and colistin-resistant profile distinguished A. jandaei from other Aeromonas species. These A. jandaei strains were isolated from blood (two strains), wounds (two strains), diarrheal stools (four strains), and a prawn (one strain). The blood and wound isolates, in particular, suggest that there is a possible clinical significance for this species and justify identification of and further research on this group of motile aeromonads. PMID:2037673

Carnahan, A; Fanning, G R; Joseph, S W

1991-03-01

68

Grouping  

NSDL National Science Digital Library

This interactive Flash applet models the measurement interpretation of division. A child or teacher chooses a total number of objects and a divisor representing the size of equal groups. The applet allows the user to move the objects into equal groups and links the process to jumps on a number line. The applet can be used to introduce children to remainders and to reinforce the language and notation of division. It works well on an interactive white board or projector. A teacher's guide to this collection of applets is cataloged separately.

2006-01-01

69

The application of the AMB protective group in the solid-phase synthesis of methylphosphonate DNA analogues.  

PubMed Central

Partially methylphosphonate-modified oligodeoxynucleotides were synthesized on solid-phase by employing the easily removable 2-(acetoxymethyl)benzoyl (AMB) group as base-protecting group. Although a rapid AMB deprotection can be accomplished in methanolic potassium carbonate, the lability of the methylphosphonate linkage towards potassium carbonate/methanol excludes the use of this deprotection reagent. Thus, saturated ammonia solution in methanol was investigated as an alternative reagent for AMB removal. It is demonstrated that the combination of the AMB protective group and ammonia/methanol as deprotection reagent significantly improves the synthesis of methylphosphonate-modified DNA fragments. A mild overnight treatment at room temperature is sufficient for complete removal of the AMB group, whereas deprotection of conventionally protected oligonucleotides requires much longer exposure to basic conditions at elevated temperatures.

Kuijpers, W H; Kuyl-Yeheskiely, E; van Boom, J H; van Boeckel, C A

1993-01-01

70

Previously unrecognized vaccine candidates against group B meningococcus identified by DNA microarrays  

Microsoft Academic Search

We have used DNA microarrays to follow Neisseria meningitidis serogroup B (MenB) gene regulation during interaction with human epithelial cells. Host-cell contact induced changes in the expression of 347 genes, more than 30% of which encode proteins with unknown function. The upregulated genes included transporters of iron, chloride, amino acids, and sulfate, many virulence factors, and the entire pathway of

Renata Grifantini; Erika Bartolini; Alessandro Muzzi; Monia Draghi; Elisabetta Frigimelica; Joel Berger; Giulio Ratti; Roberto Petracca; Giuliano Galli; Mauro Agnusdei; Marzia Monica Giuliani; Laura Santini; Brunella Brunelli; Hervé Tettelin; Rino Rappuoli; Filippo Randazzo; Guido Grandi

2002-01-01

71

Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.  

PubMed

Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU) ribosomal DNA (rDNA) sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF) for encoding the homing endonuclease (HE), whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron) and genotype IV (Bdo.S1199-B) were each found in only one strain, whereas genotype I (Bdo.S1199-A) and genotype II (Bdo.S943 and Bdo.S1506) occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea. PMID:23844098

Xu, Chao; Wang, Chunsheng; Sun, Xinyao; Zhang, Rong; Gleason, Mark L; Eiji, Tanaka; Sun, Guangyu

2013-01-01

72

DNA barcoding reveals both known and novel taxa in the Albitarsis Group (Anopheles: Nyssorhynchus) of Neotropical malaria vectors  

PubMed Central

Background Mosquitoes belonging to the Albitarsis Group (Anopheles: Nyssorhynchus) are of importance as malaria vectors across the Neotropics. The Group currently comprises six known species, and recent studies have indicated further hidden biodiversity within the Group. DNA barcoding has been proposed as a highly useful tool for species recognition, although its discriminatory utility has not been verified in closely related taxa across a wide geographic distribution. Methods DNA barcodes (658 bp of the mtDNA Cytochrome c Oxidase - COI) were generated for 565 An. albitarsis s.l. collected in Argentina, Brazil, Colombia, Paraguay, Trinidad and Venezuela over the past twenty years, including specimens from type series and type localities. Here we test the utility of currently advocated barcoding methodologies, including the Kimura-two-parameter distance model (K2P) and Neighbor-joining analysis (NJ), for determining species delineation within mosquitoes of the Neotropical Albitarsis Group of malaria vectors (Anopheles: Nyssorhynchus), and compare results with Bayesian analysis. Results Species delineation through barcoding analysis and Bayesian phylogenetic analysis, fully concur. Analysis of 565 sequences (302 unique haplotypes) resolved nine NJ tree clusters, with less than 2% intra-node variation. Mean intra-specific variation (K2P) was 0.009 (range 0.002 - 0.014), whereas mean inter-specific divergence were several-fold higher at 0.041 (0.020 - 0.056), supporting the reported "barcoding gap". These results show full support for separate species status of the six known species in the Albitarsis Group (An. albitarsis s.s., An. albitarsis F, An. deaneorum, An. janconnae, An. marajoara and An. oryzalimnetes), and also support species level status for two previously detected lineages - An. albitarsis G &An. albitarsis I (designated herein). In addition, we highlight the presence of a unique mitochondrial lineage close to An. deaneorum and An. marajoara (An. albitarsis H) from Rondônia and Mato Grosso in southwestern Brazil. Further integrated studies are required to confirm the status of this lineage. Conclusions DNA barcoding provides a reliable means of identifying both known and undiscovered biodiversity within the closely related taxa of the Albitarsis Group. We advocate its usage in future studies to elucidate the vector competence and respective distributions of all eight species in the Albitarsis Group and the novel mitochondrial lineage (An. albitarsis H) recovered in this study.

2012-01-01

73

Comprehensive phylogenetic analysis of bacterial group II intron-encoded ORFs lacking the DNA endonuclease domain reveals new varieties.  

PubMed

Group II introns are self-splicing RNAs that act as mobile retroelements in the organelles of plants, fungi and protists. They are also widely distributed in bacteria, and are generally assumed to be the ancestors of nuclear spliceosomal introns. Most bacterial group II introns have a multifunctional intron-encoded protein (IEP) ORF within the ribozyme domain IV (DIV). This ORF encodes an N-terminal reverse transcriptase (RT) domain, followed by a putative RNA-binding domain with RNA splicing or maturase activity and, in some cases, a C-terminal DNA-binding (D) region followed by a DNA endonuclease (En) domain. In this study, we focused on bacterial group II intron ORF phylogenetic classes containing only reverse transcriptase/maturase open reading frames, with no recognizable D/En region (classes A, C, D, E, F and unclassified introns). On the basis of phylogenetic analyses of the maturase domain and its C-terminal extension, which appears to be a signature characteristic of ORF phylogenetic class, with support from the phylogeny inferred from the RT domain, we have revised the proposed new class F, defining new intron ORF varieties. Our results increase knowledge of the lineage of group II introns encoding proteins lacking the En-domain. PMID:23355907

Toro, Nicolás; Martínez-Abarca, Francisco

2013-01-01

74

Effect of the diamine nonleaving group in platinum-acridinylthiourea conjugates on DNA damage and cytotoxicity.  

PubMed

The following complexes of type [PtCl(R)(ACRAMTU)](NO3)2 (ACRAMTU = 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea)), derived from prototype 1 (with R = ethane-1,2-diamine), were synthesized: 2 (with R = (1R,2R)-1,2-diaminocyclohexane), 3 (with R = propane-1,3-diamine), 4 (with R = N1,N1,N2,N2-tetramethylethane-1,2-diamine), and 5 (with R = 2,2'-bipyridine). The DNA sequence specificity of the conjugates and their antiproliferative potential in HL-60 and H460 cells were investigated. Conjugate 3 showed the strongest non-cisplatin-type DNA damage in polymerase stop assays and superior cell kill efficacy in H460 lung cancer (IC50 = 70 nM). PMID:17408248

Guddneppanavar, Rajsekhar; Choudhury, Jayati Roy; Kheradi, Alexander R; Steen, Bartlett D; Saluta, Gilda; Kucera, Gregory L; Day, Cynthia S; Bierbach, Ulrich

2007-05-01

75

Different instability of the CAG microsatellite in two haplotype groups of human mitochondrial DNA polymerase gamma  

Microsoft Academic Search

Two single nucleotide polymorphisms of the mitochondrial DNA polymerase gamma gene (POLG1), rs2238296 (T\\/C) and rs758130 (T\\/C), were analyzed in individuals of different ethnicity (Russians and Buryats) with known\\u000a genotypes of the CAG microsatellite located in the same gene. It was shown that microsatellite alleles with repeat numbers\\u000a other than 10 were significantly more frequent within the TT haplotype. A

B. A. Malyarchuk; M. A. Perkova; M. V. Derenko

2009-01-01

76

Complete mtDNA genomes of Filipino ethnolinguistic groups: a melting pot of recent and ancient lineages in the Asia-Pacific region.  

PubMed

The Philippines is a strategic point in the Asia-Pacific region for the study of human diversity, history and origins, as it is a cross-road for human migrations and consequently exhibits enormous ethnolinguistic diversity. Following on a previous in-depth study of Y-chromosome variation, here we provide new insights into the maternal genetic history of Filipino ethnolinguistic groups by surveying complete mitochondrial DNA (mtDNA) genomes from a total of 14 groups (11 groups in this study and 3 groups previously published) including previously published mtDNA hypervariable segment (HVS) data from Filipino regional center groups. Comparison of HVS data indicate genetic differences between ethnolinguistic and regional center groups. The complete mtDNA genomes of 14 ethnolinguistic groups reveal genetic aspects consistent with the Y-chromosome, namely: diversity and heterogeneity of groups, no support for a simple dichotomy between Negrito and non-Negrito groups, and different genetic affinities with Asia-Pacific groups that are both ancient and recent. Although some mtDNA haplogroups can be associated with the Austronesian expansion, there are others that associate with South Asia, Near Oceania and Australia that are consistent with a southern migration route for ethnolinguistic group ancestors into the Asia-Pacific, with a timeline that overlaps with the initial colonization of the Asia-Pacific region, the initial colonization of the Philippines and a possible separate post-colonization migration into the Philippine archipelago. PMID:23756438

Delfin, Frederick; Min-Shan Ko, Albert; Li, Mingkun; Gunnarsdóttir, Ellen D; Tabbada, Kristina A; Salvador, Jazelyn M; Calacal, Gayvelline C; Sagum, Minerva S; Datar, Francisco A; Padilla, Sabino G; De Ungria, Maria Corazon A; Stoneking, Mark

2014-02-01

77

Use of SSU rDNA group-I intron to distinguish Monilinia fructicola from M. laxa and M. fructigena.  

PubMed

Monilinia fructicola, M. laxa and M. fructigena are the causal agents of brown rot of pome and stone fruits. M. fructicola is not present in Europe and is classed as a quarantine pathogen in EU countries. A 418-bp group-I intron has been located in the small subunit (SSU) rDNA gene of M. fructicola which is absent from M. laxa and M. fructigena. PCR primers specific to the 3'-region of the intron together with the SSU rDNA primer NS5 were able to amplify a 444-bp product from M. fructicola and fruit tissue infected with M. fructicola but not from the other two species. This allows for the rapid and sensitive detection of this pathogen in planta. PMID:9435113

Fulton, C E; Brown, A E

1997-12-15

78

Divergent Histories of rDNA Group I Introns in the Lichen Family Physciaceae  

Microsoft Academic Search

The wide but sporadic distribution of group I introns in protists, plants, and fungi, as well as in eubacteria, likely resulted from extensive lateral transfer followed by differential loss. The extent of horizontal transfer of group I introns can potentially be determined by examining closely related species or genera. We used a phylogenetic approach with a large data set (including

Dawn Simon; Jessica Moline; Gert Helms; Thomas Friedl; Debashish Bhattacharya

2005-01-01

79

DNA duplexes with reactive dialdehyde groups as novel reagents for cross-linking to restriction- modification enzymes.  

PubMed Central

To create new, effective reagents for affinity modification of restriction-modification (R-M) enzymes, a regioselective method for reactive dialdehyde group incorporation into oligonucleotides, based on insertion of a 1-beta-D-galactopyranosylthymine residue, has been developed. We synthesized DNA duplex analogs of the substrates of the Eco RII and Mva I R-M enzymes that contained a galactose or periodate-oxidized galactose residue as single substituents either in the center of the Eco RII (Mva I) recognition site or in the flanking nucleotide sequence. The dependence of binding, cleavage and methylation of these substrate analogs on the modified sugar location in the duplex was determined. Cross-linking of the reagents to the enzymes under different conditions was examined. M. Eco RII covalent attachment to periodate-oxidized substrate analogs proceeded in a specific way and to a large extent depended on the location of the reactive dialdehyde group in the substrate. The yield of covalent attachment to a DNA duplex with a dialdehyde group in the flanking sequence with Eco RII or Mva I methylases was 9-20% and did not exceed 4% for R. Eco RII.

Brevnov, M G; Gritsenko, O M; Mikhailov, S N; Efimtseva, E V; Ermolinsky, B S; Van Aerschot, A; Herdewijn, P; Repyk, A V; Gromova, E S

1997-01-01

80

Genome-wide DNA polymorphisms in seven rice cultivars of temperate and tropical japonica groups.  

PubMed

Elucidation of the rice genome is expected to broaden our understanding of genes related to the agronomic characteristics and the genetic relationship among cultivars. In this study, we conducted whole-genome sequencings of 6 cultivars, including 5 temperate japonica cultivars and 1 tropical japonica cultivar (Moroberekan), by using next-generation sequencing (NGS) with Nipponbare genome as a reference. The temperate japonica cultivars contained 2 sake brewing (Yamadanishiki and Gohyakumangoku), 1 landrace (Kameji), and 2 modern cultivars (Koshihikari and Norin 8). Almost >83% of the whole genome sequences of the Nipponbare genome could be covered by sequenced short-reads of each cultivar, including Omachi, which has previously been reported to be a temperate japonica cultivar. Numerous single nucleotide polymorphisms (SNPs), insertions, and deletions were detected among the various cultivars and the Nipponbare genomes. Comparison of SNPs detected in each cultivar suggested that Moroberekan had 5-fold more SNPs than the temperate japonica cultivars. Success of the 2 approaches to improve the efficacy of sequence data by using NGS revealed that sequencing depth was directly related to sequencing coverage of coding DNA sequences: in excess of 30× genome sequencing was required to cover approximately 80% of the genes in the rice genome. Further, the contigs prepared using the assembly of unmapped reads could increase the value of NGS short-reads and, consequently, cover previously unavailable sequences. These approaches facilitated the identification of new genes in coding DNA sequences and the increase of mapping efficiency in different regions. The DNA polymorphism information between the 7 cultivars and Nipponbare are available at NGRC_Rices_Build1.0 (http://www.nodai-genome.org/oryza_sativa_en.html). PMID:24466017

Arai-Kichise, Yuko; Shiwa, Yuh; Ebana, Kaworu; Shibata-Hatta, Mari; Yoshikawa, Hirofumi; Yano, Masahiro; Wakasa, Kyo

2014-01-01

81

Genome-Wide DNA Polymorphisms in Seven Rice Cultivars of Temperate and Tropical Japonica Groups  

PubMed Central

Elucidation of the rice genome is expected to broaden our understanding of genes related to the agronomic characteristics and the genetic relationship among cultivars. In this study, we conducted whole-genome sequencings of 6 cultivars, including 5 temperate japonica cultivars and 1 tropical japonica cultivar (Moroberekan), by using next-generation sequencing (NGS) with Nipponbare genome as a reference. The temperate japonica cultivars contained 2 sake brewing (Yamadanishiki and Gohyakumangoku), 1 landrace (Kameji), and 2 modern cultivars (Koshihikari and Norin 8). Almost >83% of the whole genome sequences of the Nipponbare genome could be covered by sequenced short-reads of each cultivar, including Omachi, which has previously been reported to be a temperate japonica cultivar. Numerous single nucleotide polymorphisms (SNPs), insertions, and deletions were detected among the various cultivars and the Nipponbare genomes. Comparison of SNPs detected in each cultivar suggested that Moroberekan had 5-fold more SNPs than the temperate japonica cultivars. Success of the 2 approaches to improve the efficacy of sequence data by using NGS revealed that sequencing depth was directly related to sequencing coverage of coding DNA sequences: in excess of 30× genome sequencing was required to cover approximately 80% of the genes in the rice genome. Further, the contigs prepared using the assembly of unmapped reads could increase the value of NGS short-reads and, consequently, cover previously unavailable sequences. These approaches facilitated the identification of new genes in coding DNA sequences and the increase of mapping efficiency in different regions. The DNA polymorphism information between the 7 cultivars and Nipponbare are available at NGRC_Rices_Build1.0 (http://www.nodai-genome.org/oryza_sativa_en.html).

Arai-Kichise, Yuko; Shiwa, Yuh; Ebana, Kaworu; Shibata-Hatta, Mari; Yoshikawa, Hirofumi; Yano, Masahiro; Wakasa, Kyo

2014-01-01

82

The Kidd (JK) blood group locus assigned to chromosome 18 by close linkage to a DNA-RFLP  

Microsoft Academic Search

Summary  The close linkage between the PstI-restriction fragment length polymorphism (RFLP) disclosed by the L2.7 genomic DNA probe\\u000a and the Kidd blood group locus is described. The maximum lod score is+8.53 at recombination fraction \\u000a $$\\\\hat \\\\theta = 0.03$$\\u000a . The upper probability limit of the recombination fraction is ? =1 0.11. The L2.7 probe, previously assigned provisionally to chromosome 17, is

G. A. Geitvik; B. Høyheim; T. Gedde-Dahl; K. H. Grzeschik; R. Lothe; H. Tomter; B. Olaisen

1987-01-01

83

Synthesis, crystal structure, DNA binding, and oxidative cleavage activity of copper(II)-bipyridyl complexes containing tetraalkylammonium groups  

Microsoft Academic Search

Two copper(II) complexes of disubstituted 2,2?-bipyridine (bpy = 2, 2?-bipyridine) with tetraalkylammonium groups, [Cu(L)2Br](ClO4)5·2H2O (1) and [Cu(L)2Br](ClO4)5·H2O (2) (L = [4, 4?-(Et3NCH2)2-bpy], L = [4, 4?-((n-Bu)3NCH2)2-bpy]), have been synthesized and characterized. X-ray crystallographic study of 1 indicates that Cu(II) is a distorted trigonal bipyramidal or square pyramid. DNA binding of both complexes was studied by UV spectroscopic titration. In the

Ji-Hui Li; Jin-Tao Wang; Li-Yi Zhang; Zhong-Ning Chen; Zong-Wan Mao; Liang-Nian Ji

2009-01-01

84

Geographic grouping of Cryptococcus neoformans var. gattii by random amplified polymorphic DNA fingerprint patterns and ITS sequence divergence.  

PubMed

Eleven reference strains of Cryptococcus neoformans var. gattii were analyzed by random amplified polymorphic DNA (RAPD) patterns using three oligo primers. Three major RAPD pattern profiles (profiles I, II and III) were identified with A-1 oligo primer. Each profile was found to relate to a geographic region. Since the strains which belong to profiles I and II were mainly the isolates from America, and profile III from Asia with A-1 primer, these three profiles were assigned to the geographic grouping of America-1, America-2 and Asia, respectively. Analysis of rDNA sequences coding an internal transcribed spacer (ITS) region of C. neformans var. gattii revealed that the fungus with each RAPD profile has characteristic base sequences at the four positions (10 and 15 positions in ITS1 and 8 and 56 positions at ITS2) of the ITS regions. On the basis of the combinations of the four bases specific for the ITS regions, four ITS types, AAGG (America-1), AAAC (America-2), GGGC (Asia-1) and AGGC (Asia-2) were identified: the geographic group of Asia was further classified into two subgroups of Asia-1 and Asia-2 based on the ITS typing. Clinical isolates from Thailand (6 strains) and Brazil (7 strains) were found to belong to the geographic group of America-1 nd America-2, respectively. Five reference strains of C. neoformans var. gattii from the CBS culture collection were classified into two America-2, one Asia-1 and two Asia-2 groups. This ITS region analysis allowed us to distinguish all isolates of C. neoformans var. gattii into four geographic groups based on the ITS base sequence, and further molecular epidemiological and ecological research on this fungus is recommended. PMID:10934581

Imai, T; Watanabe, K; Tamura, M; Mikami, Y; Tanaka, R; Nishimura, K; Miyaji, M; Poonwan, N; Branchini, M L

2000-01-01

85

Fanconi anemia group J helicase and MRE11 nuclease interact to facilitate the DNA damage response.  

PubMed

FANCJ mutations are linked to Fanconi anemia (FA) and increase breast cancer risk. FANCJ encodes a DNA helicase implicated in homologous recombination (HR) repair of double-strand breaks (DSBs) and interstrand cross-links (ICLs), but its mechanism of action is not well understood. Here we show with live-cell imaging that FANCJ recruitment to laser-induced DSBs but not psoralen-induced ICLs is dependent on nuclease-active MRE11. FANCJ interacts directly with MRE11 and inhibits its exonuclease activity in a specific manner, suggesting that FANCJ regulates the MRE11 nuclease to facilitate DSB processing and appropriate end resection. Cells deficient in FANCJ and MRE11 show increased ionizing radiation (IR) resistance, reduced numbers of ?H2AX and RAD51 foci, and elevated numbers of DNA-dependent protein kinase catalytic subunit foci, suggesting that HR is compromised and the nonhomologous end-joining (NHEJ) pathway is elicited to help cells cope with IR-induced strand breaks. Interplay between FANCJ and MRE11 ensures a normal response to IR-induced DSBs, whereas FANCJ involvement in ICL repair is regulated by MLH1 and the FA pathway. Our findings are discussed in light of the current model for HR repair. PMID:23530059

Suhasini, Avvaru N; Sommers, Joshua A; Muniandy, Parameswary A; Coulombe, Yan; Cantor, Sharon B; Masson, Jean-Yves; Seidman, Michael M; Brosh, Robert M

2013-06-01

86

Rapid Plant Identification Using Species- and Group-Specific Primers Targeting Chloroplast DNA  

PubMed Central

Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

2012-01-01

87

Fanconi Anemia Group J Helicase and MRE11 Nuclease Interact To Facilitate the DNA Damage Response  

PubMed Central

FANCJ mutations are linked to Fanconi anemia (FA) and increase breast cancer risk. FANCJ encodes a DNA helicase implicated in homologous recombination (HR) repair of double-strand breaks (DSBs) and interstrand cross-links (ICLs), but its mechanism of action is not well understood. Here we show with live-cell imaging that FANCJ recruitment to laser-induced DSBs but not psoralen-induced ICLs is dependent on nuclease-active MRE11. FANCJ interacts directly with MRE11 and inhibits its exonuclease activity in a specific manner, suggesting that FANCJ regulates the MRE11 nuclease to facilitate DSB processing and appropriate end resection. Cells deficient in FANCJ and MRE11 show increased ionizing radiation (IR) resistance, reduced numbers of ?H2AX and RAD51 foci, and elevated numbers of DNA-dependent protein kinase catalytic subunit foci, suggesting that HR is compromised and the nonhomologous end-joining (NHEJ) pathway is elicited to help cells cope with IR-induced strand breaks. Interplay between FANCJ and MRE11 ensures a normal response to IR-induced DSBs, whereas FANCJ involvement in ICL repair is regulated by MLH1 and the FA pathway. Our findings are discussed in light of the current model for HR repair.

Suhasini, Avvaru N.; Sommers, Joshua A.; Muniandy, Parameswary A.; Coulombe, Yan; Cantor, Sharon B.; Masson, Jean-Yves; Seidman, Michael M.

2013-01-01

88

Universal fungus-specific primer systems and group-specific hybridization oligonucleotides for 18S rDNA.  

PubMed

We designed two primer systems that amplify a fragment of the gene coding for the small ribosomal subunit (18S rRNA). A broadly reactive, yet fungus-specific, primer cocktail comprises two previously published primers, TR1 and TR2, which specifically amplify dermatophytes, and two newly designed primers, CA1 and AF2, which specifically amplify Candida and Aspergillus respectively. This primer cocktail amplifies a DNA fragment of approximately 578 basepairs (bp) in length (from position 838 to 1415), which contains variable, possibly species-specific regions (V5, partly V7). Another newly designed primer, UF1 (universal fungal primer 1), along with the eukaryotic primer S3 amplifies a 926-bp fragment (from position 263 to 1188) that includes the variable regions V3, V4 and V5. Both primer systems amplified DNA from Saccharomyces cerevisiae, Candida albicans, Cryptococcus neoformans, Aspergillus fumigatus, Penicillium marneffei, Fusarium oxysporum and Trichophyton mentagrophytes, but not the DNA from Prototheca zopfii, Escherichia coli or humans. The previously published oligonucleotides TR and HC, which are specific for dermatophytes and Histoplasma respectively, and the newly designed group-specific oligonucleotides, CA and AF, hybridized with T. mentagrophytes, Histoplasma capsulatum, C. albicans and A. fumigatus respectively, but not with the other six fungi or with the three controls. PMID:8786753

Kappe, R; Fauser, C; Okeke, C N; Maiwald, M

1996-01-01

89

A damage-recognition protein which binds to DNA containing interstrand cross-links is absent or defective in Fanconi anemia, complementation group A, cells.  

PubMed Central

A DNA binding protein with specificity for DNA containing interstrand cross-links induced by 4,5',8-trimethylpsoralen (TMP) plus long wavelength ultraviolet (UVA) light has been identified in normal human chromatin. Protein binding to DNA was determined using a gel mobility shift assay and an oligonucleotide containing a hot spot for formation of psoralen interstrand cross-links. Specificity of the damage-recognition protein for cross-links was demonstrated both by a positive correlation between level of cross-link formation in DNA and extent of protein binding and by effective competition by treated but not undamaged DNA for the binding protein. Chromatin protein extracts from cells from individuals with the genetic disorder, Fanconi anemia, complementation group A (FA-A), which have decreased ability to repair damage produced by TMP plus UVA light, failed to show any protein binding to TMP plus UVA treated DNA. We have previously shown that these chromatin protein extracts contain a DNA endonuclease complex, pI 4.6, which specifically recognizes and incises DNA containing interstrand cross-links and which in FA-A cells is defective in its ability to incise this damaged DNA (Lambert et al. (1992) Mutation Res., 273, 57-71). Together, these findings suggest that the DNA binding protein identified is involved in recognition and repair of DNA interstrand cross-links. Images

Hang, B; Yeung, A T; Lambert, M W

1993-01-01

90

The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and high-mobility-group (HMG) box 1 to bend, wrap, and positively supercoil enhancer DNA.  

PubMed Central

Upstream binding factor (UBF) is an important transactivator of RNA polymerase I and is a member of a family of proteins that contain nucleic acid binding domains named high-mobility-group (HMG) boxes because of their similarity to HMG chromosomal proteins. UBF is a highly sequence-tolerant DNA-binding protein for which no binding consensus sequence has been identified. Therefore, it has been suggested that UBF may recognize preformed structural features of DNA, a hypothesis supported by UBF's ability to bind synthetic DNA cruciforms, four-way junctions, and even tRNA. We show here that full-length UBF can also bend linear DNA to mediate circularization of probes as small as 102 bp in the presence of DNA ligase. Longer probes in the presence of UBF become positively supercoiled when ligated, suggesting that UBF wraps the DNA in a right-handed direction, opposite the direction of DNA wrapping around a nucleosome. The dimerization domain and HMG box 1 are necessary and sufficient to circularize short probes and supercoil longer probes in the presence of DNA ligase. UBF's sequence tolerance coupled with its ability to bend and wrap DNA makes UBF an unusual eukaryotic transcription factor. However, UBF's ability to bend DNA might explain how upstream and downstream rRNA gene promoter domains interact. UBF-induced DNA wrapping could also be a mechanism by which UBF counteracts histone-mediated gene repression. Images

Putnam, C D; Copenhaver, G P; Denton, M L; Pikaard, C S

1994-01-01

91

Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.  

PubMed

Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin. PMID:20507265

Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

2010-12-01

92

DNA Sequence Variation at the Period Locus Reveals the History of Species and Speciation Events in the Drosophila Virilis Group  

PubMed Central

The virilis phylad of the Drosophila virilis group consists of five closely related taxa: D. virilis, D. lummei, D. novamexicana, D. americana americana and D. americana texana. DNA sequences from a 2.1-kb pair portion of the period locus were generated in four to eight individuals from each of the five taxa. We found evidence of recombination and high levels of variation within species. We found no evidence of recent natural selection. Surprisingly there was no evidence of divergence between D. a. americana and D. a. texana, and they collectively appear to have had a large historical effective population size. The ranges of these two taxa overlap in a large hybrid zone that has been delineated in the eastern U.S. on the basis of the geographic pattern of a chromosomal fusion. Also surprisingly, D. novamexicana appears to consist of two distinct groups each with low population size and no gene flow between them.

Hilton, H.; Hey, J.

1996-01-01

93

Examination of species boundaries in the Acropora cervicornis group (Scleractinia, cnidaria) using nuclear DNA sequence analyses.  

PubMed

Although Acropora is the most species-rich genus of the scleractinian (stony) corals, only three species occur in the Caribbean: A. cervicornis, A. palmata and A. prolifera. Based on overall coral morphology, abundance and distribution patterns, it has been suggested that A. prolifera may be a hybrid between A. cervicornis and A. palmata. The species boundaries among these three morphospecies were examined using DNA sequence analyses of the nuclear Pax-C 46/47 intron and the ribosomal DNA Internal Transcribed Spacer (ITS1 and ITS2) and 5.8S regions. Moderate levels of sequence variability were observed in the ITS and 5.8S sequences (up to 5.2% overall sequence difference), but variability within species was as large as between species and all three species carried similar sequences. Since this is unlikely to represent a shared ancestral polymorphism, the data suggest that introgressive hybridization occurs among the three species. For the Pax-C intron, A. cervicornis and A. palmata had very distinct allele frequencies and A. cervicornis carried a unique allele at a frequency of 0.769 (although sequence differences between alleles were small). All A. prolifera colonies examined were heterozygous for the Pax-C intron, whereas heterozygosity was only 0.286 and 0.333 for A. cervicornis and A. palmata, respectively. These data support the hypothesis that A. prolifera is the product of hybridization between two species that have a different allelic composition for the Pax-C intron, i.e. A. cervicornis and A. palmata. We therefore suggest that A. prolifera is a hybrid between A. cervicornis and A. palmata, which backcrosses with the parental species at low frequency. PMID:10972775

Oppen, M J; Willis, B L; Vugt, H W; Miller, D J

2000-09-01

94

DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA.  

PubMed

Rhizoctonia blight is a common and serious disease of many turfgrass species. The most widespread causal agent, Thanatephorus cucumeris (anamorph: R. solani), consists of several genetically different subpopulations. In addition, Waitea circinata varieties zeae, oryzae and circinata (anamorph: Rhizoctonia spp.) also can cause the disease. Accurate identification of the causal pathogen is important for effective management of the disease. It is challenging to distinguish the specific causal pathogen based on disease symptoms or macroscopic and microscopic morphology. Traditional methods such as anastomosis reactions with tester isolates are time consuming and sometimes difficult to interpret. In the present study universally primed PCR (UP-PCR) fingerprinting was used to assess genetic diversity of Rhizoctonia spp. infecting turfgrasses. Eighty-four Rhizoctonia isolates were sampled from diseased turfgrass leaves from seven distinct geographic areas in Virginia and Maryland. Rhizoctonia isolates were characterized by ribosomal DNA internal transcribed spacer (rDNA-ITS) region and UP-PCR. The isolates formed seven clusters based on ITS sequences analysis and unweighted pair group method with arithmetic mean (UPGMA) clustering of UP-PCR markers, which corresponded well with anastomosis groups (AGs) of the isolates. Isolates of R. solani AG 1-IB (n = 18), AG 2-2IIIB (n = 30) and AG 5 (n = 1) clustered separately. Waitea circinata var. zeae (n = 9) and var. circinata (n = 4) grouped separately. A cluster of six isolates of Waitea (UWC) did not fall into any known Waitea variety. The binucleate Rhizoctonia-like fungi (BNR) (n = 16) clustered into two groups. Rhizoctonia solani AG 2-2IIIB was the most dominant pathogen in this study, followed by AG 1-IB. There was no relationship between the geographic origin of the isolates and clustering of isolates based on the genetic associations. To our knowledge this is the first time UP-PCR was used to characterize Rhizoctonia, Waitea and Ceratobasidium isolates to their infra-species level. PMID:23709576

Amaradasa, B S; Horvath, B J; Lakshman, D K; Warnke, S E

2013-01-01

95

Patterns of group I intron presence in nuclear SSU rDNA of the Lichen family Parmeliaceae.  

PubMed

Group I introns are commonly reported within nuclear SSU ribosomal DNA of eukaryotic micro-organisms, especially in lichen-forming fungi. We have studied the primary and secondary structure of 70 new nuclear SSU rDNA group I introns of Parmeliaceae (Ascomycota: Lecanorales) and compared them with those available in databases, covering more than 60 species. The analyzed samples of Parmeliaceae fell into two groups, one having an intron at the 1506 site and another lacking this one but having another at the 1516 or 1521 position. Introns at the 1521 position seem to be transposed from 1516 sites. Introns at the 1516 position were similar in structure to ones previously reported at this site and known from other lecanoralean fungi, while those at the 1506 position showed structural differences and no similar introns are known from related fungi. The study of the distribution of group I introns within a large monophyletic ensemble of fungi has revealed an unexpected correlation between intron types and ecological and geographical parameters. The introns at the 1516 position occurred in mainly arctic, boreal, and temperate lichens, while those at position 1506 were present in mainly tropical and subtropical to oceanic mild-temperate taxa. Further, the 1516 introns occurred in genera with few distributed species that could represent older taxa, while the 1506 ones were mainly in species-rich genera that could be of recent speciation, as many species have wide distribution areas. The transition between two different environments has been accompanied by a change in introns gained and lost. PMID:17200806

Gutiérrez, Gabriel; Blanco, Oscar; Divakar, Pradeep K; Lumbsch, H Thorsten; Crespo, Ana

2007-02-01

96

Sister group relationship of turtles to the bird-crocodilian clade revealed by nuclear DNA-coded proteins.  

PubMed

The phylogenetic position of turtles is a currently controversial issue. Recent molecular studies rejected a traditional view that turtles are basal living reptiles (Hedges, S. B., and L. L. Poling. 1999. A molecular phylogeny. Science 83:998-1001; Kumazawa, Y., and M. Nishida. 1999. Complete mitochondrial DNA sequences of the green turtle and blue-tailed mole skink, statistical evidence for archosaurian affinity of turtles. Mol. Biol. Evol. 16:784-792). Instead, these studies grouped turtles with birds and crocodiles. The relationship among turtles, birds, and crocodiles remained unclear to date. To resolve this issue, we have cloned and sequenced two nuclear genes encoding the catalytic subunit of DNA polymerase alpha and glycinamide ribonucleotide synthetase-aminoimidazole ribonucleotide synthetase-glycinamide ribonucleotide formyltransferase from amniotes and an amphibian. The amino acid sequences of these proteins were subjected to a phylogenetic analysis based on the maximum likelihood method. The resulting tree showed that turtles are the sister group to a monophyletic cluster of archosaurs (birds and crocodiles). All other possible tree topologies were significantly rejected. PMID:15625185

Iwabe, Naoyuki; Hara, Yuichiro; Kumazawa, Yoshinori; Shibamoto, Kaori; Saito, Yumi; Miyata, Takashi; Katoh, Kazutaka

2005-04-01

97

Probabilistic nonadaptive group testing in the presence of errors and DNA library screening  

Microsoft Academic Search

We use the subset containment relation to construct a probabilistic nonadaptive group testing design and decoding algorithm that, in the presence of testing errors, identifies many positives in a population. We give a lower bound for the expected portion of positives identified as a function of an upper bound on the number of testing errors.

Anthony J. Macula

1999-01-01

98

Probabilistic Nonadaptive and Two-Stage Group Testing with Relatively Small Pools and DNA Library Screening  

Microsoft Academic Search

We use a simple, but nonstandard, incidence relation to construct probabilistic nonadaptive group testing algorithms that identify many positives in a population with a zero probability of yielding a false positive. More importantly, we give two-stage modifications of our nonadaptive algorithms that dramatically reduce the expected number of sufficient pools. For our algorithms, we give a lower bound on the

Anthony J. Macula

1998-01-01

99

DNA methylation of polycomb group target genes in cores taken from breast cancer centre and periphery  

Microsoft Academic Search

We previously demonstrated that methylation of neugogenic differentiation 1 (NEUROD1) gene, a polycomb group target (PCGT) gene is a predictor of response to neoadjuvant chemotherapy in breast cancer. Here,\\u000a we address the question whether NEUROD1 methylation provides clinical information independent from its expression level, and whether PCGT methylation is homogeneous\\u000a in breast cancer. We examined: (1) NEUROD1 methylation and mRNA

Evangelia-Ourania Fourkala; Cornelia Hauser-Kronberger; Sophia Apostolidou; Matthew Burnell; Allison Jones; Johannes Grall; Roland Reitsamer; Heidi Fiegl; Ian Jacobs; Usha Menon; Martin Widschwendter

2010-01-01

100

Functions of the high mobility group protein, Abf2p, in mitochondrial DNA segregation, recombination and copy number in Saccharomyces cerevisiae.  

PubMed Central

Previous studies have established that the mitochondrial high mobility group (HMG) protein, Abf2p, of Saccharomyces cerevisiae influences the stability of wild-type (rho+) mitochondrial DNA (mtDNA) and plays an important role in mtDNA organization. Here we report new functions for Abf2p in mtDNA transactions. We find that in homozygous deltaabf2 crosses, the pattern of sorting of mtDNA and mitochondrial matrix protein is altered, and mtDNA recombination is suppressed relative to homozygous ABF2 crosses. Although Abf2p is known to be required for the maintenance of mtDNA in rho+ cells growing on rich dextrose medium, we find that it is not required for the maintenance of mtDNA in p cells grown on the same medium. The content of both rho+ and rho- mtDNAs is increased in cells by 50-150% by moderate (two- to threefold) increases in the ABF2 copy number, suggesting that Abf2p plays a role in mtDNA copy control. Overproduction of Abf2p by > or = 10-fold from an ABF2 gene placed under control of the GAL1 promoter, however, leads to a rapid loss of rho+ mtDNA and a quantitative conversion of rho+ cells to petites within two to four generations after a shift of the culture from glucose to galactose medium. Overexpression of Abf2p in rho- cells also leads to a loss of mtDNA, but at a slower rate than was observed for rho+ cells. The mtDNA instability phenotype is related to the DNA-binding properties of Abf2p because a mutant Abf2p that contains mutations in residues of both HMG box domains known to affect DNA binding in vitro, and that binds poorly to mtDNA in vivo, complements deltaabf2 cells only weakly and greatly lessens the effect of overproduction on mtDNA instability. In vivo binding was assessed by colocalization to mtDNA of fusions between mutant or wild-type Abf2p and green fluorescent protein.These findings are discussed in the context of a model relating mtDNA copy number control and stability to mtDNA recombination.

Zelenaya-Troitskaya, O; Newman, S M; Okamoto, K; Perlman, P S; Butow, R A

1998-01-01

101

Structural insight into the ligand-receptor interaction between glycyrrhetinic acid (GA) and the high-mobility group protein B1 (HMGB1)-DNA complex  

PubMed Central

Structural analysis of the high-mobility group protein B1 (HMGB1)-DNA complex and a docking simulation between glycyrrhetinic acid (GA) and the HMGB1-DNA complex were performed with a software package the Molecular Operating Environment (MOE). An HMGB1-DNA (PDB code: 2GZK) was selected for the 3D structure modeling of the HMGB1-DNA complex. The Site Finder module of the MOE identified 16 possible ligand-binding sites in the modeled HMGB1-DNA complex. The docking simulation revealed that GA possibly inhibits functions of HMGB1 interfering with Lys90, Arg91, Ser101, Tyr149, C230 and C231 in the HMGB1-DNA complex. To the best of our knowledge, this is the first report of an HMGB1-DNA complex with GA, and our data verify that the GA-HMGB1-DNA model can be utilized for application to target HMGB1 for the development of antitumor drugs. Abbreviations ASE-Dock - alpha sphere and excluded volume-based ligand-protein docking, CNS - central nervous system, GA - glycyrrhetinic acid, GL - glycyrrhizin, HMGB1 - high-mobility group protein B1, LBS - ligand-biding site, MOE - Molecular Operating Environment, SRY - sex-determining region on the Y chromosome.

Yamaguchi, Hideaki; Kidachi, Yumi; Kamiie, Katsuyoshi; Noshita, Toshiro; Umetsu, Hironori

2012-01-01

102

The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.  

PubMed

We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes. PMID:9605929

Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

1998-05-01

103

Detection of HPV DNA in esophageal cancer specimens from different regions and ethnic groups: a descriptive study  

PubMed Central

Background HPV has been found repeatedly in esophageal carcinoma tissues. However, reported detection rates of HPV DNA in these tumors have varied markedly. Differences in detection methods, sample types, and geographic regions of sample origin have been suggested as potential causes of this discrepancy. Methods HPV L1 DNA and HPV genotypes were evaluated in 435 esophageal carcinoma specimens collected from four geographic regions with different ethnicities including Anyang in north China, Shantou in south China, Xinjiang in west China, and the United States. The HPV L1 fragment was detected using SPF1/GP6+ primers. HPV genotyping was performed using genotype specific PCR. Results Two hundred and forty four of 435 samples (56.1%) tested positive for HPV L1. Significant differences in detection rate were observed neither among the three areas of China nor between China and the US. HPV6, 16, 18, 26, 45, 56, 57, and 58 were identified in L1 positive samples. HPV16 and 57 were the most common types in all regions, followed by HPV26 and HPV18. Conclusions HPV infection is common in esophageal carcinoma independent of region and ethnic group of origin. Findings in this study raise the possibility that HPV is involved in esophageal carcinogenesis. Further investigation with a larger sample size over broader geographic areas may be warranted.

2010-01-01

104

Mitochondrial DNA diversity in two ethnic groups in southeastern Kenya: perspectives from the northeastern periphery of the Bantu expansion.  

PubMed

The Bantu languages are widely distributed throughout sub-Saharan Africa. Genetic research supports linguists and historians who argue that migration played an important role in the spread of this language family, but the genetic data also indicates a more complex process involving substantial gene flow with resident populations. In order to understand the Bantu expansion process in east Africa, mtDNA hypervariable region I variation in 352 individuals from the Taita and Mijikenda ethnic groups was analyzed, and we evaluated the interactions that took place between the Bantu- and non-Bantu-speaking populations in east Africa. The Taita and Mijikenda are Bantu-speaking agropastoralists from southeastern Kenya, at least some of whose ancestors probably migrated into the area as part of Bantu migrations that began around 3,000 BCE. Our analyses indicate that they show some distinctive differences that reflect their unique cultural histories. The Taita are genetically more diverse than the Mijikenda with larger estimates of genetic diversity. The Taita cluster with other east African groups, having high frequencies of haplogroups from that region, while the Mijikenda have high frequencies of central African haplogroups and cluster more closely with central African Bantu-speaking groups. The non-Bantu speakers who lived in southeastern Kenya before Bantu speaking groups arrived were at least partially incorporated into what are now Bantu-speaking Taita groups. In contrast, gene flow from non-Bantu speakers into the Mijikenda was more limited. These results suggest a more complex demographic history where the nature of Bantu and non-Bantu interactions varied throughout the area. PMID:23382080

Batai, Ken; Babrowski, Kara B; Arroyo, Juan Pablo; Kusimba, Chapurukha M; Williams, Sloan R

2013-03-01

105

Mitochondrial DNA diversity in two ethnic groups in southeastern Kenya: perspectives from the northeastern periphery of the Bantu expansion  

PubMed Central

The Bantu languages are widely distributed throughout sub-Saharan Africa. Genetic research supports linguists and historians who argue that migration played an important role in the spread of this language family, but the genetic data also indicates a more complex process involving substantial gene flow with resident populations. In order to understand the Bantu expansion process in east Africa, mtDNA hypervariable region I variation in 352 individuals from the Taita and Mijikenda ethnic groups was analyzed, and we evaluated the interactions that took place between the Bantu- and non-Bantu-speaking populations in east Africa. The Taita and Mijikenda are Bantu-speaking agropastoralists from southeastern Kenya, at least some of whose ancestors probably migrated into the area as part of Bantu migrations that began around 3,000 BCE. Our analyses indicate that they show some distinctive differences that reflect their unique cultural histories. The Taita are genetically more diverse than the Mijikenda with larger estimates of genetic diversity. The Taita cluster with other east African groups, having high frequencies of haplogroups from that region, while the Mijikenda have high frequencies of central African haplogroups and cluster more closely with central African Bantu-speaking groups. The non-Bantu speakers who lived in southeastern Kenya before Bantu speaking groups arrived were at least partially incorporated into what are now Bantu-speaking Taita groups. In contrast, gene flow from non-Bantu speakers into the Mijikenda was more limited. These results suggest a more complex demographic history where the nature of Bantu and non-Bantu interactions varied throughout the area.

Batai, Ken; Babrowski, Kara B.; Arroyo, Juan Pablo; Kusimba, Chapurukha M.; Williams, Sloan R.

2013-01-01

106

Identification of aphids of Aphis frangulae-group living on Lamiaceae species through DNA barcode.  

PubMed

The genus Aphis frangulae-group living on Lamiaceae includes several postulate species, which are morphologically indistinguishable. As a consequence, identification is possible only on the basis of the host plant or life cycle. This study tested the utility of a fragment (614 bp) of mitochondrial cytochrome oxidase 1 (COI) with the aim of identifying the species and/or to confirm the previous classification based on host plant and data reported in the literature. Although the general nucleotide variability found was rather low, the analysis enabled the separation and identification of all the specimens collected. In some cases, the lack of nucleotide variability among postulated taxa indicates the limits of identification based on biological traits. Consequently, based on the molecular analysis, the postulate species A. symphyti, A. stachydis and A. lamiorum should be regarded as synonymous of A. frangulae. PMID:24188728

Massimino Cocuzza, Giuseppe E; Cavalieri, Vincenzo

2014-05-01

107

Detection of Bovine Group A Rotavirus Using Rapid Antigen Detection Kits, RT-PCR and Next-Generation DNA Sequencing  

PubMed Central

ABSTRACT We investigated the sensitivity of human rotavirus rapid antigen detection (RAD) kits, RT-PCR and next-generation DNA sequencing (NGS) for detection of bovine group A rotavirus (RVA). The Dipstick ‘Eiken’ Rota (Dipstick) showed the highest sensitivity out of the seven RAD kits against all selected strains in limited dilution analyses, which was consistent with the results for equine rotavirus previously reported. RT-PCR had 100–103-fold higher sensitivity than the Dipstick. NGS using thirteen RT-PCR-negative fecal samples revealed that all samples yielded RVA reads and especially that two of them covered all 11 genome segments. Moreover, mapping reads to reference sequences allowed genotyping. The NGS would be sensitive and useful for analysis of less dependent on specific primers and screening of genotypes.

MINAMI-FUKUDA, Fujiko; NAGAI, Makoto; TAKAI, Hikaru; MURAKAMI, Toshiaki; OZAWA, Tadashi; TSUCHIAKA, Shinobu; OKAZAKI, Sachiko; KATAYAMA, Yukie; OBA, Mami; NISHIURA, Naomi; SASSA, Yukiko; OMATSU, Tsutomu; FURUYA, Tetsuya; KOYAMA, Satoshi; SHIRAI, Junsuke; TSUNEMITSU, Hiroshi; FUJII, Yoshiki; KATAYAMA, Kazuhiko; MIZUTANI, Tetsuya

2013-01-01

108

An exceptional group-I intron-like insertion in the SSU rDNA of lichen mycobionts.  

PubMed

An exceptional group-I intron-like insertion at position 940 of the nuclear small subunit rDNA is found in lichen mycobionts of the families Parmeliaceae and Lecanoraceae. This shared insertion site is exceptional as it follows a G. Although several features of the self-splicing Tetrahymena intron are missing, the conserved structure of the presumed core region indicates that the new intron-like insertion, which is missing in mature transcripts, is not part of a silenced ribosomal repeat. It is unlikely that the new insertion is horizontally transferred from the adjacent position 943. A phylogenetic analysis indicates congruence with lichen phylogeny and suggests that the insertion has been vertically inherited. PMID:10369961

Grube, M; Gutmann, B; Arup, U; de los Rios, A; Mattsson, J; Wedin, M

1999-06-01

109

The Retrohoming of Linear Group II Intron RNAs in Drosophila melanogaster Occurs by Both DNA Ligase 4-Dependent and -Independent Mechanisms  

PubMed Central

Mobile group II introns are bacterial retrotransposons that are thought to have invaded early eukaryotes and evolved into introns and retroelements in higher organisms. In bacteria, group II introns typically retrohome via full reverse splicing of an excised intron lariat RNA into a DNA site, where it is reverse transcribed by the intron-encoded protein. Recently, we showed that linear group II intron RNAs, which can result from hydrolytic splicing or debranching of lariat RNAs, can retrohome in eukaryotes by performing only the first step of reverse splicing, ligating their 3? end to the downstream DNA exon. Reverse transcription then yields an intron cDNA, whose free end is linked to the upstream DNA exon by an error-prone process that yields junctions similar to those formed by non-homologous end joining (NHEJ). Here, by using Drosophila melanogaster NHEJ mutants, we show that linear intron RNA retrohoming occurs by major Lig4-dependent and minor Lig4-independent mechanisms, which appear to be related to classical and alternate NHEJ, respectively. The DNA repair polymerase ? plays a crucial role in both pathways. Surprisingly, however, mutations in Ku70, which functions in capping chromosome ends during NHEJ, have only moderate, possibly indirect effects, suggesting that both Lig4 and the alternate end-joining ligase act in some retrohoming events independently of Ku. Another potential Lig4-independent mechanism, reverse transcriptase template switching from the intron RNA to the upstream exon DNA, occurs in vitro, but gives junctions differing from the majority in vivo. Our results show that group II introns can utilize cellular NHEJ enzymes for retromobility in higher organisms, possibly exploiting mechanisms that contribute to retrotransposition and mitigate DNA damage by resident retrotransposons. Additionally, our results reveal novel activities of group II intron reverse transcriptases, with implications for retrohoming mechanisms and potential biotechnological applications.

White, Travis B.; Lambowitz, Alan M.

2012-01-01

110

Comparative analysis of the influence of the high-mobility group box 1 protein on DNA binding and transcriptional activation by the androgen, glucocorticoid, progesterone and mineralocorticoid receptors.  

PubMed Central

We performed a comparative analysis of the effect of high-mobility group box protein 1 (HMGB1) on DNA binding by the DNA-binding domains (DBDs) of the androgen, glucocorticoid, progesterone and mineralocorticoid receptors. The affinity of the DBDs of the different receptors for the tyrosine aminotransferase glucocorticoid response element, a classical high-affinity binding element, was augmented up to 7-fold by HMGB1. We found no major differences in the effects of HMGB1 on DNA binding between the different steroid hormone receptors. In transient transfection assays, however, HMGB1 significantly enhances the activity of the glucocorticoid and progesterone receptors but not the androgen or mineralocorticoid receptor. We also investigated the effect of HMGB1 on the binding of the androgen receptor DBD to a subclass of directly repeated response elements that is recognized exclusively by the androgen receptor and not by the glucocorticoid, progesterone or mineralocorticoid receptor. Surprisingly, a deletion of 26 amino acid residues from the C-terminal extension of the androgen receptor DBD does not influence DNA binding but destroys its sensitivity to HMGB1. Deletion of the corresponding fragment in the DBDs of the glucocorticoid, progesterone and mineralocorticoid receptor destroyed their DNA binding. This 26-residue fragment is therefore essential for the influence of HMGB1 on DNA recognition by all steroid hormone receptors that were tested. However, it is dispensable for DNA binding by the androgen receptor.

Verrijdt, Guy; Haelens, Annemie; Schoenmakers, Erik; Rombauts, Wilfried; Claessens, Frank

2002-01-01

111

A novel phylogenetic group within Thozetella (Chaetosphaeriaceae): a new taxon based on morphology and DNA sequence analyses.  

PubMed

A new species, Thozetella pinicola, was isolated from leaf litter of Pinus elliottii Engelm. in Hong Kong. This taxon is described and compared with existing species in the genus. It occurs on the substrate as creamy white sporodochia and has short black conidiophores. Morphological characters are typical of Thozetella and it most closely resembles Thozetella falcata, Thozetella gigantea and Thozetella nivea, but may be distinguished by its distinct microawns and different conidial size. To gain further taxonomic insight into the phylogenetic relationships of our new taxon and its allies, we sequenced and analysed 6 different regions of 3 genes (ribosomal DNA and protein coding genes: RNA polymerase II largest subunit (RBP2) and b-tubulin). Resulting phylogenies are compared with existing morphological information. Molecular data support the relationship between Thozetella species and the Chaetosphaeriaceae (Chaetosphaeriales, Sordariomycetes). In addition, we recovered a new phylogenetic lineage (or group) within the existing phylogenetic framework of Thozetella as previously proposed. In particular, there is a close association between T. pinicola and T. nivea, which is strongly supported. The affinities of these 2 newly sequenced taxa are discussed in light of morphological and molecular characters. PMID:19767838

Jeewon, R; Yeung, S Y Q; Hyde, K D

2009-06-01

112

A 169-base pair tandem repeat DNA marker for subtelomeric heterochromatin and chromosomal rearrangements in aphids of the Myzus persicae group  

Microsoft Academic Search

Numerous copies of a 169-base pair DNA sequence (Myzus persicae group repeat; MpR) occur at subtelomeric locations on all chromosomes of three members of the Myzus persicae species group (Myzus persicae, M. antirrhinii, M. certus). MpR occurs in large tandem arrays at both ends of all autosomes of the standard 2n = 12 karyotype, and near one end of the

Jennifer M. Spence; Roger L. Blackman; Johann M. Testa; Paul D. Ready

1998-01-01

113

Amino group binding peptide aptamers with double disulphide-bridged loops selected by in vitro selection using cDNA display.  

PubMed

Peptide aptamers that specifically bind to the amino group on a solid-phase were screened by in vitro selection using the cDNA display method. The identified peptides have a unique structure containing two cyclic loops with disulphide bonds and a linkage region, which were indispensable for molecular recognition. PMID:24728228

Mochizuki, Yuki; Nishigaki, Koichi; Nemoto, Naoto

2014-05-30

114

Replacement of a thiourea with an amidine group in a monofunctional platinum-acridine antitumor agent. Effect on DNA interactions, DNA adduct recognition and repair.  

PubMed

A combination of biophysical, biochemical, and computational techniques was used to delineate mechanistic differences between the platinum-acridine hybrid agent [PtCl(en)(L)](NO(3))(2) (complex 1, en = ethane-1,2-diamine, L = 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea) and a considerably more potent second-generation analogue containing L' = N-[2-(acridin-9-ylamino)ethyl]-N-methylpropionamidine (complex 2). Calculations at the density functional theory level provide a rationale for the binding preference of both complexes for guanine-N7 and the relatively high level of adenine adducts observed for compound 1. A significant rate enhancement is observed for binding of the amidine-based complex 2 with DNA compared with the thiourea-based prototype 1. Studies conducted with chemical probes and on the bending and unwinding of model duplex DNA suggest that adducts of complex 2 perturb B-form DNA more severely than complex 1, however, without denaturing the double strand and significantly less than cisplatin. Circular and linear dichroism spectroscopies and viscosity measurements suggest that subtle differences exist between the intercalation modes and adduct geometries of the two complexes. The adducts formed by complex 2 most efficiently inhibit transcription of the damaged DNA by RNA polymerase II. Not only do complexes 1 and 2 cause less distortion to DNA than cisplatin, they also do not compromise the thermodynamic stability of the modified duplex. This leads to a decreased or negligible affinity of HMG domain proteins for the adducts formed by either Pt-acridine complex. In a DNA repair synthesis assay the lesions formed by complex 2 were repaired less efficiently than those formed by complex 1. These significant differences in DNA adduct formation, structure, and recognition between the two acridine complexes and cisplatin help to elucidate why compound 2 is highly active in cisplatin-resistant, repair proficient cancer cell lines. PMID:21806015

Kostrhunova, Hana; Malina, Jaroslav; Pickard, Amanda J; Stepankova, Jana; Vojtiskova, Marie; Kasparkova, Jana; Muchova, Tereza; Rohlfing, Matthew L; Bierbach, Ulrich; Brabec, Viktor

2011-10-01

115

Genetic variability and relatedness in the complex group of black Aspergilli based on random amplification of polymorphic DNA  

Microsoft Academic Search

A PCR-based technique, involving the random amplification of polymorphic DNA (RAPD), was used for assessing genomic variability among a wide range of culture collection strains of black Aspergilli and related species. The performance of this technique is compared with that of the two other genetic techniques most commonly used, namely restriction fragment length polymorphisms on rDNA and isozyme analysis. The

Béatrice Megnegneau; Fons Debets; Rolf E. Hoekstra

1993-01-01

116

Universal Plant DNA Barcode Loci May Not Work in Complex Groups: A Case Study with Indian Berberis Species  

Microsoft Academic Search

BackgroundThe concept of DNA barcoding for species identification has gained considerable momentum in animals because of fairly successful species identification using cytochrome oxidase I (COI). In plants, matK and rbcL have been proposed as standard barcodes. However, barcoding in complex genera is a challenging task.Methodology and Principal FindingsWe investigated the species discriminatory power of four reportedly most promising plant DNA

Sribash Roy; Antariksh Tyagi; Virendra Shukla; Anil Kumar; Uma M. Singh; Lal Babu Chaudhary; Bhaskar Datt; Sumit K. Bag; Pradhyumna K. Singh; Narayanan K. Nair; Tariq Husain; Rakesh Tuli; Simon Joly

2010-01-01

117

dnaJ gene sequence-based assay for species identification and phylogenetic grouping in the genus Staphylococcus  

Microsoft Academic Search

In the last few years, many attempts have been made to use conserved gene sequences for identification and for phylogenetic studies of Staphylococcus species. In an effort to identify a more reliable approach, a dnaJ gene sequence-based database was created. In this study, an approximately 883 bp portion of the dnaJ gene sequence from 45 staphylococcal type strains was compared

Mohammad Monir Shah; Hirotoshi Iihara; Makiko Noda; S. X. Song; Pham Hong Nhung; Kiyofumi Ohkusu; Yoshiaki Kawamura; Takayuki Ezaki

2007-01-01

118

EcI5, a group IIB intron with high retrohoming frequency: DNA target site recognition and use in gene targeting  

PubMed Central

We find that group II intron EcI5, a subclass CL/IIB1 intron from an Escherichia coli virulence plasmid, is highly active in retrohoming in E. coli. Both full-length EcI5 and an EcI5-?ORF intron with the intron-encoded protein expressed separately from the same donor plasmid retrohome into a recipient plasmid target site at substantially higher frequencies than do similarly configured Lactococcus lactis Ll.LtrB introns. A comprehensive view of DNA target site recognition by EcI5 was obtained from selection experiments with donor and recipient plasmid libraries in which different recognition elements were randomized. These experiments suggest that EcI5, like other mobile group II introns, recognizes DNA target sequences by using both the intron-encoded protein and base-pairing of the intron RNA, with the latter involving EBS1, EBS2, and EBS3 sequences characteristic of class IIB introns. The intron-encoded protein appears to recognize a small number of bases flanking those recognized by the intron RNA, but their identity is different than in previously characterized group II introns. A computer algorithm based on the empirically determined DNA recognition rules enabled retargeting of EcI5 to integrate specifically at 10 different sites in the chromosomal lacZ gene at frequencies up to 98% without selection. Our findings provide insight into modes of DNA target site recognition used by mobile group II introns. More generally, they show how the diversity of mobile group II introns can be exploited to provide a large variety of different target specificities and potentially other useful properties for gene targeting.

Zhuang, Fanglei; Karberg, Michael; Perutka, Jiri; Lambowitz, Alan M.

2009-01-01

119

Mutagenesis of the HMGB (high-mobility group B) protein Cmb1 (cytosine-mismatch binding 1) of Schizosaccharomyces pombe: effects on recognition of DNA mismatches and damage.  

PubMed Central

Cmb1 (cytosine-mismatch binding 1) is a high-mobility group (HMG) protein of Schizosaccharomyces pombe, which consists of 223 amino acids and has a single HMG domain at the C-terminal end. We have created several mutant and deletion forms of the Cmb1 protein and studied the effects on general DNA binding and specific binding to DNA mismatches and damaged DNA. Cmb1Delta41 (i.e. Cmb1 from which the 41 N-terminal amino acids have been deleted) bound specifically to cytosine-containing mismatches, to the cisplatin-induced intrastrand cross-links cis -GG and cis -AG and to an O (6)-methylguanine lesion. DNA binding was not affected when the 45 N-terminal amino acids were deleted, but was abolished in the absence of the 50 N-terminal amino acids, and was reduced when Cmb1 was truncated by between five and eleven C-terminal amino acids. Cmb1, both with and without the C-terminal truncations, retained its DNA binding affinity after heating at 95 degrees C. The cmb1 gene was induced when S. pombe cells were treated with cisplatin. Mitotic mutation rates were increased in a S. pombe cmb1 null mutant and in a cmb1-(1-212) mutant, which encodes a Cmb1 protein lacking the 11 C-terminal amino acids. We conclude that mutation avoidance by Cmb1 is distinct from Msh2-dependent mismatch repair, but related to nucleotide excision repair.

Kunz, Christophe; Zurbriggen, Karin; Fleck, Oliver

2003-01-01

120

Chloroplast and nuclear DNA studies in a few members of the Brassica oleracea L. group using PCR-RFLP and ISSR-PCR markers: a population genetic analysis.  

PubMed

A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude. PMID:12671762

Panda, S; Martín, J P; Aguinagalde, I

2003-04-01

121

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro  

PubMed Central

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics.

2013-01-01

122

Reactions of Glyceraldehyde 3-Phosphate Dehydrogenase Sulfhydryl Groups with bis-Electrophiles Produce DNA-Protein Crosslinks but Not Mutations  

PubMed Central

The environmental contaminant 1,2-dibromoethane and diepoxybutane, an oxidation product of the important industrial chemical butadiene, are bis-functional electrophiles and known to be mutagenic and carcinogenic. One mechanism by which bis-electrophiles can exert their toxic effects is through the induction of genotoxic and mutagenic DNA–peptide crosslinks. This mechanism has been shown in systems overexpressing the DNA repair protein O6-alkylguanine DNA-alkyltransferase (AGT) or glutathione S-transferase and involves reactions with nucleophilic cysteine residues. The hypothesis that DNA-protein crosslink formation is a more general mechanism for genotoxicity by bis-electrophiles was investigated by screening nuclear proteins for reactivity with model monofunctional electrophiles. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was identified as a candidate due to the nucleophilicity of two cysteine residues (Cys152 and Cys246) in reaction screens with model electrophiles (Dennehy, M. K. et al. (2006) Chem. Res. Toxicol. 19, 20–29). Incubation of GAPDH with bis-electrophiles resulted in inhibition of its catalytic activity, but only at high concentrations of diepoxybutane. In vitro assays indicated DNA-GAPDH crosslink formation in the presence of diepoxybutane, and bis-electrophile reactivity at Cys246 was confirmed using mass spectral analysis. In contrast to AGT, overexpression of human GAPDH in Escherichia coli did not enhance mutagenesis by diepoxybutane. We propose that the lack of mutational enhancement is in part due to the inherently lower reactivity of GAPDH toward bis-electrophiles as well as the reduced DNA binding ability relative to AGT, preventing the in vivo formation of DNA-protein crosslinks and enhanced mutagenesis.

Loecken, Elisabeth M.; Guengerich, F. Peter

2014-01-01

123

Tuning the DNA Conformational Perturbations Induced by Cytotoxic Platinum-Acridine Bisintercalators: Effect of Metal cis/trans Isomerism and DNA Threading Groups  

PubMed Central

Four highly charged, water soluble platinum-acridine bisintercalating agents have been synthesized. Depending on the cis/trans isomerism of the metal and the nature of the acridine side chains, bisintercalation induces/stabilizes the classical Watson-Crick B-form or a non-B-form. Circular dichroism spectra and chemical footprinting experiments suggest that compound 4, the most active derivative in HL-60 cells, produces a structurally severely perturbed DNA with features of a Hoogsteen base-paired biopolymer.

Choudhury, Jayati Roy; Guddneppanavar, Rajsekhar; Saluta, Gilda; Kucera, Gregory L.; Bierbach, Ulrich

2009-01-01

124

Phylogenetic Analysis of Rhinosporidium seeberi's 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade  

PubMed Central

For the past 100 years the phylogenetic affinities of Rhinosporidium seeberi have been controversial. Based on its morphological features, it has been classified as a protozoan or as a member of the kingdom Fungi. We have amplified and sequenced nearly a full-length 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence from R. seeberi. Using phylogenetic analysis, by parsimony and distance methods, of R. seeberi’s 18S SSU rDNA and that of other eukaryotes, we found that this enigmatic pathogen of humans and animals clusters with a novel group of fish parasites referred to as the DRIP clade (Dermocystidium, rossete agent, Ichthyophonus, and Psorospermium), near the animal-fungal divergence. Our phylogenetic analyses also indicate that R. seeberi is the sister taxon of the two Dermocystidium species used in this study. This molecular affinity is remarkable since members of the genus Dermocystidium form spherical structures in infected hosts, produce endospores, have not been cultured, and possess mitochondria with flat cristae. With the addition of R. seeberi to this clade, the acronym DRIP is no longer appropriate. We propose to name this monophyletic clade Mesomycetozoa to reflect the group’s phylogenetic association within the Eucarya.

Herr, Roger A.; Ajello, Libero; Taylor, John W.; Arseculeratne, Sarath N.; Mendoza, Leonel

1999-01-01

125

Preparation of a DNA matrix via an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing a pyrrole group.  

PubMed

A new methodology for the preparation of addressed DNA matrices is described. The process includes an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing on their 5' end a pyrrole moiety introduced by phosphoramidite chemistry. The electro-controlled synthesis of the copolymer (poly-pyrrole) gives, in one step, a solid conducting film deposited on the surface of an electrode. The resulting polymer consists of pyrrole chains bearing covalently linked oligonucleotide. The polymer growth is limited to the electrode surface, so that it is possible to prepare a DNA matrix on a multiple electrode device by successive copolymerizations. A support bearing four oligonucleotides was used to detect three ras mutations on a synthetic DNA fragment. PMID:8065902

Livache, T; Roget, A; Dejean, E; Barthet, C; Bidan, G; Téoule, R

1994-08-11

126

The molecular evolution and structural organization of self-splicing group I introns at position 516 in nuclear SSU rDNA of myxomycetes.  

PubMed

Group I introns are relatively common within nuclear ribosomal DNA of eukaryotic microorganisms, especially in myxomycetes. Introns at position S516 in the small subunit ribosomal RNA gene are particularly common, but have a sporadic occurrence in myxomycetes. Fuligo septica, Badhamia gracilis, and Physarum flavicomum, all members of the family Physaraceae, contain related group IC1 introns at this site. The F. septica intron was studied at the molecular level and found to self-splice as naked RNA and to generate full-length intron RNA circles during incubation. Group I introns at position S516 appear to have a particularly widespread distribution among protists and fungi. Secondary structural analysis of more than 140 S516 group I introns available in the database revealed five different types of organization, including IC1 introns with and without His-Cys homing endonuclease genes, complex twin-ribozyme introns, IE introns, and degenerate group I-like introns. Both intron structural and phylogenetic analyses indicate a multiple origin of the S516 introns during evolution. The myxomycete introns are related to S516 introns in the more distantly related brown algae and Acanthamoeba species. Possible mechanisms of intron transfer both at the RNA- and DNA-levels are discussed in order to explain the observed widespread, but scattered, phylogenetic distribution. PMID:15132172

Haugen, Peik; Coucheron, Dag H; Rønning, Sissel B; Haugli, Kari; Johansen, Steinar

2003-01-01

127

Tuning the DNA conformational perturbations induced by cytotoxic platinum-acridine bisintercalators: effect of metal cis/trans isomerism and DNA threading groups.  

PubMed

Four highly charged, water soluble platinum-acridine bisintercalating agents have been synthesized. Depending on the cis/trans isomerism of the metal and the nature of the acridine side chains, bisintercalation induces/stabilizes the classical Watson-Crick B-form or a non-B-form. Circular dichroism spectra and chemical footprinting experiments suggest that 4, the most active derivative in HL-60 cells, produces a structurally severely perturbed DNA with features of a Hoogsteen base-paired biopolymer. PMID:18457380

Choudhury, Jayati Roy; Guddneppanavar, Rajsekhar; Saluta, Gilda; Kucera, Gregory L; Bierbach, Ulrich

2008-06-12

128

Lung epithelial binding peptide-linked high mobility group box-1 A box for lung epithelial cell-specific delivery of DNA.  

PubMed

High mobility group box-1 A box (HMGB1A) is an anti-inflammatory peptide originating from HMGB1. A previous report demonstrated that recombinant HMGB1A could deliver DNA into cells. Lung epithelial-specific gene delivery is required for the gene therapy of various lung diseases such as acute lung injury. In this study, a lung epithelial-specific DNA carrier was produced by linking the lung epithelial binding peptide (LEBP) to HMGB1A. An LEBP-linked HMGB1A (LEBP-HMGB1A) expression vector, pET21a-LEBP-HMGB1A, was constructed. LEBP-HMGB1A was expressed in BL21 strain and purified by consecutive applications of nickel affinity chromatography and cationic exchange chromatography. In a gel retardation assay, LEBP-HMGB1A completely retarded DNA at a 5:1 weight ratio (peptide:DNA). LEBP-HMGB1A/DNA complexes were prepared at various weight ratios, to which a fixed amount of polyethylenimine (2?kDa, PEI2k) was added to increase the proton buffering effect of the complex. LEBP-HMGB1A had the highest transfection efficiency to L2 lung epithelial cells at a 20:1 weight ratio (peptide:DNA). At this ratio, LEBP-HMGB1A had a higher transfection efficiency than poly-L-lysine (PLL) as well as HMGB1A without LEBP. A cytotoxicity assay showed that LEBP-HMGB1A was not toxic to L2 cells. Therefore, LEBP-HMGB1A may be useful in developing gene therapies for lung diseases. PMID:21309682

Kim, Hyun Ah; Park, Ji Hwan; Cho, Su Hee; Lee, Minhyung

2011-08-01

129

Growth and grazing rates of bacteria groups with different apparent DNA content in the Gulf of Mexico  

Microsoft Academic Search

Growth rates and grazing losses of bacterioplankton were assessed by serial dilution experiments in surface waters in the Mississippi River plume, the northern Gulf of Mexico, a Texas coastal lagoon (Laguna Madre), southeast Gulf of Mexico surface water, and the chlorophyll subsurface maximum layer in the southeast Gulf of Mexico. Bacteria were quantified by flow cytometry after DNA staining with

F. J. Jochem; P. J. Lavrentyev; M. R. First

2004-01-01

130

High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells  

PubMed Central

We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors.

Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

1998-01-01

131

The nicking homing endonuclease I-BasI is encoded by a group I intron in the DNA polymerase gene of the Bacillus thuringiensis phage Bastille.  

PubMed

Here we describe the discovery of a group I intron in the DNA polymerase gene of Bacillus thuringiensis phage Bastille. Although the intron insertion site is identical to that of the Bacillus subtilis phages SPO1 and SP82 introns, the Bastille intron differs from them substantially in primary and secondary structure. Like the SPO1 and SP82 introns, the Bastille intron encodes a nicking DNA endonuclease of the H-N-H family, I-BasI, with a cleavage site identical to that of the SPO1-encoded enzyme I-HmuI. Unlike I-HmuI, which nicks both intron-minus and intron-plus DNA, I-BasI cleaves only intron-minus alleles, which is a characteristic of typical homing endonucleases. Interestingly, the C-terminal portions of these H-N-H phage endonucleases contain a conserved sequence motif, the intron-encoded endonuclease repeat motif (IENR1) that also has been found in endonucleases of the GIY-YIG family, and which likely comprises a small DNA-binding module with a globular betabetaalphaalphabeta fold, suggestive of module shuffling between different homing endonuclease families. PMID:12799434

Landthaler, Markus; Shub, David A

2003-06-15

132

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing  

PubMed Central

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility (“retrohoming”) by a process that requires reverse transcription of a highly structured, 2–2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3? ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R.; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M.

2013-01-01

133

Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.  

PubMed

Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism. PMID:21497131

Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro

2011-07-01

134

A group of chromosomal proteins is specifically released by spermine and loses DNA-binding activity upon phosphorylation.  

PubMed Central

Biologically relevant concentrations as low as 500 microM spermine led to the specific release of chromatin-associated proteins from nuclei of rice (Oryza sativa) seedlings. Using a southwestern technique, it was shown that several of these proteins bind DNA. This affinity was lost upon in organello phosphorylation by an endogenous kinase. The effect of spermine was very specific. Spermidine was far less effective and putrescine was essentially ineffective in releasing these proteins. The most abundant spermine-released protein was shown to be homologous to the maize HMG1 protein. Our results suggest that spermine induces the release of spermine-released proteins by changing DNA conformation. Binding of these proteins might be sensitive to long-range changes in chromosome structure caused by torsional stress.

Van den Broeck, D; Van der Straeten, D; Van Montagu, M; Caplan, A

1994-01-01

135

Synthesis, cytotoxic activity and DNA-interaction studies of novel anthraquinone-thiosemicarbazones with tautomerizable methylene group.  

PubMed

A series of novel anthraquinone-thiosemicarbazone derivatives in a tautomerizable keto-imine form was synthesized and tested for their in vitro cytotoxic activity against human cancer cells (HeLa, MDA-MB-361, MDA-MB-453, K562, A549) and human normal MRC-5 cells. Several compounds efficiently inhibited cancer cell growth at micromolar concentrations, especially against K562 and HeLa cells. As determined by flow cytometric analysis, anthraquinone-thiosemicarbazone caused significant increase in the number of sub-G1 phase of HeLa cells and apoptosis in a concentration-dependent manner. Also, inhibition of caspase-3, -8, and -9 with specific caspase inhibitors reduced the apoptosis mediated by the tested compounds in HeLa cells. All anthraquinone-thiosemicarbazones exhibit calf thymus DNA-binding activity, but no cleavage of plasmid DNA was observed. PMID:23644206

Markovi?, Violeta; Jani?ijevi?, Ana; Stanojkovi?, Tatjana; Kolundžija, Branka; Sladi?, Dušan; Vuj?i?, Miroslava; Janovi?, Barbara; Joksovi?, Ljubinka; Djurdjevi?, Predrag T; Todorovi?, Nina; Trifunovi?, Snežana; Joksovi?, Milan D

2013-06-01

136

Usefulness of conventional blood groups, DNA-minisatellites, and short tandem repeat polymorphisms in paternity testing: a comparison.  

PubMed

A total of 215 paternity cases were analysed after testing 24 marker systems. Despite technical advantages of polymerase chain reaction related polymorphisms (automatisation, employment of robots, lesser requirements concerning of quality and quantity of DNA) it could be shown that the exclusive employment of a parentage testing kit is compromised by an increased risk of erroneous conclusions. It is estimated that in about 3-4% of the cases ambiguous situations have to be expected which are caused by the occurrence of single or double exclusions. In these cases it is impossible to decide whether the exclusions indicate either true nonpaternity or a de novo mutation. The situation might become even more complicated if an involvement of a close relative of the alleged father cannot be ruled out. We cautiously advance the hypothesis that in parentage testing DNA minisatellite polymorphisms from an optimal set of tools. PMID:10481266

Henke, L; Fimmers, R; Josephi, E; Cleef, S; Dülmer, M; Henke, J

1999-07-26

137

A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M  

Microsoft Academic Search

Fanconi anemia is a genetic disease characterized by genomic instability and cancer predisposition. Nine genes involved in Fanconi anemia have been identified; their products participate in a DNA damage-response network involving BRCA1 and BRCA2 (refs. 2,3). We previously purified a Fanconi anemia core complex containing the FANCL ubiquitin ligase and six other Fanconi anemia-associated proteins. Each protein in this complex

Amom Ruhikanta Meetei; Annette L Medhurst; Chen Ling; Yutong Xue; Thiyam Ramsing Singh; Patrick Bier; Jurgen Steltenpool; Stacie Stone; Inderjeet Dokal; Christopher G Mathew; Maureen Hoatlin; Hans Joenje; Johan P de Winter; Weidong Wang

2005-01-01

138

Architectural DNA Binding by a High-Mobility-Group\\/Kinesin-Like Subunit in Mammalian SWI\\/SNF-Related Complexes  

Microsoft Academic Search

The SWI\\/SNF complex in yeast and Drosophila is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. The mechanism by which it is targeted to specific genes is poorly understood and may involve direct DNA binding and\\/or interactions with specific or general transcription factors. We have previously purified a mammalian complex by using antibodies against BRG1,

Weidong Wang; Tianhuai Chi; Yutong Xue; Sharleen Zhou; Ann Kuo; Gerald R. Crabtree

1998-01-01

139

Evidence for chromosome and Pst I satellite DNA family evolutionary stasis in the Bufo viridis group (Amphibia, Anura)  

Microsoft Academic Search

The West Palearctic green toads, Bufo viridis, represent a species complex. Apart from tetraploid populations, which form at least one separate species, evidence exists\\u000a for relevant differentiation among diploid populations. We present the results of a chromosomal (C-, Ag-NOR-, Replication\\u000a pattern, DAPI and CMA3 banding) and molecular study (isolation and characterization of a satellite DNA family) carried out on a

Gaetano Odierna; Gennaro Aprea; Teresa Capriglione; Sergio Castellano; Emilio Balletto

2004-01-01

140

The group 10 allergen of Dermatophagoides farinae (Acari: Pyroglyphidae): cDNA cloning, sequence analysis, and expression in Escherichia coli BL21.  

PubMed

Dermatophagoides farinae Hughes, American house dust mite, is highly allergenic, producing symptoms in people worldwide. Identifying and cloning the allergens in this species may enable better diagnostic and therapeutic approaches. Here, we cloned, sequenced, and expressed the full-length cDNA encoding D. farinae group 10 allergen (Der f 10) isolated from dust mites in China. Bioinformatic analysis indicated that the 888 bp sequence encoded a cytoskeleton protein 295 amino acids long, with a molecular weight of approximately equal 34 kDa. Sequence alignment with the group 10 allergens of Pyroglyphidae, Acaridae, and Glycyphagidae families revealed that the group 10 allergen from D. farinae is 95% similar to D. pteronyssinus Trouessart and Psoroptes ovis (Hering). These findings lay the groundwork for future studies, including large-scale production of recombinant Der f 10 allergen for diagnostic and therapeutic agents. PMID:23427671

Cui, Yubao; Zhou, Ying; Wang, Yungang; Ma, Guifang; Yang, Li

2013-01-01

141

Allelic frequency distributions of 21 non-combined DNA index system STR loci in a Russian ethnic minority group from Inner Mongolia, China*  

PubMed Central

We studied the allelic frequency distributions and statistical forensic parameters of 21 new short tandem repeat (STR) loci and the amelogenin locus, which are not included in the combined DNA index system (CODIS), in a Russian ethnic minority group from the Inner Mongolia Autonomous Region, China. A total of 114 bloodstain samples from unrelated individuals were extracted and co-amplified with four fluorescence-labeled primers in a multiplex polymerase chain reaction (PCR) system. Using capillary electrophoresis, the PCR products of the 21 STR loci were separated and genotyped. A total of 161 alleles were observed in the Russian ethnic minority group, and corresponding allelic frequencies ranged from 0.0044 to 0.5965. The 21 non-CODIS STR loci of the Russian ethnic minority group were characterized by high genetic diversity and therefore may be useful for elucidating the population’s genetic background, for individual identification, and for paternity testing in forensic practice.

Wang, Hong-dan; Shen, Chun-mei; Liu, Wen-juan; Zhang, Yu-dang; Yang, Guang; Yan, Jiang-wei; Qin, Hai-xia; Zhu, Bo-feng

2013-01-01

142

Allelic frequency distributions of 21 non-combined DNA index system STR loci in a Russian ethnic minority group from Inner Mongolia, China.  

PubMed

We studied the allelic frequency distributions and statistical forensic parameters of 21 new short tandem repeat (STR) loci and the amelogenin locus, which are not included in the combined DNA index system (CODIS), in a Russian ethnic minority group from the Inner Mongolia Autonomous Region, China. A total of 114 bloodstain samples from unrelated individuals were extracted and co-amplified with four fluorescence-labeled primers in a multiplex polymerase chain reaction (PCR) system. Using capillary electrophoresis, the PCR products of the 21 STR loci were separated and genotyped. A total of 161 alleles were observed in the Russian ethnic minority group, and corresponding allelic frequencies ranged from 0.0044 to 0.5965. The 21 non-CODIS STR loci of the Russian ethnic minority group were characterized by high genetic diversity and therefore may be useful for elucidating the population's genetic background, for individual identification, and for paternity testing in forensic practice. PMID:23733431

Wang, Hong-dan; Shen, Chun-mei; Liu, Wen-juan; Zhang, Yu-dang; Yang, Guang; Yan, Jiang-wei; Qin, Hai-xia; Zhu, Bo-feng

2013-06-01

143

Restriction enzyme analysis of mitochondrial DNA of the Aspergillus flavus group: A. flavus, A. parasiticus, and A. nomius.  

PubMed Central

Mitochondrial DNA restriction fragment length polymorphisms were identified that clearly distinguish Aspergillus flavus, A. parasiticus, and A. nomius. Mitochondrial DNAs of A. flavus and A. parasiticus were found to be circular, and their size was estimated size to be 32 kilobases. A restriction map was constructed for the mitochondrial genome of an A. parasiticus isolate by using four restriction endonucleases. Four genes tested were found to have the same order as in the mitochondrial genome of A. nidulans. The mitochondrial genome of A. nomius was estimated to be 33 kilobases. Images

Moody, S F; Tyler, B M

1990-01-01

144

Phylogenies of the Frigatebirds (Fregatidae) and Tropicbirds (Phaethonidae), two divergent groups of the traditional order Pelecaniformes, inferred from mitochondrial DNA sequences.  

PubMed

The frigatebirds (Fregatidae) and Tropicbirds (Phaethonidae) represent the most morphologically and behaviorally distinct members of the traditional Order Pelecaniformes. Using 1756bp of mitochondrial DNA sequence consisting of the 12S, ATPase-6, ATPase-8, and COI genes obtained from all extant species, we derive a completely resolved phylogeny for both groups. The inferred relationships among these species are robust to the method of phylogenetic estimation used, and all branches are well supported, in spite of the relatively recent radiation within the frigatebirds. The two families are not closely related either to each other, or to any other putative relatives (e.g., pelicans; Pelecanidae). PMID:15019606

Kennedy, Martyn; Spencer, Hamish G

2004-04-01

145

Biological and DNA evidence of two dissimilar populations of the Rhipicephalus sanguineus tick group (Acari: Ixodidae) in South America.  

PubMed

In this work, the biology, mitochondrial DNA and fertility of hybrids from two strains of Rhipicephalus sanguineus, from Brazil and Argentina, were compared. Engorged larvae, nymphs and adults from Argentina weighed more and the engorgement period of adult females was significantly longer than those of their Brazilian counterparts, whereas adult female tick yield rate was higher for the Brazilian strain. High intraspecific divergence of mitochondrial DNA was detected between R. sanguineus from Brazil and Argentina. On the other hand, a strong genetic relationship was detected between European and Argentinean R. sanguineus populations while the Brazilian population appeared to be related to the African Rhipicephalus turanicus. Adult hybrid females laid eggs, which were mostly unviable, whereas a mean of more than 1400 larvae hatched per egg mass from pure Brazilian and Argentinean strains. These results showed that differences between these strains are greater than previously assumed and that the biosystematic status of R. sanguineus ticks from South America should be re-evaluated. Wide variations, such as these might account for the reported worldwide differences in biology and vector capacity of this species. PMID:15893080

Szabó, Matias P J; Mangold, Atilio J; João, Carolina F; Bechara, Gervásio H; Guglielmone, Alberto A

2005-06-10

146

Systematic and phylogeographical assessment of the Acanthodactylus erythrurus group (Reptilia: Lacertidae) based on phylogenetic analyses of mitochondrial and nuclear DNA  

Microsoft Academic Search

We have used mitochondrial 12S rRNA, 16S rRNA and nuclear ?-fibrinogen (intron 7) sequences to investigate the phylogenetic and phylogeographic relationships between Acanthodactylus erythrurus group species (except for A. boueti). The phylogenetic analyses of the Acanthodactylus genus did not cluster A. guineensis and A. savignyi with the remaining species of the group (A. blanci, A. lineomaculatus and A. erythrurus). Within

Miguel M. Fonseca; José C. Brito; Octávio S. Paulo; Miguel A. Carretero; D. James Harris

2009-01-01

147

MHF1 plays Fanconi anaemia complementation group M protein (FANCM)-dependent and FANCM-independent roles in DNA repair and homologous recombination in plants.  

PubMed

Fanconi anaemia complementation group M protein (FANCM), a component of the human Fanconi anemia pathway, acts as DNA translocase that is essential during the repair of DNA interstrand cross-links. The DNA-damage-binding function of FANCM is strongly enhanced by the histone fold-containing FANCM-associated protein MHF1. We identified a single homologue of MHF1 in the genome of Arabidopsis thaliana. Similar to the loss of AtFANCM, the loss of AtMHF1 leads to several meiotic defects, such as chromosome bridges between bivalents and an unequal distribution of chromosomes. Moreover, MHF1, together with FANCM, is involved in interstrand cross-link repair in plants. This phenotype is detectable only in double mutants of the RecQ helicase and BLM homologue RECQ4A, which appears to function in a parallel pathway to the FANCM/MHF1 complex. However, in somatic cells, FANCM has an MHF1-independent function in replicative repair in a parallel pathway to the endonuclease MUS81. Furthermore, MHF1 is required for efficient somatic homologous recombination (HR) - a role antagonistic to FANCM. FANCM and RECQ4A define two parallel pathways of HR suppression in Arabidopsis. Hyperrecombination in the fancm but not the recq4A mutant can be abolished by MHF1 mutations. This finding indicates that MHF1 and FANCM act at different steps of a single, common, HR pathway. PMID:24635147

Dangel, Natalie J; Knoll, Alexander; Puchta, Holger

2014-06-01

148

Effects of spectator ligands on the specific recognition of intrastrand platinum-DNA cross-links by high mobility group box and TATA-binding proteins.  

PubMed

The results presented describe the effects of various spectator ligands, attached to a platinum 1,2-intrastand d(GpG) cross-link in duplex DNA, on the binding of high mobility group box (HMGB) domains and the TATA-binding protein (TBP). In addition to cisplatin-modified DNA, 15-base pair DNA probes modified by [Pt(1R,2R-diaminocyclohexane)](2+), cis-[Pt(NH(3))(cyclohexylamine)](2+), [Pt(ethylenediamine)](2+), cis-[Pt(NH(3))(cyclobutylamine)](2+), and cis-[Pt(NH(3))(2-picoline)](2+) were examined. Electrophoretic mobility shift assays show that both the A and B domains of HMGB1 as well as TBP discriminate between different platinum-DNA adducts. HMGB1 domain A is the most sensitive to the nature of the spectator ligands on platinum. The effect of the spectator ligands on protein binding also depends highly on the base pairs flanking the platinated d(GpG) site. Double-stranded oligonucleotides containing the AG*G*C sequence, where the asterisks denote the sites of platination, with different spectator ligands are only moderately discriminated by the HMGB proteins and TBP, but the recognition of dsTG*G*A is highly dependent on the ligands. The effects of HMGB1 overexpression in a BG-1 ovarian cancer cell line, induced by steroid hormones, on the sensitivity of cells treated with [Pt(1R,2R-diaminocyclohexane)Cl(2)] and cis-[Pt(NH(3))(cyclohexylamine)Cl(2)] were also examined. The results suggest that HMGB1 protein levels influence the cellular processing of cis-[Pt(NH(3))- (cyclohexylamine)](2+), but not [Pt((1R,2R)-diaminocyclohexane)](2+), DNA lesions. This result is consistent with the observed binding of HMGB1a to platinum-modified dsTG*G*A probes but not with the binding affinity of HMGB1a and HMGB1 to platinum-damaged dsAG*G*C oligonucleotides. These experiments reinforce the importance of sequence context in platinum-DNA lesion recognition by cellular proteins. PMID:11514569

Wei, M; Cohen, S M; Silverman, A P; Lippard, S J

2001-10-19

149

Ancient DNA from Hunter-Gatherer and Farmer Groups from Northern Spain Supports a Random Dispersion Model for the Neolithic Expansion into Europe  

PubMed Central

Background/Principal Findings The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. Methodology/Significance Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria). In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples) and replication of the results (43% of the samples) by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. Conclusion The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study) suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different impact on the various geographic regions, and thus contradicts the more simplistic total acculturation and replacement models proposed so far to explain Neolithisation.

Hervella, Montserrat; Izagirre, Neskuts; Alonso, Santos; Fregel, Rosa; Alonso, Antonio; Cabrera, Vicente M.; de la Rua, Concepcion

2012-01-01

150

Universal Plant DNA Barcode Loci May Not Work in Complex Groups: A Case Study with Indian Berberis Species  

PubMed Central

Background The concept of DNA barcoding for species identification has gained considerable momentum in animals because of fairly successful species identification using cytochrome oxidase I (COI). In plants, matK and rbcL have been proposed as standard barcodes. However, barcoding in complex genera is a challenging task. Methodology and Principal Findings We investigated the species discriminatory power of four reportedly most promising plant DNA barcoding loci (one from nuclear genome- ITS, and three from plastid genome- trnH-psbA, rbcL and matK) in species of Indian Berberis L. (Berberidaceae) and two other genera, Ficus L. (Moraceae) and Gossypium L. (Malvaceae). Berberis species were delineated using morphological characters. These characters resulted in a well resolved species tree. Applying both nucleotide distance and nucleotide character-based approaches, we found that none of the loci, either singly or in combinations, could discriminate the species of Berberis. ITS resolved all the tested species of Ficus and Gossypium and trnH-psbA resolved 82% of the tested species in Ficus. The highly regarded matK and rbcL could not resolve all the species. Finally, we employed amplified fragment length polymorphism test in species of Berberis to determine their relationships. Using ten primer pair combinations in AFLP, the data demonstrated incomplete species resolution. Further, AFLP analysis showed that there was a tendency of the Berberis accessions to cluster according to their geographic origin rather than species affiliation. Conclusions/Significance We reconfirm the earlier reports that the concept of universal barcode in plants may not work in a number of genera. Our results also suggest that the matK and rbcL, recommended as universal barcode loci for plants, may not work in all the genera of land plants. Morphological, geographical and molecular data analyses of Indian species of Berberis suggest probable reticulate evolution and thus barcode markers may not work in this case.

Roy, Sribash; Tyagi, Antariksh; Shukla, Virendra; Kumar, Anil; Singh, Uma M.; Chaudhary, Lal Babu; Datt, Bhaskar; Bag, Sumit K.; Singh, Pradhyumna K.; Nair, Narayanan K.; Husain, Tariq; Tuli, Rakesh

2010-01-01

151

Elevated levels of STAT1 in Fanconi anemia group A lymphoblasts correlate with the cells' sensitivity to DNA interstrand crosslinking drugs  

PubMed Central

Progressive bone marrow failure starting in the first decade of life is one of the main characteristics of Fanconi anemia. Along with the bone marrow failure, this pathology is characterized by congenital malformations, endocrine dysfunction and an extraordinary predisposition to develop cancer. The fact that hematopoietic progenitor cells from subjects with Fanconi anemia are sensitive to both DNA-interstrand crosslinking agents and inflammatory cytokines, which are aberrantly overproduced in these patients, has led to different explanations for the causes of the bone marrow failure. We analyzed STAT1 expression in lymphoblastoid cell lines derived from patients with Fanconi anemia group A and correlated this with aspects of the Fanconi anemia phenotype such as sensitivity to genotoxic agents or to inhibitory cytokines. We provide evidence of overexpression of STAT1 in FANCA-deficient cells which has both transcriptional and post-translational components, and is related to the constitutive activation of ERK in Fanconi anemia group A cells, since it can be reverted by treatment with U0126. STAT1 phosphorylation was not defective in the lymphoblasts, so these cells accumulated higher levels of active STAT1 in response to interferon gamma, probably in relation to their greater sensitivity to this cytokine. On the other hand, inhibition of STAT1 by genetic or chemical means reverted the hypersensitivity of Fanconi anemia group A lymphoblasts to DNA interstrand crosslinking agents. Our data provide an explanation for the mixed sensitivity of Fanconi anemia group A cells to both genotoxic stress and inflammatory cytokines and indicate new targets for the treatment of bone marrow failure in these patients.

Prieto-Remon, Ines; Sanchez-Carrera, Damaso; Lopez-Duarte, Monica; Richard, Carlos; Pipaon, Carlos

2013-01-01

152

Variations in sequence and occurrence of SSU rDNA group I introns in Monilinia fructicola isolates  

Microsoft Academic Search

A group I intron of 418 base pairs in the Monilinia fructicola ribosomal small-subunit se- quence was characterized. The absence of such an intron in M. laxa and M. fructigena led to a PCR test for M. fructicola identification based on the presence of this intron. The failure to amplify a PCR fragment for some isolates of M. fructicola recently

Allison J. Meldrum; Marie-Claude Tardif

2004-01-01

153

Ashkenazi Jewish mtDNA haplogroup distribution varies among distinct subpopulations: lessons of population substructure in a closed group  

Microsoft Academic Search

The quest for genes associated with diseases is widely recognized as an essential task in the effort to investigate the genetic basis of complex human disorders and traits. A basic stage in association studies is the careful choice of the model population, with preference to closed groups having little population substructure. Here, we show evidence for significant geographic substructure (P=0.017)

Jeanette Feder; Ofer Ovadia; Benjamin Glaser; Dan Mishmar

2007-01-01

154

Analysis of an Outbreak of Puerperal Fever Due to Group A Streptococci by Random Amplified Polymorphic DNA Fingerprinting  

PubMed Central

Objective: Streptococcus pyogenes is the cause of the classical childbed fever and can occur in both sporadic and epidemic form. Once an outbreak is identified on a maternity ward it is not only necessary to place the patients in strict isolation but also identify to the source of the infection. Fast reliable typing methods can aid in infection control. Methods: An outbreak of puerperal fever due to S. pyogenes was analyzed by random amplified polymorphic DNA (RAPD) analysis. Results: Identical fingerprint patterns were found in isolates of 3 patients, the throat and infected finger of the delivering obstetrician, 2 of the physician's family members, and from the cervix of a woman who was examined by the physician 7 months after the outbreak. The outbreak was stopped after antimicrobial treatment of the physician and his family members. Conclusions: RAPD typing appeared to be a fast and reliable tool for epidemiological studies of S. pyogenes and is probably more efficient in strain differentiation than classical M and T serotyping.

Muytjens, Harry L.; van den Berg, Paul P.; Voss, Andreas; Melchers, Willem J. G.

1997-01-01

155

Variations in sequence and occurrence of SSU rDNA group I introns in Monilinia fructicola isolates.  

PubMed

A group I intron of 418 base pairs in the Monilinia fructicola ribosomal small-subunit sequence was characterized. The absence of such an intron in M. laxa and M. fructigena led to a PCR test for M. fructicola identification based on the presence of this intron. The failure to amplify a PCR fragment for some isolates of M. fructicola recently lead to speculation that the intron might not be present always in M. fructicola. In this study, we analyzed 13 isolates of M. fructicola and found that the intron was absent in four isolates and we determined from sequence analysis that there are several nucleotide variations that allow the M. fructicola ribosomal SSU intron to be grouped into 6 polymorphic types. PMID:21148851

Côté, Marie-José; Prud'homme, Mireille; Meldrum, Allison J; Tardif, Marie-Claude

2004-01-01

156

Phylogeography of the blue tit ( Parus teneriffae -group) on the Canary Islands based on mitochondrial DNA sequence data and morphometrics  

Microsoft Academic Search

An analysis of the sequences of the mitochondrial cytochrome b gene (1005 bp) of the Parus teneriffae-group from the Canary Islands and North Africa revealed new insights into the phylogeography of this taxon. The origin of\\u000a the radiation on the Canarian Archipelago was apparently one of the central islands—Tenerife or Gran Canaria. The populations\\u000a on El Hierro (P. t. ombriosus) and

Christian Dietzen; Eduardo Garcia-del-Rey; Guillermo Delgado Castro; Michael Wink

2008-01-01

157

PolA1, a putative DNA polymerase I, is coexpressed with PerR and contributes to peroxide stress defenses of group A Streptococcus.  

PubMed

The peroxide stress response regulator PerR coordinates the oxidative-stress defenses of group A Streptococcus (GAS). We now show that PerR is expressed from an operon encoding a putative DNA polymerase I (PolA1), among other GAS products. A polA1 deletion mutant exhibited wild-type growth but showed reduced capacity to repair DNA damage caused by UV light or ciprofloxacin. Mutant bacteria were hypersensitive to H(2)O(2), compared with the wild type or a complemented mutant strain, and remained severely attenuated even after adaptation at sublethal H(2)O(2) levels, whereas wild-type bacteria could adapt to withstand peroxide challenge under identical conditions. The hypersensitivity of the mutant was reversed when bacteria were grown in iron-depleted medium and challenged in the presence of a hydroxyl radical scavenger, results that indicated sensitivity to hydroxyl radicals generated by Fenton chemistry. The peroxide resistance of a perR polA1 double mutant following adaptation at sublethal H(2)O(2) levels was decreased 9-fold relative to a perR single mutant, thus implicating PolA1 in PerR-mediated defenses against peroxide stress. Cultures of the polA1 mutant grown with or without prior H(2)O(2) exposure yielded considerably lower numbers of rifampin-resistant mutants than cultures of the wild type or the complemented mutant strain, a finding consistent with PolA1 lacking proofreading activity. We conclude that PolA1 promotes genome sequence diversity while playing an essential role in oxidative DNA damage repair mechanisms of GAS, dual functions predicted to confer optimal adaptive capacity and fitness in the host. Together, our studies reveal a unique genetic and functional relationship between PerR and PolA1 in streptococci. PMID:23204468

Toukoki, Chadia; Gryllos, Ioannis

2013-02-01

158

Overlapping roles of the methylated DNA-binding protein MBD1 and polycomb group proteins in transcriptional repression of HOXA genes and heterochromatin foci formation.  

PubMed

Methylated DNA binding domain (MBD) proteins and Polycomb group (PcG) proteins maintain epigenetic silencing of transcriptional activity. We report that the DNA methylation-mediated repressor MBD1 interacts with Ring1b and hPc2, the major components of Polycomb repressive complex 1. The cysteine-rich CXXC domains of MBD1 bound to Ring1b and the chromodomain of hPc2. Chromatin immunoprecipitation analysis revealed that MBD1 and hPc2 were present in silenced Homeobox A (HOXA) genes which could be reactivated by knockdown of either MBD1 or hPc2, suggesting that MBD1 and hPc2 cooperate for transcriptional repression of HOXA genes. In the nuclei of HeLa cells, MBD1 existed in close association with these PcG proteins in some heterochromatin foci, whereas an MBD1 mutant lacking the CXXC domains or an hPc2 mutant lacking the chromodomain lost this colocalization in foci. Use of the DNA demethylating agent 5-azadeoxycytidine abolished the formation of MBD1 foci but not PcG foci. Knockdown of MBD1 by small interfering RNAs did not affect the foci containing hPc2 and Ring1b, whereas the MBD1 foci were not influenced by knockdown of hPc2. These indicate that the heterochromatin foci showing MBD1 and hPc2 colocalization arise through the interaction of MBD1 and hPc2 and that the foci of MBD1 are separable from those of the PcG proteins per se. Our present findings suggest that MBD1 and PcG proteins have overlapping roles in epigenetic gene silencing and heterochromatin foci formation through their interactions. PMID:17428788

Sakamoto, Yasuo; Watanabe, Sugiko; Ichimura, Takaya; Kawasuji, Michio; Koseki, Haruhiko; Baba, Hideo; Nakao, Mitsuyoshi

2007-06-01

159

PolA1, a Putative DNA Polymerase I, Is Coexpressed with PerR and Contributes to Peroxide Stress Defenses of Group A Streptococcus  

PubMed Central

The peroxide stress response regulator PerR coordinates the oxidative-stress defenses of group A Streptococcus (GAS). We now show that PerR is expressed from an operon encoding a putative DNA polymerase I (PolA1), among other GAS products. A polA1 deletion mutant exhibited wild-type growth but showed reduced capacity to repair DNA damage caused by UV light or ciprofloxacin. Mutant bacteria were hypersensitive to H2O2, compared with the wild type or a complemented mutant strain, and remained severely attenuated even after adaptation at sublethal H2O2 levels, whereas wild-type bacteria could adapt to withstand peroxide challenge under identical conditions. The hypersensitivity of the mutant was reversed when bacteria were grown in iron-depleted medium and challenged in the presence of a hydroxyl radical scavenger, results that indicated sensitivity to hydroxyl radicals generated by Fenton chemistry. The peroxide resistance of a perR polA1 double mutant following adaptation at sublethal H2O2 levels was decreased 9-fold relative to a perR single mutant, thus implicating PolA1 in PerR-mediated defenses against peroxide stress. Cultures of the polA1 mutant grown with or without prior H2O2 exposure yielded considerably lower numbers of rifampin-resistant mutants than cultures of the wild type or the complemented mutant strain, a finding consistent with PolA1 lacking proofreading activity. We conclude that PolA1 promotes genome sequence diversity while playing an essential role in oxidative DNA damage repair mechanisms of GAS, dual functions predicted to confer optimal adaptive capacity and fitness in the host. Together, our studies reveal a unique genetic and functional relationship between PerR and PolA1 in streptococci.

Toukoki, Chadia

2013-01-01

160

Functional constraints and evolutionary dynamics of the repeats in the rDNA internal transcribed spacer 2 of members of the Anopheles barbirostris group  

PubMed Central

Background The Anopheles barbirostris group is widely distributed in Southeast Asia. Although seven species have been formally described, a molecular analysis of the rDNA ITS2 and the mitochondrial cytochrome oxidase I gene suggests that the group includes species that are morphologically very similar or identical. We have previously shown that species in the Anopheles barbirostris Subgroup have an exceptionally large ITS2 (>1.5 kb), greater than in any other Anopheline group. However, the molecular processes responsible for generating such a large ITS2 have not previously been explored. Methods To determine the processes by which this large ITS2 is generated, we examined the sequence and secondary structure of the ITS2 of 51 specimens from five species of the Anopheles barbirostris Subgroup. These include the anthropophilic species An. campestris and three morphospecies of the Barbirostris Complex: An. vanderwulpi, An. barbirostris I and III, together with a previously undescribed member of this group (Clade IV). Results and conclusions All the specimens were found to have an ITS2 greater than 1.5 kb in length. The possibility that the spacer sequences amplified were pseudogenes was examined and discarded. The large size of ITS2 in the species studied is due to the presence of internal repeats of approximately 110 bp in length, confined to the central region of the spacer. Repeats varied markedly between the species examined, with respect to their organization, number and sequence similarity. The nucleotide diversity increased in direct relation to size variation and the presence of non-repeated elements. A secondary structure analysis showed that the repeats form hairpin structures with a wide range of free energy values. These hairpin structures are known to facilitate the subsequent processing of mature rRNA. An analysis of the repeats from the different species suggests they originate from a common ancestor, with the repeats appearing before speciation of the Barbirostris Group.

2014-01-01

161

Characterization of polybacterial clinical samples using a set of group-specific broad-range primers targeting the 16S rRNA gene followed by DNA sequencing and RipSeq analysis  

PubMed Central

The standard use of a single universal broad-range PCR in direct 16S rDNA sequencing from polybacterial samples leaves the minor constituents at risk of remaining undetected because all bacterial DNA will be competing for the same reagents. In this article we introduce a set of three broad-range group-specific 16S rDNA PCRs that together cover the clinically relevant bacteria and apply them in the investigation of 25 polybacterial clinical samples. Mixed DNA chromatograms from samples containing more than one species per primer group were analysed using RipSeq Mixed (iSentio, Norway), a web-based application for the interpretation of chromatograms containing up to three different species. The group-specific PCRs reduced complexity in the resulting DNA chromatograms and made the assay more sensitive in situations with unequal species concentrations. Together this allowed for identification of a significantly higher number of bacterial species than did standard direct sequencing with a single universal primer pair and RipSeq analysis (95 vs 51). The method could improve microbiological diagnostics for important groups of patients and can be established in any laboratory with experience in direct 16S rDNA sequencing.

Lekang, Katrine; Langeland, Nina; Wiker, Harald G.

2011-01-01

162

Redox-mediated Mechanisms Regulate DNA Binding Activity of the G-group of Basic Region Leucine Zipper (bZIP) Transcription Factors in Arabidopsis*  

PubMed Central

Plant genes that contain the G-box in their promoters are responsive to a variety of environmental stimuli. Bioinformatics analysis of transcriptome data revealed that the G-box element is significantly enriched in promoters of high light-responsive genes. From nuclear extracts of high light-treated Arabidopsis plants, we identified the AtbZIP16 transcription factor as a component binding to the G-box-containing promoter fragment of light-harvesting chlorophyll a/b-binding protein2.4 (LHCB2.4). AtbZIP16 belongs to the G-group of Arabidopsis basic region leucine zipper (bZIP) type transcription factors. Although AtbZIP16 and its close homologues AtbZIP68 and AtGBF1 bind the G-box, they do not bind the mutated half-sites of the G-box palindrome. In addition, AtbZIP16 interacts with AtbZIP68 and AtGBF1 in the yeast two-hybrid system. A conserved Cys residue was shown to be necessary for redox regulation and enhancement of DNA binding activity in all three proteins. Furthermore, transgenic Arabidopsis lines overexpressing the wild type version of bZIP16 and T-DNA insertion mutants for bZIP68 and GBF1 demonstrated impaired regulation of LHCB2.4 expression. Finally, overexpression lines for the mutated Cys variant of bZIP16 provided support for the biological significance of Cys330 in redox regulation of gene expression. Thus, our results suggest that environmentally induced changes in the redox state regulate the activity of members of the G-group of bZIP transcription factors.

Shaikhali, Jehad; Noren, Louise; de Dios Barajas-Lopez, Juan; Srivastava, Vaibhav; Konig, Janine; Sauer, Uwe H.; Wingsle, Gunnar; Dietz, Karl-Josef; Strand, ?sa

2012-01-01

163

Broad and Cross-Clade CD4+ T-Cell Responses Elicited by a DNA Vaccine Encoding Highly Conserved and Promiscuous HIV-1 M-Group Consensus Peptides  

PubMed Central

T-cell based vaccine approaches have emerged to counteract HIV-1/AIDS. Broad, polyfunctional and cytotoxic CD4+ T-cell responses have been associated with control of HIV-1 replication, which supports the inclusion of CD4+ T-cell epitopes in vaccines. A successful HIV-1 vaccine should also be designed to overcome viral genetic diversity and be able to confer immunity in a high proportion of immunized individuals from a diverse HLA-bearing population. In this study, we rationally designed a multiepitopic DNA vaccine in order to elicit broad and cross-clade CD4+ T-cell responses against highly conserved and promiscuous peptides from the HIV-1 M-group consensus sequence. We identified 27 conserved, multiple HLA-DR-binding peptides in the HIV-1 M-group consensus sequences of Gag, Pol, Nef, Vif, Vpr, Rev and Vpu using the TEPITOPE algorithm. The peptides bound in vitro to an average of 12 out of the 17 tested HLA-DR molecules and also to several molecules such as HLA-DP, -DQ and murine IAb and IAd. Sixteen out of the 27 peptides were recognized by PBMC from patients infected with different HIV-1 variants and 72% of such patients recognized at least 1 peptide. Immunization with a DNA vaccine (HIVBr27) encoding the identified peptides elicited IFN-? secretion against 11 out of the 27 peptides in BALB/c mice; CD4+ and CD8+ T-cell proliferation was observed against 8 and 6 peptides, respectively. HIVBr27 immunization elicited cross-clade T-cell responses against several HIV-1 peptide variants. Polyfunctional CD4+ and CD8+ T cells, able to simultaneously proliferate and produce IFN-? and TNF-?, were also observed. This vaccine concept may cope with HIV-1 genetic diversity as well as provide increased population coverage, which are desirable features for an efficacious strategy against HIV-1/AIDS.

Almeida, Rafael Ribeiro; Rosa, Daniela Santoro; Ribeiro, Susan Pereira; Santana, Vinicius Canato; Kallas, Esper Georges; Sidney, John; Sette, Alessandro; Kalil, Jorge; Cunha-Neto, Edecio

2012-01-01

164

Design, synthesis, and DNA binding characteristics of a group of orthogonally positioned diamino, N-formamido, pyrrole- and imidazole-containing polyamides.  

PubMed

Orthogonally positioned diamino/dicationic polyamides (PAs) have good water solubility and enhanced binding affinity, whilst retaining DNA minor groove and sequence specificity compared to their monoamino/monocationic counterparts. The synthesis and DNA binding properties of the following diamino PAs: f-IPI (3a), f-IPP (4), f-PIP (5), and f-PPP (6) are described. P denotes the site where a 1-propylamino group is attached to the N1-position of the heterocycle. Binding of the diamino PAs to DNA was assessed by DNase I footprinting, thermal denaturation, circular dichroism titration, biosensor surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC) studies. According to SPR studies, f-IPI (3a) bound more strongly (K(eq)=2.4×10(8) M(-1)) and with comparable sequence selectivity to its cognate sequence 5'-ACGCGT-3' when compared to its monoamino analog f-IPI (1). The binding of f-IPI (3a) to 5'-ACGCGT-3' via the stacked dimer motif was balanced between enthalpy and entropy, and that was quite different from the enthalpy-driven binding of its monoamino parent f-IPI (1). f-IPP (4) also bound more strongly to its cognate sequence 5'-ATGCAT-3' (K(eq)=7.4×10(6) M(-1)) via the side-by-side stacked motif than its monoamino analog f-IPP (2a). Although f-PPP (6) bound via a 1:1 motif, it bound strongly to its cognate sequence 5'-AAATTT-3' (K(eq)=4.8×10(7) M(-1)), 15-times higher than the binding of its monoamino analog f-PPP (2c), albeit f-PPP bound via the stacked motif. Finally, f-PIP (5) bound to its target sequence 5'-ATCGAT-3' as a stacked dimer and it has the lowest affinity among the diamino PAs tested (Keq <1×10(5) M(-1)). This was about two times lower in affinity than the binding of its monoamino analog f-PIP (2b). The results further demonstrated that the 'core rules' of DNA recognition by monoamino PAs also apply to their diamino analogs. Specifically, PAs that contain a stacked IP core structure bind most strongly (highest binding constants) to their cognate GC doublet, followed by the binding of PAs with a stacked PP structure to two degenerate AT base pairs, and finally the binding of PAs with a PI core to their cognate CG doublet. PMID:23647824

Chavda, Sameer; Babu, Balaji; Patil, Pravin; Plaunt, Adam; Ferguson, Amanda; Lee, Megan; Tzou, Samuel; Sjoholm, Robert; Rice, Toni; Mackay, Hilary; Ramos, Joseph; Wang, Shuo; Lin, Shicai; Kiakos, Konstantinos; Wilson, W David; Hartley, John A; Lee, Moses

2013-07-01

165

Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA.  

PubMed Central

Restriction fragment length polymorphism (RFLP) analysis of PCR-amplified genes was used to study spotted fever group (SFG) rickettsiae, extending the previous work of Regnery et al. (R.L. Regnery, C.L. Spruill, and B.D. Plikaytis, J. Bacteriol. 173:1576-1589, 1991). Twenty-six strains of SFG rickettsia were studied, including several recognized species which have never been studied (R. parkeri, R. helvetica, and R. japonica) as well as strains which are not currently classified. Two previously used primer pairs derived from the R. prowazekii citrate syntase gene and the R. rickettsii 190-kDa protein antigen gene were studied, as were primer pairs obtained from the R. rickettsii 120-kDa protein antigen gene. By using three amplifications and three enzyme digestions, it was possible to differentiate between almost all of the known SFG rickettsia species and to differentiate between several strains of the R. conorii complex. Two human pathogens, "R. africae" and the Israeli tick typhus rickettsia, were first separated by using BG-12 pair primer amplification and then RsaI restriction endonuclease digestion. The proposed simplified model of identification may be useful in studying the geographical distributions of SFG rickettsiae. Images

Eremeeva, M; Yu, X; Raoult, D

1994-01-01

166

DNA Sequencing Research Group (DSRG): Evaluation of RNA Amplification Kits at Subnanogram Input Amounts of Total RNA for RNA-Seq  

PubMed Central

Multiple recent publications on RNA-Seq have demonstrated the power of next generation sequencing technologies in whole transcriptome analysis. The vendor specific protocols used for RNA library construction typically require at least 100ng of total RNA. However, under certain conditions such as single cells, stem cells, difficult to isolate cell types, or fractionated cancer cells, only a small amount of material is available. In these cases, effective transcriptome profiling requires amplification of subnanogram amounts of RNA. Several RNA amplification kits are available for amplification prior to library construction and next generation sequencing but these kits have not been comprehensively field evaluated for accuracy and performance of RNA-Seq for picogram amounts of RNA. This study conducted by the DNA Sequencing Research Group (DSRG) focuses on the evaluation of amplification kits for RNA-Seq. Four commercial amplification kits were chosen: Ovation v2 (NuGEN Technologies), SMARTer (Clontech), Seqplex (Sigma Aldrich), and Super-AMP (Miltenyi Biotech). Starting material was 5ng, 500pg and 50pg of human total reference RNA (Clontech) spiked with Ambion ERCC control mix (Life Technologies) following the manufacturer's protocol. Each kit was tested at 3 different sites to assess reproducibility. Total RNA and ERCC RNA spike-in control mixes from the same lots were sent to 12 ABRF lab sites for amplification and cDNA generation. Ideally, this would have resulted in 36 different amplified samples, 3 from each input RNA. Libraries were constructed at one site from the amplified cDNAs using the TruSeq RNA library preparation kit on the Tecan Freedom EVO Liquid Handling Robot. As an unamplified control, ribosomal depletion and PolyA selection were performed separately using 5ng, 100ng and 1ug of total RNA prior to library construction. All libraries were pooled and sequenced using the Illumina HiSeq platform. An overview of the study and the results will be presented.

Nicolet, Charles; Paulson, Ariel; Shanker, Savita; Beckloff, N.; Bintzler, D.; Bivens, N. J.; Davis, R. R.; Donnelly, R. J.; Edenberg, H. J.; Gillaspy, A. F.; Grove, D.; Jafari, N.; Kerley-Hamilton, J. S.; Lashley, K.; Lyons, R. H.; Peak, A.; Perera, A.; Thimmapuram, J.; Wang, L.; Wright, C. L.; Alekseyev, Y.

2013-01-01

167

Molecular cloning, sequence, and expression of a human GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase cDNA that can form the H blood group antigen.  

PubMed

We have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase [alpha(1,2)FT; EC 2.4.1.69]. Although this fragment determined expression of an alpha(1,2)FT whose kinetic properties mirror those of the human H blood group alpha(1,2)FT, their precise nature remained undefined. We describe here the molecular cloning, sequence, and expression of a human cDNA corresponding to these human genomic sequences. When expressed in COS-1 cells, this cDNA directs expression of cell surface H structures and a cognate alpha(1,2)FT activity with properties analogous to the human H blood group alpha(1,2)FT. The cDNA sequence predicts a 365-amino acid polypeptide characteristic of a type II transmembrane glycoprotein with a domain structure analogous to that of other glycosyltransferases but without significant primary sequence similarity to these or other known proteins. To directly demonstrate that the cDNA encodes an alpha(1,2)FT, the COOH-terminal domain predicted to be Golgi-resident was expressed in COS-1 cells as a catalytically active, secreted, and soluble protein A fusion peptide. Southern blot analysis showed that this cDNA identifies DNA sequences syntenic to the human H locus on chromosome 19. These results strongly suggest that this cloned alpha(1,2)FT cDNA represents the product of the human H blood group locus. PMID:2118655

Larsen, R D; Ernst, L K; Nair, R P; Lowe, J B

1990-09-01

168

Mucosal Immunization with High-Mobility Group Box 1 in Chitosan Enhances DNA Vaccine-Induced Protection against Coxsackievirus B3-Induced Myocarditis  

PubMed Central

Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis.

Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei

2013-01-01

169

Molecular characterisation of vegetative compatibility groups in Fusarium oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici by random amplification of polymorphic DNA and microsatellite-primed PCR  

Microsoft Academic Search

Random amplification of polymorphic DNA (RAPD-PCR) analysis was conducted on 48 isolates of Fusarium oxysporum f. sp. radicis-lycopersici (F.o.r.l.) from different geographic regions, representing all known vegetative compatibility groups (VCGs) except VCG 0097 and VCG 0099 and on eight isolates of F.oxysporum f. sp. lycopersici (F.o.l.), representing VCGs 0030, 0031, 0032 and 0033. Upon UPGMA (unweighted pair-group method with arithmetic

Virgilio Balmas; Barbara Scherm; Pietro Di Primo; Domenico Rau; Angela Marcello; Quirico Migheli

2005-01-01

170

Divergent DNA-Binding Specificities of a Group of ETHYLENE RESPONSE FACTOR Transcription Factors Involved in Plant Defense1[C][W  

PubMed Central

Transcription factors (TFs) recognize target DNA sequences with distinct DNA-binding domains (DBDs). The DBD of Arabidopsis (Arabidopsis thaliana) ETHYLENE RESPONSE FACTOR1 (AtERF1) uses three consecutive ?-strands to recognize a GCC-containing sequence, but tobacco (Nicotiana tabacum) ERF189 and periwinkle (Catharanthus roseus) Octadecanoid-derivative Responsive Catharanthus AP2-domain protein3 (ORCA3) of the same TF subgroup appear to target similar but divergent DNA sequences. Here, we examined how DNA-binding specificities of these TFs have diverged in each plant lineage to regulate distinct defense metabolisms. Extensive mutational analyses of these DBDs suggest that two modes of protein-DNA interactions independently contribute to binding specificity and affinity. Substitution of a conserved arginine to lysine in the first ?-strand of ERF189 relaxes its interaction with the second GC pair of the GCC DNA sequence. By contrast, an increased number of basic amino acids in the first two ?-strands of ORCA3 allows this TF to recognize more than one GCC-related target, presumably via increased electrostatic interactions with the negatively charged phosphate backbone of DNA. Divergent DNA-binding specificities of the ERFs may have arisen through mutational changes of these amino acid residues.

Shoji, Tsubasa; Mishima, Masaki; Hashimoto, Takashi

2013-01-01

171

High mobility group chromosomal protein 1 binds to the adeno-associated virus replication protein (Rep) and promotes Rep-mediated site-specific cleavage of DNA, ATPase activity and transcriptional repression.  

PubMed Central

High mobility group protein 1 (HMG1) is an abundant non-histone chromosomal protein which plays a role in several nuclear events involving DNA. Here we demonstrate that HMG1 physically interacts with the human adeno-associated virus (AAV) Rep protein. HMG1 promotes the formation of Rep-DNA complexes and stimulates the activity of Rep in site- and strand-specific cleavage of DNA and the hydrolysis of ATP, functions required for viral gene regulation, replication and site-specific integration of viral DNA into human chromosome 19. We show that HMG1 enhances Rep-mediated repression of the AAV p5 promoter in transfected cells, suggesting that HMG1 and Rep also interact in vivo. HMG1, Rep and DNA can be immunoprecipitated as a ternary complex. Kinetic studies indicate that complexes of Rep with DNA have similar stabilities in the presence and absence of HMG1.These results suggest that the effect of HMG1 on Rep binding is exerted at the step of complex formation and thereby may reflect an activity of HMG1 in promoting the assembly of complex cellular nucleoprotein structures.

Costello, E; Saudan, P; Winocour, E; Pizer, L; Beard, P

1997-01-01

172

DNA Fingerprinting  

NSDL National Science Digital Library

In this forensics activity, learners solve a mystery using âDNAâ taken from the scene of the crime. This activity describes how to collect a âDNA sampleâ (learner-invented DNA sequence on a roll of paper) from the culprit and from each learner in the group, then run the DNA on a âgelâ that covers the floor of the classroom, a hallway, or gymnasium. The crime-scene investigation aspect can become as elaborate as you wish by including additional âcluesâ such as fingerprints, a ransom note written in a specific type of ink, cloth fibers, eyewitness accounts and more.

Salter, Irene

2012-06-26

173

Phosphorus-nitrogen compounds: Part 28. Syntheses, structural characterizations, antimicrobial and cytotoxic activities, and DNA interactions of new phosphazenes bearing vanillinato and pendant ferrocenyl groups  

NASA Astrophysics Data System (ADS)

The gradually Cl replacement reactions of spirocyclic mono (1 and 2) and bisferrocenyl cyclotriphosphazenes (3-5) with the potassium salt of 4-hydroxy-3-methoxybenzaldehyde (potassium vanillinate) gave mono (1a-5a), geminal (gem-1b-5b), non-geminal (cis-1b, cis-5b and trans-2b-5b), tri (1c-5c) and tetra-substituted phosphazenes (1d-5d). Some phosphazenes have stereogenic P-center(s). The chirality of 4c was verified using chiral HPLC column. Electrochemical behaviors were influenced only by the number of ferrocene groups, but not the length of the amine chains and the substituent(s). The structures of the new phosphazenes were determined by FTIR, MS, 1H, 13C and 31P NMR, HSQC and HMBC spectral data. The solid-state structures of cis-1b and 4d were examined by single crystal X-ray diffraction techniques. The twelve phosphazene derivatives were screened for antimicrobial activity and the compounds 5a, cis-1b and 2c exhibited the highest antibacterial activity against G(+) and G(-) bacteria. In addition, it was found that overall gem-1b inhibited the growth of Mycobacterium tuberculosis. The compounds 1d, 2d and 4d were tested in HeLa cancer cell lines. Among these compounds, 2d had cytotoxic effect on HeLa cell in the first 48 h. Moreover, interactions between compounds 2a, gem-1b, gem-2b, cis-1b, 2c, 3c, 4c, 5c, 1d, 2d and 4d, and pBR322 plasmid DNA were investigated.

Tümer, Yasemin; Asmafiliz, Nuran; K?l?ç, Zeynel; Hökelek, Tuncer; Yasemin Koç, L.; Aç?k, Leyla; Yola, Mehmet Lütfi; Solak, Ali Osman; Öner, Ya?mur; Dündar, Devrim; Yavuz, Makbule

2013-10-01

174

Reactions of 5-methylcytosine cation radicals in DNA and model systems: Thermal deprotonation from the 5-methyl group vs. excited state deprotonation from sugar.  

PubMed

Abstract Purpose: To study the formation and subsequent reactions of the 5-methyl-2'-deoxycytidine cation radical (5-Me-2'-dC•(+)) in nucleosides and DNA-oligomers and compare to one-electron oxidized thymidine. Materials and methods: Employing electron spin resonance (ESR), cation radical formation and its reactions were investigated in 5-Me-2'-dC, thymidine (Thd) and their derivatives, in fully double-stranded (ds) d[GC*GC*GC*GC*]2 and in the 5-Me-C/A mismatched, d[GGAC*AAGC:CCTAATCG], where C* = 5-Me-C. Results: We report 5-Me-2'-dC•(+) production by one-electron oxidation of 5-Me-2'-dC by Cl2•- via annealing in the dark at 155 K. Progressive annealing of 5-Me-2'-dC•(+) at 155 K produces the allylic radical (C-CH2•). However, photoexcitation of 5-Me-2'-dC•(+) by 405 nm laser or by photoflood lamp leads to only C3'• formation. Photoexcitation of N3-deprotonated thyminyl radical in Thd and its 5'-nucleotides leads to C3'• formation but not in 3'-TMP which resulted in the allylic radical (U-CH2•) and C5'• production. For excited 5-Me-2',3'-ddC•(+), absence of the 3'-OH group does not prevent C3'• formation. For d[GC*GC*GC*GC*]2 and d[GGAC*AAGC:CCTAATCG], intra-base paired proton transferred form of G cation radical (G(N1-H)•: C(+ H(+))) is found with no observable 5-Me-2'-dC•(+) formation. Photoexcitation of (G(N1-H)•:C(+ H(+))) in d[GC*GC*GC*GC*]2 produced only C1'• and not the expected photoproducts from 5-Me-2'-dC•(+). However, photoexcitation of (G(N1-H)•:C(+ H(+))) in d[GGAC*AAGC:CCTAATCG] led to C5'• and C1'• formation. Conclusions: C-CH2• formation from 5-Me-2'-dC•(+) occurs via ground state deprotonation from C5-methyl group on the base. In the excited 5-Me-2'-dC•(+) and 5-Me-2',3'-ddC•(+), spin and charge localization at C3' followed by deprotonation leads to C3'• formation. Thus, deprotonation from C3' in the excited cation radical is kinetically controlled and sugar C-H bond energies are not the only controlling factors in these deprotonations. PMID:24428230

Adhikary, Amitava; Kumar, Anil; Palmer, Brian J; Todd, Andrew D; Heizer, Alicia N; Sevilla, Michael D

2014-06-01

175

The sequences of heat shock protein 40 (DnaJ) homologs provide evidence for a close evolutionary relationship between the Deinococcus- Thermus group and cyanobacteria  

Microsoft Academic Search

The genes encoding for heat shock protein 40 (Hsp40 or DnaJ) homologs were cloned and sequenced from the archaebacterium Halobacterium cutirubrum and the eubacterium Deinococcus proteolyticus to add to sequences from the gene banks. These genes were identified downstream of the Hsp70 (or DnaK) genes in genomic fragments spanning this region and, as in other prokaryotic species, Hsp70- Hsp40 genes

Kevin Bustard; Radhey S. Gupta

1997-01-01

176

Mono(ADP-ribosyl)ation of the N 2 amino groups of guanine residues in DNA by pierisin-2, from the cabbage butterfly, Pieris brassicae  

Microsoft Academic Search

Pierisin-2 is a cytotoxic and apoptosis-inducing protein present in Pieris brassicae with a 91% homology in the deduced amino acid sequences to pierisin-1 from Pieris rapae. We earlier showed pierisin-1 to catalyze mono(ADP-ribosyl)ation of 2?-deoxyguanosine (dG) in DNA to form N2-(ADP-ribos-1-yl)-2?-deoxyguanosine, this DNA modification appearing linked to its cytotoxicity and ability to induce apoptosis in mammalian cell lines. In this

Takeji Takamura-Enya; Masahiko Watanabe; Kotaro Koyama; Takashi Sugimura; Keiji Wakabayashi

2004-01-01

177

Unique grouping of the Far East Asian begomovirus complex based on sequence analyses of the DNA-A genome and associated DNAbeta satellite molecules isolated from tomato, honeysuckle and Eupatorium plants in Japan.  

PubMed

Nucleotide (nt) sequencing has contributed to the identification of virus species and has also proved diagnostically useful in the control of tomato-infecting begomoviruses disease. We determined the complete nt sequences of the DNA-A genome and its cognate DNAbeta satellite molecules in isolates of Tobacco leaf curl Japan virus, Honeysuckle yellow vein mosaic virus, Eupatorium yellow vein virus in Japan. Pairwise comparison analyses based on the nt sequences of DNA-A from the genetic group of these viruses tentatively named as TbLCJV, HYVMV and EpYVV (TbJV/HYV/EpV) revealed that this group had a significance threshold of 84 % identity. Phylogenetic relationship analyses of the nt sequences of DNA-A and DNAbeta revealed that their isolates were separated into a discrete Far East Asian clade, distinct from all other begomoviruses. This clade was divided into two distinct clusters comprising the subgroups TbJV/HYV and EpV. Furthermore, recombination analysis revealed that members of the TbJV/HYV/EpV group had the genetic variation indicative of many recombination events. Our study demonstrates that this group forms a unique species complex, but that members have discrete lineages depending on their natural perennial host plants. PMID:18175045

Ueda, S; Onuki, M; Hanada, K; Takanami, Y

2008-01-01

178

I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3  

PubMed Central

Homing endonucleases encoded in a group I self-splicing intron in a protein-coding gene in cyanophage genomes have not been reported, apart from some free-standing homing edonucleases. In this study, a nicking DNA endonuclease, I-PfoP3I, encoded in a group IA2 intron in the DNA polymerase gene of a T7-like cyanophage Pf-WMP3, which infects the freshwater cyanobacterium Phormidium foveolarum is described. The Pf-WMP3 intron splices efficiently in vivo and self-splices in vitro simultaneously during transcription. I-PfoP3I belongs to the HNH family with an unconventional C-terminal HNH motif. I-PfoP3I nicks the intron-minus Pf-WMP3 DNA polymerase gene more efficiently than the Pf-WMP4 DNA polymerase gene that lacks any intervening sequence in vitro, indicating the variable capacity of I-PfoP3I. I-PfoP3I cleaves 4 nt upstream of the intron insertion site on the coding strand of EXON 1 on both intron-minus Pf-WMP3 and Pf-WMP4 DNA polymerase genes. Using an in vitro cleavage assay and scanning deletion mutants of the intronless target site, the minimal recognition site was determined to be a 14 bp region downstream of the cut site. I-PfoP3I requires Mg2+, Ca2+ or Mn2+ for nicking activity. Phylogenetic analysis suggests that the intron and homing endonuclease gene elements might be inserted in Pf-WMP3 genome individually after differentiation from Pf-WMP4. To our knowledge, this is the first report of the presence of a group I self-splicing intron encoding a functional homing endonuclease in a protein-coding gene in a cyanophage genome.

Kong, Shuanglei; Liu, Xinyao; Fu, Liwen; Yu, Xiangchun; An, Chengcai

2012-01-01

179

Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses  

PubMed Central

Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types.

Krupovic, Mart; Koonin, Eugene V.

2014-01-01

180

Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses.  

PubMed

Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types. PMID:24939392

Krupovic, Mart; Koonin, Eugene V

2014-01-01

181

Use of SSU rDNA group-I intron to distinguish Monilinia fructicola from M. laxa and M. fructigena 1 EMBL accession numbers: Y14210, Y14211. 1  

Microsoft Academic Search

Monilinia fructicola, M. laxa and M. fructigena are the causal agents of brown rot of pome and stone fruits. M. fructicola is not present in Europe and is classed as a quarantine pathogen in EU countries. A 418-bp group-I intron has been located in the small subunit (SSU) rDNA gene of M. fructicola which is absent from M. laxa and

Ciaran E Fulton; Averil E Brown

1997-01-01

182

Randomly amplified polymorphic DNA analysis of Trypanosoma rangeli and allied species from human, monkeys and other sylvatic mammals of the Brazilian Amazon disclosed a new group and a species-specific marker.  

PubMed

We characterized 14 trypanosome isolates from sylvatic mammals (9 from primates, 1 from sloth, 2 from anteaters and 2 from opossum) plus 2 human isolates of Brazilian Amazon. These isolates were proven to be Trypanosoma rangeli by detection of metacyclic trypomastigotes in the salivary glands of triatomines and by a specific PCR assay. Polymorphism determined by randomly amplified polymorphic DNA (RAPD) revealed that most (12) of the Brazilian T. rangeli isolates from the Amazon differed from those of other geographical regions, thus constituting a new group of T. rangeli. Four Brazilian isolates clustered together with a previously described group (A) that was described as being composed of isolates from Colombia and Venezuela. Isolates from Panama and El Salvador form another group. The isolate from Southern Brazil did not cluster to any of the above-mentioned groups. This is the first study that assesses the genetic relationship of a large number of isolates from wild mammals, especially from non-human primates. A randomly-amplified DNA fragment (Tra625) exclusive to T. rangeli was used to develop a PCR assay able to detect all T. rangeli groups. PMID:15074877

Maia da Silva, F; Rodrigues, A C; Campaner, M; Takata, C S A; Brigido, M C; Junqueira, A C V; Coura, J R; Takeda, G F; Shaw, J J; Teixeira, M M G

2004-03-01

183

Germ-Line Variants in Methyl-Group Metabolism Genes and Susceptibility to DNA Methylation in Normal Tissues and Human Primary Tumors1  

Microsoft Academic Search

Aberrant DNA methylation is recognized as being a common feature of human neoplasia. CpG island hypermethylation and global genomic hy- pomethylation occur simultaneously in the cancer cell. However, very little is known about the interindividual inherited susceptibility to these epigenetic processes. To address this matter, we have genotyped in 233 cancer patients (with colorectal, breast, or lung tumors), four germ-line

Maria F. Paz; Sonia Avila; Mario F. Fraga; Marina Pollan; Gabriel Capella; Miquel Angel Peinado; Montserrat Sanchez-Cespedes; James G. Herman; Manel Esteller

184

Detection of potentially valuable polymorphisms in four group I intron insertion sites at the 3'-end of the LSU rDNA genes in biocontrol isolates of Metarhizium anisopliae  

PubMed Central

Background The entomopathogenic anamorphic fungus Metarhizum anisopliae is currently used as a biocontrol agent (BCA) of insects. In the present work, we analyzed the sequence data obtained from group I introns in the large subunit (LSU) of rDNA genes with a view to determining the genetic diversity present in an autochthonous collection of twenty-six M. anisopliae isolates selected as BCAs. Results DNA fragments corresponding to the 3'-end of the nuclear LSU rDNA genes of 26 M. anisopliae isolates were amplified by PCR. The amplicon sizes ranged from 0.8 to 3.4-kb. Four intron insertion sites, according to Escherichia coli J01695 numbering, were detected- Ec1921, Ec2066, Ec2449 and Ec2563- after sequencing and analysis of the PCR products. The presence/absence of introns allowed the 26 isolates to be distributed into seven genotypes. Nine of the isolates tested showed no introns, 4 had only one, 3 two, and 10 displayed three introns. The most frequent insertion sites were Ec1921 and Ec2449. Of the 26 isolates, 11 showed insertions at Ec2563 and a 1754-bp sequence was observed in ten of them. The most-parsimonious (MP) tree obtained from parsimony analysis of the introns revealed a main set containing four-groups that corresponded to the four insertion sites. Conclusion Four insertion sites of group I introns in the LSU rDNA genes allowed the establishment of seven genotypes among the twenty-six biocontrol isolates of M. anisopliae. Intron insertions at the Ec2563 site were observed for first time in this species.

Marquez, Marcela; Iturriaga, Enrique A; Quesada-Moraga, Enrique; Santiago-Alvarez, Candido; Monte, Enrique; Hermosa, Rosa

2006-01-01

185

A biosensing of Toxoplasma gondii DNA with CdTe/Fe3O4 dual functional quantum dot as reporter group  

NASA Astrophysics Data System (ADS)

Toxoplasma gondii is an intestinal coccidium that parasitizes members of the cat family as definitive hosts and has a wide range of intermediate hosts. Infection is common in many warm-blooded animals, including humans, the early detection of Toxoplasma gondii was concerned in recent years. In the current research, we presented a fast, specific, and sensitive sensing probe to detect Toxoplasma gondii DNA based on mechanism of fluorescence energy transfer (FRET), and a magnetic-fluorescent CdTe/Fe3O4 core-shell quantum dots (mQDs) was utilized as energy donor, and a commercial quencher (BHQ-2) was used as energy acceptor, respectively. The CdTe/Fe3O4 mQDs were prepared by layer-by-layer (LBL) process at ambient temperature. The sensing probe was fabricated through labeling a stem-loop Toxoplasma gondii DNA oligonucleotide with mQDs at the 5' end and BHQ-2 at 3' end, respectively, and the resulting sensing probe can be simply isolated and purified from the reactant with a common magnet. Properties of mQDs and sensing probe were determined by transmission electron microscopy (TEM) and fluorescence spectrum (FS). The TEM data demonstrated that the size of mQDs was ~20nm. the FS data indicated fluorescence intensity (FI) was doubled after the complete complimentary target Toxoplasma gondii DNA was introduced comparing with the FI before addition of target Toxoplasma gondii DNA. Moreover, only weak FI change was observed when the target DNA with one-mismatch base pair was added, this result revealed the sensing probe has high sensitivity and specificity. The current sensing probe will has great potential applications in the life science and related research.

Liang, Chu; Xu, Shichao; Yang, Juan; Zhang, Jimei; Dai, Zhao; Sun, Bo; Sun, Shuqing; Feng, Tielin; Zi, Yan; Liu, Jingwei; Luo, Hao

2009-07-01

186

The Amblyomma maculatum Koch, 1844 (Acari: Ixodidae: Amblyomminae) tick group: diagnostic characters, description of the larva of A. parvitarsum Neumann, 1901, 16S rDNA sequences, distribution and hosts.  

PubMed

A review of the largely confused Amblyomma maculatum Koch, 1844 tick group of the subgenus Anastosiella Santos Dias, 1963 (A. neumanni Ribaga, 1902, A. maculatum, A. parvitarsum Neumann, 1901, A. tigrinum Koch, 1844 and A. triste Koch, 1844) is presented together with a discussion of the diagnostic characters used for the determination of adults, nymphs and, to a lesser extent, larvae. A key for this tick group is produced, including the description of the larva of A. parvitarsum, 1901. Sequences of 16S rDNA are obtained and compared with other Amblyomma spp., including two other species currently in Anastosiella but in the ovaletick group, A. ovale Koch, 1844 and A. aureolatum (Pallas, 1772). According to the morphology and the rDNA sequences, the maculatum group is reduced to A. maculatum (Neotropical-Nearctic), A. tigrinum (Neotropical) and A. triste (Neotropical) A. neumanni and A. parvitarsum are excluded from the subgenus. The distribution is sympatric in northern South America from where A. maculatumreaches the southern Nearctic and the range of A. tigrinum extends to the southern Neotropics. These species have been found on several domestic and wild vertebrates. A. triste and A. tigrinum have been also found on man. Their role as vectors of pathogens deserves further investigation. PMID:15841347

Estrada-Peña, Agustín; Venzal, José M; Mangold, Atilio J; Cafrune, María M; Guglielmone, Alberto A

2005-02-01

187

New synthesis of 6[3-(1-adamantyl)-4-methoxyphenyl]-2-naphthoic acid and evaluation of the influence of adamantyl group on the DNA binding of a naphthoic retinoid.  

PubMed

6[3-(1-Adamantyl)-4-methoxyphenyl]-2-naphthoic acid (Adapalene®), a synthetic aromatic retinoid specific for RAR? and RAR? receptors, has been prepared utilizing a Pd/C-mediated Suzuki coupling between 6-bromo-2-naphthoic acid and 4-methoxyphenyl boronic acid, followed by introduction of an adamantyl group in the position 3 of the formed 6-(4-methoxyphenyl)-2-naphthoic acid. The interaction of 6-(4-methoxyphenyl)-2-naphthoic acid/ethyl ester and the 3-adamantyl analogs with DNA was studied in aqueous solution at physiological conditions by UV-vis spectroscopy. The calculated binding constants K(ligand-DNA) ranged between 1.1×10(4) M(-1) and 1.1×10(5) M(-1), the higher values corresponding to those of the adamantylated compounds. Molecular modeling studies have emphasized that the intercalative binding of adapalene and its derivatives to DNA is mainly stabilized by hydrophobic interactions related to the presence of the adamantyl group. PMID:21864882

Milanese, Alberto; Gorincioi, Elena; Rajabi, Mehdi; Vistoli, Giulio; Santaniello, Enzo

2011-08-01

188

Report of the European DNA profiling group (EDNAP): an investigation of the complex STR loci D21S11 and HUMFIBRA (FGA)  

Microsoft Academic Search

This paper describes a collaborative exercise which was intended to demonstrate whether uniformity of DNA profiling results could be achieved between European laboratories using two complex short tandem repeat (STR) loci. The loci D21S11 and HUMFIBRA (FGA) were chosen because they are commonly used by different European laboratories. D21S11 has approximately 14 common alleles (f>0.001), whereas HUMFIBRA has 19 common

Peter Gill; E d'Aloja; J Andersen; B Dupuy; M Jangblad; V Johnsson; A. D Kloosterman; A Kratzer; M. V Lareu; M Meldegaard; C Phillips; H Pfitzinger; S Rand; M Sabatier; R Scheithauer; H Schmitter; P Schneider; M. C Vide

1997-01-01

189

Effect of polymethylene and phenylene linking groups on the DNA cleavage specificity of distamycin-linked hydroxamic acid-vanadyl complexes.  

PubMed

Two types of distamycin-linked hydroxamic acids (DHA), which contain various lengths of polymethylene chains (PM-DHA) and relatively rigid phenylene ones (Ph-DHA), have been synthesized for the first time. Their DNA cleavage specificities were investigated by an end-labeled fragment cleavage experiment in the presence of vanadyl ion and hydrogen peroxide. The DNA cleavage by the PM-DHA x VO(II) complexes was shown to be very dependent on the length of the chain and the AT sequences. The tetramethylene DHA (1b) complex exhibited highly specific cleavage patterns flanking the 8 and 10 AT sites. Interestingly, the Ph-DHA complexes selectively cleaved the 5' end-labeled strand at the AT sites, but did not cleave the 3' end-labeled strand. The vanadyl complexing moieties and the local sequence conformation of the AT tract are suggested to contribute significantly to the DNA recognition of the PM-DHA x VO(II) complexes. PMID:10823693

Hashimoto, S; Inui, T; Nakamura, Y

2000-05-01

190

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.  

PubMed

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets. PMID:15291564

Marchán, Vicente; Cie?lak, Jacek; Livengood, Victor; Beaucage, Serge L

2004-08-11

191

Genetic similarity among Cercospora apii-group species and their detection in host plant tissue by PCR/RFLP analyses of the rDNA internal transcribed spacer (ITS).  

PubMed

The objective of this study was to determine the genetic relatedness among the Cercospora and Pseudocercospora species closely related to Cercospora apii by using a polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) analysis of the internal transcribed spacer (ITS) region. A single PCR fragment (about 550 bp) was obtained from all Cercospora species categorized as the C. apii-group, Pseudocercospora purpurea, Pseudocercospora conyzae, and Pseudocercospora cavarae. Cercospora caricis yielded a 680 bp PCR fragment. The similarity in the PCR fragment size and RFLP profiles among the C. apii-group isolates, including Pseudocercospora purpurea, and Pseudocercospora conyzae strongly suggests that these species are conspecific. Synonymy with C. apii (lectotype) at a subspecific rank has been proposed. Amplified ITS regions of genomic DNA extracted from spinach leaves showing 12 and 233% leaf spot disease symptoms caused by Cercospora beticola yielded two PCR fragments (i.e., one from the fungus and one from the host plant) and were resolved by electrophoresis of the PCR product in 3% LMP agarose. Digestion of the total PCR product with HinfI restriction enzyme yielded RFLP profiles similar to those obtained from amplified DNA from the causative agent, C. beticola. The method described in this preliminary study offers rapid detection and diagnosis of fungal infections in plants for disease prediction and management and screening of plant materials for quarantine purposes. PMID:12483593

Siboe, George M.; Murray, Johanne; Kirk, Paul M.

2000-04-01

192

Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam  

Microsoft Academic Search

BACKGROUND: During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification

Kohei Takenaka Takano; Ngoc Thi Hong Nguyen; Binh Thi Huong Nguyen; Toshihiko Sunahara; Michio Yasunami; Manh Duc Nguyen; Masahiro Takagi

2010-01-01

193

Comparison of multilocus enzyme electrophoresis and random amplified polymorphic DNA analysis for molecular subtyping of Cryptococcus neoformans. The Cryplococcal Disease Active Surveillance Group.  

PubMed Central

We evaluated multilocus enzyme electrophoresis (MEE) and random amplified polymorphic DNA (RAPD) for their usefulness in subtyping 344 Cryptococcus neoformans clinical isolates obtained from four U.S. metropolitan areas in 1992 to 1994. MEE and RAPD with five primers both discriminated between the two varieties of C. neofromans. MEE divided C. neoformans var. neoformans isolates into 15 enzyme electrophoretic subtypes (ETs) arranged in three complexes. The predominant ET 1 complex contained 10 ETs, with isolates from 70% of patients in 1 ET. RAPD with five primers further sorted this predominant ET into 19 subtypes, with 60% of isolates sorting into three RAPD types. The ET 8 MEE complex, containing three ETs, could not be divided further by RAPD. The ET 7 complex (two ETs) included isolates from all serotype AD patients. Although both MEE and RAPD identified isolates of C. neoformans var. gattii, neither distinguished between serotypes B and C. These results showed that the two C. neoformans varieties could be identified by MEE or RAPD profile as well as by biochemical methods. RAPD improved the discriminatory power of MEE for isolates within the ET 1 complex but with other ETs offered little additional sensitivity over MEE and was less sensitive than MEE with isolates of C. neoformans var. gattii. This information will be useful in identifying particular environmental sources of disease-causing exposures, in seeking clusters of cases, and in determining whether an infecting strain changes over time.

Brandt, M E; Hutwagner, L C; Kuykendall, R J; Pinner, R W

1995-01-01

194

Correlation of restriction fragment length polymorphism genotyping with internal transcribed spacer sequence, randomly amplified polymorphic DNA and multilocus sequence groupings for Candida parapsilosis.  

PubMed

Epidemiological studies of Candida parapsilosis have been performed by molecular methods. To compare two prominent methods, 29 isolates, typed by multilocus sequence typing (MLST), were typed by restriction fragment length polymorphism (RFLP). Of the 19 proposed Candida parapsilosis sensu stricto isolates [group I by internally transcribed spacer (ITS1) sequence], the most commonly encountered species, 17 were RFLP type VII-1. The species Candida orthopsilosis (eight isolates) and Candida metapsilosis (two isolates) consisted of five and one other RFLP types, respectively; none were VII-1. None of the non-VII-1 types were in more than one ITS group. VII-1 is the most common RFLP type (176/203 in continuing studies), and C. parapsilosis sensu stricto is similarly dominant in other studies, and cannot be subtyped by RFLP or MLST. RFLP subtype VII-1 and C. parapsilosis sensu stricto appear to be nearly identical; C. orthopsilosis, which can be subtyped by MLST, can also be subtyped by RFLP. C. metapsilosis appears rarely. PMID:19207835

van Asbeck, Eveline C; Clemons, Karl V; Markham, Angela N; Stevens, David A

2009-11-01

195

Ten polymorphic DNA loci, including five in the rat MHC (RT1) region, form a single linkage group on rat chromosome 20  

SciTech Connect

We have described ten markers for polymorphic loci on rat chromosome 20, including five in the rat MHC (RT1) region. These markers formed a single linkage group spanning a recombination distance of 0.40. The markers identified five expressed gene loci - RT1.N1 (thymus leukemia antigen 1), Tnfa (tumor necrosis factor {alpha}), Hspa1 (heat shock protein 70), Ggt1 ({gamma} glutamyl-transferase 1), and Prkacn2 (protein kinase C catalytic subunit binding inhibitor 2), two loci with sequences that are related to expressed genes - RT1.Aw2 (sequence related to a non-RT1A class I {alpha} chain) and Mt21 (sequence related to metallothionein 2), and three anonymous loci - D20Arb548, D20Arb234, and D20Arb249. These polymorphic markers should facilitate mapping studies and genetic monitoring of inbred rat strains. 18 refs., 2 figs., 3 tabs.

Remmers, E.F.; Du, Y.; Zha, H.; Goldmuntz, E.A.; Wilder, R.L. [National Institutes of Health, Bethesda, MD (United States)

1995-03-01

196

Hyperreflection groups  

Microsoft Academic Search

We introduce the concept of hyperreflection groups, which are a generalization of Coxeter groups. We prove the Deletion and Exchange Conditions for hyperreflection groups, and we discuss special subgroups and fundamental sectors of hyperreflection groups. In the second half of the paper, we prove that Coxeter groups and graph products of groups are examples of hyperreflection groups.

David G. Radcliffe

2010-01-01

197

Cleaving DNA with DNA  

NASA Astrophysics Data System (ADS)

A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This ``deoxyribozyme'' can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min-1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domains can be altered, making possible the targeted cleavage of single-stranded DNAs with different nucleotide sequences. Several small synthetic DNAs were made to function as simple ``restriction enzymes'' for the site-specific cleavage of single-stranded DNA.

Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

1998-03-01

198

Hyperreflection groups  

Microsoft Academic Search

We introduce the concept of hyperreflection groups, which are a\\u000ageneralization of Coxeter groups. We prove the Deletion and Exchange Conditions\\u000afor hyperreflection groups, and we discuss special subgroups and fundamental\\u000asectors of hyperreflection groups. In the second half of the paper, we prove\\u000athat Coxeter groups and graph products of groups are examples of\\u000ahyperreflection groups.

David G. Radcliffe

2010-01-01

199

DNA Restriction  

NSDL National Science Digital Library

The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragment at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends. This animation from Cold Spring Harbor Laboratory's Dolan DNA Learning Center presents DNA restriction through a series of illustrations of processes involved.

2011-11-25

200

Groups32  

NSDL National Science Digital Library

A group theory calculator. Groups32 computes information about groups of orders 1-32; has a permutation group package; and provides a search for groups with given generators and relations. Site includes documentation as well as course handouts in PDF format.

2007-11-08

201

DNA computing  

Microsoft Academic Search

Computer scientists are joining forces with molecular biologists and chemists to explore the potential for computation using information-carrying biological polymers such as nucleic acids (DNA and RNA). DNA computing is a subset of molecular computing. The key feature of DNA for computing is its information content. The self-assembly properties of DNA suggest an indirect application to computing. The concept of

D. I. Lewin

2002-01-01

202

Extracting DNA  

NSDL National Science Digital Library

This lesson for students in grades 9-12 introduces DNA, genes, chromosomes, the chemicals that make up DNA. After the basic information, students will do an experiment in which they will separate out DNA from peas. Knowing that DNA can be separated will give them a base of understanding for future lessons in biology, evolution, biotechnology, and health technology.

Science Netlinks;

2002-03-28

203

DNA replication  

NSDL National Science Digital Library

Matthew Meselson and Franklin Stahl hypothesized that DNA could replicate in any of three ways. They used isotopes of nitrogen to label DNA for their experiments to find which one of the methods was used for DNA replication. They came to the conclusion that DNA replicates via the semi-conservative method.

Mike Jones (None;)

2005-09-15

204

Molecular and cellular analysis of the DNA repair defect in a patient in Xeroderma pigmentosum complementation group D who has the clinical features of Xeroderma pigmentosum and Cockayne syndrome  

SciTech Connect

Xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are quite distinct genetic disorders that are associated with defects in excision repair of UV-induced DNA damage. A few patients have been described previously with the clinical features of both disorders. In this paper we describe an individual in this category who has unusual cellular responses to UV light. We show that his cultured fibroblasts and lymphocytes are extremely sensitive to irradiation with UV-C, despite a level of nucleotide excision repair that is 30%-40% that of normal cells. The deficiency is assigned to the XP-D complementation group, and we have identified two causative mutations in the XPD gene: a gly{yields}arg change at amino acid 675 in the allele inherited from the patient`s mother and a -1 frameshift at amino acid 669 in the allele inherited from his father. These mutations are in the C-terminal 20% of the 760-amino-acid XPD protein, in a region where we have recently identified several mutations in patients with trichothiodystrophy. 44 refs., 5 figs., 2 tabs.

Broughton, B.C.; Thompson, A.F.; Harcourt, S.A.; Cole, J.; Arlett, C.F.; Lehmann, A.R. [Univ. of Sussex, Brighton (United Kingdom); Vermeulen, W.; Hoeijmakers, J.H.J. [Erasmus Univ., Rotterdam (United Kingdom); Botta, E.; Stefanini, M. [Istituto di Genetica, Pavia (Italy)] [and others

1995-01-01

205

Grouping Dinosaurs  

NSDL National Science Digital Library

In this classroom activity, young students are introduced to sets and subsets. The activity opens with background information for teachers about cladistics. After brainstorming different ways to group the class itself, students work in small groups to identify subsets of coins. The groups then complete a worksheet that challenges them to group dinosaurs into sets and subsets and share their results with the class.

206

DNA vaccines  

Microsoft Academic Search

DNA vaccines use eukaryotic expression vectors to produce immunizing proteins in the vaccinated host. Popular methods of delivery are intramuscular and intradermal saline injections of DNA and gene gun bombardment of skin with DNA-coated gold beads. The method of DNA inoculation (gene gun versus intramuscular injection) and the form of the DNA-expressed antigen (cell-associated versus secreted) determine whether T-cell help

Harriet L. Robinson; Celia Aurora Tiglao Torres

1997-01-01

207

Conformation-dependent DNA attraction  

NASA Astrophysics Data System (ADS)

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr03235c

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

208

Compressive Sensing DNA Microarrays  

Microsoft Academic Search

Abstract—Compressive,Sensing Microarrays,(CSM) are DNA- based sensors that operate,using group,testing and,compressive sensing (CS) principles. In contrast to conventional DNA microar- rays, in which each genetic sensor is designed to respond to a single target, in a CSM each sensor responds to a set of targets. We study the problem,of designing,CSMs that simultaneously account for both the constraints from,compressive,sensing theory and,the biochemistry,of

Wei Dai; Mona A. Sheikh; Olgica Milenkovic; Richard G. Baraniukyy

2009-01-01

209

DNA supercoiling inhibits DNA knotting  

Microsoft Academic Search

Despite the fact that in living cells DNA molecules are long and highly crowded, they are rarely knotted. DNA knotting interferes with the normal functioning of the DNA and, therefore, molecular mechanisms evolved that maintain the knotting and catenation level below that which would be achieved if the DNA segments could pass randomly through each other. Biochemical experiments with torsionally

Yannis Burnier; Julien Dorier; Andrzej Stasiak

2008-01-01

210

Lie groups as spin groups  

Microsoft Academic Search

It is shown that every Lie algebra can be represented as a bivector alge- bra; hence every Lie group can be represented as a spin group. Thus, the computa- tional power of geometric algebra is available to simplify the analysis and applications of Lie groups and Lie algebras. The spin version of the general linear group is thor- oughly analyzed,

C. Doran; D. Hestenes; F. Sommen; N. van Acker

1993-01-01

211

Nanoparticle bridge DNA biosensor  

NASA Astrophysics Data System (ADS)

A new DNA sensing method is demonstrated in which DNA hybridization events lead to the formation of nanoparticle satellites that bridge two electrodes and are detected electrically. The hybridization events are exclusively carried out only on specific locations, the surfaces of C-ssDNA modified 50 nm GNPs. The uniqueness of this work is that only a small number of T-ccDNA molecules (<10) is required to form the nanoparticle satellites, allowing ultra-sensitive DNA sensing. The principle of this new DNA sensing technique has been demonstrated using target DNA and three-base-pair-mismatched DNA in 20nM concentrations. Three single-stranded DNA (ssDNA) system is used in our experiment which includes Capture-ssDNA (C-ssDNA), Target-ssDNA (T-ssDNA) and Probe-ssDNA (P-ssDNA). Both C-ssDNA and P-ssDNA are modified by a thiol group and can hybridize with different portions of T-ssDNA. T-ssDNA requires no modification in three ssDNA system, which is beneficial in many applications. C-ssDNA modified 50nm gold nanoparticle (C-50au) and P-ssDNA modified 30nm gold nanoparticle (P-30au) are prepared through the reaction of thiol-gold chemical bonding between thiolated ssDNA and gold nanoparticle (GNP) (C-ssDNA with 50nm GNP, P-ssDNA with 30nm GNP). We controllably place the C-50au only on the SiO2 band surface (˜ 90nm width) between two gold electrodes (source and drain electrodes) by forming positively- and negatively-charged self-assembled monolayers (SAMs) on SiO2 and gold surface, respectively. DNA modified GNP is negatively charged due to ionization of phosphate group on DNA back bone. C-50au therefore is negatively charged and can only be attracted toward SiO2 area (repelled by negatively charged gold electrode surface). The amine group of positively-charged SAMs on SiO2 surface is then passivated by converting to non-polar methyl functional group after C-50au placement. P-30au is first hybridized with T-ssDNA in the solution phase (T-P- 30au formed) and is introduced into DNA detection device in which C-50au are immobilized on ˜90nm width SiO2 band (between two gold electrodes). The passivation step ensures every TP-30au are attached only to C-50au through hybridization (T-P-30au will not be attracted toward SiO2 surface or gold electrodes). GNP bridges are formed across the electrodes and provide an electrical path between two gold electrodes. We ensure that every T-P-30au only hybridizes on the surface of C-50au by (1) accurately controlling C-50au placement between two gold electrodes, (2) passivating positively-charged SAMs on SiO2 surface after C-50au immobilization. When T-P-30au hybridize with C-50au on ˜90nm wide SiO 2 surface, GNP bridges form and provide an electrical path between two gold electrodes even with only a few hybridization events. Experimental results show that even a few GNP bridges formed on SiO2 band can provide a significant conductance change from an open circuit to a conductive circuit (current = 0.5 uA at voltage = 0.1 V with four GNP bridge). We also used 3-base-pair-mismatched ssDNA (3mm-ssDNA) as a control experiment, which always resulted in an open circuit (no GNP bridge formed). Our detection device is compatible with current CMOS fabrication technology and can be manufactured on a wafer scale. The direct electrical output of this DNA detection technique provides a promising basis for high-throughput screening (can be fabricated on a wafer scale) with no expensive equipment required.

Huang, Hong-Wen

212

Conformation-dependent DNA attraction.  

PubMed

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription. PMID:24847505

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-06-21

213

Evaluation of a Group-Specific 16S Ribosomal DNA-Based PCR for Detection of Helicobacter bizzozeronii, Helicobacter felis, and Helicobacter salomonis in Fresh and Paraffin-Embedded Gastric Biopsy Specimens  

PubMed Central

A new specific and sensitive 16S ribosomal DNA-based PCR assay was developed. The assay targets a 78-bp DNA fragment unique to Helicobacter bizzozeronii, Helicobacter felis, and Helicobacter salomonis and can be used with freshly frozen and formalin-fixed paraffin-embedded gastric biopsy specimens.

De Groote, Dominic; Haesebrouck, Freddy; van Doorn, Leen-Jan; Vandamme, Peter; Ducatelle, Richard

2001-01-01

214

DNA Translocation by Human Uracil DNA Glycosylase: Role of DNA Phosphate Charge†  

PubMed Central

Human DNA repair glycosylases must encounter and inspect each DNA base in the genome in order to discover damaged bases that may be present at a density of less than one in ten million normal base pairs. This remarkable example of specific molecular recognition requires a reduced dimensionality search process (facilitated diffusion) that involves both hopping and sliding along the DNA chain. Despite the widely accepted importance of facilitated diffusion in protein-DNA interactions, the molecular features of DNA that influence hopping and sliding are poorly understood. Here we explore the role of the charged DNA phosphate backbone in sliding and hopping by human uracil DNA glycosylase (hUNG), which is an exemplar that efficiently locates rare uracil bases in both dsDNA and ssDNA. Substitution of neutral methylphosphonate groups for anionic DNA phosphate groups weakened nonspecific DNA binding affinity by 0.4–0.5 kcal/mole per substitution. In contrast, sliding of hUNG between uracil sites embedded in duplex and single stranded DNA substrates persisted unabated when multiple methylphosphonate linkages were inserted between the sites. Thus a continuous phosphodiester backbone negative charge is not essential for sliding over nonspecific DNA binding sites. We consider several alternative mechanisms for these results. A model consistent with previous structural and NMR dynamic results invokes the presence of open and closed conformational states of hUNG. The open state is short-lived and has weak or nonexistent interactions with the DNA backbone that are conducive for sliding, and the populated closed state has stronger interactions with the phosphate backbone. These data suggest that the fleeting sliding form of hUNG is a distinct weakly interacting state that facilitates rapid movement along the DNA chain and resembles the transition state for DNA dissociation.

Schonhoft, Joseph D.; Kosowicz, John; Stivers, James T.

2013-01-01

215

DNA Interactive  

NSDL National Science Digital Library

DNA Interactive is an educational site celebrating the 50th anniversary of the discovery of the double-helical structure of DNA by James Watson and Francis Crick. The web site features interactive modules about the history of DNA science; discovering and reading the DNA code; manipulating the code to create tailored molecules; studying the human genome; applications of DNA research; and a chronicle of the eugenics movement. These modules feature rare video interviews with scientists, 3D animations, and narrative text to present and explain DNA science. Other materials include a teacher's guide with downloadable, printable lessons, an online teaching community, and information on further resources.

2004-01-05

216

Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA.  

PubMed Central

Currently, the genotypic identification of the spotted fever group (SFG) rickettsiae is based on restriction fragment length polymorphism analysis of PCR-amplified genes coding for the enzyme citrate synthase and the surface proteins rOmpA and rOmpB. A set of useful restriction endonucleases was found following comparison of Rickettsia rickettsii and R. prowazekii sequences. However, by using three PCR amplifications and four enzyme digestions with this set, it was impossible to differentiate between all of the known serotypes of the SFG rickettsiae. We amplified by PCR and sequenced using an automated laser fluorescent DNA sequencer a fragment of the gene encoding the protein rOmpA from 21 serotypes of the SFG rickettsiae. A 632-bp amplification product was obtained for most of the strains, although no product could be obtained by using R. akari, R. australis, R. helvetica, and R. bellii DNAs. We found a characteristic sequence for all strains studied except the two isolates of R. massiliae, isolates GS and Mtul. Using the software package BISANCE, we determined the restriction map of this fragment and identified five potentially useful endonucleases, RsaI, AluI, PstI, XbaI, and AvaII. We confirmed the computer analysis-derived profiles by PCR-restriction fragment length polymorphism analysis. The combination of the profiles obtained after digestion of the PCR product by RsaI and PstI allowed for the differentiation of 16 strains. The use of AluI and XbaI allowed for the characterization of R. parkeri and strain HA-91, respectively. R. africae and strain S were differentiated by AvaII digestion. Thus, using a single PCR amplification, we were able to differentiate all of the SFG rickettsiae whose ompA gene was amplified by PCR.

Roux, V; Fournier, P E; Raoult, D

1996-01-01

217

Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family  

PubMed Central

Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae.

Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, Jose Rubens; Antonelli, Alexandre

2012-01-01

218

DNA Replication  

NSDL National Science Digital Library

This animation, which shows DNA replication and the interactions of the various enzymes, can be used to illustrate to students the order of events in DNA replication, as well as emphasize which enzymes are involved in the process.

American Society For Microbiology;

2002-01-01

219

DNA Detectives  

NSDL National Science Digital Library

Many of the revolutionary changes that have occurred in biology since 1970 can be attributed directly to the ability to manipulate DNA in defined ways. The principal tools for this recombinant DNA technology are enzymes that can "cut and "paste" DNA. Restriction enzymes are the "chemical scissors" of the molecular biologist; these enzymes cut DNA at specific nucleotide sequences. A sample of someone's DNA, incubated with restriction enzymes, is reduced to millions of DNA fragments of varying sizes. A DNA sample from a different person would have a different nucleotide sequence and would thus be enzymatically "chopped up" into a very different collection of fragments. We have been asked to apply DNA fingerprinting to determine which suspect should be charged with a crime perpetrated in our city.

BEGIN:VCARD VERSION:2.1 FN:Suzanne Black N:Black;Suzanne ORG:Inglemoor High School REV:2005-04-09 END:VCARD

1995-06-30

220

DNA Workshop  

NSDL National Science Digital Library

How does DNA perform those all-important functions of replication and protein synthesis? This interactive feature from the A Science Odyssey Web site will help you explore and understand the secrets of DNA.

Foundation, Wgbh E.

2003-09-26

221

DNA biosensors based on self-assembled carbon nanotubes  

Microsoft Academic Search

DNA biosensors based on self-assembled multi-walled carbon nanotubes (MWNTs) were described in this paper, in which the probe DNA oligonucleotides were immobilized by forming covalent amide bonds between carboxyl groups at the nanotubes and amino groups at the ends of the DNA oligonucleotides. Hybridization between the probe and target DNA oligonucleotides was confirmed by the changes in the voltammetric peak

S. G. Wang; Ruili Wang; P. J. Sellin; Qing Zhang

2004-01-01

222

Stretching DNA  

NSDL National Science Digital Library

Explore stretching just a single strand of DNA using optical tweezers or fluid flow. Experiment with the forces involved and measure the relationship between the stretched DNA length and the force required to keep it stretched. Is DNA more like a rope or like a spring?

Simulations, Phet I.; Perkins, Kathy; Malley, Chris; Perkins, Tom; Dubson, Mike; Adams, Wendy

2007-12-01

223

DNA Nanotechnology  

NSDL National Science Digital Library

In this activity, learners explore deoxyribonucleic acid (DNA), a nanoscale structure that occurs in nature. Learners extract a sample of DNA from split peas and put the sample in an Eppendorf tube to take home. Learners discover that nanoscientists study DNA to understand its biological function and use it to make other nanoscale materials and devices.

Network, Nanoscale I.; Sciencenter

2012-06-11

224

DNA Arrays  

NSDL National Science Digital Library

This animation from Cold Spring Harbor Laboratory's Dolan DNA Learning Center presents DNA arrays. The animation contains information on Pat Brown's discovery and the purpose of DNA arrays to study gene expression as well as its role in the development of pharmacogenomic treatment for diseases such as cancer.

2012-04-10

225

Cinnamate-based DNA photolithography  

PubMed Central

As demonstrated by means of DNA nanoconstructs[1], as well as DNA functionalization of nanoparticles[2-4] and micrometre-scale colloids[5-8], complex self-assembly processes require components to associate with particular partners in a programmable fashion. In many cases the reversibility of the interactions between complementary DNA sequences is an advantage[9]. However, permanently bonding some or all of the complementary pairs may allow for flexibility in design and construction[10]. Here, we show that the substitution of a pair of complementary bases by a cinnamate group provides an efficient, addressable, UV light-based method to covalently bond complementary DNA. To show the potential of this approach, we wrote micrometre-scale patterns on a surface via UV light and demonstrate the reversible attachment of conjugated DNA and DNA-coated colloids. Our strategy enables both functional DNA photolithography and multi-step, specific binding in self-assembly processes.

Romulus, Joy; Li, Minfeng; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin

2013-01-01

226

DNA Nanotechnology  

NASA Astrophysics Data System (ADS)

Nanotechnology is the science of well-structured materials and their components. DNA nanotechnology employs branched motifs to these ends. This effort has been quite successful, because the sticky-ended association of DNA molecules occurs with high specificity, and it results in the formation of B-DNA. The use of stable branched DNA molecules permits one to make stick-figures and topological targets. We have used this strategy to construct covalently closed DNA polyhedra, knots and Borromean rings. We have constructed a DNA nanomechanical device by combining left-handed Z-DNA with right-handed B-DNA. The device consists of two DNA double crossover (DX) molecules connected by a piece of DNA that can be converted to Z-DNA. DX molecules contain two DNA double helices with parallel axes linked by Holliday-like crossovers. Atoms move between 20 and 60 Å when the device undergoes the transition. A central goal of DNA nanotechnology is the self-assembly of periodic matter. We have constructed micron-sized 2-dimensional DNA arrays in three different motifs. In the first motif, we have used DX molecules that have been designed to tile the plane. We decorate the simple DX molecule with DNA hairpins that protrude from the plane of the 2-D array; these hairpins act as topographic labels that are visible when the array is visualized by atomic force microscopy (AFM). We can change the pattern by changing the components, and by modification after assembly. We have used triple crossover (TX) molecules decorated similarly to produce patterns in 2D crystals. TX molecules contain three coplanar helical domains linked in the same fashion as DX molecules. Rotation of TX molecules leads to different patterns in the AFM. In addition, we have generated arrays from parallelograms predicated on Holliday junction analogs. These parallelograms contain cavities whose sizes can be tuned by design. This research has been supported by grants from NIGMS, ONR, NSF/DARPA and USAF.

Seeman, Nadrian C.

2000-03-01

227

Designer DNA Nanoarchitectures†  

PubMed Central

Naturally existing biological systems, from the simplest unicellular diatom to the most sophisticated organ such as human brain, are functional self-assembled architectures. Scientists have long been dreaming about building artificial nanostructures that can mimic such elegance in nature. Structural DNA nanotechnology, which uses DNA as blueprint and building material to organize matter with nanometer precision, represents an appealing solution to this challenge. Based on the knowledge of helical DNA structure and Watson-Crick base pairing rules, scientists have constructed a number of DNA nanoarchitectures with a large variety of geometries, topologies and periodicities with considerably high yields. Modified by functional groups, those DNA nanostructures can serve as scaffolds to control the positioning of other molecular species, which opens opportunities to study intermolecular synergies, such as protein-protein interactions, as well as to build artificial multi-component nano-machines. In this review, we summarize the principle of DNA self-assembly, describe the exciting progress of structural DNA nanotechnology in recent years and discuss the current frontier.

Lin, Chenxiang; Liu, Yan; Yan, Hao

2009-01-01

228

Dna Sequencing  

DOEpatents

A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

1995-04-25

229

Group Theatre.  

ERIC Educational Resources Information Center

The group interpretation approach to theatre production is defined as a method that will lead to production of plays that will appeal to "all the layers of the conscious and unconscious mind." In practice, it means that the group will develop and use resources of the theatre that orthodox companies too often ignore. The first two chapters of this…

Clark, Brian

230

Leo Group  

NASA Astrophysics Data System (ADS)

The constellation LEO contains a rich concentration of galaxies, including five Messier objects. The Leo Group is the nearest group of galaxies with both giant ellipticals and spirals, which makes it valuable for tests of the extragalactic distance scale. The region also harbors two remarkable intergalactic features: a long stream of stars and gas that has been pulled from a SPIRAL GALAXY by grav...

Schneider, S.; Murdin, P.

2000-11-01

231

Radiation damage to DNA  

SciTech Connect

Our goal is to calculate the probability to eject electrons from DNA by charged particles that pass near the macromolecule as they slow down in an aqueous medium that contains DNA in low concentration. This process is illustrated for a particle of charge Ze and velocity v, where impact parameters b{sub 1}, b{sub 2}, and b{sub 3} indicate the distances between the trajectory and a phosphate group, a base, and a sugar moiety, respectively. In the present state of our theoretical development, we must treat each of these components of DNA as an independent impurity site occupied by electrons in a Slater-type orbital with a characteristic orbital radius and band gap. Determination of these parameters will be discussed below; however, before we turn to that part of the discussion, it is interesting to address the question of multiple ionizations of DNA by the passage of a single charged particle.

Miller, J.H.

1992-04-01

232

DNA vaccines  

PubMed Central

Since the introduction of DNA vaccines two decades ago, this attractive strategy has been hampered by its low immunogenicity in humans. Studies conducted to improve the immunogenicity of DNA vaccines have shown that understanding the mechanism of action of DNA vaccines might be the key to successfully improving their immunogenicity. Our current understanding is that DNA vaccines induce innate and adaptive immune responses in two ways: (1) encoded protein (or polypeptide) antigen(s) by the DNA plasmid can be expressed in stromal cells (i.e., muscle cells) as well as DCs, where these antigens are processed and presented to naïve CD4 or CD8 T cells either by direct or cross presentation, respectively; and (2) the transfected DNA plasmid itself may bind to an un-identified cytosolic DNA sensor and activate the TBK1-STING pathway and the production of type I interferons (IFNs) which function as an adjuvant. Recent studies investigating double-stranded cytosolic DNA sensor(s) have highlighted new mechanisms in which cytosolic DNA may release secondary metabolites, which are in turn recognized by a novel DNA sensing machinery. Here, we discuss these new metabolites and the possibilities of translating this knowledge into improved immunogenicity for DNA vaccines.

Coban, Cevayir; Kobiyama, Kouji; Jounai, Nao; Tozuka, Miyuki; Ishii, Ken J

2013-01-01

233

Plane Groups  

NSDL National Science Digital Library

This is a lengthy PDF document (60 pages+) about plane groups and symmetry. It includes colorful images of each of the 17 plane groups, in several different forms. Additionally, there are some summarizing graphics that show unit cells, lattices, symmetry elements, etc. There is lots here to choose from -- I doubt that anyone will want to use all of the images. Studying plane groups is a good way to introduce crystal systems, point groups, lattices, symmetry operators, etc. All is in 2-D, but it is easy to tell students that the principles are the same in 3-D. For those who like to make changes, the PDF document was created from individual EPS files. This means that the files can be opened in Adobe Illustrator, Corel Draw, etc., and modified to fit your own needs.

Perkins, Dexter

234

Reading DNA  

NSDL National Science Digital Library

Students use edible models of the DNA molecule to transcribe an mRNA se- quence, then translate it into a protein. At the end of the lesson, understand that information within the DNA molecule is divided into segments called genes and learn that each gene contains the instructions for assembling a unique protein that performs a specialized function in the cell. A basic knowledge of DNA structure and function is required.

2004-01-01

235

DNA Extraction  

NSDL National Science Digital Library

In this activity related to plant biotechnology, learners extract DNA from fruit to investigate how it looks and feels. The procedure is similar to what scientists have to do before they can use information contained in this DNA. This lesson guide includes procedure and discussion questions to help learners reflect on the process and purpose of DNA extraction. Modifications for younger learners are included in a related PDF (see related resources).

Stephens, Janice; Leach, Jan

2011-01-01

236

Group dynamics.  

PubMed

Group dynamics play a significant role within any organization, culture, or unit. The important thing to remember with any of these structures is that they are made up of people--people with different ideas, motivations, background, and sometimes different agendas. Most groups, formal or informal, look for a leader in an effort to maintain cohesiveness of the unit. At times, that cultural bond must be developed; once developed, it must be nurtured. There are also times that one of the group no longer finds the culture comfortable and begins to act out behaviorally. It is these times that become trying for the leader as she or he attempts to remain objective when that which was once in the building phase of group cohesiveness starts to fall apart. At all times, the manager must continue to view the employee creating the disturbance as an integral part of the group. It is at this time that it is beneficial to perceive the employee exhibiting problem behaviors as a special employee, as one who needs the benefit of your experience and skills, as one who is still part of the group. It is also during this time that the manager should focus upon her or his own views in the area of power, communication, and the corporate culture of the unit that one has established before attempting to understand another's point of view. Once we understand our own motivation and accept ourselves, it is then that we may move on to offer assistance to another. Once we understand our insecurities recognizing staff dysfunction as a symptom of system dysfunction will not be so threatening to the concept of the manager that we perceive ourselves to be. It takes a secure person to admit that she or he favors staff before deciding to do something to change things. The important thing to know is that it can be done. The favored staff can find a new way of relating to others, the special employee can find new modes of behavior (and even find self-esteem in the process), the group can find new ways of interacting, and the corporate culture can boast of a leader with new views at the helm. In marriage, it takes only two; in a group, it takes a lot more. The dynamics of many people interacting may present difficulties at times; however, the birth of the bond of that group is well worth the effort. Ask any manager. PMID:2081114

Scandiffio, A L

1990-12-01

237

Multivalent Lipid--DNA Complexes: Distinct DNA Compaction Regimes  

NASA Astrophysics Data System (ADS)

Cationic liposomes (CL), while intrinsically advantageous in comparison to viruses, still have limited success for gene therapy and require more study. CL spontaneously self-assemble with DNA via counterion release, forming small particles approximately 200nm in diameter. X-ray diffraction reveals CL-DNA structures that are typically a multilamellar organization of lipids with DNA intercalated between the layers. We explore the structural properties of CL-DNA complexes formed with new multivalent lipids (Ewert et al, J. Med. Chem. 2002; 45:5023) that range from 2+ to 16+. Contrary to a simple prediction for the DNA interaxial spacing d_DNA based on a geometrical space-filling model, these lipids show dramatic DNA compaction, down to d_DNA ˜ 25 ÅVariations in the membrane charge density, ? _M, lead to distinct spacing regimes. We propose that this DNA condensation is controlled by a unique locking mechanism between the DNA double helix and the large, multivalent lipid head groups. Funded by NSF DMR-0203755 and NIH GM-59288.

Evans, Heather M.; Ahmad, A.; Ewert, K.; Safinya, C. R.

2004-03-01

238

Are isolated anti-HBc blood donors in high risk group? The detection of HBV DNA in isolated anti-HBc cases with nucleic acid amplification test (NAT) based on transcription-mediated amplification (TMA) and HBV discrimination  

Microsoft Academic Search

AimHepatitis B virus (HBV) can be transmitted by blood transfusions even so using serological tests having high sensitivity and specificity. We aimed to detect HBV DNA in isolated Anti-HBc donors and show if they have transfusion risk or not.

Hüsnü Altunay; Erdogan Kosan; Ilhan Birinci; Armagan Aksoy; Kaan Kirali; Suat Saribas; Mustafa Aslan; Pelin Yuksel; Esra Alan; Osman Sadi Yenen; Bekir Kocazeybek

2010-01-01

239

Report of the European DNA profiling group (EDNAP)-an investigation of the hypervariable STR loci ACTBP2, APOAI1 and D11S554 and the compound loci D12S391 and D1S1656  

Microsoft Academic Search

This paper describes the results of three collaborative exercises which continues the EDNAP theme to explore whether uniformity of DNA profiling results could be achieved between European laboratories using STRs. In an earlier exercise, complex hypervariable AAAG-repeat STR loci were investigated, but reproducibility was found to be poor because of the variation of techniques used by participating laboratories. In the

Peter Gill; E d'Aloja; B Dupuy; B Eriksen; M Jangblad; V Johnsson; A. D Kloosterman; A Kratzer; M. V Lareu; B Mevag; N Morling; C Phillips; H Pfitzinger; S Rand; M Sabatier; R Scheithauer; H Schmitter; P Schneider; I Skitsa; M. C Vide

1998-01-01

240

Group Learning.  

ERIC Educational Resources Information Center

Research suggests that cooperative learning works best when students are first taught group-processing skills, such as leadership, decision making, communication, trust building, and conflict management. Inadequate teacher training and boring assignments can torpedo cooperative learning efforts. Administrators should reassure teachers with…

Black, Susan

1992-01-01

241

Human mitochondrial DNA is packaged with TFAM  

Microsoft Academic Search

Mitochondrial transcription factor A (TFAM), a mem- ber of the high mobility group proteins, is essential for maintenance of mitochondrial DNA (mtDNA). Most TFAM and mtDNA (both of which are normally soluble) was recovered from the particulate fraction of human placental mitochondria when extracted with the non-ionic detergent Nonidet P-40. mtDNA and TFAM were co-immunoprecipitated by anti- TFAM antibodies. TFAM

Tanfis Istiaq Alam; Tomotake Kanki; Tsuyoshi Muta; Koutarou Ukaji; Yoshito Abe; Hiroshi Nakayama; Koji Takio; Naotaka Hamasaki; Dongchon Kang

2003-01-01

242

Comparative functional genomics of mammalian DNA methyltransferases  

Microsoft Academic Search

DNA methylation involves biochemical modification of DNA by addition of methyl groups onto CpG dinucleotides, and this epigenetic mechanism regulates gene expression in disease and development. Mammalian DNA methyltransferases, DNMT (DNMT1, DNMT3A and DNMT3B), together with the accessory protein DNMT3L establish specific DNA methylation patterns in the genome during gametogenesis, embryogenesis and somatic tissue development. The present study addresses the

Nelida Rodriguez-Osorio; Hongfeng Wang; Jennifer Rupinski; Susan M. Bridges; Erdogan Memili

2010-01-01

243

Taxonomy of the Lacto bacillus acidophilus Group  

Microsoft Academic Search

A total of 89 strains designated Lactobtrcillus acidophilus were examined for physiological properties, type of lactic acid produced, cell wall sugar pattern, guanine plus cytosine content of deoxyribonucleic acid (DNA), and DNA homol- ogy values compared with selected reference strains. Immunological reactions among a group of the strains were determined by gel diffusion tests, using antiserum to purified lactic acid

J. L. JOHNSON; C. F. PHELPS; C. S. CUMMINS; F. GASSER

1980-01-01

244

DNA ALTERATIONS  

EPA Science Inventory

The exposure of an organism to genotoxic chemicals may induce a cascade of genetic events. nitially, structural alterations to DNA are formed. ext, the DNA damage is processed and subsequently expressed in mutant gene products. inally, diseases result from the genetic damage. he ...

245

DNA Barcoding  

NSDL National Science Digital Library

This is a two-part animation. ÃÂDNA Barcoding, Part 1,ÃÂ provides an overview of how DNA barcoding of animals can be used to identify an unknown sample or discover a new species. Cytochrome c oxidase subunit 1 (COI) is found in the mitochondria as part of the electron transport chain. The COI gene is used for DNA barcoding. Just like a barcode on an item in a grocery store identifies a product, a DNA barcode (determined by DNA sequencing) is used to identify species. Part 1 run time: 1 minute, 40 seconds. ÃÂDNA Barcoding, Part 2ÃÂ details how small tissue samples are used for DNA barcoding, including a review of the laboratory and bioinformatics steps used in barcoding: DNA purification, polymerase chain reaction (PCR), agarose gel electrophoresis, DNA sequencing and analysis, and DNA sequence identification using the Basic Local Alignment Search Tool (BLAST) or the Barcode of Life Database (BOLD). Part 2 run time: 4 minutes, 15 seconds. Animation is closed captioned.

2012-10-22

246

Ancient DNA  

Microsoft Academic Search

DNA that has been recovered from archaeological and palaeontological remains makes it possible to go back in time and study the genetic relationships of extinct organisms to their contemporary relatives. This provides a new perspective on the evolution of organisms and DNA sequences. However, the field is fraught with technical pitfalls and needs stringent criteria to ensure the reliability of

Michael Hofreiter; David Serre; Hendrik N. Poinar; Melanie Kuch; Svante Pääbo

2001-01-01

247

Probe Design for Compressive Sensing DNA Microarrays  

Microsoft Academic Search

Compressive Sensing Microarrays (CSM) are DNA- based sensors that operate using group testing and compres- sive sensing (CS) principles. In contrast to conventional DNA microarrays, in which each genetic sensor is designed to re- spond to a single target, in a CSM each sensor responds to a group of targets. We study the problem of designing CS probes that simultaneously

Wei Dai; Olgica Milenkovic; Mona A. Sheikh; Richard G. Baraniuk

2008-01-01

248

Compressive Sensing DNA Microarrays  

PubMed Central

Compressive sensing microarrays (CSMs) are DNA-based sensors that operate using group testing and compressive sensing (CS) principles. In contrast to conventional DNA microarrays, in which each genetic sensor is designed to respond to a single target, in a CSM, each sensor responds to a set of targets. We study the problem of designing CSMs that simultaneously account for both the constraints from CS theory and the biochemistry of probe-target DNA hybridization. An appropriate cross-hybridization model is proposed for CSMs, and several methods are developed for probe design and CS signal recovery based on the new model. Lab experiments suggest that in order to achieve accurate hybridization profiling, consensus probe sequences are required to have sequence homology of at least 80% with all targets to be detected. Furthermore, out-of-equilibrium datasets are usually as accurate as those obtained from equilibrium conditions. Consequently, one can use CSMs in applications in which only short hybridization times are allowed.

2009-01-01

249

Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502?  

PubMed Central

Class I heat shock genes (HSGs) code for molecular chaperones which play a major role in the bacterial response to sudden increases of environmental temperature by assisting protein folding. Quantitative reverse transcriptase real-time PCR gene expression analysis of the food-borne pathogen Clostridium botulinum grown at 37°C showed that the class I HSGs grpE, dnaK, dnaJ, groEL, and groES and their repressor, hrcA, were expressed at constant levels in the exponential and transitional growth phases, whereas strong downregulation of all six genes was observed during stationary phase. After heat shock from 37 to 45°C, all HSGs were transiently upregulated. A mutant with insertionally inactivated hrcA expressed higher levels of class I HSGs during exponential growth than the wild type, followed by upregulation of only groES and groES after heat shock. Inactivation of hrcA or of dnaK encoding a major chaperone resulted in lower maximum growth temperatures than for the wild type and reduced growth rates under optimal conditions compared to the wild type. The dnaK mutant showed growth inhibition under all tested temperature, pH, and NaCl stress conditions. In contrast, the growth of an hrcA mutant was unaffected by mild temperature or acid stress compared to the wild-type strain, indicating that induced class I HSGs support growth under moderately nonoptimal conditions. We show that the expression of class I HSGs plays a major role for survival and growth of C. botulinum under the stressful environmental conditions that may be encountered during food processing or growth in food products, in the mammalian intestine, or in wounds.

Selby, Katja; Lindstrom, Miia; Somervuo, Panu; Heap, John T.; Minton, Nigel P.; Korkeala, Hannu

2011-01-01

250

Compositional Bias and Size of Genomes of Human DNA Viruses  

Microsoft Academic Search

Genomes of 144 human DNA viruses were analyzed in the aspect of their compositional asymmetry. DNA viruses were divided into two groups according to their genome sizes. The analysis revealed that the level of guanine and cytosine (GC content) in the coding sequences of small genome DNA viruses was significantly lower than that of large genome DNA viruses. Because small

Jaturong Sewatanon; Sirawat Srichatrapimuk; Prasert Auewarakul

2007-01-01

251

Investigation of DNA complexes with iron ions in solution  

Microsoft Academic Search

The optical anisotropy and intrinsic viscosity of DNA–Fe3+ complexes have been investigated. It was shown that the binding of iron ions to DNA causes the shrinkage of the macromolecule. The formation of such complexes is accompanied by increasing DNA optical anisotropy. We suggest that the binding of iron ions to widely spaced along the chain DNA groups creates the conditions

N. Kasyanenko; N. Arikainen; E. Frisman

1998-01-01

252

Dancing DNA.  

ERIC Educational Resources Information Center

An imaging technique that uses fluorescent dyes and allows scientists to track DNA as it moves through gels or in solution is described. The importance, opportunities, and implications of this technique are discussed. (KR)

Pennisi, Elizabeth

1991-01-01

253

DNA Dynamics.  

ERIC Educational Resources Information Center

Explains a method to enable students to understand DNA and protein synthesis using model-building and role-playing. Acquaints students with the triplet code and transcription. Includes copies of the charts used in this technique. (DDR)

Warren, Michael D.

1997-01-01

254

DNA Interactive  

NSDL National Science Digital Library

This DNA websiteâÂÂwhich celebrates the 50th anniversary of the discovery of the structure of the DNA double helixâÂÂis a resource for middle, high school, and college biology educators and students. The site is divided into six main topics (Timeline, Code, Manipulation, Genome, Applications, and Chronicle). Its features allow users to explore the past, manipulate models, and see hidden processes through animations, video interviews with scientists, and activities.

David Micklos (Dolan DNA Learning Center, Cold Spring Harbor;); Jan Witowski (Dolan DNA Learning Center, Cold Spring Harbor;); Chun-hua Yang (Dolan DNA Learning Center, Cold Spring Harbor;)

2010-05-27

255

DNA Sequencing  

NSDL National Science Digital Library

Teachers' Domain presents this interactive, adapted from the Dolan DNA Learning Center, with reading material and animations to help students learn the basics of DNA sequencing. The lesson is divided two parts: Sanger Sequencing and Cycle Sequencing. The processes for both techniques are covered and animations help students visualize the material presented. On the site, visitors will also find a supplemental background essay, discussion questions, and standards alignment from Teachers' Domain.

2010-10-05

256

Cardiovascular group  

NASA Technical Reports Server (NTRS)

As a starting point, the group defined a primary goal of maintaining in flight a level of systemic oxygen transport capacity comparable to each individual's preflight upright baseline. The goal of maintaining capacity at preflight levels would seem to be a reasonable objective for several different reasons, including the maintenance of good health in general and the preservation of sufficient cardiovascular reserve capacity to meet operational demands. It is also important not to introduce confounding variables in whatever other physiological studies are being performed. A change in the level of fitness is likely to be a significant confounding variable in the study of many organ systems. The principal component of the in-flight cardiovascular exercise program should be large-muscle activity such as treadmill exercise. It is desirable that at least one session per week be monitored to assure maintenance of proper functional levels and to provide guidance for any adjustments of the exercise prescription. Appropriate measurements include evaluation of the heart-rate/workload or the heart-rate/oxygen-uptake relationship. Respiratory gas analysis is helpful by providing better opportunities to document relative workload levels from analysis of the interrelationships among VO2, VCO2, and ventilation. The committee felt that there is no clear evidence that any particular in-flight exercise regimen is protective against orthostatic hypotension during the early readaptation phase. Some group members suggested that maintenance of the lower body muscle mass and muscle tone may be helpful. There is also evidence that late in-flight interventions to reexpand blood volume to preflight levels are helpful in preventing or minimizing postflight orthostatic hypotension.

Blomqvist, Gunnar

1989-01-01

257

Pooling Design and Bias Correction in DNA Library Screening  

Microsoft Academic Search

We study the group test for DNA library screening based on probabilistic approach. Group test is a method of detecting a few positive items from among a large number of items, and has wide range of applications. In DNA library screening, positive item corresponds to the clone having a specified DNA segment, and it is necessary to identify and isolate

Takafumi Kanamori; Hiroaki Uehara; Masakazu Jimbo

2010-01-01

258

Pooling Design and Bias Correction in DNA Library Screening  

Microsoft Academic Search

We study the group test for DNA library screening based on a probabilistic approach. The group test is a method of detecting a few positive items from among a large number of items, and has a wide range of applications. In DNA library screening, a positive item corresponds to the clone having a specified DNA segment, and it is necessary

Takafumi Kanamori; Hiroaki Uehara; Masakazu Jimbo

2012-01-01

259

The 1998–1999 collaborative exercises and proficiency testing program on DNA typing of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG)  

Microsoft Academic Search

A total of 28 laboratories (labs) submitted results for the 1998 collaborative exercise and the proficiency testing program of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG) group. This number increased to 46 labs in 1999. Six bloodstains were submitted, each one with 200?l soaked in cotton except the sample no. 6 submitted for

Josefina Gómez; Angel Carracedo

2000-01-01

260

Biophysical characterization of DNA binding from single molecule force measurements  

PubMed Central

Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function.

Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

2010-01-01

261

Acrolein induced DNA damage, mutagenicity and effect on DNA repair.  

PubMed

Acrolein (Acr) is a ubiquitous environmental contaminant; it also can be generated endogenously by lipid peroxidation. Acr contains a carbonyl group and an olefinic double bond; it can react with many cellular molecules including amino acids, proteins and nucleic acids. In this review article we focus on updating information regarding: (i) Acr-induced DNA damage and methods of detection, (ii) repair of Acr-DNA damage, (iii) mutagenicity of Acr-DNA adducts, (iv) sequence specificity and methylation effect on Acr-DNA adduct formation and (v) the role of Acr in human cancer. We have found that Acr can inhibit DNA repair and induces mutagenic Acr-dG adducts and that the binding spectrum of Acr in the p53 gene in normal human bronchial epithelial cells is similar to the p53 mutational spectrum in lung cancer. Since Acr-DNA adduct has been identified in human lung tissue and Acr causes bladder cancer in human and rat models, we conclude that Acr is a major lung and bladder carcinogen, and its carcinogenicity arises via induction of DNA damage and inhibition of DNA repair. PMID:21714128

Tang, Moon-shong; Wang, Hsiang-tsui; Hu, Yu; Chen, Wei-Sheng; Akao, Makoto; Feng, Zhaohui; Hu, Wenwei

2011-09-01

262

A protein-DNA docking benchmark  

PubMed Central

We present a protein–DNA docking benchmark containing 47 unbound–unbound test cases of which 13 are classified as easy, 22 as intermediate and 12 as difficult cases. The latter shows considerable structural rearrangement upon complex formation. DNA-specific modifications such as flipped out bases and base modifications are included. The benchmark covers all major groups of DNA-binding proteins according to the classification of Luscombe et al., except for the zipper-type group. The variety in test cases make this non-redundant benchmark a useful tool for comparison and development of protein–DNA docking methods. The benchmark is freely available as download from the internet.

van Dijk, Marc; Bonvin, Alexandre M. J. J.

2008-01-01

263

Ancient DNA.  

PubMed

In the past two decades, ancient DNA research has progressed from the retrieval of small fragments of mitochondrial DNA from a few late Holocene specimens, to large-scale studies of ancient populations, phenotypically important nuclear loci, and even whole mitochondrial genome sequences of extinct species. However, the field is still regularly marred by erroneous reports, which underestimate the extent of contamination within laboratories and samples themselves. An improved understanding of these processes and the effects of damage on ancient DNA templates has started to provide a more robust basis for research. Recent methodological advances have included the characterization of Pleistocene mammal populations and discoveries of DNA preserved in ancient sediments. Increasingly, ancient genetic information is providing a unique means to test assumptions used in evolutionary and population genetics studies to reconstruct the past. Initial results have revealed surprisingly complex population histories, and indicate that modern phylogeographic studies may give misleading impressions about even the recent evolutionary past. With the advent and uptake of appropriate methodologies, ancient DNA is now positioned to become a powerful tool in biological research and is also evolving new and unexpected uses, such as in the search for extinct or extant life in the deep biosphere and on other planets. PMID:15875564

Willerslev, Eske; Cooper, Alan

2005-01-01

264

Fabrication of patterned DNA surfaces.  

PubMed Central

Two photolithographic methods are described for the formation of patterned single or multiple DNA species on SiO2 substrates. In the first approach, substrates are treated with a photochemically labile organosilane monolayer film. Irradiation of these surfaces with patterned deep UV (193 nm) light results in patterned chemically reactive groups which are then reacted with heterobifunctional crosslinking molecules. Covalent attachment of modified synthetic DNA oligomers to the crosslinker results in stable DNA patterns. Alternatively, a photoresist is spin-coated over a silane film which had been previously modified with the heterobifunctional crosslinker. Upon patterned irradiation and subsequent development, the underlying crosslinker-modified layer is revealed, and is then reacted with a chemically modified DNA. Feature dimensions to 1 micron are observed when a single fluorescent DNA is attached to the surface. By performing sequential exposures, we have successfully immobilized two distinguishable DNA oligomers on a single surface. Synthetic DNA immobilized in this manner retains the ability to hybridize to its complementary strand, suggesting that these approaches may find utility in the development of miniaturized DNA-based biosensors.

Chrisey, L A; O'Ferrall, C E; Spargo, B J; Dulcey, C S; Calvert, J M

1996-01-01

265

DNA origami nanopores for controlling DNA translocation.  

PubMed

We combine DNA origami structures with glass nanocapillaries to reversibly form hybrid DNA origami nanopores. Trapping of the DNA origami onto the nanocapillary is proven by imaging fluorescently labeled DNA origami structures and simultaneous ionic current measurements of the trapping events. We then show two applications highlighting the versatility of these DNA origami nanopores. First, by tuning the pore size we can control the folding of dsDNA molecules ("physical control"). Second, we show that the specific introduction of binding sites in the DNA origami nanopore allows selective detection of ssDNA as a function of the DNA sequence ("chemical control"). PMID:23734828

Hernández-Ainsa, Silvia; Bell, Nicholas A W; Thacker, Vivek V; Göpfrich, Kerstin; Misiunas, Karolis; Fuentes-Perez, Maria Eugenia; Moreno-Herrero, Fernando; Keyser, Ulrich F

2013-07-23

266

Synthesizing human insulin using recombinant DNA, 3D animation with no audioSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

DNAi Location: Manipulation>Production>pieces of the puzzle>Synthesizing the DNA In order to synthesize human insulin using recombinant DNA technology, the human DNA sequence for insulin was needed. The amino acid sequence of human insulin was known. The Genentech group deduced the human DNA sequence of insulin based on its amino acid sequence. They then used the DNA nucleotides and synthesized the human DNA sequence. This sequence was then inserted into a plasmid and transformed into bacteria to produce insulin. By synthesizing the DNA sequence, the Genentech group assembled a human DNA sequence of insulin without ever having to use \\"real\\" human DNA. They thus bypassed some of the restrictions on human recombinant DNA work resulting from the Asilomar conference.

2008-10-06

267

Recombinant dna technical bulletin. Volume 12, Number 3, September 1989  

SciTech Connect

The Recombinant DNA Technical Bulletin is a publication of the Office of Recombinant DNA Activities (ORDA), National Institutes of Health (NIH). The Bulletin attempts to link investigators involved in recombinant DNA research with organizations active in this area. It is sent to the chairmen of Institutional Biosafety Committees registered with ORDA, to principal investigators of NIH grants and contracts involving recombinant DNA, to the chairmen of genetic manipulation advisory committees, and to other individuals and groups interested in recombinant DNA activities.

Not Available

1989-09-01

268

Interaction of APE1 and other repair proteins with DNA duplexes imitating intermediates of DNA repair and replication  

Microsoft Academic Search

Interactions of APE1 (human apurinic\\/apyrimidinic endonuclease 1) and DNA polymerase ? with various DNA structures imitating\\u000a intermediates of DNA repair and replication were investigated by gel retardation and photoaffinity labeling. Photoaffinity\\u000a labeling of APE1 and DNA polymerase ? was accomplished by DNA containing photoreactive group at the 3?-end in mouse embryonic\\u000a fibroblast (MEF) cell extract or for purified proteins. On

N. S. Dyrkheeva; S. N. Khodyreva; O. I. Lavrik

2008-01-01

269

Sequence analysis for HV I region of mitochondrial DNA using WGA (Whole Genome Amplification) method  

Microsoft Academic Search

The hypervariable (HV) region in mitochondrial DNA (mtDNA) has been studied for forensic identification, DNA analysis of mother–child relationship and comparison between ethnic groups. Meanwhile, the WGA (Whole Genome Amplification) method is a technique to amplify genome DNA, and it may be useful for analyzing degraded or limited DNA. However, we need to make a comparative study to confirm whether

Akina Nara; Shinji Harihara; Kimiharu Iwadate; Koichi Uemura

2009-01-01

270

Synthetic DNA  

PubMed Central

With world wide data predicted to exceed 40 trillion gigabytes by 2020, big data storage is a very real and escalating problem. Herein, we discuss the utility of synthetic DNA as a robust and eco-friendly archival data storage solution of the future.

O' Driscoll, Aisling; Sleator, Roy D.

2013-01-01

271

Origami DNA  

NSDL National Science Digital Library

In this activity, learners create an origami model of DNA, demonstrating its double helix structure. Two templates are available as PDFs: a standard template with the base pairs already colored or a blank template where the learners have to color the four bases A, C, T and G and mark them in the correct location on the template.

Bateman, Alex; Deshpande, Preeti

2012-06-26

272

DNA Music.  

ERIC Educational Resources Information Center

Describes an activity in which students reverse-translate proteins from their amino acid sequences back to their DNA sequences then assign musical notes to represent the adenine, guanine, cytosine, and thymine bases. Data is obtained from the National Institutes of Health (NIH) on the Internet. (DDR)

Miner, Carol; della Villa, Paula

1997-01-01

273

DNA Microarrays  

Microsoft Academic Search

Until recently, diagnostic and prognostic assessment of diseased tissues in a Pathology laboratory relied on histological and immunohistological studies. DNA microarray technology now allows the simultaneous analysis of up to thousands of different genes in histological or cytological specimens. Thus, the microarray techniques offer opportunities for the pathologist to obtain ‘molecular signatures’ of the state of activity of diseased cells

Paul Hofman

2005-01-01

274

DNA Investigations.  

ERIC Educational Resources Information Center

Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

Mayo, Ellen S.; Bertino, Anthony J.

1991-01-01

275

DNA nanostructure immobilization to lithographic DNA arrays  

NASA Astrophysics Data System (ADS)

Although DNA is well known for its genetic role in biology, DNA has also been sought-after as a material for the self-assembly of biological and electronic devices. Examples of DNA nanostructure construction include DNA tiled self-assembly and DNA Origami, where by controlling the sequence and concentration of DNA molecules, the rational design of geometric DNA nanostructures is possible. The assembly of DNA nanostructures takes place in solution and thus they are in disorder and require further organization to construct circuitry or devices. Hence, it is essential for future applications of this technology to develop methods to direct the placement of DNA nanostructures on a surface. To address this challenge my research examines the use of DNA microarrays to capture DNA nanostructures via DNA hybridization. Modern DNA arrays offer a high-density of sequence-specific molecular recognition sites where the addressable placement of DNA nanostructures can be achieved. Using Maskless Array Synthesizer (MAS) technology, I have characterized photolithographic DNA arrays for the hybridization of DNA complexes like large DNA molecules (> 1 kb), DNA-gold nanoparticle conjugates, and DNA Origami. Although modern photolithographic DNA arrays can possess a high-density of sequence (106/cm2), the printed DNA areas are on the order of tens of microns. Thus, I have also developed a method to reduce the DNA array spot size to nanoscale dimensions through the combined use of electron beam lithography with photolithographic DNA synthesis. This work addresses the key elements towards developing a surface patterning technology that takes advantage of DNA base-pairing for both molecular sub-assembly and surface patterning.

Negrete, Omar D.

276

Development and evaluation of a DNA enzyme immunoassay method for env genotyping of subtypes A through G of human immunodeficiency virus type 1 group M, with discrimination of the circulating recombinant forms CRF01_AE and CRF02_AG.  

PubMed

The tools currently available for genetic subtyping of human immunodeficiency virus type 1 are laborious or can be used only for the analysis of a limited number of samples and/or subtypes. We developed and evaluated a molecular biology-based method using subtype-specific oligonucleotide probes for env genotyping of subtypes A through G, CRF01_AE, and CRF02_AG. DNA enzyme immunoassay (DEIA) genotyping is based on nested PCR amplification of the 5' end of the env gene (proviral DNA), followed by subtype-specific hybridization and immunoenzymatic detection on microplates. DEIA genotyping was validated with a large number of samples (n = 128) collected in Europe (France; n = 47), West-Central Africa (Cameroon; n = 36), and West Africa (Senegal; n = 45). Three different formats, depending on the distribution of subtypes in the three countries, were developed. The results were compared with those obtained by sequencing of the V3-V5 region and phylogenetic analysis or an env heteroduplex mobility assay. Additional sequencing and phylogenetic analyses of the DEIA region (the first codon of the env coding sequence to the middle of conserved region C1 of gp120) were performed to investigate the reasons for discrepancies. Intense and highly specific reactions between the oligonucleotide probes and the corresponding samples were observed. Overall, correct identification was achieved for 107 of 128 samples (83.6%). One sample was not amplified, 10 (8%) were nontypeable (NT), and 10 (8%) were misidentified. Six of the 10 discordant samples were further investigated by phylogenetic analysis, which indicated that these samples corresponded to recombinants involving the env 5' end and the V3 and V5 regions of the two parental clades. Sequencing of NT samples showed numerous differences between sample and probe sequences, resulting in a lack of hybridization, and revealed the limitations of the selected probes in terms of specificity and sensitivity. We demonstrated the feasibility of DEIA genotyping: six subtypes plus the two most prevalent circulating recombinant forms were discriminated by using the 5' end of the env gene. This method can be adapted to the local situation by including only probes that correspond to the prevalent strains. PMID:11880431

Plantier, Jean-Christophe; Vergne, Laurence; Damond, Florence; MBoup, Souleymane; MPoudi-NGole, Eitel; Buzelay, Laurence; Farfara, Isabelle; Brand, Denys; Peeters, Martine; Brun-Vézinet, Françoise; Delaporte, Eric; Barin, Francis

2002-03-01

277

Development and Evaluation of a DNA Enzyme Immunoassay Method for env Genotyping of Subtypes A through G of Human Immunodeficiency Virus Type 1 Group M, with Discrimination of the Circulating Recombinant Forms CRF01_AE and CRF02_AG  

PubMed Central

The tools currently available for genetic subtyping of human immunodeficiency virus type 1 are laborious or can be used only for the analysis of a limited number of samples and/or subtypes. We developed and evaluated a molecular biology-based method using subtype-specific oligonucleotide probes for env genotyping of subtypes A through G, CRF01_AE, and CRF02_AG. DNA enzyme immunoassay (DEIA) genotyping is based on nested PCR amplification of the 5? end of the env gene (proviral DNA), followed by subtype-specific hybridization and immunoenzymatic detection on microplates. DEIA genotyping was validated with a large number of samples (n = 128) collected in Europe (France; n = 47), West-Central Africa (Cameroon; n = 36), and West Africa (Senegal; n = 45). Three different formats, depending on the distribution of subtypes in the three countries, were developed. The results were compared with those obtained by sequencing of the V3-V5 region and phylogenetic analysis or an env heteroduplex mobility assay. Additional sequencing and phylogenetic analyses of the DEIA region (the first codon of the env coding sequence to the middle of conserved region C1 of gp120) were performed to investigate the reasons for discrepancies. Intense and highly specific reactions between the oligonucleotide probes and the corresponding samples were observed. Overall, correct identification was achieved for 107 of 128 samples (83.6%). One sample was not amplified, 10 (8%) were nontypeable (NT), and 10 (8%) were misidentified. Six of the 10 discordant samples were further investigated by phylogenetic analysis, which indicated that these samples corresponded to recombinants involving the env 5? end and the V3 and V5 regions of the two parental clades. Sequencing of NT samples showed numerous differences between sample and probe sequences, resulting in a lack of hybridization, and revealed the limitations of the selected probes in terms of specificity and sensitivity. We demonstrated the feasibility of DEIA genotyping: six subtypes plus the two most prevalent circulating recombinant forms were discriminated by using the 5? end of the env gene. This method can be adapted to the local situation by including only probes that correspond to the prevalent strains.

Plantier, Jean-Christophe; Vergne, Laurence; Damond, Florence; MBoup, Souleymane; MPoudi-NGole, Eitel; Buzelay, Laurence; Farfara, Isabelle; Brand, Denys; Peeters, Martine; Brun-Vezinet, Francoise; Delaporte, Eric; Barin, Francis

2002-01-01

278

Self-assembled DNA Structures for Nanoconstruction  

Microsoft Academic Search

In recent years, a number of research groups have begun developing nanofabrication methods based on DNA self-assembly. Here we review our recent experimental progress to utilize novel DNA nanostructures for self-assembly as well as for templates in the fabrication of functional nano-patterned materials. We have prototyped a new DNA nanostructure known as a cross structure. This nanostructure has a 4-fold

Hao Yan; Peng Yin; Sung Ha Park; Hanying Li; Liping Feng; Xiaoju Guan; Dage Liu; John H. Reif; Thomas H. Labean

2004-01-01

279

Polymer microspheres carrying fluorescent DNA probes  

NASA Astrophysics Data System (ADS)

A polymer microspheres carried DNA probe, which was based on resonance energy transfer, was presented in this paper when CdTe quantum dots(QDs) were as energy donors, Au nanoparticles were as energy accepters and poly(4- vinylpyrindine-co-ethylene glycol dimethacrylate) microspheres were as carriers. Polymer microspheres with functional group on surfaces were prepared by distillation-precipitation polymerization when ethylene glycol dimethacrylate was as crosslinker in acetonitrile. CdTe QDs were prepared when 3-mercaptopropionic acid(MPA) was as the stabilizer in aqueous solution. Because of the hydrogen-bonding between the carboxyl groups of MPA on QDs and the pyrindine groups on the microspheres, the QDs were self-assembled onto the surfaces of microspheres. Then, the other parts of DNA probe were finished according to the classic method. The DNA detection results indicated that this novel fluorescent DNA probe system could recognize the existence of complementary target DNA or not.

Chen, Xiaoyu; Dai, Zhao; Zhang, Jimei; Xu, Shichao; Wu, Chunrong; Zheng, Guo

2010-07-01

280

DNA sequencing using fluorescence background electroblotting membrane  

DOEpatents

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

1992-05-12

281

DNA sequencing using fluorescence background electroblotting membrane  

DOEpatents

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

Caldwell, Karin D. (Salt Lake City, UT); Chu, Tun-Jen (Salt Lake City, UT); Pitt, William G. (Orem, UT)

1992-01-01

282

Distinct DNA methylomes of newborns and centenarians.  

PubMed

Human aging cannot be fully understood in terms of the constrained genetic setting. Epigenetic drift is an alternative means of explaining age-associated alterations. To address this issue, we performed whole-genome bisulfite sequencing (WGBS) of newborn and centenarian genomes. The centenarian DNA had a lower DNA methylation content and a reduced correlation in the methylation status of neighboring cytosine--phosphate--guanine (CpGs) throughout the genome in comparison with the more homogeneously methylated newborn DNA. The more hypomethylated CpGs observed in the centenarian DNA compared with the neonate covered all genomic compartments, such as promoters, exonic, intronic, and intergenic regions. For regulatory regions, the most hypomethylated sequences in the centenarian DNA were present mainly at CpG-poor promoters and in tissue-specific genes, whereas a greater level of DNA methylation was observed in CpG island promoters. We extended the study to a larger cohort of newborn and nonagenarian samples using a 450,000 CpG-site DNA methylation microarray that reinforced the observation of more hypomethylated DNA sequences in the advanced age group. WGBS and 450,000 analyses of middle-age individuals demonstrated DNA methylomes in the crossroad between the newborn and the nonagenarian/centenarian groups. Our study constitutes a unique DNA methylation analysis of the extreme points of human life at a single-nucleotide resolution level. PMID:22689993

Heyn, Holger; Li, Ning; Ferreira, Humberto J; Moran, Sebastian; Pisano, David G; Gomez, Antonio; Diez, Javier; Sanchez-Mut, Jose V; Setien, Fernando; Carmona, F Javier; Puca, Annibale A; Sayols, Sergi; Pujana, Miguel A; Serra-Musach, Jordi; Iglesias-Platas, Isabel; Formiga, Francesc; Fernandez, Agustin F; Fraga, Mario F; Heath, Simon C; Valencia, Alfonso; Gut, Ivo G; Wang, Jun; Esteller, Manel

2012-06-26

283

Cellular fatty acid compositions of "Achromobacter groups B and E".  

PubMed Central

Strains of "Achromobacter groups B and E" were examined for cellular fatty acid (CFA) composition to evaluate their chemical relatedness to known bacterial species and groups. The CFAs were liberated from whole cells by base hydrolysis, methylated, and analyzed by capillary gas-liquid chromatography. The CFA profiles of the two groups were identical and were distinct from CFA profiles of all other bacteria we have previously tested. These data provide support for results from whole-cell protein pattern analysis and DNA-DNA and rRNA-DNA hybridization studies, which show that "Achromobacter groups B and E" are biotypes of a single new genus and species.

Holmes, B; Moss, C W; Daneshvar, M I

1993-01-01

284

The centipede genus Eupolybothrus Verhoeff, 1907 (Chilopoda: Lithobiomorpha: Lithobiidae) in North Africa, a cybertaxonomic revision, with a key to all species in the genus and the first use of DNA barcoding for the group  

PubMed Central

Abstract The centipede genus Eupolybothrus Verhoeff, 1907 in North Africa is revised. A new cavernicolous species, Eupolybothrus kahfi Stoev & Akkari, sp. n., is described from a cave in Jebel Zaghouan, northeast Tunisia. Morphologically, it is most closely related to Eupolybothrus nudicornis (Gervais, 1837) from North Africa and Southwest Europe but can be readily distinguished by the long antennae and leg-pair 15, a conical dorso-median protuberance emerging from the posterior part of prefemur 15, and the shape of the male first genital sternite. Molecular sequence data from the cytochrome c oxidase I gene (mtDNA–5’ COI-barcoding fragment) exhibit 19.19% divergence between Eupolybothrus kahfi and Eupolybothrus nudicornis, an interspecific value comparable to those observed among four other species of Eupolybothrus which, combined with a low intraspecific divergence (0.3–1.14%), supports the morphological diagnosis of Eupolybothrus kahfi as a separate species. This is the first troglomorphic myriapod to be found in Tunisia, and the second troglomorph lithobiomorph centipede known from North Africa. Eupolybothrus nudicornis is redescribed based on abundant material from Tunisia and its post-embryonic development, distribution and habitat preferences recorded. Eupolybothrus cloudsley-thompsoni Turk, 1955, a nominal species based on Tunisian type material, is placed in synonymy with Eupolybothrus nudicornis. To comply with the latest technological developments in publishing of biological information, the paper implements new approaches in cybertaxonomy, such as fine granularity XML tagging validated against the NLM DTD TaxPub for PubMedCentral and dissemination in XML to various aggregators (GBIF, EOL, Wikipedia), vizualisation of all taxa mentioned in the text via the dynamically created Pensoft Taxon Profile (PTP) page, data publishing, georeferencing of all localities via Google Earth, and ZooBank, GenBank and MorphBank registration of datasets. An interactive key to all valid species of Eupolybothrus is made with DELTA software.

Stoev, Pavel; Akkari, Nesrine; Zapparoli, Marzio; Porco, David; Enghoff, Henrik; Edgecombe, Gregory D.; Georgiev, Teodor; Penev, Lyubomir

2010-01-01

285

Carbon nanotube-enhanced electrochemical DNA biosensor for DNA hybridization detection  

Microsoft Academic Search

A novel and sensitive electrochemical DNA biosensor based on multi-walled carbon nanotubes functionalized with a carboxylic acid group (MWNTs-COOH) for covalent DNA immobilization and enhanced hybridization detection is described. The MWNTs-COOH-modified glassy carbon electrode (GCE) was fabricated and oligonucleotides with the 5'-amino group were covalently bonded to the carboxyl group of carbon nanotubes. The hybridization reaction on the electrode was

Hong Cai; Xuni Cao; Ying Jiang; Pingang He; Yuzhi Fang

2003-01-01

286

Simulation of Adsorption of DNA on Carbon Nanotubes  

SciTech Connect

We report molecular dynamics simulations of DNA adsorption on a single-walled carbon nanotube (SWNT) in an aqueous environment. We have modeled a DNA segment with 12 base pairs (Dickerson dodecamer) and a (8,8) SWNT in water, with counterions to maintain total charge neutrality. Simulations show that DNA binds to the external surface of an uncharged or positively charged SWNT on a time scale of a few hundred picoseconds. The hydrophobic end groups of DNA are attracted to the hydrophobic SWNT surface of uncharged SWNTs, while the hydrophilic backbone of DNA does not bind to the uncharged SWNT. The binding mode of DNA to charged SWNTs is qualitatively different from uncharged SWNTs. The phosphodiester groups of the DNA backbone are attracted to a positively charged SWNT surface while DNA does not adsorb on negatively charged SWNTs. There is no evidence for canonical doublestranded DNA wrapping around either charged or uncharged SWNTs on the very short time scales of the simulations. The adsorption process appears to have negligible effect on the internal stacking structure of the DNA molecule but significantly affects the A to B form conversion of A-DNA. The adsorption of A-DNA onto an uncharged SWNT inhibits the complete relaxation of A-DNA to B-DNA within the time scale of the simulations. In contrast, binding of the A-DNA onto a positively charged SWNT may promote slightly the A to B conversion.

Zhao, X.; Johnson, J.K.

2007-08-29

287

Human DNA Repair and Recombination Genes.  

National Technical Information Service (NTIS)

Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identi...

L. H. Thompson C. A. Weber N. J. Jones

1988-01-01

288

Prognostic Significance of DNA and Histone Methylation  

Cancer.gov

Nutritional Science Research Group Recently Funded Projects Prognostic Significance of DNA and Histone Methylation Principal Investigator: Piyathilake, Chandrika J Institution: University of Alabama at Birmingham   NCI/DCP Program Director: Ross, Sharon

289

DNA Base Composition of Rickettsiae.  

National Technical Information Service (NTIS)

There is a small but distinct difference in DNA base composition between the typhus and spotted fever groups of rickettsiae. The molar percentages of guanine plus cytosine for Rickettsia prowazeki, R. typhi, and R. canada are approximately 30, for R. rick...

F. J. Tyeryar E. Weiss D. B. Millar F. M. Bozeman R. A. Ormsbee

1972-01-01

290

Engineering defined motor ensembles with DNA origami.  

PubMed

Many cytoskeletal motors function in groups to coordinate the spatial and temporal positioning of cellular cargo. While methods to study the biophysical properties of single motors are well established, methods to understand how multiple motors work synergistically or antagonistically are less well developed. Here, we describe a three-dimensional synthetic cargo structure made using DNA origami, which can be used to template defined numbers and types of cytoskeletal motors with programmable geometries and spacing. We describe methods for building the DNA origami structure, covalently attaching motors to DNA, forming the motor-DNA origami structure complex, and single-molecule assays to examine the motile properties of motor ensembles. PMID:24630107

Goodman, Brian S; Reck-Peterson, Samara L

2014-01-01

291

Sumoylation and the DNA Damage Response  

PubMed Central

The cellular response to DNA damage involves multiple pathways that work together to promote survival in the face of increased genotoxic lesions. Proteins in these pathways are often posttranslationally modified, either by small groups such as phosphate, or by protein modifiers such as ubiquitin or SUMO. The recent discovery of many more SUMO substrates that are modified at higher levels in damage conditions adds weight to the accumulated evidence suggesting that sumoylation plays an important functional role in the DNA damage response. Here we discuss the significance of DNA damage-induced sumoylation, the effects of sumoylation on repair proteins, sumoylation dynamics, and crosstalk with other posttranslational modifications in the DNA damage response.

Cremona, Catherine A.; Sarangi, Prabha; Zhao, Xiaolan

2013-01-01

292

An overview of the structures of protein-DNA complexes  

PubMed Central

On the basis of a structural analysis of 240 protein-DNA complexes contained in the Protein Data Bank (PDB), we have classified the DNA-binding proteins involved into eight different structural/functional groups, which are further classified into 54 structural families. Here we present this classification and review the functions, structures and binding interactions of these protein-DNA complexes.

Luscombe, Nicholas M; Austin, Susan E; Berman , Helen M; Thornton, Janet M

2000-01-01

293

DNA Microarrays  

NASA Astrophysics Data System (ADS)

Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

Nguyen, C.; Gidrol, X.

294

Magnetic tweezers for DNA micromanipulation  

NASA Astrophysics Data System (ADS)

We detail the design of an electromagnetic assembly capable of generating a constant magnetic field superimposed to a large magnetic field gradient (between 40 and 100 T/m), which was uniform over a large gap (between 1.5 and 2 cm). Large gaps allowed the use of wide high numerical-aperture lenses to track microspheres attached to DNA molecules with an inverted light microscope. Given the geometric constraints of the microscope, computer-aided design was used to optimize the magnetic field gradient linearity, homogeneity, and amplitude, as well as the arrangement of the magnetic coils, the currents, and the mechanical stability of the assembly. The assembly was used to apply forces of controlled amplitude, direction, and time dependence on superparamagnetic microspheres by using magnetic coils instead of permanent magnets. A streptavidin-coated microsphere was attached to the 3' end of a ?-phage DNA molecule through a single biotin molecule. The 5' end of the ?-phage DNA molecule was tethered to a glass coverslip by conjugating the DNA's overhang to a complementary 12 base-pair primer, which was itself cross-linked to a heterobifunctional group placed on the glass coverslip. By tracking the centroid of this microsphere, the mechanical response of a single ?-phage DNA molecule was measured as a function of the applied magnetic force. The resulting force-extension curve was fitted with the worm-like-chain model to obtain ?-phage DNA's persistence length and contour length, which were in agreement with previous reports.

Haber, Charbel; Wirtz, Denis

2000-12-01

295

Oxidative DNA modifications  

Microsoft Academic Search

Oxidative DNA modifications are frequent in mammalian DNA and have been suggested an important mechanism in carcinogenesis, diabetes and ageing. The foundations for this suggestion are:Evidence for the importance of oxidative DNA modifications in cancer development is: high levels of oxidative lesions in cancer tissue; highly conserved and specific DNA repair systems targeting oxidative lesions; high levels of oxidative DNA

Henrik E. Poulsen

2005-01-01

296

DNA adsorption characteristics of hollow spherule allophane nano-particles.  

PubMed

To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5'-monophosphate (5'-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5'-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al-OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. PMID:24094227

Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo

2013-12-01

297

DNA adsorption characteristics of hollow spherical allophane nano-particles  

NASA Astrophysics Data System (ADS)

To understand the propensity of the natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against a natural allophane, using single-stranded DNA (ss-DNA) and adenosine 5'-monophosphate (5'-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5'-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al-OH groups on the wall perforations through deprotonation, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the allophane clustered particle was successfully observed through TEM analysis.

Matsuura, Yoko; Iyoda, Fumitoshi; Hayashi, Shuhei; Arakawa, Shuichi; Okamoto, Masami; Hayashi, Hidetomo

2014-05-01

298

Preparation and characterization of imogolite/DNA hybrid hydrogels.  

PubMed

Imogolite is one of the clay minerals contained in volcanic ash soils. The novel hybrid hydrogels were prepared from imogolite nanofibers and DNA by utilizing strong interaction between the aluminol groups on imogolite surface and phosphate groups of DNA. The hybrid hydrogels of imogolite and DNA were prepared in various feed ratios, and their physicochemical properties and molecular aggregation states were investigated in both dispersion and gel states. The maximum DNA content in the hybrid gels was shown in equivalent molar ratio of imogolite and DNA. The physical properties of the hybrid gels were changed by varying DNA blend ratios. In the dispersion state, the hybrid gels showed a fibrous structure of imogolite, whereas a continuous network structure was observed in pure imogolite, indicating that the hybrid with DNA enhanced the dispersion of imogolite. In the gel state, DNA and imogolite nanofibers formed a 3D network structure. PMID:22148683

Jiravanichanun, Nattha; Yamamoto, Kazuya; Kato, Kenichi; Kim, Jungeun; Horiuchi, Shin; Yah, Weng-On; Otsuka, Hideyuki; Takahara, Atsushi

2012-01-01

299

THE VALENTINER GROUP AS GALOIS GROUP  

Microsoft Academic Search

We obtain the complete set of solutions to the Galois embedding problem given by the Valentiner group as a triple cover of the alternating group A6. The Valentiner group is a primitive subgroup of the special linear group of order 3o ver aeldk of characteristic 0 containing the roots of unity of order 15. It can also be seen as

TERESA CRESPO; ZBIGNIEW HAJTO

300

mtDNA / Y chromosome pedigree, animated imageSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

DNAi location:Applications>gene genealogy>Tracing ancestries>Using genetic tools together Studies following the male lineage (using the Y chromosome) have been compared to studies following the female lineage (using mitochondrial DNA (mtDNA)). The results suggest that men and women have had different roles in the peopling of the planet and in the mixing of genes among population groups. A pedigree illustrating maternal inheritance of mtDNA and paternal inheritance of the Y chromosome.

2008-10-06

301

DNA barcoding of billfishes.  

PubMed

DNA barcoding is a method promising fast and accurate identification of animal species based on the sequencing of the mitochondrial c oxidase subunit (COI) gene. In this study, we explore the prospects for DNA barcoding in one particular fish group, the billfishes (suborder Xiphioidei--swordfish, marlins, spearfishes, and sailfish). We sequenced the mitochondrial COI gene from 296 individuals from the 10 currently recognized species of billfishes, and combined these data with a further 57 sequences from previously published projects. We also sequenced the rhodopsin gene from a subset of 72 individuals to allow comparison of mitochondrial results against a nuclear marker. Five of the 10 species are readily distinguishable by COI barcodes. Of the rest, the striped marlin (Kajikia audax) and white marlin (K. albida) show highly similar sequences and are not unambiguously distinguishable by barcodes alone, likewise are the three spearfishes Tetrapturus angustirostris, T. belone, and T. pfluegeri. We discuss the taxonomic status of these species groups in light of our and other data, molecular and morphological. PMID:21980985

Hanner, Robert; Floyd, Robin; Bernard, Andrea; Collette, Bruce B; Shivji, Mahmood

2011-10-01

302

A phosphate bound universal linker for DNA synthesis.  

PubMed

A uridine-based linker immobilized onto polystyrene beads at the 5' terminus via a phosphodiester group and then used as a universal DNA synthesis support gives post synthesis DNA cleavage in 8 hrs or less without alkali metal salts. DNA produced with the new support was analyzed by HPLC, MALDI mass spectroscopy and PAGE. Each analysis showed DNA of equivalent quality to that produced with standard CPG supports, without contaminating materials resulting from linker or support backbone decomposition. PMID:10478485

Lyttle, M H; Dick, D J; Hudson, D; Cook, R M

1999-08-01

303

Mouse Zygotes Respond to Severe Sperm DNA Damage by Delaying Paternal DNA Replication and Embryonic Development  

PubMed Central

Mouse zygotes do not activate apoptosis in response to DNA damage. We previously reported a unique form of inducible sperm DNA damage termed sperm chromatin fragmentation (SCF). SCF mirrors some aspects of somatic cell apoptosis in that the DNA degradation is mediated by reversible double strand breaks caused by topoisomerase 2B (TOP2B) followed by irreversible DNA degradation by a nuclease(s). Here, we created zygotes using spermatozoa induced to undergo SCF (SCF zygotes) and tested how they responded to moderate and severe paternal DNA damage during the first cell cycle. We found that the TUNEL assay was not sensitive enough to identify the breaks caused by SCF in zygotes in either case. However, paternal pronuclei in both groups stained positively for ?H2AX, a marker for DNA damage, at 5 hrs after fertilization, just before DNA synthesis, while the maternal pronuclei were negative. We also found that both pronuclei in SCF zygotes with moderate DNA damage replicated normally, but paternal pronuclei in the SCF zygotes with severe DNA damage delayed the initiation of DNA replication by up to 12 hrs even though the maternal pronuclei had no discernable delay. Chromosomal analysis of both groups confirmed that the paternal DNA was degraded after S-phase while the maternal pronuclei formed normal chromosomes. The DNA replication delay caused a marked retardation in progression to the 2-cell stage, and a large portion of the embryos arrested at the G2/M border, suggesting that this is an important checkpoint in zygotic development. Those embryos that progressed through the G2/M border died at later stages and none developed to the blastocyst stage. Our data demonstrate that the zygote responds to sperm DNA damage through a non-apoptotic mechanism that acts by slowing paternal DNA replication and ultimately leads to arrest in embryonic development.

Gawecka, Joanna E.; Marh, Joel; Ortega, Michael; Yamauchi, Yasuhiro; Ward, Monika A.; Ward, W. Steven

2013-01-01

304

Berberine: Complex with Dna.  

National Technical Information Service (NTIS)

A complex of calf-thymus DNA with berberine sediments in the analytical ultracentrifuge. The DNA produced systematic changes in the absorption spectrum of berberine which suggest that single alkaloid molecules bind to DNA. Flow dichroism of purines and py...

A. E. Krey F. E. Hahn

1969-01-01

305

Synthesis of DNA  

DOEpatents

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Mariella, Jr., Raymond P. (Danville, CA)

2008-11-18

306

DNA, Genes and Chromosomes  

NSDL National Science Digital Library

Today you will learn about the parts of DNA and what DNA, genes and chromosomes are. Today you will learn what DNA, genes and chromosomes are and the parts of the DNA molecule. Look at all of the websites, take whatever notes you need to. At the end of the assignment, be able to describle DNA, the parts of DNA, genes and chromosomes. Covers Biology Core Curriculum, ...

Fomby, Mrs.

2007-11-07

307

PEG-assisted DNA solubilization in organic solvents for preparing cytosol specifically degradable PEG/DNA nanogels.  

PubMed

DNA was dissolved in selected organic solvents in the presence of poly(ethylene glycol) (PEG). Nanoscale PEG/DNA complex (approximately 100 nm) was produced in dimethylsulfoxide (DMSO) phase. Using a thiol-functionalized six-arm branched PEG for DNA solubilization, the PEG/DNA nanocomplex was cross-linked through the formation of disulfide linkages between the thiol groups, resulting in the production of stable PEG/DNA nanogels in aqueous solution. DNA release from the nanogels could be modulated by changing the concentration of an external reducing agent. The released plasmid DNA from the nanogels maintained intact structural integrity and exhibited appreciable gene transfection efficiency. The PEG/DNA nanogels could be potentially applied for gene therapy including DNA vaccination. PMID:17105212

Mok, Hyejung; Park, Tae Gwan

2006-01-01

308

Adaptive group testing for consecutive positives  

Microsoft Academic Search

Abstract Motivated from an application to DNA library screening, Balding and Tor- ney [1] and Colbourn [4] studied the following group testing for consecutive positives. Suppose Vn = {v1,v2,... vn} is a linearly ordered set in which each item has a positive or negative state, and there are at most d pos- itive items, forming a consecutive set under the

Justie Su-tzu Juan; Gerard J. Chang

2008-01-01

309

Mitochondrial DNA (mtDNA) in brain samples from patients with major psychiatric disorders: gene expression profiles, mtDNA content and presence of the mtDNA common deletion.  

PubMed

Several lines of evidence support a mitochondrial dysfunction in major psychiatric disorders. The objective of this study was to determine whether mitochondrial DNA (mtDNA) expression or content are implicated in the mitochondrial dysfunction observed in schizophrenia (SCH), bipolar disorder (BD), and major depressive disorder (MDD). MtDNA gene expression and mtDNA content (including the MT-ND4 deletion) were measured by RT-qPCR and qPCR, respectively. Post-mortem brain tissue from 60 subjects, divided evenly into four diagnostic groups (SCH, BD, MDD, and control (C)), was analyzed. MT-ND1 gene expression was significantly increased in the BD group compared with the C group. MDD and SCH patients showed a similar pattern of mtDNA expression, which was different from that in BD patients. Similarly, a larger number of MDD and SCH patients tended to have the MT-ND4 gene deleted compared with BD and C subjects. However, no other significant differences were observed in mtDNA gene expression and mtDNA content. Notably, high variability was observed in the mtDNA gene expression and content in each diagnostic group. Previous studies and the present work provide evidence for a role of mtDNA in SCH, BD and MDD. However, further studies with larger patient and control groups as well as by analyzing distinct brain regions are needed to elucidate the role of mtDNA in major psychiatric disorders. PMID:23355257

Torrell, Helena; Montaña, Elena; Abasolo, Nerea; Roig, Bàrbara; Gaviria, Ana M; Vilella, Elisabet; Martorell, Lourdes

2013-03-01

310

Aberrant DNA methylation patterns in diabetic nephropathy  

PubMed Central

Background The aim of this study was to evaluate whether global levels of DNA methylation status were associated with albuminuria and progression of diabetic nephropathy in a case-control study of 123 patients with type 2 diabetes- 53 patients with albuminuria and 70 patients without albuminuria. Methods The 5-methyl cytosine content was assessed by reverse phase high pressure liquid chromatography (RP-HPLC) of peripheral blood mononuclear cells to determine individual global DNA methylation status in two groups. Results Global DNA methylation levels were significantly higher in patients with albuminuria compared with those in normal range of albuminuria (p?=?0.01). There were significant differences in global levels of DNA methylation in relation to albuminuria (p?=?0.028) and an interesting pattern of increasing global levels of DNA methylation in terms of albuminuria severity. In patients with micro- and macro albuminuria, we found no significant correlations between global DNA methylation levels and duration of diabetes (p?>?0.05). In both sub groups, there were not significant differences between global DNA methylation levels with good and poor glycaemic control (p?>?0.05). In addition, in patients with albuminuria, no differences in DNA methylation levels were observed between patients with and without other risk factors including age, gender, hypertension, dyslipidaemia and obesity. Conclusions These data may be helpful in further studies to develop novel biomarkers and new strategies for clinical care of patients at risk of diabetic nephropathy.

2014-01-01

311

Evidence for two groups of banana bunchy top virus isolates  

Microsoft Academic Search

Banana bunchy top virus (BBTV) DNA component 1 from isolates from 10 different countries was cloned and sequenced and the sequences were aligned and com- pared. This analysis indicated two groups: the South Pacific group (isolates from Australia, Burundi, Egypt, Fiji, India, Tonga and Western Samoa) and the Asian group (isolates from the Philippines, Taiwan and Vietnam). The mean sequence

Mirko Karan; Robert M. Harding; James L. Dale

1994-01-01

312

Interagency mechanical operations group numerical systems group  

SciTech Connect

This report consists of the minutes of the May 20-21, 1971 meeting of the Interagency Mechanical Operations Group (IMOG) Numerical Systems Group. This group looks at issues related to numerical control in the machining industry. Items discussed related to the use of CAD and CAM, EIA standards, data links, and numerical control.

NONE

1997-09-01

313

Melanesian mtDNA Complexity  

PubMed Central

Melanesian populations are known for their diversity, but it has been hard to grasp the pattern of the variation or its underlying dynamic. Using 1,223 mitochondrial DNA (mtDNA) sequences from hypervariable regions 1 and 2 (HVR1 and HVR2) from 32 populations, we found the among-group variation is structured by island, island size, and also by language affiliation. The more isolated inland Papuan-speaking groups on the largest islands have the greatest distinctions, while shore dwelling populations are considerably less diverse (at the same time, within-group haplotype diversity is less in the most isolated groups). Persistent differences between shore and inland groups in effective population sizes and marital migration rates probably cause these differences. We also add 16 whole sequences to the Melanesian mtDNA phylogenies. We identify the likely origins of a number of the haplogroups and ancient branches in specific islands, point to some ancient mtDNA connections between Near Oceania and Australia, and show additional Holocene connections between Island Southeast Asia/Taiwan and Island Melanesia with branches of haplogroup E. Coalescence estimates based on synonymous transitions in the coding region suggest an initial settlement and expansion in the region at ?30–50,000 years before present (YBP), and a second important expansion from Island Southeast Asia/Taiwan during the interval ?3,500–8,000 YBP. However, there are some important variance components in molecular dating that have been overlooked, and the specific nature of ancestral (maternal) Austronesian influence in this region remains unresolved.

Friedlaender, Jonathan S.; Friedlaender, Francoise R.; Hodgson, Jason A.; Stoltz, Matthew; Koki, George; Horvat, Gisele; Zhadanov, Sergey; Schurr, Theodore G.; Merriwether, D. Andrew

2007-01-01

314

Repair of DNA damaged by ionizing radiation and other oxidative agents in yeast and human  

Microsoft Academic Search

Treatment of cells with oxidative DNA damaging agents such as ionizing radiation and hydrogen peroxide produces .OH radicals which attack DNA, producing single strand breaks and double strand breaks that have a 3'-blocked terminus with a phosphoglycolate or a phosphate group attached to the 3'-terminus. While DNA strand breaks with 3'-blocked termini are the hallmark of oxidative DNA damage, the

Louise Prakash

2000-01-01

315

Conserved sequences at the origin of adenovirus DNA replication.  

PubMed

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A . T-rich region which is partially conserved among these serotypes, and a distal G . C-rich region which is less well conserved. The G . C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. PMID:7143575

Stillman, B W; Topp, W C; Engler, J A

1982-11-01

316

Packaging of DNA by shell crosslinked nanoparticles.  

PubMed Central

We demonstrate compaction of DNA with nanoscale biomimetic constructs which are robust synthetic analogs of globular proteins. These constructs are approximately 15 nm in diameter, shell crosslinked knedel-like (SCKs) nanoparticles, which are prepared by covalent stabilization of amphiphilic di-block co-polymer micelles, self-assembled in an aqueous solution. This synthetic approach yields size-controlled nanoparticles of persistent shape and containing positively charged functional groups at and near the particle surface. Such properties allow SCKs to bind with DNA through electrostatic interactions and facilitate reduction of the DNA hydrodynamic diameter through reversible compaction. Compaction of DNA by SCKs was evident in dynamic light scattering experiments and was directly observed by in situ atomic force microscopy. Moreover, enzymatic digestion of the DNA plasmid (pBR322, 4361 bp) by Eco RI was inhibited at low SCK:DNA ratios and prevented when [le]60 DNA bp were bound per SCK. Digestion by Msp I in the presence of SCKs resulted in longer DNA fragments, indicating that not all enzyme cleavage sites were accessible within the DNA/SCK aggregates. These results have implications for the development of vehicles for successful gene therapy applications.

Thurmond, K B; Remsen, E E; Kowalewski, T; Wooley, K L

1999-01-01

317

Packaging of DNA by shell crosslinked nanoparticles.  

PubMed

We demonstrate compaction of DNA with nanoscale biomimetic constructs which are robust synthetic analogs of globular proteins. These constructs are approximately 15 nm in diameter, shell crosslinked knedel-like (SCKs) nanoparticles, which are prepared by covalent stabilization of amphiphilic di-block co-polymer micelles, self-assembled in an aqueous solution. This synthetic approach yields size-controlled nanoparticles of persistent shape and containing positively charged functional groups at and near the particle surface. Such properties allow SCKs to bind with DNA through electrostatic interactions and facilitate reduction of the DNA hydrodynamic diameter through reversible compaction. Compaction of DNA by SCKs was evident in dynamic light scattering experiments and was directly observed by in situ atomic force microscopy. Moreover, enzymatic digestion of the DNA plasmid (pBR322, 4361 bp) by Eco RI was inhibited at low SCK:DNA ratios and prevented when [le]60 DNA bp were bound per SCK. Digestion by Msp I in the presence of SCKs resulted in longer DNA fragments, indicating that not all enzyme cleavage sites were accessible within the DNA/SCK aggregates. These results have implications for the development of vehicles for successful gene therapy applications. PMID:10390540

Thurmond, K B; Remsen, E E; Kowalewski, T; Wooley, K L

1999-07-15

318

Recognition of Dermabacter hominis, formerly CDC fermentative coryneform group 3 and group 5, as a potential human pathogen.  

PubMed Central

Thirty strains of fermentative coryneform-like bacteria designated CDC fermentative coryneform group 3 and coryneform group 5 were compared biochemically by cellular fatty acid analysis and by DNA relatedness with the type strain of Dermabacter hominis, ATCC 49369. DNA from 22 strains of both CDC groups showed 69 to 96% relatedness (hydroxyapatite method) to labeled DNA from ATCC 49369 and to DNA from CDC group 3 strain G4964, and the strains are considered to belong to D. hominis. The remaining eight strains were genetically but not phenotypically differentiable from D. hominis. They were genetically heterogeneous, but hybridization results indicated that they probably belong to the genus Dermabacter. Thirteen of the 22 D. hominis strains and all 8 of the other Dermabacter strains had been isolated from blood, which indicates the pathogenic potential of this species and genus.

Gruner, E; Steigerwalt, A G; Hollis, D G; Weyant, R S; Weaver, R E; Moss, C W; Daneshvar, M; Brenner, D J

1994-01-01

319

Chemical method for introducing haptens on to DNA probes  

SciTech Connect

The authors developed a versatile chemical method of attaching hapten moieties onto DNA, for the construction of nonisotopic DNA probes. The DNA is reacted with N-bromosuccinimide at alkaline pH, resulting in bromination of a fraction of the thymine, guanine, and cytosine residues, with adenine modified to a lesser extent. The bromine is subsequently displaced by a primary amino group, attached to a linker arm. The other end of the linker arm has a detectable group preattached to it. They have labeled cloned hepatitis B viral (HBV) DNA with the hapten 2,4-dinitrophenyl (DNP) and used it in combination with a high affinity rabbit anti-DNP antibody, for the detection of hepatitis B DNA by slot blotting. This probe was sensitive enough to specifically detect 1 x 10/sup -17/ mol (1 x 10/sup 6/ copies) of HBV DNA in total DNA from human serum.

Keller, G.H.; Cumming, C.U.; Huang, D.P.; Manak, M.M.; Ting, R.

1988-05-01

320

Preparation and characterization of DNA/allophane composite hydrogels.  

PubMed

The preparation and characterization of the composite hydrogels based on double-stranded deoxyribonucleic acid (DNA) and natural allophane (AK70) were reported. To understand the propensity of the natural allophane to adsorb the DNA molecules, using zeta potential measurement, Fourier transform infrared spectroscopy (FTIR) and electrophoresis analyses assessed the adsorption characteristics. The freeze-dried DNA/AK70 hydrogels were demonstrated that the DNA bundle structure with a width of ?2?m and a length of ?15-20?m was wrapped around the clustered allophane particles as revealed by FE-SEM/EDX analysis. The incorporation of AK70 in hydrogels induced the increase in the enthalpy of the helix-coil transition of DNA duplex due to the restricted molecular motions of the DNA duplex facilitated by the interaction between the phosphate groups of DNA and the protonated (+)(OH2)Al(OH2) groups on the wall perforations of the allophane. PMID:24041573

Kawachi, Takuya; Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; Okamoto, Masami

2013-12-01

321

DNA based biosensors  

Microsoft Academic Search

Compared to advances in enzyme sensors, immunosensors, and microbial biosensors, relatively little work exists on DNA based biosensors. Here we review the DNA based biosensors that rely on nucleic acid hybridization. Major types DNA biosensors—electrochemical, optical, acoustic, and piezoelectric—are introduced and compared. The specificity and response characteristics of DNA biosensors are discussed. Overall, a promising future is foreseen for the

Junhui Zhai; Hong Cui; Ruifu Yang

1997-01-01

322

Quantitative DNA fiber mapping  

DOEpatents

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

Gray, Joe W. (San Francisco, CA); Weier, Heinz-Ulrich G. (Oakland, CA)

1998-01-01

323

Behavior of Supercoiled DNA  

Microsoft Academic Search

We study DNA supercoiling in a quantitative fashion by micromanipulating single linear DNA molecules with a magnetic field gradient. By anchoring one end of the DNA to multiple sites on a magnetic bead and the other end to multiple sites on a glass surface, we were able to exert torsional control on the DNA. A rotating magnetic field was used

T. R. Strick; J.-F. Allemand; D. Bensimon; V. Croquette

1998-01-01

324

DNA Demethylation by TDG  

PubMed Central

Summary DNA methylation has long been considered a very stable DNA modification in mammals that could only be removed by replication in the absence of re-methylation, i.e. by mere dilution of this epigenetic mark (so-called passive DNA demethylation). However, in recent years, a significant number of studies have revealed the existence of active processes of DNA demethylation in mammals, with important roles in development and transcriptional regulation, allowing the molecular mechanisms of active DNA demethylation to be unraveled. Here we review the recent literature highlighting the prominent role played in active DNA demethylation by base excision repair and especially by Thymine DNA Glycosylase.

Dalton, Shannon R.; Bellacosa, Alfonso

2013-01-01

325

Strategies for RNA-Guided DNA Recombination  

NASA Astrophysics Data System (ADS)

We present a model for homologous DNA recombination events guided by double-stranded RNA (dsRNA) templates, and apply this model to DNA rearrangements in some groups of ciliates, such as Stylonychia or Oxytricha. In these organisms, differentiation of a somatic macronucleus from a germline micronucleus involves extensive gene rearrangement, which can be modeled as topological braiding of the DNA, with the template-guided alignment proceeding through DNA branch migration. We show that a graph structure, which we refer to as an assembly graph, containing only 1- and 4-valent vertices can provide a physical representation of the DNA at the time of recombination. With this representation, 4-valent vertices correspond to the alignment of the recombination sites, and we model the actual recombination event as smoothing of these vertices.

Angeleska, Angela; Jonoska, Nataša; Saito, Masahico; Landweber, Laura F.

326

Potentiometric monitoring DNA hybridization.  

PubMed

The usual procedure to monitor the ion exchange of small ions utilizes a potentiometer with a selective membrane as part of the working electrode. As the next step, we have applied polyaniline electrodes to the monitoring the activity macromolecular ions during DNA hybridization. Single-strand oligonucleotide (ssODN) probes were immobilized using a nucleophilic substitution reaction of the thiolated ssODN molecules with polyaniline. The anionic phosphate groups of the probe molecules also interacted with the cationic-doped polyaniline surface. Three useful findings were observed with the potentiometric experiments. First, the binding of the complimentary target molecules with the immobilized probes revealed a substantial potential change. Further, potential change was observed neither with the non-complimentary targets nor with the samples with a mutation in the sequence. The last two experiments were important for the future evaluation of the impact of medium and potential interfering compounds: anionic groups and hydrogen bonding groups in the non-complimentary samples did not cause any interactions. PMID:19477628

Zhou, Y; Yu, B; Guiseppi-Elie, A; Sergeyev, V; Levon, K

2009-07-15

327

DNA base composition of rickettsiae.  

PubMed

There is a small but distinct difference in DNA base composition between the typhus and spotted fever groups of rickettsiae. The molar percentages of guanine plus cytosine for Rickettsia prowazeki, R. typhi, and R. canada are approximately 30, for R. rickettsi, R. conori, and R. akari they are about 32.5. The percentage for trench fever rickettsia, Rochalimaea quintana, is 38.6. PMID:4633692

Tyeryar, F J; Weiss, E; Millar, D B; Bozeman, F M; Ormsbee, R A

1973-04-27

328

Chemical methods of DNA and RNA fluorescent labeling.  

PubMed Central

Several procedures have been described for fluorescent labeling of DNA and RNA. They are based on the introduction of aldehyde groups by partial depurination of DNA or oxidation of the 3'-terminal ribonucleoside in RNA by sodium periodate. Fluorescent labels with an attached hydrazine group are efficiently coupled with the aldehyde groups and the hydrazone bonds are stabilized by reduction with sodium cyanoborohydride. Alternatively, DNA can be quantitatively split at the depurinated sites with ethylenediamine. The aldimine bond between the aldehyde group in depurinated DNA or oxidized RNA and ethylenediamine is stabilized by reduction with sodium cyanoborohydride and the primary amine group introduced at these sites is used for attachment of isothiocyanate or succinimide derivatives of fluorescent dyes. The fluorescent DNA labeling can be carried out either in solution or on a reverse phase column. These procedures provide simple, inexpensive methods of multiple DNA labeling and of introducing one fluorescent dye molecule per RNA, as well as quantitative DNA fragmentation and incorporation of one label per fragment. These methods of fluorophore attachment were shown to be efficient for use in the hybridization of labeled RNA, DNA and DNA fragments with oligonucleotide microchips.

Proudnikov, D; Mirzabekov, A

1996-01-01

329

DNA Fingerprint: Alu Lab  

NSDL National Science Digital Library

This online activity features molecular genotyping using polymerase chain reaction (PCR) to provide data to study population genetics and human evolution. In this activity, which supplements a hands-on lab at the Dolan DNA Learning Center's Harlem DNA Lab, students learn how to collect their own DNA, use PCR to amplify a region of DNA from chromosome 16, and analyze the amplified DNA with gel electrophoresis.

David Micklos (Cold Spring Harbor;)

2010-05-27

330

Amplified DNA Biosensors  

Microsoft Academic Search

\\u000a Amplified detection of DNA is a central research topic in modern bioanalytical science. Electronic or optical transduction\\u000a of DNA recognition events provides readout signals for DNA biosensors. Amplification of the DNA analysis is accomplished by\\u000a the coupling of nucleic acid-functionalized enzymes or nucleic acid-functionalized nanoparticles (NP) as labels for the DNA\\u000a duplex formation. This chapter discusses the amplified amperometric analysis

Itamar Willner; Bella Shlyahovsky; Bilha Willner; Maya Zayats

2009-01-01

331

Group B Strep Infection  

MedlinePLUS

MENU Return to Web version Group B Strep Infection Overview What is group B strep? Group B streptococcus, or group B strep for short, is a certain kind ... of healthy pregnant women. A woman who has group B strep is said to be "colonized" with ...

332

Polycomb group response elements in Drosophila and vertebrates.  

PubMed

Polycomb group genes (PcG) encode a group of about 16 proteins that were first identified in Drosophila as repressors of homeotic genes. PcG proteins are present in all metazoans and are best characterized as transcriptional repressors. In Drosophila, these proteins are known as epigenetic regulators because they remember, but do not establish, the patterned expression state of homeotic genes throughout development. PcG proteins, in general, are not DNA binding proteins, but act in protein complexes to repress transcription at specific target genes. How are PcG proteins recruited to the DNA? In Drosophila, there are specific regulatory DNA elements called Polycomb group response elements (PREs) that bring PcG protein complexes to the DNA. Drosophila PREs are made up of binding sites for a complex array of DNA binding proteins. Functional PRE assays in transgenes have shown that PREs act in the context of other regulatory DNA and PRE activity is highly dependent on genomic context. Drosophila PREs tend to regulate genes with a complex array of regulatory DNA in a cell or tissue-specific fashion and it is the interplay between regulatory DNA that dictates PRE function. In mammals, PcG proteins are more diverse and there are multiple ways to recruit PcG complexes, including RNA-mediated recruitment. In this review, we discuss evidence for PREs in vertebrates and explore similarities and differences between Drosophila and vertebrate PREs. PMID:23419717

Kassis, Judith A; Brown, J Lesley

2013-01-01

333

Identification of Phytophthora citrophthora with Cloned DNA Probes  

PubMed Central

Two different DNA fragments, one of 2.9 kilobases and the other of 5.1 kilobases, were cloned from Phytophthora citrophthora and showed no homology with DNA from plants and other related fungi. These DNA probes hybridized with DNA from 12 different P. citrophthora isolates obtained from a variety of hosts but did not hybridize with DNA from 6 P. citrophthora isolates obtained from cacao. Southern blot analysis revealed that the probes contained repetitive DNA, and restriction fragment length polymorphisms were identified among several P. citrophthora isolates. Of the isolates tested, two major groups were observed whose genetic similarity correlated with geographical distribution. One of the DNA probes was used to detect P. citrophthora growing from infected citrus roots incubated on semiselective medium. P. citrophthora was not detected by a hybridization assay of total DNA extracted directly from infected roots. Images

Goodwin, P. H.; Kirkpatrick, B. C.; Duniway, J. M.

1990-01-01

334

Comparative analysis of eubacterial DNA polymerase III alpha subunits.  

PubMed

DNA polymerase III is one of the five eubacterial DNA polymerases that is responsible for the replication of DNA duplex. Among the ten subunits of the DNA polymerase III core enzyme, the alpha subunit catalyzes the reaction for polymerizing both DNA strands. In this study, we extracted genomic sequences of the alpha subunit from 159 sequenced eubacterial genomes, and carried out sequence-based phylogenetic and structural analyses. We found that all eubacterial genomes have one or more alpha subunits, which form either homodimers or heterodimers. Phylogenetic and domain structural analyses as well as copy number variations of the alpha subunit in each bacterium indicate the classification of alpha subunit into four basic groups: polC, dnaE1, dnaE2, and dnaE3. This classification is of essence in genome composition analysis. We also consolidated the naming convention to avoid further confusion in gene annotations. PMID:17531796

Zhao, Xiao-Qian; Hu, Jian-Fei; Yu, Jun

2006-11-01

335

Effect of DNA type on response of DNA biosensor for carcinogens  

NASA Astrophysics Data System (ADS)

Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

2013-11-01

336

The crystal structures of DNA Holliday junctions  

Microsoft Academic Search

Nearly 40 years ago, Holliday proposed a four-stranded complex or junction as the central intermediate in the general mechanism of genetic recombination. During the past two years, six single-crystal structures of such DNA junctions have been determined by three different research groups. These structures all essentially adopt the antiparallel stacked-X conformation, but can be classified into three distinct categories: RNA–DNA

P. Shing Ho; Brandt F Eichman

2001-01-01

337

Redefining Cohesiveness in Groups.  

ERIC Educational Resources Information Center

Attempted to replicate and extend research on work of Kelly and Duran in assessing relationship of group member perceptions of group interaction to group effectiveness. Concludes perceived similarity may not always align with perceptions of cohesiveness. (Author/ABL)

Keyton, Joann; Springston, Jeff

1990-01-01

338

Group Time: Building Language at Group Time  

ERIC Educational Resources Information Center

This article features energizing and surprising activities for children at group time. In the drawing activity, children are asked to give instructions on how to draw a picture using vocabulary and descriptive language. In the mailbox activity, children will be surprised to discover that they have mail at group time. Mailboxes can be used for…

Church, Ellen Booth

2004-01-01

339

Unzipping of Double-stranded DNA in Engineered ?-Hemolysin Pores  

PubMed Central

Biological protein ?-hemolysin nanopore is under intense investigation as a potential platform for rapid and low-cost DNA sequencing. However, due to its narrow constriction, analysis of DNA in the ?-hemolysin pore has long time been restricted to single strands. In this paper, we report that by introducing new surface functional groups into the ?-hemolysin pore, facilitated unzipping of double-stranded DNA through the channel could be achieved. Since the mean residence time of the DNA events is dependent on the length of the duplex, and also varies with the nucleotide base composition, the modified protein pore approach offers the potential for rapid double-stranded DNA analysis, including sequencing.

Liu, Aihua; Zhao, Qitao; Krishantha, D.M. Milan; Guan, Xiyun

2011-01-01

340

Action mechanism of human SMUG1 uracil-DNA glycosylase.  

PubMed

The DNA lesions resulting from deamination or oxidation of bases are generally repaired by the base excision repair pathway initiated by damage-specific DNA glycosylases. Single-strand selective monofunctional uracil-DNA glycosylase (SMUG1) present in vertebrates and insects excises not only uracil but also uracil derivatives bearing an oxidized group at ring-C5 from DNA, indicating roles in the repair of both deamination and oxidation damage to DNA. In the present study, we have constructed a series of active site mutants of human SMUG1 and analyzed the catalytic and precision damage recognition mechanisms. PMID:17150750

Matsubara, Mayumi; Tanaka, Tamon; Terato, Hiroaki; Ide, Hiroshi

2005-01-01

341

Genomic Analysis of Clostridium botulinum Group II by Pulsed-Field Gel Electrophoresis  

Microsoft Academic Search

Pulsed-field gel electrophoresis (PFGE) was optimized for genomic analyses of Clostridium botulinum (non- proteolytic) group II. DNA degradation problems caused by extracellular DNases were overcome by fixation of cells with formaldehyde prior to isolation. A rapid (4-h) in situ DNA isolation method was also assessed and gave indistinguishable results. Genomic DNA from 21 strains of various geographical and temporal origins

SEBASTIAN HIELM; JOHANNA BJORKROTH; EIJA HYYTIA; HANNU KORKEALA

1998-01-01

342

Circulating DNA in systemic lupus erythematosus. Isolation and characterization.  

PubMed Central

Immunoprecipitable double-stranded (dsDNA) was previously shown to persist in the circulation of a clinically recognizable subgroup of patients with systemic lupus erythematosus (SLE). Plasma from 10 such patients was subjected to a DNA isolation procedure that used a combination of proteolysis, phenol extraction, and hydroxylapatite adsorption and elution in the presence of urea. The isolated dsDNA was radiolabeled by nick translation and then characterized by isopyknic ultracentrifugation in CsCl under both neutral and alkaline conditions, as well as after digestion with S1-endonuclease. These experiments demonstrated essential identity in nucleotide base composition between the plasma-derived DNA and human genomic DNA. The presence of specific human base sequences in the plasma DNA was demonstrated by finding that authentic human genomic DNA accelerated the renaturation of plasma DNA when compared with the effect of nonhuman, control DNA. The proportion of such sequences in plasma DNA was estimated by attempting to renature the plasma DNA in the presence of human DNA under conditions shown to result in complete renaturation of human DNA in model experiments. In this way, a minimum of 47% of plasma DNA base sequences could be shown also to be present in human genomic DNA. However, an average of 10-20% of the plasma-derived DNA failed to renature under these conditions, a result that was further confirmed by comparing the renaturation of the tritium-labeled plasma DNA specimens, in double-label experiments, with internal controls consisting of 14C-labeled authentic human DNA. Attempts to drive the reaction to completion with human DNA led to a similar conclusion. The relative nonrenaturability of this fraction of plasma DNA did not appear to be attributable to extensive chain breakage, although adequate analysis of this DNA subfraction was limited by reagent availability. It was therefore concluded that, in this group of SLE patients, persistently circulating DNA consisted largely of base sequences also found in human genomic DNA. The additional presence in plasma of a DNA subfraction that differed in its renaturation behavior from human genomic DNA was recognized, although its significance could not be established with certainty.

Steinman, C R

1984-01-01

343

The chemical stability of abasic RNA compared to abasic DNA  

Microsoft Academic Search

We describe the synthesis of an abasic RNA phos- phoramidite carrying a photocleavable 1-(2-nitrophe- nyl)ethyl (NPE) group at the anomeric center and a triisopropylsilyloxymethyl (TOM) group as 20-O- protecting group together with the analogous DNA and the 20-OMe RNA abasic building blocks. These units were incorporated into RNA-, 20-OMe-RNA- and DNA for the purpose of studying their chemical stabilities towards

Pascal A. Kupfer; Christian J. Leumann

2006-01-01

344

Oxidation of DNA: damage to nucleobases.  

PubMed

All organisms store the information necessary to maintain life in their DNA. Any process that damages DNA, causing a loss or corruption of that information, jeopardizes the viability of the organism. One-electron oxidation is such a process. In this Account, we address three of the central features of one-electron oxidation of DNA: (i) the migration of the radical cation away from the site of its formation; (ii) the electronic and structural factors that determine the nucleobases at which irreversible reactions most readily occur; (iii) the mechanism of reaction for nucleobase radical cations. The loss of an electron (ionization) from DNA generates an electron "hole" (a radical cation), located most often on its nucleobases, that migrates reversibly through duplex DNA by hopping until it is trapped in an irreversible chemical reaction. The particular sequence of nucleobases in a DNA oligomer determines both the efficiency of hopping and the specific location and nature of the damaging chemical reaction. In aqueous solution, DNA is a polyanion because of the negative charge carried by its phosphate groups. Counterions to the phosphate groups (typically Na(+)) play an important role in facilitating both hopping and the eventual reaction of the radical cation with H(2)O. Irreversible reaction of a radical cation with H(2)O in duplex DNA occurs preferentially at the most reactive site. In normal DNA, comprising the four common DNA nucleobases G, C, A, and T, reaction occurs most commonly at a guanine, resulting in its conversion primarily to 8-oxo-7,8-dihydroguanine (8-OxoG). Both electronic and steric effects control the outcome of this process. If the DNA oligomer does not contain a suitable guanine, then reaction of the radical cation occurs at the thymine of a TT step, primarily by a tandem process. The oxidative damage of DNA is a complex process, influenced by charge transport and reactions that are controlled by a combination of enthalpic, entropic, steric, and compositional factors. These processes occur over a broad distribution of energies, times, and spatial scales. The emergence of a complete picture of DNA oxidation will require additional exploration of the structural, kinetic, and dynamic properties of DNA, but this Account offers insight into key elements of this challenge. PMID:19938827

Kanvah, Sriram; Joseph, Joshy; Schuster, Gary B; Barnett, Robert N; Cleveland, Charles L; Landman, Uzi

2010-02-16

345

Protection of DNA against Direct Radiation Damage by Complex Formation with Positively Charged Polypeptides  

PubMed Central

Radioprotection of DNA from direct-type radiation damage by histones has been studied in model systems using complexes of positively charged polypeptides (PCPs) with DNA. PCPs bind to DNA via ionic interactions mimicking the mode of DNA-histone binding. Direct radiation damage to DNA in films of DNA-PCP complexes was quantified as unaltered base release, which correlates closely with DNA strand breaks. All types of PCPs tested protected DNA from radiation, with the maximum radioprotection being approximately 2.5-fold compared with non-complexed DNA. Conformational changes of the DNA induced by PCPs or repair of free radical damage on the DNA sugar moiety by PCPs are considered the most feasible mechanisms of radioprotection of DNA. The degree of radioprotection of DNA by polylysine (PL) increased dramatically on going from pure DNA to a molar ratio of PL monomer:DNA nucleotide ~1:2, while a further increase in the PL:DNA ratio did not offer more radioprotection. This concentration dependence is in agreement with the model of PCP binding to DNA that assumes preferential binding of positively charged side groups to DNA phosphates in the minor groove, so that the maximum occupancy of all minor-groove PCP binding sites is at a molar ratio of PCP:DNA = 1:2.

Roginskaya, Marina; Bernhard, William A.; Razskazovskiy, Yuriy

2007-01-01

346

Plasmid DNA hydrogels for biomedical applications.  

PubMed

In the last few years, our research group has focused on the design and development of plasmid DNA (pDNA) based systems as devices to be used therapeutically in the biomedical field. Biocompatible macro and micro plasmid DNA gels were prepared by a cross-linking reaction. For the first time, the pDNA gels have been investigated with respect to their swelling in aqueous solution containing different additives. Furthermore, we clarified the fundamental and basic aspects of the solute release mechanism from pDNA hydrogels and the significance of this information is enormous as a basic tool for the formulation of pDNA carriers for drug/gene delivery applications. The co-delivery of a specific gene and anticancer drugs, combining chemical and gene therapies in the treatment of cancer was the main challenge of our research. Significant progresses have been made with a new p53 encoding pDNA microgel that is suitable for the loading and release of pDNA and doxorubicin. This represents a strong valuable finding in the strategic development of systems to improve cancer cure through the synergetic effect of chemical and gene therapy. PMID:24011472

Costa, Diana; Valente, Artur J M; Miguel, M Graça; Queiroz, João

2014-03-01

347

Molecular Dynamics Simulations of DNA-Polycation Complex Formation  

PubMed Central

Abstract Complexes formed from DNA and polycations are of interest because of their potential use in gene therapy; however, there remains a lack of understanding of the structure and formation of DNA-polycation complexes at atomic scale. In this work, molecular dynamics simulations of the DNA duplex d(CGCGAATTCGCG) in the presence of polycation chains are carried out to shed light on the specific atomic interaction that result in complex formation. The structures of complexes formed from DNA with polyethylenimine, which is considered one of the most promising DNA vector candidates, and a second polycation, poly-L-lysine, are compared. After an initial separation of ?50 Å, the DNA and polycation come together and form a stable complex within 10 ns. The DNA does not undergo any major structural changes on complexation and remains in the B-form. In the formed complex, the charged amine groups of the polycation mainly interact with DNA phosphate groups, with polycation intrusion into the major and minor grooves dependent on the identity and charge state of the polycation. The ability of the polycation to effectively neutralize the charge of the DNA phosphate groups and the resulting influence on the DNA helix interaction are discussed.

Ziebarth, Jesse; Wang, Yongmei

2009-01-01

348

Mitochondrial DNA inherited variants are associated with successful aging and longevity in humans  

Microsoft Academic Search

Mitochondrial DNA (mtDNA) is char- acterized by high variability, maternal inheritance, and absence of recombination. Studies of human populations have revealed ancestral associated poly- morphisms whose combination defines groups of mtDNA types (haplogroups) that are currently used to reconstruct human evolution lineages. We used such inherited mtDNA markers to compare mtDNA population pools between a sample of individuals selected for

G. DE BENEDICTIS; G. ROSE; G. CARRIERI; M. DE LUCA; E. FALCONE; G. PASSARINO; M. BONAFE; D. MONTI; G. BAGGIO; S. BERTOLINI; D. MARI; R. MATTACE; C. FRANCESCHI

349

Ex vivo DNA Assembly  

PubMed Central

Even with decreasing DNA synthesis costs there remains a need for inexpensive, rapid, and reliable methods for assembling synthetic DNA into larger constructs or combinatorial libraries. Advances in cloning techniques have resulted in powerful in vitro and in vivo assembly of DNA. However, monetary and time costs have limited these approaches. Here, we report an ex vivo DNA assembly method that uses cellular lysates derived from a commonly used laboratory strain of Escherichia coli for joining double-stranded DNA with short end homologies embedded within inexpensive primers. This method concurrently shortens the time and decreases costs associated with current DNA assembly methods.

Fisher, Adam B.; Canfield, Zachary B.; Hayward, Laura C.; Fong, Stephen S.; McArthur, George H.

2013-01-01

350

Group Composition, Group Interaction, and Achievement in Cooperative Small Groups.  

ERIC Educational Resources Information Center

The relationship between interaction and achievement in cooperative small groups was studied in four junior high school mathematics classrooms. The interaction variable that related most strongly to achievement was asking a question and receiving no response; this type of interaction was negatively related to achievement. (Author/BW)

Webb, Noreen M.

1982-01-01

351

Extended Affine Weyl Groups  

Microsoft Academic Search

In this paper we study the Weyl groups of reduced extended affine root systems, the root systems of extended affine Lie algebras. We start by describing the extended affine Weyl group as a semidirect product of a finite Weyl group and a Heisenberg-like normal subgroup. This provides a unique expression for the Weyl group elements (in terms of some naturally

Saeid Azam

1999-01-01

352

Nearby Groups of Galaxies  

NASA Astrophysics Data System (ADS)

Groups of galaxies are gravitationally bound aggregates of tens of galaxies, like the LOCAL GROUP (LG), the home of our MILKY WAY GALAXY. What we call a `nearby' group has to be sufficiently close such that the group can be studied, in terms of structure and contents, with similar (but of course always inferior) detail as the LG. This is roughly met by groups lying in the Local Supercluster—a fla...

Binggeli, B.; Murdin, P.

2000-11-01

353

Photoelectrochemical synthesis of DNA microarrays.  

PubMed

Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

Chow, Brian Y; Emig, Christopher J; Jacobson, Joseph M

2009-09-01

354

Photoelectrochemical synthesis of DNA microarrays  

PubMed Central

Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis.

Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

2009-01-01

355

DNA Repair, DNA Replication, and UV Mutagenesis  

Microsoft Academic Search

Cells that have been irradiated with ultraviolet light (UV) suffer damage to their DNA, primarily in the form of covalent linkage between adjacent pyrimidines. Such photoproducts represent blocks to RNA and DNA polymerases and are potentially mutagenic. Blockage of RNA polymerase II by a photoproduct in the transcribed strand of an active gene leads to induction of the p53 protein,

W Glenn McGregor

1999-01-01

356

Molecular Cloning and Protein Structure of a Human Blood Group Rh Polypeptide  

Microsoft Academic Search

cDNA clones encoding a human blood group Rh polypeptide were isolated from a human bone marrow cDNA library by using a polymerase chain reaction-amplified DNA fragment encoding the known common N-terminal region of the Rh proteins. The entire primary structure of the Rh polypeptide has been deduced from the nucleotide sequence of a 1384-base-pair-long cDNA clone. Translation of the open

Baya Cherif-Zahar; Christian Bloy; Caroline Le van Kim; Dominique Blanchard; Pascal Bailly; Patricia Hermand; Charles Salmon; Jean-Pierre Cartron; Yves Colin

1990-01-01

357

Make a DNA Model  

NSDL National Science Digital Library

In this activity, learners make a 3-D model of DNA using paper and toothpicks. While constructing this model, learners will explore the composition and structure of DNA. The activity also gives suggestions for alternate materials and challenges to explore.

History, American M.

2012-06-26

358

Structural Organization of DNA.  

ERIC Educational Resources Information Center

Explains the structural organization of DNA by providing information on the primary, secondary, tertiary, and higher organization levels of the molecule. Also includes illustrations and descriptions of sign-inversion and rotating models for supercoiling of DNA. (ML)

Banfalvi, Gaspar

1986-01-01

359

Surreptitious DNA Testing  

MedlinePLUS

Most states do not have laws restricting surreptitious DNA testing. Those that do generally place restrictions only ... of states have laws that broadly restrict surreptitious DNA testing for both health and non-health-related ...

360

DNA Replication Animation  

NSDL National Science Digital Library

This resource is an animation to explain DNA replication. It is an interactive simulation activity for students. See also "Transcription and Translation Animation" to get all of the steps from DNA to protein.

Littell, Mcdougal

2012-07-19

361

The Structure of DNA  

NSDL National Science Digital Library

This animation adapted from Garland Science Publishing takes a close look at the DNA double helix and its individual components, describing their chemical structures and how they function together to make the DNA molecule unique.

Foundation, Wgbh E.

2011-12-30

362

Issues in DNA Fingerprinting.  

National Technical Information Service (NTIS)

The use, in court, of DNA Profiling, popularly referred to as DNA Fingerprinting, for forensic identification purposes has been questioned. A report of the National Research Council was solicited to clarify the issues and propose procedures of how and whe...

H. Chernoff

1994-01-01

363

Group II Intron-Based Gene Targeting Reactions in Eukaryotes  

PubMed Central

Background Mobile group II introns insert site-specifically into DNA target sites by a mechanism termed retrohoming in which the excised intron RNA reverse splices into a DNA strand and is reverse transcribed by the intron-encoded protein. Retrohoming is mediated by a ribonucleoprotein particle that contains the intron-encoded protein and excised intron RNA, with target specificity determined largely by base pairing of the intron RNA to the DNA target sequence. This feature enabled the development of mobile group II introns into bacterial gene targeting vectors (“targetrons”) with programmable target specificity. Thus far, however, efficient group II intron-based gene targeting reactions have not been demonstrated in eukaryotes. Methodology/Principal Findings By using a plasmid-based Xenopus laevis oocyte microinjection assay, we show that group II intron RNPs can integrate efficiently into target DNAs in a eukaryotic nucleus, but the reaction is limited by low Mg2+ concentrations. By supplying additional Mg2+, site-specific integration occurs in up to 38% of plasmid target sites. The integration products isolated from X. laevis nuclei are sensitive to restriction enzymes specific for double-stranded DNA, indicating second-strand synthesis via host enzymes. We also show that group II intron RNPs containing either lariat or linear intron RNA can introduce a double-strand break into a plasmid target site, thereby stimulating homologous recombination with a co-transformed DNA fragment at frequencies up to 4.8% of target sites. Chromatinization of the target DNA inhibits both types of targeting reactions, presumably by impeding RNP access. However, by using similar RNP microinjection methods, we show efficient Mg2+-dependent group II intron integration into plasmid target sites in zebrafish (Danio rerio) embryos and into plasmid and chromosomal target sites in Drosophila melanogster embryos, indicating that DNA replication can mitigate effects of chromatinization. Conclusions/Significance Our results provide an experimental foundation for the development of group II intron-based gene targeting methods for higher organisms.

White, Travis B.; Zhuang, Fanglei; Vernon, Jamie; Matsuura, Manabu; Wallingford, John; Lambowitz, Alan M.

2008-01-01

364

[DNA-cytometry in dysplasias of the uterine cervix].  

PubMed

The diagnostic group of dysplasias has been described as "a group of diagnostic impotence". DNA-aneuploidy detected by image cytometry of Feulgen stained pap smears indicates a potentially progressive lesion, representing a high-grade lesion. DNA-cytometry can identify cases of dysplasias which are likely to progress: DNA-aneuploid dysplasias are HSIL. DNA-aneuploidy is the expression of an integral HPV infection. CIN-lesions with episomal HPV infections are DNA-diploid. With the newly developed laserscanning cytometer (LSC) of ThinPrep-Preparation an automatisation of ploidy measurement is possible in combination with HPV-PCR. We recommend DNA-Image-cytometry as a routine method for classification of uterine cervical borderline lesion into regressive and progressive. PMID:11370528

Bollmann, R

2001-04-01

365

Oswald Avery (c.1930), still imageSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

Oswald Avery, circa 1930. In a very simple experiment, Oswald Avery's group showed that DNA was the "transforming principle." When isolated from one strain of bacteria, DNA was able to transform another strain and confer characteristics onto that second strain. DNA was carrying hereditary information. With DNA as the hereditary molecule, the stage was set for one of the most exciting periods in DNA science: understanding DNA structure and function. Now use the buttons along the top to explore some of the other sections in this module. Solve the structure of DNA!

2008-10-06

366

DNA based gold nanoparticles colorimetric sensors for sensitive and selective detection of Ag(I) ions  

Microsoft Academic Search

In this work, we reported both unlabeled and labeled sensing strategies for Ag(I) ions detection by using the DNA based gold nanoparticles (AuNPs) colorimetric method. In the unlabeled strategy, C-base riched single strand DNA (C-ssDNA) enwinded onto AuNPs to form AuNPs\\/C-ssDNA complex. In the labeled method, sulfhydryl group modified C-ssDNA (HS-C-ssDNA) was covalently labeled on AuNPs to produce AuNPs-S-C-ssDNA complex.

Bingling Li; Yan Du; Shaojun Dong

2009-01-01

367

DNA polymerases and cancer  

Microsoft Academic Search

There are 15 different DNA polymerases encoded in mammalian genomes, which are specialized for replication, repair or the tolerance of DNA damage. New evidence is emerging for lesion-specific and tissue-specific functions of DNA polymerases. Many point mutations that occur in cancer cells arise from the error-generating activities of DNA polymerases. However, the ability of some of these enzymes to bypass

Sabine S. Lange; Kei-ichi Takata; Richard D. Wood

2011-01-01

368

Microparticles and DNA Vaccines  

Microsoft Academic Search

Developing deoxyribonucleic acid (DNA) vaccines potent enough to be clinically useful will likely require an understanding\\u000a of the mechanism of action both of naked DNA vaccines themselves, and of adjuvant formulations that may be combined with DNA.\\u000a Mechanisms of action attributed to naked DNA vaccines described thus far include transfection of keratinocytes (1), muscle cells (2), and dendritic cells (DCs)

Kimberly Denis-Mize; Manmohan Singh; Derek T. O’Hagan; Jeffrey B. Ulmer; John J. Donnelly

369

DNA Polymerases that Propagate the Eukaryotic DNA Replication Fork  

Microsoft Academic Search

Three DNA polymerases are thought to function at the eukaryotic DNA replication fork. Currently, a coherent model has been derived for the composition and activities of the lagging strand machinery. RNA-DNA primers are initiated by DNA polymerase ?-primase. Loading of the proliferating cell nuclear antigen, PCNA, dissociates DNA polymerase ? and recruits DNA poly- merase ? and the flap endonuclease

Parie Garg; Peter M. J. Burgers

2005-01-01

370

Interactive DNA sequence and structure design for DNA nanoapplications  

Microsoft Academic Search

DNA sequence and structure design is very important for DNA nanoapplications. A computer-aided design tool is needed for exploring DNA sequence and structure of interests before experimental synthesis, which is a time- and labor-consuming process. In this paper, an interactive DNA sequence and structure design software tool called DNA shop is proposed and implemented. The visualization tool can generate DNA

Mingjun Zhang; Chaman L. Sabharwal; Weimin Tao; Tzyh-Jong Tarn; Ning Xi; Guangyong Li

2004-01-01

371

Development of salmon milt DNA/salmon collagen composite for wound dressing.  

PubMed

This study aims to develop a novel wound dressing comprising salmon milt DNA (sDNA) and salmon collagen (SC). The sDNA/SC composites were prepared by incubating a mixture of an acidic SC solution, an sDNA solution, and a collagen fibrillogenesis inducing buffer (pH 6.8) containing a crosslinking agent (water-soluble carbodiimide) for gelation, and a subsequent ventilation-drying process to give sDNA/SC films. The conjugation between sDNA and SC were confirmed by sDNA-elution assay and fluorescence microscopy. The sDNA/SC films with various doses of sDNA (sDNA/SC weight ratios of 1:5, 1:10, and 1:20) were used for in vitro cell cultures to evaluate their growth potentials of normal human dermal fibroblasts (NHDF) and normal human epidermal keratinocytes (NHEK). It was found that NHDF proliferation was increased by sDNA conjugation, whereas NHEK proliferation was dose-dependently inhibited. In light of the in vitro results, the appropriate dose of sDNA for in vivo study was determined to be the ratio of 1:10. For the implantation in full-thickness skin defects in rat dorsal region, the sDNA/SC films were reinforced by incorporating them on a porous SC sponge, because the sDNA/SC films exhibited early contraction and inadequate morphologic stability when implanted in vivo. The regenerated tissue in the sDNA/SC sponge group showed similar morphology to native dermis, while the SC sponge group without sDNA showed epithelial overgrowth, indicating that additional sDNA could reduce epidermal overgrowth. Furthermore, blood capillary formation was significantly enhanced in the sDNA/SC sponge group when compared to the SC sponge group. In conclusion, the results suggest that the sDNA/SC composite could be a potential wound dressing for clinical applications. PMID:18592347

Shen, XuanRi; Nagai, Nobuhiro; Murata, Masaru; Nishimura, Daisuke; Sugi, Masahito; Munekata, Masanobu

2008-12-01

372

Trends in DNA biosensors  

Microsoft Academic Search

Biosensors have witnessed an escalating interest nowadays, both in the research and commercial fields. Deoxyribonucleic acid (DNA) biosensors (genosensors) have been exploited for their inherent physico-chemical stability and suitability to discriminate different organism strains. The main principle of detection among genosensors relies on specific DNA hybridization, directly on the surface of a physical transducer. This review covers the main DNA

F. R. R. Teles; L. P. Fonseca

2008-01-01

373

Multiplex DNA Sequencing  

Microsoft Academic Search

The increasing demand for DNA sequences can be met by replacement of each DNA sample in a device with a mixture of N samples so that the normal throughput is increased by a factor of N. Such a method is described. In order to separate the sequence information at the end of the processing, the DNA molecules of interest are

George M. Church; Stephen Kieffer-Higgins

1988-01-01

374

Method of Targeting DNA.  

National Technical Information Service (NTIS)

The invention relates to a method of forming a three-stranded DNA molecule wherein each strand of the three-stranded DNA molecule is hybridized (that is, non-covalently bound) to at least one other strand of the three-stranded DNA molecule. The method com...

R. D. Camerini-Otero M. McIntosh C. S. Camerini-Otero L. J. Ferrin

1991-01-01

375

DNA-based Cryptography  

Microsoft Academic Search

Abstract Recent research has considered DNA as a medium for ultra - scale computation and for ultra - compact information storage One potential key application is DNA - based, molecular cryptogra - phy systems We present some procedures for DNA - based cryptography based on one - time - pads that are in principle unbreakable Practical applications of cryptographic systems

Ashish Gehani; Thomas H. Labean; John H. Reif

2004-01-01

376

Replicating animal mitochondrial DNA  

PubMed Central

The field of mitochondrial DNA (mtDNA) replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s) used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark) has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading- and lagging-strand synthesis (resembling bacterial genome replication) and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS). The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase ?, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase). Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

McKinney, Emily A.; Oliveira, Marcos T.

2013-01-01

377

Onion DNA Extraction  

NSDL National Science Digital Library

This laboratory exercise is designed to show learners how DNA can easily be extracted from onion cells using simple materials. Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Hays, Lana

2009-01-01

378

Structure-specific DNA cleavage by 5' nucleases.  

PubMed

Many processes, such as DNA replication, recombination and repair, produce branched DNA structures. These bifurcated molecules are trimmed by a group of homologous 5'-3' exonucleases (also known as 5' nucleases) in structure-specific cleavage reactions. X-ray crystallographical and biochemical studies suggest that ssDNA substrates become threaded through the 5'-3' exonucleases, where hydrolysis is effected with the aid of divalent metal cations. PMID:9787638

Ceska, T A; Sayers, J R

1998-09-01

379

Structure-specific DNA cleavage by 5? nucleases  

Microsoft Academic Search

Many processes, such as DNA replication, recombination and repair, produce branched DNA structures. These bifurcated molecules are trimmed by a group of homologous 5?–3? exonucleases (also known as 5? nucleases) in structure-specific cleavage reactions. X-ray crystallographical and biochemical studies suggest that ssDNA substrates become threaded through the 5?–3? exonucleases, where hydrolysis is effected with the aid of divalent metal cations.

Thomas A Ceska; Jon R Sayers

1998-01-01

380

Evaluation of DNAstable for DNA storage at ambient temperature.  

PubMed

Preserving DNA is important for validation of prospective and retrospective analyses, requiring many expensive types of equipment (e.g., freezers and back-up generators) and energy. While freezing is the most common method for storing extracted DNA evidence or well-characterized DNA samples for validation studies, DNAstable (Biomatrica), a commercially available medium for room temperature storage of DNA extracts was evaluated in this study. Two groups of samples consisting of different DNA quantities were investigated, one ranging from 20 to 400 ng (group 1) and the other one ranging from 1.4 to 20 ng (group 2). The DNA samples with and without DNAstable were stored at four different temperatures [?25 °C (room temperature), -20 °C, 37 °C or 50 °C]. DNA degradation over several months was monitored by SYBR Green-based qPCR assays and by PCR amplification of the core CODIS STR markers for group 1 and 2 DNA samples, respectively. For the time points tested in this study (up to 365 days), the findings indicate that the -20 °C controls and the DNAstable protected samples at room temperature provided similar DNA recoveries that were higher compared to the unprotected controls kept at RT, 37 °C or 50 °C. These results suggest that DNAstable can protect DNA samples with effectiveness similar to that of the traditional -20 °C freezing method. In addition, extrapolations from accelerated aging experiments conducted at high temperatures support that DNAstable is an effective technology for preserving purified DNA at room temperature with a larger protective impact on DNA samples of low quantity (<20 ng). PMID:24315605

Howlett, Susanne E; Castillo, Hilda S; Gioeni, Lora J; Robertson, James M; Donfack, Joseph

2014-01-01

381

Sequence specificity of DNA cleavage by Micrococcus luteus. gamma. endonuclease  

SciTech Connect

DNA fragments of defined sequence have been used to determine the sites of cleavage by ..gamma..-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus ..gamma.. endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to ..gamma.. radiation.

Hentosh, P.; Henner, W.D.; Reynolds, R.J.

1985-04-01

382

Syndromes associated with mitochondrial DNA depletion  

PubMed Central

Mitochondrial dysfunction accounts for a large group of inherited metabolic disorders most of which are due to a dysfunctional mitochondrial respiratory chain (MRC) and, consequently, deficient energy production. MRC function depends on the coordinated expression of both nuclear (nDNA) and mitochondrial (mtDNA) genomes. Thus, mitochondrial diseases can be caused by genetic defects in either the mitochondrial or the nuclear genome, or in the cross-talk between the two. This impaired cross-talk gives rise to so-called nuclear-mitochondrial intergenomic communication disorders, which result in loss or instability of the mitochondrial genome and, in turn, impaired maintenance of qualitative and quantitative mtDNA integrity. In children, most MRC disorders are associated with nuclear gene defects rather than alterations in the mtDNA itself. The mitochondrial DNA depletion syndromes (MDSs) are a clinically heterogeneous group of disorders with an autosomal recessive pattern of transmission that have onset in infancy or early childhood and are characterized by a reduced number of copies of mtDNA in affected tissues and organs. The MDSs can be divided into least four clinical presentations: hepatocerebral, myopathic, encephalomyopathic and neurogastrointestinal. The focus of this review is to offer an overview of these syndromes, listing the clinical phenotypes, together with their relative frequency, mutational spectrum, and possible insights for improving diagnostic strategies.

2014-01-01

383

Adsorption of DNA onto anionic lipid surfaces.  

PubMed

Currently self-assembled DNA delivery systems composed of DNA multivalent cations and anionic lipids are considered to be promising tools for gene therapy. These systems become an alternative to traditional cationic lipid-DNA complexes because of their low cytotoxicity lipids. However, currently these nonviral gene delivery methods exhibit low transfection efficiencies. This feature is in large part due to the poorly understood DNA complexation mechanisms at the molecular level. It is well-known that the adsorption of DNA onto like charged lipid surfaces requires the presence of multivalent cations that act as bridges between DNA and anionic lipids. Unfortunately, the molecular mechanisms behind such adsorption phenomenon still remain unclear. Accordingly a historical background of experimental evidence related to adsorption and complexation of DNA onto anionic lipid surfaces mediated by different multivalent cations is firstly reviewed. Next, recent experiments aimed to characterise the interfacial adsorption of DNA onto a model anionic phospholipid monolayer mediated by Ca(2+) (including AFM images) are discussed. Afterwards, modelling studies of DNA adsorption onto charged surfaces are summarised before presenting preliminary results obtained from both CG and all-atomic MD computer simulations. Our results allow us to establish the optimal conditions for cation-mediated adsorption of DNA onto negatively charged surfaces. Moreover, atomistic simulations provide an excellent framework to understand the interaction between DNA and anionic lipids in the presence of divalent cations. Accordingly,our simulation results in conjunction go beyond the macroscopic picture in which DNA is stuck to anionic membranes by using multivalent cations that form glue layers between them. Structural aspects of the DNA adsorption and molecular binding between the different charged groups from DNA and lipids in the presence of divalent cations are reported in the last part of the study. Although this research work is far from biomedical applications, we truly believe that scientific advances in this line will assist, at least in part, in the rational design and development of optimal carrier systems for genes and applicable to other drugs. PMID:24359695

Martín-Molina, Alberto; Luque-Caballero, Germán; Faraudo, Jordi; Quesada-Pérez, Manuel; Maldonado-Valderrama, Julia

2014-04-01

384

Working with Groups.  

ERIC Educational Resources Information Center

Describes nine Canadian programs for counseling groups of students. Topics include introducing computer-assisted guidance, future challenges for counselors, sociometry, sexuality, parent counseling, reluctant students, shyness, peer groups, education for living, and guidance advisory committees. (JAC)

Morris, Joan, Ed.

1984-01-01

385

Gluten Intolerance Group  

MedlinePLUS

... help make our programs possible. Chef to Plate Restaurant Awareness Program The Gluten Intolerance Group’s annual gluten-free awareness campaign for restaurants will take place in May, National Celiac Awareness ...

386

Control of bioelectrocatalytic transformations on DNA scaffolds.  

PubMed

The spatial organization of biomolecules on a DNA scaffold linked to an electrode leads to programmed biocatalytic transformations. This is exemplified by the electrical contacting of glucose oxidase (GOx) linked to the DNA scaffold with the electrode. A nucleic acid functionalized with a ferrocene relay unit was hybridized with the DNA scaffold at a position adjacent to the electrode, and GOx functionalized with nucleic acid units complementary to the specific domain of the DNA template was hybridized with the DNA scaffold in a position remote from the electrode. Under these conditions, ferrocene-mediated oxidation of the redox center of GOx occurred, and the effective bioelectrocatalytic oxidation of glucose was activated. Exchange of the position of GOx and the electron-mediator groups prohibited the bioelectrocatalytic oxidation of glucose. In another system, a nucleic acid-functionalized microperoxidase-11 (MP-11) and the nucleic acid-modified GOx were hybridized with the adjacent and remote sites, respectively, on the DNA scaffold associated with the electrode. In this configuration, effective MP-11-catalyzed reduction of H(2)O(2) generated by the GOx-catalyzed oxidation of glucose occurred, and the resulting bioelectrocatalytic cathodic currents were controlled by the concentration of glucose. Exchanging the positions of MP-11 and GOx on the DNA scaffold eliminated the MP-11-electrocatalyzed reduction of H(2)O(2). PMID:19505077

Piperberg, Gilad; Wilner, Ofer I; Yehezkeli, Omer; Tel-Vered, Ran; Willner, Itamar

2009-07-01

387

The GROOP Effect: Groups Mimic Group Actions  

ERIC Educational Resources Information Center

Research on perception-action links has focused on an interpersonal level, demonstrating effects of observing individual actions on performance. The present study investigated perception-action matching at an inter-group level. Pairs of participants responded to hand movements that were performed by two individuals who used one hand each or they…

Tsai, Jessica Chia-Chin; Sebanz, Natalie; Knoblich, Gunther

2011-01-01

388

Group Time: Calming Children at Group Time  

ERIC Educational Resources Information Center

The shift at the beginning of the year from the summer at home to the fall at school can be both an exciting and an anxious time for young children. Often, there is a fine line between the two emotions, with one considered positive and other negative. Awareness of how to manage these feelings in a teacher's group is essential to creating the right…

Church, Ellen Booth

2004-01-01

389

DNA Sequencing apparatus  

DOEpatents

An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

1992-01-01

390

Thermal degradation of DNA.  

PubMed

In this article, we investigate the thermal degradation of deoxyribonucleic acid (DNA). We find that under dry conditions, complete DNA degradation occurs at above 190°C. In addition, as the boiling temperature of water is pressure dependent, we have investigated the thermal degradation of the DNA in water for different applied partial pressures. This information is important for fundamental understanding of DNA structure and energetics, and can be useful for biomedical applications such as thermal targeting of DNA in cancer cells, as well as for basic research. PMID:23621849

Karni, Moshe; Zidon, Dolev; Polak, Pazit; Zalevsky, Zeev; Shefi, Orit

2013-06-01

391

DNA-Mediated Electrochemistry  

PubMed Central

The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry.

Gorodetsky, Alon A.; Buzzeo, Marisa C.

2009-01-01

392

Group Presentation Rubric  

NSDL National Science Digital Library

This document provides a grading rubric for group presentations. Groups will be evaluated in the areas of time limit, cooperation, organization, content, sources and documentation, visuals, formatting and mechanics and subject knowledge. This rubric would be useful for grading groups at most educational levels. This document may be downloaded in PDF file format.

2012-01-10

393

Working Group 7 Summary  

SciTech Connect

The primary subject of working group 7 at the 2012 Advanced Accelerator Concepts Workshop was muon accelerators for a muon collider or neutrino factory. Additionally, this working group included topics that did not fit well into other working groups. Two subjects were discussed by more than one speaker: lattices to create a perfectly integrable nonlinear lattice, and a Penning trap to create antihydrogen.

Nagaitsev S.; Berg J.

2012-06-10

394

A Group Counseling Contract.  

ERIC Educational Resources Information Center

A group counseling contract was developed following American Psychological Association ethical guidelines. The contract was effective in enabling participants to quickly become involved in group process. The contract could be modified for use by group facilitators in a variety of settings. (Author)

Johnson, Norbert; Johnson, Sarah Campbell

1980-01-01

395

Infant Group Care Risks.  

ERIC Educational Resources Information Center

Children under 3 years of age who are in group care face special health risks. The U.S. Centers for Disease Control indicate the existence of a causal relationship between infant group day care and certain diseases that are spread through contact at day care centers. Children in group care who are still in diapers are especially vulnerable to…

Kendall, Earline D.

396

Peer group image enhancement  

Microsoft Academic Search

Peer group image processing identifies a "peer group" foreach pixel and then replaces the pixel intensity with the average over thepeer group. Two parameters provide direct control over which image featuresare selectively enhanced: area (number of pixels in the feature) andwindow diameter (window size needed to enclose the feature). A discussionis given of how these parameters determine which features in

Charles S. Kenney; Yining Deng; B. S. Manjunath; Gary A. Hewer

2001-01-01

397

The Wisdom of Groups  

ERIC Educational Resources Information Center

What is it about small groups that make them so powerful? The answer is straightforward: Groups tend to solve problems better than even the brightest individuals because "many hands make light work," and "two heads are better than one." This is especially true when the groups are diverse and individuals act somewhat independently. In this month's…

Herreid, Clyde Freeman

2009-01-01

398

Customizing Group Therapy.  

ERIC Educational Resources Information Center

The group therapy context provides unparalleled opportunities for cost effective learning. However, within group meetings, therapists must strive to tailor psychological services to address the particular needs of individual patients. Creative means of customizing patients experiences within group are needed in order to address consumer needs…

Chambliss, Catherine; Oxman, Elaine

399

Engineering Clostridium Strain to Accept Unmethylated DNA  

PubMed Central

It is difficult to genetically manipulate the medically and biotechnologically important genus Clostridium due to the existence of the restriction and modification (RM) systems. We identified and engineered the RM system of a model clostridial species, C. acetobutylicum, with the aim to allow the host to accept the unmethylated DNA efficiently. A gene CAC1502 putatively encoding the type II restriction endonuclease Cac824I was identified from the genome of C. acetobutylicum DSM1731, and disrupted using the ClosTron system based on group II intron insertion. The resulting strain SMB009 lost the type II restriction endonuclease activity, and can be transformed with unmethylated DNA as efficiently as with methylated DNA. The strategy reported here makes it easy to genetically modify the clostridial species using unmethylated DNA, which will help to advance the understanding of the clostridial physiology from the molecular level.

Dong, Hongjun; Zhang, Yanping; Dai, Zongjie; Li, Yin

2010-01-01

400

Mitochondrial DNA abnormalities in ophthalmological disease.  

PubMed

Mitochondrial disorders are a group of clinically heterogeneous diseases, commonly defined by lack of cellular energy due to genetic defects of oxidative phosphorylation (OXPHOS). Ocular involvement is a prominent clinical feature of mitochondrial disease. This can manifest as optic nerve dysfunction specifically involving retinal ganglion cells as typified by Leber hereditary optic neuropathy (LHON), or progressive external ophthalmoplegia (PEO) and ptosis involving the extraocular muscles which is commonly associated with either primary mitochondrial DNA (mtDNA) mutations or acquired mtDNA defects secondary to a nuclear genetic disorder of mtDNA maintenance. In this short review, we will outline the unique characteristics of mitochondrial genetic disease and its investigation with reference to the clinical features and molecular genetic abnormalities underlying mitochondrial ophthalmological disease. PMID:23960954

Gorman, Grainne S; Taylor, Robert W

2011-10-01

401

First Nuclear DNA C-values for 25 Angiosperm Families  

Microsoft Academic Search

DNA amount is a widely used biodiversity character. As known DNA C-values represent the global angiosperm flora poorly, better coverage of taxonomic groups is needed, including at the familial level. A workshop, sponsored byAnnals of Botany , was held at the Royal Botanic Gardens, Kew in 1997. Its key aim was to identify major gaps in our knowledge of plant

Lynda Hanson; Kathryn A. McMahon; Margaret A. T. Johnson; Michael D. Bennett

2001-01-01

402

Electronic Transport in DNA  

PubMed Central

We study the electronic properties of DNA by way of a tight-binding model applied to four particular DNA sequences. The charge transfer properties are presented in terms of localization lengths (crudely speaking, the length over which electrons travel). Various types of disorder, including random potentials, are employed to account for different real environments. We have performed calculations on poly(dG)-poly(dC), telomeric-DNA, random-ATGC DNA, and ?-DNA. We find that random and ?-DNA have localization lengths allowing for electron motion among a few dozen basepairs only. A novel enhancement of localization lengths is observed at particular energies for an increasing binary backbone disorder. We comment on the possible biological relevance of sequence-dependent charge transfer in DNA.

Klotsa, Daphne; Romer, Rudolf A.; Turner, Matthew S.

2005-01-01

403

`DNA snapback' peptides  

PubMed Central

Thermal denaturation studies show that 10-15% of the calf thymus DNA in the heat denatured (Tyr-Gly-Tyr-Gly-Tyr)-DNA complex renatures spontaneously after colling. The double-strandness of this DNA was verified by its resistance to single-strand Neurospora endonuclease and by its elution profile on hydroxypatite columns. The renatured DNA isolated by the latter technique was found to contain 56% GC compared to the 41% GC content of the whole thymus DNA. Alternating tryptophanyl-glycyl and histidyl-glycyl peptides also catalyze the same renaturation. A linear correlation was found between the thermal stabilization afforded to the DNA by the various peptides and their ability to “catalyze” DNA strand renaturation.

Novak, Robert L.; Dohnal, James

1974-01-01

404

[Mitochondrial DNA variation in Asian guardian dogs].  

PubMed

The hypervariable site of the mitochondrial DNA (mtDNA) control region has been studied in several sheepdog breeds. The genetic diversity is high in the Central Asian guardian dog and the Northern Caucasian wolf dog (an aboriginal group of breeds) and low in the Caucasian guardian dog. Haplotypes of groups A, B, C, and E/W have been found in Central Asian guardian dogs; haplotypes of groups A and B, in Caucasian guardian dogs. There is evidence suggesting a gene flow from Scandinavian dog populations to the Northern Caucasus. The results of the analysis allow the Caucasian guardian dog, Northern Caucasian wolf dog, Central Asian guardian dog, and the Turkish breeds akbash and kangal to be combined into a single group with an extremely low degree of differentiation. PMID:16915922

Riabinina, O M

2006-07-01

405

DNA isolation method is a source of global DNA methylation variability measured with LUMA. Experimental analysis and a systematic review.  

PubMed

In DNA methylation, methyl groups are covalently bound to CpG dinucleotides. However, the assumption that methyl groups are not lost during routine DNA extraction has not been empirically tested. To avoid nonbiological associations in DNA methylation studies, it is essential to account for potential batch effect bias in the assessment of this epigenetic mechanism. Our purpose was to determine if the DNA isolation method is an independent source of variability in methylation status. We quantified Global DNA Methylation (GDM) by luminometric methylation assay (LUMA), comparing the results from 3 different DNA isolation methods. In the controlled analysis (n?=?9), GDM differed slightly for the same individual depending on extraction method. In the population analysis (n?=?580) there were significant differences in GDM between the 3 DNA isolation methods (medians, 78.1%, 76.5% and 75.1%; p<0.001). A systematic review of published data from LUMA GDM studies that specify DNA extraction methods is concordant with our findings. DNA isolation method is a source of GDM variability measured with LUMA. To avoid possible bias, the method used should be reported and taken into account in future DNA methylation studies. PMID:23585847

Soriano-Tárraga, Carolina; Jiménez-Conde, Jordi; Giralt-Steinhauer, Eva; Ois, Angel; Rodríguez-Campello, Ana; Cuadrado-Godia, Elisa; Fernández-Cadenas, Israel; Montaner, Joan; Lucas, Gavin; Elosua, Roberto; Roquer, Jaume

2013-01-01

406

Toxoplasma gondii infection can induce retinal DNA damage: an experimental study  

PubMed Central

AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells.

El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

2014-01-01

407

Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules  

PubMed Central

DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2?-deoxyadenosine and 2?-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2?-deoxycytidine lesions form the base pair with guanine while the 2?-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides.

Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

2013-01-01

408

High mobility group proteins and their post-translational modifications  

Microsoft Academic Search

The high mobility group (HMG) proteins, including HMGA, HMGB and HMGN, are abundant and ubiquitous nuclear proteins that bind to DNA, nucleosome and other multi-protein complexes in a dynamic and reversible fashion to regulate DNA processing in the context of chromatin. All HMG proteins, like histone proteins, are subjected to extensive post-translational modifications (PTMs), such as lysine acetylation, arginine\\/lysine methylation

Qingchun Zhang; Yinsheng Wang

2008-01-01

409

Endogenous DNA Damage and Risk of Testicular Germ Cell Tumors.  

National Technical Information Service (NTIS)

Testicular germ cell tumors (TGCT) are comprised of two histologic groups, seminomas and nonseminomas. We postulated that the possible divergent pathogeneses of these histologies may be partially explained by variable endogenous DNA damage. To assess our ...

A. J. Sigurdson B. I. Graubard C. B. Thomas I. M. Jones K. A. Mc Glynn L. Korde M. B. Cook M. H. Greene

2008-01-01

410

A general approach for DNA encapsulation in degradable polymer microcapsules.  

PubMed

We report a general and facile method for the encapsulation of DNA in nanoengineered, degradable polymer microcapsules. Single-stranded (ss), linear double-stranded (ds), and plasmid DNA were encapsulated into disulfide-cross-linked poly(methacrylic acid) (PMA) capsules. The encapsulation procedure involves four steps: adsorption of DNA onto amine-functionalized silica (SiO(2)(+)) particles; sequential deposition of thiolated PMA (PMA (SH)) and poly(vinylpyrrolidone) to form multilayers; cross-linking of the thiol groups of the PMA (SH) in the multilayers into disulfide linkages; and removal of the sacrificial SiO(2)(+) particles. Multilayer growth was dependent on the surface coverage of DNA on the SiO(2)(+) particles, with stable capsules formed from particles with up to 50% DNA surface coverage. The encapsulation strategy applies to nucleic acids with varied size and conformation and allows DNA to be concentrated over 100-fold from dilute solutions into monodisperse, uniformly loaded polymer capsules. The capsule loading can be controlled by the DNA:SiO(2)(+)particle ratio, and for 1 microm diameter capsules, loadings of approximately 1000 chains of 800 bp dsDNA and more than 10,000 chains of 20-mer ssDNA can be achieved. The encapsulated DNA was released and successfully used in polymerase chain reactions as both templates (linear dsDNA and plasmid DNA) and primer sequences (ssDNA), confirming the functionality and structural integrity of the encapsulated DNA. These DNA-loaded polymer microcapsules hold promise as delivery vehicles for gene therapy and diagnostic applications. PMID:19203131

Zelikin, Alexander N; Becker, Alisa L; Johnston, Angus P R; Wark, Kim L; Turatti, Fabio; Caruso, Frank

2007-08-01

411

Using optical tweezers to study protein-DNA interactions  

NASA Astrophysics Data System (ADS)

Mechanical manipulation of single DNA molecules can provide novel information about protein-DNA interactions. Here we review two examples studied by our group. First, we have studied the forced unraveling of nucleosomes assembled on heterogeneous DNA using core histones, the histone chaperone NAP-1, and ATP-dependent chromatin assembly and remodeling factor (ACF). We measure abrupt events releasing ~55 to 95 base pairs of DNA, which are attributable to non-equilibrium unraveling of individual nucleosomes. Wide variations observed in the unraveling force and sudden DNA re-wrapping events may have an important regulatory influence on DNA directed biochemical processes. Second, we have studied the mechanics and dynamics of single DNA looping and cleavage by "two-site" restriction enzymes. Cleavage is measured as a function of DNA tension, incubation time, and enzyme concentration, distinguishing enzymes that require DNA looping from ones that do not. Forced disruption of fixed DNA loops formed in the absence of Mg2+ is observed, allowing the distribution of number of loops, loop length, and disruption force to be measured as a function of time, DNA tension, and ionic conditions.

Smith, Douglas E.; Gemmen, Gregory J.; Millin, Rachel; Rickgauer, John P.; Schweitzer, Allan L.; Fuller, Derek N.

2005-08-01

412

Assembly and functionalization of DNA-polymer microcapsules.  

PubMed

We report the synthesis and characterization of DNA-grafted poly(N-isopropylacrylamide) (PNIPAM) micelles, their assembly into multilayered thin films, and the subsequent generation and poly(ethylene glycol) (PEG) functionalization of DNA-PNIPAM microcapsules. Multilayer films were assembled by sequentially depositing DNA-grafted PNIPAM micelles containing the cDNA sequences polyA(30) or polyT(30) (i.e., PNIPAM-A(30) or PNIPAM-T(30)). DNA-polymer microcapsules were obtained by the alternate deposition of PNIPAM-A(30) and PNIPAM-T(30) onto silica particles, followed by removal of the template core. Upon removal of the silica core particle, shrinkage of between 30 and 50% was observed for the microcapsules. The presence of PNIPAM within the DNA-polymer hybrid film reduces the permeability of the microcapsules to macrosolutes (e.g., dextran) compared with microcapsules made solely of DNA. The hydrophobic core of the DNA-grafted PNIPAM micelles was designed to contain alkyne "click" groups, which were exploited to covalently couple azide-bearing low-fouling PEG to the DNA-PNIPAM microcapsules. The combination of hydrophobic and reactive "click" nanodomains, along with the degradability of DNA, offers a multifunctional and versatile DNA-polymer capsule system that is envisioned to find applications in the controlled delivery of therapeutics. PMID:19206271

Cavalieri, Francesca; Postma, Almar; Lee, Lillian; Caruso, Frank

2009-01-27

413

DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)  

PubMed Central

Background Many studies have shown the suitability of sequence variation in the 5? region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage.

Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

2014-01-01

414

Picture perfect: DNA-templated photoaffinity labeling.  

PubMed

Just so far apart and no further: Small molecules target ID by DNA tagging. Nucleic acid hybridization has been used to pair a photo-crosslinking group with a small molecule of interest. Following photoactivation, the protein(s) interacting with the small molecule are covalently linked to a nucleic acid tag. PMID:24006240

Barluenga, Sofia; Winssinger, Nicolas

2013-10-11

415

Activation of an Mg2+-dependent DNA endonuclease of avian myeloblastosis virus alpha beta DNA polymerase by in vitro proteolytic cleavage.  

PubMed Central

Partial chymotryptic digestion of purified avian myeloblastosis virus alpha beta DNA polymerase resulted in the activation of a Mg2+-dependent DNA endonuclease activity. Incubation of the polymerase-protease mixture in the presence of super-coiled DNA and Mg2+ permitted detection of the cleaved polymerase fragment possessing DNA nicking activity. Protease digestion conditions were established permitting selective cleavage of beta to alpha, which contained DNA polymerase and RNase H activity and to a family of polypeptides ranging in size from 30,000 to 34,000 daltons. These latter beta-unique fragments were purified by polyuridylate-Sepharose 4B chromatography and were shown to contain both DNA binding and DNA endonuclease activities. We have demonstrated that this group of polymerase fragments derived by chymotryptic digestion of alpha beta DNA polymerase is similar to the in vivo-isolated avian myeloblastosis virus p32pol in size, sequence, and DNA endonuclease activity. Images

Grandgenett, D P; Golomb, M; Vora, A C

1980-01-01

416

DNA polymerases and carcinogenesis.  

PubMed

There are many various chromosomal and gene mutations in human cancer cells. The total mutation rate in normal human cells is 2·10(-7) mutations/gene/division. From 6 to 12 carcinogenic mutations can arise by the end of the life, and these can affect the structure of ~150 protooncogenes and genes encoding suppressors of tumor growth. However, this does not explain the tens and hundreds of thousands of mutations detectable in cancer cells. Mutation is any change of nucleotide sequence in cellular DNA. Gene mutations are mainly consequences of errors of DNA polymerases, especially of their specialized fraction (inaccurate DNA polymerases ?, ?, ?, ?, ?, ?, ?, µ, ?, ?, Rev1, and terminal deoxynucleotidyl transferase, and only polymerases ? and ? manifest a slight 3'-exonuclease activity) and also consequences of a decrease in the rate of repair of these errors. Inaccurate specialized human polymerases are able to synthesize DNA opposite lesions in the DNA template, but their accuracy is especially low during synthesis on undamaged DNA. In the present review fundamental features of such polymerases are considered. DNA synthesis stops in the area of its lesion, but this block is overcome due to activities of inaccurate specialized DNA polymerases. After the lesion is bypassed, DNA synthesis is switched to accurate polymerases ?, ?, ?, or ?. Mechanisms of direct and reverse switches of DNA polymerases as well as their modifications during carcinogenesis are discussed. PMID:21073415

Krutyakov, V M; Kravetskaya, T P

2010-08-01

417

lambda DNA Fingerprinting Simulation  

NSDL National Science Digital Library

The purpose of this lab activity is to demonstrate (through simulation) how DNA fingerprinting (or DNA profiling) might be used to solve a crime. Learners perform restriction digests on DNA samples from four individuals, and then search for similarities between the individuals by running the restriction fragments on an electrophoresis gel. This activity does not do a true DNA fingerprint. It simulates two of the three steps of DNA fingerprinting: restriction of DNA sample and separation by electrophoresis. This activity does not make use of the third step, the radioactive probes. In order to make DNA fingerprinting affordable, lambda DNA is used instead of plasmids. This means that the instructor has to switch the labels on the samples given to the learners. What is labeled DNA is actually the different restriction enzymes and what is labeled restriction enzyme is the lambda DNA. Although there is some deception on the part of the instructor, learners are able to do a restriction digest that simulates a crime scene which adds interest for the learner.

Conley, Thomas J.

2009-01-01

418

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches  

DOEpatents

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

McCutchen-Maloney, Sandra L. (Pleasanton, CA)

2002-01-01

419

Functional DNA Nanomaterials  

NASA Astrophysics Data System (ADS)

The discovery of DNA helical structure opened the door of modern molecular biology. Ned Seeman utilized DNA as building block to construct different nanoscale materials, and introduced a new field, know as DNA nanotechnology. After several decades of development, different DNA structures had been created, with different dimension, different morphology and even with complex curvatures. In addition, after construction of enough amounts DNA structure candidates, DNA structure template, with excellent spatial addressability, had been used to direct the assembly of different nanomaterials, including nanoparticles and proteins, to produce different functional nanomaterials. However there are still many challenges to fabricate functional DNA nanostructures. The first difficulty is that the present finite sized template dimension is still very small, usually smaller than 100nm, which will limit the application for large amount of nanomaterials assembly or large sized nanomaterials assembly. Here we tried to solve this problem through developing a new method, superorigami, to construct finite sized DNA structure with much larger dimension, which can be as large as 500nm. The second problem will be explored the ability of DNA structure to assemble inorganic nanomaterials for novel photonic or electronic properties. Here we tried to utilize DNA Origami method to assemble AuNPs with controlled 3D spacial position for possible chiral photonic complex. We also tried to assemble SWNT with discrete length for possible field effect transistor device. In addition, we tried to mimic in vivo compartment with DNA structure to study internalized enzyme behavior. From our results, constructed DNA cage origami can protect encapsulated enzyme from degradation, and internalized enzyme activity can be boosted for up to 10 folds. In summary, DNA structure can serve as an ideal template for construction of functional nanomaterials with lots of possibilities to be explored.

Zhao, Zhao

420

Rebellion in group.  

PubMed

Rebellion is a strategy of social action: to overthrow the group's status quo or to adamantly oppose its revision. Rebellion occurs when other avenues of influence seem futile or unattractive-a judgment that depends on the group's genuine receptivity to discussion and change, and equally, on the state of mind of the rebel. There are different pathways of rebel