Science.gov

Sample records for groupings usingbranched dna

  1. Directed assembly of discrete gold nanoparticle groupings usingbranched DNA scaffolds

    SciTech Connect

    Claridge, Shelley A.; Goh, Sarah L.; Frechet, Jean M.J.; Williams, Shara C.; Micheel, Christine M.; Alivisatos, A. Paul

    2004-09-14

    The concept of self-assembled dendrimers is explored for the creation of discrete nanoparticle assemblies. Hybridization of branched DNA trimers and nanoparticle-DNA conjugates results in the synthesis of nanoparticle trimer and tetramer complexes. Multiple tetramer architectures are investigated, utilizing Au-DNA conjugates with varying secondary structural motifs. Hybridization products are analyzed by gel electrophoresis, and discrete bands are observed corresponding to structures with increasing numbers of hybridization events. Samples extracted from each band are analyzed by transmission electron microscopy, and statistics compiled from micrographs are used to compare assembly characteristics for each architecture. Asymmetric structures are also produced in which both 5 and 10 nm Au particles are assembled on branched scaffolds.

  2. DNA Topoisomerase/Integrase Group, LMP

    Cancer.gov

    Welcome to the DNA Topoisomerase/Integrase Group's Wiki Home page. This web site provides additional information on the research performed by the DNA Topoisomerase/Integrase Group, LMP, which focuses on Topoisomerase, HIV-1 integrase and Tdp1 inhibitors.

  3. Group II Introns: Mobile Ribozymes that Invade DNA

    PubMed Central

    Lambowitz, Alan M.; Zimmerly, Steven

    2011-01-01

    SUMMARY Group II introns are mobile ribozymes that self-splice from precursor RNAs to yield excised intron lariat RNAs, which then invade new genomic DNA sites by reverse splicing. The introns encode a reverse transcriptase that stabilizes the catalytically active RNA structure for forward and reverse splicing, and afterwards converts the integrated intron RNA back into DNA. The characteristics of group II introns suggest that they or their close relatives were evolutionary ancestors of spliceosomal introns, the spliceosome, and retrotransposons in eukaryotes. Further, their ribozyme-based DNA integration mechanism enabled the development of group II introns into gene targeting vectors (“targetrons”), which have the unique feature of readily programmable DNA target specificity. PMID:20463000

  4. Finding human promoter groups based on DNA physical properties

    NASA Astrophysics Data System (ADS)

    Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong

    2009-10-01

    DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

  5. Mitochondrial DNA evolution in the Anaxyrus boreas species group.

    PubMed

    Goebel, Anna M; Ranker, Tom A; Corn, Paul Stephen; Olmstead, Richard G

    2009-02-01

    The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrusexsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. PMID:18662792

  6. Mitochondrial DNA evolution in the Anaxyrus boreas species group

    USGS Publications Warehouse

    Goebel, A.M.; Ranker, T.A.; Corn, P.S.; Olmstead, R.G.

    2009-01-01

    The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed A. boreas, and three localized species, Anaxyrus nelsoni, Anaxyrus exsul and Anaxyrus canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toad's range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7% uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group. ?? 2008 Elsevier Inc.

  7. Genetic Kinship Investigation from Blood Groups to DNA Markers

    PubMed Central

    Geserick, Gunther; Wirth, Ingo

    2012-01-01

    The forensic application of hereditary characteristics became possible after the discovery of human blood groups by Karl Landsteiner in 1901. The foundation for their use in kinship investigation was laid by Emil von Dungern and Ludwig Hirschfeld in 1910 by clarification of the inheritance of the ABO groups. Up to the middle of the 20th century further red cell membrane systems were discovered. From the 1920s Fritz Schiff and Georg Strassmann fought for the introduction of blood groups into forensic kinship investigation. A new era of hemogenetics was opened from 1955 as genetic polymorphisms were described in serum proteins. Starting in 1958 there followed the complex HLA system of white blood cells, which from 1963 was joined by polymophisms in erythrocyte enzymes. Therefore, from the 1980s, it was possible to clarify the majority of kinship cases with a combination of conventional markers. From 1990 to 2000 the conventional markers were gradually replaced by the more effective DNA markers. Simultaneously typing shifted from the phenotype level to the genotype level. The genomic structure of conventional genetic markers could also now be explained. As a reflection of scientific progress the legal situation also changed, particularly in the form of the official guidelines for kinship investigation. PMID:22851931

  8. A chloroplast DNA phylogeny of lilacs (Syringa, Oleaceae): plastome groups show a strong correlation with crossing groups.

    PubMed

    Kim, K J; Jansen, R K

    1998-09-01

    Phylogenetic relationships and genomic compatibility were compared for 60 accessions of Syringa using chloroplast DNA (cpDNA) and nuclear ribosomal DNA (rDNA) markers. A total of 669 cpDNA variants, 653 of which were potentially phylogenetically informative, was detected using 22 restriction enzymes. Phylogenetic analyses reveal four strongly supported plastome groups that correspond to four genetically incompatible crossing groups. Relationships of the four plastome groups (I(II(III,IV))) correlate well with the infrageneric classification except for ser. Syringa and Pinnatifoliae. Group I, which includes subg. Ligustrina, forms a basal lineage within Syringa. Group II includes ser. Syringa and Pinnatifoliae and the two series have high compatibility and low sequence divergence. Group III consists of three well-defined species groups of ser. Pubescentes. Group IV comprises all members of ser. Villosae and has the lowest interspecific cpDNA sequence divergences. Comparison of cpDNA sequence divergence with crossability data indicates that hybrids have not been successfully generated between species with divergence greater than 0.7%. Hybrid barriers are strong among the four major plastome groups, which have sequence divergence estimates ranging from 1.096 to 1.962%. In contrast, fully fertile hybrids occur between species pairs with sequence divergence below 0.4%. Three regions of the plastome have length variants of greater than 100 bp, and these indels identify 12 different plastome types that correlate with phylogenetic trees produced from cpDNA restriction site data. Biparentally inherited nuclear rDNA and maternally inherited cpDNA length variants enable the identification of the specific parentage of several lilac hybrids. PMID:21685019

  9. A DNA barcode for land plants CBOL Plant Working Group1

    E-print Network

    Barrett, Spencer C.H.

    standard has impeded progress in plant barcoding. Our aim here is to identify a standard DNA barcodeA DNA barcode for land plants CBOL Plant Working Group1 Communicated by Daniel H. Janzen, University of Pennsylvania, Philadelphia, PA, May 27, 2009 (received for review March 18, 2009) DNA barcoding

  10. Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA

    ERIC Educational Resources Information Center

    Altiparmak, Melek; Nakiboglu Tezer, Mahmure

    2009-01-01

    Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

  11. Two high-mobility group box domains act together to underwind and kink DNA

    SciTech Connect

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-06-30

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.

  12. 2006 Nature Publishing Group Mechanism of DNA translocation in a

    E-print Network

    Wraight, Colin A.

    Eric J. Enemark1 & Leemor Joshua-Tor1 The E1 protein of papillomavirus is a hexameric ring helicase. Small DNA viruses such as papillomavirus, SV40 and AAV (adeno-associated virus) use a single initiator proteins E1, large T-antigen and Rep (from papillomavirus, SV40 and AAV, respectively) belong to helicase

  13. DNA DNA DNA (d)DNA DNA DNA

    E-print Network

    Hagiya, Masami

    DNA DNA DNA DNA DNA DNA DNA DNA [ 2008] (d)DNA DNA DNA DNA 2 3 DNA DNA DNA DNA DNA DNA DNA (a) (c) (b) (d) #12;DNA DNA DNA DNA DNA DNA DNA DNA (b) DNA [Tanaka et al.2008] DNA DNA DNA DNA DNA DNA DNA #12;iGEM MIT MIT

  14. Efimov like phase of a three stranded DNA (Efimov-DNA) and the renormalization group limit cycle

    E-print Network

    Tanmoy Pal; Poulomi Sadhukhan; Somendra M. Bhattacharjee

    2015-04-10

    A three-stranded DNA with short range base pairings only is known to exhibit a classical analog of the quantum Efimov effect, viz., a three chain bound state at the two chain melting point where no two are bound. By using a non-perturbative renormalization group method for a rigid duplex DNA and a flexible third strand, with base pairings and strand exchange, we show that the Efimov-DNA is associated with a limit cycle type behavior of the flow of an effective three chain interaction. The analysis also shows that thermally generated bubbles play an essential role in producing the effect. A toy model for the flow equations shows the limit cycle in an extended three dimensional parameter space of the two-chain coupling and a complex three chain interaction.

  15. Functional analysis of DNA bending and unwinding by the high mobility group domain of LEF-1.

    PubMed

    Giese, K; Pagel, J; Grosschedl, R

    1997-11-25

    LEF-1 (lymphoid enhancer-binding factor 1) is a cell type-specific member of the family of high mobility group (HMG) domain proteins that recognizes a specific nucleotide sequence in the T cell receptor (TCR) alpha enhancer. In this study, we extend the analysis of the DNA-binding properties of LEF-1 and examine their contributions to the regulation of gene expression. We find that LEF-1, like nonspecific HMG-domain proteins, can interact with irregular DNA structures such as four-way junctions, albeit with lower efficiency than with specific duplex DNA. We also show by a phasing analysis that the LEF-induced DNA bend is directed toward the major groove. In addition, we find that the interaction of LEF-1 with a specific binding site in circular DNA changes the linking number of DNA and unwinds the double helix. Finally, we identified two nucleotides in the LEF-1-binding site that are important for protein-induced DNA bending. Mutations of these nucleotides decrease both the extent of DNA bending and the transactivation of the TCR alpha enhancer by LEF-1, suggesting a contribution of protein-induced DNA bending to the function of TCR alpha enhancer. PMID:9371763

  16. Spy: A New Group of Eukaryotic DNA Transposons without Target Site Duplications

    PubMed Central

    Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

    2014-01-01

    Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5?-AAA and TTT-3? host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. PMID:24966181

  17. Spy: a new group of eukaryotic DNA transposons without target site duplications.

    PubMed

    Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

    2014-07-01

    Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5'-AAA and TTT-3' host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. PMID:24966181

  18. Characterization and grouping of Trypanosoma cruzi stocks by DNA base-specific fluorochromes and discriminant analysis.

    PubMed

    Mühlpfordt, H; Berger, J

    1990-01-01

    Fluorochromes with G-C and A-T specificity were used for a single-cell DNA analysis of the blood-stream forms of 14 Trypanosoma cruzi stocks in a cytofluorometric assay. The kinetoplast contained 22.3%-37.9% of the total DNA G-C base content and 42.7%-63.5% of the total DNA A-T base content. In spite of these differences, the mean base A-T/G-C ratio of the total DNA was 1.11 and was nearly constant in all stocks. The G-C base ratio of kinetoplast/nucleus resulted in a grouping corresponding with the peanut agglutinin (PNA)- and wheat germ agglutinin (WGA)-type characteristics of the T. cruzi stocks. The discriminant analysis revealed relationships, in that each stock contained some trypanosomes with DNA fluorescence characteristics of common to at least one other stock. After chromomycin A3 staining, the mean hit rates for the classification into group 1 PNA and the WGA group were 99% and 96%, respectively, and the respective rates obtained after DAPI application were 84% and 94%. PMID:2159645

  19. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    PubMed Central

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  20. Interactions of the high-mobility-group-like Ceratitis capitata C1 proteins with DNA.

    PubMed

    Marquez, G; Rodriguez, A T; Fernandez, B A; Montero, F

    1987-06-01

    We have studied the interactions of the high-mobility-group-like proteins (C1a1, C1a2 and C1b) from the fruit fly Ceratitis capitata with DNA. Nitrocellulose filter binding assays, thermal denaturation studies and spectrofluorimetry of the complexes revealed the existence of specific and nonspecific interactions. Thermal denaturation curves showed that the three proteins stabilized the DNA, thus suggesting a preferential binding to double-stranded DNA. The calculation of the thermodynamic parameters of the interactions showed that the nonspecific bindings were characterized by low association constants (Ka) with values ranging from 2.7 X 10(4) M-1 to 2.0 X 10(6) M-1. Also, the cooperativity of these interactions was relatively high (cooperativity factor, w, values ranging over 20-35), and the number of nucleotides involved was low (1-3 base pairs). On the other hand, the existence of specific interactions between C1 proteins and DNA was suggested by two facts: the retention of C. capitata [3H]DNA in nitrocellulose filters was only a low percentage of total input DNA and there was a marked size dependence of the binding (25% retention of a 40-kb DNA and only 3% retention with a DNA of 1 kb). The specific bindings had higher Ka values than the nonspecific ones, and they also were cooperative. Some differences were observed between C1b and the C1a proteins about the way they interact with C. capitata DNA. PMID:3595593

  1. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups

    PubMed Central

    Peacock-Villada, Alexandra; Coljee, Vincent; Danilowicz, Claudia; Prentiss, Mara

    2015-01-01

    Accurate sequence dependent pairing of single-stranded DNA (ssDNA) molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones. PMID:26115175

  2. Distinct Structural Features of the Peroxide Response Regulator from Group A Streptococcus Drive DNA Binding

    PubMed Central

    Hammel, Michal; Nix, Jay C.; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

    2014-01-01

    Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators. PMID:24586487

  3. DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus

    PubMed Central

    Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R.; Stefanovi?, Saša; Dickinson, Timothy A.

    2015-01-01

    DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication of hawthorn materials in natural health products. PMID:25926325

  4. DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus.

    PubMed

    Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R; Stefanovi?, Saša; Dickinson, Timothy A

    2015-01-01

    DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication of hawthorn materials in natural health products. PMID:25926325

  5. Xeroderma Pigmentosum Group A Protein Loads as a Separate Factor onto DNA Lesions

    PubMed Central

    Rademakers, Suzanne; Volker, Marcel; Hoogstraten, Deborah; Nigg, Alex L.; Moné, Martijn J.; van Zeeland, Albert A.; Hoeijmakers, Jan H. J.; Houtsmuller, Adriaan B.; Vermeulen, Wim

    2003-01-01

    Nucleotide excision repair (NER) is the main DNA repair pathway in mammals for removal of UV-induced lesions. NER involves the concerted action of more than 25 polypeptides in a coordinated fashion. The xeroderma pigmentosum group A protein (XPA) has been suggested to function as a central organizer and damage verifier in NER. How XPA reaches DNA lesions and how the protein is distributed in time and space in living cells are unknown. Here we studied XPA in vivo by using a cell line stably expressing physiological levels of functional XPA fused to green fluorescent protein and by applying quantitative fluorescence microscopy. The majority of XPA moves rapidly through the nucleoplasm with a diffusion rate different from those of other NER factors tested, arguing against a preassembled XPA-containing NER complex. DNA damage induced a transient (?5-min) immobilization of maximally 30% of XPA. Immobilization depends on XPC, indicating that XPA is not the initial lesion recognition protein in vivo. Moreover, loading of replication protein A on NER lesions was not dependent on XPA. Thus, XPA participates in NER by incorporation of free diffusing molecules in XPC-dependent NER-DNA complexes. This study supports a model for a rapid consecutive assembly of free NER factors, and a relatively slow simultaneous disassembly, after repair. PMID:12897146

  6. Specialization of the DNA-Cleaving Activity of a Group I Ribozyme Through In Vitro Evolution

    NASA Technical Reports Server (NTRS)

    Tsang, Joyce; Joyce, Gerald F.

    1996-01-01

    In an earlier study, an in vitro evolution procedure was applied to a large population of variants of the Tetrahymena group 1 ribozyme to obtain individuals with a 10(exp 5)-fold improved ability to cleave a target single-stranded DNA substrate under simulated physiological conditions. The evolved ribozymes also showed a twofold improvement, compared to the wild-type, in their ability to cleave a single-stranded RNA substrate. Here, we report continuation of the in vitro evolution process using a new selection strategy to achieve both enhanced DNA and diminished RNA-cleavage activity. Our strategy combines a positive selection for DNA cleavage with a negative selection against RNA binding. After 36 "generations" of in vitro evolution, the evolved population showed an approx. 100-fold increase in the ratio of DNA to RNA-cleavage activity. Site-directed mutagenesis experiment confirmed the selective advantage of two covarying mutations within the catalytic core of ribozyme that are largely responsible for this modified behavior. The population of ribozymes has now undergone a total of 63 successive generations of evolution, resulting in an average 28 mutations relative to the wild-type that are responsible for the altered phenotype.

  7. SUMOylation of xeroderma pigmentosum group C protein regulates DNA damage recognition during nucleotide excision repair

    PubMed Central

    Akita, Masaki; Tak, Yon-Soo; Shimura, Tsutomu; Matsumoto, Syota; Okuda-Shimizu, Yuki; Shimizu, Yuichiro; Nishi, Ryotaro; Saitoh, Hisato; Iwai, Shigenori; Mori, Toshio; Ikura, Tsuyoshi; Sakai, Wataru; Hanaoka, Fumio; Sugasawa, Kaoru

    2015-01-01

    The xeroderma pigmentosum group C (XPC) protein complex is a key factor that detects DNA damage and initiates nucleotide excision repair (NER) in mammalian cells. Although biochemical and structural studies have elucidated the interaction of XPC with damaged DNA, the mechanism of its regulation in vivo remains to be understood in more details. Here, we show that the XPC protein undergoes modification by small ubiquitin-related modifier (SUMO) proteins and the lack of this modification compromises the repair of UV-induced DNA photolesions. In the absence of SUMOylation, XPC is normally recruited to the sites with photolesions, but then immobilized profoundly by the UV-damaged DNA-binding protein (UV-DDB) complex. Since the absence of UV-DDB alleviates the NER defect caused by impaired SUMOylation of XPC, we propose that this modification is critical for functional interactions of XPC with UV-DDB, which facilitate the efficient damage handover between the two damage recognition factors and subsequent initiation of NER. PMID:26042670

  8. A Dynamic Combinatorial Approach for Identifying Side Groups that Stabilize DNA-Templated Supramolecular Self-Assemblies

    PubMed Central

    Paolantoni, Delphine; Cantel, Sonia; Dumy, Pascal; Ulrich, Sébastien

    2015-01-01

    DNA-templated self-assembly is an emerging strategy for generating functional supramolecular systems, which requires the identification of potent multi-point binding ligands. In this line, we recently showed that bis-functionalized guanidinium compounds can interact with ssDNA and generate a supramolecular complex through the recognition of the phosphodiester backbone of DNA. In order to probe the importance of secondary interactions and to identify side groups that stabilize these DNA-templated self-assemblies, we report herein the implementation of a dynamic combinatorial approach. We used an in situ fragment assembly process based on reductive amination and tested various side groups, including amino acids. The results reveal that aromatic and cationic side groups participate in secondary supramolecular interactions that stabilize the complexes formed with ssDNA. PMID:25667976

  9. Rules for DNA target-site recognition by a lactococcal group II intron enable retargeting of the intron to specific DNA sequences

    PubMed Central

    Mohr, Georg; Smith, Dorie; Belfort, Marlene; Lambowitz, Alan M.

    2000-01-01

    Group II intron homing occurs primarily by a mechanism in which the intron RNA reverse splices into a DNA target site and is then reverse transcribed by the intron-encoded protein. The DNA target site is recognized by an RNP complex containing the intron-encoded protein and the excised intron RNA. Here, we analyzed DNA target-site requirements for the Lactococcus lactis Ll.LtrB group II intron in vitro and in vivo. Our results suggest a model similar to yeast mtDNA introns, in which the intron-encoded protein first recognizes a small number of nucleotide residues in double-stranded DNA and causes DNA unwinding, enabling the intron RNA to base-pair with the DNA for reverse splicing. Antisense-strand cleavage requires additional interactions between the protein and 3? exon. Key nucleotide residues are recognized directly by the intron-encoded protein independent of sequence context, and there is a stringent requirement for fixed spacing between target site elements recognized by the protein and RNA components of the endonuclease. Experiments with DNA substrates containing GC-clamps or “bubbles” indicate a requirement for DNA unwinding in the 3? exon but not the distal 5? exon region. Finally, by applying the target-site recognition rules, we show that the L1.LtrB intron can be modified to insert at new sites in a plasmid-borne thyA gene in Escherichia coli. This strategy should be generally applicable to retargeting group II introns and to delivering foreign sequences to specific sites in heterologous genomes. PMID:10716944

  10. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  11. Increased levels of chromosomal aberrations and DNA damage in a group of workers exposed to formaldehyde.

    PubMed

    Costa, Solange; Carvalho, Sandra; Costa, Carla; Coelho, Patrícia; Silva, Susana; Santos, Luís S; Gaspar, Jorge F; Porto, Beatriz; Laffon, Blanca; Teixeira, João P

    2015-07-01

    Formaldehyde (FA) is a commonly used chemical in anatomy and pathology laboratories as a tissue preservative and fixative. Because of its sensitising properties, irritating effects and cancer implication, FA accounts probably for the most important chemical-exposure hazard concerning this professional group. Evidence for genotoxic effects and carcinogenic properties in humans is insufficient and conflicting, particularly in regard to the ability of inhaled FA to induce toxicity on other cells besides first contact tissues, such as buccal and nasal cells. To evaluate the effects of exposure to FA in human peripheral blood lymphocytes, a group of 84 anatomy pathology laboratory workers exposed occupationally to FA and 87 control subjects were tested for chromosomal aberrations (CAs) and DNA damage (comet assay). The level of exposure to FA in the workplace air was evaluated. The association between genotoxicity biomarkers and polymorphic genes of xenobiotic-metabolising and DNA repair enzymes were also assessed. The estimated mean level of FA exposure was 0.38±0.03 ppm. All cytogenetic endpoints assessed by CAs test and comet assay % tail DNA (%TDNA) were significantly higher in FA-exposed workers compared with controls. Regarding the effect of susceptibility biomarkers, results suggest that polymorphisms in CYP2E1 and GSTP1 metabolic genes, as well as, XRCC1 and PARP1 polymorphic genes involved in DNA repair pathways are associated with higher genetic damage in FA-exposed subjects. Data obtained in this study show a potential health risk situation of anatomy pathology laboratory workers exposed to FA (0.38 ppm). Implementation of security and hygiene measures may be crucial to decrease risk. The obtained information may also provide new important data to be used by health care programs and by governmental agencies responsible for occupational health and safety. PMID:25711496

  12. Capture-recapture of white-tailed deer using DNA from fecal pellet-groups

    USGS Publications Warehouse

    Goode, Matthew J; Beaver, Jared T; Muller, Lisa I; Clark, Joseph D.; van Manen, Frank T.; Harper, Craig T; Basinger, P Seth

    2014-01-01

    Traditional methods for estimating white-tailed deer population size and density are affected by behavioral biases, poor detection in densely forested areas, and invalid techniques for estimating effective trapping area. We evaluated a noninvasive method of capture—recapture for white-tailed deer (Odocoileus virginianus) density estimation using DNA extracted from fecal pellets as an individual marker and for gender determination, coupled with a spatial detection function to estimate density (spatially explicit capture—recapture, SECR). We collected pellet groups from 11 to 22 January 2010 at randomly selected sites within a 1-km2 area located on Arnold Air Force Base in Coffee and Franklin counties, Tennessee. We searched 703 10-m radius plots and collected 352 pellet-group samples from 197 plots over five two-day sampling intervals. Using only the freshest pellets we recorded 140 captures of 33 different animals (15M:18F). Male and female densities were 1.9 (SE = 0.8) and 3.8 (SE = 1.3) deer km-2, or a total density of 5.8 deer km-2 (14.9 deer mile-2). Population size was 20.8 (SE = 7.6) over a 360-ha area, and sex ratio was 1.0 M: 2.0 F (SE = 0.71). We found DNA sampling from pellet groups improved deer abundance, density and sex ratio estimates in contiguous landscapes which could be used to track responses to harvest or other management actions.

  13. Complex Evolutionary History of the Aeromonas veronii Group Revealed by Host Interaction and DNA Sequence Data

    PubMed Central

    Faucher, Joshua; Horneman, Amy J.; Gogarten, J. Peter; Graf, Joerg

    2011-01-01

    Aeromonas veronii biovar sobria, Aeromonas veronii biovar veronii, and Aeromonas allosaccharophila are a closely related group of organisms, the Aeromonas veronii Group, that inhabit a wide range of host animals as a symbiont or pathogen. In this study, the ability of various strains to colonize the medicinal leech as a model for beneficial symbiosis and to kill wax worm larvae as a model for virulence was determined. Isolates cultured from the leech out-competed other strains in the leech model, while most strains were virulent in the wax worms. Three housekeeping genes, recA, dnaJ and gyrB, the gene encoding chitinase, chiA, and four loci associated with the type three secretion system, ascV, ascFG, aexT, and aexU were sequenced. The phylogenetic reconstruction failed to produce one consensus tree that was compatible with most of the individual genes. The Approximately Unbiased test and the Genetic Algorithm for Recombination Detection both provided further support for differing evolutionary histories among this group of genes. Two contrasting tests detected recombination within aexU, ascFG, ascV, dnaJ, and gyrB but not in aexT or chiA. Quartet decomposition analysis indicated a complex recent evolutionary history for these strains with a high frequency of horizontal gene transfer between several but not among all strains. In this study we demonstrate that at least for some strains, horizontal gene transfer occurs at a sufficient frequency to blur the signal from vertically inherited genes, despite strains being adapted to distinct niches. Simply increasing the number of genes included in the analysis is unlikely to overcome this challenge in organisms that occupy multiple niches and can exchange DNA between strains specialized to different niches. Instead, the detection of genes critical in the adaptation to specific niches may help to reveal the physiological specialization of these strains. PMID:21359176

  14. Complex evolutionary history of the Aeromonas veronii group revealed by host interaction and DNA sequence data.

    PubMed

    Silver, Adam C; Williams, David; Faucher, Joshua; Horneman, Amy J; Gogarten, J Peter; Graf, Joerg

    2011-01-01

    Aeromonas veronii biovar sobria, Aeromonas veronii biovar veronii, and Aeromonas allosaccharophila are a closely related group of organisms, the Aeromonas veronii Group, that inhabit a wide range of host animals as a symbiont or pathogen. In this study, the ability of various strains to colonize the medicinal leech as a model for beneficial symbiosis and to kill wax worm larvae as a model for virulence was determined. Isolates cultured from the leech out-competed other strains in the leech model, while most strains were virulent in the wax worms. Three housekeeping genes, recA, dnaJ and gyrB, the gene encoding chitinase, chiA, and four loci associated with the type three secretion system, ascV, ascFG, aexT, and aexU were sequenced. The phylogenetic reconstruction failed to produce one consensus tree that was compatible with most of the individual genes. The Approximately Unbiased test and the Genetic Algorithm for Recombination Detection both provided further support for differing evolutionary histories among this group of genes. Two contrasting tests detected recombination within aexU, ascFG, ascV, dnaJ, and gyrB but not in aexT or chiA. Quartet decomposition analysis indicated a complex recent evolutionary history for these strains with a high frequency of horizontal gene transfer between several but not among all strains. In this study we demonstrate that at least for some strains, horizontal gene transfer occurs at a sufficient frequency to blur the signal from vertically inherited genes, despite strains being adapted to distinct niches. Simply increasing the number of genes included in the analysis is unlikely to overcome this challenge in organisms that occupy multiple niches and can exchange DNA between strains specialized to different niches. Instead, the detection of genes critical in the adaptation to specific niches may help to reveal the physiological specialization of these strains. PMID:21359176

  15. Structural and biochemical analyses of DNA and RNA binding by a bifunctional homing endonuclease and group I intron splicing factor

    PubMed Central

    Bolduc, Jill M.; Spiegel, P. Clint; Chatterjee, Piyali; Brady, Kristina L.; Downing, Maureen E.; Caprara, Mark G.; Waring, Richard B.; Stoddard, Barry L.

    2003-01-01

    We determined the crystal structure of a bifunctional group I intron splicing factor and homing endonuclease, termed the I-AniI maturase, in complex with its DNA target at 2.6 Å resolution. The structure demonstrates the remarkable structural conservation of the ?-sheet DNA-binding motif between highly divergent enzyme subfamilies. DNA recognition by I-AniI was further studied using nucleoside deletion and DMS modification interference analyses. Correlation of these results with the crystal structure provides information on the relative importance of individual nucleotide contacts for DNA recognition. Alignment and modeling of two homologous maturases reveals conserved basic surface residues, distant from the DNA-binding surface, that might be involved in RNA binding. A point mutation that introduces a single negative charge in this region uncouples the maturase and endonuclease functions of the protein, inhibiting RNA binding and splicing while maintaining DNA binding and cleavage. PMID:14633971

  16. The Role of Mg(II) in DNA Cleavage Site Recognition in Group II Intron Ribozymes

    PubMed Central

    Skilandat, Miriam; Sigel, Roland K. O.

    2014-01-01

    Group II intron ribozymes catalyze the cleavage of (and their reinsertion into) DNA and RNA targets using a Mg2+-dependent reaction. The target is cleaved 3? to the last nucleotide of intron binding site 1 (IBS1), one of three regions that form base pairs with the intron's exon binding sites (EBS1 to -3). We solved the NMR solution structure of the d3? hairpin of the Sc.ai5? intron containing EBS1 in its 11-nucleotide loop in complex with the dIBS1 DNA 7-mer and compare it with the analogous RNA·RNA contact. The EBS1·dIBS1 helix is slightly flexible and non-symmetric. NMR data reveal two major groove binding sites for divalent metal ions at the EBS1·dIBS1 helix, and surface plasmon resonance experiments show that low concentrations of Mg2+ considerably enhance the affinity of dIBS1 for EBS1. Our results indicate that identification of both RNA and DNA IBS1 targets, presentation of the scissile bond, and stabilization of the structure by metal ions are governed by the overall structure of EBS1·dIBS1 and the surrounding loop nucleotides but are irrespective of different EBS1·(d)IBS1 geometries and interstrand affinities. PMID:24895129

  17. Genetic polymorphism of six DNA loci in six population groups of India.

    PubMed

    Ahmad, Shazia; Seshadri, M

    2007-08-01

    The genetic profile based on autosomal markers, four microsatellite DNA markers (D8S315, FES, D8S592, and D2S1328) and two minisatellite DNA markers (TPMT and PDGFA), were analyzed in six endogamous populations to examine the effect of geographic and linguistic affiliation on the genetic affinities among the groups. The six populations are from three different states of India and are linguistically different. Marathas from western India speak Marathi, an Indo-European language. Arayas, Muslims, Ezhavas, and Nairs from Kerala state of South India speak Malayalam, and Iyers from Tamil Nadu state speak Tamil. Genomic DNA was extracted from peripheral blood samples of random, normal, healthy individuals. Locus-specific PCR amplification was carried out, followed by electrophoresis of the amplicons and genotyping. All the loci were highly polymorphic and followed Hardy-Weinberg equilibrium, except for loci D8S315 and PDGFA in Iyers and Marathas, respectively. All six loci had high heterozygosity (average heterozygosity ranged from 0.73 to 0.76) and high polymorphism information content (0.57-0.90). The extent of gene differentiation among the six populations (G(ST) = 0.030) was greater than that for four Kerala populations (G(ST) = 0.011), suggesting proximity between the four Kerala populations. This result conforms with the cultural and linguistic background of the populations. The extent of diversity found among the populations probably resulted from the strict endogamous practices that they follow. PMID:18075006

  18. Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species

    NASA Astrophysics Data System (ADS)

    Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

    2009-05-01

    Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1?g) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288?A. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35?A) and for the noncomplementary oligonucleotide (5.77?A). The drop in current after each event was clearly noticeable and it proved to be effective.

  19. Mobile group II introns of yeast mitochondrial DNA are novel site-specific retroelements.

    PubMed Central

    Moran, J V; Zimmerly, S; Eskes, R; Kennell, J C; Lambowitz, A M; Butow, R A; Perlman, P S

    1995-01-01

    Group II introns aI1 and aI2 of the yeast mitochondrial COXI gene are mobile elements that encode an intron-specific reverse transcriptase (RT) activity. We show here that the introns of Saccharomyces cerevisiae ID41-6/161 insert site specifically into intronless alleles. The mobility is accompanied by efficient, but highly asymmetric, coconversion of nearby flanking exon sequences. Analysis of mutants shows that the aI2 protein is required for the mobility of both aI1 and aI2. Efficient mobility is dependent on both the RT activity of the aI2-encoded protein and a separate function, a putative DNA endonuclease, that is associated with the Zn2+ finger-like region of the intron reading frame. Surprisingly, there appear to be two mobility modes: the major one involves cDNAs reverse transcribed from unspliced precursor RNA; the minor one, observed in two mutants lacking detectable RT activity, appears to involve DNA level recombination. A cis-dominant splicing-defective mutant of aI2 continues to synthesize cDNAs containing the introns but is completely defective in both mobility modes, indicating that the splicing or the structure of the intron is required. Our results demonstrate that the yeast group II intron aI2 is a retroelement that uses novel mobility mechanisms. PMID:7537853

  20. Genetic analysis of 15 mtDNA SNP loci in Chinese Yi ethnic group using SNaPshot minisequencing.

    PubMed

    Hu, Chun-Ting; Yan, Jiang-Wei; Chen, Feng; Zhang, Qing-Xia; Wang, Hong-Dan; Yin, Cai-Yong; Fan, Han-Ting; Hu, Ling-Li; Shen, Chun-Mei; Meng, Hao-Tian; Zhang, Yu-Dang; Wang, Hui; Zhu, Bo-Feng

    2016-01-15

    SNaPshot minisequencing is a rapid and robust methodology based on a single base extension with a labeled ddNTP. The present study detected 15 selected SNPs in the mitochondrial DNA (mtDNA) control and coding regions by minisequencing methodology using SNaPshot for forensic purpose. The samples were collected from 99 unrelated individuals of the Yi ethnic minority group in Yunnan Province. We have predominantly found high-frequency transitions (91.7%) and a significantly lower frequency of transversions (8.3%). The nt152, 489, 8701, 10,398, 16,183, and 16,362 loci were highly polymorphic, while the nt231, 473 and 581 loci were not polymorphic in the studied population. Based on these 15 SNPs, a total of 28 mtDNA haplotypes were defined in 99 individuals with the haplotype diversity of 0.9136. Also, we compared the mtDNA sequences of Yi group and other 9 populations worldwide and drew a Neighbor-Joining tree based on the shared 12 mtDNA SNP loci, which demonstrated a close relationship between Yi and Bai groups. In conclusion, the analysis of the 15 selected SNPs increases considerably the discrimination power of mtDNA. Moreover, the SNaPshot minisequencing method could quickly detect mtDNA SNPs, and is economical and sensitive. The set of selected 15 SNPs is highly informative and is capable for anthropology genetic analysis. PMID:26432004

  1. The Fanconi anemia complementation group C protein corrects DNA interstrand cross-link-specific apoptosis in HSC536N cells.

    PubMed

    Marathi, U K; Howell, S R; Ashmun, R A; Brent, T P

    1996-09-15

    Fanconi anemia (FA) cells are hypersensitive to cytotoxicity, cell cycle arrest, and chromosomal aberrations induced by DNA cross-linking agents, such as mitomycin C (MMC) and nitrogen mustard (HN2). Although MMC hypersensitivity is complemented in a subset of FA cells (complementation group C [FA-C]) by wild-type FAC cDNA, the cytoprotective mechanism is unknown. In the current study, we tested the hypothesis that FAC protein functions in the suppression of DNA interstand cross-link (ISC)-induced cell cycle arrest and apoptosis. Comparison of HN2-induced cell cycle arrest and apoptosis with those of its non-cross-linking analogs, diethylaminoethyl chloride and 2-dimethylaminoethyl chloride, delineated the DNA ISC specificity of FAC-mediated cytoprotection. Overexpression of wild-type FAC cDNA in FA-C lymphoblasts (HSC536N cell line) prevented HN2-induced growth inhibition, G2 arrest, and DNA fragmentation that is characteristic of apoptosis. In contrast cytoprotection was not conferred against the effects of the non-cross-linking mustards. Our data show that DNA ISCs induce apoptosis more potently than do DNA monoadducts and suggest that FAC suppresses specifically DNA ISC-induced apoptosis in the G2 phase of the cell cycle. PMID:8822951

  2. Doping Level of Boron-Doped Diamond Electrodes Controls the Grafting Density of Functional Groups for DNA Assays.

    PubMed

    Švorc, ?ubomír; Jambrec, Daliborka; Vojs, Marian; Barwe, Stefan; Clausmeyer, Jan; Michniak, Pavol; Marton, Marián; Schuhmann, Wolfgang

    2015-09-01

    The impact of different doping levels of boron-doped diamond on the surface functionalization was investigated by means of electrochemical reduction of aryldiazonium salts. The grafting efficiency of 4-nitrophenyl groups increased with the boron levels (B/C ratio from 0 to 20,000 ppm). Controlled grafting of nitrophenyldiazonium was used to adjust the amount of immobilized single-stranded DNA strands at the surface and further on the hybridization yield in dependence on the boron doping level. The grafted nitro functions were electrochemically reduced to the amine moieties. Subsequent functionalization with a succinic acid introduced carboxyl groups for subsequent binding of an amino-terminated DNA probe. DNA hybridization significantly depends on the probe density which is in turn dependent on the boron doping level. The proposed approach opens new insights for the design and control of doped diamond surface functionalization for the construction of DNA hybridization assays. PMID:26285076

  3. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  4. Characterization of polymorphisms in the mitochondrial DNA of twelve ethnic groups in the Guizhou province of China.

    PubMed

    He, Yan; Ren, Ling-Yan; Shan, Ke-Ren; Zhang, Ting; Wang, Chan-Juan; Guan, Zhi-Zhong

    2016-01-01

    To characterize the genetic profiles and relationships between ancient ethnic populations, we analyzed polymorphisms in mitochondrial DNA (mtDNA) isolated from the blood of 753 members of 12 ethnic groups (Buyi, Dong, Gelao, Hui, Man, Miao, Menggu, Mulao, Maonan, Qiang, She and Zhuang) living in the Guizhou Province of China. The 9-bp deletion of mtDNA was detected by the polymerase chain reaction (PCR) and PCR-PAGE, and 11 SNPs by restriction fragment length polymorphism and mini-sequencing. Thereafter, these genotyping results were verified by PCR-DNA sequencing. The mtDNA of these populations exhibited considerable diversity, both with respect to the haplogroups M and N, and subgroups thereof. The differences between the major ethnic groups reflected the maternal inheritance. These ethnic groups in Guizhou demonstrated a genetic profile that differed considerably from that of other Asian populations. Our findings indicate that the matrilineal genetic profiles of Guizhou groups are relatively complex and distinct, showing relationships that reflect national history and geography. PMID:24660920

  5. Yeast high mobility group protein HMO1 stabilizes chromatin and is evicted during repair of DNA double strand breaks.

    PubMed

    Panday, Arvind; Xiao, LiJuan; Grove, Anne

    2015-07-13

    DNA is packaged into condensed chromatin fibers by association with histones and architectural proteins such as high mobility group (HMGB) proteins. However, this DNA packaging reduces accessibility of enzymes that act on DNA, such as proteins that process DNA after double strand breaks (DSBs). Chromatin remodeling overcomes this barrier. We show here that the Saccharomyces cerevisiae HMGB protein HMO1 stabilizes chromatin as evidenced by faster chromatin remodeling in its absence. HMO1 was evicted along with core histones during repair of DSBs, and chromatin remodeling events such as histone H2A phosphorylation and H3 eviction were faster in absence of HMO1. The facilitated chromatin remodeling in turn correlated with more efficient DNA resection and recruitment of repair proteins; for example, inward translocation of the DNA-end-binding protein Ku was faster in absence of HMO1. This chromatin stabilization requires the lysine-rich C-terminal extension of HMO1 as truncation of the HMO1 C-terminal tail phenocopies hmo1 deletion. Since this is reminiscent of the need for the basic C-terminal domain of mammalian histone H1 in chromatin compaction, we speculate that HMO1 promotes chromatin stability by DNA bending and compaction imposed by its lysine-rich domain and that it must be evicted along with core histones for efficient DSB repair. PMID:25979266

  6. Yeast high mobility group protein HMO1 stabilizes chromatin and is evicted during repair of DNA double strand breaks

    PubMed Central

    Panday, Arvind; Xiao, LiJuan; Grove, Anne

    2015-01-01

    DNA is packaged into condensed chromatin fibers by association with histones and architectural proteins such as high mobility group (HMGB) proteins. However, this DNA packaging reduces accessibility of enzymes that act on DNA, such as proteins that process DNA after double strand breaks (DSBs). Chromatin remodeling overcomes this barrier. We show here that the Saccharomyces cerevisiae HMGB protein HMO1 stabilizes chromatin as evidenced by faster chromatin remodeling in its absence. HMO1 was evicted along with core histones during repair of DSBs, and chromatin remodeling events such as histone H2A phosphorylation and H3 eviction were faster in absence of HMO1. The facilitated chromatin remodeling in turn correlated with more efficient DNA resection and recruitment of repair proteins; for example, inward translocation of the DNA-end-binding protein Ku was faster in absence of HMO1. This chromatin stabilization requires the lysine-rich C-terminal extension of HMO1 as truncation of the HMO1 C-terminal tail phenocopies hmo1 deletion. Since this is reminiscent of the need for the basic C-terminal domain of mammalian histone H1 in chromatin compaction, we speculate that HMO1 promotes chromatin stability by DNA bending and compaction imposed by its lysine-rich domain and that it must be evicted along with core histones for efficient DSB repair. PMID:25979266

  7. Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds

    SciTech Connect

    Mastroianni, Alexander; Claridge, Shelley; Alivisatos, A. Paul

    2009-03-30

    Nanostructures constructed from metal and semiconductor nanocrystals conjugated to, and organized by DNA are an emerging class of material with collective optical properties. We created discrete pyramids of DNA with gold nanocrystals at the tips. By taking small angle X-ray scattering (SAXS) measurments from solutions of these pyramids we confirmed that this pyramidal geometry creates structures which are more rigid in solution than linear DNA. We then took advantage of the tetrahedral symmetry to demonstrate construction of chiral nanostructures.

  8. DNA Barcoding Will Frequently Fail in Complicated Groups: An Example in Wild Potatoes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    DNA barcoding has been proposed as a rapid and practical molecular tool to identify species using short orthologous DNA sequences from one or a small number of universal regions. It seeks to overcome the “taxonomic impediment” of a greater need to identify organisms than the availability of competen...

  9. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group

    E-print Network

    Rohs, Remo

    multiple X-ray structures and binding properties of Fis­DNA complexes containing base analogs that the 2 selection is governed by both direct readout of the chemical features of DNA bases (`direct readout') (1). In these and other examples, basic side chain residues, most often arginines, selectively insert into the minor

  10. DNA FINGERPRINTING ANALYSIS OF VEGETATIVE COMPATIBILITY GROUPS IN ASPERGILLUS FLAVUS FROM A PEANUT FEILD IN GEORGIA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability of a species specific DNA probe pAF28 to correctly match 75 strains of A. flavus isolated from a peanut field in Georgia with one of 44 distinct VCGs was assessed. Multiple strains belonging to the same VCG typically produced identical DNA fingerprints with the exception of VCG 17 and V...

  11. Design and testing of a functional group-specific DNA probe for the study of natural populations of acetogenic bacteria.

    PubMed Central

    Lovell, C R; Hui, Y

    1991-01-01

    The acetogens, although phylogenetically diverse, can be characterized by their possession of the acetyl coenzyme A (acetyl-CoA) pathway for autotrophic CO2 fixation. The gene encoding formyltetrahydrofolate synthetase, a key enzyme of the acetyl-CoA pathway, was previously cloned from the thermophilic acetogen Clostridium thermoaceticum and has now been tested as a group-specific probe for acetogens. Stable hybrids were formed between the probe and single DNA fragments from eight known acetogens representing six genera. A hybrid was also formed between the probe and a DNA fragment from one sulfate reducer known to be capable of both autotrophic CO2 fixation and acetate catabolism. No such hybrid was formed between the probe and DNA from a homoacetate fermenter not known to use the acetyl-CoA pathway, with two known formyltetrahydrofolate synthetase-producing purine fermenters, or with DNA from 27 other species representing 16 genera of organisms that do not use the acetyl-CoA pathway. DNA purified from cells extracted from horse manure was also screened with the acetogen probe. Six hybrids, indicating at least six detectable acetogen "strains," were observed. Images PMID:1768134

  12. Differentiation and grouping of isolates of the Ganoderma lucidum complex by random amplified polymorphic DNA-PCR compared with grouping on the basis of internal transcribed spacer sequences.

    PubMed Central

    Hseu, R S; Wang, H H; Wang, H F; Moncalvo, J M

    1996-01-01

    Laccate polypores of the Ganoderma lucidum species complex are widespread white rot fungi of economic importance, but isolates cannot be identified by traditional taxonomic methods. Parsimony analysis of nucleotide sequences from the internal transcribed spacers (ITS) of the ribosomal gene (rDNA) distinguished six lineages in this species complex. Each ITS lineage may represent one or more putative species. While some isolates have identical ITS sequences, all of them could be clearly differentiated by genetic fingerprinting using random amplified polymorphic DNA (RAPD). To investigate the suitability of RAPD markers for taxonomic identification and grouping of isolates of the G. lucidum complex, RAPD fragments (RAPDs) were used as phenotypic characters in numerical and parsimony analyses. Results show that data from RAPDS do not distinguish the same clades as ITS data do. Groupings based on analysis of RAPD data were very sensitive to the choice of the grouping method used, and no consistent grouping of isolates could be proposed. However, analysis with RAPDs did resolve several robust terminal clades containing putatively conspecific isolates, suggesting that RAPDs might be helpful for systematics at the lower taxonomic levels that are unresolved by ITS sequence data. The limitations of RAPDs for systematics are briefly discussed. The conclusion of this study is that ITS sequences can be used to identify isolates of the G. lucidum complex, whereas RAPDs can be used to differentiate between isolates having identical ITS sequences. The practical implications of these results are briefly illustrated. PMID:8919797

  13. Lay perceptions of predictive testing for diabetes based on DNA test results versus family history assessment: a focus group study

    PubMed Central

    2011-01-01

    Background This study assessed lay perceptions of issues related to predictive genetic testing for multifactorial diseases. These perceived issues may differ from the "classic" issues, e.g. autonomy, discrimination, and psychological harm that are considered important in predictive testing for monogenic disorders. In this study, type 2 diabetes was used as an example, and perceptions with regard to predictive testing based on DNA test results and family history assessment were compared. Methods Eight focus group interviews were held with 45 individuals aged 35-70 years with (n = 3) and without (n = 1) a family history of diabetes, mixed groups of these two (n = 2), and diabetes patients (n = 2). All interviews were transcribed and analysed using Atlas-ti. Results Most participants believed in the ability of a predictive test to identify people at risk for diabetes and to motivate preventive behaviour. Different reasons underlying motivation were considered when comparing DNA test results and a family history risk assessment. A perceived drawback of DNA testing was that diabetes was considered not severe enough for this type of risk assessment. In addition, diabetes family history assessment was not considered useful by some participants, since there are also other risk factors involved, not everyone has a diabetes family history or knows their family history, and it might have a negative influence on family relations. Respect for autonomy of individuals was emphasized more with regard to DNA testing than family history assessment. Other issues such as psychological harm, discrimination, and privacy were only briefly mentioned for both tests. Conclusion The results suggest that most participants believe a predictive genetic test could be used in the prevention of multifactorial disorders, such as diabetes, but indicate points to consider before both these tests are applied. These considerations differ with regard to the method of assessment (DNA test or obtaining family history) and also differ from monogenic disorders. PMID:21729316

  14. A New Epistasis Group for the Repair of DNA Damage in Bacteriophage T4: Replication Repair

    PubMed Central

    Wachsman, Joseph T.; Drake, John W.

    1987-01-01

    The gene 32 mutation amA453 sensitizes bacteriophage T4 to the lethal effects of ultraviolet (UV) irradiation, methyl methanesulfonate and angelicin-mediated photodynamic irradiation when treated particles are plated on amber-suppressing host cells. The increased UV sensitivity caused by amA453 is additive to that caused by mutations in both the T4 excision repair (denV) and recombination repair (uvsWXY) systems, suggesting the operation of a third kind of repair system. The mutation uvs79, with many similarities to amA453 but mapping in gene 41, is largely epistatic to amA453. The mutation mms1, also with many similarities to amA453, maps close to amA453 within gene 32 and is largely epistatic to uvs79. Neither amA453 nor uvs79 affect the ratio of UV-induced mutational to lethal hits, nor does amA453 affect spontaneous or UV-enhanced recombination frequencies. Gene 32 encodes the major T4 ssDNA-binding protein (the scaffolding of DNA replication) and gene 41 encodes a DNA helicase, both being required for T4 DNA replication. We conclude that a third repair process operates in phage T4 and suggest that it acts during rather than before or after DNA replication. PMID:3552872

  15. Multiple Group I Introns in the Small-Subunit rDNA of Botryosphaeria dothidea: Implication for Intraspecific Genetic Diversity

    PubMed Central

    Xu, Chao; Wang, Chunsheng; Sun, Xinyao; Zhang, Rong; Gleason, Mark L.; Eiji, Tanaka; Sun, Guangyu

    2013-01-01

    Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU) ribosomal DNA (rDNA) sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF) for encoding the homing endonuclease (HE), whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron) and genotype IV (Bdo.S1199-B) were each found in only one strain, whereas genotype I (Bdo.S1199-A) and genotype II (Bdo.S943 and Bdo.S1506) occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea. PMID:23844098

  16. Complete mtDNA genomes of Filipino ethnolinguistic groups: a melting pot of recent and ancient lineages in the Asia-Pacific region.

    PubMed

    Delfin, Frederick; Min-Shan Ko, Albert; Li, Mingkun; Gunnarsdóttir, Ellen D; Tabbada, Kristina A; Salvador, Jazelyn M; Calacal, Gayvelline C; Sagum, Minerva S; Datar, Francisco A; Padilla, Sabino G; De Ungria, Maria Corazon A; Stoneking, Mark

    2014-02-01

    The Philippines is a strategic point in the Asia-Pacific region for the study of human diversity, history and origins, as it is a cross-road for human migrations and consequently exhibits enormous ethnolinguistic diversity. Following on a previous in-depth study of Y-chromosome variation, here we provide new insights into the maternal genetic history of Filipino ethnolinguistic groups by surveying complete mitochondrial DNA (mtDNA) genomes from a total of 14 groups (11 groups in this study and 3 groups previously published) including previously published mtDNA hypervariable segment (HVS) data from Filipino regional center groups. Comparison of HVS data indicate genetic differences between ethnolinguistic and regional center groups. The complete mtDNA genomes of 14 ethnolinguistic groups reveal genetic aspects consistent with the Y-chromosome, namely: diversity and heterogeneity of groups, no support for a simple dichotomy between Negrito and non-Negrito groups, and different genetic affinities with Asia-Pacific groups that are both ancient and recent. Although some mtDNA haplogroups can be associated with the Austronesian expansion, there are others that associate with South Asia, Near Oceania and Australia that are consistent with a southern migration route for ethnolinguistic group ancestors into the Asia-Pacific, with a timeline that overlaps with the initial colonization of the Asia-Pacific region, the initial colonization of the Philippines and a possible separate post-colonization migration into the Philippine archipelago. PMID:23756438

  17. DNA strand bias in the repair of the p53 gene in normal human and xeroderma pigmentosum group C fibroblasts.

    PubMed

    Evans, M K; Taffe, B G; Harris, C C; Bohr, V A

    1993-11-15

    We have measured the gene-specific and strand-specific DNA repair of UV-induced cyclobutane pyrimidine dimers in the p53 tumor suppressor gene in a normal, repair-proficient human fibroblast strain and in fibroblasts from a patient with the repair deficient disorder xeroderma pigmentosum, complementation xeroderma pigmentosum group C (XP-C). In both cell strains, repair was measured in the p53 gene and in its individual DNA strands. For comparison, the repair also was measured in other genomic regions in these human fibroblast strains, including the housekeeping gene dihydrofolate reductase, and two inactive genomic regions, the delta globin gene, and the 754 locus of the X chromosome. In both cell strains, we find that the p53 gene is repaired faster than the dihydrofolate reductase gene and much more efficiently than the inactive genomic regions. Selective repair of the transcribed DNA strand of p53 is observed in both human cell strains; the strand bias of repair is particularly distinct in XP-C. Mutations specific to the nontranscribed strand may occur due to replication errors at the sites of unrepaired DNA damage. Therefore, our results predict that the majority of mutations in skin cancers, especially those from patients with XP-C, would occur on the nontranscribed strand of the p53 gene. Indeed, Dumasz et al. (Proc. Natl. Acad. Sci. USA, in press, 1993) report such a strand bias of p53 mutation in skin cancers from XP-C patients. PMID:8221675

  18. Comprehensive phylogenetic analysis of bacterial group II intron-encoded ORFs lacking the DNA endonuclease domain reveals new varieties.

    PubMed

    Toro, Nicolás; Martínez-Abarca, Francisco

    2013-01-01

    Group II introns are self-splicing RNAs that act as mobile retroelements in the organelles of plants, fungi and protists. They are also widely distributed in bacteria, and are generally assumed to be the ancestors of nuclear spliceosomal introns. Most bacterial group II introns have a multifunctional intron-encoded protein (IEP) ORF within the ribozyme domain IV (DIV). This ORF encodes an N-terminal reverse transcriptase (RT) domain, followed by a putative RNA-binding domain with RNA splicing or maturase activity and, in some cases, a C-terminal DNA-binding (D) region followed by a DNA endonuclease (En) domain. In this study, we focused on bacterial group II intron ORF phylogenetic classes containing only reverse transcriptase/maturase open reading frames, with no recognizable D/En region (classes A, C, D, E, F and unclassified introns). On the basis of phylogenetic analyses of the maturase domain and its C-terminal extension, which appears to be a signature characteristic of ORF phylogenetic class, with support from the phylogeny inferred from the RT domain, we have revised the proposed new class F, defining new intron ORF varieties. Our results increase knowledge of the lineage of group II introns encoding proteins lacking the En-domain. PMID:23355907

  19. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  20. The electrokinetic characterization of gold nanoparticles, functionalized with cationic functional groups, and its' interaction with DNA.

    PubMed

    Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli

    2014-09-01

    Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery. PMID:25009100

  1. Cockayne syndrome group B protein regulates DNA double-strand break repair and checkpoint activation.

    PubMed

    Batenburg, Nicole L; Thompson, Elizabeth L; Hendrickson, Eric A; Zhu, Xu-Dong

    2015-05-12

    Mutations of CSB account for the majority of Cockayne syndrome (CS), a devastating hereditary disorder characterized by physical impairment, neurological degeneration and segmental premature aging. Here we report the generation of a human CSB-knockout cell line. We find that CSB facilitates HR and represses NHEJ. Loss of CSB or a CS-associated CSB mutation abrogating its ATPase activity impairs the recruitment of BRCA1, RPA and Rad51 proteins to damaged chromatin but promotes the formation of 53BP1-Rif1 damage foci in S and G2 cells. Depletion of 53BP1 rescues the formation of BRCA1 damage foci in CSB-knockout cells. In addition, knockout of CSB impairs the ATM- and Chk2-mediated DNA damage responses, promoting a premature entry into mitosis. Furthermore, we show that CSB accumulates at sites of DNA double-strand breaks (DSBs) in a transcription-dependent manner. The kinetics of DSB-induced chromatin association of CSB is distinct from that of its UV-induced chromatin association. These results reveal novel, important functions of CSB in regulating the DNA DSB repair pathway choice as well as G2/M checkpoint activation. PMID:25820262

  2. Genome-Wide DNA Polymorphisms in Seven Rice Cultivars of Temperate and Tropical Japonica Groups

    PubMed Central

    Arai-Kichise, Yuko; Shiwa, Yuh; Ebana, Kaworu; Shibata-Hatta, Mari; Yoshikawa, Hirofumi; Yano, Masahiro; Wakasa, Kyo

    2014-01-01

    Elucidation of the rice genome is expected to broaden our understanding of genes related to the agronomic characteristics and the genetic relationship among cultivars. In this study, we conducted whole-genome sequencings of 6 cultivars, including 5 temperate japonica cultivars and 1 tropical japonica cultivar (Moroberekan), by using next-generation sequencing (NGS) with Nipponbare genome as a reference. The temperate japonica cultivars contained 2 sake brewing (Yamadanishiki and Gohyakumangoku), 1 landrace (Kameji), and 2 modern cultivars (Koshihikari and Norin 8). Almost >83% of the whole genome sequences of the Nipponbare genome could be covered by sequenced short-reads of each cultivar, including Omachi, which has previously been reported to be a temperate japonica cultivar. Numerous single nucleotide polymorphisms (SNPs), insertions, and deletions were detected among the various cultivars and the Nipponbare genomes. Comparison of SNPs detected in each cultivar suggested that Moroberekan had 5-fold more SNPs than the temperate japonica cultivars. Success of the 2 approaches to improve the efficacy of sequence data by using NGS revealed that sequencing depth was directly related to sequencing coverage of coding DNA sequences: in excess of 30× genome sequencing was required to cover approximately 80% of the genes in the rice genome. Further, the contigs prepared using the assembly of unmapped reads could increase the value of NGS short-reads and, consequently, cover previously unavailable sequences. These approaches facilitated the identification of new genes in coding DNA sequences and the increase of mapping efficiency in different regions. The DNA polymorphism information between the 7 cultivars and Nipponbare are available at NGRC_Rices_Build1.0 (http://www.nodai-genome.org/oryza_sativa_en.html). PMID:24466017

  3. The Evolution of Homing Endonuclease Genes and Group I Introns in Nuclear rDNA

    E-print Network

    Lutzoni, François M.

    paired elements (P1 to P10). These conserved RNA regions catalyze a two-step, self-splicing reaction resulting in intron release and ligation of the exons (Cech 1990). When they self-splice, group I introns to maintain themselves or spread in genomes. If they lose self-splicing ability, group I introns (i

  4. Testing the validity of Northern European species in the Chrysis ignita species group (Hymenoptera: Chrysididae) with DNA barcoding.

    PubMed

    Soon, Villu; Budrys, Eduardas; Orlovskyt?, Svetlana; Paukkunen, Juho; Odegaard, Frode; Ljubomirov, Toshko; Saarma, Urmas

    2014-01-01

    Containing more than a hundred species, the Chrysis ignita species group is the largest and one of the most taxonomically challenging groups in its genus. It has not been possible to resolve the taxonomy of the group using traditional methods due to the lack of robust diagnostic morphological characters. Here we present the results of a molecular analysis designed to delimit species in the Chrysis ignita group for the first time; using mitochondrial sequence data for 364 in-group specimens consisting of all 18 species known to occur in Northern Europe. Two mitochondrial loci were analysed: a COI gene fragment, and a continuous DNA sequence consisting of 16S rRNA, tRNAVal, 12S rRNA and ND4. Two approaches were employed for delimiting species: (1) genetic distance analysis based on the standard COI barcode sequences and; (2) phylogenetic analysis of the COI fragment together with rRNA genes. Both analyses yielded trees with similar topology, but support values for nodes were higher using the second approach. Fifteen species were distinguished in all analyses: Chrysis angustula Schenck, 1856, C. brevitarsis Thomson, 1870, C. clarinicollis Linsenmaier, 1951, C. corusca Valkeila, 1971, C. fulgida Linnaeus, 1761, C. ignita (Linnaeus, 1758), C. impressa Schenck, 1856, C. iris Christ, 1791, C. leptomandibularis Niehuis, 2000, C. longula Abeille de Perrin, 1879, C. ruddii Shuckard, 1837, C. schencki Linsenmaier, 1968, C. subcoriacea Linsenmaier, 1959, C. terminata Dahlbom, 1854 and C. vanlithi Linsenmaier, 1959. The specific status of C. mediata Linsenmaier, 1951 and C. solida Haupt, 1957 was not resolved. Included unidentified specimens grouped in three clusters, two of which are distinctly delimited and apparently represent cryptic species. The specific status of the unidentified samples in the third cluster remained unclear. Moreover, our data suggest the existence of additional cryptic species currently lumped under the names C. pseudobrevitarsis Linsenmaier, 1951 and C. schencki Linsenmaier, 1968. In conclusion, our results derived from analysis of mitochondrial loci strongly support the specific status of the majority of currently recognised species in the Chrysis ignita species group, and suggest the existence of additional cryptic species in Northern Europe. Thus, considering the difficulties that often arise during species determination based on morphological characters, the mtDNA loci used here appear highly suitable for assisting species delimitation in this group as well as identification of specimens.  PMID:24869539

  5. Are clownfish groups composed of close relatives? An analysis of microsatellite DNA variation in Amphiprion percula.

    PubMed

    Buston, Peter M; Bogdanowicz, Steven M; Wong, Alex; Harrison, Richard G

    2007-09-01

    A central question of evolutionary ecology is: why do animals live in groups? Answering this question requires that the costs and benefits of group living are measured from the perspective of each individual in the group. This, in turn, requires that the group's genetic structure is elucidated, because genetic relatedness can modulate the individuals' costs and benefits. The clown anemonefish, Amphiprion percula, lives in groups composed of a breeding pair and zero to four nonbreeders. Both breeders and nonbreeders stand to gain by associating with relatives: breeders might prefer to tolerate nonbreeders that are relatives because there is little chance that relatives will survive to breed elsewhere; nonbreeders might prefer to associate with breeders that are relatives because of the potential to accrue indirect genetic benefits by enhancing anemone and, consequently, breeder fitness. Given the potential benefits of associating with relatives, we use microsatellite loci to investigate whether or not individuals within groups of A. percula are related. We develop seven polymorphic microsatellite loci, with a number of alleles (range 2-24) and an observed level of heterozygosity (mean = 0.5936) sufficient to assess fine-scale genetic structure. The mean coefficient of relatedness among group members is 0.00 +/- 0.10 (n = 9 groups), and there are no surprising patterns in the distribution of pairwise relatedness. We conclude that A. percula live in groups of unrelated individuals. This study lays the foundation for further investigations of behavioural, population and community ecology of anemonefishes which are emerging as model systems for evolutionary ecology in the marine environment. PMID:17845439

  6. Tissue distribution of blood group membrane proteins beyond red cells: evidence from cDNA libraries.

    PubMed

    Rojewski, Markus T; Schrezenmeier, Hubert; Flegel, Willy A

    2006-08-01

    The proteins of blood group systems are expressed on red blood cells (RBC) by definition. We searched nucleotide databases of human expressed sequence tags (EST) to collate the distribution of 22 distinct membrane proteins in cells and tissues other than RBC. The documented blood group genes are: MNS, Rh, Lutheran, Kell, Duffy, Kidd, Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner-Wiener, Kx, Gerbich, Cromer, Knops, Indian, Ok, Raph, John-Milton-Hagen and Gill. The genes were grouped according to their overall and their relative expression in embryo and adults. We describe the distribution of EST in cells, tissues and cell lines with a focus on non-RBC tissues. PMID:16956794

  7. Efficient control of group I intron ribozyme catalysis by DNA constraintsw

    E-print Network

    Silverman, Scott K.

    to control the tertiary structure of the 160-nucleotide P4­P6 RNA domain of the Tetrahymena group I intron For the large RNA target, we chose the 388 nt L-21 ScaI ribozyme form of the Tetrahymena group I intron,8,12 including a 3.8 A° structure of a truncated form of the Tetrahymena ribozyme (containing the P4­P6 and P3­P9

  8. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    PubMed

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants. PMID:25100013

  9. DNA polymerase gene sequences indicate western and forest tent caterpillar viruses form a new taxonomic group within baculoviruses.

    PubMed

    Nielsen, Cydney B; Cooper, Dawn; Short, Steven M; Myers, Judith H; Suttle, Curtis A

    2002-11-01

    Baculoviruses infect larval lepidopterans, and thus have potential value as microbial controls of agricultural and forest pests. Understanding their genetic relatedness and host specificity is relevant to the risk assessment of viral insecticides if non-target impacts are to be avoided. DNA polymerase gene sequences have been demonstrated to be useful for inferring genetic relatedness among dsDNA viruses. We have adopted this approach to examine the relatedness among natural isolates of two uncharacterized caterpillar-infecting baculoviruses, Malacosoma californicum pluviale nucleopolyhedrovirus (McplMNPV) and Malacosoma disstria nucleopolyhedrovirus (MadiMNPV), which infect two closely related host species with little to no cross-infectivity. We designed two degenerate primers (BVP1 and BVP2) based on protein motifs conserved among baculoviruses. McplMNPV and MadiMNPV viral DNA was obtained from naturally infected caterpillars collected from geographically distinct sites in the Southern Gulf Islands and Prince George regions of British Columbia, Canada. Sequencing of 0.9 kb PCR amplicons from six McplMNPV and six MadiMNPV isolates obtained from a total of eight sites, revealed very low nucleotide variation among McplMNPV isolates (99.2-100% nucleotide identity) and among MadiMNPV isolates (98.9-100% nucleotide identity). Greater nucleotide variation was observed between viral isolates from the two different caterpillar species (only 84.7-86.1% nucleotide identity). Both maximum parsimony and maximum likelihood phylogenetic analyses support placement of McplMNPV and MadiMNPV in a clade that is distinct from other groups of baculoviruses. PMID:12507483

  10. Group I introns in small subunit ribosomal DNA of several Phaeosphaeria species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a study of small subunit ribosomal RNA (SSU-rRNA) gene sequences in Phaeosphaeria species, group I introns were found in 9 of 10 P. avenaria f.sp. avenaria (Paa) isolates, 1 of 2 Phaeosphaeria sp. (P-rye) isolates from Polish rye (Sn48-1), 1 Phaeosphaeria sp. from dallis grass (P-dg) (S-93-48) an...

  11. A case of DNA analysis of ABO blood group variant allele A2.

    PubMed

    Mitani, T; Tsujita, H; Kobayashi, T; Yokota, M; Akane, A

    2000-12-01

    The ABO phenotype of a bloodstain (B) on a knife that was used as a weapon in an attempted murder case was found to be different from that of the Peruvian victim's blood (AB). Serological analysis showed that the A-antigenicity was much weaker than B antigenicity, suggesting that the victim's phenotype was A(2)B or A(3)B. So, the ABO genotypes of the knife bloodstain and the victim's blood were determined by DNA analysis. The 261st G deletion, specific to the O(1) allele, was not detected in the specimens by restriction fragment length polymorphism analysis. Also, the 871st A, specific to the A(3) allele, was not found by the allele-specific amplification method. Amplified product length polymorphism and direct sequencing methods finally demonstrated that the typical B sequence was found in one allele and a single C deletion in the 1,059th-1,061st C stretch in the other allele, indicating that the ABO phenotype of the bloodstain and victim's blood were A(2)B. PMID:12935705

  12. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons.

    PubMed

    Tourasse, Nicolas J; Stabell, Fredrik B; Kolstø, Anne-Brit

    2014-11-10

    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron-IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  13. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit

    2014-01-01

    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  14. Mitochondrial DNA diversity in two ethnic groups in southeastern Kenya: perspectives from the northeastern periphery of the Bantu expansion

    PubMed Central

    Batai, Ken; Babrowski, Kara B.; Arroyo, Juan Pablo; Kusimba, Chapurukha M.; Williams, Sloan R.

    2013-01-01

    The Bantu languages are widely distributed throughout sub-Saharan Africa. Genetic research supports linguists and historians who argue that migration played an important role in the spread of this language family, but the genetic data also indicates a more complex process involving substantial gene flow with resident populations. In order to understand the Bantu expansion process in east Africa, mtDNA hypervariable region I variation in 352 individuals from the Taita and Mijikenda ethnic groups was analyzed, and we evaluated the interactions that took place between the Bantu- and non-Bantu-speaking populations in east Africa. The Taita and Mijikenda are Bantu-speaking agropastoralists from southeastern Kenya, at least some of whose ancestors probably migrated into the area as part of Bantu migrations that began around 3,000 BCE. Our analyses indicate that they show some distinctive differences that reflect their unique cultural histories. The Taita are genetically more diverse than the Mijikenda with larger estimates of genetic diversity. The Taita cluster with other east African groups, having high frequencies of haplogroups from that region, while the Mijikenda have high frequencies of central African haplogroups and cluster more closely with central African Bantu-speaking groups. The non-Bantu speakers who lived in southeastern Kenya before Bantu speaking groups arrived were at least partially incorporated into what are now Bantu-speaking Taita groups. In contrast, gene flow from non-Bantu speakers into the Mijikenda was more limited. These results suggest a more complex demographic history where the nature of Bantu and non-Bantu interactions varied throughout the area. PMID:23382080

  15. MtDNA phylogeny and biogeography of Copelatinae, a highly diverse group of tropical diving beetles (Dytiscidae).

    PubMed

    Balke, Michael; Ribera, Ignacio; Vogler, Alfried P

    2004-09-01

    Copelatinae is a diverse lineage of diving beetles (Dytiscidae) frequently encountered in wet tropical and subtropical forests, but phylogenetic relationships are very poorly understood. We performed a phylogenetic and biogeographic analysis of this worldwide distributed group based on 50 species including a representative sample of major taxonomic groups and biogeographical regions. DNA sequences were obtained for the mitochondrial genes cytochrome oxidase I, cytochrome b, and 16S rRNA, for a total of 1575 aligned nucleotide positions. We found Copelatinae to be monophyletic, placed in a derived position and not sister to all remaining dytiscids, as had been suggested by earlier authors. The largest genus, Copelatus with some 460 known species was paraphyletic with respect to the smaller genera Lacconectus and Aglymbus. Among the major lineages of Copelatus, the subgenus Papuadytes was consistently recovered as sister to all other species (including Lacconectus and Aglymbus) with the possible exception of two western Palearctic taxa. We propose that the subgenus Papuadytes is removed from Copelatus and assigned generic status. Likewise, the two western Palearctic Copelatus are removed from this genus, and assigned the available genus name Liopterus. Our best phylogenetic hypothesis retrieved Afrotropical and New Guinean plus Australian species of Copelatus as monophyletic. Asian species were paraphyletic with respect to a species from Sulawesi which grouped with the species from New Guinea. Asian species were also paraphyletic with respect to Oriental Lacconectus, which was grouped with a clade of Neotropical species. Neotropical Copelatus form at least two separate lineages. The biogeographical evolution of Papuadytes is consistent with the relative age of the landmasses in the Austral region. Basal species are Australian, and successively derived ones are from New Caledonia and New Guinea. One species apparently dispersed from New Caledonia to China. Assuming a molecular clock and using a standard calibration of 2% divergence/MY the origin of Copelatinae is estimated to be between 85 and 95 MY. PMID:15288062

  16. Mimicking the First Step of RNA Splicing: An Artificial DNA Enzyme Can Synthesize Branched RNA Using an Oligonucleotide Leaving Group as a

    E-print Network

    Silverman, Scott K.

    Mimicking the First Step of RNA Splicing: An Artificial DNA Enzyme Can Synthesize Branched RNA mimics the first step of natural RNA splicing. The observation of 7S11-catalyzed branch formation with an oligonucleotide leaving group strengthens this resemblance to natural RNA splicing, with the oligonucleotide

  17. DNA conjugation andDNA conjugation and reversibility onreversibility on

    E-print Network

    Rubloff, Gary W.

    DNA conjugation andDNA conjugation and reversibility onreversibility on chitosan surfaceschitosan surfaceschitosan surfaceschitosan surfaces Rubloff Research Group Accomplishments #12;DNA conjugation and reversibility onDNA conjugation and reversibility on chitosan surfaceschitosan surfaces Accomplishment Single

  18. Previously unknown evolutionary groups dominate the ssDNA gokushoviruses in oxic and anoxic waters of a coastal marine environment

    PubMed Central

    Labonté, Jessica M.; Hallam, Steven J.; Suttle, Curtis A.

    2015-01-01

    Metagenomic studies have revealed that ssDNA phages from the family Microviridae subfamily Gokushovirinae are widespread in aquatic ecosystems. It is hypothesized that gokushoviruses occupy specialized niches, resulting in differences among genotypes traversing water column gradients. Here, we use degenerate primers that amplify a fragment of the gene encoding the major capsid protein to examine the diversity of gokushoviruses in Saanich Inlet (SI), a seasonally anoxic fjord on the coast of Vancouver Island, BC, Canada. Amplicon sequencing of samples from the mixed oxic surface (10 m) and deeper anoxic (200 m) layers indicated a diverse assemblage of gokushoviruses, with greater richness at 10 m than 200 m. A comparison of amplicon sequences with sequences selected on the basis of RFLP patterns from eight surface samples collected over a 1-year period revealed that gokushovirus diversity was higher in spring and summer during stratification and lower in fall and winter after deep-water renewal, consistent with seasonal variability within gokushovirus populations. Our results provide persuasive evidence that, while specific gokushovirus genotypes may have a narrow host range, hosts for gokushoviruses in SI consist of a wide range of bacterial taxa. Indeed, phylogenetic analysis of clustered amplicons revealed at least five new phylogenetic groups of previously unknown sequences, with the most abundant group associated with viruses infecting SUP05, a ubiquitous and abundant member of marine oxygen minimum zones. Relatives of SUP05 dominate the anoxic SI waters where they drive coupled carbon, nitrogen, and sulfur transformations along the redoxline; thus, gokushoviruses are likely important mortality agents of these bacteria with concomittant influences on biogeochemical cycling in marine oxygen minimum zones. PMID:25954254

  19. Phylogenetic Evidence for Horizontal Transmission of Group I Introns in the Nuclear Ribosomal DNA of Mushroom-Forming Fungi

    E-print Network

    Hibbett, David S.

    of Mushroom-Forming Fungi David S. Hibbett Harvard University Herbaria, Department of Organismic in the nuclear small-subunit ribosomal DNA (nuc- ssu-rDNA) in several species of homobasidiomycetes (mushroom of intron sequences suggest that the mushroom introns are monophyletic, and are nested within a clade

  20. Spectroscopic study on the interaction of ct-DNA with manganese Salen complex containing triphenyl phosphonium groups

    NASA Astrophysics Data System (ADS)

    Dehkordi, Maryam Nejat; Bordbar, Abdol-Khalegh; Lincoln, Per; Mirkhani, Valiollah

    2012-05-01

    The DNA binding properties of a bulky and hydrophobic Schiff base complex of manganese(III) [N,N'-bis(5-(triphenyl phosphonium methyl)salicylidene)-1,2-ethylene diamine chloride Mn(III) acetate] was examined by spectroscopic techniques. UV-vis titration data indicate both hypo and hyperchromic effect with addition of DNA to complex. A competitive binding study showed that the enhanced emission intensity of ethidium bromide (EB) in the presence of DNA was quenched by adding Mn Salen complex. This finding indicates that Mn Salen complex displaces EB from its binding site in DNA. Helix melting studies indicate improvement in the helix stability, and an increase in the melting temperature. The analysis of CD spectra represents the structural changes in DNA due to the binding of Mn Salen complex. The binding constant has been calculated using absorbance and fluorescence data. The results also represent that the binding process proceeds by strong electrostatic and hydrophobic interactions.

  1. Identification of a group of cryptic marine limpet species, Cellana karachiensis (Mollusca: Patellogastropoda) off Veraval coast, India, using mtDNA COI sequencing.

    PubMed

    Joseph, Sneha; Poriya, Paresh; Vakani, Bhavik; Singh, S P; Kundu, Rahul

    2016-03-01

    Present communication reports the phylogenetic relationship between three groups of a marine limpet having different color banding patterns using COI sequencing. Samples were sequenced for mtDNA COI gene using universal primer. Comparative BLAST revealed that all three types were around 99.59% identical with Cellana karachiensis, first record of this species from Indian coasts. Apart from the morphological variations, the mtDNA COI gene analysis revealed around 1% nucleotide variations between these three types. The observed dissimilarity in COI sequences was possibly too little to consider these types as three different species. The derivation of amino acid positions indicated that these types could possibly be a complex of three cryptic species of C. karachiensis. The study proposes that the Oman and Indian populations of C. karachiensis might have derived by allopatric speciation due to geographical isolation. The group of these three cryptic species, sharing same habitat between themselves, possibly showed sympatric speciation. PMID:25109628

  2. Structure-function relationships in human testis-determining factor SRY: an aromatic buttress underlies the specific DNA-bending surface of a high mobility group (HMG) box.

    PubMed

    Racca, Joseph D; Chen, Yen-Shan; Maloy, James D; Wickramasinghe, Nalinda; Phillips, Nelson B; Weiss, Michael A

    2014-11-21

    Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic "buttress" beneath its specific DNA-bending surface. PMID:25258310

  3. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  4. Identification, molecular characterization, and evolution of group I introns at the expansion segment D11 of 28S rDNA in Rhizoctonia species.

    PubMed

    González, Dolores

    2013-09-01

    The nuclear ribosomal DNA of Rhizoctonia species is polymorphic in terms of the nucleotide composition and length. Insertions of 349-410 nucleotides in length with characteristics of group I introns were detected at a single insertion point at the expansion segment D11 of 28S rDNA in 12 out of 64 isolates. Eleven corresponded to Rhizoctonia solani (teleomorph: Thanatephorous) and one (AG-Q) to Rhizoctonia spp. (teleomorph: Ceratobasidium). Sequence data showed that all but AG-Q contained conserved DNA catalytic core regions (P, Q, R, and S) essential for selfsplicing. The predicted secondary structure revealed that base-paired helices corresponded to subgroup IC1. Isolates from same anastomosis group and even subgroups within R. solani were variable with regard to possession of introns. Phylogenetic analyses indicated that introns were vertically transmitted. Unfortunately, sequence data from the conserved region from all 64 isolates were not useful for delimiting species. Analyses with IC1 introns at same insertion point, of both Ascomycota and Basidiomycota indicated the possibility of horizontal transfer at this site. The present study uncovered new questions on evolutionary pattern of change of these introns within Rhizoctonia species. PMID:24012302

  5. DNA Barcoding of Rhodiola (Crassulaceae): A Case Study on a Group of Recently Diversified Medicinal Plants from the Qinghai-Tibetan Plateau

    PubMed Central

    Zhang, Jian-Qiang; Meng, Shi-Yong; Wen, Jun; Rao, Guang-Yuan

    2015-01-01

    DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences — rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS) — for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau. PMID:25774915

  6. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing

    PubMed Central

    Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R.; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M.

    2013-01-01

    Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility (“retrohoming”) by a process that requires reverse transcription of a highly structured, 2–2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3? ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications. PMID:23697550

  7. European Mitochondrial DNA Haplogroups and Metabolic Changes during Antiretroviral Therapy in AIDS Clinical Trials Group Study A5142

    PubMed Central

    Hulgan, Todd; Haubrich, Richard; Riddler, Sharon A.; Tebas, Pablo; Ritchie, Marylyn D.; McComsey, Grace A.; Haas, David W.; Canter, Jeffrey A.

    2010-01-01

    Background Mitochondrial DNA (mtDNA) influences metabolic diseases and perhaps antiretroviral therapy (ART) complications. We explored associations between European mtDNA haplogroups and metabolic changes among A5142 participants. Methods 757 ART-naïve subjects were randomized to one of three class-sparing ART regimens including efavirenz and/or lopinavir/ritonavir with or without nucleoside reverse transcriptase inhibitors (NRTIs). Non-randomized NRTIs included stavudine, tenofovir, or zidovudine, each with lamivudine. Fasting lipid profiles and whole-body dual-energy X-ray absorptiometry (DEXA) were performed. Nine European mtDNA haplogroups were determined for 231 self-identified non-Hispanic white subjects. Metabolic changes from baseline to 96 weeks were analyzed by haplogroup. Results Median age was 39 years, 9% were female, and 37%, 32%, and 30% were randomized to NRTI-containing regimens with either efavirenz or lopinavir/ritonavir, and an NRTI-sparing regimen respectively. Among NRTI-containing regimens, 51% included zidovudine, 28% tenofovir, and 21% stavudine. Compared with other haplogroups, mtDNA haplogroup I (N=10) had higher baseline non-HDL cholesterol (160 mg/dL [interquartile range 137–171] vs. 120 mg/dL [104–136]; p=0.005), a decrease in non-HDL cholesterol over 96 weeks (?14% [?20-+6] vs. +25% [+8-+51]; p<0.001), tended to have more baseline extremity fat, and had more extremity fat loss by DEXA (?13% [?31-+12] vs. +9% [?13-+26]; p=0.08) and lipoatrophy (50% vs. 20%; p=0.04). Haplogroup W (N=5; all randomized to NRTI-sparing regimens) had the greatest increase in extremity fat (+35.5% [+26.8 - +54.9]; P=0.02). Conclusions Lipids and extremity fat were associated with European mtDNA haplogroups in this HIV-infected population. These preliminary results suggest that mitochondrial genomics may influence metabolic parameters before and during ART. PMID:20871389

  8. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    PubMed

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year. PMID:15912930

  9. Ancient DNA from Hunter-Gatherer and Farmer Groups from Northern Spain Supports a Random Dispersion Model for the Neolithic Expansion into Europe

    PubMed Central

    Hervella, Montserrat; Izagirre, Neskuts; Alonso, Santos; Fregel, Rosa; Alonso, Antonio; Cabrera, Vicente M.; de la Rúa, Concepción

    2012-01-01

    Background/Principal Findings The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. Methodology/Significance Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria). In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples) and replication of the results (43% of the samples) by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. Conclusion The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study) suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different impact on the various geographic regions, and thus contradicts the more simplistic total acculturation and replacement models proposed so far to explain Neolithisation. PMID:22563371

  10. HPV E6/E7 mRNA versus HPV DNA biomarker in cervical cancer screening of a group of Macedonian women.

    PubMed

    Duvlis, Sotirija; Popovska-Jankovic, Katerina; Arsova, Zorica Sarafinovska; Memeti, Shaban; Popeska, Zaneta; Plaseska-Karanfilska, Dijana

    2015-09-01

    High risk types of human papillomaviruses E6/E7 oncogenes and their association with tumor suppressor genes products are the key factors of cervical carcinogenesis. This study proposed them as specific markers for cervical dysplasia screening. The aim of the study is to compare the clinical and prognostic significance of HPV E6/E7 mRNA as an early biomarker versus HPV DNA detection and cytology in triage of woman for cervical cancer. The study group consists of 413 women: 258 NILM, 26 ASC-US, 81 LSIL, 41 HSIL, and 7 unsatisfactory cytology. HPV4AACE screening, real-time multiplex PCR and MY09/11 consensus PCR primers methods were used for the HPV DNA detection. The real-time multiplex nucleic acid sequence-based assay (NucliSENS EasyQ HPV assay) was used for HPV E6/E7 mRNA detection of the five most common high risk HPV types in cervical cancer (16, 18, 31, 33, and 45). The results show that HPV E6/E7 mRNA testing had a higher specificity 50% (95% CI 32-67) and positive predictive value (PPV) 62% (95% CI 46-76) for CIN2+ compared to HPV DNA testing that had specificity of 18% (95% CI 7-37) and PPV 52% (95% CI 39-76) respectively. The higher specificity and PPV of HPV E6/E7 mRNA testing are valuable in predicting insignificant HPV DNA infection among cases with borderline cytological finding. It can help in avoiding aggressive procedures (biopsies and over-referral of transient HPV infections) as well as lowering patient's anxiety and follow up period. PMID:25880030

  11. Divergent Histories of rDNA Group I Introns in the Lichen Family Physciaceae Dawn Simon,1

    E-print Network

    Bhattacharya, Debashish

    essential for self-splicing (Kruger et al. 1982; Cech 1985). The conserved RNA elements are readily aligned a phylogenetic approach with a large data set (including 62 novel large subunit [LSU] rRNA group I introns rRNA, which can support the insertion and/or retention of group I introns. In contrast, we suggest

  12. MtDNA Haplogroup A10 Lineages in Bronze Age Samples Suggest That Ancient Autochthonous Human Groups Contributed to the Specificity of the Indigenous West Siberian Population

    PubMed Central

    Pilipenko, Aleksandr S.; Trapezov, Rostislav O.; Zhuravlev, Anton A.; Molodin, Vyacheslav I.; Romaschenko, Aida G.

    2015-01-01

    Background The craniometric specificity of the indigenous West Siberian human populations cannot be completely explained by the genetic interactions of the western and eastern Eurasian groups recorded in the archaeology of the area from the beginning of the 2nd millennium BC. Anthropologists have proposed another probable explanation: contribution to the genetic structure of West Siberian indigenous populations by ancient human groups, which separated from western and eastern Eurasian populations before the final formation of their phenotypic and genetic features and evolved independently in the region over a long period of time. This hypothesis remains untested. From the genetic point of view, it could be confirmed by the presence in the gene pool of indigenous populations of autochthonous components that evolved in the region over long time periods. The detection of such components, particularly in the mtDNA gene pool, is crucial for further clarification of early regional genetic history. Results and Conclusion We present the results of analysis of mtDNA samples (n = 10) belonging to the A10 haplogroup, from Bronze Age populations of West Siberian forest-steppe (V—I millennium BC), that were identified in a screening study of a large diachronic sample (n = 96). A10 lineages, which are very rare in modern Eurasian populations, were found in all the Bronze Age groups under study. Data on the A10 lineages’ phylogeny and phylogeography in ancient West Siberian and modern Eurasian populations suggest that A10 haplogroup underwent a long-term evolution in West Siberia or arose there autochthonously; thus, the presence of A10 lineages indicates the possible contribution of early autochthonous human groups to the genetic specificity of modern populations, in addition to contributions of later interactions of western and eastern Eurasian populations. PMID:25950581

  13. Elevated levels of STAT1 in Fanconi anemia group A lymphoblasts correlate with the cells' sensitivity to DNA interstrand crosslinking drugs.

    PubMed

    Prieto-Remón, Inés; Sánchez-Carrera, Dámaso; López-Duarte, Mónica; Richard, Carlos; Pipaón, Carlos

    2013-05-01

    Progressive bone marrow failure starting in the first decade of life is one of the main characteristics of Fanconi anemia. Along with the bone marrow failure, this pathology is characterized by congenital malformations, endocrine dysfunction and an extraordinary predisposition to develop cancer. The fact that hematopoietic progenitor cells from subjects with Fanconi anemia are sensitive to both DNA-interstrand crosslinking agents and inflammatory cytokines, which are aberrantly overproduced in these patients, has led to different explanations for the causes of the bone marrow failure. We analyzed STAT1 expression in lymphoblastoid cell lines derived from patients with Fanconi anemia group A and correlated this with aspects of the Fanconi anemia phenotype such as sensitivity to genotoxic agents or to inhibitory cytokines. We provide evidence of overexpression of STAT1 in FANCA-deficient cells which has both transcriptional and post-translational components, and is related to the constitutive activation of ERK in Fanconi anemia group A cells, since it can be reverted by treatment with U0126. STAT1 phosphorylation was not defective in the lymphoblasts, so these cells accumulated higher levels of active STAT1 in response to interferon gamma, probably in relation to their greater sensitivity to this cytokine. On the other hand, inhibition of STAT1 by genetic or chemical means reverted the hypersensitivity of Fanconi anemia group A lymphoblasts to DNA interstrand crosslinking agents. Our data provide an explanation for the mixed sensitivity of Fanconi anemia group A cells to both genotoxic stress and inflammatory cytokines and indicate new targets for the treatment of bone marrow failure in these patients. PMID:23585528

  14. RecQ4 facilitates UV light-induced DNA damage repair through interaction with nucleotide excision repair factor xeroderma pigmentosum group A (XPA).

    PubMed

    Fan, Wei; Luo, Jianyuan

    2008-10-24

    Mutations in the RECQL4 helicase gene have been linked to Rothmund-Thomson syndrome, which is characterized by genome instability, cancer susceptibility, and premature aging. To better define the cellular function of the RecQ4 protein, we investigated the subcellular localization of RecQ4 upon treatment of cells with different DNA-damaging agents including UV irradiation, 4-nitroquinoline 1-oxide, camptothecin, etoposide, hydroxyurea, and H(2)O(2). We found that RecQ4 formed discrete nuclear foci specifically in response to UV irradiation and 4-nitroquinoline 1-oxide. We demonstrated that functional RecQ4 was required for the efficient removal of UV lesions and could rescue UV sensitivity of RecQ4-deficient Rothmund-Thomson syndrome cells. Furthermore, UV treatment also resulted in the colocalization of the nuclear foci formed with RecQ4 and xeroderma pigmentosum group A in human cells. Consistently, RecQ4 could directly interact with xeroderma pigmentosum group A, and this interaction was stimulated by UV irradiation. By fractionating whole cell extracts into cytoplasmic, soluble nuclear, and chromatin-bound fractions, we observed that RecQ4 protein bound more tightly to chromatin upon UV irradiation. Taken together, our findings suggest a role of RecQ4 in the repair of UV-induced DNA damages in human cells. PMID:18693251

  15. Sperm DNA oxidative damage and DNA adducts.

    PubMed

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-12-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm. PMID:26653986

  16. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  17. Phylogenetic analysis of LSU and SSU rDNA group I introns of lichen photobionts associated with the genera Xanthoria and Xanthomendoza (Teloschistaceae, lichenized Ascomycetes)

    PubMed Central

    Nyati, Shyam; Bhattacharya, Debashish; Werth, Silke; Honegger, Rosmarie

    2013-01-01

    We studied group I introns in sterile cultures of selected groups of lichen photobionts, focusing on Trebouxia species associated with Xanthoria s. lat. (including Xanthomendoza spp.; lichen-forming ascomycetes). Group I introns were found inserted after position 798 (Escherichia coli numbering) in the large subunit (LSU) rRNA in representatives of the green algal genera Trebouxia and Asterochloris. The 798 intron was found in about 25% of Xanthoria photobionts including several reference strains obtained from algal culture collections. An alignment of LSU-encoded rDNA intron sequences revealed high similarity of these sequences allowing their phylogenetic analysis. The 798 group I intron phylogeny was largely congruent with a phylogeny of the Internal Transcribed Spacer Region (ITS), indicating that the insertion of the intron most likely occurred in the common ancestor of the genera Trebouxia and Asterochloris. The intron was vertically inherited in some taxa, but lost in others. The high sequence similarity of this intron to one found in Chlorella angustoellipsoidea suggests that the 798 intron was either present in the common ancestor of Trebouxiophyceae, or that its present distribution results from more recent horizontal transfers, followed by vertical inheritance and loss. Analysis of another group I intron shared by these photobionts at small subunit (SSU) position 1512 supports the hypothesis of repeated lateral transfers of this intron among some taxa, but loss among others. Our data confirm that the history of group I introns is characterized by repeated horizontal transfers, and suggests that some of these introns have ancient origins within Chlorophyta. PMID:24415800

  18. DNA evidence on the phylogenetic systematics of New World monkeys: support for the sister-grouping of Cebus and Saimiri from two unlinked nuclear genes.

    PubMed

    Harada, M L; Schneider, H; Schneider, M P; Sampaio, I; Czelusniak, J; Goodman, M

    1995-09-01

    Previous inferences from epsilon-globin gene sequences on cladistic relationships among the 16 extant genera of Ceboidea (the New World monkeys) were tested by strength of grouping and bootstrap values for the clades in the most parsimonious trees found: for this epsilon data set enlarged with additional Cebus and Saimiri orthologues; for another nuclear DNA sequence data set consisting of IRBP (interstitial retinol-binding protein gene) intron 1 orthologues; and for tandemly combined epsilon and IRBP sequences. Different ceboid species of the same genus always grouped strongly together as demonstrated by results on Cebus (capuchin monkeys), Saimiri (squirrel monkeys), Callicebus (titi monkeys), Aotus (night monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys). Other strong groupings that could be represented as monophyletic taxa in a cladistic classification were: Cebuella (pygmy marmoset) and Callithrix (marmoset) into subtribe Callitrichina; Callitrichina, Callimico (Goeldi's monkey), Leontopithecus (lion tamarin), and Saguinus (tamarin) into subfamily Callitrichinae; Callitrichinae, Aotus, Cebus, and Saimiri into family Cebidae; Cacajao (uakari monkey) and Chiropotes (saki) into subtribe Chiropotina; Chiropotina and Pithecia (bearded saki) into tribe Pitheciini; Pitheciini and Callicebus into subfamily Pitheciinae; Brachyteles (woolly spider monkey), Lagothrix (woolly monkey), and Ateles into tribe Atelini; and Atelini and Alouatta into subfamily Atelinae. In addition the epsilon and IRBP results congruently grouped (but at lesser strengths) Brachyteles and Lagothrix into subtribe Brachytelina within Atelini, and also Cebus and Saimiri into subfamily Cebinae within Cebidae. Because the IRBP results weakly grouped Pitheciinae with Cebidae, whereas the epsilon results weakly grouped Pitheciinae with Atelinae, the present evidence is best represented in an interim cladistic classification of ceboids by dividing the superfamily Ceboidea into three families: Atelidae, Pitheciidae, and Cebidae. PMID:8845968

  19. DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rhizoctonia blight (sensu lato) is a common and serious disease of many turfgrass species. The most widespread causal agent, R. solani, consists of several genetically different subpopulations. Though hyphal anastomosis reactions have been used to group Rhizoctonia species, they are time consuming a...

  20. Synthesis and structure of a new tetracopper(II) complex bridged both by oxamido and phenolato groups: Cytotoxic activity, and reactivity towards DNA and BSA

    NASA Astrophysics Data System (ADS)

    Xu, Xiao-Wen; Li, Xue-Jie; Zhan, Shu-Hui; Li, Yan-Tuan; Wu, Zhi-Yong; Yan, Cui-Wei

    2013-05-01

    A new tetracopper(II) complex bridged both by oxamido and phenolato groups, namely [Cu4(chmpoxd)2(dabt)2](ClO4)2, where H3chmpoxd and dabt stand for N-(5-chloro-2-hydroxyl-phenyl)-N'-[3-(methylamino)propyl]oxamide and 2,2'-diamino-4,4'-bithiazole, respectively, has been synthesized and characterized by elemental analyses, molar conductance measurements, IR and electronic spectra studies, and single-crystal X-ray diffraction. The crystal structure reveals a centrosymmetric circular tetranuclear cation [Cu4(chmpoxd)2(dabt)2]2+ assembled by a pair of cis-oxamido-bridged bicopper(II) units via ?2-phenolato bridges, in which one copper(II) atom is located in a slightly distorted square-planar environment, while the other is in a square-pyramidal geometry. The Cu⋯Cu separations through the oxamido and the phenolato bridges are 5.2217(12) and 3.7042(11) Å, respectively. In vitro cytotoxicity experiment shows that the tetracopper(II) complex exhibits cytotoxic activity against the SMMC7721 and A549 cell lines. The reactivities towards HS-DNA and protein BSA revealed that the tetracopper(II) complex can interact with HS-DNA in the mode of intercalation, and the complex binds to BSA responsible for quenching of tryptophan fluorescence by static quenching mechanism.

  1. Search for human DNA topoisomerase II poisons in the group of 2,5-disubstituted-1,3,4-thiadiazoles.

    PubMed

    Plech, Tomasz; Kapro?, Barbara; Paneth, Agata; Wujec, Monika; Czarnomysy, Robert; Bielawska, Anna; Bielawski, Krzysztof; Trotsko, Nazar; Ku?mierz, Edyta; Paneth, Piotr

    2015-12-01

    A series of six 2,5-disubstituted 1,3,4-thiadiazole derivatives was synthesized and examined for cytotoxic activity in MCF-7 and MDA-MB-231 breast cancer cells. MTT assay confirmed that 2-(3-fluorophenylamino)-5-(3-hydroxyphenyl)-1,3,4-thiadiazole (2), 2-(4-bromophenylamino)-5-(2,4-dichlorophenyl)-1,3,4-thiadiazole (3), 2-(4-fluorophenylamino)-5-(2,4-dichlorophenyl)-1,3,4-thiadiazole (4), had ability to inhibit MCF-7 and MDA-MB-231 cells proliferation. The IC50 values for the mentioned compounds ranged between 120 and 160??M (with respect to MCF-7 cells) and from 70 to 170??M (with respect to MDA-MB-231 cells). It turned out, moreover, that compound 2 is a human topoisomerase II (topoII) catalytic inhibitor whereas the two other compounds (i.e. 3 and 4) are capable of stabilizing DNA-topoII cleavage complex and thus are topoII poisons. PMID:25792499

  2. The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics

    PubMed Central

    Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit

    2004-01-01

    Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ?155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

  3. Risk factors for cervical presence of human papillomavirus DNA among women at risk for HIV infection. DIANAIDS Collaborative Study Group.

    PubMed Central

    Rezza, G.; Giuliani, M.; Serraino, D.; Branca, M.; Benedetto, A.; Garbuglia, A.; Ippolito, G.; Franceschi, S.

    1998-01-01

    Risk factors for cervical infection with human papillomavirus (HPV) were assessed among 236 Italian women at risk for human immunodeficiency virus (HIV) infection (intravenous drug users (IVDU) or sexual partners of males at risk for HIV infection). All study participants underwent a structured interview, determination of HIV serostatus and detection of HPV cervical infection by means of polymerase chain reaction (PCR). Overall, the cervical presence of HPV DNA was ascertained in 86 of these 236 women (36.4%), while squamous intraepithelial lesions (SIL) were diagnosed in 57 (24.1%). HPV-infected and non-infected women did not differ in age, education and cigarette smoking. A statistically significant trend in the risk of HPV infection with increasing number of lifetime sexual partners was noted (P = 0.01), but such trend was attenuated in multivariate analysis (multiple logistic regression (MLR) odds ratio (OR) for > or = 20 partners vs 1 = 1.6, 95% confidence intervals (CI): 0.4-5.9). A nearly threefold higher risk of HPV cervical infection emerged among IVDU women (MLR-OR: 2.7, 95% CI: 1.4-5.0), and this difference was not influenced by HIV serostatus. The prevalence of HIV infection was higher among HPV-positive than HPV-negative women (62.8% and 54.0%, respectively) (MLR-OR = 1.9, 95% CI: 0.9-3.8), and the proportion of women with less than 200 CD4+ cells/mm3 was slightly and not significantly higher among HPV-positive (47.1%) than negative women (37.2%). PMID:9747769

  4. Molecular cloning, sequence, and expression of a human GDP-L-fucose:. beta. -D-galactoside 2-. alpha. -L-fucosyltransferase cDNA that can form the H blood group antigen

    SciTech Connect

    Larsen, R.D.; Ernst, L.K.; Nair, R.P.; Lowe, J.B. )

    1990-09-01

    The authors have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:{beta}D-galactoside 2-{alpha}-L-fucosyltransferase. Although this fragment determined expression of an {alpha}(1,2)FT whose kinetic properties mirror those of the human H blood group {alpha}(1,2)FT, their precise nature remained undefined. They describe here the molecular cloning, sequence, and expression of a human of cDNA corresponding to these human genomic sequences. When expressed in COS-1 cells, the cDNA directs expression of cell surface H structures and a cognate {alpha}(1,2)FT activity with properties analogous to the human H blood group {alpha}(1,2)FT. The cDNA sequence predicts a 365-amino acid polypeptide characteristic of a type II transmembrane glycoprotein with a domain structure analogous to that of other glycosyltransferases but without significant primary sequence similarity to these or other known proteins. To directly demonstrate that the cDNA encodes an {alpha}(1,2)FT, the COOH-terminal domain predicted to be Golgi-resident was expressed in COS-1 cells as a catalytically active, secreted, and soluble protein A fusion peptide. Southern blot analysis showed that this cDNA identified DNA sequences syntenic to the human H locus on chromosome 19. These results strongly suggest that this cloned {alpha}(1,2)FT cDNA represents the product of the human H blood group locus.

  5. EDITORIAL: DNA melting DNA melting

    NASA Astrophysics Data System (ADS)

    Blossey, Ralf

    2009-01-01

    DNA melting is an old topic: the fact that the dissociation of the DNA double-strand is a thermodynamic equilibrium phase transition dates back to the mid-1950s [1, 2]. There have been periods of intense interest in the topic throughout the years, in particular in the 1960s in the context of the theory of phase transitions. The development still continues. On the theory side, models of quite different character have been developed (the Poland-Scheraga model, Peyrard-Bishop-Dauxois model, etc) to study the equilibrium transition and also its dynamics. Recent advances both in biology and the nanosciences have added new twists to this field, warranting a special issue on the topic. The papers collected in this issue can roughly be grouped into three main topics: the DNA denaturation transition—the reader will find papers on this topic that address issues that are still unresolved, like the physics of denaturation bubbles and the dynamics of DNA melting, and also model improvements and new experimental findings; applications of DNA melting to biology, relating melting signatures to biologically relevant, sequence-dependent features of DNA; artificial DNA constructs and single-molecule methods to study DNA denaturation. The collected papers give a broad view of the field at the forefront of the newest research. I hope they will also convince the uninitiated reader that important questions are being addressed which might even provide unexpected answers relevant to biology. References [1] Thomas R 1953 Bull. Soc. Chim. Biol. 35 609 [2] Thomas R 1954 Biochim. Biophys. Acta 14 23

  6. SOXE transcription factors form selective dimers on non-compact DNA motifs through multifaceted interactions between dimerization and high-mobility group domains

    PubMed Central

    Huang, Yong-Heng; Jankowski, Aleksander; Cheah, Kathryn S. E.; Prabhakar, Shyam; Jauch, Ralf

    2015-01-01

    The SOXE transcription factors SOX8, SOX9 and SOX10 are master regulators of mammalian development directing sex determination, gliogenesis, pancreas specification and neural crest development. We identified a set of palindromic SOX binding sites specifically enriched in regulatory regions of melanoma cells. SOXE proteins homodimerize on these sequences with high cooperativity. In contrast to other transcription factor dimers, which are typically rigidly spaced, SOXE group proteins can bind cooperatively at a wide range of dimer spacings. Using truncated forms of SOXE proteins, we show that a single dimerization (DIM) domain, that precedes the DNA binding high mobility group (HMG) domain, is sufficient for dimer formation, suggesting that DIM?:?HMG rather than DIM:DIM interactions mediate the dimerization. All SOXE members can also heterodimerize in this fashion, whereas SOXE heterodimers with SOX2, SOX4, SOX6 and SOX18 are not supported. We propose a structural model where SOXE-specific intramolecular DIM:HMG interactions are allosterically communicated to the HMG of juxtaposed molecules. Collectively, SOXE factors evolved a unique mode to combinatorially regulate their target genes that relies on a multifaceted interplay between the HMG and DIM domains. This property potentially extends further the diversity of target genes and cell-specific functions that are regulated by SOXE proteins. PMID:26013289

  7. Composition and interrelationships of a large Neotropical freshwater fish group, the subfamily Cheirodontinae (Characiformes: Characidae): a case study based on mitochondrial and nuclear DNA sequences.

    PubMed

    Mariguela, T C; Ortí, G; Avelino, G S; Abe, K T; Oliveira, C

    2013-07-01

    Characidae is the most species-rich family of freshwater fishes in the order Characiformes, with more than 1000 valid species that correspond to approximately 55% of the order. Few hypotheses about the composition and internal relationships within this family are available and most fail to reach an agreement. Among Characidae, Cheirodontinae is an emblematic group that includes 18 genera (1 fossil) and approximately 60 described species distributed throughout the Neotropical region. The taxonomic and systematic history of Cheirodontinae is complex, and only two hypotheses about the internal relationships in this subfamily have been reported to date. In the present study, we test the composition and relationships of fishes assigned to Cheirodontinae based on a broad taxonomic sample that also includes some characid incertae sedis taxa that were previously considered to be part of Cheirodontinae. We present phylogenetic analyses of a large molecular dataset of mitochondrial and nuclear DNA sequences. Our results reject the monophyly of Cheirodontinae as previously conceived, as well as the tribes Cheirodontini and Compsurini, and the genera Cheirodon, Compsura, Leptagoniates, Macropsobrycon, Odontostilbe, and Serrapinnus. On the basis of these results we propose: (1) the exclusion of Amazonspinther and Spintherobolus from the subfamily Cheirodontinae since they are the sister-group of all remaining Characidae; (2) the removal of Macropsobrycon xinguensis of the genus Macropsobrycon; (3) the removal of Leptagoniates pi of the genus Leptagoniates; (4) the inclusion of Leptagoniates pi in the subfamily Cheirodontinae; (5) the removal of Cheirodon stenodon of the genus Cheirodon and its inclusion in the subfamily Cheirodontinae under a new genus name; (6) the need to revise the polyphyletic genera Compsura, Odontostilbe, and Serrapinnus; and (7) the division of Cheirodontinae in three newly defined monophyletic tribes: Cheirodontini, Compsurini, and Pseudocheirodontini. Our results suggest that our knowledge about the largest Neotropical fish family, Characidae, still is incipient. PMID:23541838

  8. A novel trimeric Zn (II) complex based on 8-hydroxyquinoline with trifluoromethylbenzene group: Synthesis, crystal structure, photophysical properties and DNA binding

    NASA Astrophysics Data System (ADS)

    Huo, Yanping; Wang, Chunquan; Lu, Jiguo; Hu, Sheng; Li, Xiaoyang; Zhang, Li

    2015-10-01

    A novel 2-substituted-8-hydroxyquinoline ligand (E)-2-[2-(4-trifluoromethylphenyl)ethenyl]-8-hydroxyquinoline (3, HL) was synthesized and characterized by ESI-MS, NMR spectroscopy and elemental analysis. Using solvothermal method, a trimeric complex [Zn3L6] (4) was fabricated by self-assembly of Zn(II) ions with 3. X-ray structural analysis shows that 4 exhibits a trinuclear core, which was bridged and encapsulated by six 8-hydroxyquinolinate-based ligands. The supramolecular structure of 4 features a lamellar solid constructed by aromatic stacking interactions and nonclassical C-H···F hydrogen bonds derived from 4-trifluoromethylphenyl group of the 3. The coordination behavior of zinc salt and 3 in solution was performed by 1H NMR, UV-vis and Photoluminescence (PL). The experimental results show that the complex 4 emits yellow luminescence in the solid state. To investigate its properties further, we also studied the thermal stability, photophysical properties (fluorescent emission, lifetime) of complex 4, and the interactions between 4 and C60 or EtBr-DNA system.

  9. Nanotechnology with DNA DNA Nanodevices

    E-print Network

    Ludwig-Maximilians-Universität, München

    Nanotechnology with DNA DNA Nanodevices Friedrich C. Simmel* and Wendy U. Dittmer A DNA actuator. Introduction.............285 2. Overview: DNA Nanotechnology.......285 3. Prototypes of Nanomechanical DNA overview of DNA nanotechnology as a whole is given. The most important properties of DNA molecules

  10. DNA microarray (spot) .

    E-print Network

    1. DNA microarray DNA (spot) . DNA probe , probe (hybridization) . DNA microarray cDNA oligonucleotide oligonucleotide cDNA probe . oligonucleotide microarray , DNA , probe . oligonucleotide microarray probe

  11. Macronuclei and micronuclei in Tetrahymena thermophila contain high-mobility-group-like chromosomal proteins containing a highly conserved eleven-amino-acid putative DNA-binding sequence.

    PubMed Central

    Schulman, I G; Wang, T; Wu, M; Bowen, J; Cook, R G; Gorovsky, M A; Allis, C D

    1991-01-01

    HMG (high-mobility-group protein) B and HMG C are abundant nonhistone chromosomal proteins isolated from Tetrahymena thermophila macronuclei with solubilities, molecular weights, and amino acid compositions like those of vertebrate HMG proteins. Genomic clones encoding each of these proteins have been sequenced. Both are single-copy genes that encode single polyadenylated messages whose amounts are 10 to 15 times greater in growing cells than in starved, nongrowing cells. The derived amino acid sequences of HMG B and HMG C contain a highly conserved sequence, the HMG 1 box, found in vertebrate HMGs 1 and 2, and we speculate that this sequence may represent a novel, previously unrecognized DNA-binding motif in this class of chromosomal proteins. Like HMGs 1 and 2, HMGs B and C contain a high percentage of aromatic amino acids. However, the Tetrahymena HMGs are small, are associated with nucleosome core particles, and can be specifically extracted from macronuclei by elutive intercalation, properties associated with vertebrate HMGs 14 and 17, not HMGs 1 and 2. Thus, it appears that these Tetrahymena proteins have features in common with both of the major subgroups of higher eucaryotic HMG proteins. Surprisingly, a linker histone found exclusively in transcriptionally inactive micronuclei also has several HMG-like characteristics, including the ability to be specifically extracted from nuclei by elutive intercalation and the presence of the HMG 1 box. This finding suggests that at least in T. thermophila, proteins with HMG-like properties are not restricted to regions of transcriptionally active chromatin. Images PMID:1986218

  12. Phosphorus-nitrogen compounds: Part 28. Syntheses, structural characterizations, antimicrobial and cytotoxic activities, and DNA interactions of new phosphazenes bearing vanillinato and pendant ferrocenyl groups

    NASA Astrophysics Data System (ADS)

    Tümer, Yasemin; Asmafiliz, Nuran; K?l?ç, Zeynel; Hökelek, Tuncer; Yasemin Koç, L.; Aç?k, Leyla; Yola, Mehmet Lütfi; Solak, Ali Osman; Öner, Ya?mur; Dündar, Devrim; Yavuz, Makbule

    2013-10-01

    The gradually Cl replacement reactions of spirocyclic mono (1 and 2) and bisferrocenyl cyclotriphosphazenes (3-5) with the potassium salt of 4-hydroxy-3-methoxybenzaldehyde (potassium vanillinate) gave mono (1a-5a), geminal (gem-1b-5b), non-geminal (cis-1b, cis-5b and trans-2b-5b), tri (1c-5c) and tetra-substituted phosphazenes (1d-5d). Some phosphazenes have stereogenic P-center(s). The chirality of 4c was verified using chiral HPLC column. Electrochemical behaviors were influenced only by the number of ferrocene groups, but not the length of the amine chains and the substituent(s). The structures of the new phosphazenes were determined by FTIR, MS, 1H, 13C and 31P NMR, HSQC and HMBC spectral data. The solid-state structures of cis-1b and 4d were examined by single crystal X-ray diffraction techniques. The twelve phosphazene derivatives were screened for antimicrobial activity and the compounds 5a, cis-1b and 2c exhibited the highest antibacterial activity against G(+) and G(-) bacteria. In addition, it was found that overall gem-1b inhibited the growth of Mycobacterium tuberculosis. The compounds 1d, 2d and 4d were tested in HeLa cancer cell lines. Among these compounds, 2d had cytotoxic effect on HeLa cell in the first 48 h. Moreover, interactions between compounds 2a, gem-1b, gem-2b, cis-1b, 2c, 3c, 4c, 5c, 1d, 2d and 4d, and pBR322 plasmid DNA were investigated.

  13. Group 13 HOX proteins interact with the MH2 domain of R-Smads and modulate Smad transcriptional activation functions independent of HOX DNA-binding capability

    PubMed Central

    Williams, Thomas M.; Williams, Melissa E.; Heaton, Joanne H.; Gelehrter, Thomas D.; Innis, Jeffrey W.

    2005-01-01

    Interactions with co-factors provide a means by which HOX proteins exert specificity. To identify candidate protein interactors of HOXA13, we created and screened an E11.5–E12.5, distal limb bud yeast two-hybrid prey library. Among the interactors, we isolated the BMP-signaling effector Smad5, which interacted with the paralogous HOXD13 but not with HOXA11 or HOXA9, revealing unique interaction capabilities of the AbdB-like HOX proteins. Using deletion mutants, we determined that the MH2 domain of Smad5 is necessary for HOXA13 interaction. This is the first report demonstrating an interaction between HOX proteins and the MH2 domain of Smad proteins. HOXA13 and HOXD13 also bind to other BMP and TGF-?/Activin-regulated Smad proteins including Smad1 and Smad2, but not Smad4. Furthermore, HOXD13 could be co-immunoprecipitated with Smad1 from cells. Expression of HOXA13, HOXD13 or a HOXD13 homeodomain mutant (HOXD13IQN>AAA) antagonized TGF-?-stimulated transcriptional activation of the pAdtrack-3TP-Lux reporter vector in Mv1Lu cells as well as the Smad3/Smad4-activated pTRS6-E1b promoter in Hep3B cells. Finally, using mammalian one-hybrid assay, we show that transcriptional activation by a GAL4/Smad3-C-terminus fusion protein is specifically inhibited by HOXA13. Our results identify a new co-factor for HOX group 13 proteins and suggest that HOX proteins may modulate Smad-mediated transcriptional activity through protein–protein interactions without the requirement for HOX monomeric DNA-binding capability. PMID:16087734

  14. I-PfoP3I: a novel nicking HNH homing endonuclease encoded in the group I intron of the DNA polymerase gene in Phormidium foveolarum phage Pf-WMP3.

    PubMed

    Kong, Shuanglei; Liu, Xinyao; Fu, Liwen; Yu, Xiangchun; An, Chengcai

    2012-01-01

    Homing endonucleases encoded in a group I self-splicing intron in a protein-coding gene in cyanophage genomes have not been reported, apart from some free-standing homing edonucleases. In this study, a nicking DNA endonuclease, I-PfoP3I, encoded in a group IA2 intron in the DNA polymerase gene of a T7-like cyanophage Pf-WMP3, which infects the freshwater cyanobacterium Phormidium foveolarum is described. The Pf-WMP3 intron splices efficiently in vivo and self-splices in vitro simultaneously during transcription. I-PfoP3I belongs to the HNH family with an unconventional C-terminal HNH motif. I-PfoP3I nicks the intron-minus Pf-WMP3 DNA polymerase gene more efficiently than the Pf-WMP4 DNA polymerase gene that lacks any intervening sequence in vitro, indicating the variable capacity of I-PfoP3I. I-PfoP3I cleaves 4 nt upstream of the intron insertion site on the coding strand of EXON 1 on both intron-minus Pf-WMP3 and Pf-WMP4 DNA polymerase genes. Using an in vitro cleavage assay and scanning deletion mutants of the intronless target site, the minimal recognition site was determined to be a 14 bp region downstream of the cut site. I-PfoP3I requires Mg(2+), Ca(2+) or Mn(2+) for nicking activity. Phylogenetic analysis suggests that the intron and homing endonuclease gene elements might be inserted in Pf-WMP3 genome individually after differentiation from Pf-WMP4. To our knowledge, this is the first report of the presence of a group I self-splicing intron encoding a functional homing endonuclease in a protein-coding gene in a cyanophage genome. PMID:22952751

  15. DNA barcoding for plants.

    PubMed

    de Vere, Natasha; Rich, Tim C G; Trinder, Sarah A; Long, Charlotte

    2015-01-01

    DNA barcoding uses specific regions of DNA in order to identify species. Initiatives are taking place around the world to generate DNA barcodes for all groups of living organisms and to make these data publically available in order to help understand, conserve, and utilize the world's biodiversity. For land plants the core DNA barcode markers are two sections of coding regions within the chloroplast, part of the genes, rbcL and matK. In order to create high quality databases, each plant that is DNA barcoded needs to have a herbarium voucher that accompanies the rbcL and matK DNA sequences. The quality of the DNA sequences, the primers used, and trace files should also be accessible to users of the data. Multiple individuals should be DNA barcoded for each species in order to check for errors and allow for intraspecific variation. The world's herbaria provide a rich resource of already preserved and identified material and these can be used for DNA barcoding as well as by collecting fresh samples from the wild. These protocols describe the whole DNA barcoding process, from the collection of plant material from the wild or from the herbarium, how to extract and amplify the DNA, and how to check the quality of the data after sequencing. PMID:25373752

  16. The LEF-1 High-Mobility Group Domain Undergoes a Disorder-to-Order Transition upon Formation of a Complex with Cognate DNA

    E-print Network

    Love, John J.

    of a Complex with Cognate DNA John J. Love, Xiang Li,§ John Chung, H. Jane Dyson, and Peter E. Wright, 10550 North Torrey Pines Road, La Jolla, California 92037 ReceiVed February 27, 2004; ReVised Manuscript

  17. DNA BARCODING DNA barcoding of Cuban freshwater fishes: evidence for

    E-print Network

    Bernatchez, Louis

    DNA BARCODING DNA barcoding of Cuban freshwater fishes: evidence for cryptic species and taxonomic subunit I) were used to barcode 126 individuals, representing 27 taxonomically recognized species in 17 of the DNA barcodes for cataloguing Cuban freshwater fish species and for identifying those groups

  18. DNA Computing Hamiltonian path

    E-print Network

    Hagiya, Masami

    2014 DNA DNA #12;DNA Computing · Feynman · Adleman · DNASIMD · ... · · · · · DNADNA #12;DNA · DNA · · · · DNA · · #12;2000 2005 2010 1995 Hamiltonian path DNA tweezers DNA tile DNA origami DNA box Sierpinski DNA tile self assembly DNA logic gates Whiplash PCR DNA automaton DNA spider MAYA

  19. Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses

    PubMed Central

    Krupovic, Mart; Koonin, Eugene V.

    2014-01-01

    Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types. PMID:24939392

  20. Evolution of eukaryotic single-stranded DNA viruses of the Bidnaviridae family from genes of four other groups of widely different viruses

    NASA Astrophysics Data System (ADS)

    Krupovic, Mart; Koonin, Eugene V.

    2014-06-01

    Single-stranded (ss)DNA viruses are extremely widespread, infect diverse hosts from all three domains of life and include important pathogens. Most ssDNA viruses possess small genomes that replicate by the rolling-circle-like mechanism initiated by a distinct virus-encoded endonuclease. However, viruses of the family Bidnaviridae, instead of the endonuclease, encode a protein-primed type B DNA polymerase (PolB) and hence break this pattern. We investigated the provenance of all bidnavirus genes and uncover an unexpected turbulent evolutionary history of these unique viruses. Our analysis strongly suggests that bidnaviruses evolved from a parvovirus ancestor from which they inherit a jelly-roll capsid protein and a superfamily 3 helicase. The radiation of bidnaviruses from parvoviruses was probably triggered by integration of the ancestral parvovirus genome into a large virus-derived DNA transposon of the Polinton (polintovirus) family resulting in the acquisition of the polintovirus PolB gene along with terminal inverted repeats. Bidnavirus genes for a receptor-binding protein and a potential novel antiviral defense modulator are derived from dsRNA viruses (Reoviridae) and dsDNA viruses (Baculoviridae), respectively. The unusual evolutionary history of bidnaviruses emphasizes the key role of horizontal gene transfer, sometimes between viruses with completely different genomes but occupying the same niche, in the emergence of new viral types.

  1. Characterization and grouping of Trypanosoma brucei brucei, T.b. gambiense and T.b. rhodesiense by quantitative DNA-cytofluorometry and discriminant analysis.

    PubMed

    Mühlpfordt, H; Berger, J

    1989-03-01

    For characterization and differentiation 13 stocks of Trypanosoma brucei spp. were used for a quantitative cytofluorometric determination of their DNA fluorescence intensities by two base-pair-specific fluorochromes. T. b. gambiense could be distinguished from T. b. brucei by an about 20% smaller G-C, and A-T content in the nuclear DNA and a 4% greater G-C and 15% greater A-T content of the kinetoplast DNA. T. b. gambiense could be differentiated from T. b. rhodesiense by a 20% smaller G-C and a 3.8% smaller A-T nuclear DNA content and a 2% greater G-C and a 18% greater A-T DNA content in the kinetoplast. After chromomycin (G-C specific) staining the DNA ratio kinetoplast/nucleus of T. b. gambiense was 6.8, of T. b. brucei 5.2 and of T. b. rhodesiense 5.4. The corresponding values after DAPI (A-T specific) application were 20.8 for T. b. gambiense, 14.4 for T. b. brucei and 16.6 for T. b. rhodesiense. With the fluorescence intensities a discriminant analysis has been computed. After chromomycin application the gambiense stocks could be separated from T. b. brucei and T. b. rhodesiense by this method with a hit rate of 100%. Such perfect separation could not be observed between T. b. brucei and T. b. rhodesiense. Even if most of them were classified into the corresponding subgroups some trypanosomes would nevertheless pass over into the brucei or rhodesiense subgroup and vice versa.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2544979

  2. Functional regulation of the DNA damage-recognition factor DDB2 by ubiquitination and interaction with xeroderma pigmentosum group C protein

    PubMed Central

    Matsumoto, Syota; Fischer, Eric S.; Yasuda, Takeshi; Dohmae, Naoshi; Iwai, Shigenori; Mori, Toshio; Nishi, Ryotaro; Yoshino, Ken-ichi; Sakai, Wataru; Hanaoka, Fumio; Thomä, Nicolas H.; Sugasawa, Kaoru

    2015-01-01

    In mammalian nucleotide excision repair, the DDB1–DDB2 complex recognizes UV-induced DNA photolesions and facilitates recruitment of the XPC complex. Upon binding to damaged DNA, the Cullin 4 ubiquitin ligase associated with DDB1–DDB2 is activated and ubiquitinates DDB2 and XPC. The structurally disordered N-terminal tail of DDB2 contains seven lysines identified as major sites for ubiquitination that target the protein for proteasomal degradation; however, the precise biological functions of these modifications remained unknown. By exogenous expression of mutant DDB2 proteins in normal human fibroblasts, here we show that the N-terminal tail of DDB2 is involved in regulation of cellular responses to UV. By striking contrast with behaviors of exogenous DDB2, the endogenous DDB2 protein was stabilized even after UV irradiation as a function of the XPC expression level. Furthermore, XPC competitively suppressed ubiquitination of DDB2 in vitro, and this effect was significantly promoted by centrin-2, which augments the DNA damage-recognition activity of XPC. Based on these findings, we propose that in cells exposed to UV, DDB2 is protected by XPC from ubiquitination and degradation in a stochastic manner; thus XPC allows DDB2 to initiate multiple rounds of repair events, thereby contributing to the persistence of cellular DNA repair capacity. PMID:25628365

  3. The effects of linear assembly of two carbazole groups on acid-base and DNA-binding properties of a ruthenium(II) complex

    NASA Astrophysics Data System (ADS)

    Chen, Xi; Xue, Long-Xin; Ju, Chun-Chuan; Wang, Ke-Zhi

    2013-07-01

    A novel Ru(II) complex of [Ru(bpy)2(Hbcpip)](ClO4)2 {where bpy = 2,2-bipyridine, Hbcpip = 2-(4-(9H-3,9'-bicarbazol-9-yl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} is synthesized and characterized. Calf-thymus DNA-binding properties of the complex were studied by UV-vis absorption and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, thermal denaturation and DNA viscosity measurements. The results indicate that the complex partially intercalated into the DNA with a binding constant of (5.5 ± 1.4) × 105 M-1 in buffered 50 mM NaCl. The acid-base properties of the complex were also studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state acidity ionization constant values were derived.

  4. Biosensors Group at the Institute of Molecular Biology and Biotechnology receives two EC grants within Horizon2020 to develop diagnostic platforms for DNA analysis

    E-print Network

    Gizeli, Electra

    of disease and patient status, or the food sector for quality, safety and process control. The Head in complex human and food samples. The award regarding the health sector includes detectionBiopSens concept; ctDNA amplicons produced in chamber 1 are denatured and transferred to the sensors

  5. DNA sequencing

    SciTech Connect

    Tabor, S.; Richardson, C.C.

    1991-02-19

    This patent describes a method for determining the nucleotide base sequence of a DNA molecule. It comprises: providing the DNA molecule annealed with a primer molecule able to hybridize to the DNA molecule; incubating the annealed molecules in a vessel containing four different deoxynucleoside triphosphates, a processive DNA polymerase, wherein the polymerase is able to remain bound for at least 500 bases to the DNA molecule in an environmental condition used in the extension reaction of a DNA sequencing reaction, the polymerase having less than 500 units of exonuclease activity per mg of the polymerase, and one of four DNA synthesis terminating agents which terminate DNA synthesis at a specific nucleotide base, wherein each the agent terminates DNA synthesis at a different nucleotide base, and separating the DNA products of the incubating reaction according to their size, whereby at least a part of the nucleotide base sequence of the DNA molecule can be determined.

  6. DNA-barcoding of perch-like fishes (Actinopterygii: Perciformes) from far-eastern seas of Russia with taxonomic remarks for some groups.

    PubMed

    Turanov, S V; Kartavtsev, Yu Ph; Lipinsky, V V; Zemnukhov, V V; Balanov, A A; Lee, Y-H; Jeong, D

    2016-03-01

    The analysis of variation among 203 nucleotide sequences of Co-1 gene (DNA-barcode) for 45 species, 31 genera and 7 families of the order Perciformes from the Far Eastern seas of Russia has been performed. As a result, 42 species (93.3%) can be unambiguously identified using molecular DNA-barcode at Co-1, whereas more variable markers are required for other species (6.7%): Stichaeus grigorjewi, S. nozawae, and Lumpenus sagitta. The latter includes as well 2 morphologically distinct (by number of vertebrae) but genetically unresolved species, L. sagitta (Sea of Okhotsk) and L. fabricii (Bering Sea). In addition, within this genus morphologically poorly characterized but genetically well-distinguished cryptic species has been detected. Amphi-Pacific distribution is in question relative to L. sagitta. Cryptic diversity was observed in the genus Ammodytes. PMID:25121832

  7. Transcriptional Response of Human Neurospheres to Helper-Dependent CAV-2 Vectors Involves the Modulation of DNA Damage Response, Microtubule and Centromere Gene Groups

    PubMed Central

    Licursi, Valerio; Brito, Catarina; La Torre, Mattia; Alves, Paula M.; Simao, Daniel; Mottini, Carla; Salinas, Sara; Negri, Rodolfo; Tagliafico, Enrico; Kremer, Eric J.; Saggio, Isabella

    2015-01-01

    Brain gene transfer using viral vectors will likely become a therapeutic option for several disorders. Helper-dependent (HD) canine adenovirus type 2 vectors (CAV-2) are well suited for this goal. These vectors are poorly immunogenic, efficiently transduce neurons, are retrogradely transported to afferent structures in the brain and lead to long-term transgene expression. CAV-2 vectors are being exploited to unravel behavior, cognition, neural networks, axonal transport and therapy for orphan diseases. With the goal of better understanding and characterizing HD-CAV-2 for brain therapy, we analyzed the transcriptomic modulation induced by HD-CAV-2 in human differentiated neurospheres derived from midbrain progenitors. This 3D model system mimics several aspects of the dynamic nature of human brain. We found that differentiated neurospheres are readily transduced by HD-CAV-2 and that transduction generates two main transcriptional responses: a DNA damage response and alteration of centromeric and microtubule probes. Future investigations on the biochemistry of processes highlighted by probe modulations will help defining the implication of HD-CAV-2 and CAR receptor binding in enchaining these functional pathways. We suggest here that the modulation of DNA damage genes is related to viral DNA, while the alteration of centromeric and microtubule probes is possibly enchained by the interaction of the HD-CAV-2 fibre with CAR. PMID:26207738

  8. Conformation-dependent DNA attraction

    NASA Astrophysics Data System (ADS)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr03235c

  9. DNA Translocation by Human Uracil DNA Glycosylase: Role of DNA Phosphate Charge†

    PubMed Central

    Schonhoft, Joseph D.; Kosowicz, John; Stivers, James T.

    2013-01-01

    Human DNA repair glycosylases must encounter and inspect each DNA base in the genome in order to discover damaged bases that may be present at a density of less than one in ten million normal base pairs. This remarkable example of specific molecular recognition requires a reduced dimensionality search process (facilitated diffusion) that involves both hopping and sliding along the DNA chain. Despite the widely accepted importance of facilitated diffusion in protein-DNA interactions, the molecular features of DNA that influence hopping and sliding are poorly understood. Here we explore the role of the charged DNA phosphate backbone in sliding and hopping by human uracil DNA glycosylase (hUNG), which is an exemplar that efficiently locates rare uracil bases in both dsDNA and ssDNA. Substitution of neutral methylphosphonate groups for anionic DNA phosphate groups weakened nonspecific DNA binding affinity by 0.4–0.5 kcal/mole per substitution. In contrast, sliding of hUNG between uracil sites embedded in duplex and single stranded DNA substrates persisted unabated when multiple methylphosphonate linkages were inserted between the sites. Thus a continuous phosphodiester backbone negative charge is not essential for sliding over nonspecific DNA binding sites. We consider several alternative mechanisms for these results. A model consistent with previous structural and NMR dynamic results invokes the presence of open and closed conformational states of hUNG. The open state is short-lived and has weak or nonexistent interactions with the DNA backbone that are conducive for sliding, and the populated closed state has stronger interactions with the phosphate backbone. These data suggest that the fleeting sliding form of hUNG is a distinct weakly interacting state that facilitates rapid movement along the DNA chain and resembles the transition state for DNA dissociation. PMID:23506309

  10. 1971 1976 (renormalzation group

    E-print Network

    ) R. H. Swendsen 2001 (transition matrix MC, TMMC) Ruben G. Ghulghazaryan Landau TMMC [12] Go2006 8 676 / Go 19 20 DNA RNA DNA RNA 1971 1976 (renormalzation group 40 Go Go [13] N. Go 1983 J. Onuchi (14) Go C C C C C Langevin Langevin C Go

  11. Mitochondrial DNA.

    ERIC Educational Resources Information Center

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  12. DNA Copyright

    E-print Network

    Torrance, Andrew W.

    2011-01-01

    of architecture and computer software. Sequences of DNA should also be acknowledged as eligible for copyright protection. Unaltered genomic DNA sequences would seem poor candidates for copyright protection. The case is stronger for copyright protection...

  13. DNA Banking

    SciTech Connect

    Reilly, P.R. )

    1992-11-01

    The author is involved in the ethical, legal, and social issues of banking of DNA and data from DNA analysis. In his attempt to determine the extent of DNA banking in the U.S., the author surveyed some commercial companies performing DNA banking services. This article summarizes the results of that survey, with special emphasis on the procedures the companies use to protect the privacy of individuals. 4 refs.

  14. DNA demethylation by DNA repair

    E-print Network

    Gehring, Mary

    Active DNA demethylation underlies key facets of reproduction in flowering plants and mammals and serves a general genome housekeeping function in plants. A family of 5-methylcytosine DNA glycosylases catalyzes plant ...

  15. Dna Sequencing

    DOEpatents

    Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  16. DNA sequencing

    SciTech Connect

    Tabor, S.; Richardson, C.C.

    1990-10-09

    A method for sequencing a strand of DNA. It comprises providing the strand hybridized with a primer able to hybridize to the strand, to give an hybridized mixture, incubating the hybridized mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and a first chain terminating agent, wherein the DNA polymerase causes the primer to be elongated to form a first series of first DNA products differing in the length of the elongated primer, each the first DNA product having a the chain terminating agent at its elongated end. The number of molecules of each the first DNA products is approximately the same for substantially all DNA products differing in length by no more than 20 bases, and providing a second chain terminating agent in the hybridized mixture at a concentration different from the first chain terminating agent.

  17. Development of a DNA vaccine for chicken infectious anemia and its immunogenicity studies using high mobility group box 1 protein as a novel immunoadjuvant indicated induction of promising protective immune responses.

    PubMed

    Sawant, Pradeep Mahadev; Dhama, Kuldeep; Rawool, Deepak Bhiva; Wani, Mohd Yaqoob; Tiwari, Ruchi; Singh, Shambhu Dayal; Singh, Raj Kumar

    2015-01-01

    Chicken infectious anaemia (CIA) is an economically important and emerging poultry disease reported worldwide. Current CIA vaccines have limitations like, the inability of the virus to grow to high titres in embryos/cell cultures, possession of residual pathogenicity and a risk of reversion to virulence. In the present study, a DNA vaccine, encoding chicken infectious anaemia virus (CIAV) VP1 and VP2 genes, was developed and co-administered with truncated chicken high mobility group box 1 (HMGB1?C) protein in young chicks for the evaluation of vaccine immune response. CIAV VP1 and VP2 genes were cloned in pTARGET while HMGB1?C in PET32b vector. In vitro expression of these gene constructs was evaluated by Western blotting. Further, recombinant HMGB1?C was evaluated for its biological activity. The CIAV DNA vaccine administration in specific pathogen free chicks resulted in moderately protective ELISA antibody titres in the range of 4322.87 ± 359.72 to 8288.19 ± 136.38, increased CD8(+) cells, and a higher titre was observed by co-administration of novel adjuvant (HMGB1?C) and booster immunizations. The use of vaccine with adjuvant showed achieving antibody titres nearly 8500, titre considered as highly protective, which indicates that co-immunization of HMGB1?C may have a strong adjuvant activity on CIAV DNA vaccine induced immune responses. The able potential of HMGB1 protein holding strong adjuvant activity could be exploited further with trials with vaccines for other important pathogens for achieving the required protective immune responses. PMID:25448094

  18. Unnatural nucleotides for DNA sequencing 

    E-print Network

    Jacutin, Swanee E

    1997-01-01

    , VentR(exo-)@ DNA polymerase and rTth. DNA polymerase. This demonstrates the possible role of 3'-O-methyl-dTTP as an alternative terminator to ddTTP. A fluorescent 3'safety-catch linker nucleoside with a photolabile protecting group was prepared via a...

  19. Nuclear DNA PCR-RFLPs that distinguish African and European honey bee groups of subspecies. II: Conversion of long PCR markers to standard PCR.

    PubMed

    Suazo, Alonso; Hall, H Glenn

    2002-08-01

    Nuclear DNA PCR-RFLPs previously found in amplifications of three long (> 5 kbp) anonymous regions of DNA were made analyzable using standard PCR procedures. RFLP analyses were simplified by restricting the amplifications to sections, within each locus, that contained most of the informative polymorphic sites. AluI digests of locus L-1 section 2 (L-1S2) revealed three suballeles of which one was African-specific (Apis mellifera scutellata Lepeletier) and one was east European-predominant (A. m. ligustica Spinola, A. m. carnica Pollman, and A. m. caucasica Gorbachev). Alleles found originally at locus L-2 with AvaI were determined in RFLP analysis of two sections, L-2S1int and L-2S2, resulting in two African-specific and two east European-predominant suballeles. Suballele identity was determined by the combination of banding patterns from both fragments. Polymorphisms revealed by HaeIII in locus L-2 were analyzed in amplifications and digests of L-2SM1int. an 830 bpfragment within L-2S1. Seven suballeles were found of which two were African-specific and three were east European-specific or predominant, including one suballele specific to the east European subspecies A. m. caucasica. In locus L-5, RFLPs were detected with HaeIII, DdeI, and SpeI. HaeIII polymorphisms were analyzed by amplification and digestion offragments L-5S1xt and L-5S1ter: Five suballeles were found of which three were African-specific and one east European-predominant. For DdeI, all five alleles originally found with long PCR could be identified in RFLP analyses of three sections. Two African-specific, one east European-specific, and one west European-predominant (A. m. mellifera L. and A. m. iberica Goetze) suballeles were found. A west European-predominant suballele was also found in RFLP analysis of L-5S3 with SpeI. Allele frequency data from Old World and US. populations are presented. PMID:12296627

  20. Genetic variation and demographic history of the Haplochromis laparogramma group of Lake Victoria--An analysis based on SINEs and mitochondrial DNA

    E-print Network

    Genetic variation and demographic history of the Haplochromis laparogramma group of Lake Victoria More than 500 endemic haplochromine cichlid species inhabit Lake Victoria. This striking species and population structure of closely related Lake Victoria cichlids and in showing the importance of applying

  1. SWGDAM Guidelines NIST Applied Genetics Group

    E-print Network

    ) · mtDNA Nucleotide Sequence Interpretation (2003) · Revised Validation (2004) · Y-STR Interpretation Standards for Forensic DNA Testing Laboratories (2009, 2011) ­ Audit Document for Forensic DNA Testing-7, 2012 #12;Scientific Working Group on DNA Analysis Methods (SWGDAM) ·Organized originally by FBI

  2. Functional ?-fragment of ?-galactosidase can be expressed from the mobile group I intron PpLSU3 embedded in yeast pre-ribosomal RNA derived from the chromosomal rDNA locus

    PubMed Central

    Lin, Jue; Vogt, Volker M.

    2000-01-01

    PpLSU3, a mobile group I intron found in the ribosomal RNA genes of Physarum polycephalum, encodes the I-PpoI homing endonuclease. This enzyme represents one of the rare cases in nature where a protein is expressed from an RNA polymerase I transcript. Our previous results showed that the full length intron, but not a further processed species, is the messenger for I-PpoI, implying a role of the untranslated region (UTR) in gene expression. To study the function of the 3?-UTR in expression of the endonuclease and in splicing of the intron, we replaced the I-PpoI gene in PpLSU3 with the gene for the ?-fragment of Escherichia coli ?-galactosidase, and then integrated this chimeric intron into all the chromosomal rDNA repeats of yeast. The resulting cells synthesized functional ?-fragment, as evidenced by a complementation assay analogous to that used in E.coli. The ?-galactosidase activity thus provides an unusual and potentially valuable readout for Pol I transcription from chromosomal rDNA. This is the first example in which a eucaryotic homing endonuclease gene has been successfully replaced by a heterologous gene. Using deletion mutagenesis and a novel randomization approach with the ?-fragment as a reporter, we found that a small segment of the 3?-UTR dramatically influences both splicing and protein expression. PMID:10684939

  3. Recombinant DNA means and method

    SciTech Connect

    Alford, B.L.; Mao, J.I.; Moir, D.T.; Taunton-Rigby, A.; Vovis, G.F.

    1987-05-19

    This patent describes a transformed living cell selected from the group consisting of fungi, yeast and bacteria, and containing genetic material derived from recombinant DNA material and coding for bovine rennin.

  4. Patterning nanocrystals using DNA

    SciTech Connect

    Williams, Shara Carol

    2003-09-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices to a length greater than 20 {micro}m, and collecting atomic force microscopy (AFM) images up to 30 {micro}m. We found the lattices' requirement of divalent magnesium cations to stabilize Holliday junctions to be incompatible with the stability of charge-stabilized gold nanoparticles used for the experiments here, and gold particles added indiscriminately to the lattice surface through non-specific binding. Redesigning the lattices to avoid magnesium may improve results.

  5. PEX12, the Pathogenic Gene of Group III Zellweger Syndrome: cDNA Cloning by Functional Complementation on a CHO Cell Mutant, Patient Analysis, and Characterization of Pex12p

    PubMed Central

    Okumoto, Kanji; Shimozawa, Nobuyuki; Kawai, Atsusi; Tamura, Shigehiko; Tsukamoto, Toshiro; Osumi, Takashi; Moser, Hugo; Wanders, Ronald J. A.; Suzuki, Yasuyuki; Kondo, Naomi; Fujiki, Yukio

    1998-01-01

    Rat PEX12 cDNA was isolated by functional complementation of peroxisome deficiency of a mutant CHO cell line, ZP109 (K. Okumoto, A. Bogaki, K. Tateishi, T. Tsukamoto, T. Osumi, N. Shimozawa, Y. Suzuki, T. Orii, and Y. Fujiki, Exp. Cell Res. 233:11–20, 1997), using a transient transfection assay and an ectopic, readily visible marker, green fluorescent protein. This cDNA encodes a 359-amino-acid membrane protein of peroxisomes with two transmembrane segments and a cysteine-rich zinc finger, the RING motif. A stable transformant of ZP109 with the PEX12 was morphologically and biochemically restored for peroxisome biogenesis. Pex12p was shown by expression of bona fide as well as epitope-tagged Pex12p to expose both N- and C-terminal regions to the cytosol. Fibroblasts derived from patients with the peroxisome deficiency Zellweger syndrome of complementation group III (CG-III) were also complemented for peroxisome biogenesis with PEX12. Two unrelated patients of this group manifesting peroxisome deficiency disorders possessed homozygous, inactivating PEX12 mutations: in one, Arg180Thr by one point mutation, and in the other, deletion of two nucleotides in codons for 291Asn and 292Ser, creating an apparently unchanged codon for Asn and a codon 292 for termination. These results indicate that the gene encoding peroxisome assembly factor Pex12p is a pathogenic gene of CG-III peroxisome deficiency. Moreover, truncation and site mutation studies, including patient PEX12 analysis, demonstrated that the cytoplasmically oriented N- and C-terminal parts of Pex12p are essential for biological function. PMID:9632816

  6. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  7. DNA ALTERATIONS

    EPA Science Inventory

    The exposure of an organism to genotoxic chemicals may induce a cascade of genetic events. nitially, structural alterations to DNA are formed. ext, the DNA damage is processed and subsequently expressed in mutant gene products. inally, diseases result from the genetic damage. he ...

  8. DNA Pendant

    E-print Network

    Hacker, Randi; Tsutsui, William

    2007-11-14

    Broadcast Transcript: It's a symbol of commitment. It's a memento mori. It's the DNA pendant offered by Japan's Eiwa Industry and it's two, two, two things in one. Using genetic extraction, Eiwa removes the DNA from, say, a strand of hair or a...

  9. Ten polymorphic DNA loci, including five in the rat MHC (RT1) region, form a single linkage group on rat chromosome 20

    SciTech Connect

    Remmers, E.F.; Du, Y.; Zha, H.; Goldmuntz, E.A.; Wilder, R.L.

    1995-03-01

    We have described ten markers for polymorphic loci on rat chromosome 20, including five in the rat MHC (RT1) region. These markers formed a single linkage group spanning a recombination distance of 0.40. The markers identified five expressed gene loci - RT1.N1 (thymus leukemia antigen 1), Tnfa (tumor necrosis factor {alpha}), Hspa1 (heat shock protein 70), Ggt1 ({gamma} glutamyl-transferase 1), and Prkacn2 (protein kinase C catalytic subunit binding inhibitor 2), two loci with sequences that are related to expressed genes - RT1.Aw2 (sequence related to a non-RT1A class I {alpha} chain) and Mt21 (sequence related to metallothionein 2), and three anonymous loci - D20Arb548, D20Arb234, and D20Arb249. These polymorphic markers should facilitate mapping studies and genetic monitoring of inbred rat strains. 18 refs., 2 figs., 3 tabs.

  10. Linking two DNA duplexes with a rigid linker for DNA nanotechnology

    PubMed Central

    Tashiro, Ryu; Iwamoto, Masahiro; Morinaga, Hironobu; Emura, Tomoko; Hidaka, Kumi; Endo, Masayuki; Sugiyama, Hiroshi

    2015-01-01

    DNA has recently emerged as a promising material for the construction of nanosized architectures. Chemically modified DNA has been suggested to be an important component of such architectural building blocks. We have designed and synthesized a novel H-shaped DNA oligonucleotide dimer that is cross-linked with a structurally rigid linker composed of phenylene and ethynylene groups. A rotatable DNA unit was constructed through the self-assembly of this H-shaped DNA component and two complementary DNA oligonucleotides. In addition to the rotatable unit, a locked DNA unit containing two H-shaped DNA components was also constructed. As an example of an extended locked structure, a hexagonal DNA origami dimer and oligomer were constructed by using H-shaped DNA as linkers. PMID:26130712

  11. Linking two DNA duplexes with a rigid linker for DNA nanotechnology.

    PubMed

    Tashiro, Ryu; Iwamoto, Masahiro; Morinaga, Hironobu; Emura, Tomoko; Hidaka, Kumi; Endo, Masayuki; Sugiyama, Hiroshi

    2015-08-18

    DNA has recently emerged as a promising material for the construction of nanosized architectures. Chemically modified DNA has been suggested to be an important component of such architectural building blocks. We have designed and synthesized a novel H-shaped DNA oligonucleotide dimer that is cross-linked with a structurally rigid linker composed of phenylene and ethynylene groups. A rotatable DNA unit was constructed through the self-assembly of this H-shaped DNA component and two complementary DNA oligonucleotides. In addition to the rotatable unit, a locked DNA unit containing two H-shaped DNA components was also constructed. As an example of an extended locked structure, a hexagonal DNA origami dimer and oligomer were constructed by using H-shaped DNA as linkers. PMID:26130712

  12. Nonhuman DNA.

    PubMed

    Graham, Eleanor A M

    2005-06-01

    DNA has now been used to aid criminal investigation for more than 20 years. The vast majority of this evidence has been produced by profiling of human genetic material. However, DNA profiling technology is not restricted to the human genome. Regions of genetic material displaying similar characteristics to markers used for forensic purposes in the human genome have been identified in many other animal species. Although nonhuman DNA profiling has been used for a small number of forensic investigations, the full potential of this evidence type has yet to be realized. PMID:25869954

  13. Dancing DNA.

    ERIC Educational Resources Information Center

    Pennisi, Elizabeth

    1991-01-01

    An imaging technique that uses fluorescent dyes and allows scientists to track DNA as it moves through gels or in solution is described. The importance, opportunities, and implications of this technique are discussed. (KR)

  14. DNA Adductomics

    PubMed Central

    2015-01-01

    Systems toxicology is a broad-based approach to describe many of the toxicological features that occur within a living system under stress or subjected to exogenous or endogenous exposures. The ultimate goal is to capture an overview of all exposures and the ensuing biological responses of the body. The term exposome has been employed to refer to the totality of all exposures, and systems toxicology investigates how the exposome influences health effects and consequences of exposures over a lifetime. The tools to advance systems toxicology include high-throughput transcriptomics, proteomics, metabolomics, and adductomics, which is still in its infancy. A well-established methodology for the comprehensive measurement of DNA damage resulting from every day exposures is not fully developed. During the past several decades, the 32P-postlabeling technique has been employed to screen the damage to DNA induced by multiple classes of genotoxicants; however, more robust, specific, and quantitative methods have been sought to identify and quantify DNA adducts. Although triple quadrupole and ion trap mass spectrometry, particularly when using multistage scanning (LC–MSn), have shown promise in the field of DNA adductomics, it is anticipated that high-resolution and accurate-mass LC–MSn instrumentation will play a major role in assessing global DNA damage. Targeted adductomics should also benefit greatly from improved triple quadrupole technology. Once the analytical MS methods are fully mature, DNA adductomics along with other -omics tools will contribute greatly to the field of systems toxicology. PMID:24437709

  15. Unravelling DNA

    NASA Astrophysics Data System (ADS)

    Conroy, Rs; Danilowicz, C.

    2004-04-01

    The forces involved in the biology of life are carefully balanced between stopping thermal fluctuations ripping our DNA apart and having bonds weak enough to allow enzymes to function. The application of recently developed techniques for measuring piconewton forces and imaging at the nanometre scale on a molecule-by-molecule basis has dramatically increased the impact of single-molecule biophysics. This article describes the most commonly used techniques for imaging and manipulating single biomolecules. Using these techniques, the mechanical properties of DNA can be investigated, for example through measurements of the forces required to stretch and unzip the DNA double helix. These properties determine the ease with which DNA can be folded into the cell nucleus and the size and complexity of the accompanying cellular machinery. Part of this cellular machinery is enzymes, which manipulate, repair and transcribe the DNA helix. Enzymatic function is increasingly being investigated at the single molecule level to give better understanding of the forces and processes involved in the genetic cycle. One of the challenges is to transfer this understanding of single molecules into living systems. Already there have been some notable successes, such as the development of techniques for gene expression through the application of mechanical forces to cells, and the imaging and control of viral infection of a cell. This understanding and control of DNA has also been used to design molecules, which can self-assemble into a range of structures.

  16. DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics

    E-print Network

    DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics Soo­Yong Shin 1 , Eun Jeong the complexity of DNA computing. The complexity of any computational algorithm is typically measured in terms of time and space. In DNA computing, the time complexity can be measured by the total reaction time

  17. DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics

    E-print Network

    DNA Computing Complexity Analysis Using DNA/DNA Hybridization Kinetics Soo-Yong Shin1 , Eun Jeong of DNA computing. The complexity of any computational algorithm is typically measured in terms of time and space. In DNA computing, the time complexity can be measured by the total reaction time

  18. Biophysical characterization of DNA binding from single molecule force measurements

    PubMed Central

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-01-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function. PMID:20576476

  19. Benzophenone photosensitized DNA damage.

    PubMed

    Cuquerella, M Consuelo; Lhiaubet-Vallet, Virginie; Cadet, Jean; Miranda, Miguel A

    2012-09-18

    Although the carcinogenic potential of ultraviolet radiation is well-known, UV light may interact with DNA by direct absorption or through photosensitization by endogenous or exogenous chromophores. These chromophores can extend the "active" fraction of the solar spectrum to the UVA region and beyond, which means that photosensitizers increase the probability of developing skin cancer upon exposure to sunlight. Therefore researchers would like to understand the mechanisms involved in photosensitized DNA damage both to anticipate possible photobiological risks and to design tailor-made photoprotection strategies. In this context, photosensitized DNA damage can occur through a variety of processes including electron transfer, hydrogen abstraction, triplet-triplet energy transfer, or generation of reactive oxygen species. In this Account, we have chosen benzophenone (BP) as a classical and paradigmatic chromophore to illustrate the different lesions that photosensitization may prompt in nucleosides, in oligonucleotides, or in DNA. Thus, we discuss in detail the accumulated mechanistic evidence of the BP-photosensitized reactions of DNA or its building blocks obtained by our group and others. We also include ketoprofen (KP), a BP-derivative that possesses a chiral center, to highlight the stereodifferentiation in the key photochemical events, revealed through the dynamics of the reactive triplet excited state ((3)KP*). Our results show that irradiation of the BP chromophore in the presence of DNA or its components leads to nucleobase oxidations, cyclobutane pyrimidine dimer formation, single strand breaks, DNA-protein cross-links, or abasic sites. We attribute the manifold photoreactivity of BP to its well established photophysical properties: (i) it absorbs UV light, up to 360 nm; (ii) its intersystem crossing quantum yield (?(ISC)) is almost 1; (iii) the energy of its n?* lowest triplet excited state (E(T)) is ca. 290 kJ mol(-1); (iv) it produces singlet oxygen ((1)O(2)) with a quantum yield (?(?)) of ca. 0.3. For electron transfer and singlet oxygen reactions, we focused on guanine, the nucleobase with the lowest oxidation potential. Among the possible oxidative processes, electron transfer predominates. Conversely, triplet-triplet energy transfer occurs mainly from (3)BP* to thymine, the base with the lowest lying triplet state in DNA. This process results in the formation of cyclobutane pyrimidine dimers, but it also competes with the Paternò-Büchi reaction in nucleobases or nucleosides, giving rise to oxetanes as a result of crossed cycloadditions. Interestingly, we have found significant stereodifferentiation in the quenching of the KP triplet excited state by both 2'-deoxyguanosine and thymidine. Based on these results, this chromophore shows potential as a (chiral) probe for the investigation of electron and triplet energy transport in DNA. PMID:22698517

  20. DNA unwinding and inhibition of T4 DNA ligase by anthracyclines.

    PubMed Central

    Montecucco, A; Pedrali-Noy, G; Spadari, S; Zanolin, E; Ciarrocchi, G

    1988-01-01

    The ability to alter DNA tertiary structure of ten anthracycline derivatives whose antitumor potency is known was studied by an assay that makes use of nicked circular DNA and bacteriophage T4 DNA ligase. This assay allows the detection of tertiary structure alterations caused by DNA binding of both intercalating and non-intercalating drugs. The determination of these events can be obtained at different temperatures in the range of activity of DNA ligase. The results indicate that anthracyclines alter the DNA tertiary structure but this property does not correlate with their cytotoxic or antitumor activities. An additional interesting finding was that several anthracyclines inhibit T4 DNA ligase. The inhibition can be complete and is a cubic function of drug concentration. The inhibition of DNA ligase does not correlate with the ability of anthracyclines to alter the tertiary structure of DNA but is dependent from the presence of an amino group on the sugar ring. Images PMID:3287337

  1. DNA phosphorothioate modifications influence the global transcriptional response and protect DNA from double-stranded breaks

    PubMed Central

    Gan, Rui; Wu, Xiaolin; He, Wei; Liu, Zhenhua; Wu, Shuangju; Chen, Chao; Chen, Si; Xiang, Qianrong; Deng, Zixin; Liang, Dequan; Chen, Shi; Wang, Lianrong

    2014-01-01

    The modification of DNA by phosphorothioate (PT) occurs when the non-bridging oxygen in the sugar-phosphate backbone of DNA is replaced with sulfur. This DNA backbone modification was recently discovered and is governed by the dndABCDE genes in a diverse group of bacteria and archaea. However, the biological function of DNA PT modifications is poorly understood. In this study, we employed the RNA-seq analysis to characterize the global transcriptional changes in response to PT modifications. Our results show that DNA without PT protection is susceptible to DNA damage caused by the dndFGHI gene products. The DNA double-stranded breaks then trigger the SOS response, cell filamentation and prophage induction. Heterologous expression of dndBCDE conferring DNA PT modifications at GPSA and GPST prevented the damage in Salmonella enterica. Our data provide insights into the physiological role of the DNA PT system. PMID:25319634

  2. DNA vaccines

    NASA Astrophysics Data System (ADS)

    Gregersen, Jens-Peter

    2001-12-01

    Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

  3. Ancient DNA

    PubMed Central

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    In the past two decades, ancient DNA research has progressed from the retrieval of small fragments of mitochondrial DNA from a few late Holocene specimens, to large-scale studies of ancient populations, phenotypically important nuclear loci, and even whole mitochondrial genome sequences of extinct species. However, the field is still regularly marred by erroneous reports, which underestimate the extent of contamination within laboratories and samples themselves. An improved understanding of these processes and the effects of damage on ancient DNA templates has started to provide a more robust basis for research. Recent methodological advances have included the characterization of Pleistocene mammal populations and discoveries of DNA preserved in ancient sediments. Increasingly, ancient genetic information is providing a unique means to test assumptions used in evolutionary and population genetics studies to reconstruct the past. Initial results have revealed surprisingly complex population histories, and indicate that modern phylogeographic studies may give misleading impressions about even the recent evolutionary past. With the advent and uptake of appropriate methodologies, ancient DNA is now positioned to become a powerful tool in biological research and is also evolving new and unexpected uses, such as in the search for extinct or extant life in the deep biosphere and on other planets. PMID:15875564

  4. 2.1 DNA

    E-print Network

    Zhang, Louxin

    Õ ´º Ä È º §ª ÆÁ Û È £ ¦Ã¶¡ § ÂÈ ÎÁ¡ ÇÍ¥ ¦ ¿ ß¡ DNA Þ§ Õ ¡ ÀÞ§ Ö Õ Ð DNA Þ§¡ Æ°ª ½Ï ß¡ DNA Þ° ¹ °¿¡ DNA ÚÚ ¹ · Õ À² ° ƶ ¡ DNA§ Ù 99% ¡ À § ¦ Ë° 50% ¡ À ° DNA ¹ °¿Þ§¡ Ò § ¡ªÚ DNA ¡Þ§ ¡ °ª § «Þº ¡ ³ DNA Þ§¡§¡ Ì ¡ ¶ § Ì NCBI Ï ¡ DNA Ö Þ§§ Á Ê×ËÞ § ¶ 1.6 × 1014 Ô§ÀÀ Þ§§ ÁÐ ¦ Þ§Õ Å Û ¶ Å

  5. DNA Investigations.

    ERIC Educational Resources Information Center

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  6. DNA Methylation

    PubMed Central

    Marinus, M.G.; Løbner-Olesen, A.

    2014-01-01

    The DNA of E. coli contains 19,120 6-methyladenines and 12,045 5-methylcytosines in addition to the four regular bases and these are formed by the postreplicative action of three DNA methyltransferases. The majority of the methylated bases are formed by the Dam and Dcm methyltransferases encoded by the dam (DNA adenine methyltransferase) and dcm (DNA cytosine methyltransferase) genes. Although not essential, Dam methylation is important for strand discrimination during repair of replication errors, controlling the frequency of initiation of chromosome replication at oriC, and regulation of transcription initiation at promoters containing GATC sequences. In contrast, there is no known function for Dcm methylation although Dcm recognition sites constitute sequence motifs for Very Short Patch repair of T/G base mismatches. In certain bacteria (e.g., Vibrio cholerae, Caulobacter crescentus) adenine methylation is essential and in C. crescentus, it is important for temporal gene expression which, in turn, is required for coordinating chromosome initiation, replication and division. In practical terms, Dam and Dcm methylation can inhibit restriction enzyme cleavage; decrease transformation frequency in certain bacteria; decrease the stability of short direct repeats; are necessary for site-directed mutagenesis; and to probe eukaryotic structure and function. PMID:25405210

  7. DNA nanostructure immobilization to lithographic DNA arrays

    NASA Astrophysics Data System (ADS)

    Negrete, Omar D.

    Although DNA is well known for its genetic role in biology, DNA has also been sought-after as a material for the self-assembly of biological and electronic devices. Examples of DNA nanostructure construction include DNA tiled self-assembly and DNA Origami, where by controlling the sequence and concentration of DNA molecules, the rational design of geometric DNA nanostructures is possible. The assembly of DNA nanostructures takes place in solution and thus they are in disorder and require further organization to construct circuitry or devices. Hence, it is essential for future applications of this technology to develop methods to direct the placement of DNA nanostructures on a surface. To address this challenge my research examines the use of DNA microarrays to capture DNA nanostructures via DNA hybridization. Modern DNA arrays offer a high-density of sequence-specific molecular recognition sites where the addressable placement of DNA nanostructures can be achieved. Using Maskless Array Synthesizer (MAS) technology, I have characterized photolithographic DNA arrays for the hybridization of DNA complexes like large DNA molecules (> 1 kb), DNA-gold nanoparticle conjugates, and DNA Origami. Although modern photolithographic DNA arrays can possess a high-density of sequence (106/cm2), the printed DNA areas are on the order of tens of microns. Thus, I have also developed a method to reduce the DNA array spot size to nanoscale dimensions through the combined use of electron beam lithography with photolithographic DNA synthesis. This work addresses the key elements towards developing a surface patterning technology that takes advantage of DNA base-pairing for both molecular sub-assembly and surface patterning.

  8. Targeting DNA with novel diphenylcarbazoles.

    PubMed

    Dias, Nathalie; Jacquemard, Ulrich; Baldeyrou, Brigitte; Tardy, Christelle; Lansiaux, Amélie; Colson, Pierre; Tanious, Farial; Wilson, W David; Routier, Sylvain; Mérour, Jean-Yves; Bailly, Christian

    2004-12-01

    Double-stranded DNA is a therapeutic target for a variety of anticancer and antimicrobial drugs. Noncovalent interactions of small molecules with DNA usually occur via intercalation of planar compounds between adjacent base pairs or minor-groove recognition by extended crescent-shaped ligands. However, the dynamic and flexibility of the DNA platform provide a variety of conformations that can be targeted by structurally diverse compounds. Here, we propose a novel DNA-binding template for construction of new therapeutic candidates. Four bisphenylcarbazole derivatives, derived from the combined molecular architectures of known antitumor bisphenylbenzimidazoles and anti-infectious dicationic carbazoles, have been designed, and their interaction with DNA has been studied by a combination of biochemical and biophysical methods. The substitutions of the bisphenylcarbazole core with two terminal dimethylaminoalkoxy side chains strongly promote the interaction with DNA, to prevent the heat denaturation of the double helix. The deletion or the replacement of the dimethylamino-terminal groups with hydroxyl groups strongly decreased DNA interaction, and the addition of a third cationic side chain on the carbazole nitrogen reinforced the affinity of the compound for DNA. Although the bi- and tridentate molecules both derive from well-characterized DNA minor-groove binders, the analysis of their binding mode by means of circular and linear dichroism methods suggests that these compounds form intercalation complexes with DNA. Negative-reduced dichroism signals were recorded in the presence of natural DNA and synthetic AT and GC polynucleotides. The intercalation hypothesis was validated by unwinding experiments using topoisomerase I. Prominent gel shifts were observed with the di- and trisubstituted bisphenylcarbazoles but not with the uncharged analogues. These observations, together with the documented stacking properties of such molecules (components for liquid crystals), prompted us to investigate their binding to the human telomeric DNA sequence by means of biosensor surface plasmon resonance. Under conditions favorable to G4 formation, the title compounds showed only a modest interaction with the telomeric quadruplex sequence, comparable to that measured with a double-stranded oligonucleotide. Their sequence preference was explored by DNase I footprinting experiments from which we identified a composite set of binding sequences comprising short AT stretches and a few other mixed AT/GC blocks with no special AT character. The variety of the binding sequences possibly reflects the coexistence of distinct positioning of the chromophore in the intercalation sites. The bisphenylcarbazole unit represents an original pharmacophore for DNA recognition. Its branched structure, with two or three arms suitable to introduce a structural diversity, provides an interesting scaffold to built molecules susceptible to discriminate between the different conformations of nucleic acids. PMID:15568808

  9. Comparison of three DNA extraction methods for recovery of soil protist DNA.

    PubMed

    Santos, Susana S; Nielsen, Tue Kjærgaard; Hansen, Lars H; Winding, Anne

    2015-08-01

    The use of molecular methods to investigate protist communities in soil is in rapid development this decade. Molecular analysis of soil protist communities is usually dependant on direct genomic DNA extraction from soil and inefficient or differential DNA extraction of protist DNA can lead to bias in downstream community analysis. Three commonly used soil DNA extraction methods have been tested on soil samples from three European Long-Term Observatories (LTOs) with different land-use and three protist cultures belonging to different phylogenetic groups in different growth stages. The methods tested were: ISOm-11063 (a version of the ISO-11063 method modified to include a FastPrep ®-24 mechanical lysis step), GnS-GII (developed by the GenoSol platform to extract soil DNA in large-scale soil surveys) and a commercial DNA extraction kit - Power Lyzer™ PowerSoil® DNA Isolation Kit (MoBio). DNA yield and quality were evaluated along with DNA suitability for amplification of 18S rDNA fragments by PCR. On soil samples, ISOm-11063 yields significantly higher DNA for two of the three soil samples, however, MoBio extraction favors DNA quality. This method was also more effective to recover copies of 18S rDNA numbers from all soil types. In addition and despite the lower yields, higher DNA quality was observed with DNA extracted from protist cultures with the MoBio method. Likewise, a bead-beating step shows to be a good solution for DNA extraction of soil protists, since the recovery of DNA from protist cultures and from the different soil samples with the ISOm method proved to be efficient in recovering PCR-amplifiable DNA. This study showed that soil DNA extraction methods provide biased results towards the cyst stages of protist organism. PMID:25966645

  10. Nature Communications 2015 5 7 DNA DNA DNA

    E-print Network

    Goda, Keisuke

    1A JMJD1A SWI/SNF PPAR DNA JMJD1A DNA JMJD1A JMJD1A DNA JMJD1A 265 #12 dynamics via SWI/SNF association for thermogenesis Yohei Abe, Royhan Rozqie, Yoshihiro Matsumura, Takeshi ATP UCP1 ATP JMJD1A JMJD1A SWI/SNF DNA PPAR (peroxisome proliferator-activated receptor

  11. Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family

    PubMed Central

    Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, José Rubens; Antonelli, Alexandre

    2012-01-01

    Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae. PMID:23717188

  12. Adleman[1] 1994 DNA Hamiltonian Path Problem , DNA

    E-print Network

    1. Adleman[1] 1994 DNA Hamiltonian Path Problem , DNA DNA [2]. DNA DNA , . , , 2 , DNA 4 . DNA 4 A(Adenine), C(Cytosine), G(Guanine), T(Thymine) 2 4 . , . 1 mole 6x10 23 DNA DNA . , . DNA NP-complete [1, 2], [2

  13. DNA Topology: Fundamentals

    E-print Network

    Mirkin, Sergei

    DNA Topology: Fundamentals Sergei M Mirkin, University of Illinois at Chicago, Illinois, USA Topological characteristics of DNA and specifically DNA supercoiling influence all major DNA transactions in living cells. DNA supercoiling induces the formation of unusual secondary structure by specific DNA

  14. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  15. (gene expression) DNA (DNA microarrays).

    E-print Network

    Athens, University of

    Lymphoblastic Leukemia - ALL, 25 Acute Myeloid Leukemia - AML) µ 7129 [10]. µ µ µ µ µ µ µ µ DNA. 62 µ, 22 40 , µ 2000 [6]. µ 72 µ µ (47 Acute," Cytometry, vol. 43, pp. 229-238, Mar. 2001. [3] D. Slonim, "From patterns to pathways: gene expression data

  16. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, Karin D. (Salt Lake City, UT); Chu, Tun-Jen (Salt Lake City, UT); Pitt, William G. (Orem, UT)

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  17. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  18. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    SciTech Connect

    Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Stani?ová, Jana

    2014-01-31

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.

  19. Conformational features of distamycin-DNA and netropsin-DNA complexes by Raman spectroscopy.

    PubMed Central

    Martin, J C; Wartell, R M; O'Shea, D C

    1978-01-01

    The binding of distamycin and netropsin to duplex DNA has been studied by Raman spectroscopy. Several changes occur in the Raman spectra of these drugs upon binding DNA. These changes were analyzed by assigning specific motions to the observed Raman bands through the use of molecular subunits of the drugs and normal mode calculations. Our analysis indicates that pyrrole ring and peptide group vibrations are altered upon binding to DNA. The environments of the pyrrole ring methyl groups are not affected by the binding. These data provide physical evidence consistent with a binding model in which the methyl groups on the pyrroles project away from the DNA and the peptide N-H groups form hydrogen bonds with the DNA. PMID:281697

  20. Overview of DNA Programs at NIST

    E-print Network

    Biometrics Clinical DNA Laboratory Division Group Team Bioassay Methods Biomaterials Cell Systems Science Material Measurement Laboratory (MML) Materials Science & Engineering Division (642) Materials Measurement Science Division (643) Biosystems & Biomaterials Division (644) Biomolecular Measurement Division (645

  1. DNA Mixture Interpretation & Statistical Analysis

    E-print Network

    DNA Mixture Interpretation & Statistical Analysis NIST Applied Genetics Group National Institute and Resources Available Link to http://www.cstl.nist.gov/biotech/strbase/mixture/SWGDAM-mixture-info.htm http://www.swgdam.org/resources.html #12;Mixture Training Materials Reviewed by SWGDAM Mixture Committee http://www.cstl.nist.gov/biotech/strbase/mixture/SWGDAM-mixture

  2. DNA Microarrays

    NASA Astrophysics Data System (ADS)

    Nguyen, C.; Gidrol, X.

    Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

  3. Research Article DNA barcodes from four loci provide poor resolution

    E-print Network

    Research Article DNA barcodes from four loci provide poor resolution of taxonomic groups, ON, Canada M5S 2C6 3 Canadian Centre for DNA Barcoding, 50 Stone Road East, Guelph, ON, Canada N1G 2W, Lund J, Shipley PR, Stefanovic´ S, Dickinson TA. 2015. DNA barcodes from four loci provide poor

  4. Character-based DNA barcoding allows discrimination of genera, species

    E-print Network

    DeSalle, Rob

    Character-based DNA barcoding allows discrimination of genera, species and populations in Odonata J 06520-8104, USA DNA barcoding has become a promising means for identifying organisms of all life stages taxonomic groups cannot be determined. As an alternative, DNA barcoding approaches can be `character based

  5. DNA/RNA Detection Using DNA-Templated Few-Atom Silver Nanoclusters

    PubMed Central

    Obliosca, Judy M.; Liu, Cong; Batson, Robert Austin; Babin, Mark C.; Werner, James H.; Yeh, Hsin-Chih

    2013-01-01

    DNA-templated few-atom silver nanoclusters (DNA/Ag NCs) are a new class of organic/inorganic composite nanomaterials whose fluorescence emission can be tuned throughout the visible and near-IR range by simply programming the template sequences. Compared to organic dyes, DNA/Ag NCs can be brighter and more photostable. Compared to quantum dots, DNA/Ag NCs are smaller, less prone to blinking on long timescales, and do not have a toxic core. The preparation of DNA/Ag NCs is simple and there is no need to remove excess precursors as these precursors are non-fluorescent. Our recent discovery of the fluorogenic and color switching properties of DNA/Ag NCs have led to the invention of new molecular probes, termed NanoCluster Beacons (NCBs), for DNA detection, with the capability to differentiate single-nucleotide polymorphisms by emission colors. NCBs are inexpensive, easy to prepare, and compatible with commercial DNA synthesizers. Many other groups have also explored and taken advantage of the environment sensitivities of DNA/Ag NCs in creating new tools for DNA/RNA detection and single-nucleotide polymorphism identification. In this review, we summarize the recent trends in the use of DNA/Ag NCs for developing DNA/RNA sensors. PMID:25586126

  6. Magnetic tweezers for DNA micromanipulation

    NASA Astrophysics Data System (ADS)

    Haber, Charbel; Wirtz, Denis

    2000-12-01

    We detail the design of an electromagnetic assembly capable of generating a constant magnetic field superimposed to a large magnetic field gradient (between 40 and 100 T/m), which was uniform over a large gap (between 1.5 and 2 cm). Large gaps allowed the use of wide high numerical-aperture lenses to track microspheres attached to DNA molecules with an inverted light microscope. Given the geometric constraints of the microscope, computer-aided design was used to optimize the magnetic field gradient linearity, homogeneity, and amplitude, as well as the arrangement of the magnetic coils, the currents, and the mechanical stability of the assembly. The assembly was used to apply forces of controlled amplitude, direction, and time dependence on superparamagnetic microspheres by using magnetic coils instead of permanent magnets. A streptavidin-coated microsphere was attached to the 3' end of a ?-phage DNA molecule through a single biotin molecule. The 5' end of the ?-phage DNA molecule was tethered to a glass coverslip by conjugating the DNA's overhang to a complementary 12 base-pair primer, which was itself cross-linked to a heterobifunctional group placed on the glass coverslip. By tracking the centroid of this microsphere, the mechanical response of a single ?-phage DNA molecule was measured as a function of the applied magnetic force. The resulting force-extension curve was fitted with the worm-like-chain model to obtain ?-phage DNA's persistence length and contour length, which were in agreement with previous reports.

  7. Optical DNA

    NASA Astrophysics Data System (ADS)

    Vijaywargi, Deepak; Lewis, Dave; Kirovski, Darko

    A certificate of authenticity (COA) is an inexpensive physical object with a random and unique structure S which is hard to near-exactly replicate. An inexpensive device should be able to scan object’s physical “fingerprint,” a set of features that represents S. In this paper, we explore one set of requirements that optical media such as DVDs should satisfy, to be considered as COAs. As manufacturing of such media produces inevitable errors, we use the locations and count of these errors as a “fingerprint” for each optical disc: its optical DNA. The “fingerprint” is signed using publisher’s private-key and the resulting signature is stored onto the optical medium using a post-production process. Standard DVD players with altered firmware that includes publisher’s public-key, should be able to verify the authenticity of DVDs protected with optical DNA. Our key finding is that for the proposed protocol, only DVDs with exceptional wear-and-tear characteristics would result in an inexpensive and viable anti-counterfeiting technology.

  8. Energy transport in crystalline DNA composites

    SciTech Connect

    Xu, Zaoli; Xu, Shen; Tang, Xiaoduan; Wang, Xinwei

    2014-01-15

    This work reports on the synthesis of crystalline DNA-composited films and microfibers, and details the study of thermal energy transport in them. The transient electro-thermal technique is used to characterize the thermal transport in DNA composite microfibers, and the photothermal technique is used to explore the thermal transport in the thickness direction of DNA films. Compared with microfibers, the DNA films are found to have a higher thermal transport capacity, largely due to the carefully controlled crystallization process in film synthesis. In high NaCl concentration solutions, the bond of the Na{sup +} ion and phosphate group aligns the DNA molecules with the NaCl crystal structure during crystallization. This results in significant enhancement of thermal transport in the DNA films with aligned structure.

  9. Hyperreflection groups

    E-print Network

    Radcliffe, David G

    2010-01-01

    We introduce the concept of hyperreflection groups, which are a generalization of Coxeter groups. We prove the Deletion and Exchange Conditions for hyperreflection groups, and we discuss special subgroups and fundamental sectors of hyperreflection groups. In the second half of the paper, we prove that Coxeter groups and graph products of groups are examples of hyperreflection groups.

  10. DNA barcoding of billfishes.

    PubMed

    Hanner, Robert; Floyd, Robin; Bernard, Andrea; Collette, Bruce B; Shivji, Mahmood

    2011-10-01

    DNA barcoding is a method promising fast and accurate identification of animal species based on the sequencing of the mitochondrial c oxidase subunit (COI) gene. In this study, we explore the prospects for DNA barcoding in one particular fish group, the billfishes (suborder Xiphioidei--swordfish, marlins, spearfishes, and sailfish). We sequenced the mitochondrial COI gene from 296 individuals from the 10 currently recognized species of billfishes, and combined these data with a further 57 sequences from previously published projects. We also sequenced the rhodopsin gene from a subset of 72 individuals to allow comparison of mitochondrial results against a nuclear marker. Five of the 10 species are readily distinguishable by COI barcodes. Of the rest, the striped marlin (Kajikia audax) and white marlin (K. albida) show highly similar sequences and are not unambiguously distinguishable by barcodes alone, likewise are the three spearfishes Tetrapturus angustirostris, T. belone, and T. pfluegeri. We discuss the taxonomic status of these species groups in light of our and other data, molecular and morphological. PMID:21980985

  11. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P. (Danville, CA)

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  12. DNA modifications: Another stable base in DNA

    NASA Astrophysics Data System (ADS)

    Brazauskas, Pijus; Kriaucionis, Skirmantas

    2014-12-01

    Oxidation of 5-methylcytosine has been proposed to mediate active and passive DNA demethylation. Tracking the history of DNA modifications has now provided the first solid evidence that 5-hydroxymethylcytosine is a stable epigenetic modification.

  13. DNA systematics. Volume II

    SciTech Connect

    Dutta, S.K.

    1986-01-01

    This book discusses the following topics: PLANTS: PLANT DNA: Contents and Systematics. Repeated DNA Sequences and Polyploidy in Cereal Crops. Homology of Nonrepeated DNA Sequences in Phylogeny of Fungal Species. Chloropast DNA and Phylogenetic Relationships. rDNA: Evolution Over a Billion Years. 23S rRNA-derived Small Ribosomal RNAs: Their Structure and Evolution with Reference to Plant Phylogeny. Molecular Analysis of Plant DNA Genomes: Conserved and Diverged DNA Sequences. A Critical Review of Some Terminologies Used for Additional DNA in Plant Chromosomes and Index.

  14. DNA encoding a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  15. Mammalian cell DNA replication.

    PubMed

    Hickey, R J; Malkas, L H

    1997-01-01

    The precise mechanisms involved in the regulation of the mammalian cell DNA-synthesizing machinery are poorly understood. In vitro DNA replication systems, in particular the employment of the simian virus 40 (SV40)-based cell-free DNA replication system, has identified several mammalian enzymes and proteins required for DNA synthesis. Although these proteins have been identified as playing a role in DNA replication, their functional organization allowing for the efficient replication of DNA has not been well defined. This review describes the proteins that have currently been defined as having a role in mammalian DNA replication and their proposed mechanisms of action. How these proteins may organize themselves to form multiprotein complexes, or larger DNA replication factories, allowing for efficient chromosomal DNA synthesis is discussed. In addition, the cell cycle regulation of mammalian DNA synthesis and the current status concerning mammalian DNA replication origins is described. PMID:9034719

  16. DNA Binding Hydroxyl Radical Probes

    PubMed Central

    Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

    2011-01-01

    The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA. PMID:22125376

  17. Sirtuins, Metabolism, and DNA repair

    PubMed Central

    Choi, Jee-Eun; Mostoslavsky, Raul

    2014-01-01

    Cells evolve to actively coordinate nutrient availability with cellular activity in order to maintain metabolic homeostasis. In addition, active pathways to repair DNA damage are crucial to avoid deleterious genomic instability. In recent years, it has become increasingly clear that availability of intermediate metabolites may play an important role in DNA repair, suggesting that these two seemingly distant cellular activities may be highly coordinated. The sirtuin family of proteins now described as deacylases (they can also remove acyl groups other than acetyl moieties), it appears to have evolved to control both metabolism and DNA repair. In this review, we discuss recent advances that lay the foundation to understanding the role of sirtuins in these two biological processes, and the potential crosstalk to coordinate them. PMID:25005742

  18. Origin and differentiation of human mitochondrial DNA.

    PubMed Central

    Excoffier, L; Langaney, A

    1989-01-01

    A recent study of mitochondrial DNA (mtDNA) polymorphism has generated much debate about modern human origins by proposing the existence of an "African Eve" living 200,000 years ago somewhere in Africa. In an attempt to synthesize information concerning human mtDNA genetic polymorphism, all available data on mtDNA RFLP have been gathered. A phylogeny of the mtDNA types found in 10 populations reveals that all types could have issued from a single common ancestral type. The distribution of shared types between continental groups indicates that caucasoid populations could be the closest to an ancestral population from which all other continental groups would have diverged. A partial phylogeny of the types found in five other populations also demonstrates that the myth of an African Eden was based on an incorrect "genealogical tree" of mtDNA types. Two measures of molecular diversity have been computed on all samples on the basis of mtDNA type frequencies, on one hand, and on the basis of the number of polymorphic sites in the samples, on the other. A large discrepancy is found between the two measures except in African populations; this suggests the existence of some differential selective mechanisms. The lapse of time necessary for creating the observed molecular diversity from an ancestral monomorphic population has been calculated and is found generally greater in Oriental and caucasoid populations. Implications concerning human mtDNA evolution are discussed. PMID:2562823

  19. BIOPROSPECTOR: DISCOVERING CONSERVED DNA MOTIFS IN UPSTREAM REGULATORY REGIONS

    E-print Network

    Liu, Jun

    sequencing and DNA microarray analysis of gene expression gives rise to the demand for data-mining tools. Bio in the upstream region of genes in the same expression group. There are generally two strategies for DNA sequence the upstream region of genes in the same expression pattern group and look for sequence motifs. These motifs

  20. DNA restriction patterns and DNA-DNA solution hybridization studies of Frankia isolates from Myrica pennsylvanica (bayberry).

    PubMed

    Bloom, R A; Mullin, B C; Tate, R L

    1989-09-01

    Sixteen Frankia strains were isolated from Myrica pennsylvanica (bayberry) root nodules collected at diverse sites in New Jersey. Restriction pattern analysis of total genomic DNA was used to group the isolates into gel groups, and the genetic relatedness among the isolates was evaluated by DNA-DNA solution hybridization studies. Restriction pattern analysis provided a distinctive reproducible fingerprint for each isolate. Isolates fell into nine separate groups (strain types). More than one strain type was isolated from most sites. Isolates from two different gel groups were found in 3 of 10 nodules examined. Of the 16 isolates, 10 contained extrachromosomal DNA. Six different extrachromosomal DNA banding patterns were found. Genomically similar isolates carried related, but different, banding patterns. DNA hybridization studies indicated that isolates from a single plant species can be minimally related as determined by total genome homology. Homology ranged from 12 to 99%. Highly divergent strains were isolated from the same plant and found to cohabit the same nodule. Thus, this study demonstrated that Frankia strains which infect the same host plant are not only phenotypically different but also genetically diverse. PMID:2802599

  1. Analysis of Diazofluorene DNA Binding and Damaging Activity. DNA Cleavage by a Synthetic Monomeric Diazofluorene

    PubMed Central

    Woo, Christina M.; Ranjan, Nihar; Arya, Dev P.; Herzon, Seth B.

    2014-01-01

    The lomaiviticins and kinamycins are complex DNA damaging natural products that contain a diazofluorene functional group. Herein, we elucidate the influence of skeleton structure, ring and chain isomerization, D-ring oxidation state, and naphthoquinone substitution on DNA binding and damaging activity. We show that the electrophilicity of the diazofluorene appears to be the most significant determinant of DNA damaging activity. These studies identify the monomeric diazofluorene 11 as a potent DNA cleavage agent in tissue culture. The simpler structure of 11 relative to the natural products establishes it as a useful lead for translational studies. PMID:25044348

  2. Retroviral Integrase Structure and DNA Recombination Mechanism

    PubMed Central

    Engelman, Alan; Cherepanov, Peter

    2015-01-01

    SUMMARY Due to the importance of human immunodeficiency virus type 1 (HIV-1) integrase as a drug target, the biochemistry and structural aspects of retroviral DNA integration have been the focus of intensive research during the past three decades. The retroviral integrase enzyme acts on the linear double-stranded viral DNA product of reverse transcription. Integrase cleaves specific phosphodiester bonds near the viral DNA ends during the 3? processing reaction. The enzyme then uses the resulting viral DNA 3?-OH groups during strand transfer to cut chromosomal target DNA, which simultaneously joins both viral DNA ends to target DNA 5?-phosphates. Both reactions proceed via direct transesterification of scissile phosphodiester bonds by attacking nucleophiles: a water molecule for 3? processing, and the viral DNA 3?-OH for strand transfer. X-ray crystal structures of prototype foamy virus integrase-DNA complexes revealed the architectures of the key nucleoprotein complexes that form sequentially during the integration process and explained the roles of active site metal ions in catalysis. X-ray crystallography furthermore elucidated the mechanism of action of HIV-1 integrase strand transfer inhibitors, which are currently used to treat AIDS patients, and provided valuable insights into the mechanisms of viral drug resistance. PMID:25705574

  3. DNA Computing DIVYA TADESERA

    E-print Network

    Dragan, Feodor F.

    4/28/2015 1 DNA Computing BY DIVYA TADESERA Contents Introduction History and its origin Relevancy of DNA computing in 1. Hamilton path problem(NP problem) 2. Cryptography 3. Steganography Advantages #12;4/28/2015 2 Introduction DNA(Deoxyribonucleic acid) is the genetic blueprint of any organism. Strands of DNA

  4. Quantitative DNA fiber mapping

    DOEpatents

    Gray, Joe W. (San Francisco, CA); Weier, Heinz-Ulrich G. (Oakland, CA)

    1998-01-01

    The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

  5. DNA Computing DIVYA TADESERA

    E-print Network

    Dragan, Feodor F.

    DNA Computing BY DIVYA TADESERA #12;Contents Introduction History and its origin Relevancy of DNA computing in 1. Hamilton path problem(NP problem) 2. Cryptography 3. Steganography Advantages #12;Introduction DNA(Deoxyribonucleic acid) is the genetic blueprint of any organism. Strands of DNA are long

  6. Chemical method for introducing haptens on to DNA probes

    SciTech Connect

    Keller, G.H.; Cumming, C.U.; Huang, D.P.; Manak, M.M.; Ting, R.

    1988-05-01

    The authors developed a versatile chemical method of attaching hapten moieties onto DNA, for the construction of nonisotopic DNA probes. The DNA is reacted with N-bromosuccinimide at alkaline pH, resulting in bromination of a fraction of the thymine, guanine, and cytosine residues, with adenine modified to a lesser extent. The bromine is subsequently displaced by a primary amino group, attached to a linker arm. The other end of the linker arm has a detectable group preattached to it. They have labeled cloned hepatitis B viral (HBV) DNA with the hapten 2,4-dinitrophenyl (DNP) and used it in combination with a high affinity rabbit anti-DNP antibody, for the detection of hepatitis B DNA by slot blotting. This probe was sensitive enough to specifically detect 1 x 10/sup -17/ mol (1 x 10/sup 6/ copies) of HBV DNA in total DNA from human serum.

  7. Group Counseling

    ERIC Educational Resources Information Center

    Mahler, Clarence A.

    1971-01-01

    This article reviews the major concerns of group counseling and differentiates among group guidance, group counseling, and group therapy. It also evaluates the research status of group counseling and presents implications for the future of this approach. Comment by Carl E. Thoresen follows. (Author)

  8. [DNA chips].

    PubMed

    Delpech, M

    2000-01-01

    DNA chips represent a miniaturization of the classical system of reverse dot-blot. They consist of a small size support made of plastic or glass or silicium on which probes are synthesized or immobilized. It is thus possible to fix a few thousand or even a hundred of thousands of probes per cm2. Practically the chips are hybridized with the nucleic acid to be studied that has been amplified beforehand by PCR and which is generally labelled by a fluorochrome, either during amplification or after hybridization. After washing the hybrids are detected by a system which most of the time consists of a laser and a confocal microscope interfaced with a computer, but many variations exist. It is thus possible to analyse at the same time a considerable number of sequences. The diagnostic applications are only at the prototype stage. Eventually the chips should allow the identification of any point mutation, or the search for bacteria, viruses or parasites in a very short period of time without preliminary cultures. They should also allow many sorts of typing ranging from infectious agents to HLA. They should become a particularly powerful tool in the search for new medicines and in the revealing of their toxicity. A considerable potential market is also the diagnosis of the predisposition to polygenic diseases or to a particular sensitivity to any chemical substance. In fact the chips are only just beginning to be used. One of the foreseeable developments should be the possibility to study nucleic acids without preliminary amplification and we can hope to eventually have at our disposal very cheap, autonomous integrated systems. The technology could eventually extend to fields other than molecular biology such as immunology or biochemistry. PMID:10673612

  9. lthough forensic DNA testing is well established, experts sometimes disagree about the interpreta-

    E-print Network

    Mueller, Laurence D.

    A lthough forensic DNA testing is well established, experts sometimes disagree about the interpreta. THOMPSON, LAURENCE D. MUELLER, AND DAN E. KRANE 12 Forensic DNA Statistics: Still Controversial In Some Group on DNA Analysis Methods (SWGDAM), a group of forensic scientists chosen by the FBI to propose

  10. Identification of Phytophthora citrophthora with Cloned DNA Probes

    PubMed Central

    Goodwin, P. H.; Kirkpatrick, B. C.; Duniway, J. M.

    1990-01-01

    Two different DNA fragments, one of 2.9 kilobases and the other of 5.1 kilobases, were cloned from Phytophthora citrophthora and showed no homology with DNA from plants and other related fungi. These DNA probes hybridized with DNA from 12 different P. citrophthora isolates obtained from a variety of hosts but did not hybridize with DNA from 6 P. citrophthora isolates obtained from cacao. Southern blot analysis revealed that the probes contained repetitive DNA, and restriction fragment length polymorphisms were identified among several P. citrophthora isolates. Of the isolates tested, two major groups were observed whose genetic similarity correlated with geographical distribution. One of the DNA probes was used to detect P. citrophthora growing from infected citrus roots incubated on semiselective medium. P. citrophthora was not detected by a hybridization assay of total DNA extracted directly from infected roots. Images PMID:16348140

  11. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  12. Tumorigenic DNA viruses

    SciTech Connect

    Klein, G.

    1989-01-01

    The eighth volume of Advances in Viral Oncology focuses on the three major DNA virus groups with a postulated or proven tumorigenic potential: papillomaviruses, animal hepatitis viruses, and the Epstein-Bar virus. In the opening chapters, the contributors analyze the evidence that papillomaviruses and animal hepatitis viruses are involved in tumorigenesis and describe the mechanisms that trigger virus-host cell interactions. A detailed section on the Epstein-Barr virus (EBV) - comprising more than half the book - examines the transcription and mRNA processing patterns of the virus genome; the mechanisms by which EBV infects lymphoid and epithelial cells; the immunological aspects of the virus; the actions of EBV in hosts with Acquired Immune Deficiency Syndrome; and the involvement of EBV in the etiology of Burkitt's lymphoma.

  13. Epigenetics, epidemiology and mitochondrial DNA diseases

    PubMed Central

    Chinnery, Patrick F; Elliott, Hannah R; Hudson, Gavin; Samuels, David C; Relton, Caroline L

    2012-01-01

    Over the last two decades, the mutation of mitochondrial DNA (mtDNA) has emerged as a major cause of inherited human disease. The disorders present clinically in at least 1 in 10?000 adults, but pathogenic mutations are found in approximately 1 in 200 of the background population. Mitochondrial DNA is maternally inherited and there can be marked phenotypic variability within the same family. Heteroplasmy is a significant factor and environmental toxins also appear to modulate the phenotype. Although genetic and biochemical studies have provided part of the explanation, a comprehensive understanding of the incomplete penetrance of these diseases is lacking—both at the population and family levels. Here, we review the potential role of epigenetic factors in the pathogenesis of mtDNA diseases and the contribution that epidemiological approaches can make to improve our understanding in this area. Despite being previously dismissed, there is an emerging evidence that mitochondria contain the machinery required to epigenetically modify mtDNA expression. In addition, the increased production of reactive oxygen species seen in several mtDNA diseases could lead to the epigenetic modification of the nuclear genome, including chromatin remodelling and alterations to DNA methylation and microRNA expression, thus contributing to the diverse pathophysiology observed in this group of diseases. These observations open the door to future studies investigating the role of mtDNA methylation in human disease. PMID:22287136

  14. Ex vivo DNA Assembly

    PubMed Central

    Fisher, Adam B.; Canfield, Zachary B.; Hayward, Laura C.; Fong, Stephen S.; McArthur, George H.

    2013-01-01

    Even with decreasing DNA synthesis costs there remains a need for inexpensive, rapid, and reliable methods for assembling synthetic DNA into larger constructs or combinatorial libraries. Advances in cloning techniques have resulted in powerful in vitro and in vivo assembly of DNA. However, monetary and time costs have limited these approaches. Here, we report an ex vivo DNA assembly method that uses cellular lysates derived from a commonly used laboratory strain of Escherichia coli for joining double-stranded DNA with short end homologies embedded within inexpensive primers. This method concurrently shortens the time and decreases costs associated with current DNA assembly methods. PMID:25024067

  15. Small Molecules, Inhibitors of DNA-PK, Targeting DNA Repair, and Beyond

    PubMed Central

    Davidson, David; Amrein, Lilian; Panasci, Lawrence; Aloyz, Raquel

    2012-01-01

    Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining a major mechanism for the repair of double-strand breaks (DSB) in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK). The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA-PK. Computer based drug design will not only assist in identifying novel functional moieties to replace the metabolically labile morpholino group but will also facilitate the design of molecules to target the DNA-PKcs/Ku80 interface or one of the autophosphorylation sites. PMID:23386830

  16. DNA Repair Gene Polymorphisms and Their Relation With DNA Damage, DNA Repair, and Total Antioxidant Capacity in Childhood Acute Lymphoblastic Leukemia Survivors.

    PubMed

    Dincer, Yildiz; Yüksel, Selin; Batar, Bahadir; Güven, Mehmet; Onaran, Ilhan; Celkan, Tiraje

    2015-07-01

    Oxidative stress and defective DNA repair are major contributory factors in the initiation and progression of carcinogenesis. Chemotherapy and radiotherapy cause oxidative DNA damage, consume antioxidant capacity, and impair DNA repair activity. These effects of chemotherapy and radiotherapy may be contributory factors in the development of secondary malignancy in cancer survivors. Basal, H2O2-induced, and postrepair DNA damage; urinary 8-hydroxydeoxyguanosine level as a marker of oxidatively damaged DNA; and serum total antioxidant capacity were measured; XPD Lys751Gln, XRCC1 Arg399Gln, and XRCC1 Arg194Trp polymorphisms were analyzed in childhood acute lymphoblastic leukemia (ALL) survivors. Basal and H2O2-induced DNA damage were found to be higher in the ALL survivor group versus the control group, however, there was no significant difference between the other parameters. No association was found between the examined parameters and polymorphisms of XPD 751 and XRCC1 399 and both the groups. XRCC1 194Trp allele was found to be associated with a low level of postrepair DNA damage in the ALL survivors. In conclusion, basal DNA damage and susceptibility to oxidation are high in childhood ALL survivors. This situation which may easily lead to occurrence of a secondary cancer does not seem to be a result of deficient DNA repair. PMID:24577548

  17. Group X

    SciTech Connect

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  18. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation.

    PubMed

    Blunt, T; Finnie, N J; Taccioli, G E; Smith, G C; Demengeot, J; Gottlieb, T M; Mizuta, R; Varghese, A J; Alt, F W; Jeggo, P A; Jackson, S P

    1995-03-10

    Murine cells homozygous for the severe combined immune deficiency mutation (scid) and V3 mutant hamster cells fall into the same complementation group and show similar defects in V(D)J recombination and DNA double-stranded break repair. Here we show that both cell types lack DNA-dependent protein kinase (DNA-PK) activity owing to defects in DNA-PKcs, the catalytic subunit of this enzyme. Furthermore, we demonstrate that yeast artificial chromosomes containing the DNA-PKcs gene complement both the DNA repair and recombination deficiencies of V3 cells, and we conclude that DNA-PKcs is encoded by the XRCC7 gene. As DNA-PK binds to DNA ends and is activated by these structures, our findings provide novel insights into V(D)J recombination and DNA repair processes. PMID:7889575

  19. DNA tagged microparticles

    DOEpatents

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  20. Structural Organization of DNA.

    ERIC Educational Resources Information Center

    Banfalvi, Gaspar

    1986-01-01

    Explains the structural organization of DNA by providing information on the primary, secondary, tertiary, and higher organization levels of the molecule. Also includes illustrations and descriptions of sign-inversion and rotating models for supercoiling of DNA. (ML)

  1. T7 DNA polymerase

    SciTech Connect

    Tabor, S.; Richardson, C.C.

    1989-01-03

    A method is described for determining the nucleotide base sequence of a DNA molecule, comprising: annealing the DNA molecule with a primer molecule able to hybridize to the DNA molecule; incubating separate portions of the annealed mixture in at least four vessels, each vessel containing four different deoxynucleoside triphosphates, a processive T7-type DNA polymerase, wherein the polymerase remains bound to the DNA molecule for at least 500 bases before dissociating in an environmental condition used in the extension reaction of a DNA sequencing reaction, separating the DNA products of each incubating reaction according to their size, whereby at least a part of the nucleotide base sequence of the DNA molecule can be determined.

  2. Impacts of degraded DNA on restriction enzyme associated DNA sequencing (RADSeq).

    PubMed

    Graham, Carly F; Glenn, Travis C; McArthur, Andrew G; Boreham, Douglas R; Kieran, Troy; Lance, Stacey; Manzon, Richard G; Martino, Jessica A; Pierson, Todd; Rogers, Sean M; Wilson, Joanna Y; Somers, Christopher M

    2015-11-01

    Degraded DNA from suboptimal field sampling is common in molecular ecology. However, its impact on techniques that use restriction site associated next-generation DNA sequencing (RADSeq, GBS) is unknown. We experimentally examined the effects of in situDNA degradation on data generation for a modified double-digest RADSeq approach (3RAD). We generated libraries using genomic DNA serially extracted from the muscle tissue of 8 individual lake whitefish (Coregonus clupeaformis) following 0-, 12-, 48- and 96-h incubation at room temperature posteuthanasia. This treatment of the tissue resulted in input DNA that ranged in quality from nearly intact to highly sheared. All samples were sequenced as a multiplexed pool on an Illumina MiSeq. Libraries created from low to moderately degraded DNA (12-48 h) performed well. In contrast, the number of RADtags per individual, number of variable sites, and percentage of identical RADtags retained were all dramatically reduced when libraries were made using highly degraded DNA (96-h group). This reduction in performance was largely due to a significant and unexpected loss of raw reads as a result of poor quality scores. Our findings remained consistent after changes in restriction enzymes, modified fold coverage values (2- to 16-fold), and additional read-length trimming. We conclude that starting DNA quality is an important consideration for RADSeq; however, the approach remains robust until genomic DNA is extensively degraded. PMID:25783180

  3. The Many Sides of DNA.

    ERIC Educational Resources Information Center

    Flannery, Maura C.

    1997-01-01

    Explores the meaning of DNA. Discusses histories of DNA, literature on DNA, the contributions of Max Delbruck and Barbara McClintock, life, views of control, current research, and the language of DNA. Contains 24 references. (JRH)

  4. [Analysis of 16S rDNA sequences and DNA-DNA hybridization of moderately halophilic bacteria from Xinjiang region].

    PubMed

    Zeng, Jing; Dou, Yuetan; Wang, Lei; Yang, Susheng

    2002-04-01

    Based on the previous studies on numerical taxonomy and 16S rDNA PCR-RFLP analysis, the moderately halophilic bacteria isolated from Xinjiang Region constituted a new cluster, and the phylogenetic tree was constructed by comparing with the 16S rDNA sequences of the other moderately halophilic bacteria species. In the phylogenetic tree, most of the reference strains were clustered in a group, and the similarity values of 16S rDNA sequence were above 96%. However, AI-3, Alcanivorax borkumensis and Halobacillus litoralis were clustered in another group, and the similarity value of 16S rDNA sequences between AI-3 and Alcanivorax borkumensis was 96%, and that of 16S rDNA sequences between AI-3 and Halobacillus litoralis was 99%. The results indicated that AI-3 was different from the reference strains in phylogeny. The values of DNA homology in the new cluster were more than 70%, but the value between AI-3 and Halomonas elongata was less than 50%. Thus, the strain AI-3 possibly represent a new moderately halophilic bacteria species. PMID:12557387

  5. Optimal Placement of Origins for DNA Replication

    E-print Network

    Jens Karschau; J. Julian Blow; Alessandro P. S. de Moura

    2012-02-02

    DNA replication is an essential process in biology and its timing must be robust so that cells can divide properly. Random fluctuations in the formation of replication starting points, called origins, and the subsequent activation of proteins lead to variations in the replication time. We analyse these stochastic properties of DNA and derive the positions of origins corresponding to the minimum replication time. We show that under some conditions the minimization of replication time leads to the grouping of origins, and relate this to experimental data in a number of species showing origin grouping.

  6. Inhibitory effect of oxymatrine on serum hepatitis B virus DNA in HBV transgenic mice

    PubMed Central

    Lu, Lun-Gen; Zeng, Min-De; Mao, Yi-Min; Fang, Jing-Yuan; Song, Yu-Lin; Shen, Zhao-Hui; Cao, Ai-Ping

    2004-01-01

    AIM: To study the inhibitory effect of oxymatrine on serum hepatitis B virus (HBV) DNA in HBV transgenic mice. METHODS: HBV transgenic mice model was established by microinjection, and identified by HBV DNA integration and replication. Transgenic mice with replicating HBV were divided into 3 groups, and injected with normal saline (group A, n = 9), 50 mg/kg (group B, n = 8) and 100 mg/kg (group C, n = 9) oxymatrine intraperitoneally once a day for 30 d, respectively. Quantitation of serum HBV DNA in HBV transgenic mice was performed by competitive polymerase chain reaction (PCR) in combination with DNA hybridization quantitative detection technique before and after treatment. RESULTS: Compared with pre-treatment, the serum HBV DNA in group A (F = 1.04, P = 0.9612) and group B (F = 1.13, P = 0.8739) had no changes after treatment. However, in group C serum HBV DNA was significantly decreased (F = 13.97, P = 0.0012). The serum HBV DNA after treatment was lower in group C than in groups B and A (F = 8.65, P = 0.0068; F = 12.35, P = 0.0018; respectively). The serum HBV DNA after treatment was lower in group B than in group A, but there was no statistical significance (F = 1.43, P = 0.652). CONCLUSION: Oxymatrine has inhibitory effects on serum HBV DNA in HBV transgenic mice. PMID:15069721

  7. DNA profiling of sugarcane genotypes using randomly amplified polymorphic DNA.

    PubMed

    Tabasum, S; Khan, F A; Nawaz, S; Iqbal, M Z; Saeed, A

    2010-01-01

    DNA profiles of 40 sugarcane genotypes were constructed with 30 RAPD markers. Sugarcane genotypes of both Saccharum officinarum and S. barberi were included in this study. Multiple alleles were detected from each RAPD; there was a high level of polymorphism. On average, 7.93 alleles were produced per primer, giving a total of 238 alleles. The genetic distances between these genotypes were assessed with the POPGENE DNA sequence analysis software. A dendrogram was constructed from these data; cultivated species of sugarcane formed clusters with S. barberi genotypes. The 40 genotypes were clustered into two main groups; genetic distances ranged from 20.29 to 64.66%. These RAPD fingerprints will help sugarcane breeders to evaluate the efficiency of current conventional breeding methods and will help characterize the genetic pedigree of commercial sugarcane varieties. These data will also be valuable for conservation and utilization of the genetic resources in germplasm collections. PMID:20391332

  8. Food Groups

    MedlinePLUS

    ... About the Protein Foods Group Nutrients and Health Benefits Vegetarian Choices Tips for Making Wise Choices Food Gallery Dairy All About the Dairy Group Nutrients and Health Benefits Non-Dairy Sources of Calcium Tips to Making ...

  9. Comparative studies of UV-induced DNA cleavage by structural isomers of an iodinated DNA ligand

    SciTech Connect

    Martin, R.F.; Green, A.; Denison, L.; Pardee, M.; Kelly, D.P.; Roberts, M.; Rose, M.; Reum, M.

    1994-06-15

    The purpose was to evaluate the importance of the position of the halogen atom in iodinated DNA-binding bibenzimidazoles, with respect to sensitization of UV-A-induced DNA breakage. Three analogues of iodoHoechst 33258, denoted ortho-, meta- and paraiodoHoechst, according to the site of iodine substitution, were synthesized. Plasmid DNA (pBR322) was used to assay UV-A-induced DNA single-strand breaks (ssbs). The location of the sites of strand breakage was determined by DNA sequencing gel analysis, using a [sup 32]P-endlabelled oligoDNA with a single binding site for the ligands. A clear trend in decreasing activity of sensitization of UV-induced DNA ssbs was established: Ortho- > meta-, para- > iodoHoechst 33258. The sequencing gel studies showed that orthoiodoHoechst was distinct from the other three compounds, with respect to the sites of DNA strand breakage and the chemistry of the cleavage reaction. The position of iodine substitution in iodinated bibenzimidazoles determines the location of the carbon-centered radical on the ligand in the minor groove of DNA. DNA strand cleavage is mediated by abstraction of a nearby deoxyribosyl H-atom. Hence, the position of the radical species determines: which deoxyribosyl group is attacked (i.e., site of cleavage relative to the ligand binding site); which H-atom is abstracted, more specifically which of the five deoxyribosyl carbons is involved (i.e., the chemistry of the cleavage reaction), and the stereochemistry of the transition state for the H-atom abstraction (and hence the efficiency or extent of strand breakage). The ortho-compound represents the best example to date of iodinated DNA ligands designed as potential radiation sensitizers, as an extension of the well-established sensitization by halogenated DNA precursors. 30 refs., 3 figs.

  10. Normed ?-Group

    E-print Network

    Aleks Kleyn

    2013-10-17

    Since sum which is not necessarily commutative is defined in \\Omega-algebra A, then \\Omega-algebra A is called \\Omega-group. I also considered representation of \\Omega-group. Norm defined in \\Omega-group allows us to consider continuity of operations and continuity of representation.

  11. DNAzymes in DNA Nanomachines and DNA Analysis

    NASA Astrophysics Data System (ADS)

    He, Yu; Tian, Ye; Chen, Yi; Mao, Chengde

    This chapter discusses our efforts in using DNAzymes in DNA nano-machines and DNA analysis systems. 10-23 DNAzymes can cleave specific phos-phodiester bonds in RNA. We use them to construct an autonomous DNA-RNA chimera nanomotor, which constantly extracts chemical energy from RNA substrates and transduces the energy into a mechanical motion: cycles of contraction and extension. The motor's motion can be reversibly turned on and off by a DNA analogue (brake) of the RNA substrate. Addition and removal of the brake stops and restarts, respectively, the motor's motion. Furthermore, when the RNA substrates are preorganized into a one-dimensional track, a DNAzyme can continuously move along the track so long as there are substrates available ahead. Based on a similar mechanism, a novel DNA detection system has been developed. A target DNA activates a DNAzyme to cleave RNA-containing molecular beacons (MB), which generates an enhanced fluorescence signal. A following work integrates two steps of signal amplifications: a rolling-circle amplification (RCA) to synthesize multiple copies of DNAzymes, and the DNAzymes catalyze a chemical reaction to generate a colorimetric signal. This method allows detection of DNA analytes whose concentration is as low as 1 pM.

  12. Evaluation of DNAstable for DNA storage at ambient temperature.

    PubMed

    Howlett, Susanne E; Castillo, Hilda S; Gioeni, Lora J; Robertson, James M; Donfack, Joseph

    2014-01-01

    Preserving DNA is important for validation of prospective and retrospective analyses, requiring many expensive types of equipment (e.g., freezers and back-up generators) and energy. While freezing is the most common method for storing extracted DNA evidence or well-characterized DNA samples for validation studies, DNAstable (Biomatrica), a commercially available medium for room temperature storage of DNA extracts was evaluated in this study. Two groups of samples consisting of different DNA quantities were investigated, one ranging from 20 to 400 ng (group 1) and the other one ranging from 1.4 to 20 ng (group 2). The DNA samples with and without DNAstable were stored at four different temperatures [?25 °C (room temperature), -20 °C, 37 °C or 50 °C]. DNA degradation over several months was monitored by SYBR Green-based qPCR assays and by PCR amplification of the core CODIS STR markers for group 1 and 2 DNA samples, respectively. For the time points tested in this study (up to 365 days), the findings indicate that the -20 °C controls and the DNAstable protected samples at room temperature provided similar DNA recoveries that were higher compared to the unprotected controls kept at RT, 37 °C or 50 °C. These results suggest that DNAstable can protect DNA samples with effectiveness similar to that of the traditional -20 °C freezing method. In addition, extrapolations from accelerated aging experiments conducted at high temperatures support that DNAstable is an effective technology for preserving purified DNA at room temperature with a larger protective impact on DNA samples of low quantity (<20 ng). PMID:24315605

  13. Functionalizing Designer DNA Crystals

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    Three-dimensional crystals have been self-assembled from a DNA tensegrity triangle via sticky end interaction. The tensegrity triangle is a rigid DNA motif containing three double helical edges connected pair-wise by three four-arm junctions. The symmetric triangle contains 3 unique strands combined in a 3:3:1 ratio: 3 crossover, 3 helical and 1 central. The length of the sticky end reported previously was two nucleotides (nt) (GA:TC) and the motif with 2-helical turns of DNA per edge diffracted to 4.9 A at beam line NSLS-X25 and to 4 A at beam line ID19 at APS. The purpose of these self-assembled DNA crystals is that they can be used as a framework for hosting external guests for use in crystallographic structure solving or the periodic positioning of molecules for nanoelectronics. This thesis describes strategies to improve the resolution and to incorporate guests into the 3D lattice. The first chapter describes the effect of varying sticky end lengths and the influence of 5'-phosphate addition on crystal formation and resolution. X-ray diffraction data from beam line NSLS-X25 revealed that the crystal resolution for 1-nt (G:C) sticky end was 3.4 A. Motifs with every possible combination of 1-nt and 2-nt sticky-ended phosphorylated strands were crystallized and X-ray data were collected. The position of the 5'-phosphate on either the crossover (strand 1), helical (strand 2), or central strand (3) had an impact on the resolution of the self-assembled crystals with the 1-nt 1P-2-3 system diffracting to 2.62 A at APS and 3.1 A at NSLS-X25. The second chapter describes the sequence-specific recognition of DNA motifs with triplex-forming oligonucleotides (TFOs). This study examined the feasibility of using TFOs to bind to specific locations within a 3-turn DNA tensegrity triangle motif. The TFO 5'-TTCTTTCTTCTCT was used to target the tensegrity motif containing an appropriately embedded oligopurine.oligopyrimidine binding site. As triplex formation involving cytidine nucleotides is usually pH dependent (pH < 6) four different TFOs were examined: TFO-1 was unmodified while TFOs 2-4 contained additional stabilizing analogues capable of extending triplex formation to pH 7. In addition, each of the TFOs contained a Cy5 dye at the 5'-end of the oligonucleotide to aid in characterization of TFO binding - crystals were obtained with all four variations of TFOs. Formation of DNA triplex in the motif was characterized by an electrophoretic mobility shift assay (EMSA), UV melting studies and FRET. Crystals containing TFO-1 (unmodified) and TFO-2 (with 2'-amino ethoxy modification) were isolated and flash-frozen in liquid nitrogen for X-ray data collection at beam line NSLS-X25. X-ray data was also collected for crystals of the 3-turn triangle without any TFO bound to it. Difference maps were done between the crystals with TFO against the one without to identify any additional electron density corresponding to the third strand in the triplex binding region. The data from the crystal containing TFO-2 was used to further analyze if the additional density can match the expected position of the TFO on the triangle motif. Since the additional density did not correspond to the entire binding region, 2Fo-Fc, 3Fo-2Fc and 4Fo-3Fc maps were done to check for missing pieces of the electron density. From the resulting 2Fo-Fc map, the asymmetric unit from the 3-turn triangle (31-bp duplex model based on previous structure 3UBI) was inserted into the density as a reference. However, the electron density corresponding to the TFO was still not continuous throughout the 13-nt triplex binding region and allowed only a partial fit of the TFO. The third nucleotide in positions 1, 3, 4, 6, 7 were fit into the density in the major groove of the underlying duplex with proper triplex configuration. The third chapter describes the triplex approach to position a functional group (the UV cross-linking agent psoralen) within a pre-formed DNA motif. Triplex formation and psoralen cross-linking of the motif were analyzed by native and denaturing gel electropho

  14. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  15. DNA Sequencing apparatus

    DOEpatents

    Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

    1992-01-01

    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  16. Galaxy groups

    SciTech Connect

    Brent Tully, R.

    2015-02-01

    Galaxy groups can be characterized by the radius of decoupling from cosmic expansion, the radius of the caustic of second turnaround, and the velocity dispersion of galaxies within this latter radius. These parameters can be a challenge to measure, especially for small groups with few members. In this study, results are gathered pertaining to particularly well-studied groups over four decades in group mass. Scaling relations anticipated from theory are demonstrated and coefficients of the relationships are specified. There is an update of the relationship between light and mass for groups, confirming that groups with mass of a few times 10{sup 12}M{sub ?} are the most lit up while groups with more and less mass are darker. It is demonstrated that there is an interesting one-to-one correlation between the number of dwarf satellites in a group and the group mass. There is the suggestion that small variations in the slope of the luminosity function in groups are caused by the degree of depletion of intermediate luminosity systems rather than variations in the number per unit mass of dwarfs. Finally, returning to the characteristic radii of groups, the ratio of first to second turnaround depends on the dark matter and dark energy content of the universe and a crude estimate can be made from the current observations of ?{sub matter}?0.15 in a flat topology, with a 68% probability of being less than 0.44.

  17. DNA in Nanoscale Electronics

    NASA Astrophysics Data System (ADS)

    Slinker, Jason

    2012-10-01

    DNA, the quintessential molecule of life, possesses a number of attractive properties for use in nanoscale circuits. Charge transport (CT) through DNA itself is of both fundamental and practical interest. Fundamentally, DNA has a unique configuration of ?-stacked bases in a well ordered, double helical structure. Given its unparalleled importance to life processes and its arrangement of conjugated subunits, DNA has been a compelling target of conductivity studies. In addition, further understanding of DNA CT will elucidate the biological implications of this process and advance its use in sensing technologies. We have investigated the fundamentals of DNA CT by measuring the electrochemistry of DNA monolayers under biologically-relevant conditions. We have uncovered both fundamental kinetic parameters to distinguish between competing models of operation as well as the practical implications of DNA CT for sensing. Furthermore, we are leveraging our studies of DNA conductivity for the manufacture of nanoscale circuits. We are investigating the electrical properties and self-assembly of DNA nanowires containing artificial base pair surrogates, which can be prepared through low cost and high throughput automated DNA synthesis. This unique and economically viable approach will establish a new paradigm for the scalable manufacture of nanoscale semiconductor devices.

  18. Electronic Transport in DNA

    PubMed Central

    Klotsa, Daphne; Römer, Rudolf A.; Turner, Matthew S.

    2005-01-01

    We study the electronic properties of DNA by way of a tight-binding model applied to four particular DNA sequences. The charge transfer properties are presented in terms of localization lengths (crudely speaking, the length over which electrons travel). Various types of disorder, including random potentials, are employed to account for different real environments. We have performed calculations on poly(dG)-poly(dC), telomeric-DNA, random-ATGC DNA, and ?-DNA. We find that random and ?-DNA have localization lengths allowing for electron motion among a few dozen basepairs only. A novel enhancement of localization lengths is observed at particular energies for an increasing binary backbone disorder. We comment on the possible biological relevance of sequence-dependent charge transfer in DNA. PMID:16040753

  19. DNA analysis in nanochannels

    NASA Astrophysics Data System (ADS)

    Tegenfeldt, Jonas O.; Cao, Han; Prinz, Christelle; Yu, Zhaoning; Austin, Robert H.; Cox, Edward C.; Chou, Stephen Y.; Sturm, James C.

    2003-03-01

    Measuring the length distribution of a DNA sample is a fundamental problem in molecular biology. Standard gel-based approaches require large amounts of sample and become prohibitively slow for long DNA molecules. We use nanochannels fabricated using nanoimprinting lithography and silica-silica direct bonding to stretch DNA molecules and measure their length to arbitrary precision. Compared to the timescale of days it takes to analyze large DNA in PFGE, our approach takes a few minutes and gives superior resolution with just a few femtograms of DNA. The technique can be further developed to serve as a general visualization tool for DNA that has been labeled using sequence specific probes for e.g. mapping, SNP analysis, and studies of protein-DNA interactions.

  20. DNA: structure, dense phases, charges, interactions

    E-print Network

    Potsdam, Universität

    DNA: structure, dense phases, charges, interactions #12;Outline 1. DNA: structure, charges, dense phases 2. Counterion and DNA condensation 3. ES DNA-DNA interactions 4. DNA toroidal structures 5. Interactions of real DNA helices 6. DNA-DNA ES recognition 7. DNA melting in aggregates 8. Azimuthal

  1. Cationic porphyrins as probes of DNA structure.

    PubMed Central

    Bromley, S D; Ward, B W; Dabrowiak, J C

    1986-01-01

    The DNA binding specificity of a group of cationic manganese porphyrin complexes has been examined using DNase I footprinting methodology and by observing the sites of porphyrin-induced DNA strand scission in the presence of potassium superoxide. The compounds, which possess systematic changes in total charge, its distribution on the periphery on the macrocycle and ligand shape, bind in the minor groove of AT rich regions of DNA. While changes in total charge and charge arrangement do not significantly influence specificity, a shape change which blocks close ligand contact with the minor groove relaxes the original AT specificity causing the compound to cleave at both AT and GC sites. The observed changes in binding sequence specificity were interpreted in terms of electrostatic and steric factors associated with both the compounds and DNA. PMID:3786148

  2. Heterobifunctional modification of DNA for conjugation to solid surfaces

    PubMed Central

    Lim, Hana I.; Oliver, Piercen M.; Marzillier, Jutta; Vezenov, Dmitri V.

    2010-01-01

    Many biosensors, DNA arrays, and next-generation DNA sequencing technologies need common methods for end modification of random DNA sequences generated from a sample of DNA. Surface immobilization of chemically modified DNA is often the first step in creating appropriate sensing platforms. We describe a simple technique for efficient heterobifunctional modification of arbitrary double-stranded DNA fragments with chosen chemical groups. The modification requires the use of short (10–20 base pairs) synthetic adaptors having desired terminal functional groups and installs known sequences, which can be used for hybridization of primers in the sequencing-by-synthesis approaches. The method, based on ligation under optimized conditions, is selective and provides high yields of the target heterobifunctional DNA product. An additional two-step procedure can be applied to select further for the desired bifunctionalized product using PCR amplification with a chemically modified primer. Both functional groups in the modified DNA are chemically active and can be used in surface immobilization of the DNA strands to create the surface of a biosensor or sequencing chip. PMID:20422158

  3. Whitehead Groups of Spinor Groups

    NASA Astrophysics Data System (ADS)

    Monastyrny?, A. P.; Yanchevski?, V. I.

    1991-02-01

    The Whitehead groups of spinor groups are studied. The known Kneser-Tits conjecture for spinor groups is reduced to a spinor analogue of the Tannaka-Artin problem, namely, to the question of whether the group K1Spin(D), where D is a division ring of exponent 2 , is trivial. A counterexample to the Kneser-Tits problem is constructed in the class of spinor groups. The group K1Spin(D) is computed. The stability of the Whitehead groups of spinor groups under purely transcendental extensions of the ground field is established. The R-equivalence on the k-points of spinor groups and the weak approximation problem are considered. The study of spinor group completes the study of the Whitehead groups of algebraic groups of classical type, that was started in studying reduced K-theory (V.P. Platonov) and was continued for reduced unitary K-theory (V.I. Yanchevski?) and Hermitian K-theory (Platonov and Yanchevski?). Bibliography: 50 titles.

  4. GROUP INEQUALITY

    PubMed Central

    Bowles, Samuel; Loury, Glenn C.; Sethi, Rajiv

    2014-01-01

    We explore the combined effect of segregation in social networks, peer effects, and the relative size of a historically disadvantaged group on the incentives to invest in market-rewarded skills and the dynamics of inequality between social groups. We identify conditions under which group inequality will persist in the absence of differences in ability, credit constraints, or labor market discrimination. Under these conditions, group inequality may be amplified even if initial group differences are negligible. Increases in social integration may destabilize an unequal state and make group equality possible, but the distributional and human capital effects of this depend on the demographic composition of the population. When the size of the initially disadvantaged group is sufficiently small, integration can lower the long-run costs of human capital investment in both groups and result in an increase the aggregate skill share. In contrast, when the initially disadvantaged group is large, integration can induce a fall in the aggregate skill share as the costs of human capital investment rise in both groups. We consider applications to concrete cases and policy implications. PMID:25554727

  5. ASSESSING THE EFFECTS OF HIGH METHIONINE INTAKE ON DNA METHYLATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Methylation of DNA occurs at cytosines within CpG (cytosine-guanine) dinucleotides and is one of several epigenetic mechanisms that serve to establish and maintain tissue-specific patterns of gene expression. The methyl groups transferred in mammalian DNA methylation reactions are ultimately derived...

  6. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    PubMed Central

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (<100 ?M) formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  7. The centipede genus Eupolybothrus Verhoeff, 1907 (Chilopoda: Lithobiomorpha: Lithobiidae) in North Africa, a cybertaxonomic revision, with a key to all species in the genus and the first use of DNA barcoding for the group

    PubMed Central

    Stoev, Pavel; Akkari, Nesrine; Zapparoli, Marzio; Porco, David; Enghoff, Henrik; Edgecombe, Gregory D.; Georgiev, Teodor; Penev, Lyubomir

    2010-01-01

    Abstract The centipede genus Eupolybothrus Verhoeff, 1907 in North Africa is revised. A new cavernicolous species, Eupolybothrus kahfi Stoev & Akkari, sp. n., is described from a cave in Jebel Zaghouan, northeast Tunisia. Morphologically, it is most closely related to Eupolybothrus nudicornis (Gervais, 1837) from North Africa and Southwest Europe but can be readily distinguished by the long antennae and leg-pair 15, a conical dorso-median protuberance emerging from the posterior part of prefemur 15, and the shape of the male first genital sternite. Molecular sequence data from the cytochrome c oxidase I gene (mtDNA–5’ COI-barcoding fragment) exhibit 19.19% divergence between Eupolybothrus kahfi and Eupolybothrus nudicornis, an interspecific value comparable to those observed among four other species of Eupolybothrus which, combined with a low intraspecific divergence (0.3–1.14%), supports the morphological diagnosis of Eupolybothrus kahfi as a separate species. This is the first troglomorphic myriapod to be found in Tunisia, and the second troglomorph lithobiomorph centipede known from North Africa. Eupolybothrus nudicornis is redescribed based on abundant material from Tunisia and its post-embryonic development, distribution and habitat preferences recorded. Eupolybothrus cloudsley-thompsoni Turk, 1955, a nominal species based on Tunisian type material, is placed in synonymy with Eupolybothrus nudicornis. To comply with the latest technological developments in publishing of biological information, the paper implements new approaches in cybertaxonomy, such as fine granularity XML tagging validated against the NLM DTD TaxPub for PubMedCentral and dissemination in XML to various aggregators (GBIF, EOL, Wikipedia), vizualisation of all taxa mentioned in the text via the dynamically created Pensoft Taxon Profile (PTP) page, data publishing, georeferencing of all localities via Google Earth, and ZooBank, GenBank and MorphBank registration of datasets. An interactive key to all valid species of Eupolybothrus is made with DELTA software. PMID:21594115

  8. Thermodynamics of cationic lipid binding to DNA and DNA condensation: roles of electrostatics and hydrophobicity.

    PubMed

    Matulis, Daumantas; Rouzina, Ioulia; Bloomfield, Victor A

    2002-06-26

    Alkylammonium binding to DNA was studied by isothermal titration calorimetry. Experimental data, obtained as functions of alkyl chain length, salt concentration, DNA concentration, and temperature, provided a detailed thermodynamic description of lipid-DNA binding reactions leading to DNA condensation. Lipid binding, counterion displacement, and DNA condensation were highly cooperative processes, driven by a large increase in entropy and opposed by a relatively small endothermic enthalpy at room temperature. Large negative heat capacity change indicated a contribution from hydrophobic interactions between aliphatic tails. An approximation of lipid-DNA binding as dominated by two factors-ionic and hydrophobic interactions-yielded a model that was consistent with experimental data. Chemical group contributions to the energetics of binding were determined and could be used to predict energetics of other lipid binding to DNA. Electrostatic and hydrophobic contributions to Gibbs free energy, enthalpy, entropy, and heat capacity could be distinguished by applying additivity principles. Binding of lipids with two, three, and four aliphatic tails was investigated and compared to single-tailed lipid binding. Structurally, the model suggests that lipid cationic headgroups and aliphatic tails distribute evenly and lay down on DNA surface without the formation of micelles. PMID:12071742

  9. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L. (Pleasanton, CA)

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  10. Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules.

    PubMed

    Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

    2013-10-01

    DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2'-deoxyadenosine and 2'-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2'-deoxycytidine lesions form the base pair with guanine while the 2'-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

  11. [Mitochondrial DNA variation in Asian guardian dogs].

    PubMed

    Riabinina, O M

    2006-07-01

    The hypervariable site of the mitochondrial DNA (mtDNA) control region has been studied in several sheepdog breeds. The genetic diversity is high in the Central Asian guardian dog and the Northern Caucasian wolf dog (an aboriginal group of breeds) and low in the Caucasian guardian dog. Haplotypes of groups A, B, C, and E/W have been found in Central Asian guardian dogs; haplotypes of groups A and B, in Caucasian guardian dogs. There is evidence suggesting a gene flow from Scandinavian dog populations to the Northern Caucasus. The results of the analysis allow the Caucasian guardian dog, Northern Caucasian wolf dog, Central Asian guardian dog, and the Turkish breeds akbash and kangal to be combined into a single group with an extremely low degree of differentiation. PMID:16915922

  12. Molecular biology - Methylation talk between histones and DNA 

    E-print Network

    Bird, Adrian P

    2001-01-01

    The addition of methyl groups to DNA or histones is a way to directly or indirectly silence gene expression. Although the two events are conceivably connected, they have always been studied separately. In his Perspective, ...

  13. DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

    PubMed Central

    Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

    2014-01-01

    Background Many studies have shown the suitability of sequence variation in the 5? region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

  14. Hierarchical-Multiplex DNA Patterns Mediated by Polymer Brush Nanocone Arrays That Possess Potential Application for Specific DNA Sensing.

    PubMed

    Liu, Wendong; Liu, Xueyao; Ge, Peng; Fang, Liping; Xiang, Siyuan; Zhao, Xiaohuan; Shen, Huaizhong; Yang, Bai

    2015-11-11

    This paper provides a facile and cost-efficient method to prepare single-strand DNA (ssDNA) nanocone arrays and hierarchical DNA patterns that were mediated by poly(2-hydroxyethyl methacrylate) (PHEMA) brush. The PHEMA brush nanocone arrays with different morphology and period were fabricated via colloidal lithography. The hierarchical structure was prepared through the combination of colloidal lithography and traditional photolithography. The DNA patterns were easily achieved via grafting the amino group modified ssDNA onto the side chain of polymer brush, and the anchored DNA maintained their reactivity. The as-prepared ssDNA nanocone arrays can be applied for target DNA sensing with the detection limit reaching 1.65 nM. Besides, with the help of introducing microfluidic ideology, the hierarchical-multiplex DNA patterns on the same substrate could be easily achieved with each kind of pattern possessing one kind of ssDNA, which are promising surfaces for the preparation of rapid, visible, and multiplex DNA sensors. PMID:26497053

  15. Automata groups 

    E-print Network

    Muntyan, Yevgen

    2010-01-16

    constructed finite au- tomata which generate infinite torsion groups [Ale72, Sus79, Gri80, GS83]. Later R.I. Grigorchuk proved that the groups he constructed have intermediate growth be- tween polynomial and exponential, providing a solution to Milnor Problem...

  16. Hydra groups

    E-print Network

    Dison, Will

    2010-01-01

    We give examples of CAT(0), biautomatic, free-by-cyclic, one-relator groups which have finite-rank free subgroups of huge (Ackermannian) distortion. This leads to elementary examples of groups whose Dehn functions are similarly extravagant. This behaviour originates in manifestations of Hercules-versus-the-hydra battles in string-rewriting.

  17. Group Theatre.

    ERIC Educational Resources Information Center

    Clark, Brian

    The group interpretation approach to theatre production is defined as a method that will lead to production of plays that will appeal to "all the layers of the conscious and unconscious mind." In practice, it means that the group will develop and use resources of the theatre that orthodox companies too often ignore. The first two chapters of this…

  18. Revealing the competition between peeled ssDNA, melting bubbles, and S-DNA during DNA overstretching

    E-print Network

    Doyle, Patrick S.

    to discoveries of new dsDNA structures such as L-DNA, produced by stretching undertwisted DNA (3), or P-DNA on DNA with open ends (end-opened DNA), which is torsion-unconstrained (5, 6). Since its discovery, threeRevealing the competition between peeled ssDNA, melting bubbles, and S-DNA during DNA

  19. "Photoclick" postsynthetic modification of DNA.

    PubMed

    Arndt, Stefanie; Wagenknecht, Hans-Achim

    2014-12-22

    A new DNA building block bearing a push-pull-substituted diaryltetrazole linked to the 5-position of 2'-deoxyuridine through an aminopropynyl group was synthesized. The accordingly modified oligonucleotide allows postsynthetic labeling with a maleimide-modified sulfo-Cy3 dye, N-methylmaleimide, and methylmethacrylate as dipolarophiles by irradiation at 365?nm (LED). The determined rate constant of (23±7)?M(-1) ?s(-1) is remarkably high with respect to other copper-free bioorthogonal reactions and comparable with the copper-catalyzed cycloaddition between azides and acetylenes. PMID:25359534

  20. DNA microarray technologies for measuring proteinDNA interactions

    E-print Network

    Bulyk, Martha L.

    DNA microarray technologies for measuring protein­DNA interactions Martha L Bulyk DNA approach to analyse the in vitro binding of proteins directly to double-stranded DNA microarrays (protein binding microarrays; PBMs), permits rapid characterization of their DNA binding site sequence

  1. Electrochemical DNA Hybridization Detection Using DNA Dohyoung Kwon,a

    E-print Network

    Kwak, Juhyoun

    Full Paper Electrochemical DNA Hybridization Detection Using DNA Cleavage Dohyoung Kwon,a Kyuwon method for detection of DNA hybridization using enzymatic cleavage. The strategy is based on that S1 nuclease is able to specifically cleave only single strand DNA, but not double strand DNA. The capture

  2. DNA BARCODING Mitochondrial DNA barcoding detects some species that

    E-print Network

    DNA BARCODING Mitochondrial DNA barcoding detects some species that are real, and some; Nymphalidae) difficult to determine. We use mitochondrial DNA (mtDNA) barcoding, nuclear sequences. Although earlier biosystematic studies based on morphology described only four species, mtDNA barcoding

  3. Simulation of DNA Catenanes

    PubMed Central

    Vologodskii, Alexander; Rybenkov, Valentin V.

    2010-01-01

    Summary DNA catenanes are important objects in biology, foremost as they appear during replication of circular DNA molecules. In this review we analyze how conformational properties of DNA catenanes can be studied by computer simulation. We consider classification of catenanes, their topological invariants and the methods of calculation of these invariants. We briefly analyze the DNA model and the simulation procedure used to sample the equilibrium conformational ensemble of catenanes with a particular topology. We consider how to avoid direct simulation of many DNA molecules when we need to account for the linking-unlinking process. The simulation methods and their comparisons with experiments are illustrated by some examples. We also describe an approach that allows simulating the steady state fraction of DNA catenanes created by type II topoisomerases. PMID:20145800

  4. DNA barcoding fishes.

    PubMed

    Weigt, Lee A; Driskell, Amy C; Baldwin, Carole C; Ormos, Andrea

    2012-01-01

    This chapter is an overview of the techniques for DNA barcoding of fishes from field collection to DNA sequence analysis. Recommendations for modifications of field protocols and best tissue sampling practices are made. A variety of DNA extraction protocols is provided, including high-throughput robot-assisted methods. A pair of well-tested forward and reverse primers for PCR amplification and sequencing are presented. These primers have been successfully used for DNA barcode on a wide array of marine fish taxa and also work well in most freshwater and cartilaginous fishes. Recipes and cycling protocols for both PCR amplification and sequencing and cleanup methods for the reaction products are provided. A method for the consistent production of high-quality DNA barcodes from DNA sequence data is given and stringent guidelines for judging the quality of raw sequence data are laid out. PMID:22684954

  5. DNA profiles from fingermarks.

    PubMed

    Templeton, Jennifer E L; Linacre, Adrian

    2014-11-01

    Criminal investigations would be considerably improved if DNA profiles could be routinely generated from single fingermarks. Here we report a direct DNA profiling method that was able to generate interpretable profiles from 71% of 170 fingermarks. The data are based on fingermarks from all 5 digits of 34 individuals. DNA was obtained from the fingermarks using a swab moistened with Triton-X, and the fibers were added directly to one of two commercial DNA profiling kits. All profiles were obtained without increasing the number of amplification cycles; therefore, our method is ideally suited for adoption by the forensic science community. We indicate the use of the technique in a criminal case in which a DNA profile was generated from a fingermark on tape that was wrapped around a drug seizure. Our direct DNA profiling approach is rapid and able to generate profiles from touched items when current forensic practices have little chance of success. PMID:25391915

  6. Electrocatalysis in DNA Sensors.

    PubMed

    Furst, Ariel; Hill, Michael G; Barton, Jacqueline K

    2014-12-14

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

  7. Elasticity of DNA nanowires

    NASA Astrophysics Data System (ADS)

    Gupta, Sanjeev K.; McEwan, Andrew; Luka?evi?, Igor

    2016-01-01

    In this paper, using a theoretical model we bring forth the Young modulus of DNA nanowire (NWs) as a function of diameter considering both equilibrium strain and surface stress effects. A good trend between the present calculated and the available theoretical size-dependent Young modulus of different metallic and semiconducting NWs is found, which supports the DNA NWs mechanical strength. We have extended our view of studied materials to predict the behavior of the DNA NWs and ascertain their resemblance to the behavior of either metallic or semiconducting nature of NWs. We have also demonstrated the variation in Young modulus of the DNA NWs with the variation of relaxed material property of DNA NWs. This study extrapolates key factors in modeling DNA NWs for the electronic device applications.

  8. Multiprotein DNA Looping

    NASA Astrophysics Data System (ADS)

    Vilar, Jose M. G.; Saiz, Leonor

    2006-06-01

    DNA looping plays a fundamental role in a wide variety of biological processes, providing the backbone for long range interactions on DNA. Here we develop the first model for DNA looping by an arbitrarily large number of proteins and solve it analytically in the case of identical binding. We uncover a switchlike transition between looped and unlooped phases and identify the key parameters that control this transition. Our results establish the basis for the quantitative understanding of fundamental cellular processes like DNA recombination, gene silencing, and telomere maintenance.

  9. DNA ELECTROPHORESIS AT SURFACES

    SciTech Connect

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in the different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.

  10. Immune sensing of DNA

    PubMed Central

    Paludan, Søren R.; Bowie, Andrew G.

    2013-01-01

    SUMMARY Although it has been appreciated for some years that cytosolic DNA is immune-stimulatory, it is only in the past five years that the molecular basis of DNA sensing by the innate immune system has begun to be revealed. In particular it has been described how DNA induces type I interferon, central in anti-viral responses and a mediator of autoimmunity. While to date more than 10 cytosolic receptors of DNA have been proposed, STING is a key adaptor protein for most DNA sensing pathways, and we are now beginning to understand the signaling mechanisms for STING. In this review we describe the recent progress in understanding signaling mechanisms activated by DNA and the relevance of DNA sensing to pathogen responses and autoimmunity. We highlight new insights gained into how and why the immune system responds to both pathogen and self DNA, and define important questions that now need to be addressed in the field of innate immune activation by DNA. PMID:23706668

  11. Multiprotein DNA looping

    E-print Network

    Jose M. G. Vilar; Leonor Saiz

    2006-06-19

    DNA looping plays a fundamental role in a wide variety of biological processes, providing the backbone for long range interactions on DNA. Here we develop the first model for DNA looping by an arbitrarily large number of proteins and solve it analytically in the case of identical binding. We uncover a switch-like transition between looped and unlooped phases and identify the key parameters that control this transition. Our results establish the basis for the quantitative understanding of fundamental cellular processes like DNA recombination, gene silencing, and telomere maintenance.

  12. Investigating the Role of Vitamin D and DNA Repair in Influencing Cancer Presentation and Outcomes 

    E-print Network

    Syed, Moinuddin Mohammed

    2014-09-26

    in (http://www.1000genomes.org/) with known genotypes of human repair genes will be quantified for DNA repair capacity using comet assay, cell cycle analysis, and gene expression of key DNA repair genes (for both ethnic groups) after exposure to DNA...

  13. Investigating the role of vitamin D and DNA repair in influencing cancer presentation and outcome 

    E-print Network

    Pidaparti, Divya

    2015-04-24

    in (http://www.1000genomes.org/) with known genotypes of human repair genes will be quantified for DNA repair capacity using comet assay, cell cycle analysis, and gene expression of key DNA repair genes (for both ethnic groups) after exposure to DNA...

  14. Investigating the role of vitamin D and DNA repair in influencing cancer presentation and outcomes 

    E-print Network

    Varrier, Shilpa

    2015-04-23

    in (http://www.1000genomes.org/) with known genotypes of human repair genes will be quantified for DNA repair capacity using comet assay, cell cycle analysis, and gene expression of key DNA repair genes (for both ethnic groups) after exposure to DNA...

  15. DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information

    ERIC Educational Resources Information Center

    McCallister, Gary

    2005-01-01

    The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code. (Contains 6 figures.)

  16. Introduction: DNA Electrophoresis Fralin Life Science

    E-print Network

    Hopkins, William A.

    .................................... 12 Student Pre-Lab Activity: What is DNA? DNA extraction from strawberry ..... Teacher guide: DNA extraction from strawberry.................................. 14 Student guide: DNA extraction from strawberry.................................. 16

  17. Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

    NASA Technical Reports Server (NTRS)

    Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

    1982-01-01

    The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

  18. DNA Databases: Uses and Issues

    E-print Network

    ) Fundamentals of Forensic DNA Typing, Figure 1.3 #12;Applications for DNA Testing · Crime solving ­ matching) #12;Quality Results are Essential in Forensic DNA Testing · DNA results impact lives ­ the guilty can locations 268 exonerated as of April 19, 2011 #12;Historical Perspective on DNA Typing 1985 1990 1994 1996

  19. Inferring ethnicity from mitochondrial DNA sequence

    PubMed Central

    2011-01-01

    Background The assignment of DNA samples to coarse population groups can be a useful but difficult task. One such example is the inference of coarse ethnic groupings for forensic applications. Ethnicity plays an important role in forensic investigation and can be inferred with the help of genetic markers. Being maternally inherited, of high copy number, and robust persistence in degraded samples, mitochondrial DNA may be useful for inferring coarse ethnicity. In this study, we compare the performance of methods for inferring ethnicity from the sequence of the hypervariable region of the mitochondrial genome. Results We present the results of comprehensive experiments conducted on datasets extracted from the mtDNA population database, showing that ethnicity inference based on support vector machines (SVM) achieves an overall accuracy of 80-90%, consistently outperforming nearest neighbor and discriminant analysis methods previously proposed in the literature. We also evaluate methods of handling missing data and characterize the most informative segments of the hypervariable region of the mitochondrial genome. Conclusions Support vector machines can be used to infer coarse ethnicity from a small region of mitochondrial DNA sequence with surprisingly high accuracy. In the presence of missing data, utilizing only the regions common to the training sequences and a test sequence proves to be the best strategy. Given these results, SVM algorithms are likely to also be useful in other DNA sequence classification applications. PMID:21554759

  20. A new structural insight into XPA-DNA interactions.

    PubMed

    Hilton, Benjamin; Shkriabai, Nick; Musich, Phillip R; Kvaratskhelia, Mamuka; Shell, Steven; Zou, Yue

    2014-01-01

    XPA (xeroderma pigmentosum group A) protein is an essential factor for NER (nucleotide excision repair) which is believed to be involved in DNA damage recognition/verification, NER factor recruiting and stabilization of repair intermediates. Past studies on the structure of XPA have focused primarily on XPA interaction with damaged DNA. However, how XPA interacts with other DNA structures remains unknown though recent evidence suggest that these structures could be important for its roles in both NER and non-NER activities. Previously, we reported that XPA recognizes undamaged DNA ds/ssDNA (double-strand/single-strandDNA) junctions with a binding affinity much higher than its ability to bind bulky DNA damage. To understand how this interaction occurs biochemically we implemented a structural determination of the interaction using a MS-based protein footprinting method and limited proteolysis. By monitoring surface accessibility of XPA lysines to NHS-biotin modification in the free protein and the DNA junction-bound complex we show that XPA physically interacts with the DNA junctions via two lysines, K168 and K179, located in the previously known XPA(98-219) DBD (DNA-binding domain). Importantly, we also uncovered new lysine residues, outside of the known DBD, involved in the binding. We found that residues K221, K222, K224 and K236 in the C-terminal domain are involved in DNA binding. Limited proteolysis analysis of XPA-DNA interactions further confirmed this observation. Structural modelling with these data suggests a clamp-like DBD for the XPA binding to ds/ssDNA junctions. Our results provide a novel structure-function view of XPA-DNA junction interactions. PMID:25385088

  1. Stool vs. Serum Hepatitis B Virus DNA in Patients with Chronic Hepatitis B

    PubMed Central

    Zheng, Ji-shun; Chen, Meng-meng; Yang, Hai-fei; Zhou, Xiang-tian; Liu, Yan-yan; Li, Jia-bin

    2015-01-01

    Background Serum hepatitis B virus (HBV) DNA and hepatitis B e antigen (HBeAg) liver function in patients with chronic hepatitis B (CHB) are significantly associated. A comparison of clinical significance of fecal HBV DNA and serum HBV DNA has not yet been reported. Material/Methods Stool and serum samples were collected from 66 patients with CHB. Fecal HBV DNA, serum HBV DNA, and intestinal microbiota DNA were detected by real-time quantitative fluorescence polymerase chain reaction (PCR). Liver function and HBeAg were analyzed. Results The stool and serum HBV DNA were positively correlated (r=0.57, P=0.001). Fecal HBV DNA was higher in the HBeAg-positive group than in the HBeAg-negative group (P=0.02). Fecal HBV DNA was negatively correlated with alkaline phosphatase (ALP) (r=?0.41, P=0.001) and TBIL (r=?0.29, P=0.02), and was positively correlated with Enterococcus (r=0.38, P=0.002). Serum HBV DNA was negatively correlated with alanine aminotransferase (ALT) (r=?0.30, P=0.02), aminotransferase (AST) (r=?0.26, P=0.049), and Lactobacillus (r=?0.31, P=0.01). Conclusions These observations suggest that fecal HBV DNA and serum HBV DNA in patients with CHB have different effects. Fecal HBV DNA might be associated with changes in Enterococcus concentrations, but serum HBV DNA is not. PMID:26645150

  2. Denaturation of DNA at high salt concentrations

    E-print Network

    Arghya Maity; Amar Singh; Navin Singh

    2015-08-19

    Cations present in the solution are important for the stability of two negative strands of DNA molecules. Experimental as well as theoretical results show that the DNA molecule is more stable as the concentration of salt (or cations) increases. It is known that the two strands of DNA molecule carry negative charge due to phosphate group along the strands. These cations act as a shielding particles to the two like charge strands. Recently, in an experiment it is shown that there is a critical value in the concentration of salts (or cations) that can stabilize the helical structure of DNA. If one add more salt in the solution beyond this critical value, the stability of the DNA molecule will disrupt. In this work we study the stability of DNA molecules at higher concentrations. How the stability at higher concentration can be explained through some theoretical calculations is the aim of this manuscript. We consider the PBD model with proper modifications that can explain the negative stability of the molecule at higher concentration. Our findings are in close match with the experimental results.

  3. Denaturation of DNA at high salt concentrations

    E-print Network

    Maity, Arghya; Singh, Navin

    2015-01-01

    Cations present in the solution are important for the stability of two negative strands of DNA molecules. Experimental as well as theoretical results show that the DNA molecule is more stable as the concentration of salt (or cations) increases. It is known that the two strands of DNA molecule carry negative charge due to phosphate group along the strands. These cations act as a shielding particles to the two like charge strands. Recently, in an experiment it is shown that there is a critical value in the concentration of salts (or cations) that can stabilize the helical structure of DNA. If one add more salt in the solution beyond this critical value, the stability of the DNA molecule will disrupt. In this work we study the stability of DNA molecules at higher concentrations. How the stability at higher concentration can be explained through some theoretical calculations is the aim of this manuscript. We consider the PBD model with proper modifications that can explain the negative stability of the molecule a...

  4. Automata representation for Abelian groups

    NASA Astrophysics Data System (ADS)

    Fong, Wan Heng; Gan, Yee Siang; Sarmin, Nor Haniza; Turaev, Sherzod

    2013-04-01

    A finite automaton is one of the classic models of recognition devices, which is used to determine the type of language a string belongs to. A string is said to be recognized by a finite automaton if the automaton "reads" the string from the left to the right starting from the initial state and finishing at a final state. Another type of automata which is a counterpart of sticker systems, namely Watson-Crick automata, is finite automata which can scan the double-stranded tapes of DNA strings using the complimentary relation. The properties of groups have been extended for the recognition of finite automata over groups. In this paper, two variants of automata, modified deterministic finite automata and modified deterministic Watson-Crick automata are used in the study of Abelian groups. Moreover, the relation between finite automata diagram over Abelian groups and the Cayley table is introduced. In addition, some properties of Abelian groups are presented in terms of automata.

  5. DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?

    PubMed Central

    Maresca, Alessandra; Zaffagnini, Mirko; Caporali, Leonardo; Carelli, Valerio; Zanna, Claudia

    2015-01-01

    Autosomal dominant cerebellar ataxia-deafness and narcolepsy (ADCA-DN) and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E) are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5)-methyltransferase 1 (DNMT1). DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy, and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA) suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however, mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is regulated and executed? PMID:25815005

  6. Microscopic and spectroscopic analysis of chitosan-DNA conjugates.

    PubMed

    Agudelo, D; Kreplak, L; Tajmir-Riahi, H A

    2016-02-10

    Conjugations of DNA with chitosans 15kD (ch-15), 100kD (ch-100) and 200kD (ch-200) were investigated in aqueous solution at pH 5.5-6.5. Multiple spectroscopic methods and atomic force microscopy (AFM) were used to locate the chitosan binding sites and the effect of polymer conjugation on DNA compaction and particle formation. Structural analysis showed that chitosan-DNA conjugation is mainly via electrostatic interactions through polymer cationic charged NH2 and negatively charged backbone phosphate groups. As polymer size increases major DNA compaction and particle formation occurs. At high chitosan concentration major DNA structural changes observed indicating a partial B to A-DNA conformational transition. PMID:26686122

  7. Crystallization and X-ray diffraction analysis of the DNA-remodelling protein DnaD from Bacillus subtilis

    SciTech Connect

    Schneider, Sabine; Carneiro, Maria J. V. M.; Ioannou, Charikleia; Soultanas, Panos; Paoli, Max

    2007-02-01

    Crystallization and preliminary X-ray diffraction analysis of the two domains of DnaD from B. subtilis is reported. The DnaD protein is an essential component of the chromosome-replication machinery of the Gram-positive bacterium Bacillus subtilis and is part of the primosomal cascade that ultimately loads the replicative ring helicase DnaC onto DNA. Moreover, DnaD is a global regulator of DNA architecture, as it forms higher order nucleoprotein structures in order to open supercoiled DNA. Here, the crystallization and preliminary X-ray diffraction analysis of the two domains of DnaD from B. subtilis are reported. Crystals of the N-terminal domain are trigonal, with either P3{sub 1}21 or P3{sub 2}21 space-group symmetry, and diffracted X-rays to 2.0 Å resolution; crystals of the C-terminal domain are hexagonal, with space group P6{sub 1} or P6{sub 5}, and diffracted X-rays to 2.9 Å resolution in-house. Determination of the structure of the DnaD domains will provide insight into how remodelling of the nucleoid is associated with priming of replication in the model Gram-positive organism B. subtilis.

  8. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    SciTech Connect

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  9. Dietary and lifestyle factors of DNA methylation.

    PubMed

    Lim, Unhee; Song, Min-Ae

    2012-01-01

    Lifestyle factors, such as diet, smoking, physical activity, and body weight management, are known to constitute the majority of cancer causes. Epigenetics has been widely proposed as a main mechanism that mediates the reversible effects of dietary and lifestyle factors on carcinogenesis. This chapter reviews human studies on potential dietary and lifestyle determinants of DNA methylation. Apart from a few prospective investigations and interventions of limited size and duration, evidence mostly comes from cross-sectional observational studies and supports some associations. Studies to date suggest that certain dietary components may alter genomic and gene-specific DNA methylation levels in systemic and target tissues, affecting genomic stability and transcription of tumor suppressors and oncogenes. Most data and supportive evidence exist for folate, a key nutritional factor in one-carbon metabolism that supplies the methyl units for DNA methylation. Other candidate bioactive food components include alcohol and other key nutritional factors of one-carbon metabolism, polyphenols and flavonoids in green tea, phytoestrogen, and lycopene. Some data also support a link of DNA methylation with physical activity and energy balance. Effects of dietary and lifestyle exposures on DNA methylation may be additionally modified by common genetic variants, environmental carcinogens, and infectious agents, an aspect that remains largely unexplored. In addition, growing literature supports that the environmental conditions during critical developmental stages may influence later risk of metabolic disorders in part through persistent programming of DNA methylation. Further research of these modifiable determinants of DNA methylation will improve our understanding of cancer etiology and may present certain DNA methylation markers as attractive surrogate endpoints for prevention research. Considering the plasticity of epigenetic marks and correlated nature of lifestyle factors, more longitudinal studies of healthy individuals of varying age, sex, and ethnic groups are warranted, ideally with comprehensive data collection on various lifestyle factors. PMID:22359306

  10. Influence of killing method on Lepidoptera DNA barcode recovery.

    PubMed

    Willows-Munro, Sandi; Schoeman, M Corrie

    2015-05-01

    The global DNA barcoding initiative has revolutionized the field of biodiversity research. Such large-scale sequencing projects require the collection of large numbers of specimens, which need to be killed and preserved in a way that is both DNA-friendly and which will keep voucher specimens in good condition for later study. Factors such as time since collection, correct storage (exposure to free water and heat) and DNA extraction protocol are known to play a role in the success of downstream molecular applications. Limited data are available on the most efficient, DNA-friendly protocol for killing. In this study, we evaluate the quality of DNA barcode (cytochrome oxidase I) sequences amplified from DNA extracted from specimens collected using three different killing methods (ethyl acetate, cyanide and freezing). Previous studies have suggested that chemicals, such as ethyl acetate and formaldehyde, degraded DNA and as such may not be appropriate for the collection of insects for DNA-based research. All Lepidoptera collected produced DNA barcodes of good quality, and our study found no clear difference in nucleotide signal strength, probability of incorrect base calling and phylogenetic utility among the three different treatment groups. Our findings suggest that ethyl acetate, cyanide and freezing can all be used to collect specimens for DNA analysis. PMID:25229871

  11. Modeling DNA Replication Intermediates

    SciTech Connect

    Broyde, S.; Roy, D.; Shapiro, R.

    1997-06-01

    While there is now available a great deal of information on double stranded DNA from X-ray crystallography, high resolution NMR and computer modeling, very little is known about structures that are representative of the DNA core of replication intermediates. DNA replication occurs at a single strand/double strand junction and bulged out intermediates near the junction can lead to frameshift mutations. The single stranded domains are particularly challenging. Our interest is focused on strategies for modeling the DNA of these types of replication intermediates. Modeling such structures presents special problems in addressing the multiple minimum problem and in treating the electrostatic component of the force field. We are testing a number of search strategies for locating low energy structures of these types and we are also investigating two different distance dependent dielectric functions in the coulombic term of the force field. We are studying both unmodified DNA and DNA damaged by aromatic amines, carcinogens present in the environment in tobacco smoke, barbecued meats and automobile exhaust. The nature of the structure adopted by the carcinogen modified DNA at the replication fork plays a key role in determining whether the carcinogen will cause a mutation during replication that can initiate the carcinogenic process. In the present work results are presented for unmodified DNA.

  12. Forensic DNA testing.

    PubMed

    Weedn, V W; Roby, R K

    1993-05-01

    Forensic deoxyribonucleic acid (DNA) testing has revolutionized criminal investigations. Deoxyribonucleic acid testing is superseding traditional serologic testing due to its discriminatory power, universal application to biologic materials, and resistance to environmental insults, among other advantages. Its acceptance is becoming commonplace, and it is being put into widespread use. Forensic DNA testing technology and its application is continuing to evolve. PMID:8489337

  13. Characterization of muntjac DNA

    SciTech Connect

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  14. Environmental DNA Samples

    USGS Multimedia Gallery

    Samples from various aquatic species and other material necessary to create environemntal DNA (eDNA) assays are stored at the Snake River Field Station in Boise. Water samples from aquatic ecosystems are compared against the assays to identify the presence and location of species in those ecosy...

  15. Environmental DNA Samples

    USGS Multimedia Gallery

    Samples collected form coho salmon that will be used to develop environmental DNA (eDNA) assays for the species. Water samples from aquatic ecosystems are compared against the assays to identify the presence and location of species in those ecosystems....

  16. Recombinant DNA for Teachers.

    ERIC Educational Resources Information Center

    Duvall, James G., III

    1992-01-01

    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  17. Nanotechnology: Deadly DNA

    NASA Astrophysics Data System (ADS)

    Krishnan, Swati; Simmel, Friedrich C.

    2015-01-01

    DNA self-assembly has previously been used to create channel-like structures that can penetrate through lipid bilayer membranes. However, such assemblies have not been shown to cause cell death before. Now a DNA nanopore has been shown to exert a cytotoxic effect when administered to cells.

  18. Routine DNA testing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

  19. MICROWAVE RESONANCES IN DNA

    EPA Science Inventory

    This report describes spectroscopic studies of DNA which were undertaken to better understand a physical basis for microwave absorption by this molecule. hree types of studies are described. ) The low frequency scattered light spectrum of DNA was studied by two methods. irst, Ram...

  20. Curating DNA specimens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    DNA data are used in a variety of ethnobiological disciplines including archaeology, conservation, ecology, medicinal plants and natural products research, taxonomy and systematics, crop evolution and domestication, and genetic diversity. It frequently is convenient to store and share DNA among coop...

  1. Simple & Safe Genomic DNA Isolation.

    ERIC Educational Resources Information Center

    Moss, Robert; Solomon, Sondra

    1991-01-01

    A procedure for purifying DNA using either bacteria or rat liver is presented. Directions for doing a qualitative DNA assay using diphenylamine and a quantitative DNA assay using spectroscopy are included. (KR)

  2. Studying DNA in the Classroom.

    ERIC Educational Resources Information Center

    Zarins, Silja

    1993-01-01

    Outlines a workshop for teachers that illustrates a method of extracting DNA and provides instructions on how to do some simple work with DNA without sophisticated and expensive equipment. Provides details on viscosity studies and breaking DNA molecules. (DDR)

  3. Structure of large dsDNA viruses

    PubMed Central

    Klose, Thomas; Rossmann, Michael G.

    2015-01-01

    Nucleocytoplasmic large dsDNA viruses (NCLDVs) encompass an ever-increasing group of large eukaryotic viruses, infecting a wide variety of organisms. The set of core genes shared by all these viruses includes a major capsid protein with a double jelly-roll fold forming an icosahedral capsid, which surrounds a double layer membrane that contains the viral genome. Furthermore, some of these viruses, such as the members of the Mimiviridae and Phycodnaviridae have a unique vertex that is used during infection to transport DNA into the host. PMID:25003382

  4. Recombinant DNA in Medicine

    PubMed Central

    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.

    1984-01-01

    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been extensively and successfully tested in humans and insulin has been licensed for sale. Mass production of bacterial and viral antigens with recombinant DNA technology is likely to provide safe and effective vaccines for some disorders for which there is no prevention. The cloned probes for the human ?- and ?-globin loci, for specific disease genes, such as the Z allele of ?-antitrypsin, and for random genomic sequences are proving useful for prenatally diagnosing human genetic disorders and preventing their clinical consequences. Images PMID:6208695

  5. Advances in DNA photonics

    NASA Astrophysics Data System (ADS)

    Heckman, Emily M.; Aga, Roberto S.; Fehrman Cory, Emily M.; Ouchen, Fahima; Lesko, Alyssa; Telek, Brian; Lombardi, Jack; Bartsch, Carrie M.; Grote, James G.

    2012-10-01

    In this paper we present our current research in exploring a DNA biopolymer for photonics applications. A new processing technique has been adopted that employs a modified soxhlet-dialysis (SD) rinsing technique to completely remove excess ionic contaminants from the DNA biopolymer, resulting in a material with greater mechanical stability and enhanced performance reproducibility. This newly processed material has been shown to be an excellent material for cladding layers in poled polymer electro-optic (EO) waveguide modulator applications. Thin film poling results are reported for materials using the DNA biopolymer as a cladding layer, as are results for beam steering devices also using the DNA biopolymer. Finally, progress on fabrication of a Mach Zehnder EO modulator with DNA biopolymer claddings using nanoimprint lithography techniques is reported.

  6. The DNA repair endonuclease Mus81 facilitates fast DNA replication in the absence of exogenous damage

    PubMed Central

    Fu, Haiqing; Martin, Melvenia M.; Regairaz, Marie; Huang, Liang; You, Yang; Lin, Chi-Mei; Ryan, Michael; Kim, RyangGuk; Shimura, Tsutomu; Pommier, Yves; Aladjem, Mirit I.

    2015-01-01

    The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication initiation events. In the absence of Mus81 endonuclease activity, DNA synthesis is slowed and replication initiation events are more frequent. In addition, Mus81 deficient cells fail to recover from exposure to low doses of replication inhibitors and cell viability is dependent on the XPF endonuclease. Despite an increase in replication initiation frequency, cells lacking Mus81 use the same pool of replication origins as Mus81-expressing cells. Therefore, decelerated DNA replication in Mus81 deficient cells does not initiate from cryptic or latent origins not used during normal growth. These results indicate that Mus81 plays a key role in determining the rate of DNA replication without activating a novel group of replication origins. PMID:25879486

  7. Studies of nanoscale structural ordering in planar DNA complexes with amphiphilic mono- and polycations

    NASA Astrophysics Data System (ADS)

    Antipina, Maria N.; Gainutdinov, Radmir V.; Rachnyanskaya, Anna A.; Tolstikhina, Alla L.; Yurova, Tatiana V.; Khomutov, Gennady B.

    2003-06-01

    Formation of DNA complexes with Langmuir monolayers of cationic lipid octadecylamine (ODA) and new amphiphilic polycation poly-4-vinylpyridine with 16% cetylpyridinium groups (PVP-16) on the surface of native DNA aqueous solution with low ionic strength has been studied. AFM topographic images of DNA/ODA and DNA/PVP-16 complex Langmuir-Blodgett films deposited on the mica substrates were obtained. The complex structures and individual DNA molecules on the amphiphile monolayer surface were observed. The characteristic extended net-like structures and quasi-circular toroidal condensed conformations of the planar DNA complexes were formed in dependence on the polycationic amphiphile monolayer state during the DNA binding. The data obtained give evidence for the effectiveness of monolayer techniques for investigation the mechanisms of DNA complexation with amphiphilic mono- and polycations and demonstrate its perspectives for creation of supramolecular planar DNA-based self-organized nanostructures with nanoscale structural ordering.

  8. An azide-modified nucleoside for metabolic labeling of DNA.

    PubMed

    Neef, Anne B; Luedtke, Nathan W

    2014-04-14

    Metabolic incorporation of azido nucleoside analogues into living cells can enable sensitive detection of DNA replication through copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) and strain-promoted azide-alkyne cycloaddition (SPAAC) "click" reactions. One major limitation to this approach is the poor chemical stability of nucleoside derivatives containing an aryl azide group. For example, 5-azido-2'-deoxyuridine (AdU) exhibits a 4 h half-life in water, and it gives little or no detectable labeling of cellular DNA. In contrast, the benzylic azide 5-(azidomethyl)-2'-deoxyuridine (AmdU) is stable in solution at 37?°C, and it gives robust labeling of cellular DNA upon addition of fluorescent alkyne derivatives. In addition to providing the first examples of metabolic incorporation into and imaging of azide groups in cellular DNA, these results highlight the general importance of assessing azide group stability in bioorthogonal chemical reporter strategies. PMID:24644275

  9. Raman spectroscopy of topotecan, an inhibitor of DNA topoisomerase I

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Ustinova, O. A.; Strel'Tsov, S. A.; Grokhovskii, S. L.; Zhuze, A. L.; Nabiev, I. R.; Sukhanova, A. V.; Oleinikov, V. A.

    2002-10-01

    Topotecan (TPT), a water-soluble derivative of camptothecin (inhibitor of human DNA topoiomerase I), has found wide application in cancer chemotherapy. The central problem in using topotecan is the presence of lactone rings in its molecules, which undergo hydrolysis at a physiological pH yielding an inactive and even toxic form of the drug. The analysis of Raman spectra of TPT in H2O and D2O solutions made it possible to assign the spectral bands to the vibrations of particular molecular groups. Spectral features indicative of the opening of the lactone rings of the TPT molecules, deprotonation of the hydroxyl groups in their quinoline fragments, and of possible participation of the hydroxyl and carbonyl groups in H bonding are found. The data obtained are necessary to study the molecular mechanisms of TPT-DNA interaction and the formation of ternary complexes between TPT, DNA, and DNA topoisomerase I.

  10. Tracking Mitochondrial DNA In Situ.

    PubMed

    Ligasová, Anna; Koberna, Karel

    2016-01-01

    The methods of the detection of (1) non-labeled and (2) BrdU-labeled mitochondrial DNA (mtDNA) are described. They are based on the production of singlet oxygen by monovalent copper ions and the subsequent induction of DNA gaps. The ends of interrupted DNA serve as origins for the labeling of mtDNA by DNA polymerase I or they are utilized by exonuclease that degrades DNA strands, unmasking BrdU in BrdU-labeled DNA. Both methods are sensitive approaches without the need of additional enhancement of the signal or the use of highly sensitive optical systems. PMID:26530676

  11. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L. (Pleasanton, CA)

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  12. mtDNA sequence diversity in Africa.

    PubMed Central

    Watson, E.; Bauer, K.; Aman, R.; Weiss, G.; von Haeseler, A.; Pääbo, S.

    1996-01-01

    mtDNA sequences were determined from 241 individuals from nine ethnic groups in Africa. When they were compared with published data from other groups, it was found that the !Kung, Mbuti, and Biaka show on the order of 10 times more sequence differences between the three groups, as well as between those and the other groups (the Fulbe, Hausa, Tuareg, Songhai, Kanuri, Yoruba, Mandenka, Somali, Tukana, and Kikuyu), than these other groups do between one other. Furthermore, the pairwise sequence distributions, patterns of coalescence events, and numbers of variable positions relative to the mean sequence difference indicate that the former three groups have been of constant size over time, whereas the latter have expanded in size. We suggest that this reflects subsistence patterns in that the populations that have expanded in size are food producers whereas those that have not are hunters and gatherers. PMID:8755932

  13. Group Anonymity

    E-print Network

    Chertov, Oleg; 10.1007/978-3-642-14058-7_61

    2010-01-01

    In recent years the amount of digital data in the world has risen immensely. But, the more information exists, the greater is the possibility of its unwanted disclosure. Thus, the data privacy protection has become a pressing problem of the present time. The task of individual privacy-preserving is being thoroughly studied nowadays. At the same time, the problem of statistical disclosure control for collective (or group) data is still open. In this paper we propose an effective and relatively simple (wavelet-based) way to provide group anonymity in collective data. We also provide a real-life example to illustrate the method.

  14. Statistical analysis of molecular nanotemplate driven DNA adsorption on graphite.

    PubMed

    Dubrovin, E V; Speller, S; Yaminsky, I V

    2014-12-30

    In this work, we have studied the conformation of DNA molecules aligned on the nanotemplates of octadecylamine, stearyl alcohol, and stearic acid on highly oriented pyrolytic graphite (HOPG). For this purpose, fluctuations of contours of adsorbed biopolymers obtained from atomic force microscopy (AFM) images were analyzed using the wormlike chain model. Moreover, the conformations of adsorbed biopolymer molecules were characterized by the analysis of the scaling exponent ?, which relates the mean squared end-to-end distance and contour length of the polymer. During adsorption on octadecylamine and stearyl alcohol nanotemplates, DNA forms straight segments, which order along crystallographic axes of graphite. In this case, the conformation of DNA molecules can be described using two different length scales. On a large length scale (at contour lengths l > 200-400 nm), aligned DNA molecules have either 2D compact globule or partially relaxed 2D conformation, whereas on a short length scale (at l ? 200-400 nm) their conformation is close to that of rigid rods. The latter type of conformation can be also assigned to DNA adsorbed on a stearic acid nanotemplate. The different conformation of DNA molecules observed on the studied monolayers is connected with the different DNA-nanotemplate interactions associated with the nature of the functional group of the alkane derivative in the nanotemplate (amine, alcohol, or acid). The persistence length of ?-DNA adsorbed on octadecylamine nanotemplates is 31 ± 2 nm indicating the loss of DNA rigidity in comparison with its native state. Similar values of the persistence length (34 ± 2 nm) obtained for 24-times shorter DNA molecules adsorbed on an octadecylamine nanotemplate demonstrate that this rigidity change does not depend on biopolymer length. Possible reasons for the reduction of DNA persistence length are discussed in view of the internal DNA structure and DNA-surface interaction. PMID:25470069

  15. Stabilization of DNA Structures with Poly(ethylene sodium phosphate).

    PubMed

    Moriyama, Rui; Iwasaki, Yasuhiko; Miyoshi, Daisuke

    2015-09-10

    The structure and stability of biomolecules under molecular crowding conditions are of interest because such information clarifies how biomolecules behave under cell-mimicking conditions. The anionic surfaces of chromatin, which is composed of DNA strands and histone complexes, are concentrated in cell nuclei and thus generate a polyanionic crowding environment. In this study, we designed and synthesized an anionic polymer, poly(ethylene sodium phosphate) (PEP·Na), which has a nucleic acid phosphate backbone and created a cell nucleus-like environment. The effects of molecular crowding with PEP·Na on the thermodynamics of DNA duplexes, triplexes, and G-quadruplexes were systematically studied. Thermodynamic analysis demonstrated that PEP·Na significantly stabilized the DNA structures; e.g., a free energy change at 25 °C for duplex formation decreased from -6.6 to -12.8 kcal/mol with 20 wt % PEP·Na. Thermodynamic parameters further indicated that the factors for the stabilization of the DNA structures were dependent on sodium ion concentration. At lower polymer concentrations, the stabilization was attributed to a shielding of the electrostatic repulsion between DNA strands by the sodium ions of PEP·Na. In contrast, at higher polymer concentrations, the DNA structures were entropically stabilized by volume exclusion, which could be enhanced by electrostatic repulsion between phosphate groups in DNA strands and in PEP·Na. Additionally, increasing PEP·Na concentration resulted in increasing enthalpy of the DNA duplex but decreasing enthalpy of DNA G-quadruplex, indicating that the polymers also promoted dehydration of the DNA strands. Thus, polyanionic crowding affects the thermodynamics of DNA structures via the sodium ions, volume exclusion, and hydration. The stabilization of DNA by the cell nucleus-like polyanionic crowding provides new information regarding DNA structures and allows for modeling reactions in cell nuclei. PMID:26173001

  16. DNA binding by pixantrone.

    PubMed

    Adnan, Najia; Buck, Damian P; Evison, Benny J; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

    2010-12-01

    The binding of the anticancer drug pixantrone (6,9-bis[(2-aminoethyl)amino]benzo[g]isoquinoline-5,10-dione dimaleate) to the octanucleotide duplexes d(ACGATCGT)(2) and the corresponding C-5 methylated cytosine ((5Me)C) analogue d(A(5Me)CGAT(5Me)CGT)(2) has been studied by NMR spectroscopy and molecular modelling. The large upfield shifts observed for the resonances from the aromatic protons of pixantrone upon addition to either d(ACGATCGT)(2) or the corresponding (5Me)C analogue is consistent with the drug binding the octanucleotides by intercalation. The selective reduction in the sequential NOEs between the C(2)-G(3) and C(6)-G(7) nucleotides in NOESY spectra of either octanucleotide with added pixantrone confirms the intercalative binding mechanism. Strong NOEs from the side-chain ethylene protons of pixantrone to the H5 protons and the 5-CH(3) protons of the C(2) and C(6) residues of d(ACGATCGT)(2) and d(A(5Me)CGAT(5Me)CGT)(2), respectively, indicate that pixantrone predominantly intercalates from the DNA major groove at the 5'-CG and 5'-(5Me)CG sites. Simple molecular models based on the conclusions from the NMR experiments indicated that the (5Me)C groups do not represent a steric barrier to intercalation from the major groove. However, the observation of weak NOEs from the ethylene protons of pixantrone to a variety of minor groove protons from either octanucleotide suggests that the drug can also associate in the minor groove. PMID:20865205

  17. Quantitive DNA Fiber Mapping

    SciTech Connect

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  18. Organization of DNA Replication

    PubMed Central

    Chagin, Vadim O.; Stear, Jeffrey H.; Cardoso, M. Cristina

    2010-01-01

    The discovery of the DNA double helix structure half a century ago immediately suggested a mechanism for its duplication by semi-conservative copying of the nucleotide sequence into two DNA daughter strands. Shortly after, a second fundamental step toward the elucidation of the mechanism of DNA replication was taken with the isolation of the first enzyme able to polymerize DNA from a template. In the subsequent years, the basic mechanism of DNA replication and its enzymatic machinery components were elucidated, mostly through genetic approaches and in vitro biochemistry. Most recently, the spatial and temporal organization of the DNA replication process in vivo within the context of chromatin and inside the intact cell are finally beginning to be elucidated. On the one hand, recent advances in genome-wide high throughput techniques are providing a new wave of information on the progression of genome replication at high spatial resolution. On the other hand, novel super-resolution microscopy techniques are just starting to give us the first glimpses of how DNA replication is organized within the context of single intact cells with high spatial resolution. The integration of these data with time lapse microscopy analysis will give us the ability to film and dissect the replication of the genome in situ and in real time. PMID:20452942

  19. What Controls DNA Looping?

    PubMed Central

    Perez, Pamela J.; Clauvelin, Nicolas; Grosner, Michael A.; Colasanti, Andrew V.; Olson, Wilma K.

    2014-01-01

    The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional structures and fluctuations of protein and DNA allow us to examine the likely means of enhancing such communication. Here, we describe the application of these approaches to the looping of a 92 base-pair DNA segment between the headpieces of the tetrameric Escherichia coli Lac repressor protein. The distortions of the double helix induced by a second protein—the nonspecific nucleoid protein HU—increase the computed likelihood of looping by several orders of magnitude over that of DNA alone. Large-scale deformations of the repressor, sequence-dependent features in the DNA loop, and deformability of the DNA operators also enhance looping, although to lesser degrees. The correspondence between the predicted looping propensities and the ease of looping derived from gene-expression and single-molecule measurements lends credence to the derived structural picture. PMID:25167135

  20. Innovations. DNA detectives.

    PubMed

    May, M

    1999-01-01

    To understand the many potential causes and resulting consequences of DNA damage, scientists first need methods to detect it. Canadian scientists X. Chris Le and Michael Weinfeld, with help from U.S. molecular biologist Steven Leadon, developed a selective, sensitive technique for measuring DNA damage. The scientists combined a thymine glycol antibody with thymine glycol to selectively tag a specific type of DNA damage. They then added a second antibody with fluorescing properties, and used laser-induced fluorescence to identify the damaged portion of the tagged DNA. The fluorescence can be quantified, with higher levels of fluorescence indicating higher DNA damage. The technique was shown to find 1 damaged base in 1 billion normal bases. This level of sensitivity could allow the measurement of DNA damage resulting from clinical levels of radiation, and may allow scientists to establish a day-to-day baseline for DNA damage. From this baseline, it would be possible to ascertain the levels of damage that a cell can tolerate, as well as how much damaged it is capable of repairing on a daily basis. PMID:9872726

  1. DNA-PK assay

    DOEpatents

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  2. Interaction of DNA and DNA-anti-DNA complexes to fibronectin

    SciTech Connect

    Gupta, R.C.; Simpson, W.A.; Raghow, R.; Hasty, K.

    1986-03-01

    Fibronectin (Fn) is a large multidomain glycoprotein found in the basement membrane, on cell surface and in plasma. The interactions of Fn with DNA may be significant in glomerular deposition of DNA-anti-DNA complexes in patients with systemic lupus erythematosus (SLE). The authors examined the binding of DNA and DNA-anti-DNA complexes to Fn by a solid phase assay in which Fn was coated to microtiter plates and reacted with (/sup 3/H)DNA or DNA complexes with a monoclonal anti-DNA antibody. The optimal interaction of DNA with Fn occurs at <0.1M NaCl suggesting that the binding is charge dependent; the specificity of this binding was shown by competitive inhibition and locking experiments using anti-Fn. The binding was maximum at pH 6.5 and in the absence of Ca/sup 2 +/. The addition of Clq enhanced the binding of DNA and DNA-anti-DNA complexes to Fn, whereas heparan sulfate inhibited such binding. The monomeric or aggregated IgC did not bind Fn but aggregated IgG bound to Fn in the presence of Clq. Furthermore, DNA-anti-DNA complexes in sera from active SLE patients bound Fn which was enhanced in the presence of Clq; DNase abolished this binding indicating that the interaction of these complexes was mediated by DNA. These observations may partially explain the molecular mechanism(s) of the deposition of DNA-anti-DNA complexes in basement membrane.

  3. Molecular dynamics simulations of DNA-polycation complexes

    NASA Astrophysics Data System (ADS)

    Ziebarth, Jesse; Wang, Yongmei

    2008-03-01

    A necessary step in the preparation of DNA for use in gene therapy is the packaging of DNA with a vector that can condense DNA and provide protection from degrading enzymes. Because of the immunoresponses caused by viral vectors, there has been interest in developing synthetic gene therapy vectors, with polycations emerging as promising candidates. Molecular dynamics simulations of the DNA duplex CGCGAATTCGCG in the presence of 20 monomer long sequences of the polycations, poly-L-lysine (PLL) and polyethyleneimine (PEI), with explicit counterions and TIP3P water, are performed to provide insight into the structure and formation of DNA polyplexes. After an initial separation of approximately 50 å, the DNA and polycation come together and form a stable complex within 10 ns. The DNA does not undergo any major structural changes upon complexation and remains in the B-form. In the formed complex, the charged amine groups of the polycation mainly interact with DNA phosphate groups, and rarely occupy electronegative sites in either the major or minor grooves. Differences between complexation with PEI and PLL will be discussed.

  4. Energy and Technology Review: Unlocking the mysteries of DNA repair

    SciTech Connect

    Quirk, W.A.

    1993-04-01

    DNA, the genetic blueprint, has the remarkable property of encoding its own repair following diverse types of structural damage induced by external agents or normal metabolism. We are studying the interplay of DNA damaging agents, repair genes, and their protein products to decipher the complex biochemical pathways that mediate such repair. Our research focuses on repair processes that correct DNA damage produced by chemical mutagens and radiation, both ionizing and ultraviolet. The most important type of DNA repair in human cells is called excision repair. This multistep process removes damaged or inappropriate pieces of DNA -- often as a string of 29 nucleotides containing the damage -- and replaces them with intact ones. We have isolated, cloned, and mapped several human repair genes associated with the nucleotide excision repair pathway and involved in the repair of DNA damage after exposure to ultraviolet light or mutagens in cooked food. We have shown that a defect in one of these repair genes, ERCC2, is responsible for the repair deficiency in one of the groups of patients with the recessive genetic disorder xeroderma pigmentosum (XP group D). We are exploring ways to purify sufficient quantities (milligrams) of the protein products of these and other repair genes so that we can understand their functions. Our long-term goals are to link defective repair proteins to human DNA repair disorders that predispose to cancer, and to produce DNA-repair-deficient mice that can serve as models for the human disorders.

  5. Focus: DNA probes

    SciTech Connect

    Not Available

    1986-11-01

    Progress in the development of DNA probes for the identification and quantitation of specific genetic sequences in biological samples is reviewed. Current research efforts in the development of DNA probes for the diagnosis of a wide variety of bacterial, viral, and other infectious diseases, such as herpes simplex and cytomegalovirus, and inherited genetic diseases such as cystic fibrosis and sickle cell anemia are discussed. Progress in development of DNA probe assays for cancer diagnosis, detection of Salmonella food poisoning, tissue typing (detection of histocompatibility antigens), mutagen screening, and animal diseases, among other applications is included.

  6. NIST Forensic DNA Research April 15, 2004 EDNAP Meeting (Nicosia, Cyprus)

    E-print Network

    working group of the European Network of Forensic Science Institutes (ENFSI) and the Scientific Working working group of the European Network of Forensic Science Institutes (ENFSI) and the Scientific WorkingNIST Forensic DNA Research April 15, 2004 EDNAP Meeting (Nicosia, Cyprus) 1 Forensic DNA Projects

  7. Molecular self-assembly with scaffolded DNA origami enables building custom-shaped

    E-print Network

    Cai, Long

    -helical domains with single-stranded `staple' oligonucleotides. The basic volume element in DNA origami magnetic resonance3. Functionalized DNA origami objects for various applications can be cre- ated by integrating staple oligonucleotides carrying functional groups such as fluorescent dyes or chemi- cal groups

  8. Becky Hill Green Mountain DNA Conference LT-DNA Analysis

    E-print Network

    Becky Hill ­ Green Mountain DNA Conference LT-DNA Analysis July 26, 2010 http of the Chief Medical Examiner, NYC Green Mountain DNA Conference Burlington, VT July 26, 2010 Low Template (LT generally aim for 0.5-2 ng 100 pg template 5 pg template #12;Becky Hill ­ Green Mountain DNA Conference LT

  9. Preparation of Plasmid DNA Preparation of PCR DNA

    E-print Network

    Campbell, A. Malcolm

    Abstract Preparation of Plasmid DNA Preparation of PCR DNA Design of DNA Chip Methods: Oligonucleotide Addition Results Graph ­ PCR vs. Plasmid Conclusions Future Experiment Comparison of the Use of Plasmid and PCR DNA on Microarray Chips Biology Department, Davidson College, Davidson, NC 28035Dan Pierce

  10. DNA sequencing: Clinical applications of new DNA sequencing technologies

    E-print Network

    Quake, Stephen R.

    DNA sequencing: Clinical applications of new DNA sequencing technologies Frederick E. Dewey, MD1-PAAuthorManuscriptNIH-PAAuthorManuscriptNIH-PAAuthorManuscript #12;Gilbert and Sanger sequencing,5,6 that DNA sequencing became widely available to the research community. The Sanger method, which is based on DNA chain termination with a small concentration of radio

  11. DNA BARCODING DNA barcoding exposes a case of mistaken identity

    E-print Network

    Schuettpelz, Eric

    DNA BARCODING DNA barcoding exposes a case of mistaken identity in the fern horticultural trade 93312, USA Abstract Using cheilanthoid ferns, we provide an example of how DNA barcoding approaches can identification errors in the international trade. Keywords: Cheilanthes, cheilanthoids, cultivated, DNA barcoding

  12. Circadian Modulation of 8-Oxoguanine DNA Damage Repair.

    PubMed

    Manzella, Nicola; Bracci, Massimo; Strafella, Elisabetta; Staffolani, Sara; Ciarapica, Veronica; Copertaro, Alfredo; Rapisarda, Venerando; Ledda, Caterina; Amati, Monica; Valentino, Matteo; Tomasetti, Marco; Stevens, Richard G; Santarelli, Lory

    2015-01-01

    The DNA base excision repair pathway is the main system involved in the removal of oxidative damage to DNA such as 8-Oxoguanine (8-oxoG) primarily via the 8-Oxoguanine DNA glycosylase (OGG1). Our goal was to investigate whether the repair of 8-oxoG DNA damage follow a circadian rhythm. In a group of 15 healthy volunteers, we found a daily variation of Ogg1 expression and activity with higher levels in the morning compared to the evening hours. Consistent with this, we also found lower levels of 8-oxoG in morning hours compared to those in the evening hours. Lymphocytes exposed to oxidative damage to DNA at 8:00 AM display lower accumulation of 8-oxoG than lymphocytes exposed at 8:00 PM. Furthermore, altered levels of Ogg1 expression were also observed in a group of shift workers experiencing a deregulation of circadian clock genes compared to a control group. Moreover, BMAL1 knockdown fibroblasts with a deregulated molecular clock showed an abolishment of circadian variation of Ogg1 expression and an increase of OGG1 activity. Our results suggest that the circadian modulation of 8-oxoG DNA damage repair, according to a variation of Ogg1 expression, could render humans less susceptible to accumulate 8-oxoG DNA damage in the morning hours. PMID:26337123

  13. Tris-dependent oxidative DNA strand scission during electrophoresis.

    PubMed

    Ray, T; Mills, A; Dyson, P

    1995-06-01

    The DNA of two Streptomyces species contains site-specific labile modifications. During gel electrophoresis the DNA can undergo Tris-dependent strand scission at the positions of these modifications. Our investigations into the nucleolytic activity which reacts with the modifications implicate a peracid derivative of Tris formed at the anode; the kinetics of production and decay of this activity were followed using both a DNA cleavage assay and a reduced methyl viologen assay to measure oxidant. Anode activation could be chemically mimicked by addition of peracetic acid to Tris buffers. We tested the DNA cleavage activity of several other compounds after anode or chemical activation; we used an analogue of Tris lacking a primary amine group and also several reagents known to promote DNA strand cleavage by amine-catalysis at abasic sites. Anode generation of oxidant could be detected for compounds containing either hydroxyl or carboxyl groups. However, DNA cleavage activity correlated with oxidant formation only for those compounds also containing primary amine groups. These results support a mechanism of DNA strand scission at modification sites via concerted peracid-mediated oxidative and amine-catalysed reactions. The novel finding of Tris-dependent formation of a long-lived reactive oxidant at the anode suggests that this compound is unsuited as an electrophoresis buffer for certain biological macromolecules. PMID:7498131

  14. Circadian Modulation of 8-Oxoguanine DNA Damage Repair

    PubMed Central

    Manzella, Nicola; Bracci, Massimo; Strafella, Elisabetta; Staffolani, Sara; Ciarapica, Veronica; Copertaro, Alfredo; Rapisarda, Venerando; Ledda, Caterina; Amati, Monica; Valentino, Matteo; Tomasetti, Marco; Stevens, Richard G.; Santarelli, Lory

    2015-01-01

    The DNA base excision repair pathway is the main system involved in the removal of oxidative damage to DNA such as 8-Oxoguanine (8-oxoG) primarily via the 8-Oxoguanine DNA glycosylase (OGG1). Our goal was to investigate whether the repair of 8-oxoG DNA damage follow a circadian rhythm. In a group of 15 healthy volunteers, we found a daily variation of Ogg1 expression and activity with higher levels in the morning compared to the evening hours. Consistent with this, we also found lower levels of 8-oxoG in morning hours compared to those in the evening hours. Lymphocytes exposed to oxidative damage to DNA at 8:00 AM display lower accumulation of 8-oxoG than lymphocytes exposed at 8:00 PM. Furthermore, altered levels of Ogg1 expression were also observed in a group of shift workers experiencing a deregulation of circadian clock genes compared to a control group. Moreover, BMAL1 knockdown fibroblasts with a deregulated molecular clock showed an abolishment of circadian variation of Ogg1 expression and an increase of OGG1 activity. Our results suggest that the circadian modulation of 8-oxoG DNA damage repair, according to a variation of Ogg1 expression, could render humans less susceptible to accumulate 8-oxoG DNA damage in the morning hours. PMID:26337123

  15. Complex kinetics of DNA condensation revealed through DNA twist tracing

    NASA Astrophysics Data System (ADS)

    Li, Wei; Wong, Wei Juan; Lim, Ci Ji; Ju, Hai-Peng; Li, Ming; Yan, Jie; Wang, Peng-Ye

    2015-08-01

    Toroid formation is an important mechanism for DNA condensation in cells. The length change during DNA condensation was investigated in previous single-molecule experiments. However, DNA twist is key to understanding the topological kinetics of DNA condensation. In this study, DNA twist as well as DNA length was traced during the DNA condensation by the freely orbiting magnetic tweezers and the tilted magnetic tweezers combined with Brownian dynamics simulations. The experimental results disclose the complex relationship between DNA extension and backbone rotation. Brownian dynamics simulations show that the toroid formation follows a wiggling pathway which leads to the complex DNA backbone rotation as revealed in our experiments. These findings provide the complete description of multivalent cation-dependent DNA toroid formation under tension.

  16. Effect of salt concentration on the stability of heterogeneous DNA

    NASA Astrophysics Data System (ADS)

    Singh, Amar; Singh, Navin

    2015-02-01

    We study the role of cations on the stability of double stranded DNA (dsDNA) molecules. It is known that the two strands of double stranded DNA (dsDNA) have negative charge due to phosphate group. Cations in the form of salt in the solution, act as shielding agents thereby reducing the repulsion between these strands. We study several heterogeneous DNA molecules. We calculate the phase diagrams for DNA molecules in thermal as well as in force ensembles using Peyrard-Bishop-Dauxois (PBD) model. The dissociation and the stacking energies are the two most important factors that play an important role in the DNA stability. With suitable modifications in the model parameters we investigate the role of cation concentration on the stability of different heterogeneous DNA molecules. The objective of this work is to understand how these cations modify the strength of different pairs or bases along the strand. The phase diagram for the force ensemble case (a dsDNA is pulled from an end) is compared with the experimental results.

  17. Effect of salt concentration on the stability of heterogeneous DNA

    E-print Network

    Amar Singh; Navin Singh

    2015-09-28

    We study the role of cations on the stability of double stranded DNA (dsDNA) molecules.It is known that the two strands of double stranded DNA(dsDNA) have negative charge due to phosphate group. Cations in the form of salt in the solution, act as shielding agents thereby reducing the repulsion between these strands. We study several heterogeneous DNA molecules. We calculate the phase diagrams for DNA molecules in thermal as well as in force ensembles using Peyrard-Bishop-Dauxois (PBD) model. The dissociation and the stacking energies are the two most important factors that play an important role in the DNA stability. With suitable modifications in the model parameters we investigate the role of cation concentration on the stability of different heterogeneous DNA molecules. The objective of this work is to understand how these cations modify the strength of different pairs or bases along the strand. The phase diagram for the force ensemble case (a dsDNA is pulled from an end) is compared with the experimental results.

  18. Underrepresented groups

    NASA Technical Reports Server (NTRS)

    Peters, David A.

    1990-01-01

    The problem with the shortage of under represented groups in science and engineering is absolutely crucial, especially considering that U.S. will experience a shortage of 560,000 science and engineering personnel by the year 2010. Most studies by the National Science Foundation also concluded that projected shortages cannot be alleviated without significant increases in the involvement of Blacks, Hispanics, Native Americans, handicapped persons, and women.

  19. DNA sequencing conference, 2

    SciTech Connect

    Cook-Deegan, R.M.; Venter, J.C.; Gilbert, W.; Mulligan, J.; Mansfield, B.K.

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  20. [Diagnostic DNA probes].

    PubMed

    Fey, M F

    1990-05-19

    Advances in molecular biology have had a tremendous impact on our understanding of the pathogenesis of hereditary disorders, tumours and infectious diseases. It is anticipated that recombinant DNA technology will gradually assume an important role as a diagnostic tool in medicine, since at least some of the techniques are now ready for routine use in the clinical laboratory. The most lucrative application (and hence the most competitive market) for DNA probes will be the detection of bacteria, viruses and other microbiological organisms by nucleic acid hybridization techniques. The value of recombinant DNA technology for prenatal diagnosis and carrier detection in genetic disorders is now firmly established. Analysis of DNA and RNA obtained from tumours may provide diagnostic information of practical relevance in carefully selected cases. It is, however, unlikely to challenge the established value of the more "traditional" diagnostic tools such as histopathology and immunophenotyping. PMID:2190309

  1. FBI's DNA analysis program

    NASA Astrophysics Data System (ADS)

    Brown, John R.

    1994-03-01

    Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

  2. Advance the DNA computing 

    E-print Network

    Qiu, Zhiquan Frank

    2004-09-30

    molecule and computer engineering are required to develop efficient DNA computing algorithms. After Adleman solved the Hamilton Path Problem using a combinatorial molecular method, many other hard computational problems were investigated with the proposed...

  3. DNA damage and carcinogenesis

    SciTech Connect

    Stelow, R B

    1980-01-01

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 10/sup 4/ fold.

  4. HPV DNA test

    MedlinePLUS

    ... during sex. Some types of HPV can cause cervical cancer and other cancers. These are called high-risk ... High-risk types of HPV can lead to cervical cancer or anal cancer. The HPV-DNA test is ...

  5. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  6. Shear Unzipping of DNA

    E-print Network

    Buddhapriya Chakrabarti; David R. Nelson

    2009-04-09

    We study theoretically the mechanical failure of a simple model of double stranded DNA under an applied shear. Starting from a more microscopic Hamiltonian that describes a sheared DNA, we arrive at a nonlinear generalization of a ladder model of shear unzipping proposed earlier by deGennes [deGennes P. G. C. R. Acad. Sci., Ser. IV; Phys., Astrophys. 2001, 1505]. Using this model and a combination of analytical and numerical methods, we study the DNA "unzipping" transition when the shearing force exceeds a critical threshold at zero temperature. We also explore the effects of sequence heterogeneity and finite temperature and discuss possible applications to determine the strength of colloidal nanoparticle assemblies functionalized by DNA.

  7. Close encounters with DNA

    PubMed Central

    Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

    2014-01-01

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  8. Multiplex analysis of DNA

    DOEpatents

    Church, George M. (Boston, MA); Kieffer-Higgins, Stephen (Dorchester, MA)

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  9. In organello formaldehyde crosslinking of proteins to mtDNA: Identification of bifunctional proteins

    PubMed Central

    Kaufman, Brett A.; Newman, Scott M.; Hallberg, Richard L.; Slaughter, Clive A.; Perlman, Philip S.; Butow, Ronald A.

    2000-01-01

    The segregating unit of mtDNA is a protein–DNA complex called the nucleoid. In an effort to understand how nucleoid proteins contribute to mtDNA organization and inheritance, we have developed an in organello formaldehyde crosslinking procedure to identify proteins associated with mtDNA. Using highly purified mitochondria, we observed a time-dependent crosslinking of protein to mtDNA as determined by sedimentation through isopycnic cesium chloride gradients. We detected ?20 proteins crosslinked to mtDNA and identified 11, mostly by mass spectrometry. Among them is Abf2p, an abundant, high-mobility group protein that is known to function in nucleoid morphology, and in mtDNA transactions. In addition to several other proteins with known DNA binding properties or that function in mtDNA maintenance, we identified other mtDNA-associated proteins that were not anticipated, such as the molecular chaperone Hsp60p and a Krebs cycle protein, Kgd2p. Genetic experiments indicate that hsp60-ts mutants have a petite-inducing phenotype at the permissive temperature and that a kgd2? mutation increases the petite-inducing phenotype of an abf2? mutation. Crosslinking and DNA gel shift experiments show that Hsp60p binds to single-stranded DNA with high specificity for the template strand of a putative origin of mtDNA replication. These data identify bifunctional proteins that participate in the stability of ?+ mtDNA. PMID:10869431

  10. Influence of some aldehyde blocking agents on staining of depurinized DNA with cationic dyes.

    PubMed

    Erenpreisa, J; Freivalds, T

    1979-01-01

    Rat liver, spleen and Walker carcinosarcoma imprints were subjected to depurinizing Feulgen hydrolysis and then treated with blocking agents of aldehyde groups. Such blockators as sodium bisulfite and hydroxylamine which multiplay additionally anionic groups in DNA and intensify the reactions with cationic dyes, ensuring anisotropic staining. Hydrazine lowers the binding of carionic dyes to DNA, instead phenylhydrazine, completely blocks both aldehyde and phosphate groups. When the imprints were treated with 2.4-dinitrophenylhydrazine, aldehyde and phosphate groups of apurinic acid were blocked, and DNA staining by cationic dyes occurred only on account of nitrogroups of the blocking agents which have been used. The staining reaction of cationic dyes after the use of anionogenic blocking agents of aldehyde groups is prospective not only for revealing DNA but also for several other compounds with natural or potential aldo- and ketogroups. However the reaction with phenylhydrazine can serve as a staining without removal of DNA prior to staining as an optional procedure. PMID:86483

  11. Leading Edge Reversing DNA Methylation

    E-print Network

    Zhang, Yi

    ). In mammals, new DNA methylation pattern is established by de novo DNA methyltransferases, DNMT3A and DNMT3B is faithfully maintained in daughter cells through the action of maintenance DNA methyltransferase DNMT1 and itsLeading Edge Review Reversing DNA Methylation: Mechanisms, Genomics, and Biological Functions Hao

  12. DNA Microarrays An R Tutorial

    E-print Network

    Qiu, Weigang

    DNA Microarrays An R Tutorial Gene Expression Analysis & R Tutorial Weigang Qiu Department Expression Analysis & R Tutorial #12;DNA Microarrays An R Tutorial Outline 1 DNA Microarrays 2 An R Tutorial Weigang Qiu Gene Expression Analysis & R Tutorial #12;DNA Microarrays An R Tutorial Functional Genomics

  13. -DNA 1217 BK21-IT,

    E-print Network

    - DNA 1217 BK21-IT, (MEC) (NRL) . . : : : : syshin@bi.snu.ac.kr ihlee@bi.snu.ac.kr btzhang@bi.snu.ac.kr 2004 9 16 2005 10 14 - DNA (DNA Sequence Design using -Multiobjective Evolutionary Algorithm) (Soo-Yong Shin) (In-Hee Lee) (Byoung-Tak Zhang) DNA

  14. Das DNA-Puzzle

    NASA Astrophysics Data System (ADS)

    Kirchner, Stefan

    Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

  15. Celebrating DNA's Repair Crew.

    PubMed

    Kunkel, Thomas A

    2015-12-01

    This year, the Nobel Prize in Chemistry has been awarded to Tomas Lindahl, Aziz Sancar, and Paul Modrich for their seminal studies of the mechanisms by which cells from bacteria to man repair DNA damage that is generated by normal cellular metabolism and stress from the environment. These studies beautifully illustrate the remarkable power of DNA repair to influence life from evolution through disease susceptibility. PMID:26638062

  16. Simultaneous RNA-DNA FISH.

    PubMed

    Lai, Lan-Tian; Meng, Zhenyu; Shao, Fangwei; Zhang, Li-Feng

    2016-01-01

    A highly useful tool for studying lncRNAs is simultaneous RNA-DNA FISH, which reveals the localization and quantitative information of RNA and DNA in cellular contexts. However, a simple combination of RNA FISH and DNA FISH often generates disappointing results because the fragile RNA signals are often damaged by the harsh conditions used in DNA FISH for denaturing the DNA. Here, we describe a robust and simple RNA-DNA FISH protocol, in which amino-labeled nucleic acid probes are used for RNA FISH. The method is suitable to detect single-RNA molecules simultaneously with DNA. PMID:26721488

  17. Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters

    E-print Network

    Bolshoy, Alexander

    Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters Alexander Bolshoy1 of the distribution of predicted intrinsic curvature along all available complete prokaryotic genomes, the genomes were divided into two groups. Curvature distribution in all prokaryotes of the first group indicated

  18. Variations in brain DNA

    PubMed Central

    Avila, Jesús; Gómez-Ramos, Alberto; Soriano, Eduardo

    2014-01-01

    It is assumed that DNA sequences are conserved in the diverse cell types present in a multicellular organism like the human being. Thus, in order to compare the sequences in the genome of DNA from different individuals, nucleic acid is commonly isolated from a single tissue. In this regard, blood cells are widely used for this purpose because of their availability. Thus blood DNA has been used to study genetic familiar diseases that affect other tissues and organs, such as the liver, heart, and brain. While this approach is valid for the identification of familial diseases in which mutations are present in parental germinal cells and, therefore, in all the cells of a given organism, it is not suitable to identify sporadic diseases in which mutations might occur in specific somatic cells. This review addresses somatic DNA variations in different tissues or cells (mainly in the brain) of single individuals and discusses whether the dogma of DNA invariance between cell types is indeed correct. We will also discuss how single nucleotide somatic variations arise, focusing on the presence of specific DNA mutations in the brain. PMID:25505410

  19. DNA synthesis security.

    PubMed

    Nouri, Ali; Chyba, Christopher F

    2012-01-01

    It is generally assumed that genetic engineering advances will, inevitably, facilitate the misapplication of biotechnology toward the production of biological weapons. Unexpectedly, however, some of these very advances in the areas of DNA synthesis and sequencing may enable the implementation of automated and nonintrusive safeguards to avert the illicit applications of biotechnology. In the case of DNA synthesis, automated DNA screening tools could be built into DNA synthesizers in order to block the synthesis of hazardous agents. In addition, a comprehensive safety and security regime for dual-use genetic engineering research could include nonintrusive monitoring of DNA sequencing. This is increasingly feasible as laboratories outsource this service to just a few centralized sequencing factories. The adoption of automated, nonintrusive monitoring and surveillance of the DNA synthesis and sequencing pipelines may avert many risks associated with dual-use biotechnology. Here, we describe the historical background and current challenges associated with dual-use biotechnologies and propose strategies to address these challenges. PMID:22328441

  20. DNA biosensors that reason.

    PubMed

    Sainz de Murieta, Iñaki; Rodríguez-Patón, Alfonso

    2012-08-01

    Despite the many designs of devices operating with the DNA strand displacement, surprisingly none is explicitly devoted to the implementation of logical deductions. The present article introduces a new model of biosensor device that uses nucleic acid strands to encode simple rules such as "IF DNA_strand(1) is present THEN disease(A)" or "IF DNA_strand(1) AND DNA_strand(2) are present THEN disease(B)". Taking advantage of the strand displacement operation, our model makes these simple rules interact with input signals (either DNA or any type of RNA) to generate an output signal (in the form of nucleotide strands). This output signal represents a diagnosis, which either can be measured using FRET techniques, cascaded as the input of another logical deduction with different rules, or even be a drug that is administered in response to a set of symptoms. The encoding introduces an implicit error cancellation mechanism, which increases the system scalability enabling longer inference cascades with a bounded and controllable signal-noise relation. It also allows the same rule to be used in forward inference or backward inference, providing the option of validly outputting negated propositions (e.g. "diagnosis A excluded"). The models presented in this paper can be used to implement smart logical DNA devices that perform genetic diagnosis in vitro. PMID:22406690

  1. DNA methylation in an engineered heart tissue model of cardiac hypertrophy: common signatures and effects of DNA methylation inhibitors.

    PubMed

    Stenzig, Justus; Hirt, Marc N; Löser, Alexandra; Bartholdt, Lena M; Hensel, Jan-Tobias; Werner, Tessa R; Riemenschneider, Mona; Indenbirken, Daniela; Guenther, Thomas; Müller, Christian; Hübner, Norbert; Stoll, Monika; Eschenhagen, Thomas

    2016-01-01

    DNA methylation affects transcriptional regulation and constitutes a drug target in cancer biology. In cardiac hypertrophy, DNA methylation may control the fetal gene program. We therefore investigated DNA methylation signatures and their dynamics in an in vitro model of cardiac hypertrophy based on engineered heart tissue (EHT). We exposed EHTs from neonatal rat cardiomyocytes to a 12-fold increased afterload (AE) or to phenylephrine (PE 20 µM) and compared DNA methylation signatures to control EHT by pull-down assay and DNA methylation microarray. A 7-day intervention sufficed to induce contractile dysfunction and significantly decrease promoter methylation of hypertrophy-associated upregulated genes such as Nppa (encoding ANP) and Acta1 (?-skeletal actin) in both intervention groups. To evaluate whether pathological consequences of AE are affected by inhibiting de novo DNA methylation we applied AE in the absence and presence of DNA methyltransferase (DNMT) inhibitors: 5-aza-2'-deoxycytidine (aza, 100 µM, nucleosidic inhibitor), RG108 (60 µM, non-nucleosidic) or methylene disalicylic acid (MDSA, 25 µM, non-nucleosidic). Aza had no effect on EHT function, but RG108 and MDSA partially prevented the detrimental consequences of AE on force, contraction and relaxation velocity. RG108 reduced AE-induced Atp2a2 (SERCA2a) promoter methylation. The results provide evidence for dynamic DNA methylation in cardiac hypertrophy and warrant further investigation of the potential of DNA methylation in the treatment of cardiac hypertrophy. PMID:26680771

  2. A novel carbohydrate derived compound FCP5 causes DNA strand breaks and oxidative modifications of DNA bases in cancer cells.

    PubMed

    Czubatka, Anna; Sarnik, Joanna; Lucent, Del; Blasiak, Janusz; Witczak, Zbigniew J; Poplawski, Tomasz

    2015-02-01

    1,5-Anhydro-6-deoxy-methane-sulfamido-D-glucitol (FCP5) is a functionalized carbohydrate containing functional groups that render it potentially therapeutically useful. According to our concept of 'functional carb-pharmacophores' (FCPs) incorporation of the methanesulfonamido pharmacophore to 1,5 glucitol could create a therapeutically useful compound. Our previous studies revealed that FCP5 was cytotoxic to cancer cells. Therefore, in this work we assessed the cytotoxic mechanisms of FCP5 in four cancer cell lines - HeLa, LoVo, A549 and MCF-7, with particular focus on DNA damage and repair. A broad spectrum of methods, including comet assay with modifications, DNA repair enzyme assay, plasmid relaxation assay, and DNA fragmentation assay, were used. We also checked the potential for FCP5 to induce apoptosis. The results show that FCP5 can induce DNA strand breaks as well as oxidative modifications of DNA bases. DNA lesions induced by FCP5 were not entirely repaired in HeLa cells and DNA repair kinetics differs from other cell lines. Results from molecular docking and plasmid relaxation assay suggest that FCP5 binds to the major groove of DNA with a preference for adenosine-thymine base pair sequences and directly induces DNA strand breaks. Thus, FCP5 may represent a novel lead for the design of new major groove-binding compounds. The results also confirmed the validity of functional carb-pharmacophores as a new source of innovative drugs. PMID:25557509

  3. DNA Knots: Theory and Experiments

    NASA Astrophysics Data System (ADS)

    Sumners, D. W.

    Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.

  4. Multicolor and erasable DNA photolithography.

    PubMed

    Huang, Fujian; Xu, Huaguo; Tan, Weihong; Liang, Haojun

    2014-07-22

    The immobilization of DNA molecules onto a solid support is a crucial step in biochip research and related applications. In this work, we report a DNA photolithography method based on photocleavage of 2-nitrobenzyl linker-modified DNA strands. These strands were subjected to ultraviolet light irradiation to generate multiple short DNA strands in a programmable manner. Coupling the toehold-mediated DNA strand-displacement reaction with DNA photolithography enabled the fabrication of a DNA chip surface with multifunctional DNA patterns having complex geometrical structures at the microscale level. The erasable DNA photolithography strategy was developed to allow different paintings on the same chip. Furthermore, the asymmetrical modification of colloidal particles was carried out by using this photolithography strategy. This strategy has broad applications in biosensors, nanodevices, and DNA-nanostructure fabrication. PMID:24988147

  5. Multicolor and Erasable DNA Photolithography

    PubMed Central

    2015-01-01

    The immobilization of DNA molecules onto a solid support is a crucial step in biochip research and related applications. In this work, we report a DNA photolithography method based on photocleavage of 2-nitrobenzyl linker-modified DNA strands. These strands were subjected to ultraviolet light irradiation to generate multiple short DNA strands in a programmable manner. Coupling the toehold-mediated DNA strand-displacement reaction with DNA photolithography enabled the fabrication of a DNA chip surface with multifunctional DNA patterns having complex geometrical structures at the microscale level. The erasable DNA photolithography strategy was developed to allow different paintings on the same chip. Furthermore, the asymmetrical modification of colloidal particles was carried out by using this photolithography strategy. This strategy has broad applications in biosensors, nanodevices, and DNA-nanostructure fabrication. PMID:24988147

  6. DNA bending facilitates the error-free DNA damage tolerance pathway and upholds genome integrity

    PubMed Central

    Gonzalez-Huici, Victor; Szakal, Barnabas; Urulangodi, Madhusoodanan; Psakhye, Ivan; Castellucci, Federica; Menolfi, Demis; Rajakumara, Eerappa; Fumasoni, Marco; Bermejo, Rodrigo; Jentsch, Stefan; Branzei, Dana

    2014-01-01

    DNA replication is sensitive to damage in the template. To bypass lesions and complete replication, cells activate recombination-mediated (error-free) and translesion synthesis-mediated (error-prone) DNA damage tolerance pathways. Crucial for error-free DNA damage tolerance is template switching, which depends on the formation and resolution of damage-bypass intermediates consisting of sister chromatid junctions. Here we show that a chromatin architectural pathway involving the high mobility group box protein Hmo1 channels replication-associated lesions into the error-free DNA damage tolerance pathway mediated by Rad5 and PCNA polyubiquitylation, while preventing mutagenic bypass and toxic recombination. In the process of template switching, Hmo1 also promotes sister chromatid junction formation predominantly during replication. Its C-terminal tail, implicated in chromatin bending, facilitates the formation of catenations/hemicatenations and mediates the roles of Hmo1 in DNA damage tolerance pathway choice and sister chromatid junction formation. Together, the results suggest that replication-associated topological changes involving the molecular DNA bender, Hmo1, set the stage for dedicated repair reactions that limit errors during replication and impact on genome stability. PMID:24473148

  7. Defects in mitochondrial DNA replication and oxidative damage in muscle of mtDNA mutator mice.

    PubMed

    Kolesar, Jill E; Safdar, Adeel; Abadi, Arkan; MacNeil, Lauren G; Crane, Justin D; Tarnopolsky, Mark A; Kaufman, Brett A

    2014-10-01

    A causal role for mitochondrial dysfunction in mammalian aging is supported by recent studies of the mtDNA mutator mouse ("PolG" mouse), which harbors a defect in the proofreading-exonuclease activity of mitochondrial DNA polymerase gamma. These mice exhibit accelerated aging phenotypes characteristic of human aging, including systemic mitochondrial dysfunction, exercise intolerance, alopecia and graying of hair, curvature of the spine, and premature mortality. While mitochondrial dysfunction has been shown to cause increased oxidative stress in many systems, several groups have suggested that PolG mutator mice show no markers of oxidative damage. These mice have been presented as proof that mitochondrial dysfunction is sufficient to accelerate aging without oxidative stress. In this study, by normalizing to mitochondrial content in enriched fractions we detected increased oxidative modification of protein and DNA in PolG skeletal muscle mitochondria. We separately developed novel methods that allow simultaneous direct measurement of mtDNA replication defects and oxidative damage. Using this approach, we find evidence that suggests PolG muscle mtDNA is indeed oxidatively damaged. We also observed a significant decrease in antioxidants and expression of mitochondrial biogenesis pathway components and DNA repair enzymes in these mice, indicating an association of maladaptive gene expression with the phenotypes observed in PolG mice. Together, these findings demonstrate the presence of oxidative damage associated with the premature aging-like phenotypes induced by mitochondrial dysfunction. PMID:25106705

  8. Forensic DNA profiling and database.

    PubMed

    Panneerchelvam, S; Norazmi, M N

    2003-07-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection. PMID:23386793

  9. Intermediate DNA at low added salt: DNA bubbles slow the diffusion of short DNA fragments

    E-print Network

    Tomislav Vuletic; Sanja Dolanski Babic; Ticijana Ban; Joachim Raedler; Francoise Livolant; Silvia Tomic

    2011-01-05

    We report a study of DNA (150 bp fragments) conformations in very low added salt $DNA concentration range $0.0015\\leq c \\leq 8$~mM (bp). We found an intermediate DNA conformation in the region $0.05 DNA has the diffusion coefficient, $D_p$ reduced below the values for both ssDNA coils and native dsDNA helices of similar polymerization degree $N$. Thus, this DNA population can not be a simple mix of dsDNA and of ssDNA which results from DNA melting. Here, melting occurs due to a reduction in screening concomitant with DNA concentration being reduced, in already very low salt conditions. The intermediate DNA is rationalized through the well known concept of fluctuational openings (DNA bubbles) which we postulate to form in AT-rich portions of the sequence, without the strands coming apart. Within the bubbles, DNA is locally stretched, while the whole molecule remains rod-like due to very low salt environment. Therefore, such intermediate DNA is elongated, in comparison to dsDNA, which accounts for its reduced $D_p$.

  10. Low copy number of mitochondrial DNA (mtDNA) predicts worse prognosis in early-stage laryngeal cancer patients

    PubMed Central

    2014-01-01

    Objectives Alterations in mitochondrial DNA (mtDNA) copy number have been widely reported in various human cancers, and been considered to be an important hallmark of cancers. However, little is known about the value of copy number variations of mtDNA in the prognostic evaluation of laryngeal cancer. Design and methods Using real-time quantitative PCR method, we investigated mtDNA copy number in a cohort of laryngeal cancers (n =204) and normal laryngeal tissues (n =40), and explored the association of variable mtDNA copy number with clinical outcomes of laryngeal cancer patients. Results Our data showed that the relative mean mtDNA content was higher in the laryngeal cancer patients (11.91?±?4.35 copies) than the control subjects (4.72?±?0.70 copies). Moreover, we found that mtDNA content was negatively associated with cigarette smoking (pack-years), tumor invasion, and TNM stage. Notably, variable mtDNA content did not affect overall survival of laryngeal cancer patients. However, when the patients were categorized into early-stage and late-stage tumor groups according to TNM stage, we found that low mtDNA content was strongly associated with poor survival in the former, but not in the latter. Conclusions The present study demonstrated that low mtDNA content was strongly correlated with some of clinicopathological characteristics, such as cigarette smoking, tumor invasion and TNM stage. In addition, we found a strong link between low mtDNA content and worse survival of the patients with early-stage tumors. Taken together, low copy number of mtDNA may be a useful poor prognostic factor for early-stage laryngeal cancer patients. Virtual slides The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1841771572115955 PMID:24499477

  11. Unzipping of Double-stranded DNA in Engineered ?-Hemolysin Pores.

    PubMed

    Liu, Aihua; Zhao, Qitao; Krishantha, D M Milan; Guan, Xiyun

    2011-06-12

    Biological protein ?-hemolysin nanopore is under intense investigation as a potential platform for rapid and low-cost DNA sequencing. However, due to its narrow constriction, analysis of DNA in the ?-hemolysin pore has long time been restricted to single strands. In this paper, we report that by introducing new surface functional groups into the ?-hemolysin pore, facilitated unzipping of double-stranded DNA through the channel could be achieved. Since the mean residence time of the DNA events is dependent on the length of the duplex, and also varies with the nucleotide base composition, the modified protein pore approach offers the potential for rapid double-stranded DNA analysis, including sequencing. PMID:21709813

  12. Unzipping of Double-stranded DNA in Engineered ?-Hemolysin Pores

    PubMed Central

    Liu, Aihua; Zhao, Qitao; Krishantha, D.M. Milan; Guan, Xiyun

    2011-01-01

    Biological protein ?-hemolysin nanopore is under intense investigation as a potential platform for rapid and low-cost DNA sequencing. However, due to its narrow constriction, analysis of DNA in the ?-hemolysin pore has long time been restricted to single strands. In this paper, we report that by introducing new surface functional groups into the ?-hemolysin pore, facilitated unzipping of double-stranded DNA through the channel could be achieved. Since the mean residence time of the DNA events is dependent on the length of the duplex, and also varies with the nucleotide base composition, the modified protein pore approach offers the potential for rapid double-stranded DNA analysis, including sequencing. PMID:21709813

  13. [DNA helicases and human diseases].

    PubMed

    Uhring, Muriel; Poterszman, Arnaud

    2006-12-01

    DNA helicases are molecular motors that catalyse the unwinding of energetically unstable structures into single strands and have therefore an essential role in nearly all metabolism transactions. Defects in helicase function can result in human syndromes in which predisposition to cancer and genomic instability are common features. So far different helicase genes have been found associated in 8 such disorders. RecQ helicases are a family of conserved enzymes required for maintaining the genome integrity that function as suppressors of inappropriate recombination. Mutations in RecQ4, BLM and WRN give rise to various disorders: Bloom syndrome, Rothmund-Thomson syndrome, and Werner syndrome characterized by genomic instability and increased cancer susceptibility. The DNA helicase BRIP1/BACH1 is involved in double-strand break repair and is defective in Fanconi anemia complementation group J. Mutations in XPD and XPB genes can result in xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy, three genetic disorders with different clinical features but with association of transcription and NER defects. This review summarizes our current knowledge on the diverse biological functions of these helicases and the molecular basis of the associated diseases. PMID:17156731

  14. Supramolecular Complexes of DNA

    NASA Astrophysics Data System (ADS)

    Zuber, G.; Scherman, D.

    Deoxyribose nucleic acid or DNA is a linear polymer in the form of a double strand, synthesised by sequential polymerisation of a large number of units chosen from among the nucleic bases called purines (adenosine A and guanosine G) and pyrimidines (cytosine C and thymidine T). DNA contains all the genetic information required for life. It exists in the form of a limited number (a few dozen) of very big molecules, called chromosomes. This genetic information is first of all transcribed. In this process, a restricted fragment of the DNA called a gene is copied in the form of ribonucleic acid, or RNA. This RNA is itself a polymer, but with a single strand in which the sequence of nucleic acids is schematically analogous to the sequence on one of the two strands of the transcribed DNA. Finally, this RNA is translated into a protein, yet another linear polymer. The proteins make up the main part of the active constituents ensuring the survival of the cell. Any loss of information, either by mutation or by deletion of the DNA, will cause an imbalance in the cell's metabolism that may in turn lead to incurable pathologies. Several strategies have been developed to reduce the consequences of such genetic deficiencies or, more generally, to act, by amplifying or suppressing them, on the mechanisms leading from the reading of the genetic information to the production of proteins: Strategies aiming to introduce synthetic DNA or RNA, which selectively block the expression of certain genes, are now being studied by an increasing number of research scientists and pharmacologists. They use antisense oligodeoxyribonucleotides or interfering oligoribonucleotides and they already have clinical applications. This kind of therapy is often called gene pharmacology. Other, more ambitious strategies aim to repair in situ mutated or incomplete DNA within the chromosomes themselves, by introducing short sequences of DNA or RNA which recognise and take the place of mutations. This is the underlying principle of genetic correction. Yet other strategies aim to reintroduce the deficient DNA fragments into the cells in the form of genes. Indeed, in certain diseases, the only solution is to bring genetic information back into the cells by transferring exogeneous DNA into the cell nucleus. This approach goes by the name of gene therapy.

  15. DNA packaging proteins Glom and Glom2 coordinately organize the mitochondrial nucleoid of Physarum polycephalum.

    PubMed

    Itoh, Kie; Izumi, Akiko; Mori, Toshiyuki; Dohmae, Naoshi; Yui, Ryoko; Maeda-Sano, Katsura; Shirai, Yuki; Kanaoka, Masahiro M; Kuroiwa, Tsuneyoshi; Higashiyama, Tetsuya; Sugita, Mamoru; Murakami-Murofushi, Kimiko; Kawano, Shigeyuki; Sasaki, Narie

    2011-07-01

    Mitochondrial DNA (mtDNA) is generally packaged into the mitochondrial nucleoid (mt-nucleoid) by a high-mobility group (HMG) protein. Glom is an mtDNA-packaging HMG protein in Physarum polycephalum. Here we identified a new mtDNA-packaging protein, Glom2, which had a region homologous with yeast Mgm101. Glom2 could bind to an entire mtDNA and worked synergistically with Glom for condensation of mtDNA in vitro. Down-regulation of Glom2 enhanced the alteration of mt-nucleoid morphology and the loss of mtDNA induced by down-regulation of Glom, and impaired mRNA accumulation of some mtDNA-encoded genes. These data suggest that Glom2 may organize the mt-nucleoid coordinately with Glom. PMID:21406253

  16. Strandwise translocation of a DNA glycosylase on undamaged DNA

    SciTech Connect

    Qi, Yan; Nam, Kwangho; Spong, Marie C.; Banerjee, Anirban; Sung, Rou-Jia; Zhang, Michael; Karplus, Martin; Verdine, Gregory L.

    2012-05-14

    Base excision repair of genotoxic nucleobase lesions in the genome is critically dependent upon the ability of DNA glycosylases to locate rare sites of damage embedded in a vast excess of undamaged DNA, using only thermal energy to fuel the search process. Considerable interest surrounds the question of how DNA glycosylases translocate efficiently along DNA while maintaining their vigilance for target damaged sites. Here, we report the observation of strandwise translocation of 8-oxoguanine DNA glycosylase, MutM, along undamaged DNA. In these complexes, the protein is observed to translocate by one nucleotide on one strand while remaining untranslocated on the complementary strand. We further report that alterations of single base-pairs or a single amino acid substitution (R112A) can induce strandwise translocation. Molecular dynamics simulations confirm that MutM can translocate along DNA in a strandwise fashion. These observations reveal a previously unobserved mode of movement for a DNA-binding protein along the surface of DNA.

  17. Diffusion coefficients of two-dimensional viral DNA walks

    NASA Astrophysics Data System (ADS)

    Hsu, Tai-Hsin; Nyeo, Su-Long

    2003-05-01

    DNA sequences are represented as two-dimensional walkers based on groups of mapping rules for the nucleotides in the DNA sequences. Digital sequences from irrational and random numbers in base 4 are generated and their diffusion properties are then compared with those of 21 nucleotide sequences of animal and plant viruses. By defining the diffusion coefficient as a function of the number of steps taken in a walk, we show that the coefficients for the viral DNA sequences generally have maximum values considerably larger than those for the random-number sequences of same lengths. Moreover, using the walker diagrams generated by different mapping groups, we can study the dominance of any of the nucleotide pairs (AG or CT), (AC or GT), or (AT or CG) in a DNA sequence. Other possible studies of this approach are mentioned.

  18. 2006 Nature Publishing Group The finished DNA sequence of human

    E-print Network

    Cai, Long

    an earlier advanced sequence tagged site (STS) physical map, which contained 5,300 large-insert clones and 3,100 markers with an average resolu- tion of 44 kilobases (kb)4 . After integration with the whole genome-order structure indicative of the `core centromere' on either arm, but previously established markers8 , which

  19. 2006 Nature Publishing Group Folding DNA to create nanoscale shapes

    E-print Network

    Winfree, Erik

    techniques have essentially answered this challenge: atomic force microscopy2 (AFM) and scanning tunnelling microscopy3,4 (STM) allow us to manipulate individual atoms. But these techniques create patterns serially (one line or one pixel at a time) and tend to require ultrahigh vacuum or cryogenic temperatures

  20. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. PMID:18834537

  1. DNA Display I. Sequence-Encoded Routing of DNA Populations

    PubMed Central

    Halpin, David R

    2004-01-01

    Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools based on sequence. Partitioning steps can be iterated indefinitely, with worst-case yields of 85% per step. These techniques facilitate DNA-programmed chemical synthesis, and thus enable a materials biology that could revolutionize drug discovery. PMID:15221027

  2. Coarse-graining DNA for simulations of DNA nanotechnology

    E-print Network

    Doye, Jonathan P K; Louis, Ard A; Romano, Flavio; Sulc, Petr; Matek, Christian; Snodin, Benedict E K; Rovigatti, Lorenzo; Schreck, John S; Harrison, Ryan M; Smith, William P J

    2013-01-01

    To simulate long time and length scale processes involving DNA it is necessary to use a coarse-grained description. Here we provide an overview of different approaches to such coarse graining, focussing on those at the nucleotide level that allow the self-assembly processes associated with DNA nanotechnology to be studied. OxDNA, our recently-developed coarse-grained DNA model, is particularly suited to this task, and has opened up this field to systematic study by simulations. We illustrate some of the range of DNA nanotechnology systems to which the model is being applied, as well as the insights it can provide into fundamental biophysical properties of DNA.

  3. Coarse-graining DNA for simulations of DNA nanotechnology

    E-print Network

    Jonathan P. K. Doye; Thomas E. Ouldridge; Ard A. Louis; Flavio Romano; Petr Sulc; Christian Matek; Benedict E. K. Snodin; Lorenzo Rovigatti; John S. Schreck; Ryan M. Harrison; William P. J. Smith

    2013-08-18

    To simulate long time and length scale processes involving DNA it is necessary to use a coarse-grained description. Here we provide an overview of different approaches to such coarse graining, focussing on those at the nucleotide level that allow the self-assembly processes associated with DNA nanotechnology to be studied. OxDNA, our recently-developed coarse-grained DNA model, is particularly suited to this task, and has opened up this field to systematic study by simulations. We illustrate some of the range of DNA nanotechnology systems to which the model is being applied, as well as the insights it can provide into fundamental biophysical properties of DNA.

  4. Environmental Vibrio parahaemolyticus DNA signatures validation.

    PubMed

    Caburlotto, G; Knight, I T; Lleo, M M; Taviani, E; Huq, A; Colwell, R R

    2011-12-01

    Insignia is a novel DNA computational system which uses highly efficient algorithms to compare bacterial genomes and to identify specific DNA signatures to distinguish a target bacterium, or group of bacteria, from all other known bacterial species. It is currently being validated using different bacterial groups, including Vibrio spp. In this study, the genomic analysis by Insignia was conducted on Vibrio parahaemolyticus, a halophilic gram-negative bacteria which constitutes a leading cause of seafood-borne disease. Insignia was used to identify 37 V. parahaemolyticus-specific signatures and to design PCR assays to validate the representative signature sequences by TaqMan essays. The 37 assays targeted loci distributed around the genome and detected genes coding for hypothetical proteins and for proteins involved in adhesion, starvation and virulence. A panel of V. parahaemolyticus environmental strains isolated from the North Adriatic Sea (Italy) and from the Black Sea (Georgia) was used to validate the selected signatures. The signature assays revealed both sensitive and specific and the method allowed a more accurate identification of the tested bacterial strains at the species level when compared to biochemical and PCR standard methods. Using Insignia, it was possible to distinguish two different groups among the strains previously identified as V. parahaemolyticus: most of the strains were included in a "V. parahaemolyticus-like group" showing nearly all of the signatures assayed while a small group of 10 strains contained only a few of the signatures tested. By sequencing the 16S rDNA of this latter group, it was confirmed that they were not V. parahaemolyticus but in fact belonged to other Vibrio species. No significant genome-wide differences were detected between the strains isolated in Italy and in Georgia though the very different geographical origin. PMID:21940129

  5. Nonhomologous DNA End Joining in Cell-Free Extracts

    PubMed Central

    Sharma, Sheetal; Raghavan, Sathees C.

    2010-01-01

    Among various DNA damages, double-strand breaks (DSBs) are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ) is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems. PMID:20936167

  6. Leukocyte Mitochondrial DNA Copy Number Is Associated with Chronic Obstructive Pulmonary Disease

    PubMed Central

    Liu, Shih-Feng; Kuo, Ho-Chang; Tseng, Ching-Wan; Huang, Hung-Tu; Chen, Yung-Che; Tseng, Chia-Cheng; Lin, Meng-Chih

    2015-01-01

    Background Oxidative stress is known to be involved in the pathogenesis of chronic obstructive pulmonary disease (COPD). Evidence suggests that leukocytes mitochondria DNA (mtDNA) is susceptible to undergo mutations, insertions, or depletion in response to reactive oxidative stress (ROS). We hypothesize that mtDNA copy number is associated with the development of COPD. Methodology/Principal Findings Relative mtDNA copy number was measured by a quantitative real-time PCR assay using DNA extracted from peripheral leukocytes. MtDNA copy number of peripheral leukocytes in the COPD group (n = 86) is significantly decreased compared with non-smoker group (n = 77) (250.3± 21.5 VS. 464.2± 49.9, P<0.001). MtDNA copy number in the COPD group was less than that in the healthy smoking group, but P value nearly achieved significance (250.3± 21.5 VS. 404.0± 76.7, P = 0.08) MtDNA copy number has no significance with age, gender, body mass index, current smoking, and pack-years in COPD group, healthy smoker group and no smoker group, respectively. Serum glutathione level in the COPD group is significantly decreased compared with healthy smoker and non-smoker groups (4.5± 1.3 VS. 6.2± 1.9 and 4.5± 1.3 VS. 7.1±1.1 mU/mL; P<0.001 respectively). Pearson correlation test shows a significant liner correlation between mtDNA copy number and serum glutathione level (R = 0.2, P = 0.009). Conclusions/Significance COPD is associated with decreased leukocyte mtDNA copy number and serum glutathione. COPD is a regulatory disorder of leukocytes mitochondria. However, further studies are needed to determine the real mechanisms about the gene and the function of mitochondria. PMID:26394041

  7. DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters

    NASA Astrophysics Data System (ADS)

    Fernández-Álvarez, Fernando Ángel; Machordom, Annie

    2013-09-01

    For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.

  8. Bricks and blueprints: methods and standards for DNA assembly.

    PubMed

    Casini, Arturo; Storch, Marko; Baldwin, Geoffrey S; Ellis, Tom

    2015-09-01

    DNA assembly is a key part of constructing gene expression systems and even whole chromosomes. In the past decade, a plethora of powerful new DNA assembly methods - including Gibson Assembly, Golden Gate and ligase cycling reaction (LCR) - have been developed. In this Innovation article, we discuss these methods as well as standards such as the modular cloning (MoClo) system, GoldenBraid, modular overlap-directed assembly with linkers (MODAL) and PaperClip, which have been developed to facilitate a streamlined assembly workflow, to aid the exchange of material between research groups and to create modular reusable DNA parts. PMID:26081612

  9. Higher-Level Phylogenetic Relationships of Homobasidiomycetes (Mushroom-Forming Fungi) Inferred from Four rDNA Regions

    E-print Network

    Hibbett, David S.

    from Four rDNA Regions Manfred Binder and David S. Hibbett1 Department of Biology, Clark University and mitochondrial large and small subunit ribosomal RNA genes (nuc-lsu, nuc-ssu, mt-lsu, mt-ssu rDNA), although groups of molecular systematists working on homobasidiomycetes have tended to focus on differ- ent rDNA

  10. Towards single molecule DNA sequencing

    NASA Astrophysics Data System (ADS)

    Liu, Hao

    Single molecule DNA Sequencing technology has been a hot research topic in the recent decades because it holds the promise to sequence a human genome in a fast and affordable way, which will eventually make personalized medicine possible. Single molecule differentiation and DNA translocation control are the two main challenges in all single molecule DNA sequencing methods. In this thesis, I will first introduce DNA sequencing technology development and its application, and then explain the performance and limitation of prior art in detail. Following that, I will show a single molecule DNA base differentiation result obtained in recognition tunneling experiments. Furthermore, I will explain the assembly of a nanofluidic platform for single strand DNA translocation, which holds the promised to be integrated into a single molecule DNA sequencing instrument for DNA translocation control. Taken together, my dissertation research demonstrated the potential of using recognition tunneling techniques to serve as a general readout system for single molecule DNA sequencing application.

  11. Cardiovascular group

    NASA Technical Reports Server (NTRS)

    Blomqvist, Gunnar

    1989-01-01

    As a starting point, the group defined a primary goal of maintaining in flight a level of systemic oxygen transport capacity comparable to each individual's preflight upright baseline. The goal of maintaining capacity at preflight levels would seem to be a reasonable objective for several different reasons, including the maintenance of good health in general and the preservation of sufficient cardiovascular reserve capacity to meet operational demands. It is also important not to introduce confounding variables in whatever other physiological studies are being performed. A change in the level of fitness is likely to be a significant confounding variable in the study of many organ systems. The principal component of the in-flight cardiovascular exercise program should be large-muscle activity such as treadmill exercise. It is desirable that at least one session per week be monitored to assure maintenance of proper functional levels and to provide guidance for any adjustments of the exercise prescription. Appropriate measurements include evaluation of the heart-rate/workload or the heart-rate/oxygen-uptake relationship. Respiratory gas analysis is helpful by providing better opportunities to document relative workload levels from analysis of the interrelationships among VO2, VCO2, and ventilation. The committee felt that there is no clear evidence that any particular in-flight exercise regimen is protective against orthostatic hypotension during the early readaptation phase. Some group members suggested that maintenance of the lower body muscle mass and muscle tone may be helpful. There is also evidence that late in-flight interventions to reexpand blood volume to preflight levels are helpful in preventing or minimizing postflight orthostatic hypotension.

  12. DNA banking and DNA databanking by academic and commercial laboratories

    SciTech Connect

    McEwen, J.E. |; Reilly, P.R.

    1994-09-01

    The advent of DNA-based testing is giving rise to DNA banking (the long-term storage of cells, transformed cell lines, or extracted DNA for subsequent retrieval and analysis) and DNA data banking (the indefinite storage of information derived from DNA analysis). Large scale acquisition and storage of DNA and DNA data has important implications for the privacy rights of individuals. A survey of 148 academically based and commercial DNA diagnostic laboratories was conducted to determine: (1) the extent of their DNA banking activities; (2) their policies and experiences regarding access to DNA samples and data; (3) the quality assurance measures they employ; and (4) whether they have written policies and/or depositor`s agreements addressing specific issues. These issues include: (1) who may have access to DNA samples and data; (2) whether scientists may have access to anonymous samples or data for research use; (3) whether they have plans to contact depositors or retest samples if improved tests for a disorder become available; (4) disposition of samples at the end of the contract period if the laboratory ceases operations, if storage fees are unpaid, or after a death or divorce; (5) the consequence of unauthorized release, loss, or accidental destruction of samples; and (6) whether depositors may share in profits from the commercialization of tests or treatments developed in part from studies of stored DNA. The results suggest that many laboratories are banking DNA, that many have already amassed a large number of samples, and that a significant number plan to further develop DNA banking as a laboratory service over the next two years. Few laboratories have developed written policies governing DNA banking, and fewer still have drafted documents that define the rights and obligations of the parties. There may be a need for increased regulation of DNA banking and DNA data banking and for better defined policies with respect to protecting individual privacy.

  13. Identification of Birds through DNA Barcodes

    PubMed Central

    2004-01-01

    Short DNA sequences from a standardized region of the genome provide a DNA barcode for identifying species. Compiling a public library of DNA barcodes linked to named specimens could provide a new master key for identifying species, one whose power will rise with increased taxon coverage and with faster, cheaper sequencing. Recent work suggests that sequence diversity in a 648-bp region of the mitochondrial gene, cytochrome c oxidase I (COI), might serve as a DNA barcode for the identification of animal species. This study tested the effectiveness of a COI barcode in discriminating bird species, one of the largest and best-studied vertebrate groups. We determined COI barcodes for 260 species of North American birds and found that distinguishing species was generally straightforward. All species had a different COI barcode(s), and the differences between closely related species were, on average, 18 times higher than the differences within species. Our results identified four probable new species of North American birds, suggesting that a global survey will lead to the recognition of many additional bird species. The finding of large COI sequence differences between, as compared to small differences within, species confirms the effectiveness of COI barcodes for the identification of bird species. This result plus those from other groups of animals imply that a standard screening threshold of sequence difference (10× average intraspecific difference) could speed the discovery of new animal species. The growing evidence for the effectiveness of DNA barcodes as a basis for species identification supports an international exercise that has recently begun to assemble a comprehensive library of COI sequences linked to named specimens. PMID:15455034

  14. Interaction of adriamycin with DNA as studied by resonance Raman spectroscopy.

    PubMed Central

    Manfait, M; Alix, A J; Jeannesson, P; Jardillier, J C; Theophanides, T

    1982-01-01

    Raman and resonance Raman spectra of the complex DNA-adriamycin in aqueous solution have been recorded and analysed. Calf thymus DNA was used and it is found that in the complex DNA-adriamycin the chromophore of adriamycin is intercalated in the GC sequences. The substituents on the rings give hydrogen bonding interactions with the base pairs above and below the intercalation site. It is suggested from the Raman and resonance Raman spectral modifications that the phenolic groups of the chromophore are involved in the drug-DNA intercalation, in addition to pi-pi, hydroxyl and amino group interactions. PMID:7111023

  15. Anti-idiotypic antibody against anti-DNA in sera of laboratory personnel exposed to lupus sera or nucleic acids.

    PubMed Central

    Hatfield, M; Evans, M; Suenaga, R; Hassanein, K M; Abdou, N I

    1987-01-01

    We tested for anti-DNA, anti-idiotypic, antinuclear, and lymphocytotoxic antibodies in the sera of three groups of normals: volunteers never exposed to lupus sera or nucleic acids (group I), research personnel handling nucleic acids (group II), and laboratory personnel handling lupus sera (group III). There was no significant differences among the groups with respect to levels of either single stranded or double stranded anti-DNA. Group I showed no significant differences in binding to F(ab')2 fragments of lupus anti-DNA, lupus non-anti-DNA or normal IgG. Compared to group I, groups II and III bound significantly higher to anti-DNA F(ab')2 fragments compared to non-anti-DNA F(ab')2 or normal F(ab')2 fragments. Sera from the three groups were negative for antibodies and all but one individual from group III had normal antinuclear antibody titres. These results indicate that sera of normals exposed to lupus sera or to nucleic acids contain an anti-idiotype directed against anti-DNA antibody. The possible role of these anti-idiotypes in regulating the anti-DNA antibody is discussed. PMID:3500815

  16. DNA homology studies on Clostridium botulinum and related clostridial species

    SciTech Connect

    Suen, J.C.

    1986-01-01

    The genetic relationships among toxigenic Clostridium botulinum and nontoxigenic C. subterminale and C. hastiforme were examined. DNA hybridization (hydroxyapatite method at 50/sup 0/C and 65/sup 0/C) was used to determine genetic relatedness among these organisms. DNA was labeled in vitro with /sup 32/P by the nick translation method. C. botulinum type G had less than 20% DNA relatedness with strains of C. botulinum types A, B and F. All nine strains of C. botulinum type G, two of 10 strains of C. subterminale, and one of three strains of C. hastiforme formed one DNA hybridization group, with DNA relatedness ranging from 76 to 100%. The remaining strains formed six smaller hybridization groups: two groups contained single strains of C. hastiforme, and the other four contained strains of C. subterminale. Thus, DNA hybridization data indicate that all strains of the toxigenic C. botulinum type G and the few strains of nontoxigenic C. subterminale and C. hastiforme form a single new species with toxigenicity as a variable characteristic.

  17. Detection of aerosolized varicella-zoster virus DNA in patients with localized herpes zoster.

    PubMed

    Suzuki, Kayoko; Yoshikawa, Tetsushi; Tomitaka, Akiko; Matsunaga, Kayoko; Asano, Yoshizo

    2004-03-15

    We examined the excretion of varicella zoster virus (VZV) in hospitalized patients with herpes zoster localized to the thoracic region whose skin lesions were covered with either hydrocolloid dressing agents (hydrocolloid group) or conventional gauze bandages (gauze group). The presence of VZV DNA in swab samples from lesion coverings, the throat, and filters of air purifiers was examined by use of a sensitive polymerase chain reaction assay. For the hydrocolloid group, VZV was detected in none of the samples from lesion coverings or air purifier filters; for the gauze group, VZV DNA was detected in samples from gauze coverings and air purifier filters for all 6 patients. VZV DNA was detected less frequently in throat samples from patients in the hydrocolloid group than in those from patients in the gauze group. The results of the present study suggest that hydrocolloid dressing agents prevent excretion of aerosolized VZV DNA from skin lesions of patients with localized herpes zoster. PMID:14999603

  18. Discrimination of RNA versus DNA by polynucleotide phosphorylase

    PubMed Central

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2013-01-01

    Polynucleotide phosphorylase (PNPase) plays synthetic and degradative roles in bacterial RNA metabolism; it is also suggested to participate in bacterial DNA transactions. Here we used chimeric polynucleotides, composed of alternating RNA and DNA tracts, to analyze whether and how Mycobacterium smegmatis PNPase discriminates RNA versus DNA during the 3' phosphorolysis reaction. We find that a kinetic block to 3' phosphorolysis of a DNA tract within an RNA polynucleotide is exerted when resection has progressed to the point that a 3' monoribonucleotide flanks the impeding DNA segment. The position of the pause one nucleotide upstream of the first deoxynucleotide encountered is independent of DNA tract length. However, the duration of the pause is affected by DNA tract length, being transient for a single deoxynucleotide and durable when two or more consecutive deoxynucleotides are encountered. Substituting manganese for magnesium as the metal cofactor enables PNPase to “nibble” into the DNA tract. A 3'-phosphate group prevents RNA phosphorolysis when the metal cofactor is magnesium. With manganese, PNPase can resect an RNA 3'-phosphate end, albeit 80-fold slower than a 3'-OH. We discuss the findings in light of the available structures of PNPase and of the archaeal exosome•RNA•phosphate complex and propose a model for catalysis whereby the metal cofactor interacts with the scissile phosphodiester and the penultimate ribose. PMID:23980617

  19. DNA Vaccination Techniques.

    PubMed

    Fissolo, Nicolás; Montalban, Xavier; Comabella, Manuel

    2016-01-01

    Multiple sclerosis (MS) is the most common inflammatory, demyelinating, and neurodegenerative disorder of the central nervous system (CNS) in humans. Although the etiology of MS remains unknown, several lines of evidence support the notion that autoimmunity against components of the myelin sheath plays a major role in susceptibility to and development of the disease. At present, there are no approved MS therapies aimed specifically toward downregulating antigen-specific autoreactive immune cells. One antigen-specific approach that appears promising for the treatment of MS is DNA vaccination. This technique has demonstrated efficacy in clinical trials while maintaining safety.Here, we describe the generation of DNA vaccines containing immunologically relevant antigens of MS. Moreover, we present a detailed protocol for the prophylactic and therapeutic administration of DNA vaccines via intramuscular injection targeting on the development of experimental autoimmune encephalomyelitis (EAE), an animal model resembling MS. PMID:24973869

  20. DNA based molecular motors

    NASA Astrophysics Data System (ADS)

    Michaelis, Jens; Muschielok, Adam; Andrecka, Joanna; Kügel, Wolfgang; Moffitt, Jeffrey R.

    2009-12-01

    Most of the essential cellular processes such as polymerisation reactions, gene expression and regulation are governed by mechanical processes. Controlled mechanical investigations of these processes are therefore required in order to take our understanding of molecular biology to the next level. Single-molecule manipulation and force spectroscopy have over the last 15 years been developed into extremely powerful techniques. Applying these techniques to the investigation of proteins and DNA molecules has led to a mechanistic understanding of protein function on the level of single molecules. As examples for DNA based molecular machines we will describe single-molecule experiments on RNA polymerases as well as on the packaging of DNA into a viral capsid-a process that is driven by one of the most powerful molecular motors.

  1. Duplication in DNA Sequences

    NASA Astrophysics Data System (ADS)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  2. Rotary DNA motors.

    PubMed Central

    Doering, C; Ermentrout, B; Oster, G

    1995-01-01

    Many molecular motors move unidirectionally along a DNA strand powered by nucleotide hydrolysis. These motors are multimeric ATPases with more than one hydrolysis site. We present here a model for how these motors generate the requisite force to process along their DNA track. This novel mechanism for force generation is based on a fluctuating electrostatic field driven by nucleotide hydrolysis. We apply the principle to explain the motion of certain DNA helicases and the portal protein, the motor that bacteriophages use to pump the genome into their capsids. The motor can reverse its direction without reversing the polarity of its electrostatic field, that is, without major structural modifications of the protein. We also show that the motor can be driven by an ion gradient; thus the mechanism may apply as well to the bacterial flagellar motor and to ATP synthase. Images FIGURE 1 FIGURE 2 FIGURE 4 FIGURE 5 FIGURE 7 PMID:8599633

  3. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  4. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, Stanley (Cambridge, MA); Richardson, Charles (Chestnut Hill, MA)

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  5. Group evaporation

    NASA Technical Reports Server (NTRS)

    Shen, Hayley H.

    1991-01-01

    Liquid fuel combustion process is greatly affected by the rate of droplet evaporation. The heat and mass exchanges between gas and liquid couple the dynamics of both phases in all aspects: mass, momentum, and energy. Correct prediction of the evaporation rate is therefore a key issue in engineering design of liquid combustion devices. Current analytical tools for characterizing the behavior of these devices are based on results from a single isolated droplet. Numerous experimental studies have challenged the applicability of these results in a dense spray. To account for the droplets' interaction in a dense spray, a number of theories have been developed in the past decade. Herein, two tasks are examined. One was to study how to implement the existing theoretical results, and the other was to explore the possibility of experimental verifications. The current theoretical results of group evaporation are given for a monodispersed cluster subject to adiabatic conditions. The time evolution of the fluid mechanic and thermodynamic behavior in this cluster is derived. The results given are not in the form of a subscale model for CFD codes.

  6. Group telepresence

    NASA Astrophysics Data System (ADS)

    Konesky, Gregory A.

    2004-03-01

    Telepresence and teleoperation permit the ability to sense and interact with a remote and potentially hazardous environment without the difficulty of getting there, being there, and then returning safely. Previous telepresence demonstrations have employed only a single remote device or vehicle which, if it experiences difficulty, may require human intervention for rescue, or be abandoned if the rescue is too hazardous. Multiple remote device or vehicle deployment opens the opportunity for interaction to improve the chances for mission success. With a sufficiently large number of remote devices or vehicles, whose interaction is conveyed over high speed internet links, a large body of simultaneous remote users can result. Imposing an access fee structure can result in an enterprise which is economically self-supporting when conducted on a sufficiently large scale. Various levels of interaction, ranging from active participant to active viewer to passive viewer, have corresponding levels of access fee. Experiences in achieving group telepresence among a small fleet teleoperated vehicles are discussed, as are simple solutions to complex issues of inter-vehicle awareness. A general economic model is presented for a large scale "telepresence safari" that is economically self-supporting. The potential for large scale Lunar telepresence is also discussed.

  7. Molecular targets, DNA breakage, DNA repair: Their roles in mutation induction in mammalian germ cells

    SciTech Connect

    Sega, G.A.

    1989-01-01

    Variability in genetic sensitivity among different germ-cell stages in the mammal to various mutagens could be the result of how much chemical reaches the different stages, what molecular targets may be affected in the different stages and whether or not repair of lesions occurs. Several chemicals have been found to bind very strongly to protamine in late-spermatid and early-spermatozoa stages in the mouse. The chemicals also produce their greatest genetic damage in these same germ-cell stages. While chemical binding to DNA has not been correlated with the level of induced genetic damage, DNA breakage in the sensitive stages has been shown to increase. This DNA breakage is believed to indirectly result from chemical binding to sulfhydryl groups in protamine which prevents normal chromatin condensation within the sperm nucleus. 22 refs., 5 figs.

  8. [Cu(phen)2](2+) acts as electrochemical indicator and anchor to immobilize probe DNA in electrochemical DNA biosensor.

    PubMed

    Yang, Linlin; Li, Xiaoyu; Li, Xi; Yan, Songling; Ren, Yinna; Wang, Mengmeng; Liu, Peng; Dong, Yulin; Zhang, Chaocan

    2016-01-01

    We demonstrate a novel protocol for sensitive in situ label-free electrochemical detection of DNA hybridization based on copper complex ([Cu(phen)2](2+), where phen = 1,10-phenanthroline) and graphene (GR) modified glassy carbon electrode. Here, [Cu(phen)2](2+) acted advantageously as both the electrochemical indicator and the anchor for probe DNA immobilization via intercalative interactions between the partial double helix structure of probe DNA and the vertical aromatic groups of phen. GR provided large density of docking site for probe DNA immobilization and increased the electrical conductivity ability of the electrode. The modification procedure was monitored by electrochemical impedance spectroscopy (EIS). Square-wave voltammetry (SWV) was used to explore the hybridization events. Under the optimal conditions, the designed electrochemical DNA biosensor could effectively distinguish different mismatch degrees of complementary DNA from one-base mismatch to noncomplementary, indicating that the biosensor had high selectivity. It also exhibited a reasonable linear relationship. The oxidation peak currents of [Cu(phen)2](2+) were linear with the logarithm of the concentrations of complementary target DNA ranging from 1 × 10(-12) to 1 × 10(-6) M with a detection limit of 1.99 × 10(-13) M (signal/noise = 3). Moreover, the stability of the electrochemical DNA biosensor was also studied. PMID:26403602

  9. Comparison on the interaction of Al3+/nano-Al13 with calf thymus DNA /salmon sperm DNA

    NASA Astrophysics Data System (ADS)

    Ma, Fei; Ma, Yue; Du, Changwen; Yang, Xiaodi; Shen, Renfang

    2015-11-01

    The conformation change, binding mode and binding site between Al3+/nano-Al13 and calf thymus DNA/salmon sperm DNA were investigated by UV-vis absorption, FTIR spectra, Raman spectroscopy and CD spectra, as well as melting curves measurement. The UV-vis spectra and circular dichroism spectra results suggested that the phosphate group structure was changed when Al3+ interacted with DNA, while the double-helix was distorted when nano-Al13 interacted with DNA. The FTIR and Raman spectroscopy revealed that the binding sites were Al3+ … PO2, Al3+ … N7/guanine PO2 … Al13 … N7-C8/guanine with calf thymus DNA, and Al3+ … N3-O2/cytosine, Al3+ … N7-C8/guanine, PO2 … Al13 … N7-C8/guanine, PO2 … Al13 … N1/adenine with salmon sperm DNA, respectively. The electrostatic binding was existed between Al3+ and DNA, and the electrostatic binding and complexing were found between nano-Al13 and DNA.

  10. Searching for DNA Lesions: Structural Evidence for Lower- and Higher-Affinity DNA Binding Conformations of Human Alkyladenine DNA Glycosylase

    E-print Network

    Drennan, Catherine L.

    To efficiently repair DNA, human alkyladenine DNA glycosylase (AAG) must search the million-fold excess of unmodified DNA bases to find a handful of DNA lesions. Such a search can be facilitated by the ability of glycosylases, ...

  11. Borrowing nuclear DNA helicases to protect mitochondrial DNA.

    PubMed

    Ding, Lin; Liu, Yilun

    2015-01-01

    In normal cells, mitochondria are the primary organelles that generate energy, which is critical for cellular metabolism. Mitochondrial dysfunction, caused by mitochondrial DNA (mtDNA) mutations or an abnormal mtDNA copy number, is linked to a range of human diseases, including Alzheimer's disease, premature aging? and cancer. mtDNA resides in the mitochondrial lumen, and its duplication requires the mtDNA replicative helicase, Twinkle. In addition to Twinkle, many DNA helicases, which are encoded by the nuclear genome and are crucial for nuclear genome integrity, are transported into the mitochondrion to also function in mtDNA replication and repair. To date, these helicases include RecQ-like helicase 4 (RECQ4), petite integration frequency 1 (PIF1), DNA replication helicase/nuclease 2 (DNA2) and suppressor of var1 3-like protein 1 (SUV3). Although the nuclear functions of some of these DNA helicases have been extensively studied, the regulation of their mitochondrial transport and the mechanisms by which they contribute to mtDNA synthesis and maintenance remain largely unknown. In this review, we attempt to summarize recent research progress on the role of mammalian DNA helicases in mitochondrial genome maintenance and the effects on mitochondria-associated diseases. PMID:25984607

  12. Borrowing Nuclear DNA Helicases to Protect Mitochondrial DNA

    PubMed Central

    Ding, Lin; Liu, Yilun

    2015-01-01

    In normal cells, mitochondria are the primary organelles that generate energy, which is critical for cellular metabolism. Mitochondrial dysfunction, caused by mitochondrial DNA (mtDNA) mutations or an abnormal mtDNA copy number, is linked to a range of human diseases, including Alzheimer’s disease, premature aging? and cancer. mtDNA resides in the mitochondrial lumen, and its duplication requires the mtDNA replicative helicase, Twinkle. In addition to Twinkle, many DNA helicases, which are encoded by the nuclear genome and are crucial for nuclear genome integrity, are transported into the mitochondrion to also function in mtDNA replication and repair. To date, these helicases include RecQ-like helicase 4 (RECQ4), petite integration frequency 1 (PIF1), DNA replication helicase/nuclease 2 (DNA2) and suppressor of var1 3-like protein 1 (SUV3). Although the nuclear functions of some of these DNA helicases have been extensively studied, the regulation of their mitochondrial transport and the mechanisms by which they contribute to mtDNA synthesis and maintenance remain largely unknown. In this review, we attempt to summarize recent research progress on the role of mammalian DNA helicases in mitochondrial genome maintenance and the effects on mitochondria-associated diseases. PMID:25984607

  13. Probe immobilization strategies and device optimization for novel transistor-based DNA sensors

    NASA Astrophysics Data System (ADS)

    Fahrenkopf, Nicholas M.

    The research presented herein exploits the terminal phosphate group on single stranded DNA molecules for direct immobilization to surfaces utilized in semiconductor device fabrication with the end goal of transistor based DNA sensors. As a demonstration of the feasibility of this immobilization strategy DNA immobilization to a variety of surfaces was evaluated for usefulness in biosensor applications. It was determined that DNA can be directly immobilized to a variety of semiconductor surfaces through the terminal phosphate group. Further, this immobilization allows for the hybridization of the immobilized DNA to complementary target in solution. The immobilization of DNA to hafnium dioxide was particularly of interest due to its use in modern nanoelectronics manufacturing. The interactions between DNA and various forms of hafnium dioxide were thoroughly studied in order to understand and optimize the immobilization of DNA to hafnium dioxide for field effect transistor (FET) based DNA sensors. A secondary immobilization route of DNA to a subset of hafnium dioxide surfaces was identified and we have shown that this mechanism is through the nitrogenous bases of the probe molecule. Finally, a novel FET sensor was designed and developed which incorporated III-V materials and hafnium dioxide. The development of the sensor was carried out with the long term goal of determining if FET DNA sensors would have increased sensitivity if fabricated with: 1) the direct immobilization of probe DNA; 2) hafnium dioxide gate dielectric; and/or 3) III-V FET structure. Here, we demonstrate a proof-of-concept device that incorporates these three features and is capable of detecting DNA in solution, DNA immobilized to the surface, and DNA hybridization events.

  14. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  15. The Dynamics of DNA Sequencing.

    ERIC Educational Resources Information Center

    Morvillo, Nancy

    1997-01-01

    Describes a paper-and-pencil activity that helps students understand DNA sequencing and expands student understanding of DNA structure, replication, and gel electrophoresis. Appropriate for advanced biology students who are familiar with the Sanger method. (DDR)

  16. Nanotechnology: Pathfinder for DNA constructs

    NASA Astrophysics Data System (ADS)

    Liedl, Tim

    2015-07-01

    Representations of 3D surfaces used in computer graphics have been adopted as templates in an efficient method for making nanoscale objects from DNA, lowering the barriers to applications of DNA nanotechnology. See Letter p.441

  17. Structural diversity of supercoiled DNA

    NASA Astrophysics Data System (ADS)

    Irobalieva, Rossitza N.; Fogg, Jonathan M.; Catanese, Daniel J.; Sutthibutpong, Thana; Chen, Muyuan; Barker, Anna K.; Ludtke, Steven J.; Harris, Sarah A.; Schmid, Michael F.; Chiu, Wah; Zechiedrich, Lynn

    2015-10-01

    By regulating access to the genetic code, DNA supercoiling strongly affects DNA metabolism. Despite its importance, however, much about supercoiled DNA (positively supercoiled DNA, in particular) remains unknown. Here we use electron cryo-tomography together with biochemical analyses to investigate structures of individual purified DNA minicircle topoisomers with defined degrees of supercoiling. Our results reveal that each topoisomer, negative or positive, adopts a unique and surprisingly wide distribution of three-dimensional conformations. Moreover, we uncover striking differences in how the topoisomers handle torsional stress. As negative supercoiling increases, bases are increasingly exposed. Beyond a sharp supercoiling threshold, we also detect exposed bases in positively supercoiled DNA. Molecular dynamics simulations independently confirm the conformational heterogeneity and provide atomistic insight into the flexibility of supercoiled DNA. Our integrated approach reveals the three-dimensional structures of DNA that are essential for its function.

  18. Structural diversity of supercoiled DNA

    PubMed Central

    Irobalieva, Rossitza N.; Fogg, Jonathan M.; Catanese, Daniel J.; Sutthibutpong, Thana; Chen, Muyuan; Barker, Anna K.; Ludtke, Steven J.; Harris, Sarah A.; Schmid, Michael F.; Chiu, Wah; Zechiedrich, Lynn

    2015-01-01

    By regulating access to the genetic code, DNA supercoiling strongly affects DNA metabolism. Despite its importance, however, much about supercoiled DNA (positively supercoiled DNA, in particular) remains unknown. Here we use electron cryo-tomography together with biochemical analyses to investigate structures of individual purified DNA minicircle topoisomers with defined degrees of supercoiling. Our results reveal that each topoisomer, negative or positive, adopts a unique and surprisingly wide distribution of three-dimensional conformations. Moreover, we uncover striking differences in how the topoisomers handle torsional stress. As negative supercoiling increases, bases are increasingly exposed. Beyond a sharp supercoiling threshold, we also detect exposed bases in positively supercoiled DNA. Molecular dynamics simulations independently confirm the conformational heterogeneity and provide atomistic insight into the flexibility of supercoiled DNA. Our integrated approach reveals the three-dimensional structures of DNA that are essential for its function. PMID:26455586

  19. MAMMALIAN DNA IN PCR REAGENTS

    EPA Science Inventory

    Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

  20. Molecular Programming with DNA

    NASA Astrophysics Data System (ADS)

    Winfree, Erik

    2009-05-01

    Information can be stored in molecules and processed by molecular reactions. Molecular information processing is at the heart of all biological systems; might it soon also be at the heart of non-biological synthetic chemical systems? Perhaps yes. One technological approach comes from DNA nanotechnology and DNA computing, where DNA is used as a non-biological informational polymer that can be rationally designed to create a rich class of molecular systems -- for example, DNA molecules that self-assemble precisely, that fold into complex nanoscale objects, that act as mechanical actuators and molecular motors, and that make decisions based on digital and analog logic. I will argue that to fully exploit their design potential, we will need to invent programming languages for specifying the behavior of information-based molecular systems, to create theoretical tools for understanding and analyzing the behavior of molecular programs, to develop compilers that automate the design of molecules with the desired behaviors, and to expand experimental techniques so that the implementation and debugging of complex molecular systems becomes as commonplace and practical as computer programming.

  1. Automated DNA Sequencing System

    SciTech Connect

    Armstrong, G.A.; Ekkebus, C.P.; Hauser, L.J.; Kress, R.L.; Mural, R.J.

    1999-04-25

    Oak Ridge National Laboratory (ORNL) is developing a core DNA sequencing facility to support biological research endeavors at ORNL and to conduct basic sequencing automation research. This facility is novel because its development is based on existing standard biology laboratory equipment; thus, the development process is of interest to the many small laboratories trying to use automation to control costs and increase throughput. Before automation, biology Laboratory personnel purified DNA, completed cycle sequencing, and prepared 96-well sample plates with commercially available hardware designed specifically for each step in the process. Following purification and thermal cycling, an automated sequencing machine was used for the sequencing. A technician handled all movement of the 96-well sample plates between machines. To automate the process, ORNL is adding a CRS Robotics A- 465 arm, ABI 377 sequencing machine, automated centrifuge, automated refrigerator, and possibly an automated SpeedVac. The entire system will be integrated with one central controller that will direct each machine and the robot. The goal of this system is to completely automate the sequencing procedure from bacterial cell samples through ready-to-be-sequenced DNA and ultimately to completed sequence. The system will be flexible and will accommodate different chemistries than existing automated sequencing lines. The system will be expanded in the future to include colony picking and/or actual sequencing. This discrete event, DNA sequencing system will demonstrate that smaller sequencing labs can achieve cost-effective the laboratory grow.

  2. Automating DNA processing 

    E-print Network

    Wienen, Michael Jan

    1994-01-01

    is to be accomplished. This thesis identifies and explains modules in DNA processing and how they can be improved by automation. modules associated with genome mapping are the focus of most of the discussion. A functional biochemistry background is provided so...

  3. Nutrients and DNA Methylation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Epigenetics is a new mechanism responsible for development, aging, and disease process such as cancer development. One major epigenetic phenomenon is DNA methylation, which attributes to gene expression and integrity. Deepening the knowledge on one-carbon metabolism is very important to understandin...

  4. TRANSFECTION WITH BACULOVIRUS DNA

    EPA Science Inventory

    Purified DNA from the nuclear polyhedrosis viruses of Autographa californica (AcM NPV) and Rachiplusia ou (RoM NPV) were found to be infectious in TN-368 cells employing the calcium phosphate precipitation technique (F.L. Graham and A.J. van der Eb, Virology, 52, 456-467, 1973). ...

  5. Enzymatic DNA molecules

    NASA Technical Reports Server (NTRS)

    Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

    1998-01-01

    The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.

  6. Protein methylation and DNA repair.

    PubMed

    Lake, Aimee N; Bedford, Mark T

    2007-05-01

    DNA is under constant attack from intracellular and external mutagens. Sites of DNA damage need to be pinpointed so that the DNA repair machinery can be mobilized to the proper location. The identification of damaged sites, recruitment of repair factors, and assembly of repair "factories" is orchestrated by posttranslational modifications (PTMs). These PTMs include phosphorylation, ubiquitination, sumoylation, acetylation, and methylation. Here we discuss recent data surrounding the roles of arginine and lysine methylation in DNA repair processes. PMID:17306845

  7. Effect of prenatal X irradiation on chemical components of DNA and DNA-protein crosslinks in rat cerebrum in the perinatal periods

    SciTech Connect

    Iwasaki, S.; Tanaka, H.; Arima, M.

    1987-04-01

    Wistar rats were X-irradiated in utero with 100 or 200 R on Day 13 of gestation. X Irradiation resulted in decreases not only in cerebral weight up to 15 days old but also in DNA content from Day 19 of gestation to 5 days old, and in a tendency to increase the ratio of protein to DNA in the perinatal period. The DNA contents of the homogenate, isolated nuclei, and chromatin of the cerebrum in the irradiated group were significantly lower than those in the control group. The ratio of protein to DNA at the nuclei, chromatin, and isolated DNA steps increased on irradiation. The total nucleoside content of isolated DNA determined by high-performance liquid chromatography was higher in the irradiated group than that in the control group on Day 21 of gestation but not on Day 19 of gestation. No new peaks were observed and no change in the guanine-cytosine content was seen on irradiation. X Irradiation resulted in decreases in the cytosine and deoxycytidine contents and an increase in the deoxyadenosine content. The formation of DNA-protein crosslinks in the cerebral chromatin as determined by a filter binding assay tended to increase in the irradiated groups.

  8. Mechanistic studies of bleomycin-mediated double-stranded DNA cleavage and structural studies of DNA containing normal and 4'-oxidized abasic sites

    E-print Network

    Chen, Jingyang, Ph. D. Massachusetts Institute of Technology

    2006-01-01

    In order to examine the role of partial intercalation in double-stranded (ds) DNA cleavage mediated by a single bleomycin (BLM), a bulky group ([-cyclodextrin) was chemically attached to the polyamine tail of BLM A5 to ...

  9. The Future of Forensic DNA

    E-print Network

    besides STRs for identity testing? ­ Phenotyping capabilities? ­ Next-generation DNA sequencing? #12;NIST ­ Expanded use of databases (e.g., familial searching) ­ Rapid DNA testing · More distant future ­ LociThe Future of Forensic DNA John M. Butler, PhD National Institute of Standards and Technology

  10. The Future of Forensic DNA

    E-print Network

    ­ Workshops on mixture interpretation and CE troubleshooting ­ Third edition of Forensic DNA Typing textbook (2009, 2011, & 2013) #12;INTERPRETATION John M. Butler Forensic DNA Typing Textbook 3rd Edition is ThreeThe Future of Forensic DNA John M. Butler, PhD National Institute of Standards and Technology

  11. Calf thymus DNA-binding ability study of anthocyanins from purple sweet potatoes ( Ipomoea batatas L.).

    PubMed

    Wang, Dan; Wang, Xirui; Zhang, Chao; Ma, Yue; Zhao, Xiaoyan

    2011-07-13

    A total of 10 anthocyanin compounds were identified from five purple sweet potato ( Ipomoea batatas L.) varieties, Qunzi, Zishu038, Ji18, Jingshu6, and Ziluolan, by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) to assess their calf thymus DNA-binding ability in vitro. The interaction between anthocyanins and calf thymus DNA in Tris-HCl buffer solution (pH 6.9) was evaluated by fluorescence spectroscopy. Using ethidium bromide (EB) as a fluorescence probe, fluorescence quenching of the emission peak was seen in the DNA-EB system when anthocyanins were added, indicating that the anthocyanins bound with DNA. The acylated groups influenced the ability of the interaction with DNA. Anthocyanins from purple sweet potato with more acylated groups in sorphorose have a stronger binding ability with DNA. PMID:21678894

  12. Melatonin prevents damage elicited by the organophosphorous pesticide diazinon on mouse sperm DNA.

    PubMed

    Sarabia, L; Maurer, I; Bustos-Obregón, E

    2009-02-01

    Toxic effects of pesticides are commonly associated with DNA damage. To evaluate the effect of the organophosphate diazinon on sperm DNA and to test whether melatonin could prevent this damage, male mice were intraperitoneally treated with melatonin, diazinon (1/3 or 2/3 LD50) or both; cauda epididymal spermatozoa were obtained on days 1 and 32 postinjection and tested for DNA alterations. On day 1, sperm from diazinon-treated mice showed augmented DNA breakages and reduced chromatin packaging, whilst DNA damage increased only in the diazinon 2/3 LD50 group. Micronucleus test of bone marrow cells demonstrated somatic cell chromosomal damage in both diazinon-treated groups. Pretreatment with melatonin before diazinon acute administration improved all parameters studied on day 1 pi. The organophosphorous pesticide diazinon is a dose-dependent testicular toxicant that alters the sperm DNA structure; melatonin is able to prevent this damage. PMID:18571725

  13. Identification, mapping and linkage analysis of randomly amplified DNA polymorphisms in Tetrahymena thermophila

    SciTech Connect

    Brickner, J.H.; Lynch, T.J.; Zeilinger, D.; Orias, E.

    1996-06-01

    Using the random amplified polymorphic DNA (RAPD) technique and exploiting the unique genetics of Tetrahymena thermophila, we have identified and characterized 40 DNA polymorphisms occurring between two inbred strains (B and C3) of this ciliated protozoan. These RAPD markers permit the PCR amplification of a DNA species using template DNA from SB1969 (B strain) but fail to do so using DNA from C3-368-5 (C3 strain). Polymorphisms were mapped to chromosomes using a panel of monosomic strains constructed by crossing B strain-derived nullisomic strains to inbred strain C3. They map to all five chromosomes and appear to be evenly distributed throughout the genome. Chromosomal groups were then analyzed for linkage using meiotic segregants; four linkage groups were identified in chromosomes 1R, 2L, 3 and 5. The RAPD method appears useful for the construction of a genetic map of the Tetrahymena genome based on DNA polymorphisms. 37 refs., 4 figs., 6 tabs.

  14. Arsenic Biotransformation as a Cancer Promoting Factor by Inducing DNA Damage and Disruption of Repair Mechanisms

    PubMed Central

    Martinez, Victor D.; Vucic, Emily A.; Adonis, Marta; Gil, Lionel; Lam, Wan L.

    2011-01-01

    Chronic exposure to arsenic in drinking water poses a major global health concern. Populations exposed to high concentrations of arsenic-contaminated drinking water suffer serious health consequences, including alarming cancer incidence and death rates. Arsenic is biotransformed through sequential addition of methyl groups, acquired from s-adenosylmethionine (SAM). Metabolism of arsenic generates a variety of genotoxic and cytotoxic species, damaging DNA directly and indirectly, through the generation of reactive oxidative species and induction of DNA adducts, strand breaks and cross links, and inhibition of the DNA repair process itself. Since SAM is the methyl group donor used by DNA methyltransferases to maintain normal epigenetic patterns in all human cells, arsenic is also postulated to affect maintenance of normal DNA methylation patterns, chromatin structure, and genomic stability. The biological processes underlying the cancer promoting factors of arsenic metabolism, related to DNA damage and repair, will be discussed here. PMID:22091411

  15. Diversity of DNA methyltransferases that recognize asymmetric target sequences.

    PubMed

    Madhusoodanan, Urulangodi Kunhiraman; Rao, Desirazu N

    2010-04-01

    DNA methyltransferases (MTases) are a group of enzymes that catalyze the methyl group transfer from S-adenosyl-L-methionine in a sequence-specific manner. Orthodox Type II DNA MTases usually recognize palindromic DNA sequences and add a methyl group to the target base (either adenine or cytosine) on both strands. However, there are a number of MTases that recognize asymmetric target sequences and differ in their subunit organization. In a bacterial cell, after each round of replication, the substrate for any MTase is hemimethylated DNA, and it therefore needs only a single methylation event to restore the fully methylated state. This is in consistent with the fact that most of the DNA MTases studied exist as monomers in solution. Multiple lines of evidence suggest that some DNA MTases function as dimers. Further, functional analysis of many restriction-modification systems showed the presence of more than one or fused MTase genes. It was proposed that presence of two MTases responsible for the recognition and methylation of asymmetric sequences would protect the nascent strands generated during DNA replication from cognate restriction endonuclease. In this review, MTases recognizing asymmetric sequences have been grouped into different subgroups based on their unique properties. Detailed characterization of these unusual MTases would help in better understanding of their specific biological roles and mechanisms of action. The rapid progress made by the genome sequencing of bacteria and archaea may accelerate the identification and study of species- and strain-specific MTases of host-adapted bacteria and their roles in pathogenic mechanisms. PMID:20184512

  16. mtDNA Mutations and Their Role in Aging, Diseases and Forensic Sciences

    PubMed Central

    Zapico, Sara C.; Ubelaker, Douglas H.

    2013-01-01

    Mitochondria are independent organelles with their own DNA. As a primary function, mitochondria produce the energy for the cell through Oxidative Phosphorylation (OXPHOS) in the Electron Transport Chain (ETC). One of the toxic products of this process is Reactive Oxygen Species (ROS), which can induce oxidative damage in macromolecules like lipids, proteins and DNA. Mitochondrial DNA (mtDNA) is less protected and has fewer reparation mechanisms than nuclear DNA (nDNA), and as such is more exposed to oxidative, mutation-inducing damage. This review analyzes the causes and consequences of mtDNA mutations and their relationship with the aging process. Neurodegenerative diseases, related with the aging, are consequences of mtDNA mutations resulting in a decrease in mitochondrial function. Also described are “mitochondrial diseases”, pathologies produced by mtDNA mutations and whose symptoms are related with mitochondrial dysfunction. Finally, mtDNA haplogroups are defined in this review; these groups are important for determination of geographical origin of an individual. Additionally, different haplogroups exhibit variably longevity and risk of certain diseases. mtDNA mutations in aging and haplogroups are of special interest to forensic science research. Therefore this review will help to clarify the key role of mtDNA mutations in these processes and support further research in this area. PMID:24307969

  17. The Autonomous Glycosylation of Large DNA Viruses.

    PubMed

    Piacente, Francesco; Gaglianone, Matteo; Laugieri, Maria Elena; Tonetti, Michela G

    2015-01-01

    Glycosylation of surface molecules is a key feature of several eukaryotic viruses, which use the host endoplasmic reticulum/Golgi apparatus to add carbohydrates to their nascent glycoproteins. In recent years, a newly discovered group of eukaryotic viruses, belonging to the Nucleo-Cytoplasmic Large DNA Virus (NCLDV) group, was shown to have several features that are typical of cellular organisms, including the presence of components of the glycosylation machinery. Starting from initial observations with the chlorovirus PBCV-1, enzymes for glycan biosynthesis have been later identified in other viruses; in particular in members of the Mimiviridae family. They include both the glycosyltransferases and other carbohydrate-modifying enzymes and the pathways for the biosynthesis of the rare monosaccharides that are found in the viral glycan structures. These findings, together with genome analysis of the newly-identified giant DNA viruses, indicate that the presence of glycogenes is widespread in several NCLDV families. The identification of autonomous viral glycosylation machinery leads to many questions about the origin of these pathways, the mechanisms of glycan production, and eventually their function in the viral replication cycle. The scope of this review is to highlight some of the recent results that have been obtained on the glycosylation systems of the large DNA viruses, with a special focus on the enzymes involved in nucleotide-sugar production. PMID:26690138

  18. The Autonomous Glycosylation of Large DNA Viruses

    PubMed Central

    Piacente, Francesco; Gaglianone, Matteo; Laugieri, Maria Elena; Tonetti, Michela G.

    2015-01-01

    Glycosylation of surface molecules is a key feature of several eukaryotic viruses, which use the host endoplasmic reticulum/Golgi apparatus to add carbohydrates to their nascent glycoproteins. In recent years, a newly discovered group of eukaryotic viruses, belonging to the Nucleo-Cytoplasmic Large DNA Virus (NCLDV) group, was shown to have several features that are typical of cellular organisms, including the presence of components of the glycosylation machinery. Starting from initial observations with the chlorovirus PBCV-1, enzymes for glycan biosynthesis have been later identified in other viruses; in particular in members of the Mimiviridae family. They include both the glycosyltransferases and other carbohydrate-modifying enzymes and the pathways for the biosynthesis of the rare monosaccharides that are found in the viral glycan structures. These findings, together with genome analysis of the newly-identified giant DNA viruses, indicate that the presence of glycogenes is widespread in several NCLDV families. The identification of autonomous viral glycosylation machinery leads to many questions about the origin of these pathways, the mechanisms of glycan production, and eventually their function in the viral replication cycle. The scope of this review is to highlight some of the recent results that have been obtained on the glycosylation systems of the large DNA viruses, with a special focus on the enzymes involved in nucleotide-sugar production. PMID:26690138

  19. Sequence Recognition of DNA by Protein-Induced Conformational Transitions

    SciTech Connect

    Watkins, Derrick; Mohan, Srividya; Koudelka, Gerald B.; Williams, Loren Dean

    2010-11-09

    The binding of proteins to specific sequences of DNA is an important feature of virtually all DNA transactions. Proteins recognize specific DNA sequences using both direct readout (sensing types and positions of DNA functional groups) and indirect readout (sensing DNA conformation and deformability). Previously we showed that the P22 c2 repressor N-terminal domain (P22R NTD) forces the central non-contacted 5{prime}-ATAT-3{prime} sequence of the DNA operator into the B{prime} state, a state known to affect DNA hydration, rigidity and bending. Usually the B{prime} state, with a narrow minor groove and a spine of hydration, is reserved for A-tract DNA (TpA steps disrupt A-tracts). Here, we have co-crystallized P22R NTD with an operator containing a central 5{prime}-ACGT-3{prime} sequence in the non-contacted region. C {center_dot} G base pairs have not previously been observed in the B{prime} state and are thought to prevent it. However, P22R NTD induces a narrow minor groove and a spine of hydration to 5{prime}-ACGT-3{prime}. We observe that C {center_dot} G base pairs have distinctive destabilizing and disordering effects on the spine of hydration. It appears that the reduced stability of the spine results in a higher energy cost for the B to B{prime} transition. The differential effect of DNA sequence on the barrier to this transition allows the protein to sense the non-contacted DNA sequence.

  20. A survey of DNA diagnostic laboratories regarding DNA banking

    SciTech Connect

    McEwen, J.E.; Reilly, P.R.

    1995-06-01

    This article reports the findings of a survey of 148 academically based and commercial DNA diagnostic labs regarding DNA banking (defined as the storage of individual DNA samples in some form with identifiers for later retrieval). The population surveyed consisted of all laboratories listed with HELIX, a national directory of DNA diagnostic labs that includes a fairly comprehensive listing of clinical service labs as well as a large number of research labs. The survey was concerned primarily with the legal and ethical issues that the long-term storage of DNA may raise. The survey inquired into the respondent`s policies and procedures concerning (1) the extent of DNA banking and of interest in developing DNA banking in academia and industry and (2) the degree to which DNA banks had developed written internal policies and/or a written depositor`s agreement (a signed document defining the rights and obligations of the person from whom the sample was taken and the bank) designed to anticipate or prevent some of the ethical and legal problems that can arise from the long-term retention of DNA. Our research suggests that (1) the activity of DNA banking is growing, particularly in the academic setting, and (2) most academically based DNA banks lack written internal policies, written depositor`s agreements, or other relevant documentation regarding important aspects of this activity. 10 refs., 10 tabs.

  1. Mechanical Properties of Base-Modified DNA Are Not Strictly Determined by Base Stacking or Electrostatic Interactions

    PubMed Central

    Peters, Justin P.; Mogil, Lauren S.; McCauley, Micah J.; Williams, Mark C.; Maher, L. James

    2014-01-01

    This work probes the mystery of what balance of forces creates the extraordinary mechanical stiffness of DNA to bending and twisting. Here we explore the relationship between base stacking, functional group occupancy of the DNA minor and major grooves, and DNA mechanical properties. We study double-helical DNA molecules substituting either inosine for guanosine or 2,6-diaminopurine for adenine. These DNA variants, respectively, remove or add an amino group from the DNA minor groove, with corresponding changes in hydrogen-bonding and base stacking energy. Using the techniques of ligase-catalyzed cyclization kinetics, atomic force microscopy, and force spectroscopy with optical tweezers, we show that these DNA variants have bending persistence lengths within the range of values reported for sequence-dependent variation of the natural DNA bases. Comparison with seven additional DNA variants that modify the DNA major groove reveals that DNA bending stiffness is not correlated with base stacking energy or groove occupancy. Data from circular dichroism spectroscopy indicate that base analog substitution can alter DNA helical geometry, suggesting a complex relationship among base stacking, groove occupancy, helical structure, and DNA bend stiffness. PMID:25028886

  2. Efficacy of a DNA vaccine delivered in attenuated Salmonella typhimurium against Eimeria tenella infection in chickens.

    PubMed

    Du, Aifang; Wang, Suhua

    2005-06-01

    The efficacy of an oral DNA vaccine carrying the Eimeria tenella 5401 antigen gene delivered by attenuated Salmonella typhimurium was examined in an experimental challenge study. The DNA vaccine preparation was made by transforming the recombinant plasmid pcDNA3-5401 into the attenuated S. typhimurium strain (Dam(-) and PhoP(-)) (designated hereafter as ZJ111/pcDNA3-5401). The chickens were randomly divided into six groups, 50 per group. Group A were given PBS as control. Chickens in group B were fed with 10(8) colony forming units (CFU) of attenuated S. typhimurium carrying pcDNA3. Group C were immunised with 100 microg of the recombinant 5401 protein via intramuscular injection. Groups D to F orally received ZJ111/pcDNA3-5401 at doses of 10(7), 10(8) and 10(9)CFU per chicken, respectively. All immunisations were boosted 2 weeks later. The immunised chickens were challenged with 6x10(4) homologous sporulated oocysts 14 days after the second immunisation. No significant differences in body weight were detected between the groups before immunisation and at week 4 after the booster immunisation. The ZJ111/pcDNA3-5401 was eventually eliminated from the spleen and liver on week 6 post-immunisation. The plasmid pcDNA3-5401 was stably maintained in over 80% of the attenuated S. typhimurium population after 100 generations of growth in antibiotic-free media. Oral immunisation of chickens with ZJ111/pcDNA3-5401 elicited specific humoral responses and stimulated proliferation of peripheral blood lymphocytes. The lymphocyte proliferation response was significantly higher in all vaccinated groups than in the control chickens. Antibody response was significantly lower in group C than in groups immunised with strain ZJ111/pcDNA3-5401. Vaccination with the strain ZJ111/pcDNA3-5401 at 10(8) (group E) and 10(9) (group F) CFU per chicken provided 55.0 and 57.5% protection against E. tenella challenge, respectively. These results have important implications for the development of DNA vaccines against avian coccidiosis by bacteria-vectored oral delivery system. PMID:15890351

  3. Regulating the Transport of DNA through Biofriendly Nanochannels in a Thin Solid Membrane

    PubMed Central

    Wang, Deqiang; Harrer, Stefan; Luan, Binquan; Stolovitzky, Gustavo; Peng, Hongbo; Afzali-Ardakani, Ali

    2014-01-01

    Channels formed by membrane proteins regulate the transport of water, ions or nutrients that are essential to cells' metabolism. Recent advances in nanotechnology allow us to fabricate solid-state nanopores for transporting and analyzing biomolecules. However, uncontrollable surface properties of a fabricated nanopore cause irregular transport of biomolecules, limiting potential biomimetic applications. Here we show that a nanopore functionalized with a self-assembled monolayer (SAM) can potentially regulate the transport of a DNA molecule by changing functional groups of the SAM. We found that an enhanced interaction between DNA and a SAM-coated nanopore can slow down the translocation speed of DNA molecules and increase the DNA capture-rate. Our results demonstrate that the transport of DNA molecules inside nanopores could be modulated by coating a SAM on the pore surface. Our method to control the DNA motion inside a nanopore may find its applications in nanopore-based DNA sequencing devices. PMID:24496378

  4. Regulating the Transport of DNA through Biofriendly Nanochannels in a Thin Solid Membrane

    NASA Astrophysics Data System (ADS)

    Wang, Deqiang; Harrer, Stefan; Luan, Binquan; Stolovitzky, Gustavo; Peng, Hongbo; Afzali-Ardakani, Ali

    2014-02-01

    Channels formed by membrane proteins regulate the transport of water, ions or nutrients that are essential to cells' metabolism. Recent advances in nanotechnology allow us to fabricate solid-state nanopores for transporting and analyzing biomolecules. However, uncontrollable surface properties of a fabricated nanopore cause irregular transport of biomolecules, limiting potential biomimetic applications. Here we show that a nanopore functionalized with a self-assembled monolayer (SAM) can potentially regulate the transport of a DNA molecule by changing functional groups of the SAM. We found that an enhanced interaction between DNA and a SAM-coated nanopore can slow down the translocation speed of DNA molecules and increase the DNA capture-rate. Our results demonstrate that the transport of DNA molecules inside nanopores could be modulated by coating a SAM on the pore surface. Our method to control the DNA motion inside a nanopore may find its applications in nanopore-based DNA sequencing devices.

  5. Measuring the elasticity of ribonucleotide(s)-containing DNA molecules using AFM.

    PubMed

    Koh, Kyung Duk; Chiu, Hsiang-Chih; Riedo, Elisa; Storici, Francesca

    2015-01-01

    Ribonucleotides, ribonucleoside monophosphates (rNMPs), have been revealed as possibly the most noncanonical nucleotides in genomic DNA. rNMPs, either not removed from Okazaki fragments during DNA replication or incorporated and scattered throughout the genome, pose a perturbation to the structure and a threat to the stability of DNA. The instability of DNA is mainly due to the extra 2'-hydroxyl (OH) group of rNMPs which give rise to local structural effects, which may disturb various molecular interactions in cells. As a result of these structural perturbations by rNMPs, the elastic properties of DNA are also affected. Here, we show the approach to test whether the presence of rNMPs in DNA duplexes could alter the elasticity of DNA by implementing atomic force microscopy (AFM)-based single molecule force-measurements of short rNMP(s)-containing oligonucleotides (oligos). PMID:25895994

  6. SSB pushed off free DNA end

    E-print Network

    Lohman, Timothy M.

    dynamic structure with its DNA strand -- one in which SSB slides spontaneously and rapidly along ssDNA the prototypical E. coli protein, which wraps ssDNA around its tetrameric (four-subunit) protein core (Fig. 1SSB SSB pushed off free DNA end DNA SSB removed directly MOLECULAR BIOLOGY SlipslidingonDNA

  7. Braid groups of imprimitive reflection groups

    E-print Network

    Digne, François

    6/5/2012 1 Braid groups of imprimitive reflection groups Ruth Corran Cap Hornu May 30, 2012 Finite complex reflection groups V a vector space over C with dim(V) = r. A complex reflection s is a non) is the reflection hyperplane for the reflection s A (finite) complex reflection group W is a (finite) group

  8. Blast induced neurotrauma causes overpressure dependent changes to the DNA methylation equilibrium.

    PubMed

    Bailey, Zachary S; Grinter, Michael B; De La Torre Campos, Diego; VandeVord, Pamela J

    2015-09-14

    Traumatic brain injury (TBI) has a high prevalence in our society and often leads to morbidity and mortality. TBI also occurs frequently in a military setting where exposure to blast waves is common. Abnormal gene expression involved with oxidative stress, inflammation and neuronal apoptosis has been well documented following blast induced neurotrauma (BINT). Altered epigenetic transcriptional regulation through DNA methylation has been implicated in the pathology of the injury. Imbalance between DNA methylation and DNA demethylation may lead to altered methylation patterns and subsequent changes in gene transcription. DNA methyltransferase enzymes (DNMT1, DNMT3a, and DNMT3b) are responsible for the addition of methyl groups to DNA, DNA methylation. Whereas the combined function of ten-eleven translocation enzymes (TET1, TET2, and TET3) and thymine-DNA glycosylase (TDG) result in the removal of methyl groups from DNA, DNA demethylation. We used an established rodent model of BINT to assess changes in DNA methylation and demethylation enzymes following injury. Three different blast overpressures were investigated (10, 17 and 23psi). Gene expression was investigated in the prefrontal cortex and hippocampus two weeks following injury. We observed DNMT, TET and TDG expression changes between pressure groups and brain regions. The hippocampus was more vulnerable to enzyme expression changes than the prefrontal cortex, which correlated with aberrant DNA methylation. A significant negative correlation was found between global DNA methylation and the magnitude of blast overpressure exposure. Through transcriptional regulation, altered DNA methylation patterns may offer insight into the characteristic outcomes associated with the injury pathology including inflammation, oxidative stress and apoptosis. As such, these enzymes may be important targets to future therapeutic intervention strategies. PMID:26232681

  9. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting.

    PubMed

    Vlijm, Rifka; V D Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  10. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  11. Information storage in DNA sequences

    SciTech Connect

    Burks, C.

    1983-01-01

    We seek to describe a starting point for modeling the evolution of DNA sequences within the framework of cellular automata by discussing the current understanding of genetic information storage in DNA sequences. This includes alternately viewing the role of DNA in living organisms as a simple scheme and as a complex scheme; a presentation of the extent of experimentally determined DNA sequence data present in the Los Alamos Nucleic Acid Database; and finally, a brief review of strategies for identifying and classifying patterns in DNA sequences.

  12. Solid colloids with surface-mobile DNA linkers.

    PubMed

    van der Meulen, Stef A J; Leunissen, Mirjam E

    2013-10-01

    Surface functionalization with bioinspired binding groups is increasingly used to steer nano- and microscale self-assembly processes, with complementary DNA "sticky ends" as one of the most notable examples. The fabrication of well-organized structures is complicated, however, by the sharp association/dissociation transitions and the slow rearrangement kinetics intrinsic to collections of discrete, surface-immobilized binding groups and is aggravated by natural nonuniformities in the surface coating. Here, we demonstrate a novel system of solid microparticles functionalized with specific binding groups-in this case DNA linkers-that are fully mobile along the particle surface. These colloids display qualitatively new behavior and circumvent many of the commonly encountered issues. Importantly, the association/dissociation transition, and thereby the temperature window for equilibrium self-assembly, is much broader. We further find that the linkers are uniformly distributed above the DNA melting temperature, while visibly accumulating at the interparticle contacts below this temperature. The unique combination of binding group mobility with nondeformability, monodispersity, and facile manipulation of solid particles should have a profound impact on DNA-mediated and other bioinspired self-assembly approaches. Moreover, our highly tunable experimental system enables detailed model investigations that will also deepen our fundamental understanding of other systems with surface-mobile binding groups, for instance, biological ligand-receptor interactions. PMID:24040916

  13. A Scalable Method for Analysis and Display of DNA Sequences

    PubMed Central

    Sirovich, Lawrence; Stoeckle, Mark Y.; Zhang, Yu

    2009-01-01

    Background Comparative DNA sequence analysis provides insight into evolution and helps construct a natural classification reflecting the Tree of Life. The growing numbers of organisms represented in DNA databases challenge tree-building techniques and the vertical hierarchical classification may obscure relationships among some groups. Approaches that can incorporate sequence data from large numbers of taxa and enable visualization of affinities across groups are desirable. Methodology/Principal Findings Toward this end, we developed a procedure for extracting diagnostic patterns in the form of indicator vectors from DNA sequences of taxonomic groups. In the present instance the indicator vectors were derived from mitochondrial cytochrome c oxidase I (COI) sequences of those groups and further analyzed on this basis. In the first example, indicator vectors for birds, fish, and butterflies were constructed from a training set of COI sequences, then correlations with test sequences not used to construct the indicator vector were determined. In all cases, correlation with the indicator vector correctly assigned test sequences to their proper group. In the second example, this approach was explored at the species level within the bird grouping; this also gave correct assignment, suggesting the possibility of automated procedures for classification at various taxonomic levels. A false-color matrix of vector correlations displayed affinities among species consistent with higher-order taxonomy. Conclusions/Significance The indicator vectors preserved DNA character information and provided quantitative measures of correlations among taxonomic groups. This method is scalable to the largest datasets envisioned in this field, provides a visually-intuitive display that captures relational affinities derived from sequence data across a diversity of life forms, and is potentially a useful complement to current tree-building techniques for studying evolutionary processes based on DNA sequence data. PMID:19798412

  14. Effect of donor age on DNA repair by articular chondrocytes

    SciTech Connect

    Lipman, J.M.

    1986-05-01

    The hypothesis that aging of articular chondrocytes at a cellular level results from loss of DNA repair capability was studied by two different measures: unscheduled DNA synthesis (UDS) and O/sup 6/-methylguanine acceptor protein (MGAP) activity. UDS following damage by 254 nm ultraviolet irradiation (20J/m/sup 2/) was examined in intact articular cartilage from rabbits of different ages. Semiconservative DNA synthesis was suppressed with hydroxurea and repair followed by the incorporation of (/sup 3/H)-thymidine ((/sup 3/H)-dThd). After repair the cartilage was digested in proteinase K (0.5mg/ml) with dodecyl sodium sulfate (0.2%) and DNA determined with Hoechst 33258 dye. UDS (dpm (/sup 3/H)-dThd/..mu..g DNA) was greater in articular cartilage from 3- than 39-month-old rabbits. MGAP was studied in cell extracts of cultured human and rabbit chondrocytes by transfer of (/sup 3/H) O/sup 6/-methyl groups from exogenous DNA to protein. It was significantly less in rabbit than in human cells on a per protein or DNA basis. There was no decline in this activity in human chondrocytes from newborn to 60 years of age; and rabbits from 3- to 36-months-old. The data indicate that in the two different repair mechanisms, age differences are found with resting but not dividing chondrocytes.

  15. Methylome Diversification through Changes in DNA Methyltransferase Sequence Specificity

    PubMed Central

    Furuta, Yoshikazu; Namba-Fukuyo, Hiroe; Shibata, Tomoko F.; Nishiyama, Tomoaki; Shigenobu, Shuji; Suzuki, Yutaka; Sugano, Sumio; Hasebe, Mitsuyasu; Kobayashi, Ichizo

    2014-01-01

    Epigenetic modifications such as DNA methylation have large effects on gene expression and genome maintenance. Helicobacter pylori, a human gastric pathogen, has a large number of DNA methyltransferase genes, with different strains having unique repertoires. Previous genome comparisons suggested that these methyltransferases often change DNA sequence specificity through domain movement—the movement between and within genes of coding sequences of target recognition domains. Using single-molecule real-time sequencing technology, which detects N6-methyladenines and N4-methylcytosines with single-base resolution, we studied methylated DNA sites throughout the H. pylori genome for several closely related strains. Overall, the methylome was highly variable among closely related strains. Hypermethylated regions were found, for example, in rpoB gene for RNA polymerase. We identified DNA sequence motifs for methylation and then assigned each of them to a specific homology group of the target recognition domains in the specificity-determining genes for Type I and other restriction-modification systems. These results supported proposed mechanisms for sequence-specificity changes in DNA methyltransferases. Knocking out one of the Type I specificity genes led to transcriptome changes, which suggested its role in gene expression. These results are consistent with the concept of evolution driven by DNA methylation, in which changes in the methylome lead to changes in the transcriptome and potentially to changes in phenotype, providing targets for natural or artificial selection. PMID:24722038

  16. Detecting ATM-dependent chromatin modification in DNA damage response.

    PubMed

    Udayakumar, Durga; Horikoshi, Nobuo; Mishra, Lopa; Hunt, Clayton; Pandita, Tej K

    2015-01-01

    Loss of function or mutation of the ataxia-telangiectasia mutated gene product (ATM) results in inherited genetic disorders characterized by neurodegeneration, immunodeficiency, and cancer. Ataxia-telangiectasia mutated (ATM) gene product belongs to the PI3K-like protein kinase (PIKKs) family and is functionally implicated in mitogenic signal transduction, chromosome condensation, meiotic recombination, cell-cycle control, and telomere maintenance. The ATM protein kinase is primarily activated in response to DNA double strand breaks (DSBs), the most deleterious form of DNA damage produced by ionizing radiation (IR) or radiomimetic drugs. It is detected at DNA damage sites, where ATM autophosphorylation causes dissociation of the inactive homodimeric form to the activated monomeric form. Interestingly, heat shock can activate ATM independent of the presence of DNA strand breaks. ATM is an integral part of the sensory machinery that detects DSBs during meiosis, mitosis, or DNA breaks mediated by free radicals. These DNA lesions can trigger higher order chromatin reorganization fuelled by posttranslational modifications of histones and histone binding proteins. Our group, and others, have shown that ATM activation is tightly regulated by chromatin modifications. This review summarizes the multiple approaches used to discern the role of ATM and other associated proteins in chromatin modification in response to DNA damage. PMID:25827888

  17. Genomic DNA binding to ZnO microrods

    NASA Astrophysics Data System (ADS)

    Guzmán-Embús, D. A.; Cardozo, M. Orrego; Vargas-Hernández, C.

    2015-08-01

    In this work, ZnO microrods were produced by hydrothermal synthesis. DNA was extracted from pork spleen cells by cellular lysis, deproteinization and precipitation. The analysis of the DNA binding to the ZnO was performed using Raman spectroscopy a technique that allowed for the evaluation of the effect that the presence of the ZnO in the complex has on the DNA structure. Vibrational spectral bands from the DNA molecule and hexagonal wurtzite ZnO were observed and classified as E2(M), A1(TO), E2(High), E1(LO) and 2LO. The Raman signals from the vibrational bands corresponding to the phosphodiester bond 5?-C-O-P-O-C-3? and bond stretching of the PO2- group, as well as ring vibrations of the nitrogenous bases of the DNA, were enhanced by the presence of the ZnO microrods. The bands from the modes corresponding to the C-O and Odbnd Psbnd O- molecules of the DNA backbone were observed to exhibit larger spectral shifts due to the compression and tensile stresses generated at the ZnO/DNA interface, respectively. In addition, the relative vibrational mode intensities of the nitrogenous bases increased.

  18. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  19. DNA-based soft phases.

    PubMed

    Bellini, Tommaso; Cerbino, Roberto; Zanchetta, Giuliano

    2012-01-01

    This chapter reviews the state-of-the-art in the study of molecular or colloidal systems whose mutual interactions are mediated by DNA molecules. In the last decade, the robust current knowledge of DNA interactions has enabled an impressive growth of self-assembled DNA-based structures that depend crucially on the properties of DNA-DNA interactions. In many cases, structures are built on design by exploiting the programmable selectivity of DNA interactions and the modularity of their strength. The study of DNA-based materials is definitely an emerging field in condensed matter physics, nanotechnology, and material science. This chapter will consider both systems that are entirely constructed by DNA and hybrid systems in which latex or metal colloidal particles are coated by DNA strands. We will confine our discussion to systems in which DNA-mediated interactions promote the formation of "phases," that is structures extending on length scales much larger than the building blocks. Their self-assembly typically involves a large number of interacting particles and often features hierarchical stages of structuring. Because of the possibility of fine-tuning the geometry and strength of the DNA-mediated interactions, these systems are characterized by a wide variety of patterns of self-assembly, ranging from amorphous, to liquid crystalline, to crystalline in one, two, or three dimensions. PMID:21826603

  20. Archaeal DNA polymerases in biotechnology.

    PubMed

    Zhang, Likui; Kang, Manyu; Xu, Jiajun; Huang, Yanchao

    2015-08-01

    DNA polymerase (pol) is a ubiquitous enzyme that synthesizes DNA strands in all living cells. In vitro, DNA pol is used for DNA manipulation, including cloning, PCR, site-directed mutagenesis, sequencing, and several other applications. Family B archaeal DNA pols have been widely used for molecular biological methods. Biochemical and structural studies reveal that each archaeal DNA pol has different characteristics with respect to fidelity, processivity and thermostability. Due to their high fidelity and strong thermostability, family B archaeal DNA pols have the extensive application on high-fidelity PCR, DNA sequencing, and site-directed mutagenesis while family Y archaeal DNA pols have the potential for error-prone PCR and random mutagenesis because of their low fidelity and strong thermostability. This information combined with mutational analysis has been used to construct novel DNA pols with altered properties that enhance their use as biotechnological reagents. In this review, we focus on the development and use of family B archaeal DNA pols. PMID:26150245

  1. Group B Strep Infection

    MedlinePLUS

    MENU Return to Web version Group B Strep Infection Overview What is group B strep? Group B streptococcus, or group B strep for ... skin, lips, or nails may turn blue) Diagnosis & Tests How will I know I have group B ...

  2. [DNA biobanks. Establishment and maintenance].

    PubMed

    Henriksen, F L; Hørder, M

    1998-08-24

    The need for extraction, purification and storage of DNA in biobanks is increasing. DNA may be obtained from mouth brush water, guthrie cards, tissue biopsies or venous blood. Sampling conditions depend on the method used for procurement of DNA, e.g. DNA extraction or Ebstein Barr Virus transformation. Exact knowledge about the validity and stability of DNA stored in buffer is still insufficient. Biobanks at hospitals and at research departments are regulated by the Danish Private Registers, etc. Act. Research projects based on DNA biobanks should be notified to the Danish Data Protection Agency and approved by the local ethical committee. Discount, economic, and business class set-ups are different practical and financial models for the structure of DNA biobanking. PMID:9739602

  3. DNA adducts-chemical addons

    PubMed Central

    Rajalakshmi, T. R.; AravindhaBabu, N.; Shanmugam, K. T.; Masthan, K. M. K.

    2015-01-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  4. Forensic trace DNA: a review

    PubMed Central

    2010-01-01

    DNA analysis is frequently used to acquire information from biological material to aid enquiries associated with criminal offences, disaster victim identification and missing persons investigations. As the relevance and value of DNA profiling to forensic investigations has increased, so too has the desire to generate this information from smaller amounts of DNA. Trace DNA samples may be defined as any sample which falls below recommended thresholds at any stage of the analysis, from sample detection through to profile interpretation, and can not be defined by a precise picogram amount. Here we review aspects associated with the collection, DNA extraction, amplification, profiling and interpretation of trace DNA samples. Contamination and transfer issues are also briefly discussed within the context of trace DNA analysis. Whilst several methodological changes have facilitated profiling from trace samples in recent years it is also clear that many opportunities exist for further improvements. PMID:21122102

  5. Conformationally Gated Charge Transfer in DNA Three-Way Junctions.

    PubMed

    Zhang, Yuqi; Young, Ryan M; Thazhathveetil, Arun K; Singh, Arunoday P N; Liu, Chaoren; Berlin, Yuri A; Grozema, Ferdinand C; Lewis, Frederick D; Ratner, Mark A; Renaud, Nicolas; Siriwong, Khatcharin; Voityuk, Alexander A; Wasielewski, Michael R; Beratan, David N

    2015-07-01

    Molecular structures that direct charge transport in two or three dimensions possess some of the essential functionality of electrical switches and gates. We use theory, modeling, and simulation to explore the conformational dynamics of DNA three-way junctions (TWJs) that may control the flow of charge through these structures. Molecular dynamics simulations and quantum calculations indicate that DNA TWJs undergo dynamic interconversion among "well stacked" conformations on the time scale of nanoseconds, a feature that makes the junctions very different from linear DNA duplexes. The studies further indicate that this conformational gating would control charge flow through these TWJs, distinguishing them from conventional (larger size scale) gated devices. Simulations also find that structures with polyethylene glycol linking groups ("extenders") lock conformations that favor CT for 25 ns or more. The simulations explain the kinetics observed experimentally in TWJs and rationalize their transport properties compared with double-stranded DNA. PMID:26266714

  6. Evidence for recombination in scorpion mitochondrial DNA (Scorpiones: Buthidae)

    PubMed Central

    Gantenbein, Benjamin; Fet, Victor; Gantenbein-Ritter, Iris A; Balloux, François

    2005-01-01

    There has been very little undisputed evidence for recombination in animal mitochondrial DNA (mtDNA) provided so far. Previous unpublished results suggestive of mtDNA recombination in the scorpion family Buthidae, together with cytological evidence for a unique mechanism of mitochondrial fusion in that family, prompted us to investigate this group in more details. First, we sequenced the complete mtDNA genome of Mesobuthus gibbosus, and chose two genes opposing each other (16S and coxI). We then sequenced 150 individuals from the natural populations of four species of Buthidae (Old World genera Buthus and Mesobuthus). We observed strong evidence for widespread recombination through highly significant negative correlations between linkage disequilibrium and physical distance in three out of four species. The evidence is further confirmed when using five other tests for recombination and by the presence of a high amount of homoplasy in phylogenetic trees. PMID:15870032

  7. Novel selection methods for DNA-encoded chemical libraries.

    PubMed

    Chan, Alix I; McGregor, Lynn M; Liu, David R

    2015-06-01

    Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. PMID:25723146

  8. A Novel Large-Scale Deletion of The Mitochondrial DNA of Spermatozoa of Men in North Iran

    PubMed Central

    Gholinezhad Chari, Maryam; Hosseinzadeh Colagar, Abasalt; Bidmeshkipour, Ali

    2015-01-01

    Background To investigate the level of correlation between large-scale deletions of the mitochondrial DNA (mtDNA) with defective sperm function. Materials and Methods In this analytic study, a total of 25 semen samples of the nor- mozoospermic infertile men from North of Iran were collected from the IVF center in an infertility clinic. The swim-up procedure was performed for the separation of spermatozoa into two groups; (normal motility group and abnormal motility group) by 2.0 ml of Ham’s F-10 medium and 1.0 ml of semen. After total DNA extraction, a long-range polymerase chain reaction (PCR) technique was used to determine the mtDNA deletions in human spermatozoa. Results The products of PCR analysis showed a common 4977 bp deletion and a novel 4866 bp deletion (flanked by a seven-nucleotide direct repeat of 5?-ACCCCCT-3? within the deleted area) from the mtDNA of spermatozoa in both groups. However, the frequency of mtDNA deletions in abnormal motility group was significantly higher than the normal motility group (56, and 24% for 4866 bp-deleted mtDNA and, 52, and 28% for 4977 bp-deleted mtDNA, respectively). Conclusion It is suggested that large-scale deletions of the mtDNA is associated with poor sperm motility and may be a causative factor in the decline of fertility in men. PMID:25780528

  9. Plasmid DNA mono-ion complex stabilized by hydrogen bond for in vivo diffusive gene delivery.

    PubMed

    Asayama, Shoichiro; Nohara, Atsushi; Negishi, Yoichi; Kawakami, Hiroyoshi

    2015-04-13

    Our original concept of the mono-ion complex (MIC) between plasmid DNA (pDNA) and a monocationic biocompatible polymer has been stabilized by hydrogen bond formation. To form the hydrogen bond with pDNA, ?-amide-pentylimidazolium end-modified poly(ethylene glycol), that is, APe-Im-PEG, has been synthesized. Agarose gel retardation assay and circular dichroism measurement have revealed that the MIC between pDNA and APe-Im-PEG has been stabilized by the hydrogen bond between pDNA and the ?-amide group and that the stable MIC has surprisingly further migrated into gel, as compared with naked pDNA. The rise of melting temperature suggests that the specific hydrogen bond forms between an adenine-thymine base pair and the ?-amide group. The resulting pDNA MIC with APe-Im-PEG has enhanced gene expression by intramuscular administration in mice, as compared with a poly(ethylenimine) polyion complex (PIC). These results suggest that the pDNA MIC is diffusive in vivo administration site, as compared with pDNA PICs. Our methodology for MIC stabilization by a ?-amide group is expected to offer superior supramolecular systems to those by ubiquitous PICs for in vivo diffusive gene delivery. PMID:25749015

  10. Inhaled crocidolite mutagenicity in lung DNA.

    PubMed Central

    Rihn, B; Coulais, C; Kauffer, E; Bottin, M C; Martin, P; Yvon, F; Vigneron, J C; Binet, S; Monhoven, N; Steiblen, G; Keith, G

    2000-01-01

    We used transgenic mice carrying the lacI reporter gene to study the mutagenesis potential of asbestos crocidolite. The animals were exposed by nose-only inhalation to an aerosol containing 5.75 mg/m(3) crocidolite dust for 6 hr/day and 5 consecutive days. After 1, 4, and 12 weeks, we examined four end points: the cytology of bronchoalveolar lavage, the lung load of crocidolite, the hydrophobic DNA adducts, and the mutations in the lacI reporter gene. Twelve weeks after exposure, nearly 10% of the inhaled fibers remained in the lung (227 +/- 103 ng/mg lung). There was evidence of a typical inflammatory response consisting of multinucleate macrophages at weeks 4 and 12, whereas immediately after the exposure, we observed numerous polymorphonuclear neutrophils. The mutant frequency significatively increased during the fourth week after the exposure: 13.5 [time] 10(-5) in the exposed group versus 6. 9 10(-5) in the control group. The induction factor, defined by the ratio of checked mutants of exposed mice to checked mutants of control mice, was 1.96. The mutation spectrum of control lung DNA and exposed lung DNA was similar, suggesting the possible involvement of a DNA repair decrease in crocidolite-treated animals. We used the (32)P-postlabeling method and did not detect any increase of either 5 mC or bulky adduct in treated mice. This is the first study that demonstrates asbestos mutagenicity in vivo after a nose-only inhalation. Images Figure 1 Figure 2 PMID:10753093

  11. Entrapment of DNA in an intersubunit tunnel system of a single-stranded DNA-binding protein

    PubMed Central

    Ghalei, Homa; von Moeller, Holger; Eppers, Detlef; Sohmen, Daniel; Wilson, Daniel N.; Loll, Bernhard; Wahl, Markus C.

    2014-01-01

    Instead of a classical single-stranded deoxyribonuleic acid (DNA)-binding protein (SSB), some hyperthermophilic crenarchaea harbor a non-canonical SSB termed ThermoDBP. Two related but poorly characterized groups of proteins, which share the ThermoDBP N-terminal DNA-binding domain, have a broader phylogenetic distribution and co-exist with ThermoDBPs and/or other SSBs. We have investigated the nucleic acid binding properties and crystal structures of representatives of these groups of ThermoDBP-related proteins (ThermoDBP-RPs) 1 and 2. ThermoDBP-RP 1 and 2 oligomerize by different mechanisms and only ThermoDBP-RP2 exhibits strong single-stranded DNA affinity in vitro. A crystal structure of ThermoDBP-RP2 in complex with DNA reveals how the NTD common to ThermoDBPs and ThermoDBP-RPs can contact the nucleic acid in a manner that allows a symmetric homotetrameric protein complex to bind single-stranded DNA molecules asymmetrically. While single-stranded DNA wraps around the surface or binds along channels of previously investigated SSBs, it traverses an internal, intersubunit tunnel system of a ThermoDBP-RP2 tetramer. Our results indicate that some archaea have acquired special SSBs for genome maintenance in particularly challenging environments. PMID:24744237

  12. The effects of a wheat germ rich diet on oxidative mtDNA damage, mtDNA copy number and antioxidant enzyme activities in aging Drosophila.

    PubMed

    Mutlu, Ayse Gul

    2013-03-01

    The free radical theory of aging posits that the accumulation of macromolecular damage induced by toxic reactive oxygen species plays a central role in the aging process. Therefore consumption of dietary antioxidants appears to be of great importance. Wheat germ have strong antioxidant properties. Aim of this study is investigate the effects of a wheat germ rich diet on oxidative mtDNA damage, mtDNA copy number and antioxidant enzyme activities in Drosophila. Current results suggested that dietary wheat germ enhances the activities of antioxidant enzymes in Drosophila. There was no statistically difference in mtDNA damage and mtDNA copy number results of "Wheat Germ" and "Refined White Flour" feed groups. mtDNA damage slightly increased with aging in both groups but these changes were no statistically different. PMID:23567826

  13. Effect of temperature and UV illumination on charge transport mechanisms in DNA

    NASA Astrophysics Data System (ADS)

    Narenji, Alaleh G.; Goshi, Noah; Bui, Chris; Mokili, John; Kassegne, Sam

    2015-04-01

    Research into the use of DNA molecules as building blocks for nanoelectronics as well as nanosystems continues. Recently, our group has reported significant electrical conductivity in ?-DNA through direct and in-direct measurements involving high-aspect ratio electrodes that eliminate the effect of the substrate. Our results demonstrate that, at moderate to high frequencies, ?-DNA molecular wires show low impedance. In addition, to prove that the conductivity is indeed from DNA bridge, we studied the effect of temperature and UV irradiation on DNA molecular wires. The temperature results indicate that ?-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4°C - 40°C, then decreases from 40°C to the melting point (~110°C) at which ?-DNA denatures resulting in a complete loss of current transduction. This hysteric and bi-model behavior makes DNA a candidate for nanoelectronics components such as thermal transistors and switches. The data from UV exposure experiments indicates decreased conductivity of ?-DNA molecular wires after UV exposure, due to damage to GC base pairs and phosphate groups reducing the path available for both charge hopping and short-range electron tunneling mechanisms. The lessons learned from these conductivity experiments along with our knowledge of different charge transport mechanisms within DNA can be applied to the design of synthetic molecular wires for the construction of nanoelectronic devices.

  14. Fleet DNA (Presentation)

    SciTech Connect

    Walkokwicz, K.; Duran, A.

    2014-06-01

    The Fleet DNA project objectives include capturing and quantifying drive cycle and technology variation for the multitude of medium- and heavy-duty vocations; providing a common data storage warehouse for medium- and heavy-duty vehicle fleet data across DOE activities and laboratories; and integrating existing DOE tools, models, and analyses to provide data-driven decision making capabilities. Fleet DNA advantages include: for Government - providing in-use data for standard drive cycle development, R&D, tech targets, and rule making; for OEMs - real-world usage datasets provide concrete examples of customer use profiles; for fleets - vocational datasets help illustrate how to maximize return on technology investments; for Funding Agencies - ways are revealed to optimize the impact of financial incentive offers; and for researchers -a data source is provided for modeling and simulation.

  15. Tops and Writhing DNA

    E-print Network

    Joseph Samuel; Supurna Sinha

    2010-11-30

    The torsional elasticity of semiflexible polymers like DNA is of biological significance. A mathematical treatment of this problem was begun by Fuller using the relation between link, twist and writhe, but progress has been hindered by the non-local nature of the writhe. This stands in the way of an analytic statistical mechanical treatment, which takes into account thermal fluctuations, in computing the partition function. In this paper we use the well known analogy with the dynamics of tops to show that when subjected to stretch and twist, the polymer configurations which dominate the partition function admit a local writhe formulation in the spirit of Fuller and thus provide an underlying justification for the use of Fuller's "local writhe expression" which leads to considerable mathematical simplification in solving theoretical models of DNA and elucidating their predictions. Our result facilitates comparison of the theoretical models with single molecule micromanipulation experiments and computer simulations.

  16. Systemic Lupus Erythematosus with and without Anti-dsDNA Antibodies: Analysis from a Large Monocentric Cohort

    PubMed Central

    Fabrizio, Conti; Fulvia, Ceccarelli; Carlo, Perricone; Laura, Massaro; Elisa, Marocchi; Francesca, Miranda; Francesca Romana, Spinelli; Simona, Truglia; Cristiano, Alessandri; Guido, Valesini

    2015-01-01

    Objectives. The anti-dsDNA antibodies are a marker for Systemic Lupus Erythematosus (SLE) and 70–98% of patients test positive. We evaluated the demographic, clinical, laboratory, and therapeutical features of a monocentric SLE cohort according to the anti-dsDNA status. Methods. We identified three groups: anti-dsDNA + (persistent positivity); anti-dsDNA ± (initial positivity and subsequent negativity during disease course); anti-dsDNA ? (persistent negativity). Disease activity was assessed by the European Consensus Lupus Activity Measurement (ECLAM). Results. We evaluated 393 patients (anti-dsDNA +: 62.3%; anti-dsDNA ±: 13.3%; anti-dsDNA ?: 24.4%). The renal involvement was significantly more frequent in anti-dsDNA + (30.2%), compared with anti-dsDNA ± and anti-dsDNA ? (21.1% and 18.7%, resp.; P = 0.001). Serositis resulted significantly more frequent in anti-dsDNA ? (82.3%) compared to anti-dsDNA + and anti-dsDNA ± (20.8% and 13.4%, resp.; P < 0.0001). The reduction of C4 serum levels was identified significantly more frequently in anti-dsDNA + and anti-dsDNA ± (40.0% and 44.2%, resp.) compared with anti-dsDNA ? (21.8%, P = 0.005). We did not identify significant differences in the mean ECLAM values before and after modification of anti-dsDNA status (P = 0.7). Conclusion. Anti-dsDNA status influences the clinical and immunological features of SLE patients. Nonetheless, it does not appear to affect disease activity. PMID:26063969

  17. Evolutionary patterns of DNA base composition and correlation to polymorphisms in DNA repair systems.

    PubMed

    Li, Xianran; Scanlon, Michael J; Yu, Jianming

    2015-04-20

    DNA base composition is a fundamental genome feature. However, the evolutionary pattern of base composition and its potential causes have not been well understood. Here, we report findings from comparative analysis of base composition at the whole-genome level across 2210 species, the polymorphic-site level across eight population comparison sets, and the mutation-site level in 12 mutation-tracking experiments. We first demonstrate that base composition follows the individual-strand base equality rule at the genome, chromosome and polymorphic-site levels. More intriguingly, clear separation of base-composition values calculated across polymorphic sites was consistently observed between basal and derived groups, suggesting common underlying mechanisms. Individuals in the derived groups show an A&T-increase/G&C-decrease pattern compared with the basal groups. Spontaneous and induced mutation experiments indicated these patterns of base composition change can emerge across mutation sites. With base-composition across polymorphic sites as a genome phenotype, genome scans with human 1000 Genomes and HapMap3 data identified a set of significant genomic regions enriched with Gene Ontology terms for DNA repair. For three DNA repair genes (BRIP1, PMS2P3 and TTDN), ENCODE data provided evidence for interaction between genomic regions containing these genes and regions containing the significant SNPs. Our findings provide insights into the mechanisms of genome evolution. PMID:25765652

  18. DNA waves and water

    E-print Network

    L. Montagnier; J. Aissa; E. Del Giudice; C. Lavallee; A. Tedeschi; G. Vitiello

    2010-12-23

    Some bacterial and viral DNA sequences have been found to induce low frequency electromagnetic waves in high aqueous dilutions. This phenomenon appears to be triggered by the ambient electromagnetic background of very low frequency. We discuss this phenomenon in the framework of quantum field theory. A scheme able to account for the observations is proposed. The reported phenomenon could allow to develop highly sensitive detection systems for chronic bacterial and viral infections.

  19. Hardware Controller DNA Synthesizer

    Energy Science and Technology Software Center (ESTSC)

    1995-07-27

    The program controls the operation of various hardware components of an automatic 12-channel parrallel oligosynthesizer. This involves accepting information regarding the DNA sequence to be generated and converting this into a series of instructions to I/O ports to actuate the appropriate hardware components. The design and function of the software is specific to a particular hardware platform and has no utility for controlling other configurations.

  20. A single mutation in the 729 residue modulates human DNA topoisomerase IB DNA binding and drug resistance

    PubMed Central

    Losasso, Carmen; Cretaio, Erica; Fiorani, Paola; D’Annessa, Ilda; Chillemi, Giovanni; Benedetti, Piero

    2008-01-01

    Human DNA topoisomerase I (hTop1p) catalyzes the relaxation of supercoiled DNA and constitutes the cellular target of the antitumor drug camptothecin (CPT). The X-ray crystal structure of the enzyme covalently joined to DNA and bound to the CPT analog Topotecan suggests that there are two classes of mutations that can produce a CPT-resistant enzyme. The first class includes changes in residues that directly interact with the drug, whereas a second class alters interactions with the DNA and thereby destabilizes the drug binding site. The Thr729Ala, that is part of a hydrophobic pocket in the enzyme C-terminal domain, belongs to a third group of mutations that confer CPT resistance, but do not interact directly with the drug or the DNA. To understand the contribution of this residue in drug resistance, we have studied the effect on hTop1p catalysis and CPT sensitivity of four different substitutions in the Thr729 position (Thr729Ala, Thr729Glu, Thr729Lys and Thr729Pro). Tht729Glu and Thr729Lys mutants show severe CPT resistance and furthermore, Thr729Glu shows a remarkable defect in DNA binding. We postulate that the maintenance of the hydrophobic pocket integrity, where Thr729 is positioned, is crucial for drug sensitivity and DNA binding. PMID:18772225

  1. Spectral Clustering Gene Ontology Terms to Group Genes by Function

    E-print Network

    Zell, Andreas

    Spectral Clustering Gene Ontology Terms to Group Genes by Function Nora Speer, Christian Spieth throughput me- thods like DNA microarrays, biologists are capable of producing huge amounts of data. During the analysis of such data the need for a group- ing of the genes according to their biological function arises

  2. 1364 Biochemistry 1991, 30, 1364-1372 DNA-Nogalamycin Interactionst,$

    E-print Network

    Williams, Loren

    , the positively charged amino sugar substituent of daunomycin is replaced by an uncharged nogalose sugar to a bicyclo amino sugar with a positively charged dimethylamino group. Much larger DNA fluctuations-ray crystal structure of the complex between nogalamycin and the self-complementary DNA hexamer d("e5CGTsAme5

  3. Microfabricated Devices for Sizing DNA and Sorting Cells Hou-Pu Choua

    E-print Network

    Quake, Stephen R.

    has been demonstrated. Keywords: MEMS, Cell sorting, DNA diagnostics 1. Introduction There are numerous applications in biology in which one wishes to know the size distribution of DNA fragments at Princeton,5 building on work by the Whitesides group at Harvard.6 There are numerous possible applications

  4. A MACHINE LEARNING APPROACH TO DNA MICROARRAY BICLUSTERING Dept. of Electrical Engineering

    E-print Network

    Mak, Man-Wai

    A MACHINE LEARNING APPROACH TO DNA MICROARRAY BICLUSTERING ANALYSIS S.Y. Kung Dept. of Electrical-established machine learning techniques and neural networks, several biclustering algorithms can be developed for DNA microarray analysis. It has been recognized that genes (even though they may belong to the same gene group

  5. DNA barcoding and the taxonomy of Microgastrinae wasps (Hymenoptera, Braconidae): impacts after 8 years and nearly

    E-print Network

    DNA barcoding and the taxonomy of Microgastrinae wasps (Hymenoptera, Braconidae): impacts after 8­2011) of DNA barcoding microgas- trine wasps. Currently they are the best represented group of parasitoid Hymenoptera in the Barcode of Life Data System (BOLD), a massive barcode storage and analysis data management

  6. M.C. Kline Biological Evidence Preservation TWG DNA Science Update

    E-print Network

    M.C. Kline ­ Biological Evidence Preservation TWG DNA Science Update August 17, 2010 http://www.cstl.nist.gov/biotech/strbase/NISTpub.htm 1 DNA Science Update Margaret C. Kline NIST Applied Genetics Group Biochemical Science Division NIST and Technology. Certain commercial equipment, instruments and materials are identified in order to specify

  7. Clinical Comparison of QUANTA Flash dsDNA Chemiluminescent Immunoassay with Four Current Assays for the Detection of Anti-dsDNA Autoantibodies

    PubMed Central

    Infantino, Maria; Meacci, Francesca; Bentow, Chelsea; Martis, Peter; Benucci, Maurizio; Afeltra, Antonella; Rigon, Amelia; Atzeni, Fabiola; Sarzi-Puttini, Piercarlo; Manfredi, Mariangela; Mahler, Michael

    2015-01-01

    Introduction. The objective of the present study was to compare QUANTA Flash dsDNA, a chemiluminescent immunoassay (CIA) on the BIO-FLASH, a rapid-response chemiluminescent analyzer, to three other anti-dsDNA antibody assays and to Crithidia luciliae indirect immunofluorescence test (CLIFT). Methods. In the first part of the study, 161 samples, 61 from patients suffering from systemic lupus erythematosus (SLE) and 100 from a disease control group, were tested by QUANTA Flash dsDNA CIA, QUANTA Lite dsDNA SC ELISA, BioPlex 2200 multiplex flow immunoassay (MFI), ImmuLisa dsDNA ELISA, and NOVA Lite CLIFT. A second cohort of 69?SLE patients was then tested by QUANTA Flash dsDNA and CLIFT to expand the study. Results. The overall qualitative agreements varied between 77.0% (NOVA Lite CLIFT versus QUANTA Lite) and 89.4% (ImmuLisa versus NOVA Lite CLIFT). The clinical sensitivities for the anti-dsDNA antibody tests varied from 8.2% (NOVA Lite CLIFT) to 54.1% (QUANTA Lite), while the clinical specificities varied from 88.0% (BioPlex 2200) to 100.0% (NOVA Lite CLIFT). Good correlation was found between QUANTA Flash dsDNA and NOVA Lite CLIFT. Conclusion. Significant variations among dsDNA methods were observed. QUANTA Flash dsDNA provides a good combination of sensitivity and specificity for the diagnosis of SLE and good agreement to CLIFT. PMID:25759849

  8. Insights into RNA/DNA hybrid recognition and processing by RNase H from the crystal structure of a non-specific enzyme-dsDNA complex

    SciTech Connect

    Pallan, Pradeep S.; Egli, Martin

    2009-06-17

    Ribonuclease HI (RNase H) is a member of the nucleotidyl-transferase superfamily and endo-nucleolytically cleaves the RNA portion in RNA/DNA hybrids and removes RNA primers from Okazaki fragments. The enzyme also binds RNA and DNA duplexes but is unable to cleave either. Three-dimensional structures of bacterial and human RNase H catalytic domains bound to RNA/DNA hybrids have revealed the basis for substrate recognition and the mechanism of cleavage. In order to visualize the enzyme's interactions with duplex DNA and to establish the structural differences that afford tighter binding to RNA/DNA hybrids relative to dsDNA, we have determined the crystal structure of Bacillus halodurans RNase H in complex with the B-form DNA duplex [d(CGCGAATTCGCG)]2. The structure demonstrates that the inability of the enzyme to cleave DNA is due to the deviating curvature of the DNA strand relative to the substrate RNA strand and the absence of Mg{sup 2+} at the active site. A subset of amino acids engaged in contacts to RNA 2{prime}-hydroxyl groups in the substrate complex instead bind to bridging or non-bridging phosphodiester oxygens in the complex with dsDNA. Qualitative comparison of the enzyme's interactions with the substrate and inhibitor duplexes is consistent with the reduced binding affinity for the latter and sheds light on determinants of RNase H binding and cleavage specificity.

  9. Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

    NASA Technical Reports Server (NTRS)

    Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

    1999-01-01

    Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

  10. Acetylation of Werner syndrome protein (WRN): relationships with DNA damage, DNA replication and DNA metabolic activities

    PubMed Central

    Lozada, Enerlyn; Yi, Jingjie; Luo, Jianyuan; Orren, David K.

    2014-01-01

    Loss of WRN function causes Werner Syndrome, characterized by increased genomic instability, elevated cancer susceptibility and premature aging. Although WRN is subject to acetylation, phosphorylation and sumoylation, the impact of these modifications on WRN’s DNA metabolic function remains unclear. Here, we examined in further depth the relationship between WRN acetylation and its role in DNA metabolism, particularly in response to induced DNA damage. Our results demonstrate that endogenous WRN is acetylated somewhat under unperturbed conditions. However, levels of acetylated WRN significantly increase after treatment with certain DNA damaging agents or the replication inhibitor hydroxyurea. Use of DNA repair-deficient cells or repair pathway inhibitors further increase levels of acetylated WRN, indicating that induced DNA lesions and their persistence are at least partly responsible for increased acetylation. Notably, acetylation of WRN correlates with inhibition of DNA synthesis, suggesting that replication blockage might underlie this effect. Moreover, WRN acetylation modulates its affinity for and activity on certain DNA structures, in a manner that may enhance its relative specificity for physiological substrates. Our results also show that acetylation and deacetylation of endogenous WRN is a dynamic process, with sirtuins and other histone deacetylases contributing to WRN deacetylation. These findings advance our understanding of the dynamics of WRN acetylation under unperturbed conditions and following DNA damage induction, linking this modification not only to DNA damage persistence but also potentially to replication stalling caused by specific DNA lesions. Our results are consistent with proposed metabolic roles for WRN and genomic instability phenotypes associated with WRN deficiency. PMID:24965941

  11. [The use of temporal temperature gradient gel electrophoresis to reveal mutations in peripheral blood mitochondrial DNA].

    PubMed

    Gaziev, A I; Guliaeva, N A; Bel'skaia, I I; Muksinova, K N; Zakharova, M L; Fomenko, L A; Antipova, V N; Bezlepkin, V G

    2008-01-01

    The mutations in mitochondrial DNA (mtDNA) arise at a higher frequency than in nuclear DNA, and their appearance in peripheral blood can be considered as a sensitive marker to estimate the level of genotoxic load. For revealing the presence of mutations in mtDNA of peripheral blood, we used the method of temporal temperature gradient gel electrophoresis (TTGE). The samples of whole blood DNA from four donor groups were used. Group I contained 10 young (23-26 years) donors and Group II 12 elderly (65-74 years) donors. Group III was formed from patients with breast cancer (12 women) past sessions of radio-chemotherapies (RCHT). Group IV was made of professionals of a nucleus plant occupationally exposed to chronic gamma-irradiation. PCR was carried out on four coding sequences and on one hypervariable sequence of the D-loop (DloopI) of mtDNA. PCR products were tested with TTGE. Most mutations were revealed in the DloopI. Heteroplasmy in the region of DloopI was registered in the blood of each donor of Group III 7 days after the RCHT session. Also, mutations in mtDNA Dloop1 were found in 6 of 13 individuals of Group IV. The blood of this donor group was taken 16 to 28 years after prolonged irradiations in a dose range of 250-350 cGy. In the elderly donor group, the same results were observed in 3 of 12 individuals. The results show that the method of TTGE can be used in mass analyses to assess the effects of radiation and other genotoxic agents in man by detection of unknown mutations in peripheral blood mtDNA. PMID:18666643

  12. Advances in DNA sequencing technologies for high resolution HLA typing.

    PubMed

    Cereb, Nezih; Kim, Hwa Ran; Ryu, Jaejun; Yang, Soo Young

    2015-12-01

    This communication describes our experience in large-scale G group-level high resolution HLA typing using three different DNA sequencing platforms - ABI 3730 xl, Illumina MiSeq and PacBio RS II. Recent advances in DNA sequencing technologies, so-called next generation sequencing (NGS), have brought breakthroughs in deciphering the genetic information in all living species at a large scale and at an affordable level. The NGS DNA indexing system allows sequencing multiple genes for large number of individuals in a single run. Our laboratory has adopted and used these technologies for HLA molecular testing services. We found that each sequencing technology has its own strengths and weaknesses, and their sequencing performances complement each other. HLA genes are highly complex and genotyping them is quite challenging. Using these three sequencing platforms, we were able to meet all requirements for G group-level high resolution and high volume HLA typing. PMID:26423536

  13. Molecular and Enzymatic Profiles of Mammalian DNA Methyltransferases: Structures and Targets for Drugs

    PubMed Central

    Xu, F.; Mao, C.; Ding, Y.; Rui, C.; Wu, L.; Shi, A.; Zhang, H.; Zhang, L.; Xu, Z.

    2010-01-01

    DNA methylation is an epigenetic event involved in a variety array of processes that may be the foundation of genetic phenomena and diseases. DNA methyltransferase is a key enzyme for cytosine methylation in DNA, and can be divided into two functional families (Dnmt1 and Dnmt3) in mammals. All mammalian DNA methyltransferases are encoded by their own single gene, and consisted of catalytic and regulatory regions (except Dnmt2). Via interactions between functional domains in the regulatory or catalytic regions and other adaptors or cofactors, DNA methyltransferases can be localized at selective areas (specific DNA/nucleotide sequence) and linked to specific chromosome status (euchromatin/heterochromatin, various histone modification status). With assistance from UHRF1 and Dnmt3L or other factors in Dnmt1 and Dnmt3a/Dnmt3b, mammalian DNA methyltransferases can be recruited, and then specifically bind to hemimethylated and unmethylated double-stranded DNA sequence to maintain and de novo setup patterns for DNA methylation. Complicated enzymatic steps catalyzed by DNA methyltransferases include methyl group transferred from cofactor Ado-Met to C5 position of the flipped-out cytosine in targeted DNA duplex. In the light of the fact that different DNA methyltransferases are divergent in both structures and functions, and use unique reprogrammed or distorted routines in development of diseases, design of new drugs targeting specific mammalian DNA methyltransferases or their adaptors in the control of key steps in either maintenance or de novo DNA methylation processes will contribute to individually treating diseases related to DNA methyltransferases. PMID:20939822

  14. Kiwifruit as a modulator of DNA damage and DNA repair.

    PubMed

    Collins, Andrew R

    2013-01-01

    Kiwifruit are a rich source of vitamin C and other antioxidants. We have demonstrated the capacity of kiwifruit to protect cellular DNA against oxidative damage in single-dose human experiments and in longer term supplementation trials using the comet assay to measure both DNA-strand breaks and oxidized bases. Enhanced antioxidant status following a single large dose of kiwifruit is shown by an increased resistance of lymphocyte DNA to oxidation by H(2)O(2)in vitro. After 3 weeks (or more) of supplementation, endogenous base oxidation is significantly decreased. In addition to its antioxidant potential, kiwifruit stimulates base excision repair as measured in an in vitro assay with DNA containing 8-oxoguanine as substrate. The relevance of DNA damage protection and modulation of DNA repair to cancer risk is discussed. PMID:23394994

  15. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase ?.

    PubMed

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase ? (pol ?) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol ? can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol ? can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis. PMID:26530671

  16. Mechanism of DNA damage tolerance

    PubMed Central

    Bi, Xin

    2015-01-01

    DNA damage may compromise genome integrity and lead to cell death. Cells have evolved a variety of processes to respond to DNA damage including damage repair and tolerance mechanisms, as well as damage checkpoints. The DNA damage tolerance (DDT) pathway promotes the bypass of single-stranded DNA lesions encountered by DNA polymerases during DNA replication. This prevents the stalling of DNA replication. Two mechanistically distinct DDT branches have been characterized. One is translesion synthesis (TLS) in which a replicative DNA polymerase is temporarily replaced by a specialized TLS polymerase that has the ability to replicate across DNA lesions. TLS is mechanistically simple and straightforward, but it is intrinsically error-prone. The other is the error-free template switching (TS) mechanism in which the stalled nascent strand switches from the damaged template to the undamaged newly synthesized sister strand for extension past the lesion. Error-free TS is a complex but preferable process for bypassing DNA lesions. However, our current understanding of this pathway is sketchy. An increasing number of factors are being found to participate or regulate this important mechanism, which is the focus of this editorial. PMID:26322163

  17. Mitochondrial DNA maintenance: an appraisal.

    PubMed

    Akhmedov, Alexander T; Marín-García, José

    2015-11-01

    Mitochondria play a crucial role in a variety of cellular processes ranging from energy metabolism, generation of reactive oxygen species (ROS), and Ca(2+) handling to stress responses, cell survival, and death. Malfunction of the organelle may contribute to the pathogenesis of neuromuscular disorders, cancer, premature aging, and cardiovascular diseases, including myocardial ischemia, cardiomyopathy, and heart failure. Mitochondria are unique as they contain their own genome organized into DNA-protein complexes, so-called mitochondrial nucleoids, along with multiprotein machineries, which promote mitochondrial DNA (mtDNA) replication, transcription, and repair. Although the organelle possesses almost all known nuclear DNA repair pathways, including base excision repair, mismatch repair, and recombinational repair, the proximity of mtDNA to the main sites of ROS production and the lack of protective histones may result in increased susceptibility to oxidative stress and other types of mtDNA damage. Defects in the components of these highly organized machineries, which mediate mtDNA maintenance (replication and repair), may result in accumulation of point mutations and/or deletions in mtDNA and decreased mtDNA copy number impairing mitochondrial function. This review will focus on the mechanisms of mtDNA maintenance with emphasis on the proteins implicated in these processes and their functional role in various disease conditions and aging. PMID:26286847

  18. Alteration of the nucleosomal DNA path in the crystal structure of a human nucleosome core particle

    PubMed Central

    Tsunaka, Yasuo; Kajimura, Naoko; Tate, Shin-ichi; Morikawa, Kosuke

    2005-01-01

    Gene expression in eukaryotes depends upon positioning, mobility and packaging of nucleosomes; thus, we need the detailed information of the human nucleosome core particle (NCP) structure, which could clarify chromatin properties. Here, we report the 2.5 ? crystal structure of a human NCP. The overall structure is similar to those of other NCPs reported previously. However, the DNA path of human NCP is remarkably different from that taken within other NCPs with an identical DNA sequence. A comparison of the structural parameters between human and Xenopus laevis DNA reveals that the DNA path of human NCP consecutively shifts by 1 bp in the regions of superhelix axis location ?5.0 to ?2.0 and 5.0 to 7.0. This alteration of the human DNA path is caused predominantly by tight DNA–DNA contacts within the crystal. It is also likely that the conformational change in the human H2B tail induces the local alteration of the DNA path. In human NCP, the region with the altered DNA path lacks Mn2+ ions and the B-factors of the DNA phosphate groups are substantially high. Therefore, in contrast to the histone octamer, the nucleosomal DNA is sufficiently flexible and mobile and can undergo drastic conformational changes, depending upon the environment. PMID:15951514

  19. Acquired immunogenicity of calf thymus DNA and LDL modified by D-ribose: a comparative study.

    PubMed

    Akhter, Firoz; Khan, M Salman; Ahmad, Saheem

    2015-01-01

    Glycation of biologically important macromolecules leads to the establishment of advanced glycation end products (AGEs) having significant role in the pathophysiology of various diseases. d-Ribose, is a highly reactive pentose sugar resulting in the rapid formation of AGEs. Formation of d-ribose derived glycated DNA and LDL has been previously demonstrated; however no comparative, extensive studies have been performed to assess the immunogenicity of d-ribose glycated calf thymus DNA (CT-DNA) and LDL. In the present study, the results showed that animals immunized with d-ribose modified CT-DNA and LDL induced antibodies as detected by direct binding and competition ELISA. The modified CT-DNA and LDL were found to be highly immunogenic, eliciting high titer immunogen-specific antibodies, while the native forms of DNA was almost non-immunogenic. The induced antibodies from modified CT-DNA and LDL exhibited wide range of heterogeneity in recognizing various nucleic acid conformers, DNA bases and amino acids. Furthermore, Serum antibodies from diabetes and diabetes atherosclerosis patients were screened for their binding to native CT-DNA, LDL and glycated CT-DNA, LDL. Glycated CT-DNA showed almost equivalent binding to both diabetes and diabetic atherosclerosis group while high recognition was observed when glycated LDL was used as an antigen. PMID:25450543

  20. Origin of Circulating Free DNA in Sepsis: Analysis of the CLP Mouse Model

    PubMed Central

    Hamaguchi, Shigeto; Akeda, Yukihiro; Yamamoto, Norihisa; Seki, Masafumi; Yamamoto, Kouji; Oishi, Kazunori; Tomono, Kazunori

    2015-01-01

    Recently, it has been reported that circulating free DNA (cf-DNA) in the blood is increased in various infectious diseases, including sepsis. Moreover, a relationship between cf-DNA and neutrophil extracellular traps (NETs) has been suggested. However, it is still unclear what the source and physiological role of cf-DNA in sepsis are. In this study, we examined the source of cf-DNA by detecting citrullinated histone H3, a characteristic feature of NET formation, in cecal ligation and puncture- (CLP-)operated mice. In addition, neutrophil depletion using anti-Ly6G antibodies was performed to assess the association between neutrophils and cf-DNA. Increased cf-DNA levels were observed only in CLP mice and not in the control groups; the qPCR findings revealed that the cf-DNA was mainly host-derived, even in bacteremic conditions. Citrullinated histone H3 was not increased in the neutrophils upon CLP, and the depletion of neutrophils showed limited effects on decreasing the amount of cf-DNA. Taken together, these results suggested that elevated cf-DNA levels during early-phase sepsis may represent a candidate biomarker for the severity of sepsis and that, contrary to previous findings, cf-DNA is not derived from neutrophils or NETs. PMID:26273139