Science.gov

Sample records for guanosine analogue 2-amino-6-mercapto-7-methylpurine

  1. Alkylation of guanosine and 4-(p-nitrobenzyl)-pyridine by styrene oxide analogues in vitro.

    PubMed

    Hemminki, K; Heinonen, T; Vainio, H

    1981-11-01

    In vitro alkylation activity of styrene oxide (SO) and three of its analogues, 4-vinyltoluene oxide (VTO), 3,5-dimethylstyrene oxide (DMSO), and 4-nitrostyrene oxide (NSO) was assayed using 4-(p-nitrobenzyl)pyridine (NBP) and guanosine as nucleophiles. Hydrolysis rates were also determined. The half-lives of VTO, DMSO, SO, and NSO were 8, 11, 40, and 60 h, respectively in aqueous solution. The rate of NBP alkylation correlated with the rate of hydrolysis. By contrast, the rates of guanosine alkylation were quite different: SO greater than VTO greater than DMSO. NSO did not react with guanosine. Fluorescence an ultraviolet spectroscopic data on the guanosine adducts indicated that SO, VTO, and DMSO formed main alkyl products at N-7. PMID:7325798

  2. Structural Basis for Recognition of Guanosine by a Synthetic Tricyclic Cytosine Analogue: Guanidinium G-Clamp

    SciTech Connect

    Wilds, C.J.; Maier, M.A.; Manoharan, M.; Egli, M.

    2010-03-08

    An oligonucleotide analogue containing a novel heterocyclic analogue, the guanidinium G-clamp, was designed to allow formation of five H-bonds to guanosine. The guanidinium group was introduced postsynthetically by treatment of the deprotected oligonucleotide containing a free amino group with a solution of 1H-pyrazole-1-carboxamidine and purified by a combination of size-exclusion chromatography and reversed-phase HPLC. A single incorporation of this modification into an oligodeoxynucleotide sequence was found to increase duplex stability by 13{sup o} and 16{sup o} per modification to RNA and DNA, respectively. Crystals of a self-complementary decamer sequence containing this modification were grown and diffracted to 1-{angstrom} resolution. The structure was solved by molecular replacement and revealed that the modification forms additional H-bonds to O(6) and N(7) of guanosine through the amino and imino N-atoms, respectively. The origins of enhanced duplex stability are also attributed to increased stacking interactions mediated by the phenoxazine moiety of the G-clamp and formation of H-bond networks between the positively charged guanidinium group, H{sub 2}O molecules, and negatively charged O-atoms from phosphates on the adjacent strand.

  3. Phosphonylated Acyclic Guanosine Analogues with the 1,2,3-Triazole Linker.

    PubMed

    Głowacka, Iwona E; Andrei, Graciela; Schols, Dominique; Snoeck, Robert; Piotrowska, Dorota G

    2015-01-01

    A novel series of {4-[(2-amino-6-chloro-9H-purin-9-yl)methyl]-1H-1,2,3-triazol-1-yl}alkylphosphonates and {4-[(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)methyl]-1H-1,2,3-triazol-1-yl}alkylphosphonates as acyclic analogues of guanosine were synthesized and assessed for antiviral activity against a broad range of DNA and RNA viruses and for their cytostatic activity toward three cancerous cell lines (HeLa, L1210 and CEM). They were devoid of antiviral activity; however, several phosphonates were found slightly cytostatic against HeLa cells at an IC50 in the 80-210 µM range. Compounds (1R,2S)-17k and (1S,2S)-17k showed the highest inhibitory effects (IC50=15-30 µM) against the proliferation of murine leukemia (L1210) and human T-lymphocyte (CEM) cell lines. PMID:26501246

  4. An industrial process for selective synthesis of 7-methyl guanosine 5'-diphosphate: versatile synthon for synthesis of mRNA cap analogues.

    PubMed

    Kore, Anilkumar R; Parmar, Gaurang

    2006-03-01

    We report an industrial scale facile synthesis of 7-methyl guanosine 5'-diphosphate, which plays an important role in synthesis of various mRNA cap analogs. An efficient and selective methylation at position 7 of guanosine 5'-diphosphate was achieved by dissolving guanosine 5'-diphosphate in water and drops wise addition of dimethyl sulfate over a period of 1 h at room temperature. The reaction was completed within 2 h and resulted in more than a 96% yield. The desired product, 7-methyl GDP was purified by using BPG column on AKTA Purifier 100. Certainly, this method has advantages over the known methylation method, in terms of yield, economy, safety, and environmental concerns. PMID:16629126

  5. A new nonhydrolyzable reactive cGMP analogue, (Rp)-Guanosine-3′, 5′-cyclic-S-(4-bromo-2, 3-dioxobutyl)monophosphorothioate, which targets the cGMP binding site of human platelet PDE3A

    PubMed Central

    Hung, Su H.; Liu, Andy H.; Pixley, Robin A.; Francis, Penelope; Williams, LaTeeka D.; Matsko, Christopher M.; Barnes, Karine D.; Sivendran, Sharmila; Colman, Roberta F.; Colman, Robert W.

    2008-01-01

    The amino acids involved in substrate (cAMP) binding to human platelet cGMP-inhibited cAMP phosphodiesterase (PDE3A) are identified. Less is known about the inhibitor (cGMP) binding site. We have now synthesized a nonhydrolyzable reactive cGMP analog, Rp-guanosine-3′, 5′-cyclic-S-(4-bromo-2, 3-dioxobutyl)monophosphorothioate (Rp-cGMPS-BDB). Rp-cGMPS-BDB irreversibly inactivates PDE3A (KI = 43.4 ± 7.2 μM and kcart = 0.007 ± 0.0006 min−1). The effectiveness of protectants in decreasing the rate of inactivation by Rp-cGMPS-BDB is: Rp-cGMPS (Kd = 72 μM) > Sp-cGMPS (124), Sp-cAMPS (182) > GMP (1517), Rp-cAMPS (3762), AMP (4370 μM). NAD+, neither a substrate nor an inhibitor of PDE3A, does not protect. Nonhydrolyzable cGMP analogs exhibit greater affinity than the cAMP analogs. These results indicate that Rp-cGMPS-BDB targets favorably the cGMP binding site consistent with a docking model of PDE3A-Rp-cGMPS-BDB active site. We conclude that Rp-cGMPS-BDB is an effective active site-directed affinity label for PDE3A with potential for other cGMP-dependent enzymes. PMID:18394675

  6. Extracellular guanosine regulates extracellular adenosine levels

    PubMed Central

    Cheng, Dongmei; Jackson, Travis C.; Verrier, Jonathan D.; Gillespie, Delbert G.

    2013-01-01

    The aim of this investigation was to test the hypothesis that extracellular guanosine regulates extracellular adenosine levels. Rat preglomerular vascular smooth muscle cells were incubated with adenosine, guanosine, or both. Guanosine (30 μmol/l) per se had little effect on extracellular adenosine levels. Extracellular adenosine levels 1 h after addition of adenosine (3 μmol/l) were 0.125 ± 0.020 μmol/l, indicating rapid disposition of extracellular adenosine. Extracellular adenosine levels 1 h after addition of adenosine (3 μmol/l) plus guanosine (30 μmol/l) were 1.173 ± 0.061 μmol/l, indicating slow disposition of extracellular adenosine. Cell injury increased extracellular levels of endogenous adenosine and guanosine, and the effects of cell injury on endogenous extracellular adenosine were modulated by altering the levels of endogenous extracellular guanosine with exogenous purine nucleoside phosphorylase (converts guanosine to guanine) or 8-aminoguanosine (inhibits purine nucleoside phosphorylase). Extracellular guanosine also slowed the disposition of extracellular adenosine in rat preglomerular vascular endothelial cells, mesangial cells, cardiac fibroblasts, and kidney epithelial cells and in human aortic and coronary artery vascular smooth muscle cells and coronary artery endothelial cells. The effects of guanosine on adenosine levels were not mimicked or attenuated by 5-iodotubericidin (adenosine kinase inhibitor), erythro-9-(2-hydroxy-3-nonyl)-adenine (adenosine deaminase inhibitor), 5-aminoimidazole-4-carboxamide (guanine deaminase inhibitor), aristeromycin (S-adenosylhomocysteine hydrolase inhibitor), low sodium (inhibits concentrative nucleoside transporters), S-(4-nitrobenzyl)−6-thioinosine [inhibits equilibrative nucleoside transporter (ENT) type 1], zidovudine (inhibits ENT type 2), or acadesine (known modulator of adenosine levels). Guanosine also increases extracellular inosine, uridine, thymidine, and cytidine, yet decreases

  7. Guanosine nucleotide precursor for flavinogenesis of Eremothecium Ashbyii.

    PubMed

    Mitsuda, H; Nakajima, K

    1975-01-01

    The purine precursor in the riboflavin biosynthetic pathway in Eremothecium ashbyii was examined using a guanine analogue, 8-azaguanine, with non-growing cell systems. 1. Riboflavin formation in the culture filtrate was determined at 0, 5, 10 and 20 hr after start of the incubation of the non-growing cells in the presence of xanthine or 8-azaguanine (1 mM, respectively). At 20 hr of incubation, the addition of xanthine stimulated riboflavin formation by 36% and the addition of 8-azaguanine inhibited the formation by 57%. 2. Acid soluble nucleotide pools in the cells were followed at 0, 5, 10 and 20 hr of the incubation period in the presence of xanthine or 8-azaguanine by means of anion exchange column chromatography. The result showed that the GTP pool changed markedly despite the fact that the adenosine nucleotide pool was almost constant irrespective of the presence or absence of these purines till 10 hr of incubation. But, the decrease of the former was overcome in part by the addition of flavinogenic xanthine. Furthermore, the total amounts of GTP and guanosine accumulated in cells in the presence of 8-azaguanine reached the maximum already at 5 hr, attaining a level twice as much as the GTP contents of the control. 3. The role of guanosine nucleotide pool in riboflavin formation was further examined using 8-azaguanine. In this experiment the drug was added to the suspension of non-growing cells at 3 hr or 6 hr after the incubation was started and the reaction was continued till the 12th hr. A more clear-cut correlationship between riboflavin formation and guanosine nucleotide pool was oberved by this experiment. The guanosine nucleotide pool (consisting of GMP, GDP and GTP) increased simultaneously with the inhibition of riboflavin formation. Of the guanosine nucleotides pools, the GMP pool increased 2.7 times above normal upon the addition of 8-azaguanine during the incubation for 6 hr and 5.3 fold for 9 hr. While, the GTP pool increased 1.9 fold above

  8. Affinity of guanosine derivatives for polycytidylate revisited

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Hurley, T. B.; Baird, E. E.

    1995-01-01

    Evidence is presented for complexation of guanosine 5'-monophosphate 2-methylimidazolide (2-MeImpG) with polycytidylate (poly(C)) at pH 8.0 and 23 degrees C in the presence of 1.0 M NaCl2 and 0.2 M MgCl2 in water. The association of 2-MeImpG with poly(C) was investigated using UV-vis spectroscopy as well as by monitoring the kinetics of the nucleophilic substitution reaction of the imidazole moiety by amines. The results of both methods are consistent with moderately strong poly(C) 2-MeImpG complexation and the spectrophotometric measurements allowed the construction of a binding isotherm with a concentration of 2-MeImpG equal to 5.55 +/- 0.15 mM at half occupancy. UV spectroscopy was employed to establish the binding of other guanosine derivatives on poly(C). These derivatives are guanosine 5'-monophosphate (5'GMP), guanosine 5'-monophosphate imidazolide (ImpG), and guanosine 5'-monophosphate morpholidate (morpG). Within experimental error these guanosine derivatives exhibit the same affinity for poly(C) as 2-MeImpG.

  9. A broadly applicable continuous spectrophotometric assay for measuring aminoacyl-tRNA synthetase activity.

    PubMed Central

    Lloyd, A J; Thomann, H U; Ibba, M; Söll, D

    1995-01-01

    We describe a convenient, simple and novel continuous spectrophotometric method for the determination of aminoacyl-tRNA synthetase activity. The assay relies upon the measurement of inorganic pyrophosphate generated in the first step of the aminoacylation of a tRNA. Pyrophosphate release is coupled to inorganic pyrophosphatase, to generate phosphate, which in turn is used as the substrate of purine nucleoside phosphorylase to catalyze the N-glycosidic cleavage of 2-amino 6-mercapto 7-methylpurine ribonucleoside. Of the reaction products, ribose 1-phosphate and 2-amino 6-mercapto 7-methylpurine, the latter has a high absorbance at 360 nm relative to the nucleoside and hence provides a spectrophotometric signal that can be continuously followed. The non-destructive nature of the spectrophotometric assay allowed the re-use of the tRNAs in question in successive experiments. The usefulness of this method was demonstrated for glutaminyl-tRNA synthetase (GlnRS) and tryptophanyl-tRNA synthetase. Initial velocities measured using this assay correlate closely with those assayed by quantitation of [3H]Gln-tRNA or [14C]Trp-tRNA formation respectively. In both cases amino acid transfer from the aminoacyl adenylate to the tRNA represents the rate determining step. In addition, aminoacyl adenylate formation by aspartyl-tRNA synthetase was followed and provided a more sensitive means of active site titration than existing techniques. Finally, this novel method was used to provide direct evidence for the cooperativity of tRNA and ATP binding to GlnRS. PMID:7659511

  10. 2'-Modified Guanosine Analogs for the Treatment of HCV.

    PubMed

    Girijavallabhan, Vinay; Arasappan, Ashok; Bennett, Frank; Chen, Kevin; Dang, Qun; Huang, Ying; Kerekes, Angela; Nair, Latha; Pissarnitski, Dmitri; Verma, Vishal; Alvarez, Carmen; Chen, Ping; Cole, David; Esposite, Sara; Huang, Yuhua; Hong, Qingmei; Liu, Zhidan; Pan, Weidong; Pu, Haiyan; Rossman, Randall; Truong, Quang; Vibulbhan, Bancha; Wang, Jun; Zhao, Zhiqiang; Olsen, David; Stamford, Andrew; Bogen, Stephane; Njoroge, F George

    2016-06-01

    Novel 2'-modified guanosine nucleosides were synthesized from inexpensive starting materials in 7-10 steps via hydroazidation or hydrocyanation reactions of the corresponding 2'-olefin. The antiviral effectiveness of the guanosine nucleosides was evaluated by converting them to the corresponding 5'-O-triphosphates (compounds 38-44) and testing their biochemical inhibitory activity against the wild-type NS5B polymerase. PMID:27104963

  11. Injection of guanosine and adenosine nucleotides into Limulus ventral photoreceptor cells

    PubMed Central

    Bolsover, S. R.; Brown, J. E.

    1982-01-01

    1. Several nucleotide and nucleotide analogues had striking effects when pressure-injected into Limulus ventral photoreceptor cells. The poorly hydrolysable GTP analogues guanosine 5′-0-(3-thiotriphosphate) (GTPγS), guanylyl imidodiphosphate (Gpp[NH]p) and guanylyl (β, γ methylene) diphosphonate (Gpp[CH2]p) produced large increases in the frequency of `discrete events' that were recorded from photoreceptors in darkness. This effect was only observed after the injected cell was exposed to light. Injection of the ATP analogue ATPγS had effects similar to those of the GTP analogues. 2. We conclude that GTPγS, Gpp[NH]p, Gpp[CH2]p and ATPγS act at a common site to cause a light-dependent, long-term activation of the excitation mechanism of the photoreceptor. 3. Injection of GTP or GDP at pH 4.8 was followed by a smooth, transient depolarization that was observed neither when GTP at pH 7.5 was injected nor when ATP, 5′GMP or 2-[N-morpholino] ethane sulphonic acid (MES) were injected at pH 4.8. The reversal potential of the current induced by GTP injection was significantly more positive than the reversal potential of the light-induced current. 4. We conclude that GTP injection induces changes of membrane conductance either in addition to, or different from, the light-induced change of membrane conductance. 5. Injection of the ATP analogue adenylyl imidodiphosphate (App[NH]p), and the pyrophosphate analogue imidodiphosphate (p[NH]p) produced a drastic decrease in the sensitivity of photoreceptors to light. This decrease in sensitivity was partially reversed when the concentration of calcium ions in the bathing medium was reduced. 6. We suggest that App[NH]p and p[NH]p injections act by increasing the cytoplasmic concentration of calcium ions. PMID:7153930

  12. The roles of initiation factor 2 and guanosine triphosphate in initiation of protein synthesis

    PubMed Central

    Antoun, Ayman; Pavlov, Michael Y.; Andersson, Kerstin; Tenson, Tanel; Ehrenberg, Måns

    2003-01-01

    The role of IF2 from Escherichia coli was studied in vitro using a system for protein synthesis with purified components. Stopped flow experiments with light scattering show that IF2 in complex with guanosine triphosphate (GTP) or a non-cleavable GTP analogue (GDPNP), but not with guanosine diphosphate (GDP), promotes fast association of ribosomal subunits during initiation. Biochemical experiments show that IF2 promotes fast formation of the first peptide bond in the presence of GTP, but not GDPNP or GDP, and that IF2–GDPNP binds strongly to post-initiation ribosomes. We conclude that the GTP form of IF2 accelerates formation of the 70S ribosome from subunits and that GTP hydrolysis accelerates release of IF2 from the 70S ribosome. The results of a recent report, suggesting that GTP and GDP promote initiation equally fast, have been addressed. Our data, indicating that eIF5B and IF2 have similar functions, are used to rationalize the phenotypes of GTPase-deficient mutants of eIF5B and IF2. PMID:14532131

  13. Guanosine Protects Against Cortical Focal Ischemia. Involvement of Inflammatory Response.

    PubMed

    Hansel, Gisele; Tonon, André Comiran; Guella, Felipe Lhywinskh; Pettenuzzo, Letícia Ferreira; Duarte, Thiago; Duarte, Marta Maria Medeiros Frescura; Oses, Jean Pierre; Achaval, Matilde; Souza, Diogo Onofre

    2015-12-01

    Stroke is the major cause of death and the most frequent cause of disability in the adult population worldwide. Guanosine plays an important neuroprotective role in several cerebral ischemic models and is involved in the modulation of oxidative responses and glutamatergic parameters. Because the excessive reactive oxygen species produced during an ischemic event can trigger an inflammatory response, the purpose of this study was to evaluate the hypothesis that guanosine is neuroprotective against focal cerebral ischemia, inhibits microglia/macrophages activation, and mediates an inflammatory response ameliorating the neural damage. Permanent focal cerebral ischemia was induced in adult rats, and guanosine was administered immediately, 1, 3, and 6 h after surgery. Twenty-four hours after ischemia, the asymmetry scores were evaluated by the cylinder test; neuronal damage was evaluated by Fluoro-Jade C (FJC) staining and propidium iodide (PI) incorporation; microglia and immune cells were evaluated by anti-Iba-1 antibody; and inflammatory parameters such as interleukins (IL): IL-1, IL-6, IL-10; tumor necrosis factors alpha (TNF-α); and interferon-gamma (INF-γ) were evaluated in the brain tissue and cerebrospinal fluid. The ischemic event increased the levels of Iba-1-positive cells and pro-inflammatory cytokines and decreased IL-10 levels (an anti-inflammatory cytokine) in the lesion periphery. The guanosine treatment attenuated the changes in these inflammatory parameters and also reduced the infarct volume, PI incorporation, and number of FJC-positive cells, improving the functional recovery. Thus, guanosine may have been a promising therapeutic agent for the treatment of ischemic brain injury by reduction of inflammatory process triggered in an ischemic event. PMID:25394382

  14. Recognition of guanosine by dissimilar tRNA methyltransferases.

    PubMed

    Sakaguchi, Reiko; Giessing, Anders; Dai, Qing; Lahoud, Georges; Liutkeviciute, Zita; Klimasauskas, Saulius; Piccirilli, Joseph; Kirpekar, Finn; Hou, Ya-Ming

    2012-09-01

    Guanosines are important for biological activities through their specific functional groups that are recognized for RNA or protein interactions. One example is recognition of N(1) of G37 in tRNA by S-adenosyl-methionine (AdoMet)-dependent tRNA methyltransferases to synthesize m(1)G37-tRNA, which is essential for translational fidelity in all biological domains. Synthesis of m(1)G37-tRNA is catalyzed by TrmD in bacteria and by Trm5 in eukarya and archaea, using unrelated and dissimilar structural folds. This raises the question of how dissimilar proteins recognize the same guanosine. Here we probe the mechanism of discrimination among functional groups of guanosine by TrmD and Trm5. Guanosine analogs were systematically introduced into tRNA through a combination of chemical and enzymatic synthesis. Single turnover kinetic assays and thermodynamic analysis of the effect of each analog on m(1)G37-tRNA synthesis reveal that TrmD and Trm5 discriminate functional groups differently. While both recognize N(1) and O(6) of G37, TrmD places a much stronger emphasis on these functional groups than Trm5. While the exocyclic 2-amino group of G37 is important for TrmD, it is dispensable for Trm5. In addition, while an adjacent G36 is obligatory for TrmD, it is nonessential for Trm5. These results depict a more rigid requirement of guanosine functional groups for TrmD than for Trm5. However, the sensitivity of both enzymes to analog substitutions, together with an experimental revelation of their low cellular concentrations relative to tRNA substrates, suggests a model in which these enzymes rapidly screen tRNA by direct recognition of G37 in order to monitor the global state of m(1)G37-tRNA. PMID:22847817

  15. Regulation of Phospholipid Synthesis in Escherichia coli by Guanosine Tetraphosphate

    PubMed Central

    Merlie, John P.; Pizer, Lewis I.

    1973-01-01

    Phospholipid synthesis has been reported to be subject to stringent control in Escherichia coli. We present evidence that demonstrates a strict correlation between guanosine tetraphosphate accumulation and inhibition of phospholipid synthesis. In vivo experiments designed to examine the pattern of phospholipid labeling with 32P-inorganic phosphate and 32P-sn-glycerol-3-phosphate suggest that regulation must occur at the glycerol-3-phosphate acyltransferase step. Assay of phospholipid synthesis by cell-free extracts and semipurified preparations revealed that guanosine tetraphosphate inhibits at least two enzymes specific for the biosynthetic pathway, sn-glycerol-3-phosphate acyltransferase as well as sn-glycerol-3-phosphate phosphatidyl transferase. These findings provide a biochemical basis for the stringent control of lipid synthesis as well as regulation of steady-state levels of phospholipid in growing cells. Images PMID:4583220

  16. The role of surface energy in guanosine nucleotide alignment: an intriguing scenario.

    PubMed

    Tone, Caterina M; De Santo, Maria P; Ciuchi, Federica

    2014-07-01

    In this paper we report how the confining surfaces and the ionic effects of different concentration of guanosine solution can be used to vary the alignment of liquid crystal phases of guanosine nucleotides. Liquid crystal phases of guanosine 5'-monophosphate ammonium salt and guanosine 5'-monophosphate free acid in pure water, with and without silver sulphate, were studied by polarized optical microscope. A periodic modulation of the texture was observed. This modulation depends on both on the concentration and on the presence of silver ions in the liquid crystal phase. We demonstrate that, according to the surface energy of the alignment layers, it is possible to homeotropically align the guanosine chromonic phase without applying any external magnetic field. Finally, we report the formation of spherical, vesicle-like guanosine 5'-monophosphate aggregates, when the solution was confined between two hydrophobic surfaces containing exposed Si groups. PMID:24832053

  17. PRODUCTION OF EXTRACELLULAR GUANOSINE-5'-MONOPHOSPHATE BY BACILLUS SUBTILIS

    PubMed Central

    Demain, A. L.; Miller, I. M.; Hendlin, D.

    1964-01-01

    Demain, A. L. (Merck Sharp & Dohme Research Laboratories, Rahway, N.J.), I. M. Miller, and D. Hendlin. Production of extracellular guanosine-5'-monophosphate by Bacillus subtilis. J. Bacteriol. 88:991–995. 1964.—Wild-type Bacillus subtilis colonies were found to feed purineless mutants. A strain with high feeding capacity was selected for study, with a guanineless mutant of B. subtilis used as the assay organism. The factor was excreted during its growth phase in a complex medium containing starch and soybean meal extract. Nutritional studies led to the development of a defined medium to be used for biochemical studies and to aid in the isolation of the factor. Starch was replaced by maltose and the soybean meal extract by Mn++. Production of the factor was sensitive to the pH of the medium during growth. Practically its entire extracellular accumulation occurred before visible lysis. The factor was identified as guanosine-5'-monophosphate derived by extracellular enzymatic hydrolysis of excreted ribonucleic acid. PMID:14219064

  18. Mechanisms involved in the antinociception induced by systemic administration of guanosine in mice

    PubMed Central

    Schmidt, AP; Böhmer, AE; Schallenberger, C; Antunes, C; Tavares, RG; Wofchuk, ST; Elisabetsky, E; Souza, DO

    2010-01-01

    Background and purpose: It is well known that adenine-based purines exert multiple effects on pain transmission. However, less attention has been given to the potential effects of guanine-based purines on pain transmission. The aim of this study was to investigate the effects of intraperitoneal (i.p.) and oral (p.o.) administration of guanosine on mice pain models. Additionally, investigation into the mechanisms of action of guanosine, its potential toxicity and cerebrospinal fluid (CSF) purine levels were also assessed. Experimental approach: Mice received an i.p. or p.o. administration of vehicle (0.1 mM NaOH) or guanosine (up to 240 mg·kg−1) and were evaluated in several pain models. Key results: Guanosine produced dose-dependent antinociceptive effects in the hot-plate, glutamate, capsaicin, formalin and acetic acid models, but it was ineffective in the tail-flick test. Additionally, guanosine produced a significant inhibition of biting behaviour induced by i.t. injection of glutamate, AMPA, kainate and trans-ACPD, but not against NMDA, substance P or capsaicin. The antinociceptive effects of guanosine were prevented by selective and non-selective adenosine receptor antagonists. Systemic administration of guanosine (120 mg·kg−1) induced an approximately sevenfold increase on CSF guanosine levels. Guanosine prevented the increase on spinal cord glutamate uptake induced by intraplantar capsaicin. Conclusions and implications: This study provides new evidence on the mechanism of action of the antinociceptive effects after systemic administration of guanosine. These effects seem to be related to the modulation of adenosine A1 and A2A receptors and non-NMDA glutamate receptors. PMID:20132210

  19. DNAzyme-mediated catalysis with only guanosine and cytidine nucleotides

    PubMed Central

    Schlosser, Kenny; Li, Yingfu

    2009-01-01

    Single-stranded DNA molecules have the capacity to adopt catalytically active structures known as DNAzymes, although the fundamental limits of this ability have not been determined. Starting with a parent DNAzyme composed of all four types of standard nucleotides, we conducted a search of the surrounding sequence space to identify functional derivatives with catalytic cores composed of only three, and subsequently only two types of nucleotides. We provide the first report of a DNAzyme that contains only guanosine and cytidine deoxyribonucleotides in its catalytic domain, which consists of just 13 nucleotides. This DNAzyme catalyzes the Mn2+-dependent cleavage of an RNA phosphodiester bond ∼5300-fold faster than the corresponding uncatalyzed reaction, but ∼10 000-fold slower than the parent. The demonstration of a catalytic DNA molecule made from a binary nucleotide alphabet broadens our understanding of the fundamental limits of nucleic-acid-mediated catalysis. PMID:19050014

  20. Kinetics of the hydrolysis of guanosine 5'-phospho-2-methylimidazolide

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia

    1986-01-01

    The hydrolysis kinetics of guanosine 5'-phospho-2-methylimidazolide (2-MeImpG) in aqueous buffered solutions of various pH's was studied at 75 and 37 C, using spectrophotometric and HPLC techniques. The hydrolysis was found to be very slow even at low pH. At 75 C and pH at or below l.0, two kinetic processes were observed: the more rapid one was attributed to the hydrolysis of the phosphoimidazolide P-N bond; the second, much slower one, was attributed to the cleavage of the glycosidic bond. It is noted that the P-N hydrolysis in phosphoimidazolides is very slow compared to other phosphoramidates, and that this might be one of the reasons why the phosphoimidazolides showed an extraordinary ability to form long oligomers under template-directed conditions.

  1. Nucleotides as nucleophiles: reactions of nucleotides with phosphoimidazolide activated guanosine

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Rosenbach, M. T.; Hurley, T. B.

    1991-01-01

    An earlier study of the reaction of phosphoimidazolide activated nucleosides (ImpN) in aqueous phosphate buffers indicated two modes of reaction of the phosphate monoanion and dianion. The first mode is catalysis of the hydrolysis of the P-N bond in ImpN's which leads to imidazole and nucleoside 5'-monophosphate. The second represents a nucleophilic substitution of the imidazole to yield the nucleoside 5'-diphosphate. This earlier study thus served as a model for the reaction of ImpN with nucleoside monophosphates (pN) because the latter can be regarded as phosphate derivatives. In the present study we investigated the reaction of guanosine 5'-phosphate-2-methylimidazolide, 2-MeImpG, in the presence of pN (N = guanosine, adenosine and uridine) in the range 6.9 less than or equal to pH less than or equal to 7.7. We observed that pN's do act as nucleophiles to form NppG, and as general base to enhance the hydrolysis of the P-N bond in 2-MeImpG, i.e. pN show the same behavior as inorganic phosphate. The kinetic analysis yields the following rate constants for the dianion pN2-: knpN = 0.17 +/- 0.02 M-1 h-1 for nucleophilic attack and khpN = 0.11 +/- 0.07 M-1 h-1 for general base catalysis of the hydrolysis. These rate constants which are independent of the nucleobase compare with kp.2 = 0.415 M-1 h-1 and khp2. = 0.217 M-1 h-1 for the reactions of HPO4(2-). In addition, this study shows that under conditions where pN presumably form stacks, the reaction mechanism remains unchanged although in quantitative terms stacked pN are somewhat less reactive. Attack by the 2'-OH and 3'-OH groups of the ribose moiety in amounts greater than or equal to 1% is not observed; this is attributed to the large difference in nucleophilicity in the neutral pH range between the phosphate group and the ribose hydroxyls. This nucleophilicity rank is not altered by stacking.

  2. Nitric oxide and cyclic guanosine monophosphate signaling in the eye.

    PubMed

    Murad, Ferid

    2008-06-01

    This brief review describes the components and pathways utilized in nitric oxide (NO) and cyclic guanosine monophosphate (cGMP) signaling. Since the discovery of the effects of NO and cGMP on smooth muscle relaxation about 30 years ago, the field has expanded in many directions such that many, but not all, biochemical and biological effects seem to be regulated by these unique signaling molecules. While many of the effects of NO are due to activation of soluble guanylyl cyclase (sGC) that can be considered the receptor for NO, cGMP, in turn, can activate a cGMP-dependent protein kinase (PKG) to phosphorylate an array of proteins. Some of the effects of cGMP can be independent of PKG and are due to effects on ion channels or cyclic nucleotide phosphodiesterases. Also, some of the effects of NO can be independent of sGC activation. The isoenzymes and macromolecules that participate in these signaling pathways can serve as molecular targets to identify compounds that increase or decrease their activation and thus serve as chemical leads for discovering novel drugs for a variety of diseases. Some examples are given. However, with about 90,000 publications in the field since our first reports in 1977, this brief review can only give the readers a sample of the excitement and opportunities we have found in this cell signaling system. PMID:18443613

  3. Ag(+)-mediated assembly of 5'-guanosine monophosphate.

    PubMed

    Loo, Kristine; Degtyareva, Natalya; Park, Jihae; Sengupta, Bidisha; Reddish, Michaeal; Rogers, Christopher C; Bryant, Andrea; Petty, Jeffrey T

    2010-04-01

    Polymorphic forms of nucleic acids provide platforms for new nanomaterials, and transition metal cations give access to alternative arrangements of nucleobases by coordinating with electron-rich functional groups. Interaction of Ag(+) with 5'-guanosine monophosphate (5'-GMP) is considered in this work. Ag(+) promotes nucleotide stacking and aggregation, as indicated by the increased viscosity of 5'-GMP solutions with Ag(+), magnification of the circular dichroism response of guanine by Ag(+), and exothermic reactions between Ag(+) and guanine derivatives. Isothermal titration calorimetry studies show that the reaction is favored starting at 10 microM 5'-GMP. Utilizing the exothermic heat change associated with reaction of Ag(+) with 5'-GMP, local structure within the aggregate was assessed. On the basis of the salt dependence of the reaction and comparison with the corresponding nucleoside, the dianionic phosphate of 5'-GMP is one binding site for Ag(+), although this electrostatic interaction is not a dominant contribution to the overall heat change. Another binding site is the N7 on the nucleobase, as determined via studies with 7-deazaguanosine. Besides this binding site, Ag(+) also associates with the O6, as earlier studies deduced from the shift in the carbonyl stretching frequency associated with adduct formation. With these two binding sites on the nucleobase, the empirical stoichiometry of approximately 1 Ag(+):nucleobase derived from the calorimetry studies indicates that Ag(+) coordinates two nucleobases. The proposed structural model is a Ag(+)-mediated guanine dimer within a base stacked aggregate. PMID:20205377

  4. Guanosine potentiates the antiproliferative effect of cytosine-beta-D-arabinofuranoside in melanoma cell lines.

    PubMed

    Sidi, Y; Panet, C; Cyjon, A; Fenig, E; Beery, E; Nordenberg, J

    1993-01-01

    Guanosine is shown to potentiate markedly the antiproliferative effect of cytosine-beta-D-arabinoside (ara-C) on B16 F10 mouse and SKMEL-28 human melanoma cell lines. Several metabolic consequences of the synergistic interaction between ara-C and guanosine on cell growth were determined in B16 F10 mouse melanoma cells. Treatment of the cells with guanosine for 24 hr resulted in an increase in the percentage of cells in the S phase of the cell cycle, a threefold increase in intracellular GTP concentration, and an increase in the incorporation of ara-C into acid-insoluble material and phosphorylated metabolites. These findings suggest that guanosine potentiates the growth-inhibitory effect of ara-C in B16 F10 melanoma cells by increasing the intracellular concentration of its active metabolites. PMID:8402221

  5. Tissue distribution and metabolism of guanosine in rats following intraperitoneal injection.

    PubMed

    Giuliani, P; Ballerini, P; Ciccarelli, R; Buccella, S; Romano, S; D'Alimonte, I; D' Alimonte, I; Poli, A; Beraudi, A; Peña, E; Jiang, S; Rathbone, M P; Caciagli, F; Di Iorio, P

    2012-01-01

    Guanosine has long been known as an endogenous purine nucleoside deeply involved in the modulation of several intracellular processes, especially G-protein activity. More recently, it has been reported to act as an extracellular signaling molecule released from neurons and, more markedly, from astrocytes either in basal conditions or after different kinds of stimulation including hypoxia. Moreover, in vivo studies have shown that guanosine plays an important role as both a neuroprotective and neurotrophic agent in the central nervous system. Specific high-affinity binding sites for this nucleoside have been found on membrane preparations from rat brain. The present study was undertaken to investigate the distribution and metabolic profiles of guanosine after administering the nucleoside to gain a better understanding of the biological effects of this potential drug candidate. Rats were given an intraperitonal (i.p.) injection of 2, 4, 8 or 16 mg/kg of guanosine combined with 0.05% of [3H]guanosine. Plasma samples were collected 7.5, 15, 30, 60 and 90 min after the guanosine-mixture administration and analyzed by either a liquid scintillation counter or by HPLC connected to a UV and to an on-line radiochemical detector to measure the levels of guanosine and its metabolic products guanine, xanthine and uric acid. The levels of guanosine, guanine and xanthine were also measured in brain, lung, heart, kidney and liver tissue homogenates at the defined time points after the injection of 8 mg/kg of the guanosine-mixture. We found that the levels of radioactivity in plasma increased linearly in a dose- and time-dependent manner. Guanosine was widely distributed in all tissues examined in the present study, at almost twice its usual levels. In addition, guanine levels dramatically increased in all the organs. Interestingly, enzymatic analysis of the plasma samples showed the presence of a soluble purine nucleoside phosphorylase, a key enzyme in the purine salvage pathway

  6. Determination of phosphate in soil extracts in the field: A green chemistry enzymatic method.

    PubMed

    Campbell, Ellen R; Warsko, Kayla; Davidson, Anna-Marie; Bill Campbell, Wilbur H

    2015-01-01

    Measurement of ortho-phosphate in soil extracts usually involves sending dried samples of soil to a laboratory for analysis and waiting several weeks for the results. Phosphate determination methods often involve use of strong acids, heavy metals, and organic dyes. To overcome limitations of this approach, we have developed a phosphate determination method which can be carried out in the field to obtain results on the spot. This new method uses: •Small volumes.•An enzymatic reaction.•Green chemistry. First, the soil sample is extracted with deionized water and filtered. Next, an aliquot of the soil extract (0.5 mL) is transferred to a disposable cuvette, containing 0.5 mL of reaction mixture [200 mM HEPES, pH 7.6, 20 mM MgCl2, with 80 nmol 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG) and 1 unit of recombinant purine nucleoside phosphorylase (PNP; EC 2.4.2.1)], mixed, and incubated for 10 min at field temperature. Absorbance of the completed reaction is measured at 360 nm in open-source, portable photometer linked by bluetooth to a smartphone. The phosphate and phosphorus content of the soil is determined by comparison of its absorbance at 360 nm to a previously prepared standard phosphate curve, which is stored in the smartphone app. PMID:26150991

  7. Determination of phosphate in soil extracts in the field: A green chemistry enzymatic method

    PubMed Central

    Campbell, Ellen R.; Warsko, Kayla; Davidson, Anna-Marie; (Bill) Campbell, Wilbur H.

    2015-01-01

    Measurement of ortho-phosphate in soil extracts usually involves sending dried samples of soil to a laboratory for analysis and waiting several weeks for the results. Phosphate determination methods often involve use of strong acids, heavy metals, and organic dyes. To overcome limitations of this approach, we have developed a phosphate determination method which can be carried out in the field to obtain results on the spot. This new method uses: • Small volumes. • An enzymatic reaction. • Green chemistry. First, the soil sample is extracted with deionized water and filtered. Next, an aliquot of the soil extract (0.5 mL) is transferred to a disposable cuvette, containing 0.5 mL of reaction mixture [200 mM HEPES, pH 7.6, 20 mM MgCl2, with 80 nmol 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG) and 1 unit of recombinant purine nucleoside phosphorylase (PNP; EC 2.4.2.1)], mixed, and incubated for 10 min at field temperature. Absorbance of the completed reaction is measured at 360 nm in open-source, portable photometer linked by bluetooth to a smartphone. The phosphate and phosphorus content of the soil is determined by comparison of its absorbance at 360 nm to a previously prepared standard phosphate curve, which is stored in the smartphone app. PMID:26150991

  8. Guanosine protects glial cells against 6-hydroxydopamine toxicity.

    PubMed

    Giuliani, Patricia; Ballerini, Patrizia; Buccella, Silvana; Ciccarelli, Renata; Rathbone, Michel P; Romano, Silvia; D'Alimonte, Iolanda; Caciagli, Francesco; Di Iorio, Patrizia; Pokorski, Mieczyslaw

    2015-01-01

    Increasing body of evidence indicates that neuron-neuroglia interaction may play a key role in determining the progression of neurodegenerative diseases including Parkinson's disease (PD), a chronic pathological condition characterized by selective loss of dopaminergic (DA) neurons in the substantia nigra. We have previously reported that guanosine (GUO) antagonizes MPP(+)-induced cytotoxicity in neuroblastoma cells and exerts neuroprotective effects against 6-hydroxydopamine (6-OHDA) and beta-amyloid-induced apoptosis of SH-SY5Y cells. In the present study we demonstrate that GUO protected C6 glioma cells, taken as a model system for astrocytes, from 6-OHDA-induced neurotoxicity. We show that GUO, either alone or in combination with 6-OHDA activated the cell survival pathways ERK and PI3K/Akt. The involvement of these signaling systems in the mechanism of the nucleoside action was strengthened by a reduction of the protective effect when glial cells were pretreated with U0126 or LY294002, the specific inhibitors of MEK1/2 and PI3K, respectively. Since the protective effect on glial cell death of GUO was not affected by pretreatment with a cocktail of nucleoside transporter blockers, GUO transport and its intracellular accumulation were not at play in our in vitro model of PD. This fits well with our data which pointed to the presence of specific binding sites for GUO on rat brain membranes. On the whole, the results described in the present study, along with our recent evidence showing that GUO when administered to rats via intraperitoneal injection is able to reach the brain and with previous data indicating that it stimulates the release of neurotrophic factors, suggest that GUO, a natural compound, by acting at the glial level could be a promising agent to be tested against neurodegeneration. PMID:25310956

  9. Indolyl-3-butyric acid-induced Arabidopsis stomatal opening mediated by 3',5'-cyclic guanosine-monophosphate.

    PubMed

    Cousson, A

    2010-12-01

    It has been pharmacologically suggested that 3',5'-cyclic guanosine-monophosphate (cGMP) mediates indolyl-3-butyric acid (IBA)-induced stomatal opening. In Arabidopsis thaliana (L.) Heynh., such investigations compared the wild type (Columbia and Ws ecotypes) to mutants knockout for either GTP-binding protein (G protein) α subunit 1 (gpa1-4), putative G protein-coupled receptor 1 (gcr1-5), calcineurin B-like isoform 1 (cbl1) or 9 (cbl9), or the NADPH oxidases AtrbohD and AtrbohF (atrbohD/F). Stomatal opening to IBA or the permeant cGMP analogue, 8-bromo-cGMP (8-Br-cGMP) was abolished in the atrbohD/F mutant. The IBA response was fully or partially suppressed, respectively, in the gcr1-5 mutant, or the gpa1-4 and cbl1 mutants. In the cbl9 mutant, the response to IBA or 8-Br-cGMP, respectively, was partially or fully suppressed. Phenylarsine oxide (PAO) affected the IBA response, which the cbl1 mutant overlapped or the gpa1-4 and cbl9 mutants increased up to 100% inhibition. 6-anilino-5,8-quinolinedione, mas17, the (Rp)-diastereomer of 8-bromo-3',5'-cyclic guanosine monophosphorothioate (Rp-8-Br-cGMPS), nicotinamide, ruthenium red (RRed), 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA), cyclosporine A (CsA) and FK506 converged to affect the IBA response, which the gpa1-4 and cbl9 mutants overlapped or the cbl1 mutant and PAO increased up to 100% inhibition. Rp-8-Br-cGMPS, nicotinamide, RRed, BAPTA, CsA or FK506 paralled the cbl9 and atrbohD/F mutants to abolish the 8-Br-cGMP response. Based on so far revealed features of these mutants and pharmacological compounds, these results confirmed cGMP as a Ca(2+)-mobilizing second messenger for apoplastic auxin whose perception and transduction would implicate a seven-transmembrane receptor - G protein - guanylyl cyclase unit at the guard cell plasma membrane. PMID:20951600

  10. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. II - Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1992-01-01

    Hairpin oligonucleotides were prepared with 5-prime-terminal single-stranded sequments containing cytidylate (C) and guanylate (G) residues. It was found that incubation of these hairpin oligonucleotides with a mixutre of cytidine and guanosine 5-prime-phosphoro (2-methyl)imidazolides results in sequence-specific addition of C and G residues to the 3-prime terminus of the hairpin.

  11. Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases

    PubMed Central

    Michalowski, Daniel; Chitima-Matsiga, Rebecca; Held, Daniel M.; Burke, Donald H.

    2008-01-01

    DNA aptamers RT5, RT6 and RT47 form a group of related sequences that inhibit HIV-1 reverse transcriptase (RT). The essential inhibitory structure is identified here as bimodular, with a 5′ stem–loop module physically connected to a 3′-guanosine quadruplex module. The stem–loop tolerates considerable sequence plasticity. Connections between the guanosine triplets in the quadruplex could be simplified to a single nucleotide or a nonnucleic acid linker, such as hexaethylene glycol. All 12 quadruplex guanosines are required in an aptamer retaining most of the original loop sequence from RT6; only 11 are required for aptamer R1T (single T residue in intra-quadruplex loops). Circular dichroism (CD) spectroscopy gave ellipticity minima and maxima at 240 nm and 264 nm, indicating a parallel arrangement of the quadruplex strands. The simplified aptamers displayed increased overall stability. An aptamer carrying the original intra-quadruplex loops from RT6 inhibited RT in K+ buffers but not in Na+ buffers and displayed significant CD spectral broadening in Na+ buffers, while R1T inhibited RT in both buffers and displayed less broadening in Na+ buffers. The bimodular ssDNA aptamers inhibited RT from diverse primate lentiviruses with low nM IC50 values. These data provide insight into the requirements for broad-spectrum RT inhibition by nucleic acid aptamers. PMID:18996899

  12. Voltammetric determination of adenosine and guanosine using fullerene-C(60)-modified glassy carbon electrode.

    PubMed

    Goyal, Rajendra N; Gupta, Vinod K; Oyama, Munetaka; Bachheti, Neeta

    2007-02-28

    A fullerene-C(60)-modified glassy carbon electrode (GCE) is used for the simultaneous determination of adenosine and guanosine by differential pulse voltammetry. Compared to a bare glassy carbon electrode, the modified electrode exhibits an apparent shift of the oxidation potentials in the cathodic direction and a marked enhancement in the voltammetric peak current response for both the biomolecules. Linear calibration curves are obtained over the concentration range 0.5muM-1.0mM in 0.1M phosphate buffer solution at pH 7.2 with a detection limit of 3.02x10(-7)M and 1.45x10(-7)M for individual determination of adenosine and guanosine, respectively. The interference studies showed that the fullerene-C(60)-modified glassy carbon electrode exhibited excellent selectivity in the presence of hypoxanthine, xanthine, uric acid and ascorbic acid. The proposed procedure was successfully applied to detect adenosine and guanosine in human blood plasma and urine, without any preliminary pre-treatment. PMID:19071420

  13. Guanosine effect on cholesterol efflux and apolipoprotein E expression in astrocytes.

    PubMed

    Ballerini, Patrizia; Ciccarelli, Renata; Di Iorio, Patrizia; Buccella, Silvana; D'Alimonte, Iolanda; Giuliani, Patricia; Masciulli, Arianna; Nargi, Eleonora; Beraudi, Alina; Rathbone, Michel P; Caciagli, Francesco

    2006-11-01

    The main source of cholesterol in the central nervous system (CNS) is represented by glial cells, mainly astrocytes, which also synthesise and secrete apolipoproteins, in particular apolipoprotein E (ApoE), the major apolipoprotein in the brain, thus generating cholesterol-rich high density lipoproteins (HDLs). This cholesterol trafficking, even though still poorly known, is considered to play a key role in different aspects of neuronal plasticity and in the stabilisation of synaptic transmission. Moreover, cell cholesterol depletion has recently been linked to a reduction in amyloid beta formation. Here we demonstrate that guanosine, which we previously reported to exert several neuroprotective effects, was able to increase cholesterol efflux from astrocytes and C6 rat glioma cells in the absence of exogenously added acceptors. In this effect the phosphoinositide 3 kinase/extracellular signal-regulated kinase 1/2 (PI3K/ERK1/2) pathway seems to play a pivotal role. Guanosine was also able to increase the expression of ApoE in astrocytes, whereas it did not modify the levels of ATP-binding cassette protein A1 (ABCA1), considered the main cholesterol transporter in the CNS. Given the emerging role of cholesterol balance in neuronal repair, these effects provide evidence for a role of guanosine as a potential pharmacological tool in the modulation of cholesterol homeostasis in the brain. PMID:18404467

  14. Remyelination after chronic spinal cord injury is associated with proliferation of endogenous adult progenitor cells after systemic administration of guanosine.

    PubMed

    Jiang, Shucui; Ballerini, Patrizia; Buccella, Silvana; Giuliani, Patricia; Jiang, Cai; Huang, Xinjie; Rathbone, Michel P

    2008-03-01

    Axonal demyelination is a consistent pathological sequel to chronic brain and spinal cord injuries and disorders that slows or disrupts impulse conduction, causing further functional loss. Since oligodendroglial progenitors are present in the demyelinated areas, failure of remyelination may be due to lack of sufficient proliferation and differentiation of oligodendroglial progenitors. Guanosine stimulates proliferation and differentiation of many types of cells in vitro and exerts neuroprotective effects in the central nervous system (CNS). Five weeks after chronic traumatic spinal cord injury (SCI), when there is no ongoing recovery of function, intraperitoneal administration of guanosine daily for 2 weeks enhanced functional improvement correlated with the increase in myelination in the injured cord. Emphasis was placed on analysis of oligodendrocytes and NG2-positive (NG2+) cells, an endogenous cell population that may be involved in oligodendrocyte replacement. There was an increase in cell proliferation (measured by bromodeoxyuridine staining) that was attributable to an intensification in progenitor cells (NG2+ cells) associated with an increase in mature oligodendrocytes (determined by Rip+ staining). The numbers of astroglia increased at all test times after administration of guanosine whereas microglia only increased in the later stages (14 days). Injected guanosine and its breakdown product guanine accumulated in the spinal cords; there was more guanine than guanosine detected. We conclude that functional improvement and remyelination after systemic administration of guanosine is due to the effect of guanosine/guanine on the proliferation of adult progenitor cells and their maturation into myelin-forming cells. This raises the possibility that administration of guanosine may be useful in the treatment of spinal cord injury or demyelinating diseases such as multiple sclerosis where quiescent oligodendroglial progenitors exist in demyelinated plaques. PMID

  15. Remyelination after chronic spinal cord injury is associated with proliferation of endogenous adult progenitor cells after systemic administration of guanosine

    PubMed Central

    Ballerini, Patrizia; Buccella, Silvana; Giuliani, Patricia; Jiang, Cai; Huang, Xinjie; Rathbone, Michel P.

    2008-01-01

    Axonal demyelination is a consistent pathological sequel to chronic brain and spinal cord injuries and disorders that slows or disrupts impulse conduction, causing further functional loss. Since oligodendroglial progenitors are present in the demyelinated areas, failure of remyelination may be due to lack of sufficient proliferation and differentiation of oligodendroglial progenitors. Guanosine stimulates proliferation and differentiation of many types of cells in vitro and exerts neuroprotective effects in the central nervous system (CNS). Five weeks after chronic traumatic spinal cord injury (SCI), when there is no ongoing recovery of function, intraperitoneal administration of guanosine daily for 2 weeks enhanced functional improvement correlated with the increase in myelination in the injured cord. Emphasis was placed on analysis of oligodendrocytes and NG2-positive (NG2+) cells, an endogenous cell population that may be involved in oligodendrocyte replacement. There was an increase in cell proliferation (measured by bromodeoxyuridine staining) that was attributable to an intensification in progenitor cells (NG2+ cells) associated with an increase in mature oligodendrocytes (determined by Rip+ staining). The numbers of astroglia increased at all test times after administration of guanosine whereas microglia only increased in the later stages (14 days). Injected guanosine and its breakdown product guanine accumulated in the spinal cords; there was more guanine than guanosine detected. We conclude that functional improvement and remyelination after systemic administration of guanosine is due to the effect of guanosine/guanine on the proliferation of adult progenitor cells and their maturation into myelin-forming cells. This raises the possibility that administration of guanosine may be useful in the treatment of spinal cord injury or demyelinating diseases such as multiple sclerosis where quiescent oligodendroglial progenitors exist in demyelinated plaques

  16. Relationship between antitumor effect and metabolites of 5-fluorouracil in combination treatment with 5-fluorouracil and guanosine in ascites Sarcoma 180 tumor system

    SciTech Connect

    Iigo, M.; Kuretani, K.; Hoshi, A.

    1983-12-01

    The antitumor activity of (6-14C)5-fluorouracil ((6-14C)FUra) against ascites Sarcoma 180 was significantly enhanced by coadministration of guanosine, and slightly by adenosine, but not by cytidine or uridine. In advanced ascites Sarcoma 180, guanosine also enhanced the action of FUra, but adenosine, uridine, and cytidine did not. The potentiation of antitumor activity by guanosine was reversed by addition of cytidine. The antitumor activity of FUra was significantly potentiated when guanosine was administered either 0 to 15 min before or 5 min after FUra. Changes in metabolites of FUra after potentiation by guanosine were investigated. The potentiation of antitumor activity of FUra by guanosine was considered to be due to an increase in incorporation of FUra into FUra-nucleotides and RNA in the tumor cells.

  17. Use of phosphoimidazolide-activated guanosine to investigate the nucleophilicity of spermine and spermidine

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Baird, E. E.; Smith, P. J.

    1995-01-01

    Guanosine 5'-phosphate 2-methylimidazolide (2-MeImpG), a labile phosphoimidazolide analog of guanosine triphosphate, was used to test the reactivity of the natural polyamines (PAs), spermine (spm) and spermidine (spd). The products are the guanosine 5'-phosphate-polyamine derivatives (PA-pG: spd-pG and spm-pG) which are quite stable in the range 4 < pH < 11. Our study is the first of which we are aware that reports on the nucleophilicity of these amines. The main findings are as follows. (i) HPLC analysis of the products indicates the formation of only two of the three possible spd products and only one of the two possible spm products. These results can be explained if only the primary amino groups of the two polyamines are reactive, while the secondary amino groups are rendered unreactive by a steric effect. The reactions of 2-MeImpG and other phosphoimidazolide derivatives of nucleosides (ImpNs) with primary and secondary monoamines support this interpretation (Kanavarioti et al. J. Org. Chem. 1995, 60, 632). (ii) The product ratio of the two spd-pG adducts derived from the primary amino groups varies between 2.40 and 0.71 in the range 6.1 < or equal to pH < or equal to 11.9. Such small variation in the product ratio can only be rationalized by the similar, but not identical, basicity of the two primary amino groups and provides strong support for a previously reported model for polyamine ionization (Onasch et. al. Biophys. Chem. 1984, 19, 245). (iii) On the basis of our kinetic determinations conditions at which the nucleophilicity of these amines is at a minimum and at which other interactions with ImpNs could be tested can be chosen.

  18. Fluorescent Sensing of Guanine and Guanosine Monophosphate with Conjugated Receptors Incorporating Aniline and Naphthyridine Moieties.

    PubMed

    Lu, Shao-Hung; Phang, Riping; Fang, Jim-Min

    2016-04-15

    Ethyne-linked naphthyridine-aniline conjugated molecules are selective sensors of decylguanine in dichloromethane and guanosine monophosphate in water (Kass = 16 000 M(-1)). The 2-acetamido-1,8-naphthyridine moiety binds with guanine in a DAA-ADD triply hydrogen-bonded motif. The aniline moiety enhances an electron-donating effect, and the substituent is tuned to attain extra hydrogen bonds, π-π stacking, and electrostatic interactions. The proposed binding modes are supported by a Job plot, ESI-MS, (1)H NMR, UV-vis, and fluorescence spectral analyses. PMID:27018895

  19. The combination of organoselenium compounds and guanosine prevents glutamate-induced oxidative stress in different regions of rat brains.

    PubMed

    Dalla Corte, Cristiane L; Bastos, Luíza L; Dobrachinski, Fernando; Rocha, João B T; Soares, Félix A A

    2012-01-01

    This study was designed to investigate the protective effects of the combination of guanosine and 2 organoselenium compounds (ebselen and diphenyl diselenide) against glutamate-induced oxidative stress in different regions of rat brains. Glutamate caused an increase in reactive oxygen species (ROS) generation and a decrease in [(3)H]-glutamate uptake in striatal, cortical, and hippocampal slices. Guanosine, ebselen, and diphenyl diselenide prevented glutamate-induced ROS production in striatal, cortical and hippocampal slices. The combination of guanosine with organoselenium compounds was more effective against glutamate-induced ROS production than the individual compounds alone. Guanosine prevented [(3)H]-glutamate uptake inhibition in striatal, cortical, and hippocampal slices. Thus, protection against the harmful effects of glutamate is possibly due to the combination of the antioxidant properties of organoselenium compounds and the stimulatory effect of guanosine on glutamate uptake. In conclusion, the combination of antioxidants and glutamatergic system modulators could be considered a potential therapy against the prooxidant effects of glutamate. PMID:22133308

  20. Guanosine reduces apoptosis and inflammation associated with restoration of function in rats with acute spinal cord injury

    PubMed Central

    Bendjelloul, Farid; Ballerini, Patrizia; D’Alimonte, Iolanda; Nargi, Elenora; Jiang, Cai; Huang, Xinjie; Rathbone, Michel P.

    2007-01-01

    Spinal cord injury results in progressive waves of secondary injuries, cascades of noxious pathological mechanisms that substantially exacerbate the primary injury and the resultant permanent functional deficits. Secondary injuries are associated with inflammation, excessive cytokine release, and cell apoptosis. The purine nucleoside guanosine has significant trophic effects and is neuroprotective, antiapoptotic in vitro, and stimulates nerve regeneration. Therefore, we determined whether systemic administration of guanosine could protect rats from some of the secondary effects of spinal cord injury, thereby reducing neurological deficits. Systemic administration of guanosine (8 mg/kg per day, i.p.) for 14 consecutive days, starting 4 h after moderate spinal cord injury in rats, significantly improved not only motor and sensory functions, but also recovery of bladder function. These improvements were associated with reduction in the inflammatory response to injury, reduction of apoptotic cell death, increased sparing of axons, and preservation of myelin. Our data indicate that the therapeutic action of guanosine probably results from reducing inflammation resulting in the protection of axons, oligodendrocytes, and neurons and from inhibiting apoptotic cell death. These data raise the intriguing possibility that guanosine may also be able to reduce secondary pathological events and thus improve functional outcome after traumatic spinal cord injury in humans. PMID:18404454

  1. The Synthesis of Guanosine 5′-Diphosphate l-Fucose from Guanosine 5′-Diphosphate 3,5-d-[3H]Mannose Catalyzed by an Enzyme Extract from Fruits of the Flax

    PubMed Central

    Barber, George A.

    1980-01-01

    An enzyme system from fruits of the flax plant is described that catalyzes the synthesis of the sugar nucleotide guanosine 5′-diphosphate l-fucose from guanosine 5′-diphosphate d-mannose with the intermediate formation of guanosine 5′-diphosphate 4-keto-6-deoxy-d-mannose. Tritium from-[3H]H2O was incorporated into the l-fucose portion of the sugar nucleotide in the course of the reaction, and tritium at the 3,5-carbons of the d-mannose moiety of GDP-d-mannose was exchanged with protons in the medium. These results support a mechanism of synthesis analogous to that proposed for the formation of l-rhamnose and other 6-deoxy sugars. PMID:16661431

  2. A Transition State Analogue for an RNA-Editing Reaction

    PubMed Central

    Haudenschild, Brittany L.; Maydanovych, Olena; Véliz, Eduardo A.; Macbeth, Mark R.; Bass, Brenda L.; Beal, Peter A.

    2007-01-01

    Deamination at C6 of adenosine in RNA catalyzed by the ADAR enzymes generates inosine at the corresponding position. Because inosine is decoded as guanosine during translation, this modification can lead to codon changes in messenger RNA. Hydration of 8-azanebularine across the C6–N1 double bond generates an excellent mimic of the transition state proposed for the hydrolytic deamination reaction catalyzed by ADARs. Here, we report the synthesis of a phosphoramidite of 8-azanebularine and its use in the preparation of RNAs mimicking the secondary structure found at a known editing site in the glutamate receptor B subunit pre-mRNA. The binding properties of analogue-containing RNAs indicate that a tight binding ligand for an ADAR can be generated by incorporation of 8-azanebularine. The observed high-affinity binding is dependent on a functional active site, the presence of one, but not the other, of ADAR2’s two double-stranded RNA-binding motifs (dsRBMs), and the correct placement of the nucleoside analogue into the sequence/structural context of a known editing site. These results advance our understanding of substrate recognition during ADAR-catalyzed RNA editing and are important for structural studies of ADAR· RNA complexes. PMID:15355102

  3. Plant Purine Nucleoside Catabolism Employs a Guanosine Deaminase Required for the Generation of Xanthosine in Arabidopsis[W

    PubMed Central

    Dahncke, Kathleen; Witte, Claus-Peter

    2013-01-01

    Purine nucleotide catabolism is common to most organisms and involves a guanine deaminase to convert guanine to xanthine in animals, invertebrates, and microorganisms. Using metabolomic analysis of mutants, we demonstrate that Arabidopsis thaliana uses an alternative catabolic route employing a highly specific guanosine deaminase (GSDA) not reported from any organism so far. The enzyme is ubiquitously expressed and deaminates exclusively guanosine and 2’-deoxyguanosine but no other aminated purines, pyrimidines, or pterines. GSDA belongs to the cytidine/deoxycytidylate deaminase family of proteins together with a deaminase involved in riboflavin biosynthesis, the chloroplastic tRNA adenosine deaminase Arg and a predicted tRNA-specific adenosine deaminase 2 in A. thaliana. GSDA is conserved in plants, including the moss Physcomitrella patens, but is absent in the algae and outside the plant kingdom. Our data show that xanthosine is exclusively generated through the deamination of guanosine by GSDA in A. thaliana, excluding other possible sources like the dephosphorylation of xanthosine monophosphate. Like the nucleoside hydrolases NUCLEOSIDE HYDROLASE1 (NSH1) and NSH2, GSDA is located in the cytosol, indicating that GMP catabolism to xanthine proceeds in a mostly cytosolic pathway via guanosine and xanthosine. Possible implications for the biosynthetic route of purine alkaloids (caffeine and theobromine) and ureides in other plants are discussed. PMID:24130159

  4. Novel Characteristics of Trypanosoma brucei Guanosine 5'-monophosphate Reductase Distinct from Host Animals

    PubMed Central

    Kimura, Chihiro; Shinohara, Takahiro; Tomiyama, Ai; Imamura, Akira; Kuwamura, Mitsuru; Nishimura, Kazuhiko; Fujimori, Ko; Shuto, Satoshi; Ishibashi, Osamu; Kubata, Bruno Kilunga; Inui, Takashi

    2016-01-01

    The metabolic pathway of purine nucleotides in parasitic protozoa is a potent drug target for treatment of parasitemia. Guanosine 5’-monophosphate reductase (GMPR), which catalyzes the deamination of guanosine 5’-monophosphate (GMP) to inosine 5’-monophosphate (IMP), plays an important role in the interconversion of purine nucleotides to maintain the intracellular balance of their concentration. However, only a few studies on protozoan GMPR have been reported at present. Herein, we identified the GMPR in Trypanosoma brucei, a causative protozoan parasite of African trypanosomiasis, and found that the GMPR proteins were consistently localized to glycosomes in T. brucei bloodstream forms. We characterized its recombinant protein to investigate the enzymatic differences between GMPRs of T. brucei and its host animals. T. brucei GMPR was distinct in having an insertion of a tandem repeat of the cystathionine β-synthase (CBS) domain, which was absent in mammalian and bacterial GMPRs. The recombinant protein of T. brucei GMPR catalyzed the conversion of GMP to IMP in the presence of NADPH, and showed apparent affinities for both GMP and NADPH different from those of its mammalian counterparts. Interestingly, the addition of monovalent cations such as K+ and NH4+ to the enzymatic reaction increased the GMPR activity of T. brucei, whereas none of the mammalian GMPR’s was affected by these cations. The monophosphate form of the purine nucleoside analog ribavirin inhibited T. brucei GMPR activity, though mammalian GMPRs showed no or only a little inhibition by it. These results suggest that the mechanism of the GMPR reaction in T. brucei is distinct from that in the host organisms. Finally, we demonstrated the inhibitory effect of ribavirin on the proliferation of trypanosomes in a dose-dependent manner, suggesting the availability of ribavirin to develop a new therapeutic agent against African trypanosomiasis. PMID:26731263

  5. Aspartame and Its Analogues

    NASA Astrophysics Data System (ADS)

    Pavlova, L. A.; Komarova, T. V.; Davidovich, Yurii A.; Rogozhin, S. V.

    1981-04-01

    The results of studies on the biochemistry of the sweet taste are briefly reviewed. The methods of synthesis of "aspartame" — a sweet dipeptide — are considered, its structural analogues are described, and quantitative estimates are made of the degree of sweetness relative to sucrose. Attention is concentrated mainly on problems of the relation between the structure of the substance and its taste in the series of aspartyl derivatives. The bibliography includes 118 references.

  6. Modulating the Cyclic Guanosine Monophosphate Substrate Selectivity of the Phosphodiesterase 3 Inhibitors by Pyridine, Pyrido[2,3-d]pyrimidine Derivatives and Their Effects upon the Growth of HT-29 Cancer Cell Line

    PubMed Central

    Abadi, Ashraf Hassan; Hany, Marwa Saeed; Elsharif, Shimaa Awadain; Eissa, Amal Abdel Haleem; Gary, Bernard DeWayne; Tinsley, Heather Nicole; Piazza, Gary Anthony

    2016-01-01

    Analogues with the scaffolds of 3-cyano-4-alkoxyphenyl-6-bromoaryl-2-pyridone and 2-amino-3-cyano-4-alkoxyphenyl-6-bromoarylpyridine were synthesized. Cyclization of the 2-amino derivatives with formic acid and formamide gave the corresponding pyrido[2,3-d]pyrimidin-4(3H)-one and the pyrido[2,3-d]pyrimidin-4-amine derivatives, respectively. Active phosphodiesterase 3 (PDE3) inhibitors were identified from each of the four aforementioned scaffolds. This is the first report that pyrido[2,3-d]pyrimidin-4(3H)-one and pyrido[2,3-d]pyrimidin-4-amine derivatives can inhibit PDE3. The analogues with the pyridone and pyrido[2,3-d]pyrimidin-4(3H)-one scaffolds inhibited both cAMP and cyclic guanosine monophosphate (cGMP) hydrolysis by PDE3, while the amine containing scaffolds were more selective for cGMP hydrolysis. This observation may set the base for substrate-selective pharmacological modulation of this important class of drug targets and with less side effects, particularly tachcardia. The dual inhibitors of PDE3 were more potent inhibitor towards the growth of HT-29 cancer cell lines. PMID:23546000

  7. Adenosine/guanosine-3',5'-bis-phosphates as biocompatible and selective Zn2+-ion chelators. Characterization and comparison with adenosine/guanosine-5'-di-phosphate.

    PubMed

    Sayer, Alon Haim; Blum, Eliav; Major, Dan Thomas; Vardi-Kilshtain, Alexandra; Levi Hevroni, Bosmat; Fischer, Bilha

    2015-04-28

    Although involved in various physiological functions, nucleoside bis-phosphate analogues and their metal-ion complexes have been scarcely studied. Hence, here, we explored the solution conformation of 2′-deoxyadenosine- and 2′-deoxyguanosine-3′,5′-bisphosphates, 3 and 4, d(pNp), as well as their Zn(2+)/Mg(2+) binding sites and binding-modes (i.e. inner- vs. outer-sphere coordination), acidity constants, stability constants of their Zn(2+)/Mg(2+) complexes, and their species distribution. Analogues 3 and 4, in solution, adopted a predominant Southern ribose conformer (ca. 84%), gg conformation around C4'-C5' and C5'-O5' bonds, and glycosidic angle in the anti-region (213-270°). (1)H- and (31)P-NMR experiments indicated that Zn(2+)/Mg(2+) ions coordinated to P5' and P3' groups of 3 and 4 but not to N7 nitrogen atom. Analogues 3 and 4 formed ca. 100-fold more stable complexes with Zn(2+)vs. Mg(2+)-ions. Complexes of 3 and 4 with Mg(2+) at physiological pH were formed in minute amounts (11% and 8%, respectively) vs. Zn(2+) complexes (46% and 44%). Stability constants of Zn(2+)/Mg(2+) complexes of analogues 3 and 4 (log KML(M) = 4.65-4.75/2.63-2.79, respectively) were similar to those of the corresponding complexes of ADP and GDP (log KML(M) = 4.72-5.10/2.95-3.16, respectively). Based on the above findings, we hypothesized that the unexpectedly low log K values of Zn(2+)-d(pNp) as compared to Zn(2+)-NDP complexes, are possibly due to formation of outer-sphere coordination in the Zn(2+)-d(pNp) complex vs. inner-sphere in the NDP-Zn(2+) complex, in addition to loss of chelation to N7 nitrogen atom in Zn(2+)-d(pNp). Indeed, explicit solvent molecular dynamics simulations of 1 and 3 for 100 ns supported this hypothesis. PMID:25797179

  8. Structural Analogues of Selfotel.

    PubMed

    Dziuganowska, Zofia A; Ślepokura, Katarzyna; Volle, Jean-Noël; Virieux, David; Pirat, Jean-Luc; Kafarski, Paweł

    2016-06-17

    A small library of phosphonopiperidylcarboxylic acids, analogues of NMDA antagonist selfotel (CGS 19755), was synthesized. First, the series of aromatic esters was obtained via a palladium-catalyzed cross-coupling reaction (Hirao coupling) of dialkyl phosphites with bromopyridinecarboxylates, followed by their hydrolysis. Then, hydrogenation of the resulting phosphonopyridylcarboxylic acids over PtO2 yielded the desired phosphonopiperidylcarboxylic acids. NMR studies indicated that the hydrogenation reaction proceeds predominantly by cis addition. Several compounds were obtained as monocrystal structures. Preliminary biological studies performed on cultures of neurons suggest that the obtained compounds possess promising activity toward NMDA receptors. PMID:27187758

  9. Analogue-to-Digital and Digital-to-Analogue Conversion.

    ERIC Educational Resources Information Center

    Gregory, Martin

    1997-01-01

    Discusses circuits for three-bit and four-bit analogue digital converters and digital analogue converters. These circuits feature slow operating speeds that enable the circuitry to be used to demonstrate the mode of operation using oscilloscopes and signal generators. (DDR)

  10. Oligomerization of activated D- and L-guanosine mononucleotides on templates containing D- and L-deoxycytidylate residues

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Pitsch, S.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1998-01-01

    The oligomerization of activated D- and L- and racemic guanosine-5'-phosphoro-2-methylimidazole on short templates containing D- and L-deoxycytidylate has been studied. Results obtained with D-oligo(dC)s as templates are similar to those previously reported for experiments with a poly(C) template. When one L-dC or two consecutive L-dCs are introduced into a D-template, regiospecific synthesis of 3'-5' oligo(G)s proceeds to the end of the template, but three consecutive L-dCs block synthesis. Alternating D-,L-oligomers do not facilitate oligomerization of the D-, L-, and racemic 2-guanosine-5'-phosphoro-2-methylimidazole. We suggest that once a "predominately D-metabolism" existed, occasional L-residues in a template would not have led to the termination of self-replication.

  11. P2Y2 receptor up-regulation induced by guanosine or UTP in rat brain cultured astrocytes.

    PubMed

    Ballerini, P; Di Iorio, P; Caciagli, F; Rathbone, M P; Jiang, S; Nargi, E; Buccella, S; Giuliani, P; D'Alimonte, I; Fischione, G; Masciulli, A; Romano, S; Ciccarelli, R

    2006-01-01

    Among P2 metabotropic ATP receptors, P2Y2 subtype seems to be peculiar as its upregulation triggers important biological events in different cells types. In non-stimulated cells including astrocytes, P2Y2 receptors are usually expressed at levels lower than P2Y1 sites, however the promoter region of the P2Y2 receptors has not yet been studied and little is known about the mechanisms underlying the regulation of the expression of this ATP receptor. We showed that not only UTP and ATP are the most potent and naturally occurring agonist for P2Y2 sites, but also guanosine induced an up-regulation of astrocyte P2Y2 receptor mRNA evaluated by Northern blot analysis. We also focused our attention on this nucleoside since in our previous studies it was reported to be released by cultured astrocytes and to exert different neuroprotective effects. UTP and guanosine-evoked P2Y2 receptor up-regulation in rat brain cultured astrocytes was linked to an increased P2Y2-mediated intracellular calcium response, thus suggesting an increased P2Y2 activity. Actinomycin D, a RNA polymerase inhibitor, abrogated both UTP and guanosine-mediated P2Y2 up-regulation, thus indicating that de novo transcription was required. The effect of UTP and guanosine was also evaluated in astrocytes pretreated with different inhibitors of signal transduction pathways including ERK, PKC and PKA reported to be involved in the regulation of other cell surface receptor mRNAs. The results show that ERK1-2/MAPK pathway play a key role in the P2Y2 receptor up-regulation mediated by either UTP or guanosine. Moreover, our data suggest that PKA is also involved in guanosine-induced transcriptional activation of P2Y2 mRNA and that increased intracellular calcium levels and PKC activation may also mediate P2Y2 receptor up-regulation triggered by UTP. The extracellular release of ATP under physiological and pathological conditions has been widely studied. On the contrary, little is known about the release of

  12. X-ray characterization of mesophases of human telomeric G-quadruplexes and other DNA analogues

    DOE PAGESBeta

    Yasar, Selcuk; Schimelman, Jacob B.; Aksoyoglu, M. Alphan; Steinmetz, Nicole F.; French, Roger H.; Parsegian, V. Adrian; Podgornik, Rudolf

    2016-06-02

    We report that observed in the folds of guanine-rich oligonucleotides, non-canonical G-quadruplex structures are based on G-quartets formed by hydrogen bonding and cation-coordination of guanosines. In dilute 5'-guanosine monophosphate (GMP) solutions, G-quartets form by the self-assembly of four GMP nucleotides. We use x-ray diffraction to characterize the columnar liquid-crystalline mesophases in concentrated solutions of various model G-quadruplexes. We then probe the transitions between mesophases by varying the PEG solution osmotic pressure, thus mimicking in vivo molecular crowding conditions. Using the GMP-quadruplex, built by the stacking of G-quartets with no covalent linking between them, as the baseline, we report the liquid-crystallinemore » phase behaviors of two other related G-quadruplexes: (i) the intramolecular parallel-stranded G-quadruplex formed by the 22-mer four-repeat human telomeric sequence AG3 (TTAG3)3 and (ii) the intermolecular parallel-stranded G-quadruplex formed by the TG(4)T oligonucleotides. Finally, we compare the mesophases of the G-quadruplexes, under PEG-induced crowding conditions, with the corresponding mesophases of the canonical duplex and triplex DNA analogues.« less

  13. X-ray characterization of mesophases of human telomeric G-quadruplexes and other DNA analogues.

    PubMed

    Yasar, Selcuk; Schimelman, Jacob B; Aksoyoglu, M Alphan; Steinmetz, Nicole F; French, Roger H; Parsegian, V Adrian; Podgornik, Rudolf

    2016-01-01

    Observed in the folds of guanine-rich oligonucleotides, non-canonical G-quadruplex structures are based on G-quartets formed by hydrogen bonding and cation-coordination of guanosines. In dilute 5'-guanosine monophosphate (GMP) solutions, G-quartets form by the self-assembly of four GMP nucleotides. We use x-ray diffraction to characterize the columnar liquid-crystalline mesophases in concentrated solutions of various model G-quadruplexes. We then probe the transitions between mesophases by varying the PEG solution osmotic pressure, thus mimicking in vivo molecular crowding conditions. Using the GMP-quadruplex, built by the stacking of G-quartets with no covalent linking between them, as the baseline, we report the liquid-crystalline phase behaviors of two other related G-quadruplexes: (i) the intramolecular parallel-stranded G-quadruplex formed by the 22-mer four-repeat human telomeric sequence AG3(TTAG3)3 and (ii) the intermolecular parallel-stranded G-quadruplex formed by the TG4T oligonucleotides. Finally, we compare the mesophases of the G-quadruplexes, under PEG-induced crowding conditions, with the corresponding mesophases of the canonical duplex and triplex DNA analogues. PMID:27249961

  14. X-ray characterization of mesophases of human telomeric G-quadruplexes and other DNA analogues

    PubMed Central

    Yasar, Selcuk; Schimelman, Jacob B.; Aksoyoglu, M. Alphan; Steinmetz, Nicole F.; French, Roger H.; Parsegian, V. Adrian; Podgornik, Rudolf

    2016-01-01

    Observed in the folds of guanine-rich oligonucleotides, non-canonical G-quadruplex structures are based on G-quartets formed by hydrogen bonding and cation-coordination of guanosines. In dilute 5′-guanosine monophosphate (GMP) solutions, G-quartets form by the self-assembly of four GMP nucleotides. We use x-ray diffraction to characterize the columnar liquid-crystalline mesophases in concentrated solutions of various model G-quadruplexes. We then probe the transitions between mesophases by varying the PEG solution osmotic pressure, thus mimicking in vivo molecular crowding conditions. Using the GMP-quadruplex, built by the stacking of G-quartets with no covalent linking between them, as the baseline, we report the liquid-crystalline phase behaviors of two other related G-quadruplexes: (i) the intramolecular parallel-stranded G-quadruplex formed by the 22-mer four-repeat human telomeric sequence AG3(TTAG3)3 and (ii) the intermolecular parallel-stranded G-quadruplex formed by the TG4T oligonucleotides. Finally, we compare the mesophases of the G-quadruplexes, under PEG-induced crowding conditions, with the corresponding mesophases of the canonical duplex and triplex DNA analogues. PMID:27249961

  15. X-ray characterization of mesophases of human telomeric G-quadruplexes and other DNA analogues

    NASA Astrophysics Data System (ADS)

    Yasar, Selcuk; Schimelman, Jacob B.; Aksoyoglu, M. Alphan; Steinmetz, Nicole F.; French, Roger H.; Parsegian, V. Adrian; Podgornik, Rudolf

    2016-06-01

    Observed in the folds of guanine-rich oligonucleotides, non-canonical G-quadruplex structures are based on G-quartets formed by hydrogen bonding and cation-coordination of guanosines. In dilute 5‧-guanosine monophosphate (GMP) solutions, G-quartets form by the self-assembly of four GMP nucleotides. We use x-ray diffraction to characterize the columnar liquid-crystalline mesophases in concentrated solutions of various model G-quadruplexes. We then probe the transitions between mesophases by varying the PEG solution osmotic pressure, thus mimicking in vivo molecular crowding conditions. Using the GMP-quadruplex, built by the stacking of G-quartets with no covalent linking between them, as the baseline, we report the liquid-crystalline phase behaviors of two other related G-quadruplexes: (i) the intramolecular parallel-stranded G-quadruplex formed by the 22-mer four-repeat human telomeric sequence AG3(TTAG3)3 and (ii) the intermolecular parallel-stranded G-quadruplex formed by the TG4T oligonucleotides. Finally, we compare the mesophases of the G-quadruplexes, under PEG-induced crowding conditions, with the corresponding mesophases of the canonical duplex and triplex DNA analogues.

  16. Structural basis of thiamine pyrophosphate analogues binding to the eukaryotic riboswitch.

    PubMed

    Thore, Stéphane; Frick, Christian; Ban, Nenad

    2008-07-01

    The thiamine pyrophosphate (TPP)-sensing riboswitch is the only riboswitch found in eukaryotes. In plants, TPP regulates its own production by binding to the 3' untranslated region of the mRNA encoding ThiC, a critical enzyme in thiamine biosynthesis, which promotes the formation of an unstable splicing variant. In order to better understand the molecular basis of TPP-analogue binding to the eukaryotic TPP-responsive riboswitch, we have determined the crystal structures of the Arabidopsis thaliana TPP-riboswitch in complex with oxythiamine pyrophosphate (OTPP) and with the antimicrobial compound pyrithiamine pyrophosphate (PTPP). The OTPP-riboswitch complex reveals that the pyrimidine ring of OTPP is stabilized in its enol form in order to retain key interactions with guanosine 28 of the riboswitch previously observed in the TPP complex. The structure of PTPP in complex with the riboswitch shows that the base moiety of guanosine 60 undergoes a conformational change to cradle the pyridine ring of the PTPP. Structural information from these complexes has implications for the design of novel antimicrobials targeting TPP-sensing riboswitches. PMID:18533652

  17. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. 2. Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, T.; Orgel, L. E.

    1992-01-01

    We have prepared hairpin oligonucleotides in which a 5'-terminal single-stranded segment contains cytidylate (C) and guanylate (G) residues. When these hairpin substrates are incubated with a mixture of cytidine 5'-phosphoro(2-methly)imidazolide (2-MeImpC) and guanosine 5'-phosphoro(2-methyl)imidazolide (2-MeImpG), the 5'-terminal segment acts as a template to facilitate sequence-specific addition of G and C residues to the 3'-terminus of the hairpin. If an isolated G residue is present at the 3'-end of the template strand, it is copied regiospecifically in the presence of 2-MeImpC and 2-MeImpG to give a product containing an isolated C residue linked to its G neighbors by 3'-5'-internucleotide bonds. However, if only 2-MeImpC is present in the reaction mixture, very little reaction occurs. Thus, the presence of 2-MeImpG catalyzes the incorporation of C. If the template strand contains a short sequence of G residues, it is copied in the presence of a mixture of 2-MeImpC and 2-MeImpG. If only 2-MeImpC is present in the reaction mixture, efficient synthesis occurs to give a final product containing one fewer C residue than the number of G residues in the template.

  18. [Cyclic Guanosine Monophosphate as a Mediator in Processes of Stress Signaling Transduction in Higher Plants].

    PubMed

    Dubovskaya, L V; Bakakina, Y S; Volotovski, I D

    2015-01-01

    Currently, biophysical mechanisms of stress signaling transduction became an object of consideration of researchers in connection with the urgent necessity to develop new techniques to enhance the sustainability and productivity of agricultural crops. The development of sensitive methods for the determination of cyclic guanosine monophosphate (cGMP) and comparative analysis of cGMP-dependent events in biological systems has contributed to progress in the understanding of the functioning of cGMP in plant cells. Currently, it is shown that cGMP as a secondary mediator is involved in such vital processes of growth and development of plants as seed germination, cell division, development of chloroplasts, flowering and regulation of stomatal movements. This review summarizes the available data in the literature about the role of cGMP in the responses of plant organisms to the action of stress factors of abiotic and biotic nature and its interaction with other intracellular mediators. With the use of existing ideas about the biophysical mechanisms of stress in plants, the basic elements of cGMP-dependent signal transduction system in a plant cell are considered. PMID:26394467

  19. Guanosine controls inflammatory pathways to afford neuroprotection of hippocampal slices under oxygen and glucose deprivation conditions.

    PubMed

    Dal-Cim, Tharine; Ludka, Fabiana K; Martins, Wagner C; Reginato, Charlise; Parada, Esther; Egea, Javier; López, Manuela G; Tasca, Carla I

    2013-08-01

    Guanosine (GUO) is an endogenous modulator of glutamatergic excitotoxicity and has been shown to promote neuroprotection in in vivo and in vitro models of neurotoxicity. This study was designed to understand the neuroprotective mechanism of GUO against oxidative damage promoted by oxygen/glucose deprivation and reoxygenation (OGD). GUO (100 μM) reduced reactive oxygen species production and prevented mitochondrial membrane depolarization induced by OGD. GUO also exhibited anti-inflammatory actions as inhibition of nuclear factor kappa B activation and reduction of inducible nitric oxide synthase induction induced by OGD. These GUO neuroprotective effects were mediated by adenosine A1 receptor, phosphatidylinositol-3 kinase and MAPK/ERK. Furthermore, GUO recovered the impairment of glutamate uptake caused by OGD, an effect that occurred via a Pertussis toxin-sensitive G-protein-coupled signaling, blockade of adenosine A2A receptors (A2A R), but not via A1 receptor. The modulation of glutamate uptake by GUO also involved MAPK/ERK activation. In conclusion, GUO, by modulating adenosine receptor function and activating MAPK/ERK, affords neuroprotection of hippocampal slices subjected to OGD by a mechanism that implicates the following: (i) prevention of mitochondrial membrane depolarization, (ii) reduction of oxidative stress, (iii) regulation of inflammation by inhibition of nuclear factor kappa B and inducible nitric oxide synthase, and (iv) promoting glutamate uptake. PMID:23713463

  20. A positive entropy change for guanosine binding and for the chemical step in the Tetrahymena ribozyme reaction.

    PubMed

    McConnell, T S; Cech, T R

    1995-03-28

    The ribozyme derived from the group I intron of Tetrahymena thermophila binds an exogenous guanosine nucleotide, which acts as the nucleophile in the sequence-specific cleavage of oligonucleotides. By examining the temperature dependence of the reaction under conditions where Km = Kd, we conclude the following: (1) Guanosine 5'-monophosphate (pG) binds to the closed ribozyme-oligonucleotide substrate complex with a positive entropy change (delta S degree' = +23 eu) and an enthalpy change (delta H degree') close to zero. This is contrary to the expectation that binding would cause increased order (negative delta S degree) and be driven by a negative delta H degree. (2) Inosine and 2-aminopurine riboside, each lacking two hydrogen-bonding moieties relative to guanosine, also bind with a positive entropy value and an unfavorable (positive) delta H degree'. From this result, we suggest that the hydrogen-bonding moieties make an enthalpic contribution to guanosine binding overcoming an intrinsic unfavorable delta H. (3) At 0 degree C, there is equally tight binding of pG in the presence and absence of oligonucleotide substrate bound to the ribozyme. Thus, energetic interactions responsible for the thermodynamic coupling between pG and oligonucleotide substrate binding seen at higher temperatures are indirect. (4) The activation barrier of the chemical step is stabilized by a positive delta S++ (+31 to 39 eu). This stabilization is seen in four reactions using substrates with two different leaving groups in the presence and absence of pG, suggesting that the entropic contribution is inherent to the active site. The positive delta S values for the chemical step and for the binding of pG can be explained by a conformational change or release of water. Thus, although hydrogen bonding contributes to binding of nucleotides to this RNA enzyme as previously thought, it is these other events which produce a positive delta S that provide the energetic driving force for binding

  1. Probing the interplay between the two steps of group I intron splicing: competition of exogenous guanosine with omega G.

    PubMed

    Zarrinkar, P P; Sullenger, B A

    1998-12-22

    One largely unexplored question about group I intron splicing is how the cleavage and ligation steps of the reaction are coordinated. We describe a simple in vitro trans-splicing model system in which both steps take place, including the exchange of ligands in the guanosine-binding site that must occur between the two steps. Using this model system, we show that the switch is accomplished by modulating the relative affinity of the binding site for the two ligands. While the terminal guanosine of the intron (omegaG) and exogenous guanosine compete for binding during the first step of splicing, no competition is apparent during the second step, when omegaG is bound tightly. These results help explain how the ribozyme orchestrates progression through the splicing reaction. In addition to providing a new tool to ask basic questions about RNA catalysis, the trans-splicing model system will also facilitate the development of therapeutically useful group I ribozymes that can repair mutant mRNAs. PMID:9922174

  2. Phosphonate analogues of aminoacyl adenylates.

    PubMed Central

    Southgate, C C; Dixon, H B

    1978-01-01

    Phosphonomethyl analogues of glycyl phosphate and valyl phosphate, i.e. NH2-CHR-CO-CH2-PO(OH)2, were synthesized and esterified with adenosine to give analogues of aminoacyl adenylates. The interaction of these adenylate analogues with valyl-tRNA synthetase from Escherichia coli was studied by fluorescence titration. The analogue of valyl phosphate has an affinity for the enzyme comparable with that of valine, but that of valyl adenylate is bound much less tightly than either valyl adenylate or corresponding derivative of valinol. The affinity of the analogue of glycyl adenylate was too low to be measured. We conclude that this enzyme interacts specifically with both the side chain and the anhydride linkage of the adenylate intermediate. PMID:743207

  3. NASA/ESMD Analogue Mission Plans

    NASA Technical Reports Server (NTRS)

    Hoffman, Stephen J.

    2007-01-01

    A viewgraph presentation exploring Earth and its analogues is shown. The topics include: 1) ESMD Goals for the Use of Earth Analogues; 2) Stakeholders Summary; 3) Issues with Current Analogue Situation; 4) Current state of Analogues; 5) External Implementation Plan (Second Step); 6) Recent Progress in Utilizing Analogues; 7) Website Layout Example-Home Page; 8) Website Layout Example-Analogue Site; 9) Website Layout Example-Analogue Mission; 10) Objectives of ARDIG Analog Initiatives; 11) Future Plans; 12) Example: Cold-Trap Sample Return; 13) Example: Site Characterization Matrix; 14) Integrated Analogue Studies-Prerequisites for Human Exploration; and 15) Rating Scale Definitions.

  4. Measurement of intercolumnar forces between parallel guanosine four-stranded helices.

    PubMed Central

    Mariani, P; Saturni, L

    1996-01-01

    The deoxyguanosine-5'-monophosphate in aqueous solution self-associates into stable structures, which include hexagonal and cholesteric columnar phases. The structural unit is a four-stranded helix, composed of a stacked array of Hoogsteen-bonded guanosine quartets. We have measured by osmotic stress method the force per unit length versus interaxial distance between helices in the hexagonal phase under various ionic conditions. Two contributions have been recognized: the first one is purely electrostatic, is effective at large distances, and shows a strong dependence on the salt concentration of the solution. The second contribution is short range, dominates at interaxial separations smaller than about 30-32 A, and rises steeply as the columns approach each other, preventing the coalescence of the helices. This repulsion has an exponential nature and shows a magnitude and a decay length insensitive to the ionic strength of the medium. Because these features are distinctive of the hydration force detected between phospholipid bilayers or between several linear macromolecules (DNA, polysaccharides, collagen), we conclude that the dominant force experienced by deoxyguanosine helices approaching contact is hydration repulsion. The observed decay length of about 0.7 A has been rationalized to emerge from the coupling between the 3-A decay length of water solvent and the helically ordered structure of the hydrophilic groups on the opposing surfaces. The present results agree with recent measurements, also showing the dependence of the hydration force decay on the structure of interacting surfaces and confirm the correlations between force and structure. Images FIGURE 1 PMID:8744324

  5. Role of Increased Guanosine Triphosphate Cyclohydrolase-1 Expression and Tetrahydrobiopterin Levels upon T Cell Activation

    PubMed Central

    Chen, Wei; Li, Li; Brod, Torben; Saeed, Omar; Thabet, Salim; Jansen, Thomas; Dikalov, Sergey; Weyand, Cornelia; Goronzy, Jorg; Harrison, David G.

    2011-01-01

    Tetrahydrobiopterin (BH4) is an essential co-factor for the nitric-oxide (NO) synthases, and in its absence these enzymes produce superoxide (O2˙̄) rather than NO. The rate-limiting enzyme for BH4 production is guanosine triphosphate cyclohydrolase-1 (GTPCH-1). Because endogenously produced NO affects T cell function, we sought to determine whether antigen stimulation affected T cell GTPCH-1 expression and ultimately BH4 levels. Resting T cells had minimal expression of inducible NOS (NOS2), endothelial NOS (NOS3), and GTPCH-1 protein and nearly undetectable levels of BH4. Anti-CD3 stimulation of T cells robustly stimulated the coordinated expression of NOS2, NOS3, and GTPCH-1 and markedly increased both GTPCH-1 activity and T cell BH4 levels. The newly expressed GTPCH-1 was phosphorylated on serine 72 and pharmacological inhibition of casein kinase II reduced GTPCH-1 phosphorylation and blunted the increase in T cell BH4. Inhibition of GTPCH-1 with diaminohydroxypyrimidine (1 mmol/liter) prevented T cell BH4 accumulation, reduced NO production, and increased T cell O2˙̄ production, due to both NOS2 and NOS3 uncoupling. GTPCH-1 inhibition also promoted TH2 polarization in memory CD4 cells. Ovalbumin immunization of mice transgenic for an ovalbumin receptor (OT-II mice) confirmed a marked increase in T cell BH4 in vivo. These studies identify a previously unidentified consequence of T cell activation, promoting BH4 levels, NO production, and modulating T cell cytokine production. PMID:21343293

  6. Regulation of Escherichia coli aspartate transcarbamylase synthesis by guanosine tetraphosphate and pyrimidine ribonucleoside triphosphates.

    PubMed

    Turnbough, C L

    1983-02-01

    The effects of guanosine tetraphosphate (ppGpp) and pyrimidine ribonucleoside triphosphates on Escherichia coli aspartate transcarbamylase (ATCase) synthesis were examined. To determine the effect of ppGpp, a stringent (relA+) and relaxed (relA) isogenic pair of E. coli K-12 strains was starved for isoleucine, and the residual rate of synthesis of this enzyme was measured. It was necessary to starve the strains for uracil before the isoleucine limitation to maintain similar, low levels of UTP, the putative pyrimidine effector of ATCase synthesis. The isoleucine starvation of the stringent strain caused an immediate 10-fold increase in the intracellular concentration of ppGpp, which was coincident with the cessation of the synthesis of the enzyme. The elevated level of ppGpp then decayed until it reached an intracellular concentration similar to that found in unstarved cells. Enzyme synthesis resumed at this time. In the relaxed strain, the intracellular concentration of ppGpp did not increase upon isoleucine starvation and synthesis of the enzyme was not repressed. These experiments strongly indicated that ppGpp acts as a negative effector of ATCase synthesis. The repression of ATCase synthesis by ppGpp was demonstrated directly by using a Salmonella typhimurium (relA) in vitro coupled transcription-translation system with a lambda specialized transducing phage carrying the E. coli K-12 operon encoding the subunits of this enzyme (pyrBI) as a source of DNA. This in vitro system was also used to measure the effects of UTP and CTP on ATCase synthesis. Increasing the concentration of UTP in the in vitro reaction mixture resulted in strong repression of this synthesis, whereas increasing the CTP concentration did not affect synthesis significantly. Possible mechanisms for the regulation of pyr gene expression, including attenuation control, are discussed. PMID:6337130

  7. Positive control of lac operon expression in vitro by guanosine 5'-diphosphate 3'-diphosphate.

    PubMed

    Primakoff, P; Artz, S W

    1979-04-01

    Maximal expression of the Escherichia coli lactose operon in a coupled in vitro transcription-translation system from a Salmonella typhimurium relA mutant was strongly dependent upon addition of guanosine 5'-diphosphate 3'-diphosphate (ppGpp). Without added ppGpp, at saturating 3',5'-cyclic AMP (cAMP) concentrations, synthesis of beta-galactosidase (beta-D-galactoside galactohydrolase, EC 3.2.1.23) was reproducibly only 5-7% of that which can be obtained with 0.5-0.8 mM ppGpp. Experiments in which transcription was uncoupled from translation indicated that this 14- to 20-fold stimulation by ppGpp occurred at the level of transcription. When coupled beta-galactosidase synthesis was primed with a template containing a well-characterized mutant lac promoter (lacP(r)L8UV5), the dependence on ppGpp was greatly reduced. This result provides an important experimental control previously unavailable for verifying the significance of ppGpp effects on gene regulation in vitro; it indicates that activation of lacP(+) expression by ppGpp is specifically an effect of increased transcription initiations. Furthermore, the large ppGpp stimulation of lacP(+) DNA enabled the level of expression of this template to approach that of lacP(r)L8UV5 DNA, an observation expected from results in vivo but not obtained with other transcription-translation systems in vitro. The importance of these results is considered with respect to previous ideas on the physiological role of ppGpp as a supercontrol molecule in bacterial regulation. PMID:109832

  8. A Cyclic Guanosine Monophosphate–Dependent Pathway Can Regulate Net Hepatic Glucose Uptake in Vivo

    PubMed Central

    An, Zhibo; Winnick, Jason J.; Moore, Mary C.; Farmer, Ben; Smith, Marta; Irimia, Jose M.; Roach, Peter J.; Cherrington, Alan D.

    2012-01-01

    We previously showed that hepatic nitric oxide regulates net hepatic glucose uptake (NHGU), an effect that can be eliminated by inhibiting hepatic soluble guanylate cyclase (sGC), suggesting that the sGC pathway is involved in the regulation of NHGU. The aim of the current study was to determine whether hepatic cyclic guanosine monophosphate (cGMP) reduces NHGU. Studies were performed on conscious dogs with transhepatic catheters. A hyperglycemic-hyperinsulinemic clamp was established in the presence of portal vein glucose infusion. 8-Br-cGMP (50 µg/kg/min) was delivered intraportally, and either the glucose load to the liver (CGMP/GLC; n = 5) or the glucose concentration entering the liver (CGMP/GCC; n = 5) was clamped at 2× basal. In the control group, saline was given intraportally (SAL; n = 10), and the hepatic glucose concentration and load were doubled. 8-Br-cGMP increased portal blood flow, necessitating the two approaches to glucose clamping in the cGMP groups. NHGU (mg/kg/min) was 5.8 ± 0.5, 2.7 ± 0.5, and 4.8 ± 0.3, whereas the fractional extraction of glucose was 11.0 ± 1, 5.5 ± 1, and 8.5 ± 1% during the last hour of the study in SAL, CGMP/GLC, and CGMP/GCC, respectively. The reduction of NHGU in response to 8-Br-cGMP was associated with increased AMP-activated protein kinase phosphorylation. These data indicate that changes in liver cGMP can regulate NHGU under postprandial conditions. PMID:22688328

  9. Involvement of Cyclic Guanosine Monophosphate-Dependent Protein Kinase I in Renal Antifibrotic Effects of Serelaxin

    PubMed Central

    Wetzl, Veronika; Schinner, Elisabeth; Kees, Frieder; Hofmann, Franz; Faerber, Lothar; Schlossmann, Jens

    2016-01-01

    Introduction: Kidney fibrosis has shown to be ameliorated through the involvement of cyclic guanosine monophosphate (cGMP) and its dependent protein kinase I (cGKI). Serelaxin, the recombinant form of human relaxin-II, increases cGMP levels and has shown beneficial effects on kidney function in acute heart failure patients. Antifibrotic properties of serelaxin are supposed to be mediated via relaxin family peptide receptor 1 and subsequently enhanced nitric oxide/cGMP to inhibit transforming growth factor-β (TGF-β) signaling. This study examines the involvement of cGKI in the antifibrotic signaling of serelaxin. Methods and Results: Kidney fibrosis was induced by unilateral ureteral obstruction in wildtype (WT) and cGKI knock-out (KO) mice. After 7 days, renal antifibrotic effects of serelaxin were assessed. Serelaxin treatment for 7 days significantly increased cGMP in the kidney of WT and cGKI-KO. In WT, renal fibrosis was reduced through decreased accumulation of collagen1A1, total collagen, and fibronectin. The profibrotic connective tissue growth factor as well as myofibroblast differentiation were reduced and matrix metalloproteinases-2 and -9 were positively modulated after treatment. Moreover, Smad2 as well as extracellular signal-regulated kinase 1 (ERK1) phosphorylation were decreased, whereas phosphodiesterase (PDE) 5a phosphorylation was increased. However, these effects were not observed in cGKI-KO. Conclusion: Antifibrotic renal effects of serelaxin are mediated via cGMP/cGKI to inhibit Smad2- and ERK1-dependent TGF-β signaling and increased PDE5a phosphorylation. PMID:27462268

  10. N-H stretching vibrations of guanosine-cytidine base pairs in solution: ultrafast dynamics, couplings, and line shapes.

    PubMed

    Fidder, Henk; Yang, Ming; Nibbering, Erik T J; Elsaesser, Thomas; Röttger, Katharina; Temps, Friedrich

    2013-02-01

    Dynamics and couplings of N-H stretching vibrations of chemically modified guanosine-cytidine (G·C) base pairs in chloroform are investigated with linear infrared spectroscopy and ultrafast two-dimensional infrared (2D-IR) spectroscopy. Comparison of G·C absorption spectra before and after H/D exchange reveals significant N-H stretching absorption in the region from 2500 up to 3300 cm(-1). Both of the local stretching modes ν(C)(NH(2))(b) of the hydrogen-bonded N-H moiety of the cytidine NH(2) group and ν(G)(NH) of the guanosine N-H group contribute to this broad absorption band. Its complex line shape is attributed to Fermi resonances of the N-H stretching modes with combination and overtones of fingerprint vibrations and anharmonic couplings to low-frequency modes. Cross-peaks in the nonlinear 2D spectra between the 3491 cm(-1) free N-H oscillator band and the bands centered at 3145 and 3303 cm(-1) imply N-H···O═C hydrogen bond character for both of these transitions. Time evolution illustrates that the 3303 cm(-1) band is composed of a nearly homogeneous band absorbing at 3301 cm(-1), ascribed to ν(G)(NH(2))(b), and a broad inhomogeneous band peaking at 3380 cm(-1) with mainly guanosine carbonyl overtone character. Kinetics and signal strengths indicate a <0.2 ps virtually complete population transfer from the excited ν(G)(NH(2))(b) mode to the ν(G)(NH) mode at 3145 cm(-1), suggesting lifetime broadening as the dominant source for the homogeneous line shape of the 3301 cm(-1) transition. For the 3145 cm(-1) band, a 0.3 ps population lifetime was obtained. PMID:23317104

  11. In Search of Enzymes with a Role in 3′, 5′-Cyclic Guanosine Monophosphate Metabolism in Plants

    PubMed Central

    Gross, Inonge; Durner, Jörg

    2016-01-01

    In plants, nitric oxide (NO)-mediated 3′, 5′-cyclic guanosine monophosphate (cGMP) synthesis plays an important role during pathogenic stress response, stomata closure upon osmotic stress, the development of adventitious roots and transcript regulation. The NO-cGMP dependent pathway is well characterized in mammals. The binding of NO to soluble guanylate cyclase enzymes (GCs) initiates the synthesis of cGMP from guanosine triphosphate. The produced cGMP alters various cellular responses, such as the function of protein kinase activity, cyclic nucleotide gated ion channels and cGMP-regulated phosphodiesterases. The signal generated by the second messenger is terminated by 3′, 5′-cyclic nucleotide phosphodiesterase (PDEs) enzymes that hydrolyze cGMP to a non-cyclic 5′-guanosine monophosphate. To date, no homologues of mammalian cGMP-synthesizing and degrading enzymes have been found in higher plants. In the last decade, six receptor proteins from Arabidopsis thaliana have been reported to have guanylate cyclase activity in vitro. Of the six receptors, one was shown to be a NO dependent guanylate cyclase enzyme (NOGC1). However, the role of these proteins in planta remains to be elucidated. Enzymes involved in the degradation of cGMP remain elusive, albeit, PDE activity has been detected in crude protein extracts from various plants. Additionally, several research groups have partially purified and characterized PDE enzymatic activity from crude protein extracts. In this review, we focus on presenting advances toward the identification of enzymes involved in the cGMP metabolism pathway in higher plants. PMID:27200049

  12. Guanosine and its modified derivatives are endogenous ligands for TLR7.

    PubMed

    Shibata, Takuma; Ohto, Umeharu; Nomura, Shosaku; Kibata, Kayoko; Motoi, Yuji; Zhang, Yan; Murakami, Yusuke; Fukui, Ryutaro; Ishimoto, Tatsushi; Sano, Shigetoshi; Ito, Tomoki; Shimizu, Toshiyuki; Miyake, Kensuke

    2016-05-01

    Toll-like receptor (TLR) 7and 8 were considered to recognize single-strand RNA (ssRNA) from viruses. Although these receptors also respond to synthetic small chemical ligands, such as CL075 and R848, it remains to be determined whether these receptors sense natural small molecules or not. In the structure of human TLR8 (huTLR8) with ssRNA, there are two ligand-binding sites: one binds a uridine and the other binds an oligoribonucleotide (ORN). This finding demonstrates that huTLR8 recognizes degradation products of ssRNA, suggesting the presence of natural small ligands. We here show that TLR7 works as the sensor for guanosine (G)/2'-deoxyguanosine (dG) in the presence of ORN where ORN strengthens TLR7 interaction with G/dG. In addition, modified nucleosides such as 7-methylguanosine, 8-hydroxyguanosine (8-OHG) and 8-hydroxydeoxyguanosine (8-OHdG) activated TLR7 with ORNs. Importantly, 8-OHdG-a well-known oxidative DNA damage marker with unknown function-induced strong cytokine production comparable to G and dG both in mouse and human immune cells. Although 8-OHdG bound TLR7/ORN with lower affinity than dG did in isothermal titration calorimetry, administered 8-OHdG was metabolically more stable than dG in the serum, indicating that 8-OHdG acts on TLR7 as an endogenous ligand in vivo To address a role of G analogs in the disease state, we also examined macrophages from Unc93b1 (D34A/D34A) mice, which suffer from TLR7-dependent systemic inflammation, and found that Unc93b1 (D34A/D34A) macrophages showed significantly enhanced response to G alone or 8-OHdG with ORN. In conclusion, our results provide evidence that G, dG, 8-OHG and 8-OHdG are novel endogenous ligands for TLR7. PMID:26489884

  13. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

    PubMed

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

    2016-05-01

    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  14. Light-driven artificial enzymes for selective oxidation of guanosine triphosphate using water-soluble POSS network polymers.

    PubMed

    Jeon, Jong-Hwan; Tanaka, Kazuo; Chujo, Yoshiki

    2014-09-01

    The light-driven artificial enzymes were constructed to realize unnatural reactions concerning bio-significant molecules. In this manuscript, the guanosine triphosphate (GTP)-selective oxidation is reported using the network polymers composed of polyhedral oligomeric silsesquioxane (POSS). We synthesized the water-soluble POSS network polymer containing the naphthyridine ligands to capture GTP inside the networks and the ruthenium complexes to oxidize the captured GTP under light irradiation. Initially, the binding affinities of the guanosine nucleosides to the naphthyridine ligand inside the POSS network polymer were evaluated from the emission quenching experiments. Accordingly, it was observed that the naphthyridine ligand can form the stable complex only with GTP (K(a) = 5.5 × 10(6) M(-1)). These results indicate that only GTP can be captured by the network polymer. Next, the photo-catalytic activity of the ruthenium complex-modified POSS network polymer was investigated. Finally, it was revealed that the network polymer can decompose GTP efficiently under light irradiation. This is the first example, to the best of our knowledge, to offer not only the GTP-selective host polymers but also the light-driven artificial enzyme for GTP oxidation. PMID:25026217

  15. Hydrolysis of Guanosine Triphosphate (GTP) by the Ras·GAP Protein Complex: Reaction Mechanism and Kinetic Scheme.

    PubMed

    Khrenova, Maria G; Grigorenko, Bella L; Kolomeisky, Anatoly B; Nemukhin, Alexander V

    2015-10-01

    Molecular mechanisms of the hydrolysis of guanosine triphosphate (GTP) to guanosine diphosphate (GDP) and inorganic phosphate (Pi) by the Ras·GAP protein complex are fully investigated by using modern modeling tools. The previously hypothesized stages of the cleavage of the phosphorus-oxygen bond in GTP and the formation of the imide form of catalytic Gln61 from Ras upon creation of Pi are confirmed by using the higher-level quantum-based calculations. The steps of the enzyme regeneration are modeled for the first time, providing a comprehensive description of the catalytic cycle. It is found that for the reaction Ras·GAP·GTP·H2O → Ras·GAP·GDP·Pi, the highest barriers correspond to the process of regeneration of the active site but not to the process of substrate cleavage. The specific shape of the energy profile is responsible for an interesting kinetic mechanism of the GTP hydrolysis. The analysis of the process using the first-passage approach and consideration of kinetic equations suggest that the overall reaction rate is a result of the balance between relatively fast transitions and low probability of states from which these transitions are taking place. Our theoretical predictions are in excellent agreement with available experimental observations on GTP hydrolysis rates. PMID:26374425

  16. Phosphonomethyl analogues of hexose phosphates.

    PubMed

    Webster, D; Jondorf, W R; Dixon, H B

    1976-05-01

    The analogue of fructose 1,6-bisphosphate in which the phosphate group, -O-PO3H2, on C-6 is replaced by the phosphonomethyl group, -CH2-PO3H2, was made enzymically from the corresponding analogue of 3-phosphoglycerate. It was a substrate for aldolase, which was used to form it, but not for fructose 1,6-bisphosphatase. It was hydrolysed chemically to yield the corresponding analogue of fructose 6-phosphate [i.e. 6-deoxy-6-(phosphonomethyl)-D-fructose, or, more strictly, 6,7-dideoxy-7-phosphono-D-arabino-2-heptulose]. This proved to be a substrate for the sequential actions of glucose 6-phosphate isomerase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase. Thus seven out of the nine enzymes of the glycolytic and pentose phosphate pathways so far tested catalyse the reactions of the phosphonomethyl isosteres of their substrates. PMID:7247

  17. Testing nucleoside analogues as inhibitors of Bacillus anthracis spore germination in vitro and in macrophage cell culture.

    PubMed

    Alvarez, Zadkiel; Lee, Kyungae; Abel-Santos, Ernesto

    2010-12-01

    Bacillus anthracis, the etiological agent of anthrax, has a dormant stage in its life cycle known as the endospore. When conditions become favorable, spores germinate and transform into vegetative bacteria. In inhalational anthrax, the most fatal manifestation of the disease, spores enter the organism through the respiratory tract and germinate in phagosomes of alveolar macrophages. Germinated cells can then produce toxins and establish infection. Thus, germination is a crucial step for the initiation of pathogenesis. B. anthracis spore germination is activated by a wide variety of amino acids and purine nucleosides. Inosine and l-alanine are the two most potent nutrient germinants in vitro. Recent studies have shown that germination can be hindered by isomers or structural analogues of germinants. 6-Thioguanosine (6-TG), a guanosine analogue, is able to inhibit germination and prevent B. anthracis toxin-mediated necrosis in murine macrophages. In this study, we screened 46 different nucleoside analogues as activators or inhibitors of B. anthracis spore germination in vitro. These compounds were also tested for their ability to protect the macrophage cell line J774a.1 from B. anthracis cytotoxicity. Structure-activity relationship analysis of activators and inhibitors clarified the binding mechanisms of nucleosides to B. anthracis spores. In contrast, no structure-activity relationships were apparent for compounds that protected macrophages from B. anthracis-mediated killing. However, multiple inhibitors additively protected macrophages from B. anthracis. PMID:20921305

  18. Sum-frequency generation spectroscopy of self-assembled structures of Guanosine 5‧-monophosphate on mica

    NASA Astrophysics Data System (ADS)

    Kunstelj, Klemen; Spindler, Lea; Federiconi, Francesco; Bonn, Mischa; Drevenšek-Olenik, Irena; Čopič, Martin

    2008-12-01

    The structure and ordering of Guanosine 5'-monophosphate (GMP) films self-assembled on mica from GMP salt solutions were studied by infrared-visible sum-frequency generation spectroscopy (IR-VIS SFG) and atomic force microscopy (AFM). We find that the surface self-assembly of GMP can be tuned through the concentration of the GMP solution as well as the nature of the counter ion. At low concentrations of the ammonium and the sodium GMP salt solutions, the self-assembled films are very similar, while at higher concentrations the SFG signal of ammonium GMP samples is dominated by a contribution not originating from azimuthally symmetric layers, which signifies that a helical bulk structure might be present.

  19. Human taste and umami receptor responses to chemosensorica generated by Maillard-type N²-alkyl- and N²-arylthiomethylation of guanosine 5'-monophosphates.

    PubMed

    Suess, Barbara; Brockhoff, Anne; Degenhardt, Andreas; Billmayer, Sylvia; Meyerhof, Wolfgang; Hofmann, Thomas

    2014-11-26

    Structural modification of the exocyclic amino function of guanosine 5'-monophosphate (5'-GMP) by Maillard-type reactions with reducing carbohydrates was recently found to increase the umami-enhancing activity of the nucleotide upon S-N(2)-1-carboxyalkylation and S-N(2)-(1-alkylamino)carbonylalkylation, respectively. Since the presence of sulfur atoms in synthetic N(2)-alkylated nucleotides was reported to be beneficial for sensory activity, a versatile Maillard-type modification of 5'-GMP upon reaction with glycine's Strecker aldehyde formaldehyde and organic thiols was performed in the present study. A series of N(2)-(alkylthiomethyl)guanosine and N(2)-(arylthiomethyl)guanosine 5'-monophosphates was generated and the compounds were evaluated to what extent they enhance the umami response to monosodium L-glutamate in vivo by a paired-choice comparison test using trained human volunteers and in vitro by means of cell-based umami taste receptor assay. Associated with a high umami-enhancing activity (β-value 5.1), N(2)-(propylthiomethyl)guanosine 5'-monophosphate could be generated when 5'-GMP reacted with glucose, glycine, and the onion-derived odorant 1-propanethiol, thus opening a valuable avenue to produce high-potency umami-enhancing chemosensorica from food-derived natural products by kitchen-type chemistry. PMID:25375264

  20. Lipid peroxides as endogenous oxidants forming 8-oxo-guanosine and lipid-soluble antioxidants as suppressing agents

    PubMed Central

    Kanazawa, Kazuki; Sakamoto, Miku; Kanazawa, Ko; Ishigaki, Yoriko; Aihara, Yoshiko; Hashimoto, Takashi; Mizuno, Masashi

    2016-01-01

    The oxidation of guanosine to 8-oxo-2'-deoxyguanosine (8-oxo-dG) in DNA is closely associated with induction of various diseases, but the endogenous oxidant species involved remains unclear. Hydrogen peroxides (H2O2) have been considered to be the oxidant, while lipid peroxides are another possible oxidant because generated easily in bio-membranes surrounding DNA. The oxidant potency was compared between lipid peroxides and H2O2. Linoleic acid hydroperoxides (LOOH) formed 8-oxo-dG at a higher level than H2O2 in guanosine or double-stranded DNA. In the presence of a physiological concentration of Fe2+ to produce hydroxyl radicals, LOOH was also a stronger oxidant. In a lipid micelle, LOOH markedly produced 8-oxo-dG at a concentration one-tenth of that of H2O2. Upon adding to rat hepatic mitochondria, phosphatidylcholine hydroperoxides produced 8-oxo-dG abundantly. Employing HepG2 cells after pretreated with glutathione peroxidase inhibitor, LOOH formed 8-oxo-dG more abundantly than H2O2. Then, antioxidants to suppress the 8-oxo-dG formation were examined, when the nuclei of pre-incubated HepG2 with antioxidants were exposed to LOOH. Water-soluble ascorbic acid, trolox, and N-acetyl cysteine showed no or weak antioxidant potency, while lipid-soluble 2,6-dipalmitoyl ascorbic acid, α-tocopherol, and lipid-soluble phytochemicals exhibited stronger potency. The present study shows preferential formation of 8-oxo-dG upon LOOH and the inhibition by lipid-soluble antioxidants. PMID:27499574

  1. Lipid peroxides as endogenous oxidants forming 8-oxo-guanosine and lipid-soluble antioxidants as suppressing agents.

    PubMed

    Kanazawa, Kazuki; Sakamoto, Miku; Kanazawa, Ko; Ishigaki, Yoriko; Aihara, Yoshiko; Hashimoto, Takashi; Mizuno, Masashi

    2016-07-01

    The oxidation of guanosine to 8-oxo-2'-deoxyguanosine (8-oxo-dG) in DNA is closely associated with induction of various diseases, but the endogenous oxidant species involved remains unclear. Hydrogen peroxides (H2O2) have been considered to be the oxidant, while lipid peroxides are another possible oxidant because generated easily in bio-membranes surrounding DNA. The oxidant potency was compared between lipid peroxides and H2O2. Linoleic acid hydroperoxides (LOOH) formed 8-oxo-dG at a higher level than H2O2 in guanosine or double-stranded DNA. In the presence of a physiological concentration of Fe(2+) to produce hydroxyl radicals, LOOH was also a stronger oxidant. In a lipid micelle, LOOH markedly produced 8-oxo-dG at a concentration one-tenth of that of H2O2. Upon adding to rat hepatic mitochondria, phosphatidylcholine hydroperoxides produced 8-oxo-dG abundantly. Employing HepG2 cells after pretreated with glutathione peroxidase inhibitor, LOOH formed 8-oxo-dG more abundantly than H2O2. Then, antioxidants to suppress the 8-oxo-dG formation were examined, when the nuclei of pre-incubated HepG2 with antioxidants were exposed to LOOH. Water-soluble ascorbic acid, trolox, and N-acetyl cysteine showed no or weak antioxidant potency, while lipid-soluble 2,6-dipalmitoyl ascorbic acid, α-tocopherol, and lipid-soluble phytochemicals exhibited stronger potency. The present study shows preferential formation of 8-oxo-dG upon LOOH and the inhibition by lipid-soluble antioxidants. PMID:27499574

  2. Oxidatively damaged guanosine in white blood cells and in urine of welders: associations with exposure to welding fumes and body iron stores.

    PubMed

    Pesch, Beate; Lotz, Anne; Koch, Holger M; Marczynski, Boleslaw; Casjens, Swaantje; Käfferlein, Heiko U; Welge, Peter; Lehnert, Martin; Heinze, Evelyn; Van Gelder, Rainer; Hahn, Jens-Uwe; Behrens, Thomas; Raulf, Monika; Hartwig, Andrea; Weiss, Tobias; Brüning, Thomas

    2015-08-01

    The International Agency for Research on Cancer considers the carcinogenicity of welding fume of priority for re-evaluation. Genotoxic effects in experimental animals are still inconclusive. Here, we investigated the association of personal exposure to metals in respirable welding fumes during a working shift with oxidatively damaged guanosine in DNA of white blood cells (WBC) and in postshift urine samples from 238 welders. Medians of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) were 2.35/10(6) dGuo in DNA of WBC and 4.33 µg/g creatinine in urine. The median of 8-oxo-7,8-dihydroguanosine (8-oxoGuo) was 7.03 µg/g creatinine in urine. The extent of both urinary parameters was higher in welders applying techniques with high particle emission rates to stainless steel than in tungsten inert gas welders (8-oxodGuo: 9.96 vs. 4.49 µg/L, 8-oxoGuo: 15.7 vs. 7.7 µg/L), but this apparent difference diminished after creatinine adjustment. We applied random intercept models to estimate the influence of airborne and systemic exposure to metals on oxidatively damaged guanosine in WBC and urine together with covariates. We observed a highly significant nonlinear association of urinary 8-oxoGuo with serum ferritin (P < 0.0001) and higher 8-oxoGuo concentrations for respirable iron >1,000 µg/m(3) compared to ≤57 µg/m(3). Similar effects were found for manganese. Airborne chromium but not nickel was associated with all oxidatively modified guanosine measures, whereas urinary chromium as well as nickel showed associations with urinary modified guanosines. In summary, oxidatively damaged urinary guanosine was associated with airborne and systemic exposure to metals in welders and showed a strong relation to body iron stores. PMID:25107450

  3. Muscarinic interactions of bisindolylmaleimide analogues.

    PubMed

    Lazareno, S; Popham, A; Birdsall, N J

    1998-11-01

    We have used radioligand binding studies to determine the affinities of seven bisindolylmaleimide analogues, six of which are selective inhibitors of protein kinase C, at human muscarinic M1-M4 receptors. The compounds were most potent at M1 receptors, and Ro-31-8220 was the most potent analogue, with a Kd of 0.6 microM at M1 receptors. The weakest compounds, bisindolylmaleimide IV and bisindolylmaleimide V, had Kd values of 100 microM. If it is necessary to use protein kinase C inhibitors at concentrations of 10 microM or more in studies involving muscarinic receptors then bisindolylmaleimide IV may be the most appropriate inhibitor to use. PMID:9851596

  4. Synthesis, molecular modeling and biological evaluation of novel tadalafil analogues as phosphodiesterase 5 and colon tumor cell growth inhibitors, new stereochemical perspective

    PubMed Central

    Abadi, Ashraf H.; Gary, Bernard D.; Tinsley, Heather N.; Piazza, Gary A.; Abdel-Halim, Mohammad

    2016-01-01

    The synthesis of novel tadalafil analogues in which the benzodioxole moiety is replaced by 2-bromophenyl; the chiral carbons swing from R,R to R,S, S,R and S,S; the piperazinedione ring is maintained or reduced to the 5-membered imidazolidinedione or thioxoimidazolinone is described. The prepared analogues were evaluated for their capacity to inhibit the cyclic guanosine monophosphate (cGMP) selective phosphodiesterase 5 (PDE5) isozyme and the growth of human HT-29 colon adenocarcinoma cells. The R absolute configuration of C-5 in the β-carboline-hydantoin and C-6 in the β-carboline-piperazinedione derivatives was found to be essential for the PDE5 inhibition. In addition, tadalafil analogues that were synthesized from L-tryptophan were more active than those derived from D-tryptophan, which is of economic value and expands the horizon for the discovery of new carbolines as PDE5 inhibitors. While some analogues displayed potent tumor cell growth inhibitory activity, there was no apparent correlation with their PDE5 inhibitory activity, which leads us to conclude that other PDE isozymes or PDE5 splice variants may be involved. PMID:20206015

  5. Synthesis, molecular modeling and biological evaluation of novel tadalafil analogues as phosphodiesterase 5 and colon tumor cell growth inhibitors, new stereochemical perspective.

    PubMed

    Abadi, Ashraf H; Gary, Bernard D; Tinsley, Heather N; Piazza, Gary A; Abdel-Halim, Mohammad

    2010-04-01

    The synthesis of novel tadalafil analogues in which the benzodioxole moiety is replaced by 2-bromophenyl; the chiral carbons swing from R,R to R,S, S,R and S,S; the piperazinedione ring is maintained or reduced to the 5-membered imidazolidinedione or thioxoimidazolinone is described. The prepared analogues were evaluated for their capacity to inhibit the cyclic guanosine monophosphate (cGMP) selective phosphodiesterase 5 (PDE5) isozyme and the growth of human HT-29 colon adenocarcinoma cells. The R absolute configuration of C-5 in the beta-carboline-hydantoin and C-6 in the beta-carboline-piperazinedione derivatives was found to be essential for the PDE5 inhibition. In addition, tadalafil analogues that were synthesized from l-tryptophan were more active than those derived from d-tryptophan, which is of economic value and expands the horizon for the discovery of new carbolines as PDE5 inhibitors. While some analogues displayed potent tumor cell growth inhibitory activity, there was no apparent correlation with their PDE5 inhibitory activity, which leads us to conclude that other PDE isozymes or PDE5 splice variants may be involved. PMID:20206015

  6. Substrate analogues for isoprenoid enzymes

    SciTech Connect

    Stremler, K.E.

    1987-01-01

    Diphosphonate analogues of geranyl diphosphate, resistant to degradation by phosphatases, were found to be alternate substrates for the reaction with farnesyl diphosphate synthetase isolated from avian liver. The difluoromethane analogue was shown to be the better alternate substrate, in agreement with solvolysis results which indicate that the electronegativity of the difluoromethylene unit more closely approximates that of the normal bridging oxygen. The usefulness of the C/sub 10/ difluoro analogue, for detecting low levels of isoprenoid enzymes in the presence of high levels of phosphatase activity, was demonstrated with a cell-free preparation from lemon peel. A series of C/sub 5/ through C/sub 15/ homoallylic and allylic diphosphonates, as well as two 5'-nucleotide diphosphonates, was prepared in high overall yield using the activation-displacement sequence. Radiolabeled samples of several of the allylic diphosphonates were prepared with tritium located at C1. A series of geraniols, stereospecifically deuterated at C1, was prepared. The enantiomeric purities and absolute configurations were determined by derivatization as the mandelate esters for analysis by /sup 1/H NMR. The stereochemistry of the activation-displacement sequence was examined using C1-deuterated substrates.

  7. Policy issues in space analogues

    NASA Astrophysics Data System (ADS)

    Auger, Robin N.; Facktor, Debra D.

    Space mission planning is increasingly focusing on destinations beyond Earth orbit. Advancements in technology will inevitably be required to enable long-duration human spaceflight missions, and breakthroughs in the policy arena will also be needed to achieve success in such missions. By exploring how policy issues have been addressed in analogous extreme environments, policymakers can develop a framework for addressing these issues as they apply to long-term human spaceflight. Policy issues that need to be addressed include: crew selection, training, organization, and activities, medical testing, illness, injury, and death; communication; legal accountability and liability; mission safety and risk management; and environmental contamination. This paper outlines the approach of a study underway by The George Washington University and ANSER to examine how these policy issues have been addressed in several analogues and how the experiences of these analogues can help formulate policies for long-duration human spaceflight missions. Analogues being studied include Antarctic bases, submarine voyages, undersea stations, Biosphere 2, and the U.S. Skylab and Russian Mir space stations.

  8. Phosphonate analogue substrates for enolase.

    PubMed

    Anderson, V E; Cleland, W W

    1990-11-20

    Phosphonate analogues in which the bridge between C-2 and phosphorus is a CH2 group are slow substrates for yeast enolase. The pH variation of the kinetic parameters for the methylene analogue of 2-phosphoglycerate suggests that the substrate binds as a dianion and that Mg2+ can bind subsequently only if a metal ligand and the catalytic base are unprotonated. Primary deuterium isotope effects of 4-8 on V/KMg, but ones of only 1.15-1.32 on V for dehydration, show that proton removal to give the carbanion intermediate largely limits V/KMg and that a slow step follows which largely limits V (presumably carbanion breakdown). Since there is a D2O solvent isotope effect on V for the reverse reaction of 5, but not an appreciable one on the forward reaction, it appears that the slow rates with phosphonate analogues result from the fact that the carbanion intermediate is more stable than that formed from the normal substrates, and its reaction in both directions limits V. Increased stability as a result of replacement of oxygen by carbon at C-2 of the carbanion is the expected chemical behavior. PMID:2271661

  9. Comparative Structural Dynamics of tRNA(Phe) with Respect to Hinge Region Methylated Guanosine: A Computational Approach.

    PubMed

    Sonawane, Kailas D; Bavi, Rohit S; Sambhare, Susmit B; Fandilolu, Prayagraj M

    2016-06-01

    Transfer RNAs (tRNAs) contain various uniquely modified nucleosides thought to be useful for maintaining the structural stability of tRNAs. However, their significance for upholding the tRNA structure has not been investigated in detail at the atomic level. In this study, molecular dynamic simulations have been performed to assess the effects of methylated nucleic acid bases, N (2)-methylguanosine (m(2)G) and N (2)-N (2)-dimethylguanosine (m 2 (2) G) at position 26, i.e., the hinge region of E. coli tRNA(Phe) on its structure and dynamics. The results revealed that tRNA(Phe) having unmodified guanosine in the hinge region (G26) shows structural rearrangement in the core of the molecule, resulting in lack of base stacking interactions, U-turn feature of the anticodon loop, and TΨC loop. We show that in the presence of the unmodified guanosine, the overall fold of tRNA(Phe) is essentially not the same as that of m(2)G26 and m 2 (2) G26 containing tRNA(Phe). This structural rearrangement arises due to intrinsic factors associated with the weak hydrogen-bonding patterns observed in the base triples of the tRNA(Phe) molecule. The m(2)G26 and m 2 (2) G26 containing tRNA(Phe) retain proper three-dimensional fold through tertiary interactions. Single-point energy and molecular electrostatics potential calculation studies confirmed the structural significance of tRNAs containing m(2)G26 and m 2 (2) G26 compared to tRNA with normal G26, showing that the mono-methylated (m(2)G26) and dimethylated (m 2 (2) G26) modifications are required to provide structural stability not only in the hinge region but also in the other parts of tRNA(Phe). Thus, the present study allows us to better understand the effects of modified nucleosides and ionic environment on tRNA folding. PMID:27216172

  10. Guanosine may increase absence epileptic activity by means of A2A adenosine receptors in Wistar Albino Glaxo Rijswijk rats.

    PubMed

    Lakatos, Renáta Krisztina; Dobolyi, Árpád; Todorov, Mihail Ivilinov; Kékesi, Katalin A; Juhász, Gábor; Aleksza, Magdolna; Kovács, Zsolt

    2016-06-01

    The non-adenosine nucleoside guanosine (Guo) was demonstrated to decrease quinolinic acid(QA)-induced seizures, spontaneously emerged absence epileptic seizures and lipopolysaccharide(LPS)-evoked induction of absence epileptic seizures suggesting its antiepileptic potential. It was also described previously that intraperitoneal (i.p.) injection of 20 and 50mg/kg Guo decreased the number of spike-wave discharges (SWDs) in a well investigated model of human absence epilepsy, the Wistar Albino Glaxo Rijswijk (WAG/Rij) rats during 4th (20mg/kg Guo) and 3rd as well as 4th (50mg/kg Guo) measuring hours. Guanosine can potentially decrease SWD number by means of its putative receptors but absence epileptic activity changing effects of Guo by means of increased extracellular adenosine (Ado) cannot be excluded. An increase in the dose of i.p. injected Guo is limited by its low solubility in saline, therefore, we addressed in the present study whether higher doses of Guo, diluted in sodium hydroxide (NaOH) solution, have more potent antiepileptic effect in WAG/Rij rats. We confirmed that i.p. 50mg/kg Guo decreased but, surprisingly, i.p. 100mg/kg Guo enhanced the number of SWDs in WAG/Rij rats. Combined i.p. injection of a non-selective Ado receptor antagonist theophylline (5mg/kg) or a selective Ado A2A receptor (A2AR) antagonist SCH 58261 (7-(2-phenylethyl)-5-amino-2-(2-furyl)-pyrazolo-[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine) (1mg/kg) and a cyclooxygenase 1 and 2/COX-1 and COX-2 inhibitor indomethacin (10mg/kg) with 100mg/kg Guo decreased the SWD number compared to i.p. 100mg/kg Guo alone. The results suggest that i.p. 100mg/kg Guo can increase SWD number by means of the adenosinergic system. PMID:27154620

  11. FUNCTION GENERATOR FOR ANALOGUE COMPUTERS

    DOEpatents

    Skramstad, H.K.; Wright, J.H.; Taback, L.

    1961-12-12

    An improved analogue computer is designed which can be used to determine the final ground position of radioactive fallout particles in an atomic cloud. The computer determines the fallout pattern on the basis of known wind velocity and direction at various altitudes, and intensity of radioactivity in the mushroom cloud as a function of particle size and initial height in the cloud. The output is then displayed on a cathode-ray tube so that the average or total luminance of the tube screen at any point represents the intensity of radioactive fallout at the geographical location represented by that point. (AEC)

  12. Ecstasy analogues found in cacti.

    PubMed

    Bruhn, Jan G; El-Seedi, Hesham R; Stephanson, Nikolai; Beck, Olof; Shulgin, Alexander T

    2008-06-01

    Human interest in psychoactive phenethylamines is known from the use of mescaline-containing cacti and designer drugs such as Ecstasy. From the alkaloid composition of cacti we hypothesized that substances resembling Ecstasy might occur naturally. In this article we show that lophophine, homopiperonylamine and lobivine are new minor constituents of two cactus species, Lophophora williamsii (peyote) and Trichocereus pachanoi (San Pedro). This is the first report of putatively psychoactive phenethylamines besides mescaline in these cacti. A search for further biosynthetic analogues may provide new insights into the structure-activity relationships of mescaline. An intriguing question is whether the new natural compounds can be called "designer drugs." PMID:18720674

  13. Theoretical vibrational spectroscopy of intermediates and the reaction mechanism of the guanosine triphosphate hydrolysis by the protein complex Ras-GAP

    NASA Astrophysics Data System (ADS)

    Khrenova, Maria G.; Grigorenko, Bella L.; Nemukhin, Alexander V.

    2016-09-01

    The structures and vibrational spectra of the reacting species upon guanosine triphosphate (GTP) hydrolysis to guanosine diphosphate and inorganic phosphate (Pi) trapped inside the protein complex Ras-GAP were analyzed following the results of QM/MM simulations. The frequencies of the phosphate vibrations referring to the reactants and to Pi were compared to those observed in the experimental FTIR studies. A good correlation between the theoretical and experimental vibrational data provides a strong support to the reaction mechanism of GTP hydrolysis by the Ras-GAP enzyme system revealed by the recent QM/MM modeling. Evolution of the vibrational bands associated with the inorganic phosphate Pi during the elementary stages of GTP hydrolysis is predicted.

  14. Theoretical vibrational spectroscopy of intermediates and the reaction mechanism of the guanosine triphosphate hydrolysis by the protein complex Ras-GAP.

    PubMed

    Khrenova, Maria G; Grigorenko, Bella L; Nemukhin, Alexander V

    2016-09-01

    The structures and vibrational spectra of the reacting species upon guanosine triphosphate (GTP) hydrolysis to guanosine diphosphate and inorganic phosphate (Pi) trapped inside the protein complex Ras-GAP were analyzed following the results of QM/MM simulations. The frequencies of the phosphate vibrations referring to the reactants and to Pi were compared to those observed in the experimental FTIR studies. A good correlation between the theoretical and experimental vibrational data provides a strong support to the reaction mechanism of GTP hydrolysis by the Ras-GAP enzyme system revealed by the recent QM/MM modeling. Evolution of the vibrational bands associated with the inorganic phosphate Pi during the elementary stages of GTP hydrolysis is predicted. PMID:27214270

  15. The Valles natural analogue project

    SciTech Connect

    Stockman, H.; Krumhansl, J.; Ho, C.; McConnell, V.

    1994-12-01

    The contact between an obsidian flow and a steep-walled tuff canyon was examined as an analogue for a highlevel waste repository. The analogue site is located in the Valles Caldera in New Mexico, where a massive obsidian flow filled a paleocanyon in the Battleship Rock tuff. The obsidian flow provided a heat source, analogous to waste panels or an igneous intrusion in a repository, and caused evaporation and migration of water. The tuff and obsidian samples were analyzed for major and trace elements and mineralogy by INAA, XRF, X-ray diffraction; and scanning electron microscopy and electron microprobe. Samples were also analyzed for D/H and {sup 39}Ar/{sup 4O} isotopic composition. Overall,the effects of the heating event seem to have been slight and limited to the tuff nearest the contact. There is some evidence of devitrification and migration of volatiles in the tuff within 10 meters of the contact, but variations in major and trace element chemistry are small and difficult to distinguish from the natural (pre-heating) variability of the rocks.

  16. Analysis of nitric oxide-cyclic guanosine monophosphate signaling during metamorphosis of the nudibranch Phestilla sibogae Bergh (Gastropoda: Opisthobranchia).

    PubMed

    Bishop, Cory D; Pires, Anthony; Norby, Shong-Wan; Boudko, Dmitri; Moroz, Leonid L; Hadfield, Michael G

    2008-01-01

    The gas nitric oxide (NO), and in some cases its downstream second messenger, cyclic guanosine monophosphate (cGMP) function in different taxa to regulate the timing of life-history transitions. Increased taxonomic sampling is required to foster conclusions about the evolution and function of NO/cGMP signaling during life-history transitions. We report on the function and localization of NO and cGMP signaling during metamorphosis of the nudibranch Phestilla sibogae. Pharmacological manipulation of NO or cGMP production in larvae modulated responses to a natural settlement cue from the coral Porites compressa in a manner that suggest inhibitory function for NO/cGMP signaling. However, these treatments were not sufficient to induce metamorphosis in the absence of cue, a result unique to this animal. We show that induction of metamorphosis in response to the settlement cue is associated with a reduction in NO production. We documented the expression of putative NO synthase (NOS) and the production of cGMP during larval development and observed no larval cells in which NOS and cGMP were both detected. The production of cGMP in a bilaterally symmetrical group of cells fated to occupy the distal tip of rhinophores is correlated with competence to respond to the coral settlement cue. These results suggest that endogenous NO and cGMP are involved in modulating responses of P. sibogae to a natural settlement cue. We discuss these results with respect to habitat selection and larval ecology. PMID:18460091

  17. Alterations in the Cerebellar (Phospho)Proteome of a Cyclic Guanosine Monophosphate (cGMP)-dependent Protein Kinase Knockout Mouse*

    PubMed Central

    Corradini, Eleonora; Vallur, Raghavan; Raaijmakers, Linsey M.; Feil, Susanne; Feil, Robert; Heck, Albert J. R.; Scholten, Arjen

    2014-01-01

    The cyclic nucleotide cyclic guanosine monophosphate (cGMP) plays an important role in learning and memory, but its signaling mechanisms in the mammalian brain are not fully understood. Using mass-spectrometry-based proteomics, we evaluated how the cerebellum adapts its (phospho)proteome in a knockout mouse model of cGMP-dependent protein kinase type I (cGKI). Our data reveal that a small subset of proteins in the cerebellum (∼3% of the quantified proteins) became substantially differentially expressed in the absence of cGKI. More changes were observed at the phosphoproteome level, with hundreds of sites being differentially phosphorylated between wild-type and knockout cerebellum. Most of these phosphorylated sites do not represent known cGKI substrates. An integrative computational network analysis of the data indicated that the differentially expressed proteins and proteins harboring differentially phosphorylated sites largely belong to a tight network in the Purkinje cells of the cerebellum involving important cGMP/cAMP signaling nodes (e.g. PDE5 and PKARIIβ) and Ca2+ signaling (e.g. SERCA3). In this way, removal of cGKI could be linked to impaired cerebellar long-term depression at Purkinje cell synapses. In addition, we were able to identify a set of novel putative (phospho)proteins to be considered in this network. Overall, our data improve our understanding of cerebellar cGKI signaling and suggest novel players in cGKI-regulated synaptic plasticity. PMID:24925903

  18. Peroxynitrite-Dependent Zinc Release and Inactivation of Guanosine 5′-Triphosphate Cyclohydrolase 1 Instigate Its Ubiquitination in Diabetes

    PubMed Central

    Zhao, Yu; Wu, Jiliang; Zhu, Huaiping; Song, Ping; Zou, Ming-Hui

    2013-01-01

    Aberrant degradation of guanosine 5′-triphosphate cyclohydrolase 1 (GTPCH1) with consequent deficiency of tetrahydrobiopterin is considered the primary cause for endothelial dysfunction in diabetes. How GTPCH1 becomes susceptible to the degradation remains unknown. We hypothesized that oxidation and release of the zinc ion by peroxynitrite (ONOO−), a potent oxidant generated by nitric oxide and superoxide anions, instigates GTPCH1 ubiquitination and degradation. Zinc contents, GTPCH1 ubiquitination, and GTPCH1 activity were assayed in purified GTPCH1, endothelial cells, and hearts from diabetic mice. Exogenous ONOO− dose-dependently released zinc, inhibited its activity, and increased the ubiquitin binding affinity of GTPCH1 in vitro and in endothelial cells. Consistently, high glucose (30 mmol/L) inhibited GTPCH1 activity with increased ubiquitination, which was inhibited by antioxidants. Furthermore, mutation of the zinc-binding cysteine (141) (C141R or C141A) significantly reduced GTPCH1 activity and reduced its half-life but increased GTPCH1 ubiquitination, indicating an essential role of the zinc ion in maintaining the catalytic activity and stability of GTPCH1. Finally, GTPCH1 ubiquitination and degradation markedly increased in parallel with decreased GTPCH1 activity in the aortas and hearts of diabetic mice, both of which were attenuated by the inhibitors of ONOO− in mice in vivo. Taken together, we conclude that ONOO− releases zinc and inhibits GTPCH1, resulting in its ubiquitination and degradation of the enzyme. PMID:23974923

  19. Length of guanosine homopolymeric repeats modulates promoter activity of subfamily II tpr genes of Treponema pallidum ssp. pallidum.

    PubMed

    Giacani, Lorenzo; Lukehart, Sheila; Centurion-Lara, Arturo

    2007-11-01

    In Treponema pallidum, homopolymeric guanosine repeats of varying length are present upstream of both Subfamily I (tprC, D, F and I) and II (tprE, G and J) tpr genes, a group of potential virulence factors, immediately upstream of the +1 nucleotide. To investigate the influence of these poly-G sequences on promoter activity, tprE, G, J, F and I promoter regions containing homopolymeric tracts with different numbers of Gs, the ribosomal binding site and start codon were cloned in frame with the green fluorescent protein reporter gene (GFP), and promoter activity was measured both as fluorescence emission from Escherichia coli cultures transformed with the different plasmid constructs and using quantitative RT-PCR. For tprJ, G and E-derived clones, fluorescence was significantly higher with constructs containing eight Gs or fewer, while plasmids containing the same promoters with none or more Gs gave modest or no signal above the background. In contrast, tprF/I-derived clones induced similar levels of fluorescence regardless of the number of Gs within the promoter. GFP mRNA quantification showed that all of the promoters induced measurable transcription of the GFP gene; however, only for Subfamily II promoters was message synthesis inversely correlated to the number of Gs in the construct. PMID:17683506

  20. Non-adenosine nucleoside inosine, guanosine and uridine as promising antiepileptic drugs: a summary of current literature.

    PubMed

    Kovacs, Zsolt; Kekesi, Katalin A; Juhasz, Gabor; Barna, Janos; Heja, Laszlo; Lakatos, Renata; Dobolyi, Arpad

    2015-01-01

    Adenosine (Ado) and some non-adenosine (non-Ado) nucleosides including inosine (Ino), guanosine (Guo) and uridine (Urd) are modulatory molecules in the central nervous system (CNS), regulating different physiological and pathophysiological processes in the brain such as sleep and epilepsy. Indeed, different drugs effective on adenosinergic system (e.g., Ado metabolism inhibitors, agonists and antagonists of Ado receptors) are being used in drug development for the treatment of epileptic disorders. Although (i) endogenous Ino, Guo and Urd showed anticonvulsant/antiepileptic effects (e.g., in quinolinic acid - induced seizures and in different epilepsy models such as hippocampal kindling models), and (ii) there is a need to generate new and more effective antiepileptic drugs for the treatment of drug-resistant epilepsies, our knowledge about antiepileptic influence of non-Ado nucleosides is far from complete. Thus, in this review article, we give a short summary of anticonvulsant/antiepileptic effects and mechanisms evoked by Ino, Guo, and Urd. Finally, we discuss some non-Ado nucleoside derivatives and their structures, which may be candidates as potential antiepileptic agents. PMID:25382017

  1. Influence of salt additives on phase transformation of guanosine 5-monophosphate disodium in anti-solvent crystallization

    NASA Astrophysics Data System (ADS)

    Nguyen, Anh-Tuan; Kang, Jeongki; Kim, Woo-Sik

    2013-06-01

    The influence of sodium chloride (NaCl) as an additive on the anti-solvent crystallization of guanosine 5-monophosphate disodium (GMP-2Na) was investigated in continuous Couette-Taylor (CT) and batch mixing tank (MT) crystallizers. The anti-solvent crystallization initially precipitated amorphous solids of GMP-2Na, which then slowly transformed into hydrate crystals in the solution. However, the phase transformation of GMP-2Na was markedly promoted by the sodium chloride additive due to the common ion effect. While the normal phase transformation in the batch MT crystallizer required over 120 min of crystallization time without using the sodium chloride additive, the process was completed within 60 min when a small amount of the salt additive was added. The phase transformation was also significantly accelerated in the continuous CT crystallizer. Without using the sodium chloride additive, 7 min of the mean residence time was required for the production of 100% hydrate GMP crystals. However, when using the sodium chloride additive, a mean residence time of only 2 min was sufficient to completely transform the amorphous solids of GMP-2Na into hydrate crystals due to the common ion effect combined with the effective fluid motion of the Taylor vortex for the mass transfer.

  2. Intranasal guanosine administration presents a wide therapeutic time window to reduce brain damage induced by permanent ischemia in rats.

    PubMed

    Ramos, Denise Barbosa; Muller, Gabriel Cardozo; Rocha, Guilherme Botter Maio; Dellavia, Gustavo Hirata; Almeida, Roberto Farina; Pettenuzzo, Leticia Ferreira; Loureiro, Samanta Oliveira; Hansel, Gisele; Horn, Ângelo Cássio Magalhães; Souza, Diogo Onofre; Ganzella, Marcelo

    2016-03-01

    In addition to its intracellular roles, the nucleoside guanosine (GUO) also has extracellular effects that identify it as a putative neuromodulator signaling molecule in the central nervous system. Indeed, GUO can modulate glutamatergic neurotransmission, and it can promote neuroprotective effects in animal models involving glutamate neurotoxicity, which is the case in brain ischemia. In the present study, we aimed to investigate a new in vivo GUO administration route (intranasal, IN) to determine putative improvement of GUO neuroprotective effects against an experimental model of permanent focal cerebral ischemia. Initially, we demonstrated that IN [(3)H] GUO administration reached the brain in a dose-dependent and saturable pattern in as few as 5 min, presenting a higher cerebrospinal GUO level compared with systemic administration. IN GUO treatment started immediately or even 3 h after ischemia onset prevented behavior impairment. The behavior recovery was not correlated to decreased brain infarct volume, but it was correlated to reduced mitochondrial dysfunction in the penumbra area. Therefore, we showed that the IN route is an efficient way to promptly deliver GUO to the CNS and that IN GUO treatment prevented behavioral and brain impairment caused by ischemia in a therapeutically wide time window. PMID:26695181

  3. Synthesis of the coenzymes adenosine diphosphate glucose, guanosine diphosphate glucose, and cytidine diphosphoethanolamine under primitive Earth conditions

    NASA Technical Reports Server (NTRS)

    Mar, A.; Oro, J.

    1991-01-01

    The nonenzymatic synthesis of the coenzymes adenosine diphosphate glucose (ADPG), guanosine diphosphate glucose (GDPG), and cytidine diphosphoethanolamine (CDP-ethanolamine) has been carried out under conditions considered to have been prevalent on the early Earth. The production of these compounds was performed by allowing simple precursor molecules to react under aqueous solutions, at moderate temperatures and short periods of time, with mediation by cyanamide or urea. These two condensing agents are considered to have been present in significant amounts on the primitive Earth and have been previously used in the nonenzymatic synthesis of several other important biochemical compounds. In our experiments, ADPG was obtained by heating glucose-1-phosphate (G1P) and ATP in the presence of cyanamide for 24 h at 70 degrees C. The reaction of G1P and GTP under the same conditions yielded GDPG. The cyanamide-mediated production of CDP-ethanolamine was carried out by reacting a mixture of ethanolamine phosphate and CTP for 24 h at 70 degrees C. The separation and identification of the reaction products was carried out by paper chromatography, thin-layer chromatography, high performance thin-layer chromatography, high performance liquid chromatography, both normal and reverse-phase, UV spectroscopy, enzymatic assays, and acid hydrolysis. Due to the mild conditions employed, and to the relative ease of these reactions, these studies offer a simple attractive system for the nonenzymatic synthesis of phosphorylated high-energy metabolic intermediates under conditions considered to have been prevalent on the ancient Earth.

  4. A guanosine quadruplex and two stable hairpins flank a major cleavage site in insulin-like growth factor II mRNA.

    PubMed Central

    Christiansen, J; Kofod, M; Nielsen, F C

    1994-01-01

    Insulin-like growth factor II (IGF-II) mRNAs are cleaved by an endonucleolytic event in a conserved part of their 3' untranslated region that is predicted to exhibit a complex higher-order RNA structure. In the present study, we have examined the putative secondary structures of in vitro transcripts from the conserved part of human and rat mRNAs by enzymatic and chemical probing. The results show that the cleavage site is situated between two highly structured domains. The upstream domain consists of two large hairpins, whereas the downstream domain is guanosine-rich. The guanosine-rich domain adopts a compact unimolecular conformation in Na+ or K+ but not in Li+, and it completely arrests reverse transcription in K+ but only partially in Na+, indicating the presence of an intramolecular guanosine quadruplex. The flanking higher-order structures may ensure that the cleavage site is not sequestered in stable RNA structures, thus allowing interactions with RNA or proteins at posttranscriptional stages of IGF-II expression. Images PMID:7838726

  5. CO2 Capture with Enzyme Synthetic Analogue

    SciTech Connect

    Cordatos, Harry

    2010-11-08

    Overview of an ongoing, 2 year research project partially funded by APRA-E to create a novel, synthetic analogue of carbonic anhydrase and incorporate it into a membrane for removal of CO2 from flue gas in coal power plants. Mechanism background, preliminary feasibility study results, molecular modeling of analogue-CO2 interaction, and program timeline are provided.

  6. Fully analogue photonic reservoir computer.

    PubMed

    Duport, François; Smerieri, Anteo; Akrout, Akram; Haelterman, Marc; Massar, Serge

    2016-01-01

    Introduced a decade ago, reservoir computing is an efficient approach for signal processing. State of the art capabilities have already been demonstrated with both computer simulations and physical implementations. If photonic reservoir computing appears to be promising a solution for ultrafast nontrivial computing, all the implementations presented up to now require digital pre or post processing, which prevents them from exploiting their full potential, in particular in terms of processing speed. We address here the possibility to get rid simultaneously of both digital pre and post processing. The standalone fully analogue reservoir computer resulting from our endeavour is compared to previous experiments and only exhibits rather limited degradation of performances. Our experiment constitutes a proof of concept for standalone physical reservoir computers. PMID:26935166

  7. An analogue study of intrusions.

    PubMed

    Laposa, Judith M; Alden, Lynn E

    2006-07-01

    According to cognitive theorists, intrusive trauma memories have their origin in how information during the event is processed. Two studies investigated functional cognitive strategies during medical crises that might protect against intrusions. In Study 1, interviews with health-care professionals were used to identify cognitive strategies judged to be effective in controlling emotions and dealing with medical crises. Study 2 systematically manipulated the use of those strategies in a trauma analogue film paradigm. Experimental participants reported fewer intrusions, and less fear and avoidance of film-related stimuli during the subsequent week than controls. The manipulation did not affect anxiety during the film or memory disorganization. Implications for cognitive theories of intrusion development are discussed. PMID:16125135

  8. Fully analogue photonic reservoir computer

    PubMed Central

    Duport, François; Smerieri, Anteo; Akrout, Akram; Haelterman, Marc; Massar, Serge

    2016-01-01

    Introduced a decade ago, reservoir computing is an efficient approach for signal processing. State of the art capabilities have already been demonstrated with both computer simulations and physical implementations. If photonic reservoir computing appears to be promising a solution for ultrafast nontrivial computing, all the implementations presented up to now require digital pre or post processing, which prevents them from exploiting their full potential, in particular in terms of processing speed. We address here the possibility to get rid simultaneously of both digital pre and post processing. The standalone fully analogue reservoir computer resulting from our endeavour is compared to previous experiments and only exhibits rather limited degradation of performances. Our experiment constitutes a proof of concept for standalone physical reservoir computers. PMID:26935166

  9. Laboratory study of cometary analogues

    NASA Astrophysics Data System (ADS)

    Colangeli, L.; Brucato, J.; Mennella, V.; Palumbo, P.

    In situ exploration (e.g., GIOTTO mission) and astronomical observations (e.g., ISO) of comets have provided fundamental information about the structure, chemistry and physical properties of materials present in such primordial bodies of the Solar System. Moreover, it is known that cosmic materials evolve, depending on the efficiency of active processes (e.g., thermal annealing, UV irradiation, ion bombardment, gassolid interactions) in different space environments. Thus, the properties of cometary constituents must be considered in a wider perspective, including cosmic dust formation around cold stars and evolution in the interstellar medium until the formation of proto-planetary nebulae. In this scenario, laboratory experiments provide important hints to clarify the status of cometary compounds. The laboratory work is aimed at both reproducing material properties and at simulating their evolution based on the most effective mechanisms active in space. Several techniques are used to synthesise "analogues" of cometary compounds with controlled chemical and physical characteristics. The study of optical properties, complemented by other analytical techniques, is applied to investigate the products of synthesis in the experiments. The monitoring of the effects produced by processing methods, similar to those active in space, provides information both on the reactivity of materials and on the efficiency of treatments. Such an approach is able to provide quantitative information on chemical and structural modifications produced on organic and refractory materials. The comparison of laboratory results with data coming from space observations and in situ measurements provides a powerful tool to understand the real nature of comets and to place constraints on formation and evolution pathways. The laboratory experiments on analogues gain even more relevance as a sort of training in the future perspective of analysing cometary samples returned to Earth by space missions (e

  10. Analysis of nitric oxide-cyclic guanosine monophosphate signaling during metamorphosis of the nudibranch Phestilla sibogae Bergh (Gastropoda: Opisthobranchia)

    PubMed Central

    Bishop, Cory D.; Pires, Anthony; Norby, Shong-Wan; Boudko, Dmitri; Moroz, Leonid L.; Hadfield, Michael G.

    2014-01-01

    SUMMARY The gas nitric oxide (NO), and in some cases its downstream second messenger, cyclic guanosine monophosphate (cGMP) function in different taxa to regulate the timing of life-history transitions. Increased taxonomic sampling is required to foster conclusions about the evolution and function of NO/cGMP signaling during life-history transitions. We report on the function and localization of NO and cGMP signaling during metamorphosis of the nudibranch Phestilla sibogae. Pharmacological manipulation of NO or cGMP production in larvae modulated responses to a natural settlement cue from the coral Porites compressa in a manner that suggest inhibitory function for NO/cGMP signaling. However, these treatments were not sufficient to induce metamorphosis in the absence of cue, a result unique to this animal. We show that induction of metamorphosis in response to the settlement cue is associated with a reduction in NO production. We documented the expression of putative NO synthase (NOS) and the production of cGMP during larval development and observed no larval cells in which NOS and cGMP were both detected. The production of cGMP in a bilaterally symmetrical group of cells fated to occupy the distal tip of rhinophores is correlated with competence to respond to the coral settlement cue. These results suggest that endogenous NO and cGMP are involved in modulating responses of P. sibogae to a natural settlement cue. We discuss these results with respect to habitat selection and larval ecology. PMID:18460091

  11. Semaphorin 3A activates the guanosine triphosphatase Rab5 to promote growth cone collapse and organize callosal axon projections.

    PubMed

    Wu, Kong-Yan; He, Miao; Hou, Qiong-Qiong; Sheng, Ai-Li; Yuan, Lei; Liu, Fei; Liu, Wen-Wen; Li, Guangpu; Jiang, Xing-Yu; Luo, Zhen-Ge

    2014-01-01

    Axon guidance (pathfinding) wires the brain during development and is regulated by various attractive and repulsive cues. Semaphorin 3A (Sema3A) is a repulsive cue, inducing the collapse of axon growth cones. In the mammalian forebrain, the corpus callosum is the major commissure that transmits information flow between the two hemispheres, and contralateral axons assemble into well-defined tracts. We found that the patterning of callosal axon projections in rodent layer II and III (L2/3) cortical neurons in response to Sema3A was mediated by the activation of Rab5, a small guanosine triphosphatase (GTPase) that mediates endocytosis, through the membrane fusion protein Rabaptin-5 and the Rab5 guanine nucleotide exchange factor (GEF) Rabex-5. Rabaptin-5 bound directly to Plexin-A1 in the Sema3A receptor complex [an obligate heterodimer formed by Plexin-A1 and neuropilin 1 (NP1)]; Sema3A enhanced this interaction in cultured neurons. Rabaptin-5 bridged the interaction between Rab5 and Plexin-A1. Sema3A stimulated endocytosis from the cell surface of callosal axon growth cones. In utero electroporation to reduce Rab5 or Rabaptin-5 impaired axon fasciculation or caused mistargeting of L2/3 callosal projections in rats. Overexpression of Rabaptin-5 or Rab5 rescued the defective callosal axon fasciculation or mistargeting of callosal axons caused by the loss of Sema3A-Plexin-A1 signaling in rats expressing dominant-negative Plexin-A1 or in NP1-deficient mice. Thus, our findings suggest that Rab5, its effector Rabaptin-5, and its regulator Rabex-5 mediate Sema3A-induced axon guidance during brain development. PMID:25161316

  12. Semaphorin 3A activates the guanosine triphosphatase Rab5 to promote growth cone collapse and organize callosal axon projections

    PubMed Central

    Wu, Kong-Yan; He, Miao; Hou, Qiong-Qiong; Sheng, Ai-Li; Yuan, Lei; Liu, Fei; Liu, Wen-Wen; Li, Guangpu; Jiang, Xing-Yu; Luo, Zhen-Ge

    2015-01-01

    Axon guidance (pathfinding) wires the brain during development and is regulated by various attractive and repulsive cues. Semaphorin 3A (Sema3A) is a repulsive cue, inducing the collapse of axon growth cones. In the mammalian forebrain, the corpus callosum is the major commissure that transmits information flow between the two hemispheres, and contralateral axons assemble into well-defined tracts. We found that the patterning of callosal axon projections in rodent layer II and III (L2/3) cortical neurons in response to Sema3A was mediated by the activation of Rab5, a small guanosine triphosphatase (GTPase) that mediates endocytosis, through the membrane fusion protein Rabaptin-5 and the Rab5 guanine nucleotide exchange factor (GEF) Rabex-5. Rabaptin-5 bound directly to Plexin-A1 in the Sema3A receptor complex [an obligate heterodimer formed by Plexin-A1 and neuropilin 1 (NP1)]; Sema3A enhanced this interaction in cultured neurons. Rabaptin-5 bridged the interaction between Rab5 and Plexin-A1. Sema3A stimulated endocytosis from the cell surface of callosal axon growth cones. In utero electroporation to reduce Rab5 or Rabaptin-5 impaired axon fasciculation or caused mistargeting of L2/3 callosal projections in rats. Over-expression of Rabaptin-5 or Rab5 rescued the defective callosal axon fasciculation or mistargeting of callosal axons caused by the loss of Sema3A–Plexin-A1 signaling in rats expressing dominant-negative Plexin-A1 or in NP1-deficient mice. Thus, our findings suggest that Rab5, its effector Rabaptin-5, and its regulator Rabex-5 mediate Sema3A-induced axon guidance during brain development. PMID:25161316

  13. Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.

    PubMed

    Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich

    2011-05-12

    N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1). PMID:21244064

  14. Xenopus oocyte resting potential, muscarinic responses and the role of calcium and guanosine 3',5'-cyclic monophosphate.

    PubMed Central

    Dascal, N; Landau, E M; Lass, Y

    1984-01-01

    Resting potential (r.p.) and muscarinic response mechanisms were studied in Xenopus laevis oocytes using the voltage-clamp technique. Insertion of micro-electrodes into the oocyte produced a 'shunt' membrane conductance which partially sealed after a few minutes. The oocyte resting potential (measured with a single intracellular electrode) ranged from -40 to -60 mV. Ouabain and low K+ solution depolarized both follicles and denuded oocytes. The electrogenic Na+-K+ pump was more active in the latter. In the presence of ouabain, the r.p. agreed with the constant field theory. alpha (PNa+/PK+) was 0.12 in follicles and 0.24 in denuded oocytes. beta (PCl-/PK+) was 0.4 in both. At [Na+]o lower than 70 mM, the r.p. deviated considerably from the constant field predictions. The relatively large value of alpha indicated the major role of Na+ in oocyte r.p. determination. The oocyte muscarinic response was separated into four distinct components: the fast depolarizing Cl- current, 'D1'; the slow depolarizing Cl- current, 'D2'; the slow hyperpolarizing K+ current, 'H'; and the large membrane Cl- current fluctuation, 'F'. The H response reversal potential showed a Nernst relationship to [K+] and was selectively blocked by intracellular injection of tetraethylammonium (TEA). The D1 and D2 reversal potential showed a Nernst relationship to [Cl-]. In Ca2+-deficient, EGTA-containing medium, D2 and F were abolished and D1 and H were reduced. Verapamil inhibited all responses. Increasing [Ca2+]o caused a significant increase in D1, D2 and F response amplitudes. Intracellular injection of 0.6-10 pmol guanosine 3',5'-cyclic monophosphate, induced a large outward K+ current, similar to the muscarinic H response. PMID:6086916

  15. Absence epileptic activity changing effects of non-adenosine nucleoside inosine, guanosine and uridine in Wistar Albino Glaxo Rijswijk rats.

    PubMed

    Kovács, Z; Kékesi, K A; Dobolyi, Á; Lakatos, R; Juhász, G

    2015-08-01

    Adenosine (Ado) and non-adenosine (non-Ado) nucleosides such as inosine (Ino), guanosine (Guo) and uridine (Urd) may have regionally different roles in the regulation of physiological and pathophysiological processes in the central nervous system (CNS) such as epilepsy. It was demonstrated previously that Ino and Guo decreased quinolinic acid (QA)-induced seizures and Urd reduced penicillin-, bicuculline- and pentylenetetrazole (PTZ)-induced seizures. It has also been demonstrated that Ino and Urd may exert their effects through GABAergic system by altering the function of GABA(A) type of gamma-aminobutyric acid receptors (GABAA receptors) whereas Guo decreases glutamate-induced excitability through glutamatergic system, which systems (GABAergic and glutamatergic) are involved in pathomechanisms of absence epilepsy. Thus, we hypothesized that Ino and Guo, similarly to the previously described effect of Urd, might also decrease absence epileptic activity. We investigated in the present study whether intraperitoneal (i.p.) application of Ino (500 and 1000mg/kg), Guo (20 and 50mg/kg), Urd (500 and 1000mg/kg), GABA(A) receptor agonist muscimol (1 and 3mg/kg), GABA(A) receptor antagonist bicuculline (2 and 4mg/kg), non-selective Ado receptor antagonist theophylline (5 and 10mg/kg) and non-competitive N-methyl-d-aspartate (NMDA) receptor antagonist (+)-5-methyl-10,11-dihydro-5H-dibenzo (a,d) cyclohepten-5,10-imine maleate (MK-801, 0.0625 and 0.1250mg/kg) alone and in combination have modulatory effects on absence epileptic activity in Wistar Albino Glaxo Rijswijk (WAG/Rij) rats. We found that Guo decreased the number of spike-wave discharges (SWDs) whereas Ino increased it dose-dependently. We strengthened that Urd can decrease absence epileptic activity. Our results suggest that Guo, Urd and their analogs could be potentially effective drugs for treatment of human absence epilepsy. PMID:26037802

  16. Mast cell degranulation is negatively regulated by the Munc13-4-binding small-guanosine triphosphatase Rab37

    PubMed Central

    Higashio, Hironori; Satoh, Yoh-ichi; Saino, Tomoyuki

    2016-01-01

    Mast cell degranulation is regulated by the small guanosine triphosphatases (GTPases) Rab27a and Rab27b, which have distinct and opposing roles: Rab27b acts as a positive regulator through its effector protein Munc13-4, a non-neuronal isoform of the vesicle-priming Munc13 family of proteins, whereas Rab27a acts as a negative regulator through its effector protein melanophilin, by maintaining integrity of cortical filamentous actin (F-actin), a barrier to degranulation. Here we investigated the role of Rab37, one of the Rab GTPases assumed to be implicated in regulated secretion during mast cell degranulation. Using the RBL-2H3 mast cell line, we detected Rab37 on the secretory granules and found that antigen-induced degranulation was extensively increased by either knockdown of Rab37 or overexpression of a dominant-active Rab37 mutant. This hypersecretion phenotype in the Rab37-knockdown cells was suppressed by simultaneous knockdown of Rab27a and Rab27b or of Munc13-4, but not by disruption of cortical F-actin. We further found that Rab37 interacted with Munc13-4 in a GTP-independent manner and formed a Rab27-Munc13-4-Rab37 complex. These results suggest that Rab37 is a Munc13-4-binding protein that inhibits mast cell degranulation through its effector protein, by counteracting the vesicle-priming activity of the Rab27-Munc13-4 system. PMID:26931073

  17. Guanosine 3′,5′-bispyrophosphate coordinates global gene expression during glucose-lactose diauxie in Escherichia coli

    PubMed Central

    Traxler, Matthew F.; Chang, Dong-Eun; Conway, Tyrrell

    2006-01-01

    Guanosine 3′,5′-bispyrophosphate (ppGpp), also known as “magic spot,” has been shown to bind prokaryotic RNA polymerase to down-regulate ribosome production and increase transcription of amino acid biosynthesis genes during the stringent response to amino acid starvation. Because many environmental growth perturbations cause ppGpp to accumulate, we hypothesize ppGpp to have an overarching role in regulating the genetic program that coordinates transitions between logarithmic growth (feast) and growth arrest (famine). We used the classic glucose-lactose diauxie as an experimental system to investigate the temporal changes in transcription that accompany growth arrest and recovery in wild-type Escherichia coli and in mutants that lack RelA (ppGpp synthetase) and other global regulators, i.e., RpoS and Crp. In particular, diauxie was delayed in the relA mutant and was accompanied by a 15% decrease in the number of carbon sources used and a 3-fold overall decrease in the induction of RpoS and Crp regulon genes. Thus the data significantly expand the previously known role of ppGpp and support a model wherein the ppGpp-dependent redistribution of RNA polymerase across the genome is the driving force behind control of the stringent response, general stress response, and starvation-induced carbon scavenging. Our conceptual model of diauxie describes these global control circuits as dynamic, interconnected, and dependent upon ppGpp for the efficient temporal coordination of gene expression that programs the cell for transitions between feast and famine. PMID:16467149

  18. Plant volatile analogues strengthen attractiveness to insect.

    PubMed

    Sun, Yufeng; Yu, Hao; Zhou, Jing-Jiang; Pickett, John A; Wu, Kongming

    2014-01-01

    Green leaf bug Apolygus lucorum (Meyer-Dür) is one of the major pests in agriculture. Management of A. lucorum was largely achieved by using pesticides. However, the increasing population of A. lucorum since growing Bt cotton widely and the increased awareness of ecoenvironment and agricultural product safety makes their population-control very challenging. Therefore this study was conducted to explore a novel ecological approach, synthetic plant volatile analogues, to manage the pest. Here, plant volatile analogues were first designed and synthesized by combining the bioactive components of β-ionone and benzaldehyde. The stabilities of β-ionone, benzaldehyde and analogue 3 g were tested. The electroantennogram (EAG) responses of A. lucorum adult antennae to the analogues were recorded. And the behavior assay and filed experiment were also conducted. In this study, thirteen analogues were acquired. The analogue 3 g was demonstrated to be more stable than β-ionone and benzaldehyde in the environment. Many of the analogues elicited EAG responses, and the EAG response values to 3 g remained unchanged during seven-day period. 3 g was also demonstrated to be attractive to A. lucorum adults in the laboratory behavior experiment and in the field. Its attractiveness persisted longer than β-ionone and benzaldehyde. This indicated that 3 g can strengthen attractiveness to insect and has potential as an attractant. Our results suggest that synthetic plant volatile analogues can strengthen attractiveness to insect. This is the first published study about synthetic plant volatile analogues that have the potential to be used in pest control. Our results will support a new ecological approach to pest control and it will be helpful to ecoenvironment and agricultural product safety. PMID:24911460

  19. Plant Volatile Analogues Strengthen Attractiveness to Insect

    PubMed Central

    Sun, Yufeng; Yu, Hao; Zhou, Jing-Jiang; Pickett, John A.; Wu, Kongming

    2014-01-01

    Green leaf bug Apolygus lucorum (Meyer-Dür) is one of the major pests in agriculture. Management of A. lucorum was largely achieved by using pesticides. However, the increasing population of A. lucorum since growing Bt cotton widely and the increased awareness of ecoenvironment and agricultural product safety makes their population-control very challenging. Therefore this study was conducted to explore a novel ecological approach, synthetic plant volatile analogues, to manage the pest. Here, plant volatile analogues were first designed and synthesized by combining the bioactive components of β-ionone and benzaldehyde. The stabilities of β-ionone, benzaldehyde and analogue 3 g were tested. The electroantennogram (EAG) responses of A. lucorum adult antennae to the analogues were recorded. And the behavior assay and filed experiment were also conducted. In this study, thirteen analogues were acquired. The analogue 3 g was demonstrated to be more stable than β-ionone and benzaldehyde in the environment. Many of the analogues elicited EAG responses, and the EAG response values to 3 g remained unchanged during seven-day period. 3 g was also demonstrated to be attractive to A. lucorum adults in the laboratory behavior experiment and in the field. Its attractiveness persisted longer than β-ionone and benzaldehyde. This indicated that 3 g can strengthen attractiveness to insect and has potential as an attractant. Our results suggest that synthetic plant volatile analogues can strengthen attractiveness to insect. This is the first published study about synthetic plant volatile analogues that have the potential to be used in pest control. Our results will support a new ecological approach to pest control and it will be helpful to ecoenvironment and agricultural product safety. PMID:24911460

  20. Space analogue studies in Antarctica

    NASA Astrophysics Data System (ADS)

    Lugg, D.; Shepanek, M.

    1999-09-01

    Medical research has been carried out on the Australian National Antarctic Research Expeditions (ANARE) for 50 years. As an extension of this program collaborative Australian/United States research on immunology, microbiology, psychology and remote medicine has produced important data and insight on how humans adapt to the stress of extreme isolation, confinement and the harsh environment of Antarctica. An outstanding analogue for the isolation and confinement of space missions (especially planetary outposts), ANARE has been used as an international research platform by Australia and the United States since 1993. Collaborative research has demonstrated a lowered responsiveness of the immune system under the isolation and confinement of Antarctic winter-over; a reduction of almost 50% in T cell proliferation to mltogen phytohaemogglutinin, as well as changes in latent herpesvirus states and the expansion of the polyclonal latent Epstein-Barr virus infected B cell populations. Although no clinically significant disease has been found to result from these immune changes, research is currently assessing the effects of psychological factors on the immune system. This and associated research performed to date and its relevance to both organisations is discussed, and comment made on possible extensions to the program in both medical and other fields.

  1. Condensed matter analogues of cosmology

    NASA Astrophysics Data System (ADS)

    Kibble, Tom; Srivastava, Ajit

    2013-10-01

    It is always exciting when developments in one branch of physics turn out to have relevance in a quite different branch. It would be hard to find two branches farther apart in terms of energy scales than early-universe cosmology and low-temperature condensed matter physics. Nevertheless ideas about the formation of topological defects during rapid phase transitions that originated in the context of the very early universe have proved remarkably fruitful when applied to a variety of condensed matter systems. The mathematical frameworks for describing these systems can be very similar. This interconnection has led to a deeper understanding of the phenomena in condensed matter systems utilizing ideas from cosmology. At the same time, one can view these condensed matter analogues as providing, at least in a limited sense, experimental access to the phenomena of the early universe for which no direct probe is possible. As this special issue well illustrates, this remains a dynamic and exciting field. The basic idea is that when a system goes through a rapid symmetry-breaking phase transition from a symmetric phase into one with spontaneously broken symmetry, the order parameter may make different choices in different regions, creating domains that when they meet can trap defects. The scale of those domains, and hence the density of defects, is constrained by the rate at which the system goes through the transition and the speed with which order parameter information propagates. This is what has come to be known as the Kibble-Zurek mechanism. The resultant scaling laws have now been tested in a considerable variety of different systems. The earliest experiments illustrating the analogy between cosmology and condensed matter were in liquid crystals, in particular on the isotropic-to-nematic transition, primarily because it is very easy to induce the phase transition (typically at room temperature) and to image precisely what is going on. This field remains one of the

  2. Antimicrobial activity of resveratrol analogues.

    PubMed

    Chalal, Malik; Klinguer, Agnès; Echairi, Abdelwahad; Meunier, Philippe; Vervandier-Fasseur, Dominique; Adrian, Marielle

    2014-01-01

    Stilbenes, especially resveratrol and its derivatives, have become famous for their positive effects on a wide range of medical disorders, as indicated by a huge number of published studies. A less investigated area of research is their antimicrobial properties. A series of 13 trans-resveratrol analogues was synthesized via Wittig or Heck reactions, and their antimicrobial activity assessed on two different grapevine pathogens responsible for severe diseases in the vineyard. The entire series, together with resveratrol, was first evaluated on the zoospore mobility and sporulation level of Plasmopara viticola (the oomycete responsible for downy mildew). Stilbenes displayed a spectrum of activity ranging from low to high. Six of them, including the most active ones, were subsequently tested on the development of Botrytis cinerea (fungus responsible for grey mold). The results obtained allowed us to identify the most active stilbenes against both grapevine pathogens, to compare the antimicrobial activity of the evaluated series of stilbenes, and to discuss the relationship between their chemical structure (number and position of methoxy and hydroxy groups) and antimicrobial activity. PMID:24918540

  3. Space analogue studies in Antarctica

    NASA Technical Reports Server (NTRS)

    Lugg, D.; Shepanek, M.

    1999-01-01

    Medical research has been carried out on the Australian National Antarctic Research Expeditions (ANARE) for 50 years. As an extension of this program collaborative Australian/United States research on immunology, microbiology, psychology and remote medicine has produced important data and insight on how humans adapt to the stress of extreme isolation, confinement and the harsh environment of Antarctica. An outstanding analogue for the isolation and confinement of space missions (especially planetary outposts), ANARE has been used as an international research platform by Australia and the United States since 1993. Collaborative research has demonstrated a lowered responsiveness of the immune system under the isolation and confinement of Antarctic winter-over; a reduction of almost 50% in T cell proliferation to mitogen phytohaemogglutinin, as well as changes in latent herpesvirus states and the expansion of the polyclonal latent Epstein-Barr virus infected B cell populations. Although no clinically significant disease has been found to result from these immune changes, research is currently assessing the effects of psychological factors on the immune system. This and associated research performed to date and its relevance to both organisations is discussed, and comment made on possible extensions to the program in both medical and other fields.

  4. Heterocyclic chalcone analogues as potential anticancer agents.

    PubMed

    Sharma, Vikas; Kumar, Vipin; Kumar, Pradeep

    2013-03-01

    Chalcones, aromatic ketones and enones acting as the precursor for flavonoids such as Quercetin, are known for their anticancer effects. Although, parent chalcones consist of two aromatic rings joined by a three-carbon α,β-unsaturated carbonyl system, various synthetic compounds possessing heterocyclic rings like pyrazole, indole etc. are well known and proved to be effective anticancer agents. In addition to their use as anticancer agents in cancer cell lines, heterocyclic analogues are reported to be effective even against resistant cell lines. In this connection, we hereby highlight the potential of various heterocyclic chalcone analogues as anticancer agents with a brief summary about therapeutic potential of chalcones, mechanism of anticancer action of various chalcone analogues, and current and future prospects related to the chalcones-derived anticancer research. Furthermore, some key points regarding chalcone analogues have been reviewed by analyzing their medicinal properties. PMID:22721390

  5. Synthesis and SAR of vinca alkaloid analogues.

    PubMed

    Voss, Matthew E; Ralph, Jeffery M; Xie, Dejian; Manning, David D; Chen, Xinchao; Frank, Anthony J; Leyhane, Andrew J; Liu, Lei; Stevens, Jason M; Budde, Cheryl; Surman, Matthew D; Friedrich, Thomas; Peace, Denise; Scott, Ian L; Wolf, Mark; Johnson, Randall

    2009-02-15

    Versatile intermediates 12'-iodovinblastine, 12'-iodovincristine and 11'-iodovinorelbine were utilized as substrates for transition metal based chemistry which led to the preparation of novel analogues of the vinca alkaloids. The synthesis of key iodo intermediates, their transformation into final products, and the SAR based upon HeLa and MCF-7 cell toxicity assays is presented. Selected analogues 27 and 36 show promising anticancer activity in the P388 murine leukemia model. PMID:19147348

  6. Kinetic dissection of individual steps in the poly(C)-directed oligoguanylate synthesis from guanosine 5'-monophosphate 2-methylimidazolide

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Bernasconi, C. F.; Alberas, D. J.; Baird, E. E.

    1993-01-01

    A kinetic study of oligoguanylate synthesis on a polycytidylate template, poly(C), as a function of the concentration of the activated monomer, guanosine 5'-monophosphate 2-methylimidazolide, 2-MeImpG, is reported. Reactions were run with 0.005-0.045 M 2-MeImpG in the presence of 0.05 M poly(C) at 23 degrees C. The kinetic results are consistent with a reaction scheme (eq 1) that consists of a series of consecutive steps, each step representing the addition of one molecule of 2-MeImpG to the growing oligomer. This scheme allows the calculation of second-order rate constants for every step by analyzing the time-dependent growth of each oligomer. Computer simulations of the course of reaction based on the determined rate constants and eq 1 are in excellent agreement with the product distributions seen in the HPLC profiles. In accord with an earlier study (Fakhrai, H.; Inoue, T.; Orgel, L. E. Tetrahedron 1984, 40, 39), rate constants, ki, for the formation of the tetramer and longer oligomers up to the 16-mer were found to be independent of length and somewhat higher than k3 (formation of trimer), which in turn is much higher than k2 (formation of dimer). The ki (i > or = 4), k3, and k2 values are not true second-order rate constants but vary with monomer concentration. Mechanistic models for the dimerization (Scheme I) and elongation reactions (Scheme II) are proposed that are consistent with our results. These models take into account that the monomer associates with the template in a cooperative manner. Our kinetic analysis allowed the determination of rate constants for the elementary processes of covalent bond formation between two monomers (dimerization) and between an oligomer and a monomer (elongation) on the template. A major conclusion from our study is that bond formation between two monomer units or between a primer and a monomer is assisted by the presence of additional next-neighbor monomer units. This is consistent with recent findings with hairpin

  7. Planetary habitability: lessons learned from terrestrial analogues

    NASA Astrophysics Data System (ADS)

    Preston, Louisa J.; Dartnell, Lewis R.

    2014-01-01

    Terrestrial analogue studies underpin almost all planetary missions and their use is essential in the exploration of our Solar system and in assessing the habitability of other worlds. Their value relies on the similarity of the analogue to its target, either in terms of their mineralogical or geochemical context, or current physical or chemical environmental conditions. Such analogue sites offer critical ground-truthing for astrobiological studies on the habitability of different environmental parameter sets, the biological mechanisms for survival in extreme environments and the preservation potential and detectability of biosignatures. The 33 analogue sites discussed in this review have been selected on the basis of their congruence to particular extraterrestrial locations. Terrestrial field sites that have been used most often in the literature, as well as some lesser known ones which require greater study, are incorporated to inform on the astrobiological potential of Venus, Mars, Europa, Enceladus and Titan. For example, the possibility of an aerial habitable zone on Venus has been hypothesized based on studies of life at high-altitudes in the terrestrial atmosphere. We also demonstrate why many different terrestrial analogue sites are required to satisfactorily assess the habitability of the changing environmental conditions throughout Martian history, and recommend particular sites for different epochs or potential niches. Finally, habitable zones within the aqueous environments of the icy moons of Europa and Enceladus and potentially in the hydrocarbon lakes of Titan are discussed and suitable analogue sites proposed. It is clear from this review that a number of terrestrial analogue sites can be applied to multiple planetary bodies, thereby increasing their value for astrobiological exploration. For each analogue site considered here, we summarize the pertinent physiochemical environmental features they offer and critically assess the fidelity with which

  8. Kinetics of the template-directed oligomerization of guanosine 5'-phosphate-2-methylimidazolide: Effect of temperature on individual steps of reactionion

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Bernasconi, C. F.; Alberas, D. J.

    1991-01-01

    Non-enzymatic, template-directed reactions have been proposed as models for prebiological polynucleotide synthesis. Chemically activated mononucleotides react in the presence of a polynucleotide, acting as the template in a Watson-Crick base-pairing fashing, and form the complementary daughter polynucleotide. Phosphoimidazolide-activated nucleotides have been used successfully as substrates in these reactions. The kinetics of the guanosine 5'-monophosphate-2-methylimidazolide (2-MelmpG) reaction in aqueous pH 8.0 solutions in the presence and in the absence of polycytidylate (poly(C)) were studied, acting as the template at 6, 23, and 37 C. In the absence of the template, the major reaction pathway of 2-MelmpG is hydrolysis of the P-N bond to form the unreactive guanosine 5'-monophosphate (5'-GMP) and 2-methylimidazole. Concentrated solution of 2-MelmpG (greater than 0.02 M) in the absence of the template form only a small amount dinucleotide, (pG)2, but in the presence of poly(C), oligoguanylates, (pG)n with 2 less than or = n less than or = 40, can be detected. We were able to determine the rate constants for individual steps of this reaction. A summary of the conclusions is presented.

  9. Glucagonlike Peptide 2 Analogue Teduglutide

    PubMed Central

    Chaturvedi, Lakshmi S.; Basson, Marc D.

    2015-01-01

    IMPORTANCE Short bowel syndrome occurs when a shortened intestine cannot absorb sufficient nutrients or fluids. Teduglutide is a recombinant analogue of human glucagonlike peptide 2 that reduces dependence on parenteral nutrition in patients with short bowel syndrome by promoting enterocytic proliferation, increasing the absorptive surface area. However, enterocyte function depends not only on the number of cells that are present but also on differentiated features that facilitate nutrient absorption and digestion. OBJECTIVE To test the hypothesis that teduglutide impairs human intestinal epithelial differentiation. DESIGN AND SETTING We investigated the effects of teduglutide in the modulation of proliferation and differentiation in human Caco-2 intestinal epithelial cells at a basic science laboratory. This was an in vitro study using Caco-2 cells, a human-derived intestinal epithelial cell line commonly used to model enterocytic biology. EXPOSURE Cells were exposed to teduglutide or vehicle control. MAINOUTCOMESAND MEASURES We analyzed the cell cycle by bromodeoxyuridine incorporation or propidium iodide staining and flow cytometry and measured cell proliferation by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay. We used quantitative reverse transcription–polymerase chain reaction to assay the expression of the enterocytic differentiation markers villin, sucrase-isomaltase, glucose transporter 2 (GLUT2), and dipeptidyl peptidase 4 (DPP-4), as well as that of the putative differentiation signals schlafen 12 (SLFN12) and caudal-related homeobox intestine-specific transcription factor (Cdx2). Villin promoter activity was measured by a luciferase-based assay. RESULTS The MTS assay demonstrated that teduglutide increased cell numbers by a mean (SD) of 10% (2%) over untreated controls at a maximal 500nM (n = 6, P < .05). Teduglutide increased bromodeoxyuridine-positive cells vs untreated controls by a mean (SD

  10. Convergent syntheses of LeX analogues

    PubMed Central

    Wang, An; Hendel, Jenifer

    2010-01-01

    Summary The synthesis of three Lex derivatives from one common protected trisaccharide is reported. These analogues will be used respectively for competitive binding experiments, conjugation to carrier proteins and immobilization on gold. An N-acetylglucosamine monosaccharide acceptor was first glycosylated at O-4 with a galactosyl imidate. This coupling was performed at 40 °C under excess of BF3·OEt2 activation and proceeded best if the acceptor carried a 6-chlorohexyl rather than a 6-azidohexyl aglycon. The 6-chlorohexyl disaccharide was then converted to an acceptor and submitted to fucosylation yielding the corresponding protected 6-chlorohexyl Lex trisaccharide. This protected trisaccharide was used as a precursor to the 6-azidohexyl, 6-acetylthiohexyl and 6-benzylthiohexyl trisaccharide analogues which were obtained in excellent yields (70–95%). In turn, we describe the deprotection of these intermediates in one single step using dissolving metal conditions. Under these conditions, the 6-chlorohexyl and 6-azidohexyl intermediates led respectively to the n-hexyl and 6-aminohexyl trisaccharide targets. Unexpectedly, the 6-acetylthiohexyl analogue underwent desulfurization and gave the n-hexyl glycoside product, whereas the 6-benzylthiohexyl analogue gave the desired disulfide trisaccharide dimer. This study constitutes a particularly efficient and convergent preparation of these three Lex analogues. PMID:20485599

  11. Dolastatin 11 conformations, analogues and pharmacophore.

    PubMed

    Ali, Md Ahad; Bates, Robert B; Crane, Zackary D; Dicus, Christopher W; Gramme, Michelle R; Hamel, Ernest; Marcischak, Jacob; Martinez, David S; McClure, Kelly J; Nakkiew, Pichaya; Pettit, George R; Stessman, Chad C; Sufi, Bilal A; Yarick, Gayle V

    2005-07-01

    Twenty analogues of the natural antitumor agent dolastatin 11, including majusculamide C, were synthesized and tested for cytotoxicity against human cancer cells and stimulation of actin polymerization. Only analogues containing the 30-membered ring were active. Molecular modeling and NMR evidence showed the low-energy conformations. The amide bonds are all trans except for the one between the Tyr and Val units, which is cis. Since an analogue restricted to negative 2-3-4-5 angles stimulated actin polymerization but was inactive in cells, the binding conformation (most likely the lowest-energy conformation in water) has a negative 2-3-4-5 angle, whereas a conformation with a positive 2-3-4-5 angle (most likely the lowest energy conformation in chloroform) goes through cell walls. The highly active R alcohol from borohydride reduction of dolastatin 11 is a candidate for conversion to prodrugs. PMID:15878670

  12. Binding of rhodopsin and rhodopsin analogues to transducin, rhodopsin kinase and arrestin-1

    PubMed Central

    Araujo, Nelson A; Sanz-Rodríguez, Carlos E; Bubis, José

    2014-01-01

    AIM: To investigate the interaction of reconstituted rhodopsin, 9-cis-retinal-rhodopsin and 13-cis-retinal-rhodopsin with transducin, rhodopsin kinase and arrestin-1. METHODS: Rod outer segments (ROS) were isolated from bovine retinas. Following bleaching of ROS membranes with hydroxylamine, rhodopsin and rhodopsin analogues were generated with the different retinal isomers and the concentration of the reconstituted pigments was calculated from their UV/visible absorption spectra. Transducin and arrestin-1 were purified to homogeneity by column chromatography, and an enriched-fraction of rhodopsin kinase was obtained by extracting freshly prepared ROS in the dark. The guanine nucleotide binding activity of transducin was determined by Millipore filtration using β,γ-imido-(3H)-guanosine 5’-triphosphate. Recognition of the reconstituted pigments by rhodopsin kinase was determined by autoradiography following incubation of ROS membranes containing the various regenerated pigments with partially purified rhodopsin kinase in the presence of (γ-32P) ATP. Binding of arrestin-1 to the various pigments in ROS membranes was determined by a sedimentation assay analyzed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis. RESULTS: Reconstituted rhodopsin and rhodopsin analogues containing 9-cis-retinal and 13-cis-retinal rendered an absorption spectrum showing a maximum peak at 498 nm, 486 nm and about 467 nm, respectively, in the dark; which was shifted to 380 nm, 404 nm and about 425 nm, respectively, after illumination. The percentage of reconstitution of rhodopsin and the rhodopsin analogues containing 9-cis-retinal and 13-cis-retinal was estimated to be 88%, 81% and 24%, respectively. Although only residual activation of transducin was observed in the dark when reconstituted rhodopsin and 9-cis-retinal-rhodopsin was used, the rhodopsin analogue containing the 13-cis isomer of retinal was capable of activating transducin independently of light. Moreover

  13. Classical Simulated Annealing Using Quantum Analogues

    NASA Astrophysics Data System (ADS)

    La Cour, Brian R.; Troupe, James E.; Mark, Hans M.

    2016-08-01

    In this paper we consider the use of certain classical analogues to quantum tunneling behavior to improve the performance of simulated annealing on a discrete spin system of the general Ising form. Specifically, we consider the use of multiple simultaneous spin flips at each annealing step as an analogue to quantum spin coherence as well as modifications of the Boltzmann acceptance probability to mimic quantum tunneling. We find that the use of multiple spin flips can indeed be advantageous under certain annealing schedules, but only for long anneal times.

  14. Classical Simulated Annealing Using Quantum Analogues

    NASA Astrophysics Data System (ADS)

    La Cour, Brian R.; Troupe, James E.; Mark, Hans M.

    2016-06-01

    In this paper we consider the use of certain classical analogues to quantum tunneling behavior to improve the performance of simulated annealing on a discrete spin system of the general Ising form. Specifically, we consider the use of multiple simultaneous spin flips at each annealing step as an analogue to quantum spin coherence as well as modifications of the Boltzmann acceptance probability to mimic quantum tunneling. We find that the use of multiple spin flips can indeed be advantageous under certain annealing schedules, but only for long anneal times.

  15. D-luciferin analogues: a multicolor toolbox for bioluminescence imaging.

    PubMed

    Sun, Yuan-Qiang; Liu, Jing; Wang, Pi; Zhang, Jingyu; Guo, Wei

    2012-08-20

    Colorful mixture: Three types of luciferin analogues, that is, alkylaminoluciferins, aminoselenoluciferin, and luciferins with a benzimidazole scaffold, have been reported. These analogues show excellent bioluminescent properties and great potential in bioluminescence imaging. PMID:22807027

  16. Synthesis and Cytoxicity of Sempervirine and Analogues.

    PubMed

    Pan, Xiaohong; Yang, Chunying; Cleveland, John L; Bannister, Thomas D

    2016-03-01

    Sempervirine and analogues were synthesized using a route featuring Sonogashira and Larock Pd-catalyzed reactions. Structure-activity relationships were investigated using three human cancer cell lines. 10-Fluorosempervirine is the most potently cytotoxic member of the family yet described. PMID:26828413

  17. Solanapyrone analogues from a Hawaiian fungicolous fungus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Four new solanayrone analogues (solanapyrones J-M; 1-4) have been isolated from an unidentified fungicolous fungus collected in Hawaii. The structures and relative configurations of these compounds were determined by analysis of ID NMR, 2D NMR, and MS data. Solanapyrone J(1) showed antifungal acti...

  18. New cytotoxic analogues of annonaceous acetogenins.

    PubMed

    Rodier, S; Le Huerou, Y; Renoux, B; Doyon, J; Renard, P; Pierré, A; Gesson, J P; Grée, R

    2001-01-01

    A series of new acetogenin analogues incorporating a central catechol moiety instead of the tetrahydrofuran ring(s) have been prepared and tested against L1210 leukemia cells. Although less potent than bullatacinone, which has the same terminal lactone, these compounds display interesting cell cycle effects. PMID:11962508

  19. CO2 Capture with Enzyme Synthetic Analogue

    SciTech Connect

    Cordatos, Harry

    2010-03-01

    Project overview provides background on carbonic anhydrase transport mechanism for CO2 in the human body and proposed approach for ARPA-E project to create a synthetic enzyme analogue and utilize it in a membrane for CO2 capture from flue gas.

  20. Synthesis of lipid II phosphonate analogues.

    PubMed

    Borbás, Anikó; Herczegh, Pál

    2011-09-01

    Simple analogues of lipid II were synthesized from 3,4,6-tri-O-acetyl-2-acetamido-2-deoxy-1-thio-β-D-glucopyranose using conjugate addition onto ethylidene bisphosphonate and subsequent Wadsworth-Horner-Emmons reaction with long chain aliphatic aldehydes. PMID:21600568

  1. The arsonomethyl analogue of 3-phosphoglycerate.

    PubMed Central

    Adams, S R; Sparkes, M J; Dixon, H B

    1983-01-01

    4-Arsono-2-hydroxybutanoic acid, the analogue of 3-phosphoglycerate in which -CH2-AsO3H2 replaces -O-PO3H2, was synthesized. It proved to be a substrate for phosphoglycerate kinase. Its Michaelis constant was only slightly higher than that of the natural substrate, but its catalytic constant was about 1300 times smaller. PMID:6615422

  2. Synthesis and antimicrobial activity of squalamine analogue.

    PubMed

    Kim, H S; Choi, B S; Kwon, K C; Lee, S O; Kwak, H J; Lee, C H

    2000-08-01

    Synthesis and antimicrobial activity of squalamine analogue 2 are reported. The synthesis of 2 was accomplished from bisnoralcohol 3. The spermidine moiety was introduced via reductive amination of an appropriately functionalized 3beta-aminosterol with spermidinyl aldehyde 17 utilizing sodium triacetoxyborohydride as the reducing agent. Compound 2 shows weaker antimicrobial activity than squalamine. PMID:11003150

  3. [Dmt(1)]DALDA analogues modified with tyrosine analogues at position 1.

    PubMed

    Cai, Yunxin; Lu, Dandan; Chen, Zhen; Ding, Yi; Chung, Nga N; Li, Tingyou; Schiller, Peter W

    2016-08-01

    Analogues of [Dmt(1)]DALDA (H-Dmt-d-Arg-Phe-Lys-NH2; Dmt=2',6'-dimethyltyrosine), a potent μ opioid agonist peptide with mitochondria-targeted antioxidant activity were prepared by replacing Dmt with various 2',6'-dialkylated Tyr analogues, including 2',4',6'-trimethyltyrosine (Tmt), 2'-ethyl-6'-methyltyrosine (Emt), 2'-isopropyl-6'-methyltyrosine (Imt) and 2',6'-diethyltyrosine (Det). All compounds were selective μ opioid agonists and the Tmt(1)-, Emt(1) and Det(1)-analogues showed subnanomolar μ opioid receptor binding affinities. The Tmt(1)- and Emt(1)-analogues showed improved antioxidant activity compared to the Dmt(1)-parent peptide in the DPPH radical-scavenging capacity assay, and thus are of interest as drug candidates for neuropathic pain treatment. PMID:27301366

  4. Modification and translocation of Rac/Rop guanosine 5'-triphosphate-binding proteins of Scoparia dulcis in response to stimulation with methyl jasmonate.

    PubMed

    Mitamura, Toshiaki; Yamamura, Yoshimi; Kurosaki, Fumiya

    2011-01-01

    Translocation of two Rac/Rop guanosine 5'-triphosphate-binding proteins from Scoparia dulcis, Sdrac-1 and Sdrac-2, was examined employing transformed belladonna which overproduces these proteins as glutathione-S-transferase-tagged forms. The transferase activities of the fused proteins in microsomal fraction of belladonna markedly increased by the incubation with methyl jasmonate either in Sdrac-1 or Sdrac-2 transformant, while low and constant activities were observed in the untreated control. Recombinant Sdrac-2 protein was found to bind to prenyl chain in the presence of cell extracts prepared from methyl jasmonate-treated S. dulcis, however, Sdrac-1 was palmitoylated by the addition of the cell extracts. These results suggest that both Sdrac-1 and Sdrac-2 translocate to plant membranes by the stimulation with methyl jasmonate, however, targeting of these proteins is triggered by the independent modification mechanisms, palmitoylation for Sdrac-1 and prenylation for Sdrac-2. PMID:21628882

  5. Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

    PubMed

    Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

    2008-11-01

    A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level. PMID:18981590

  6. Mechanistic Investigation of cPMP Synthase in Molybdenum Cofactor Biosynthesis Using an Uncleavable Substrate Analogue

    PubMed Central

    Hover, Bradley M.; Lilla, Edward A.; Yokoyama, Kenichi

    2016-01-01

    Molybdenum cofactor (Moco) is essential for all kingdoms of life, plays central roles in various biological processes, and must be biosynthesized de novo. During its biosynthesis, the characteristic pyranopterin ring is constructed by a complex rearrangement of guanosine 5′-triphosphate (GTP) into cyclic pyranopterin monophosphate (cPMP) through the action of two enzymes, MoaA and MoaC. Recent studies revealed that MoaC catalyzes the majority of the transformation and produces cPMP from a unique cyclic nucleotide, 3′,8-cyclo-7,8-dihydro-GTP (3′,8-cH2GTP). However, the mechanism by which MoaC catalyzes this complex rearrangement is largely unexplored. Here, we report the mechanistic characterization of MoaC using an uncleavable substrate analogue, 3′,8-cH2GMP[CH2]PP, as a probe to investigate the timing of cyclic phosphate formation. Using partially active MoaC variants, 3′,8-cH2GMP[CH2]PP was found to be accepted by MoaC as a substrate and was converted to an analogue of the previously described MoaC reaction intermediate, suggesting that the early stage of catalysis proceeds without cyclic phosphate formation. In contrast, when it was incubated with wt-MoaC, 3′,8-cH2GMP[CH2]PP caused mechanism-based inhibition. Detailed characterization of the inhibited MoaC suggested that 3′,8-cH2GMP[CH2]PP is mainly converted to a molecule (compound Y) with an acid-labile triaminopyrimidinone base without an established pyranopterin structure. MS analysis of MoaC treated with 3′,8-cH2GMP[CH2]PP provided strong evidence that compound Y forms a tight complex with MoaC likely through a covalent linkage. These observations are consistent with a mechanism in which cyclic phosphate ring formation proceeds in concert with the pterin ring formation. This mechanism would provide a thermodynamic driving force to complete the formation of the unique tetracyclic structure of cPMP. PMID:26575208

  7. Mechanistic Investigation of cPMP Synthase in Molybdenum Cofactor Biosynthesis Using an Uncleavable Substrate Analogue.

    PubMed

    Hover, Bradley M; Lilla, Edward A; Yokoyama, Kenichi

    2015-12-15

    Molybdenum cofactor (Moco) is essential for all kingdoms of life, plays central roles in various biological processes, and must be biosynthesized de novo. During its biosynthesis, the characteristic pyranopterin ring is constructed by a complex rearrangement of guanosine 5'-triphosphate (GTP) into cyclic pyranopterin monophosphate (cPMP) through the action of two enzymes, MoaA and MoaC. Recent studies revealed that MoaC catalyzes the majority of the transformation and produces cPMP from a unique cyclic nucleotide, 3',8-cyclo-7,8-dihydro-GTP (3',8-cH2GTP). However, the mechanism by which MoaC catalyzes this complex rearrangement is largely unexplored. Here, we report the mechanistic characterization of MoaC using an uncleavable substrate analogue, 3',8-cH2GMP[CH2]PP, as a probe to investigate the timing of cyclic phosphate formation. Using partially active MoaC variants, 3',8-cH2GMP[CH2]PP was found to be accepted by MoaC as a substrate and was converted to an analogue of the previously described MoaC reaction intermediate, suggesting that the early stage of catalysis proceeds without cyclic phosphate formation. In contrast, when it was incubated with wt-MoaC, 3',8-cH2GMP[CH2]PP caused mechanism-based inhibition. Detailed characterization of the inhibited MoaC suggested that 3',8-cH2GMP[CH2]PP is mainly converted to a molecule (compound Y) with an acid-labile triaminopyrimidinone base without an established pyranopterin structure. MS analysis of MoaC treated with 3',8-cH2GMP[CH2]PP provided strong evidence that compound Y forms a tight complex with MoaC likely through a covalent linkage. These observations are consistent with a mechanism in which cyclic phosphate ring formation proceeds in concert with the pterin ring formation. This mechanism would provide a thermodynamic driving force to complete the formation of the unique tetracyclic structure of cPMP. PMID:26575208

  8. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine*S⃞

    PubMed Central

    Demirci, Hasan; Gregory, Steven T.; Dahlberg, Albert E.; Jogl, Gerwald

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N2-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate. PMID:18667428

  9. Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

    PubMed Central

    Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

    1999-01-01

    We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

  10. Recent advances in topoisomerase I-targeting agents, camptothecin analogues.

    PubMed

    Kim, Dae-Kee; Lee, Namkyu

    2002-12-01

    The present review concentrates on camptothecin (CPT) analogues, the most extensively studied topoisomerase I (topo I) inhibitors, and provides concise information on the structural features of human topo I enzyme, mechanisms of interaction of CPT with topo I, structure-activity relationship study of CPT analogues including the influence of lactone stability on antitumor activity, and recent updates of valuable CPT analogues. PMID:12370044

  11. [Insulin analogues: modifications in the structure, molecular and metabolic consequences].

    PubMed

    de Luis, D A; Romero, E

    2013-01-01

    Recombinant DNA technology has provided insulin analogues for the treatment of diabetes mellitus, with an efficacy and safety that has improved the treatment of this disease. We briefly review the principal characteristics of the insulin analogues currently available. Both rapid-acting (lispro, aspart and glulisine) and long acting (glargine and determir) insulin analogues are included in this review. We describe the pharmacology of each insulin analogue, their differences with the human insulin, the administration, indication, efficacy and safety. In addition we discussed the main controversies of the use of these insulin analogues. In particular, those related with the risk of cancer and retinopathy, and their use in pregnant women. PMID:23517895

  12. Design and synthesis of new fluconazole analogues.

    PubMed

    Pore, Vandana S; Agalave, Sandip G; Singh, Pratiksha; Shukla, Praveen K; Kumar, Vikash; Siddiqi, Mohammad I

    2015-06-21

    We have synthesized new fluconazole analogues containing two different 1,2,3-triazole units in the side chain. The synthesis of new amide analogues using a variety of acids is also described. All the compounds showed very good antifungal activity. A hemolysis study of the most active compounds 6e and 13j showed that both compounds did not cause any hemolysis at the dilutions tested. These compounds did not exhibit any toxicity to L929 cells at MIC and lower concentrations. In the docking study, the overall binding mode of 6e and 13j appeared to be reasonable and provided a good insight into the structural basis of inhibition of Candida albicans Cyp51 by these compounds. PMID:25975803

  13. Efficient synthesis of esermethole and its analogues.

    PubMed

    Zhou, Yongyun; Zhao, Yuanhong; Dai, Xiaoyong; Liu, Jianping; Li, Liang; Zhang, Hongbin

    2011-06-01

    In this work, a general and flexible synthetic route towards the synthesis of pyrroloindoline alkaloids was developed. This new strategy features with a palladium mediated sequential arylation-allylation of o-bromoanilides and leads to the construction of oxindoles bearing a full carbon quaternary center. The cheap triphenylphosphine was proved to be a highly effective ligand for this one pot transformation. On the basis of this new method, esermethole and its analogues were synthesized. PMID:21472186

  14. Synthesis of constrained analogues of tryptophan

    PubMed Central

    Negrato, Marco; Abbiati, Giorgio; Dell’Acqua, Monica

    2015-01-01

    Summary A Lewis acid-catalysed diastereoselective [4 + 2] cycloaddition of vinylindoles and methyl 2-acetamidoacrylate, leading to methyl 3-acetamido-1,2,3,4-tetrahydrocarbazole-3-carboxylate derivatives, is described. Treatment of the obtained cycloadducts under hydrolytic conditions results in the preparation of a small library of compounds bearing the free amino acid function at C-3 and pertaining to the class of constrained tryptophan analogues. PMID:26664620

  15. Synthesis and cytotoxic activity of acetogenin analogues.

    PubMed

    Rodier, S; Le Huérou, Y; Renoux, B; Doyon, J; Renard, P; Pierré, A; Gesson, J P; Grée, R

    2000-06-19

    A set of 16 new simplified analogues of acetogenins has been designed based on: (i) the replacement of the bis THF moiety of these natural products by an ethylene glycol bis ether unit; (ii) the introduction of different lipophilic side chains (alkyl, aryl, dialkylamino, O-cholesteryl); (iii) the presence of the same terminal isolactone. In vitro cytotoxic activity against L1210 leukemia is reported. PMID:10890167

  16. The Brookhaven electron analogue, 1953--1957

    SciTech Connect

    Plotkin, M.

    1991-12-18

    The following topics are discussed on the Brookhaven electron analogue: L.J. Haworth and E.L. VanHorn letters; Original G.K. Green outline for report; General description; Parameter list; Mechanical Assembly; Alignment; Degaussing; Vacuum System; Injection System; The pulsed inflector; RF System; Ferrite Cavity; Pick-up electrodes and preamplifiers; Radio Frequency power amplifier; Lens supply; Controls and Power; and RF acceleration summary.

  17. Blood Loss Estimation Using Gauze Visual Analogue

    PubMed Central

    Ali Algadiem, Emran; Aleisa, Abdulmohsen Ali; Alsubaie, Huda Ibrahim; Buhlaiqah, Noora Radhi; Algadeeb, Jihad Bagir; Alsneini, Hussain Ali

    2016-01-01

    Background Estimating intraoperative blood loss can be a difficult task, especially when blood is mostly absorbed by gauze. In this study, we have provided an improved method for estimating blood absorbed by gauze. Objectives To develop a guide to estimate blood absorbed by surgical gauze. Materials and Methods A clinical experiment was conducted using aspirated blood and common surgical gauze to create a realistic amount of absorbed blood in the gauze. Different percentages of staining were photographed to create an analogue for the amount of blood absorbed by the gauze. Results A visual analogue scale was created to aid the estimation of blood absorbed by the gauze. The absorptive capacity of different gauze sizes was determined when the gauze was dripping with blood. The amount of reduction in absorption was also determined when the gauze was wetted with normal saline before use. Conclusions The use of a visual analogue may increase the accuracy of blood loss estimation and decrease the consequences related to over or underestimation of blood loss. PMID:27626017

  18. Three Efficient Methods for Preparation of Coelenterazine Analogues.

    PubMed

    Shakhmin, Anton; Hall, Mary P; Walker, Joel R; Machleidt, Thomas; Binkowski, Brock F; Wood, Keith V; Kirkland, Thomas A

    2016-07-18

    The growing popularity of bioluminescent assays has highlighted the need for coelenterazine analogues possessing properties tuned for specific applications. However, the structural diversity of known coelenterazine analogues has been limited by current syntheses. Known routes for the preparation of coelenterazine analogues employ harsh reaction conditions that limit access to many substituents and functional groups. Novel synthetic routes reported here establish simple and robust methods for synthesis and investigation of structurally diverse marine luciferase substrates. Specifically, these new routes allow synthesis of coelenterazine analogues containing various heterocyclic motifs and substituted aromatic groups with diverse electronic substituents at the R(2) position. Interesting analogues described herein were characterized by their physicochemical properties, bioluminescent half-life, light output, polarity and cytotoxicity. Some of the analogues represent leads that can be utilized in the development of improved bioluminescent systems. PMID:27305599

  19. U.S. Nuclear Regulatory Commission natural analogue research program

    SciTech Connect

    Kovach, L.A.; Ott, W.R.

    1995-09-01

    This article describes the natural analogue research program of the U.S. Nuclear Regulatory Commission (US NRC). It contains information on the regulatory context and organizational structure of the high-level radioactive waste research program plan. It also includes information on the conditions and processes constraining selection of natural analogues, describes initiatives of the US NRC, and describes the role of analogues in the licensing process.

  20. CO2 Removal using a Synthetic Analogue of Carbonic Anhydrase

    SciTech Connect

    Cordatos, Harry

    2010-09-14

    Project attempts to develop a synthetic analogue for carbonic anhydrase and incorporate it in a membrane for separation of CO2 from coal power plant flue gas. Conference poster presents result of first 9 months of project progress including concept, basic system architecture and membrane properties target, results of molecular modeling for analogue - CO2 interaction, and next steps of testing analogue resistance to flue gas contaminants.

  1. Conformationally restrained aromatic analogues of fosmidomycin and FR900098.

    PubMed

    Kurz, Thomas; Schlüter, Katrin; Pein, Miriam; Behrendt, Christoph; Bergmann, Bärbel; Walter, Rolf D

    2007-07-01

    The synthesis and in-vitro antimalarial activity of conformationally restrained bis(pivaloyloxymethyl) ester analogues of the natural product fosmidomycin is presented. In contrast to alpha-aryl-substituted analogues, conformationally restrained aromatic analogues exhibit only moderate in-vitro antimalarial activity against the chloroquine-sensitive strain 3D7 of Plasmodium falciparum. The most active derivative displays an IC(50) value of 47 microM. PMID:17611943

  2. Phonon analogue of topological nodal semimetals

    NASA Astrophysics Data System (ADS)

    Po, Hoi Chun; Bahri, Yasaman; Vishwanath, Ashvin

    2015-03-01

    Recently, Kane and Lubensky proposed a mapping between bosonic phonon problems on isostatic lattices to chiral fermion systems based on factorization of the dynamical matrix [Nat. Phys. 10, 39 (2014)]. The existence of topologically protected zero modes in such mechanical problems is related to their presence in the fermionic system and is dictated by a local index theorem. Here we adopt the proposed mapping to construct a two-dimensional mechanical analogue of a fermionic topological nodal semimetal that hosts a robust bulk node in its linearized phonon spectrum. Such topologically protected soft modes with tunable wavevector may be useful in designing mechanical structures with fault-tolerant properties.

  3. Digitoxin Analogues with Improved Anticytomegalovirus Activity

    PubMed Central

    2014-01-01

    Cardiac glycosides are potent inhibitors of cancer cell growth and possess antiviral activities at nanomolar concentrations. In this study we evaluated the anticytomegalovirus (CMV) activity of digitoxin and several of its analogues. We show that sugar type and sugar length attached to the steroid core structure affects its anticytomegalovirus activity. Structure–activity relationship (SAR) studies identified the l-sugar containing cardiac glycosides as having improved anti-CMV activity and may lead to better understanding of how these compounds inhibit CMV replication. PMID:24900847

  4. Analogue factoring algorithm based on polychromatic interference

    NASA Astrophysics Data System (ADS)

    Tamma, Vincenzo; Garuccio, Augusto; Shih, Yanhua

    2010-08-01

    We present a novel factorization algorithm which can be computed using an analogue computer based on a polychromatic source with a given wavelength bandwidth, a multi-path interferometer and a spectrometer. The core of this algorithm stands on the measurement of the periodicity of a "factoring" function given by an exponential sum at continuous argument by recording a sequence of interferograms associated with suitable units of displacement in the inteferometer. A remarking rescaling property of such interferograms allows, in principle, the prime number decomposition of several large integers. The information about factors is encoded in the location of the inteferogram maxima.

  5. Spectroscopic study of solar twins and analogues

    NASA Astrophysics Data System (ADS)

    Datson, Juliet; Flynn, Chris; Portinari, Laura

    2015-02-01

    Context. Many large stellar surveys have been and are still being carried out, providing huge amounts of data, for which stellar physical parameters will be derived. Solar twins and analogues provide a means to test the calibration of these stellar catalogues because the Sun is the best-studied star and provides precise fundamental parameters. Solar twins should be centred on the solar values. Aims: This spectroscopic study of solar analogues selected from the Geneva-Copenhagen Survey (GCS) at a resolution of 48 000 provides effective temperatures and metallicities for these stars. We test whether our spectroscopic parameters, as well as the previous photometric calibrations, are properly centred on the Sun. In addition, we search for more solar twins in our sample. Methods: The methods used in this work are based on literature methods for solar twin searches and on methods we developed in previous work to distinguish the metallicity-temperature degeneracies in the differential comparison of spectra of solar analogues versus a reference solar reflection spectrum. Results: We derive spectroscopic parameters for 148 solar analogues (about 70 are new entries to the literature) and verify with a-posteriori differential tests that our values are well-centred on the solar values. We use our dataset to assess the two alternative calibrations of the GCS parameters; our methods favour the latest revision. We show that the choice of spectral line list or the choice of asteroid or time of observation does not affect the results. We also identify seven solar twins in our sample, three of which are published here for the first time. Conclusions: Our methods provide an independent means to differentially test the calibration of stellar catalogues around the values of a well-known benchmark star, which makes our work interesting for calibration tests of upcoming Galactic surveys. Based on observations made with ESO Telescopes at the La Silla Observatory under programme ID 077.D

  6. Materials analogue of zero-stiffness structures

    NASA Astrophysics Data System (ADS)

    Kumar, Arun; Subramaniam, Anandh

    2011-04-01

    Anglepoise lamps and certain tensegrities are examples of zero-stiffness structures. These structures are in a state of neutral equilibrium with respect to changes in configuration of the system. Using Eshelby's example of an edge dislocation in a thin plate that can bend, we report the discovery of a non-trivial new class of material structures as an analogue to zero-stiffness structures. For extended positions of the edge dislocation in these structures, the dislocation experiences a zero image force. Salient features of these material structures along with the key differences from conventional zero-stiffness structures are pointed out.

  7. Adenosine 3′:5′-cyclic monophosphate- and guanosine 3′:5′-cyclic monophosphate-dependent protein kinases: Possible homologous proteins

    PubMed Central

    Lincoln, Thomas M.; Corbin, Jackie D.

    1977-01-01

    The properties of purified mammalian adenosine 3′:5′-cyclic monophosphate (cAMP)- and guanosine 3′:5′-cyclic monophosphate (cGMP)-dependent protein kinases were compared. Several physical characteristics of the two enzymes were similar, including size, shape, affinity for cyclic nucleotide binding, and Km for ATP. In addition, the amino acid composition of the two proteins indicated a close composition homology (70-90%). Both cyclic nucleotide-dependent protein kinases catalyzed phosphorylation of rat liver pyruvate kinase (EC 2.7.1.40) and fructose 1,6-diphosphatase (EC 3.1.3.11), rabbit skeletal muscle glycogen synthase (EC 2.4.1.11) and phosphorylase b kinase (EC 2.7.1.38), and calf thymus histone H2b. The phosphorylation of several synthetic peptides and of trypsin-sensitive and trypsin-insensitive sites in glycogen synthase suggested similar recognition sites on the protein substrates for the two kinases. The cAMP-dependent protein kinase was the better catalyst with each protein or peptides substrate. The results suggest that the two enzymes evolved from a common ancestral protein. Images PMID:198777

  8. An Interplay among FIS, H-NS, and Guanosine Tetraphosphate Modulates Transcription of the Escherichia coli cspA Gene under Physiological Growth Conditions.

    PubMed

    Brandi, Anna; Giangrossi, Mara; Giuliodori, Anna M; Falconi, Maurizio

    2016-01-01

    CspA, the most characterized member of the csp gene family of Escherichia coli, is highly expressed not only in response to cold stress, but also during the early phase of growth at 37°C. Here, we investigate at molecular level the antagonistic role played by the nucleoid proteins FIS and H-NS in the regulation of cspA expression under non-stress conditions. By means of both probing experiments and immunological detection, we demonstrate in vitro the existence of binding sites for these proteins on the cspA regulatory region, in which FIS and H-NS bind simultaneously to form composite DNA-protein complexes. While the in vitro promoter activity of cspA is stimulated by FIS and repressed by H-NS, a compensatory effect is observed when both proteins are added in the transcription assay. Consistently with these findings, inactivation of fis and hns genes reversely affect the in vivo amount of cspA mRNA. In addition, by means of strains expressing a high level of the alarmone guanosine tetraphosphate ((p)ppGpp) and in vitro transcription assays, we show that the cspA promoter is sensitive to (p)ppGpp inhibition. The (p)ppGpp-mediated expression of fis and hns genes is also analyzed, thus clarifying some aspects of the regulatory loop governing cspA transcription. PMID:27252944

  9. Selective blockade of phosphodiesterase types 2, 5 and 9 results in cyclic 3′5′ guanosine monophosphate accumulation in retinal pigment epithelium cells

    PubMed Central

    Diederen, R M H; Heij, E C La; Ittersum, M Markerink‐van; Kijlstra, A; Hendrikse, F; de Vente, J

    2007-01-01

    Aim To investigate which phosphodiesterase (PDE) is involved in regulating cyclic 3′5′ guanosine monophosphate breakdown in retinal pigment epithelium (RPE) cells. Methods cGMP content in the cultured RPE cells (D407 cell line) was evaluated by immunocytochemistry in the presence of non‐selective or isoform‐selective PDE inhibitors in combination with the particulate guanylyl cyclase stimulator atrial natriuretic peptide (ANP) or the soluble guanylyl cyclase stimulator sodium nitroprusside (SNP). mRNA expression of PDE2, PDE5 and PDE9 was studied in cultured human RPE cells and rat RPE cell layers using non‐radioactive in situ hybridisation. Results In the absence of PDE inhibitors, cGMP levels in cultured RPE cells are very low. cGMP accumulation was readily detected in cultured human RPE cells after incubation with Bay60–7550 as a selective PDE2 inhibitor, sildenafil as a selective PDE5 inhibitor or Sch51866 as a selective PDE9 inhibitor. In the presence of PDE inhibition, cGMP content increased markedly after stimulation of the particulate guanylyl cyclase. mRNA of PDE2,PDE5 and PDE9 was detected in all cultured human RPE cells and also in rat RPE cell layers. Conclusions PDE2, PDE5 and PDE9 have a role in cGMP metabolism in RPE cells. PMID:16943225

  10. Coordination of two sequential ester-transfer reactions: exogenous guanosine binding promotes the subsequent omegaG binding to a group I intron.

    PubMed

    Bao, Penghui; Wu, Qi-Jia; Yin, Ping; Jiang, Yanfei; Wang, Xu; Xie, Mao-Hua; Sun, Tao; Huang, Lin; Mo, Ding-Ding; Zhang, Yi

    2008-12-01

    Self-splicing of group I introns is accomplished by two sequential ester-transfer reactions mediated by sequential binding of two different guanosine ligands, but it is yet unclear how the binding is coordinated at a single G-binding site. Using a three-piece trans-splicing system derived from the Candida intron, we studied the effect of the prior GTP binding on the later omegaG binding by assaying the ribozyme activity in the second reaction. We showed that adding GTP simultaneously with and prior to the esterified omegaG in a substrate strongly accelerated the second reaction, suggesting that the early binding of GTP facilitates the subsequent binding of omegaG. GTP-mediated facilitation requires C2 amino and C6 carbonyl groups on the Watson-Crick edge of the base but not the phosphate or sugar groups, suggesting that the base triple interactions between GTP and the binding site are important for the subsequent omegaG binding. Strikingly, GTP binding loosens a few local structures of the ribozyme including that adjacent to the base triple, providing structural basis for a rapid exchange of omegaG for bound GTP. PMID:18978026

  11. tRNA recognition for modification: solution probing of tRNA complexed with Escherichia coli tRNA (guanosine-1) methyltransferase.

    PubMed

    Gabryszuk, J; Holmes, W M

    1997-11-01

    The interaction of Escherichia coli tRNA (guanosine-1) methyltransferase and tRNA(1Leu) transcripts has been probed using cleavage with iodine of phosphorothioate-substituted transcripts, lead acetate, and enzymes specific for single- and double-stranded RNA. All lytic agents protect the anticodon stem-loop and variable loop regions against cleavage, and some protection is also seen in core structures of the tRNA. Residues from both strands of the anticodon stem are protected against cleavage with iodine and lead by enzyme, yet positions G37 and G36, which are crucial for catalysis and binding, are not. This suggests that these residues may undergo structural perturbation in the presence of S-adenosyl methionine. Occupancy of the AdoMet site by the product S-adenosyl-homocysteine, a potent inhibitor of the enzyme, has little or no effect on tRNA binding or protection. Enhanced reactivity with lead is seen at residues located in the anticodon stem-loop, extra-loop, and core (C34, U47c, and G49), which suggests some perturbations in RNA structure might accompany binding. PMID:9409623

  12. An Interplay among FIS, H-NS, and Guanosine Tetraphosphate Modulates Transcription of the Escherichia coli cspA Gene under Physiological Growth Conditions

    PubMed Central

    Brandi, Anna; Giangrossi, Mara; Giuliodori, Anna M.; Falconi, Maurizio

    2016-01-01

    CspA, the most characterized member of the csp gene family of Escherichia coli, is highly expressed not only in response to cold stress, but also during the early phase of growth at 37°C. Here, we investigate at molecular level the antagonistic role played by the nucleoid proteins FIS and H-NS in the regulation of cspA expression under non-stress conditions. By means of both probing experiments and immunological detection, we demonstrate in vitro the existence of binding sites for these proteins on the cspA regulatory region, in which FIS and H-NS bind simultaneously to form composite DNA-protein complexes. While the in vitro promoter activity of cspA is stimulated by FIS and repressed by H-NS, a compensatory effect is observed when both proteins are added in the transcription assay. Consistently with these findings, inactivation of fis and hns genes reversely affect the in vivo amount of cspA mRNA. In addition, by means of strains expressing a high level of the alarmone guanosine tetraphosphate ((p)ppGpp) and in vitro transcription assays, we show that the cspA promoter is sensitive to (p)ppGpp inhibition. The (p)ppGpp-mediated expression of fis and hns genes is also analyzed, thus clarifying some aspects of the regulatory loop governing cspA transcription. PMID:27252944

  13. Structural Basis of Differential Ligand Recognition by Two Classes of bis-(3-5)-cyclic Dimeric Guanosine Monophosphate-binding Riboswitches

    SciTech Connect

    K Smith; C Shanahan; E Moore; A Simon; S Strobel

    2011-12-31

    The bis-(3'-5')-cyclic dimeric guanosine monophosphate (c-di-GMP) signaling pathway regulates biofilm formation, virulence, and other processes in many bacterial species and is critical for their survival. Two classes of c-di-GMP-binding riboswitches have been discovered that bind this second messenger with high affinity and regulate diverse downstream genes, underscoring the importance of RNA receptors in this pathway. We have solved the structure of a c-di-GMP-II riboswitch, which reveals that the ligand is bound as part of a triplex formed with a pseudoknot. The structure also shows that the guanine bases of c-di-GMP are recognized through noncanonical pairings and that the phosphodiester backbone is not contacted by the RNA. Recognition is quite different from that observed in the c-di-GMP-I riboswitch, demonstrating that at least two independent solutions for RNA second messenger binding have evolved. We exploited these differences to design a c-di-GMP analog that selectively binds the c-di-GMP-II aptamer over the c-di-GMP-I RNA. There are several bacterial species that contain both types of riboswitches, and this approach holds promise as an important tool for targeting one riboswitch, and thus one gene, over another in a selective fashion.

  14. Human monocyte killing of Staphylococcus aureus: modulation by agonists of cyclic adenosine 3',5'-monophosphate and cyclic guanosine 3',5'-monophosphate.

    PubMed Central

    O'Dorisio, M S; Vandenbark, G R; LoBuglio, A F

    1979-01-01

    This study was designed to test whether cyclic nucleotides play a role in the regulation of bacterial killing by human monocytes. Agents were tested for their ability to activate monocyte adenylate or guanylate cyclase in cell-free preparations, to increase cyclic adenosine 3',5'-monophosphate (cAMP) or cyclic guanosine 3',5'-monophosphate (cGMP) in intact human monocytes, and to modulate monocyte-induced killing of Staphylococcus aureus in vitro. Prostaglandin E1 and cholera toxin activated monocyte adenylate cyclase and inhibited monocyte killing of S. aureus. An adenylate cyclase inhibitor, RMI 12330A, reversed the prostaglandin E1-mediated inhibition of bacterial killing, thus implicating cAMP as the intracellular mediator of this inhibition. In contrast, monocyte cGMP levels were increased 5- and 17-fold by 5-hydroxytryptamine and N-methyl-N' -nitro-N-nitrosoguanidine, respectively, but neither agent was effective in modulating monocyte bactericidal activity. Thus, modulation of bactericidal activity in human monocytes did not conform to the yin/yang theory of opposing actions by cAMP and cGMP, for although monocyte-mediated killing of S. aureus was inhibited by cAMP agonists, it was not enhanced by cGMP agonists. PMID:44704

  15. Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

    PubMed

    Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

    2009-06-01

    A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms. PMID:19483328

  16. Antinociceptive Effect of Vardenafil on Carrageenan-Induced Hyperalgesia in Rat: involvement of Nitric Oxide/Cyclic Guanosine Monophosphate/Calcium Channels Pathway.

    PubMed

    Gediz, Ezgi İkiz; Nacitarhan, Cahit; Minareci, Edibe; Sadan, Gulay

    2015-01-01

    In this study, we aimed to investigate the peripheral antinociception effects of specific phosphodiesterase 5 (PDE-5) inhibitor vardenafil on carrageenan-induced nociception in rats, and the role of calcium besides the L-arginine- nitric oxide (NO)- cyclic guanosine monophophate (cGMP) pathway in these effects. Hyperalgesia was induced by the intraplantar injection of 0.1 mL fresh carrageenan solution to right hind-paw whereas, saline as a vehicle of carrageenan was injected to the left paw. This procedure was used for measuring mechanic nociception pressure via an analgesimeter. Pressure which produced nociception was measured before (0 minute) and after(15, 30, 60 and 120 minutes) carrageenan injection. Local administration of vardenafil produced a dose-dependent antinociceptive effect. Pretreatment with N(W)-nitro-L-arginine methyl ester (L-NAME, nitric oxide synthase inhibitor), oxadiazolo (4, 3, a) quinoxalin -1-one (ODQ, inhibitor of guanylyl cyclase) or A23187 (calcium ionophore) decreased the effect of vardenafil. In contrast, L-arginine (nitric oxide donor) seemed to potentiate the vardenafil-induced antinociception. Our results suggest that phosphodiesterase type-5 inhibitor vardenafil may offer a new therapeutic tool to treat pain. It's effect was probably result from L-arginine/NO-cGMP pathway activation and Ca + 2 channels are also involved. PMID:26664380

  17. Antinociceptive Effect of Vardenafil on Carrageenan-Induced Hyperalgesia in Rat: involvement of Nitric Oxide/Cyclic Guanosine Monophosphate/Calcium Channels Pathway

    PubMed Central

    Gediz, Ezgi İkiz; Nacitarhan, Cahit; Minareci, Edibe; Sadan, Gulay

    2015-01-01

    In this study, we aimed to investigate the peripheral antinociception effects of specific phosphodiesterase 5 (PDE-5) inhibitor vardenafil on carrageenan-induced nociception in rats, and the role of calcium besides the L-arginine- nitric oxide (NO)- cyclic guanosine monophophate (cGMP) pathway in these effects. Hyperalgesia was induced by the intraplantar injection of 0.1 mL fresh carrageenan solution to right hind-paw whereas, saline as a vehicle of carrageenan was injected to the left paw. This procedure was used for measuring mechanic nociception pressure via an analgesimeter. Pressure which produced nociception was measured before (0 minute) and after(15, 30, 60 and 120 minutes) carrageenan injection. Local administration of vardenafil produced a dose-dependent antinociceptive effect. Pretreatment with NW-nitro-L-arginine methyl ester (L-NAME, nitric oxide synthase inhibitor), oxadiazolo (4, 3, a) quinoxalin -1-one (ODQ, inhibitor of guanylyl cyclase) or A23187 (calcium ionophore) decreased the effect of vardenafil. In contrast, L-arginine (nitric oxide donor) seemed to potentiate the vardenafil-induced antinociception. Our results suggest that phosphodiesterase type-5 inhibitor vardenafil may offer a new therapeutic tool to treat pain. It’s effect was probably result from L-arginine/NO-cGMP pathway activation and Ca + 2 channels are also involved. PMID:26664380

  18. Transforming growth factor-β inhibits IQ motif containing guanosine triphosphatase activating protein 1 expression in lung fibroblasts via the nuclear factor-κB signaling pathway.

    PubMed

    Zong, Chuanyue; Zhang, Xianlong; Xie, Ying; Cheng, Jiawen

    2015-07-01

    IQ motif containing guanosine triphosphatase activating protein 1 (IQGAP1) is associated with idiopathic pulmonary fibrogenesis (IPF); however, characterization of the expression of IQGAP1 in lung fibroblasts has remained elusive. The present study therefore evaluated IQGAP1 expression in mouse and human lung fibroblasts under fibrotic conditions via western blot analysis. It was revealed that IQGAP1 expression levels were significantly decreased in lung fibroblasts isolated from bleomycin-challenged mice than in those of control mice. Transforming growth factor-β (TGF-β) induced differentiation, as well as decreased expression of IQGAP1 in WI-38 cells human lung fibroblasts. Furthermore, inhibition of nuclear factor (NF)-κB activation restored the TGF-β-induced inhibition of IQGAP1 expression in WI-38 cells. In lysophosphatidic acid (LPA)-challenged WI-38 cells, the expression of IQGAP1 was also decreased, while neutralized anti-TGF-β antibody treatment restored the LPA-induced inhibition of IQGAP1 expression. These data indicated that TGF-β inhibited IQGAP1 expression in lung fibroblasts via the NF-κB signaling pathway, presenting a potential novel therapeutic target for the treatment of IPF. PMID:25684348

  19. DNA 3' pp 5' G de-capping activity of aprataxin: effect of cap nucleoside analogs and structural basis for guanosine recognition

    DOE PAGESBeta

    Chauleau, Mathieu; Jacewicz, Agata; Shuman, Stewart

    2015-05-24

    DNA3' pp 5'G caps synthesized by the 3'-PO4/5'-OH ligase RtcB have a strong impact on enzymatic reactions at DNA 3'-OH ends. Aprataxin, an enzyme that repairs A5'pp5'DNA ends formed during abortive ligation by classic 3'-OH/5'-PO4 ligases, is also a DNA 3' de-capping enzyme, converting DNAppG to DNA3'p and GMP. By taking advantage of RtcB's ability to utilize certain GTP analogs to synthesize DNAppN caps, we show that aprataxin hydrolyzes inosine and 6-O-methylguanosine caps, but is not adept at removing a deoxyguanosine cap. We report a 1.5 Å crystal structure of aprataxin in a complex with GMP, which reveals that: (i)more » GMP binds at the same position and in the same anti nucleoside conformation as AMP; and (ii) aprataxin makes more extensive nucleobase contacts with guanine than with adenine, via a hydrogen bonding network to the guanine O6, N1, N2 base edge. Alanine mutations of catalytic residues His147 and His149 abolish DNAppG de-capping activity, suggesting that the 3' de-guanylylation and 5' de-adenylylation reactions follow the same pathway of nucleotidyl transfer through a covalent aprataxin-(His147)–NMP intermediate. Alanine mutation of Asp63, which coordinates the guanosine ribose hydroxyls, impairs DNAppG de-capping.« less

  20. The electrical properties of Mars analogue dust

    NASA Astrophysics Data System (ADS)

    Merrison, J.; Jensen, J.; Kinch, K.; Mugford, R.; Nørnberg, P.

    2004-03-01

    Dust is a major environmental factor on the surface and in the atmosphere of Mars. Knowing the electrical charge state of this dust would be of both scientific interest and important for the safety of instruments on the Martian surface. In this study the first measurements have been performed of dust electrification using suspended Mars analogue material. This has been achieved by attracting suspended dust onto electrodes placed inside a Mars simulation wind tunnel. The Mars analogue used was from Salten Skov in Denmark, this contained a high concentration of ferric oxide precipitate. Once suspended, this dust was found to consist of almost equal quantities of negatively (46±6%) and positively (44±15%) charged grains. These grains were estimated to typically carry a net charge of around 10 5e, this is sufficient to dominate the processes of adhesion and cohesion of this suspended dust. Evidence is presented for electrostatic aggregation of the dust while in suspension. Development of a simple instrument for measuring electrical charging of the suspended dust on Mars will be discussed.

  1. Long-term predictions using natural analogues

    SciTech Connect

    Ewing, R.C.

    1995-09-01

    One of the unique and scientifically most challenging aspects of nuclear waste isolation is the extrapolation of short-term laboratory data (hours to years) to the long time periods (10{sup 3}-10{sup 5} years) required by regulatory agencies for performance assessment. The direct validation of these extrapolations is not possible, but methods must be developed to demonstrate compliance with government regulations and to satisfy the lay public that there is a demonstrable and reasonable basis for accepting the long-term extrapolations. Natural systems (e.g., {open_quotes}natural analogues{close_quotes}) provide perhaps the only means of partial {open_quotes}validation,{close_quotes} as well as data that may be used directly in the models that are used in the extrapolation. Natural systems provide data on very large spatial (nm to km) and temporal (10{sup 3}-10{sup 8} years) scales and in highly complex terranes in which unknown synergisms may affect radionuclide migration. This paper reviews the application (and most importantly, the limitations) of data from natural analogue systems to the {open_quotes}validation{close_quotes} of performance assessments.

  2. Self-Powered Analogue Smart Skin.

    PubMed

    Shi, Mayue; Zhang, Jinxin; Chen, Haotian; Han, Mengdi; Shankaregowda, Smitha A; Su, Zongming; Meng, Bo; Cheng, Xiaoliang; Zhang, Haixia

    2016-04-26

    The progress of smart skin technology presents unprecedented opportunities for artificial intelligence. Resolution enhancement and energy conservation are critical to improve the perception and standby time of robots. Here, we present a self-powered analogue smart skin for detecting contact location and velocity of the object, based on a single-electrode contact electrification effect and planar electrostatic induction. Using an analogue localizing method, the resolution of this two-dimensional smart skin can be achieved at 1.9 mm with only four terminals, which notably decreases the terminal number of smart skins. The sensitivity of this smart skin is remarkable, which can even perceive the perturbation of a honey bee. Meanwhile, benefiting from the triboelectric mechanism, extra power supply is unnecessary for this smart skin. Therefore, it solves the problems of batteries and connecting wires for smart skins. With microstructured poly(dimethylsiloxane) films and silver nanowire electrodes, it can be covered on the skin with transparency, flexibility, and high sensitivity. PMID:27010713

  3. Functional Analysis: The Use of Analogues in Applied Settings.

    ERIC Educational Resources Information Center

    Stichter, Janine Peck

    2001-01-01

    This article suggests possible applications of experimental analyses using analogues to empirically verify results of functional assessments in classrooms for students with autism and related disabilities. Analogue assessments involve creating conditions in which antecedents and consequences are held constant and specific variables suspected to…

  4. Space Analogue Environments: Are the Populations Comparable?

    NASA Astrophysics Data System (ADS)

    Sandal, G. M.

    Background: Much of our present understanding about psychology in space is based on studies of groups operating in so-called analogue environments where personnel are exposed to many of the same stressors as those experienced by astronauts in space. One possible problem with extrapolating results is that personnel operating in various hazardous and confined environments might differ in characteristics influencing coping, interaction, and performance. The object of this study was to compare the psychological similarity of these populations in order to get a better understanding of whether this extrapolation is justifiable. The samples investigated include polar crossings (N= 22), personnel on Antarctic research stations (N= 183), several military occupations (N= 187), and participants in space simulation studies (N=20). Methods: Personnel in each of these environments were assessed using the Personality Characteristic Inventory (PCI) and Utrecht Coping List (UCL). The PCI is a multidimensional trait assessment battery that measures various aspects of achievement orientation and social competence. The UCL is a questionnaire designed to assess habitual coping strategies when encountering stressful or demanding situations. Results: Only minor differences in use of habitual coping strategies were evident across the different samples. In relation to personality scores, the military subjects and participants in space simulation studies indicated higher competitiveness and negative instrumentality compared to both the personnel on Antarctic research stations and participants in polar expedition. Among the personnel on Antarctic research stations, significant gender differences were found with women scoring lower on competitiveness, negative instrumentality and impatience/irritability. Compared to the other samples, the participants in polar expeditions were found to be more homogeneous in personality and no significant gender differences were evident on the traits that

  5. GTP but not GDP analogues promote association of ADP-ribosylation factors, 20-kDa protein activators of cholera toxin, with phospholipids and PC-12 cell membranes.

    PubMed

    Walker, M W; Bobak, D A; Tsai, S C; Moss, J; Vaughan, M

    1992-02-15

    ADP-ribosylation factors (ARFs) are a family of approximately 20-kDa guanine nucleotide-binding proteins initially identified by their ability to enhance cholera toxin ADP-ribosyltransferase activity in the presence of GTP. ARFs have been purified from both membrane and cytosolic fractions. ARF purified from bovine brain cytosol requires phospholipid plus detergent for high affinity guanine nucleotide binding and for optimal enhancement of cholera toxin ADP-ribosyltransferase activity. The phospholipid requirements, combined with a putative role for ARF in vesicular transport, suggested that the soluble protein might interact reversibly with membranes. A polyclonal antibody against purified bovine ARF (sARF II) was used to detect ARF by immunoblot in membrane and soluble fractions from rat pheochromocytoma (PC-12) cell homogenates. ARF was predominantly cytosolic but increased in membranes during incubation of homogenates with nonhydrolyzable GTP analogues guanosine 5'-O-(3-thiotriphosphate), guanylyl-(beta gamma-imido)-diphosphate, and guanylyl-(beta gamma-methylene)-diphosphate, and to a lesser extent, adenosine 5'-O-(3-thiotriphosphate). GTP, GDP, GMP, and ATP were inactive. Cytosolic ARF similarly associated with added phosphatidylserine, phosphatidylinositol, or cardiolipin in GTP gamma S-dependent fashion. ARF binding to phosphatidylserine was reversible and coincident with stimulation of cholera toxin-catalyzed ADP-ribosylation. These observations may reflect a mechanism by which ARF could cycle between soluble and membrane compartments in vivo. PMID:1737779

  6. Development of new mitomycin C and porfiromycin analogues.

    PubMed

    Iyengar, B S; Lin, H J; Cheng, L; Remers, W A; Bradner, W T

    1981-08-01

    New mitomycin C and porfiromycin analogues were prepared by treating mitomycin A and N-methylmitomycin A with a variety of amines, including aziridines, allylamines, propargylamines, chloroalkylamines, hydroxyalkylamines, glycine derivatives, aralkylamines, and heterocyclic amines. All analogues were evaluated against P-388 murine leukemia and selected ones were examined for their leukopenic properties. Certain analogues were found to be superior to mitomycin C in potency, efficacy, and therapeutic ratio in the P-388 assay. The most active substituents at the mitosane 7 position included aziridine, 2-methylaziridine, propargylamine, furfurylamine, methyl glycinate, and 3-aminopyridine. Mitomycin A and the 7-aziridino, 7-(2-methylaziridino), and 3-aminopyridine analogues were less leukopenic than mitomycin C. Certain other analogues, including propargylamino and methyl glycinate, were highly leukopenic. The three compounds tested against B-16 melanoma in mice were significantly more effective than mitomycin C in this assay. Previously established structure--activity relationships were found inadequate to account for all of the new data. PMID:7328599

  7. Synthesis and biological activity of tetralone abscisic acid analogues.

    PubMed

    Nyangulu, James M; Nelson, Ken M; Rose, Patricia A; Gai, Yuanzhu; Loewen, Mary; Lougheed, Brenda; Quail, J Wilson; Cutler, Adrian J; Abrams, Suzanne R

    2006-04-01

    Bicyclic analogues of the plant hormone abscisic acid (ABA) were designed to incorporate the structural elements and functional groups of the parent molecule that are required for biological activity. The resulting tetralone analogues were predicted to have enhanced biological activity in plants, in part because oxidized products would not cyclize to forms corresponding to the inactive catabolite phaseic acid. The tetralone analogues were synthesized in seven steps from 1-tetralone and a range of analogues were accessible through a second route starting with 2-methyl-1-naphthol. Tetralone ABA 8 was found to have greater activity than ABA in two bioassays. The absolute configuration of (+)-8 was established by X-ray crystallography of a RAMP hydrazone derivative. The hydroxymethyl compounds 10 and 11, analogues for studying the roles of 8- and 9-hydroxy ABA 3 and 6, were also synthesized and found to be active. PMID:16557330

  8. Derivatisable Cyanobactin Analogues: A Semisynthetic Approach

    PubMed Central

    Oueis, Emilia; Adamson, Catherine; Mann, Greg; Ludewig, Hannes; Redpath, Philip; Migaud, Marie

    2015-01-01

    Abstract Many natural cyclic peptides have potent and potentially useful biological activities. Their use as therapeutic starting points is often limited by the quantities available, the lack of known biological targets and the practical limits on diversification to fine‐tune their properties. We report the use of enzymes from the cyanobactin family to heterocyclise and macrocyclise chemically synthesised substrates so as to allow larger‐scale syntheses and better control over derivatisation. We have made cyclic peptides containing orthogonal reactive groups, azide or dehydroalanine, that allow chemical diversification, including the use of fluorescent labels that can help in target identification. We show that the enzymes are compatible and efficient with such unnatural substrates. The combination of chemical synthesis and enzymatic transformation could help renew interest in investigating natural cyclic peptides with biological activity, as well as their unnatural analogues, as therapeutics. PMID:26507241

  9. Solution Processed PEDOT Analogues in Electrochemical Supercapacitors.

    PubMed

    Österholm, Anna M; Ponder, James F; Kerszulis, Justin A; Reynolds, John R

    2016-06-01

    We have designed fully soluble ProDOTx-EDOTy copolymers that are electrochemically equivalent to electropolymerized PEDOT without using any surfactants or dispersants. We show that these copolymers can be incorporated as active layers in solution processed thin film supercapacitors to demonstrate capacitance, stability, and voltage similar to the values of those that use electrodeposited PEDOT as the active material with the added advantage of the possibility for large scale, high-throughput processing. These Type I supercapacitors provide exceptional cell voltages (up to 1.6 V), highly symmetrical charge/discharge behavior, promising long-term stability exceeding 50 000 charge/discharge cycles, as well as energy (4-18 Wh/kg) and power densities (0.8-3.3 kW/kg) that are comparable to those of electrochemically synthesized analogues. PMID:27195798

  10. Association of blood lead levels with urinary F2-8α Isoprostane and 8-hydroxy-2-deoxy-Guanosine concentrations in first-grade Uruguayan children

    PubMed Central

    Roy, Aditi; Queirolo, Elena; Peregalli, Fabiana; Mañay, Nelly; Martínez, Gabriela; Kordas, Katarzyna

    2015-01-01

    Oxidative stress (OS) is a potential molecular mechanism for lead-induced toxicities, yet, we have limited understanding of the relation between low-level lead (Pb) exposure and OS, especially in children. This cross-sectional study examines the association between blood lead level (BLL) and two OS markers—urinary F2-8α isoprostane or isoprostane (a marker of lipid peroxidation) and 8-hydroxy-2-deoxy-Guanosine or 8-OH-dG (a marker of DNA damage) in 211 children, aged 5–8 years, from Montevideo, Uruguay. The role of dietary intakes of vitamin C and zinc in modifying the relation between BLL and OS was also examined. The mean (SD) BLL of the study children was 4.7 (2.2) μg/dL, with 30.2% children having BLL ≥5 μg/dL, the current reference level set by the US Centre for Disease Control for identifying, monitoring and management of children with elevated BLL. In covariate-adjusted analysis, there was a weak positive association between BLL and urinary isoprostane (adjusted for specific gravity) [β = 0.09, p< 0.1]. No association was found between children’s BLL and urinary 8-OH-dG. Interactions between dietary intakes of vitamin C or zinc and BLL on OS biomarkers were not consistent. However, when BLL and vitamin C or BLL and zinc were modeled together, BLL was independently associated with isoprostane concentration [β = 0.10, p< 0.05] but vitamin C or zinc intake was not. These findings suggest that there may be a potential adverse effect of BLL on OS in children with low-level Pb exposure. There is a need to study the effects of Pb on other OS measures, as well as the role of OS in mediating low-level Pb toxicity on functional outcomes. PMID:25863186

  11. Neuroprotection Promoted by Guanosine Depends on Glutamine Synthetase and Glutamate Transporters Activity in Hippocampal Slices Subjected to Oxygen/Glucose Deprivation.

    PubMed

    Dal-Cim, Tharine; Martins, Wagner C; Thomaz, Daniel T; Coelho, Victor; Poluceno, Gabriela Godoy; Lanznaster, Débora; Vandresen-Filho, Samuel; Tasca, Carla I

    2016-05-01

    Guanosine (GUO) has been shown to act as a neuroprotective agent against glutamatergic excitotoxicity by increasing glutamate uptake and decreasing its release. In this study, a putative effect of GUO action on glutamate transporters activity modulation was assessed in hippocampal slices subjected to oxygen and glucose deprivation (OGD), an in vitro model of brain ischemia. Slices subjected to OGD showed increased excitatory amino acids release (measured by D-[(3)H]aspartate release) that was prevented in the presence of GUO (100 µM). The glutamate transporter blockers, DL-TBOA (10 µM), DHK (100 µM, selective inhibitor of GLT-1), and sulfasalazine (SAS, 250 µM, Xc(-) system inhibitor) decreased OGD-induced D-aspartate release. Interestingly, DHK or DL-TBOA blocked the decrease in glutamate release induced by GUO, whereas SAS did not modify the GUO effect. GUO protected hippocampal slices from cellular damage by modulation of glutamate transporters, however selective blockade of GLT-1 or Xc- system only did not affect this protective action of GUO. OGD decreased hippocampal glutamine synthetase (GS) activity and GUO recovered GS activity to control levels without altering the kinetic parameters of GS activity, thus suggesting GUO does not directly interact with GS. Additionally, the pharmacological inhibition of GS activity with methionine sulfoximine abolished the effect of GUO in reducing D-aspartate release and cellular damage evoked by OGD. Altogether, results in hippocampal slices subjected to OGD show that GUO counteracts the release of excitatory amino acids, stimulates the activity of GS, and decreases the cellular damage by modulation of glutamate transporters activity. PMID:26858177

  12. Involvement of nitric oxide-cyclic guanosine monophosphate pathway in the antidepressant-like effect of tropisetron and ondansetron in mice forced swimming test and tail suspension test.

    PubMed

    Haj-Mirzaian, Arya; Kordjazy, Nastaran; Amiri, Shayan; Haj-Mirzaian, Arvin; Amini-Khoei, Hossien; Ostadhadi, Sattar; Dehpour, AhmadReza

    2016-06-01

    Antidepressant-like effects of 5-hydroxytryptamine subtype 3 (5-HT3) antagonists including tropisetron and ondansetron have been previously demonstrated in the literature. It was reported that stimulation of 5-HT3 receptors activate the nitric oxide-cyclic guanosine monophosphate (NO-cGMP) pathway, which is involved in regulation of behavioral and emotional functions. In our study, treating animals with tropisetron (5, 10, and 30mg/kg) and ondansetron (0.01 and 0.1µg/kg) significantly decreased the immobility time in forced swimming test (FST) and tail-suspension test (TST). Co-administration of subeffective doses of tropisetron (1mg/kg) and ondansetron (0.001µg/kg) with subeffective dose of l-NAME (10mg/kg, nonselective NO synthase (NOS) inhibitor) and 7-nitroindazole (25mg/kg, neural NOS inhibitor) exerted antidepressant-like effect in FST and TST, while aminoguanidine (50mg/kg, inducible NOS inhibitor) did not enhance the antidepressant-like effect of 5-HT3 antagonists. Besides, l-arginine (750mg/kg, NO precursor) and sildenafil (5mg/kg, phosphodiesterase inhibitor) suppressed the anti-immobility effect of 5-HT3 antagonists. None of the treatments altered the locomotor behavior of mice in open-field test. Also, hippocampal (but not cortical) nitrite level was significantly lower in tropisetron and ondansetron-treated mice compared with saline-injected mice. Also, co-administration of 7-nitroindazole with tropisetron or ondansetron caused a significant decrease in hippocampal nitrite levels. In conclusion, we suggest that antidepressant-like effect of tropisetron and ondansetron are partially mediated by modulation of NO-cGMP pathway. PMID:27001377

  13. Mitogenic signaling pathways of growth factors can be distinguished by the involvement of pertussis toxin-sensitive guanosine triphosphate-binding protein and of protein kinase C.

    PubMed Central

    Nishizawa, N; Okano, Y; Chatani, Y; Amano, F; Tanaka, E; Nomoto, H; Nozawa, Y; Kohno, M

    1990-01-01

    We have examined the possible involvements of pertussis toxin (PT)-sensitive guanosine triphosphate (GTP)-binding protein (Gp) and protein kinase C (PKC) in the mitogenic signaling pathways of various growth factors by the use of PT-pretreated and/or 12-O-tetradecanoyl phorbol-13-acetate (TPA)-pretreated mouse fibroblasts. Effects of PT pretreatment (inactivation of PT-sensitive Gp) and TPA pretreatment (depletion of PKC) on mitogen-induced DNA synthesis varied significantly and systematically in response to growth factors: mitogenic responses of cells to thrombin, bombesin, and bradykinin were almost completely abolished both in PT- and TPA-pretreated cells; responses to epidermal growth factor (EGF), platelet-derived growth factor (PDGF), and vanadate were reduced to approximately 50% both in PT- and TPA-pretreated cells compared with native cells; response to basic fibroblast growth factor (bFGF) was not affected in PT-pretreated cells but was inhibited to some extent in TPA-pretreated cells. Thus, growth factors examined have been classified into three groups with regard to the involvements of PT-sensitive Gp and PKC in their signal transduction pathways. Binding of each growth factor to its receptor was not affected significantly by pretreatment of cells with PT or TPA. Inhibitory effects of PT and TPA pretreatment on each mitogen-induced DNA synthesis were not additive, suggesting that the functions of PT-sensitive Gp and PKC lie on an identical signal transduction pathway. Although all three groups of mitogens activated PKC, signaling of each growth factor depends to a varying extent on the function of PKC. Our results indicate that a single peptide growth factor such as EGF, PDGF, or bFGF acts through multiple signaling pathways to induce cell proliferation. Images PMID:2129194

  14. Inhibition of the nitric oxide/cyclic guanosine monophosphate pathway limited the cardioprotective effect of post-conditioning in hearts with apical myocardial infarction.

    PubMed

    Correa, Francisco; Buelna-Chontal, Mabel; Chagoya, Victoria; García-Rivas, Gerardo; Vigueras, Rosa María; Pedraza-Chaverri, José; García-Niño, Wylly Ramsés; Hernández-Pando, Rogelio; León-Contreras, Juan Carlos; Zazueta, Cecilia

    2015-10-15

    Reperfusion damage involves opening of the mitochondrial permeability transition pore (mPTP) and loss of ATP synthesis. Several cardioprotective pathways are activated by ischemic or pharmacological post-conditioning (PC). The mechanisms that are activated by PC in no co-morbidity murine models include: activation of rescue kinases, oxidative stress reduction, glycolytic flux regulation and preservation of ATP synthesis. However, relatively scarce efforts have been made to define whether the efficacy of PC signaling is blunted by risk factors or systemic diseases associated with ischemic heart pathology. Experimental evidence has shown that the nitric oxide (NO)/cyclic guanosine monophosphate (cGMP) signaling is a main mechanism activated by PC in hearts without pathological history. In this work we evaluated the participation of the NO pathway, through downstream kinase activation and inhibition of mPTP in hearts with previous infarct. Myocardial infarction was induced with a single dose of isoproterenol (85 mg/kg i.p.) to male Wistar rats. After 24 h, the hearts were mounted into the Langendorff system and subjected to 30 min of ischemia and 60 min of reperfusion. PC consisted of 5 cycles of 30 s of reperfusion/30 s of ischemia, then the hearts were reperfused with or without inhibitors of the NO/cGMP pathway. PC activates the NO/cGMP pathway, as increased cGMP and NO levels were detected in isoproterenol-treated hearts. The cardioprotective effect of PC was abolished with both L-NAME (inhibitor of constitutive NO synthase) and ODQ (inhibitor of soluble guanylate cyclase), whereas the NO donor (DETA-NO) restored cardioprotection even in the presence of L-NAME or ODQ. We also found that mitochondrial structure and function was preserved in PC hearts. We conclude that PC exerts cardioprotection in hearts with previous infarct by maintaining mitochondrial structure and function through NO-dependent pathway. PMID:26387613

  15. Roles of insulin, guanosine 5'-[gamma-thio]triphosphate and phorbol 12-myristate 13-acetate in signalling pathways of GLUT4 translocation.

    PubMed Central

    Todaka, M; Hayashi, H; Imanaka, T; Mitani, Y; Kamohara, S; Kishi, K; Tamaoka, K; Kanai, F; Shichiri, M; Morii, N; Narumiya, S; Ebina, Y

    1996-01-01

    Insulin, guanosine 5'-[gamma-thio]triphosphate (GTP[S] and phorbol 12-myristate 13-acetate (PMA) trigger the translocation of Gl UT4 (type 4 glucose transporter; insulin-sensitive glucose transporter) from an intracellular pool to the cell surface. We have developed a highly sensitive and quantitative method to detect GLUT4 immunologically on the surface of intact 3T3-L1 adipocytes and Chinese hamster ovary (CHO) cells, using c-myc epitope-tagged GLUT4 (GLUT4myc). We examined the roles of insulin, GTP[S] and PMA in the signalling pathways of GLUT4 translocation in the CHO cell system. Among small molecular GTP-binding proteins, ras, rab3D, rad and rho seem to be candidates as signal transmitters of insulin-stimulated GLUT4 translocation. Overexpression of wild-type H-ras and the dominant negative mutant H-rass17N in our cell system respectively enhanced and blocked insulin-stimulated activation of mitogen-activated protein kinase, but did not affect insulin-stimulated GLUT4 translocation. Overexpression of rab3D or rad in the cells did not affect GLUT4 translocation triggered by insulin, GTP[S] or PMA. Treatment with Botulinum C3 exoenzyme, a specific inhibitor of rho, had no effect on GLUT4 translocation induced by insulin, GTP[S] or PMA. Therefore these small molecular GTP-binding proteins are not likely to be involved in GLUT4 translocation. In addition, insulin, GTP[S] and PMA apparently stimulate GLUT4 translocation through independent pathways. PMID:8645171

  16. Kinetics of the interaction of translation factor SelB from Escherichia coli with guanosine nucleotides and selenocysteine insertion sequence RNA.

    PubMed

    Thanbichler, M; Bock, A; Goody, R S

    2000-07-01

    The kinetics of the interaction of GTP and GDP with SelB, the specific translation factor for the incorporation of selenocysteine into proteins, have been investigated using the stopped-flow method. Useful signals were obtained using intrinsic (i.e. tryptophan) fluorescence, the fluorescence of methylanthraniloyl derivatives of nucleotides, or fluorescence resonance energy transfer from tryptophan to the methylanthraniloyl group. The affinities of SelB for GTP (K(d) = 0.74 micrometer) and GDP (K(d) = 13.4 micrometer) were considerably lower than those of other translation factors. Of functional significance is the fact that the rate constant for GDP release from its complex with SelB (15 s(-)(1)) is many orders of magnitude larger than for elongation factor Tu, explaining why a GDP/GTP exchange factor is not required for the action of SelB. In contrast, the rate of release of GTP is 2 orders of magnitude slower and not significantly faster than for elongation factor Tu. Using a fluorescently labeled 17-nucleotide RNA minihelix that represents a binding site for the protein and that is part of the fdhF selenocysteine insertion sequence element positioned immediately downstream of the UGA triplet coding for selenocysteine incorporation, the kinetics of the interaction were studied. The high affinity of the interaction (K(d) approximately 1 nm) appeared to be increased even further when selenocysteyl-tRNA(Sec) was bound to SelB, but to be independent of the presence or nature of the guanosine nucleotide at the active site. These results suggest that the affinity of SelB for its RNA binding site is maximized when charged tRNA is bound and decreases to allow dissociation and reading of codons downstream of the selenocysteine codon after selenocysteine peptide bond formation. PMID:10781605

  17. DNA 3' pp 5' G de-capping activity of aprataxin: effect of cap nucleoside analogs and structural basis for guanosine recognition

    SciTech Connect

    Chauleau, Mathieu; Jacewicz, Agata; Shuman, Stewart

    2015-05-24

    DNA3' pp 5'G caps synthesized by the 3'-PO4/5'-OH ligase RtcB have a strong impact on enzymatic reactions at DNA 3'-OH ends. Aprataxin, an enzyme that repairs A5'pp5'DNA ends formed during abortive ligation by classic 3'-OH/5'-PO4 ligases, is also a DNA 3' de-capping enzyme, converting DNAppG to DNA3'p and GMP. By taking advantage of RtcB's ability to utilize certain GTP analogs to synthesize DNAppN caps, we show that aprataxin hydrolyzes inosine and 6-O-methylguanosine caps, but is not adept at removing a deoxyguanosine cap. We report a 1.5 Å crystal structure of aprataxin in a complex with GMP, which reveals that: (i) GMP binds at the same position and in the same anti nucleoside conformation as AMP; and (ii) aprataxin makes more extensive nucleobase contacts with guanine than with adenine, via a hydrogen bonding network to the guanine O6, N1, N2 base edge. Alanine mutations of catalytic residues His147 and His149 abolish DNAppG de-capping activity, suggesting that the 3' de-guanylylation and 5' de-adenylylation reactions follow the same pathway of nucleotidyl transfer through a covalent aprataxin-(His147)–NMP intermediate. Alanine mutation of Asp63, which coordinates the guanosine ribose hydroxyls, impairs DNAppG de-capping.

  18. Natural analogues of nuclear waste glass corrosion.

    SciTech Connect

    Abrajano, T.A. Jr.; Ebert, W.L.; Luo, J.S.

    1999-01-06

    This report reviews and summarizes studies performed to characterize the products and processes involved in the corrosion of natural glasses. Studies are also reviewed and evaluated on how well the corrosion of natural glasses in natural environments serves as an analogue for the corrosion of high-level radioactive waste glasses in an engineered geologic disposal system. A wide range of natural and experimental corrosion studies has been performed on three major groups of natural glasses: tektite, obsidian, and basalt. Studies of the corrosion of natural glass attempt to characterize both the nature of alteration products and the reaction kinetics. Information available on natural glass was then compared to corresponding information on the corrosion of nuclear waste glasses, specifically to resolve two key questions: (1) whether one or more natural glasses behave similarly to nuclear waste glasses in laboratory tests, and (2) how these similarities can be used to support projections of the long-term corrosion of nuclear waste glasses. The corrosion behavior of basaltic glasses was most similar to that of nuclear waste glasses, but the corrosion of tektite and obsidian glasses involves certain processes that also occur during the corrosion of nuclear waste glasses. The reactions and processes that control basalt glass dissolution are similar to those that are important in nuclear waste glass dissolution. The key reaction of the overall corrosion mechanism is network hydrolysis, which eventually breaks down the glass network structure that remains after the initial ion-exchange and diffusion processes. This review also highlights some unresolved issues related to the application of an analogue approach to predicting long-term behavior of nuclear waste glass corrosion, such as discrepancies between experimental and field-based estimates of kinetic parameters for basaltic glasses.

  19. Evolving a polymerase for hydrophobic base analogues.

    PubMed

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity. PMID:19778048

  20. Current european regulatory perspectives on insulin analogues.

    PubMed

    Enzmann, Harald G; Weise, Martina

    2011-01-01

    Insulin analogues are increasingly considered as an alternative to human insulin in the therapy of diabetes mellitus. Insulin analogues (IAs) are chemically different from human insulin and may have different pharmacokinetic or pharmacodynamic properties. The significance of the modifications of the insulin molecule for the safety profile of IAs must be considered. This review describes the regulatory procedure and the expectations for the scientific content of European marketing authorization applications for innovative IAs submitted to the European Medicines Agency. Particular consideration is given to a potential cancer hazard. Specific regulatory guidance on how to address a possible carcinogenic or tumor promoting effect of innovative IAs in non-clinical studies is available. After marketing authorization, the factual access of patients to the new product will be determined to great extent by health technology assessment bodies, reimbursement decisions and the price. Whereas the marketing authorization is a European decision, pricing and reimbursement are national or regional responsibilities. The assessment of benefit and risk by the European Medicines Agency is expected to influence future decisions on price and reimbursement on a national or regional level. Collaborations between regulatory agencies and health technology assessment bodies have been initiated on European and national level to facilitate the use of the European Medicines Agency's benefit risk assessment as basis on which to build the subsequent health technology assessment. The option for combined or joint scientific advice procedures with regulators and health technology assessment bodies on European level or on a national level in several European Member States may help applicants to optimize their development program and dossier preparation in regard of both European marketing authorization application and reimbursement decisions. PMID:21736748

  1. Functionalized Congener Approach to Muscarinic Antagonists: Analogues of Pirenzepine

    PubMed Central

    Karton, Yishai; Bradbury, Barton J.; Baumgold, Jesse; Paek, Robert; Jacobson, Kenneth A.

    2012-01-01

    The M1-selective muscarinic receptor antagonist pirenzepine (5,11-dihydro-11-[(4-methyl-1-piperazinyl)acetyl]-6H-pyrido[2,3-b] [1,4]benzodiazepin-6-one) was derivatized to explore points of attachment of functionalized side chains for the synthesis of receptor probes and ligands for affinity chromatography. The analogues prepared were evaluated in competitive binding assays versus [3H]-N-methylscopolamine at four muscarinic receptor subtypes (m1AChR-m4AChR) in membranes from rat heart tissue and transfected A9L cells. 9-(Hydroxymethyl)pirenzepine, 8-(methylthio)pirenzepine, and a series of 8-aminosulfonyl derivatives were synthesized. Several 5-substituted analogues of pirenzepine also were prepared. An alternate series of analogues substituted on the 4-position of the piperazine ring was prepared by reaction of 4-desmethylpirenzepine with various electrophiles. An N-chloroethyl analogue of pirenzepine was shown to form a reactive aziridine species in aqueous buffer yet failed to affinity label muscarinic receptors. Within a series of aminoalkyl analogues, the affinity increased as the length of the alkyl chain increased. Shorter chain analogues were generally much less potent than pirenzepine, and longer analogues (7–10 carbons) were roughly as potent as pirenzepine at m1 receptors, but were nonselective. Depending on the methylene chain length, acylation or alkyl substitution of the terminal amine also influenced the affinity at muscarinic receptors. PMID:2066986

  2. The preparation of zaragozic acid A analogues by directed biosynthesis.

    PubMed

    Chen, T S; Petuch, B; MacConnell, J; White, R; Dezeny, G; Arison, B; Bergstrom, J D; Colwell, L; Huang, L; Monaghan, R L

    1994-11-01

    Zaragozic acid A analogues are produced by an unidentified sterile fungus when it is exogenously supplied with 2-thiophenecarboxylic acid, 3-thiophenecarboxylic acid, 2-furoic acid, 2-fluorobenzoic acid, 3-fluorobenzoic acid, or 4-fluorobenzoic acid. The analogues carry 2-thiophenyl, 3-thiophenyl, 2-furyl, o-fluorophenyl, m-fluorophenyl, or p-fluorophenyl group, respectively, at C-6' of the C-1 alkyl side chain replacing the phenyl group of natural zaragozic acid A. All the new analogues of zaragozic acid A possess picomolar inhibitory activity against squalene synthase in vitro. PMID:8002393

  3. Recent developments in naturally derived antimalarials: cryptolepine analogues.

    PubMed

    Wright, Colin W

    2007-06-01

    Increasing resistance of Plasmodium falciparum to commonly used antimalarial drugs has made the need for new agents increasingly urgent. In this paper, the potential of cryptolepine, an alkaloid from the West African shrub Cryptolepis sanguinolenta, as a lead towards new antimalarial agents is discussed. Several cryptolepine analogues have been synthesized that have promising in-vitro and in-vivo antimalarial activity. Studies on the antimalarial modes of action of these analogues indicate that they may have different or additional modes of action to the parent compound. Elucidation of the mode of action may facilitate the development of more potent antimalarial cryptolepine analogues. PMID:17637183

  4. Synthesis, antiarrhythmic activity, and toxicological evaluation of mexiletine analogues.

    PubMed

    Roselli, Mariagrazia; Carocci, Alessia; Budriesi, Roberta; Micucci, Matteo; Toma, Maddalena; Di Cesare Mannelli, Lorenzo; Lovece, Angelo; Catalano, Alessia; Cavalluzzi, Maria Maddalena; Bruno, Claudio; De Palma, Annalisa; Contino, Marialessandra; Perrone, Maria Grazia; Colabufo, Nicola Antonio; Chiarini, Alberto; Franchini, Carlo; Ghelardini, Carla; Habtemariam, Solomon; Lentini, Giovanni

    2016-10-01

    Four mexiletine analogues have been tested for their antiarrhythmic, inotropic, and chronotropic effects on isolated guinea pig heart tissues and to assess calcium antagonist activity, in comparison with the parent compound mexiletine. All analogues showed from moderate to high antiarrhythmic activity. In particular, three of them (1b,c,e) were more active and potent than the reference drug, while exhibiting only modest or no negative inotropic and chronotropic effects and vasorelaxant activity, thus showing high selectivity of action. All compounds showed no cytotoxicity and 1b,c,d did not impair motor coordination. All in, these new analogues exhibit an interesting cardiovascular profile and deserve further investigation. PMID:27267000

  5. INX-08189, a Phosphoramidate Prodrug of 6-O-Methyl-2′-C-Methyl Guanosine, Is a Potent Inhibitor of Hepatitis C Virus Replication with Excellent Pharmacokinetic and Pharmacodynamic Properties▿

    PubMed Central

    Vernachio, John H.; Bleiman, Blair; Bryant, K. Dawn; Chamberlain, Stanley; Hunley, Damound; Hutchins, Jeff; Ames, Brenda; Gorovits, Elena; Ganguly, Babita; Hall, Andrea; Kolykhalov, Alexander; Liu, Yule; Muhammad, Jerry; Raja, Nicholas; Walters, C. Robin; Wang, Jin; Williams, Karen; Patti, Joseph M.; Henson, Geoffrey; Madela, Karolina; Aljarah, Mohamed; Gilles, Arnaud; McGuigan, Christopher

    2011-01-01

    INX-08189 is an aryl-phosphoramidate of 6-O-methyl-2′-C-methyl guanosine. INX-08189 was highly potent in replicon assays, with a 50% effective concentration of 10 ± 6 nM against hepatitis C genotype 1b at 72 h. The inhibitory effect on viral replication was rapid, with a 50% effective concentration (EC50) of 35 ± 8 nM at 24 h. An intracellular 2′-C-methyl guanosine triphosphate (2′-C-MeGTP) concentration of 2.43 ± 0.42 pmol/106 cells was sufficient to achieve 90% inhibition of viral replication. In vitro resistance studies confirmed that the S282T mutation in the NS5b gene conferred an approximately 10-fold reduction in sensitivity to INX-08189. However, the complete inhibition of S282T mutant replicons still could be achieved with an EC90 of 344 ± 170 nM. Drug combination studies of INX-08189 and ribavirin indicated significant synergy in antiviral potency both in wild-type and S282T-expressing replicons. Genotype 1b replicons could be cleared after 14 days of culture when exposed to as little as 20 nM INX-08189. No evidence of mitochondrial toxicity was observed after 14 days of INX-08189 exposure in both HepG2 and CEM human cell lines. In vivo studies of rats and cynomolgus monkeys demonstrated that 2′-C-MeGTP concentrations in liver equivalent to the EC90 could be attained after a single oral dose of INX-08189. Rat liver 2′-C-MeGTP concentrations were proportional to dose, sustained for greater than 24 h, and correlated with plasma concentrations of the nucleoside metabolite 2′-C-methyl guanosine. The characteristics displayed by INX-08189 support its continued development as a clinical candidate for the treatment of chronic HCV infection. PMID:21357300

  6. INX-08189, a phosphoramidate prodrug of 6-O-methyl-2'-C-methyl guanosine, is a potent inhibitor of hepatitis C virus replication with excellent pharmacokinetic and pharmacodynamic properties.

    PubMed

    Vernachio, John H; Bleiman, Blair; Bryant, K Dawn; Chamberlain, Stanley; Hunley, Damound; Hutchins, Jeff; Ames, Brenda; Gorovits, Elena; Ganguly, Babita; Hall, Andrea; Kolykhalov, Alexander; Liu, Yule; Muhammad, Jerry; Raja, Nicholas; Walters, C Robin; Wang, Jin; Williams, Karen; Patti, Joseph M; Henson, Geoffrey; Madela, Karolina; Aljarah, Mohamed; Gilles, Arnaud; McGuigan, Christopher

    2011-05-01

    INX-08189 is an aryl-phosphoramidate of 6-O-methyl-2'-C-methyl guanosine. INX-08189 was highly potent in replicon assays, with a 50% effective concentration of 10±6 nM against hepatitis C genotype 1b at 72 h. The inhibitory effect on viral replication was rapid, with a 50% effective concentration (EC50) of 35±8 nM at 24 h. An intracellular 2'-C-methyl guanosine triphosphate (2'-C-MeGTP) concentration of 2.43±0.42 pmol/10(6) cells was sufficient to achieve 90% inhibition of viral replication. In vitro resistance studies confirmed that the S282T mutation in the NS5b gene conferred an approximately 10-fold reduction in sensitivity to INX-08189. However, the complete inhibition of S282T mutant replicons still could be achieved with an EC90 of 344±170 nM. Drug combination studies of INX-08189 and ribavirin indicated significant synergy in antiviral potency both in wild-type and S282T-expressing replicons. Genotype 1b replicons could be cleared after 14 days of culture when exposed to as little as 20 nM INX-08189. No evidence of mitochondrial toxicity was observed after 14 days of INX-08189 exposure in both HepG2 and CEM human cell lines. In vivo studies of rats and cynomolgus monkeys demonstrated that 2'-C-MeGTP concentrations in liver equivalent to the EC90 could be attained after a single oral dose of INX-08189. Rat liver 2'-C-MeGTP concentrations were proportional to dose, sustained for greater than 24 h, and correlated with plasma concentrations of the nucleoside metabolite 2'-C-methyl guanosine. The characteristics displayed by INX-08189 support its continued development as a clinical candidate for the treatment of chronic HCV infection. PMID:21357300

  7. Lanthanum inhibition of Vibrio cholerae and Escherichia coli enterotoxin-induced enterosorption and its effects on intestinal mucosa cyclic adenosine 3',5'-monophosphate and cyclic guanosine 3',5'-monophosphate levels.

    PubMed Central

    Leitch, G J; Amer, M S

    1975-01-01

    Several trivalent cations, including lanthanum (La3+), inhibited the secretion (enterosorption) induced by the enterotoxins of Vibrio cholerae and Escherichia coli in the rabbit ileum in vivo. High concentrations (greater than 10 mM) of La3+ were required to inhibit cholera enterotoxin (CE)-induced enterosorption, probably because of the adsorption of the La3+ often potentiated the CE-induced enterosorption. If luminal La3+ exposure followed CE exposure, some recovery of the enterosorptive response was observed. The longer the lag between the CE exposure and the La3+ exposure, the greater was the recovery of the enterosorptive response. Lanthanum inhibited HCO3- secretion more than Cl- secretion. By altering the luminal fluid pH at the time of La3+ exposure, it was found that La3+ was adsorbed to negatively charged luminal sites, having an apparent pK between 2.5 and 3.0. Although La3+ antagonized the enterosorptive response to CE, it mimicked rather than antagonized the cyclic adenosine 3',5'-monophosphate elevation and cyclic guanosine 3',5'-monophosphate depression induced by the toxin. It is therefore concluded that the La3+ inhibition of the CE-induced enterosorption must have occurred at a site following the generation of the cyclic nucleotides. Cholera enterotoxin caused complex time-dependent changes in the mucosal cyclic adenosine 3',5'-monophosphate and cyclic guanosine 3',5'-monophosphate levels, as revealed by studying tissue cyclic adenosine 3',5'-monophosphate/cyclic guanosine 3',5'-monophosphate ratios. The possible roles these two cyclic nucleotides may play in the pathogenesis of the cholera diarrhea are discussed. PMID:164410

  8. Interaction of tRNA with tRNA (guanosine-1)methyltransferase: binding specificity determinants involve the dinucleotide G36pG37 and tertiary structure.

    PubMed

    Redlak, M; Andraos-Selim, C; Giege, R; Florentz, C; Holmes, W M

    1997-07-22

    The sequence G37pG36 is present in all tRNA species recognized and methylated by the Escherichia coli modification enzyme tRNA (guanosine-1)methyltransferase. We have examined whether this dinucleotide sequence provides the base specific recognition signal for this enzyme and have assessed the role of the remaining tRNA in recognition. E. coli tRNAHis and yeast tRNAAsp were substituted with G at positions 36 and 37 and were found to be excellent substrates for methylation. This suggested that the general tRNA structure can be specifically bound by the enzyme. In addition, heterologous tRNA species including fully modified tRNA1Leu are excellent inhibitors of tRNA1Leu transcript methylation. Analyses of structural variants of yeast tRNAAsp and E. coli tRNA1Leu demonstrate clearly that the core tertiary structures of tRNA are required for recognition and that G37 must be in the correct position in space relative to important contacts elsewhere in the molecule. This latter conclusion was reached because the addition of one to three stacked base pairs in the anticodon stem of tRNA1Leu dramatically alters activity. In this case, the G37 base is rotated away from the correct position in space relative to other tRNA contact sites. The acceptor stem structure is required for optimal activity since deletion of three or five base pairs is detrimental to activity; however, specific base sequence may not be important because (i) the addition of three stacked base pairs of different sequence had little effect on activity and (ii) heterologous tRNAs with little or no sequence homology in the acceptor stem are excellent substrates. Both poly G and GpG are potent and specific inhibitors of enzyme activity and are minimal substrates which can be methylated, forming m1G. Taken together, these studies suggest that 1MGT can bind the general tRNA structure and that the crucial base-pair contacts are G37 and G36. PMID:9220956

  9. Pharmacokinetic Profile and Acute Toxicological Properties of a Novel Radiosensitizer Cytosine-Phosphate-Guanosine Oligodeoxynucleotide 107 in Mice Following Intravenous and Orthotopic Administration.

    PubMed

    Cen, Yanyan; Li, Xiaoli; Yin, Zhiwei; Yan, Zifei; Liu, Dan; Peng, Wei; Pan, Feng; Zhou, Hong

    2015-10-01

    The synthetic cytosine-phosphate-guanosine oligodeoxynucleotide 107 (CpG ODN107) is a novel radiosensitizer for glioma treatment. However, the information related to its pharmacokinetics and toxicity remains unclear. Therefore, the plasma pharmacokinetics, distribution, elimination, and acute toxicity of CpG ODN107 in mice were investigated in the present experiments. The results from the liquid chromatography-tandem mass spectrometry (LC-MS/MS) assay showed that the plasma elimination half-life (t1/2β) of CpG ODN107 in BALB/c mice varied slightly with the dose, and it was 0.65, 0.49, and 0.50 h at the intravenous doses of 2.5, 5, and 10 mg/kg, respectively. CpG ODN107 rapidly and widely distributed in organs/tissues, except the brain and testes. The highest concentrations were found in the liver (28.6% of the administered dose after 0.5 h) and the kidneys (5.7% of the administered dose after 1 h). CpG ODN107 (0.3, 3, and 30 μg/mL) could highly bind to human and mouse plasma proteins in vitro. CpG ODN107 in the forms of prototype was excreted in urine (1.79%) and feces (0.91%), and its shortened metabolites were excreted in urine (2.1%) and feces (2.2%) within the first 24 h. The mice in vivo optical image showed CpG ODN107 labeled with Alexa Fluor 680 fluorochrome (AF680) accumulated in the brain after orthotopic injection, eliminated very slowly, and excreted in urine compared with poly T labeled with AF680. The median lethal dose (LD50) of CpG ODN107 was 75.7 mg/kg for mice; this dose only could produce apparent spleen and liver damage, in line with the distribution features of CpG ODN. In conclusion, our present pharmacokinetic and toxicity investigation will provide helpful information to further pharmacodynamic and pharmacokinetic research of CpG ODN107 and other oligodeoxynucleotide drugs in the future. PMID:26213852

  10. Elevated intracranial dopamine impairs the glutamate-nitric oxide-cyclic guanosine monophosphate pathway in cortical astrocytes in rats with minimal hepatic encephalopathy

    PubMed Central

    DING, SAIDAN; HUANG, WEILONG; YE, YIRU; YANG, JIANJING; HU, JIANGNAN; WANG, XIAOBIN; LIU, LEPING; LU, QIN; LIN, YUANSHAO

    2014-01-01

    In a previous study by our group memory impairment in rats with minimal hepatic encephalopathy (MHE) was associated with the inhibition of the glutamate-nitric oxide-cyclic guanosine monophosphate (Glu-NO-cGMP) pathway due to elevated dopamine (DA). However, the effects of DA on the Glu-NO-cGMP pathway localized in primary cortical astrocytes (PCAs) had not been elucidated in rats with MHE. In the present study, it was identified that when the levels of DA in the cerebral cortex of rats with MHE and high-dose DA (3 mg/kg)-treated rats were increased, the co-localization of N-methyl-d-aspartate receptors subunit 1 (NMDAR1), calmodulin (CaM), nitric oxide synthase (nNOS), soluble guanylyl cyclase (sGC) and cyclic guanine monophosphate (cGMP) with the glial fibrillary acidic protein (GFAP), a marker protein of astrocytes, all significantly decreased, in both the MHE and high-dose DA-treated rats (P<0.01). Furthermore, NMDA-induced augmentation of the expression of NMDAR1, CaM, nNOS, sGC and cGMP localized in PCAs was decreased in MHE and DA-treated rats, as compared with the controls. Chronic exposure of cultured cerebral cortex PCAs to DA treatment induced a dose-dependent decrease in the concentration of intracellular calcium, nitrites and nitrates, the formation of cGMP and the expression of NMDAR1, CaM, nNOS and sGC/cGMP. High doses of DA (50 μM) significantly reduced NMDA-induced augmentation of the formation of cGMP and the contents of NMDAR1, CaM, nNOS, sGC and cGMP (P<0.01). These results suggest that the suppression of DA on the Glu-NO-cGMP pathway localized in PCAs contributes to memory impairment in rats with MHE. PMID:25059564

  11. Elevated intracranial dopamine impairs the glutamate‑nitric oxide‑cyclic guanosine monophosphate pathway in cortical astrocytes in rats with minimal hepatic encephalopathy.

    PubMed

    Ding, Saidan; Huang, Weilong; Ye, Yiru; Yang, Jianjing; Hu, Jiangnan; Wang, Xiaobin; Liu, Leping; Lu, Qin; Lin, Yuanshao

    2014-09-01

    In a previous study by our group memory impairment in rats with minimal hepatic encephalopathy (MHE) was associated with the inhibition of the glutamate‑nitric oxide‑cyclic guanosine monophosphate (Glu‑NO‑cGMP) pathway due to elevated dopamine (DA). However, the effects of DA on the Glu‑NO‑cGMP pathway localized in primary cortical astrocytes (PCAs) had not been elucidated in rats with MHE. In the present study, it was identified that when the levels of DA in the cerebral cortex of rats with MHE and high‑dose DA (3 mg/kg)‑treated rats were increased, the co‑localization of N‑methyl‑d‑aspartate receptors subunit 1 (NMDAR1), calmodulin (CaM), nitric oxide synthase (nNOS), soluble guanylyl cyclase (sGC) and cyclic guanine monophosphate (cGMP) with the glial fibrillary acidic protein (GFAP), a marker protein of astrocytes, all significantly decreased, in both the MHE and high‑dose DA‑treated rats (P<0.01). Furthermore, NMDA‑induced augmentation of the expression of NMDAR1, CaM, nNOS, sGC and cGMP localized in PCAs was decreased in MHE and DA‑treated rats, as compared with the controls. Chronic exposure of cultured cerebral cortex PCAs to DA treatment induced a dose‑dependent decrease in the concentration of intracellular calcium, nitrites and nitrates, the formation of cGMP and the expression of NMDAR1, CaM, nNOS and sGC/cGMP. High doses of DA (50 µM) significantly reduced NMDA‑induced augmentation of the formation of cGMP and the contents of NMDAR1, CaM, nNOS, sGC and cGMP (P<0.01). These results suggest that the suppression of DA on the Glu‑NO‑cGMP pathway localized in PCAs contributes to memory impairment in rats with MHE. PMID:25059564

  12. Actions of Thyroid Hormone Analogues on Chemokines

    PubMed Central

    Glinsky, Gennadi V.

    2016-01-01

    The extracellular domain of plasma membrane integrin αvβ3 contains a receptor for thyroid hormone (L-thyroxine, T4; 3,5,3′-triiodo-L-thyronine, T3); this receptor also binds tetraiodothyroacetic acid (tetrac), a derivative of T4. Tetrac inhibits the binding of T4 and T3 to the integrin. Fractalkine (CX3CL1) is a chemokine relevant to inflammatory processes in the CNS that are microglia-dependent but also important to normal brain development. Expression of the CX3CL1 gene is downregulated by tetrac, suggesting that T4 and T3 may stimulate fractalkine expression. Independently of its specific receptor (CX3CR1), fractalkine binds to αvβ3 at a site proximal to the thyroid hormone-tetrac receptor and changes the physical state of the integrin. Tetrac also affects expression of the genes for other CNS-relevant chemokines, including CCL20, CCL26, CXCL2, CXCL3, and CXCL10. The chemokine products of these genes are important to vascularity of the brain, particularly of the choroid plexus, to inflammatory processes in the CNS and, in certain cases, to neuroprotection. Thyroid hormones are known to contribute to regulation of each of these CNS functions. We propose that actions of thyroid hormone and hormone analogues on chemokine gene expression contribute to regulation of inflammatory processes in brain and of brain blood vessel formation and maintenance. PMID:27493972

  13. Radiolabeled Somatostatin Analogue Therapy Of Gastroenteropancreatic Cancer.

    PubMed

    Bodei, Lisa; Kwekkeboom, Dik J; Kidd, Mark; Modlin, Irvin M; Krenning, Eric P

    2016-05-01

    Peptide receptor radionuclide therapy (PRRT) has been utilized for more than two decades and has been accepted as an effective therapeutic modality in the treatment of inoperable or metastatic gastroenteropancreatic neuroendocrine neoplasms (NENs) or neuroendocrine tumors (NETs). The two most commonly used radiopeptides for PRRT, (90)Y-octreotide and (177)Lu-octreotate, produce disease-control rates of 68%-94%, with progression-free survival rates that compare favorably with chemotherapy, somatostatin analogues, and newer targeted therapies. In addition, biochemical and symptomatic responses are commonly observed. In general, PRRT is well tolerated with only low to moderate toxicity in most individuals. In line with the need to place PRRT in the therapeutic sequence of gastroenteropancreatic NENs, a recently sponsored phase III randomized trial in small intestine NENs treated with (177)Lu-octreotate vs high-dose octreotide long-acting release demonstrated that (177)Lu-octreotate significantly improved progression-free survival. Other strategies that are presently being developed include combinations with targeted therapies or chemotherapy, intra-arterial PRRT, and salvage treatments. Sophisticated molecular tools need to be incorporated into the management strategy to more effectively define therapeutic efficacy and for an early identification of adverse events. The strategy of randomized controlled trials is a key issue to standardize the treatment and establish the position of PRRT in the therapeutic algorithm of NENs. PMID:27067503

  14. Actions of Thyroid Hormone Analogues on Chemokines.

    PubMed

    Davis, Paul J; Glinsky, Gennadi V; Lin, Hung-Yun; Mousa, Shaker A

    2016-01-01

    The extracellular domain of plasma membrane integrin αvβ3 contains a receptor for thyroid hormone (L-thyroxine, T4; 3,5,3'-triiodo-L-thyronine, T3); this receptor also binds tetraiodothyroacetic acid (tetrac), a derivative of T4. Tetrac inhibits the binding of T4 and T3 to the integrin. Fractalkine (CX3CL1) is a chemokine relevant to inflammatory processes in the CNS that are microglia-dependent but also important to normal brain development. Expression of the CX3CL1 gene is downregulated by tetrac, suggesting that T4 and T3 may stimulate fractalkine expression. Independently of its specific receptor (CX3CR1), fractalkine binds to αvβ3 at a site proximal to the thyroid hormone-tetrac receptor and changes the physical state of the integrin. Tetrac also affects expression of the genes for other CNS-relevant chemokines, including CCL20, CCL26, CXCL2, CXCL3, and CXCL10. The chemokine products of these genes are important to vascularity of the brain, particularly of the choroid plexus, to inflammatory processes in the CNS and, in certain cases, to neuroprotection. Thyroid hormones are known to contribute to regulation of each of these CNS functions. We propose that actions of thyroid hormone and hormone analogues on chemokine gene expression contribute to regulation of inflammatory processes in brain and of brain blood vessel formation and maintenance. PMID:27493972

  15. Cell-Cycle Analyses Using Thymidine Analogues in Fission Yeast

    PubMed Central

    Anda, Silje; Boye, Erik; Grallert, Beata

    2014-01-01

    Thymidine analogues are powerful tools when studying DNA synthesis including DNA replication, repair and recombination. However, these analogues have been reported to have severe effects on cell-cycle progression and growth, the very processes being investigated in most of these studies. Here, we have analyzed the effects of 5-ethynyl-2′-deoxyuridine (EdU) and 5-Chloro-2′-deoxyuridine (CldU) using fission yeast cells and optimized the labelling procedure. We find that both analogues affect the cell cycle, but that the effects can be mitigated by using the appropriate analogue, short pulses of labelling and low concentrations. In addition, we report sequential labelling of two consecutive S phases using EdU and 5-bromo-2′-deoxyuridine (BrdU). Furthermore, we show that detection of replicative DNA synthesis is much more sensitive than DNA-measurements by flow cytometry. PMID:24551125

  16. Synthesis of a stable and orally bioavailable englerin analogue.

    PubMed

    Fash, David M; Peer, Cody J; Li, Zhenwu; Talisman, Ian J; Hayavi, Sima; Sulzmaier, Florian J; Ramos, Joe W; Sourbier, Carole; Neckers, Leonard; Figg, W Douglas; Beutler, John A; Chain, William J

    2016-06-01

    Synthesis of analogues of englerin A with a reduced propensity for hydrolysis of the glycolate moiety led to a compound which possessed the renal cancer cell selectivity of the parent and was orally bioavailable in mice. PMID:27107948

  17. Efficient total syntheses and biological activities of two teixobactin analogues.

    PubMed

    Parmar, Anish; Iyer, Abhishek; Vincent, Charlotte S; Van Lysebetten, Dorien; Prior, Stephen H; Madder, Annemieke; Taylor, Edward J; Singh, Ishwar

    2016-04-26

    The discovery of the new antibiotic teixobactin has been timely in the race for unearthing novel antibiotics wherein the emergence of drug resistant bacteria poses a serious threat worldwide. Herein, we present the total syntheses and biological activities of two teixobactin analogues. This approach is simple, efficient and has several advantages: it uses commercially available building blocks (except AllocHN-d-Thr-OH), has a single purification step and a good recovery (22%). By using this approach we have synthesised two teixobactin analogues and established that the d-amino acids are critical for the antimicrobial activity of these analogues. With continuing high expectations from teixobactin, this work can be regarded as a stepping stone towards an in depth study of teixobactin, its analogues and the quest for synthesising similar molecules. PMID:26984316

  18. Defining Analytical Strategies for Mars Sample Return with Analogue Missions

    NASA Astrophysics Data System (ADS)

    Osinski, G. R.; Sapers, H. M.; Francis, R.; Pontefract, A.; Tornabene, L. L.; Haltigin, T.

    2016-05-01

    The characterization of biosignatures in MSR samples will require integrated, cross-platform laboratory analyses carefully correlated and calibrated with Rover-based technologies. Analogue missions provide context for implementation and assessment.

  19. Effects of Prostaglandin Analogues on Aqueous Humor Outflow Pathways

    PubMed Central

    Winkler, Nelson S.

    2014-01-01

    Abstract Elevated intraocular pressure (IOP) is the most prevalent risk factor for glaucoma. All treatments, whether surgical or pharmaceutical, are aimed at lowering IOP. Prostaglandin analogues are a first line therapy for glaucoma due to their ability to reduce IOP, once-daily dosing, efficacy, and minimal side-effect profile. Whereas prostaglandin analogues have been known to alter aqueous humor outflow through the unconventional (uveoscleral) pathway, more recent evidence suggests their action also occurs through the conventional (trabecular) pathway. Understanding how prostaglandin analogues successfully lower IOP is important, as this information may lead to the discovery of new molecular targets for future therapeutic intervention. This review explores the current understanding of prostaglandin analogue biology as it pertains to IOP reduction and improved aqueous humor outflow facility. PMID:24359106

  20. Practical enantiospecific syntheses of lysobisphosphatidic acid and its analogues.

    PubMed

    Jiang, Guowei; Xu, Yong; Prestwich, Glenn D

    2006-02-01

    We describe a versatile, efficient, and practical method for the preparation of enantiomerically pure lysobisphosphatidic acid (LBPA), bisether analogues, and phosphorothioate analogues of LBPA from solketal. Phosphorylation of a protected sn-2-O-oleoyl glycerol with 2-cyanoethyl bis(N,N-diisopropylamino)phosphite, followed by oxidation and deprotection, generated the enantiomers of 2,2'-LBPA. The corresponding phosphorothioate analogues were obtained by oxidation with sulfur. The (R,R) and (S,S) enantiomers of both LBPA and phosphorothioate LBPA were synthesized from (S)- and (R)-solketal, respectively. The ether analogue of (S,S)-lysobisphosphatidic acid (LBPA) and its enantiomer were synthesized from the same enantiomer (S)-solketal by simply changing the sequence of deprotection steps. PMID:16438504

  1. From BPA to its analogues: Is it a safe journey?

    PubMed

    Usman, Afia; Ahmad, Masood

    2016-09-01

    Bisphenol-A (BPA) is one of the most abundant synthetic chemicals in the world due to its uses in plastics. Its widespread exposure vis-a-vis low dose effects led to a reduction in its safety dose and imposition of ban on its use in infant feeding bottles. This restriction paved the way for the gradual market entry of its analogues. However, their structural similarity to BPA has put them under surveillance for endocrine disrupting potential. The application of these analogues is increasing and so are the studies reporting their toxicity. This review highlights the reasons which led to the ban of BPA and also reports the exposure and toxicological data available on its analogues. Hence, this compilation is expected to answer in a better way whether the replacement of BPA by these analogues is safer or more harmful? PMID:27262103

  2. Structural analogues of diosgenyl saponins: synthesis and anticancer activity.

    PubMed

    Kaskiw, Matthew J; Tassotto, Mary Lynn; Mok, Mac; Tokar, Stacey L; Pycko, Roxanne; Th'ng, John; Jiang, Zi-Hua

    2009-11-15

    Saponins display various biological activities including anti-tumor activity. Recently intensive research has been focused on developing saponins for tumor therapies. The diosgenyl saponin dioscin is one of the most common steroidal saponins and exhibits potent anticancer activity in several human cancer cells through apoptosis-inducing pathways. In this paper, we describe the synthesis of several diosgenyl saponin analogues containing either a 2-amino-2-deoxy-beta-d-glucopyranosyl residue or an alpha-l-rhamnopyranosyl-(1-->4)-2-amino-2-deoxy-beta-d-glucopyranosyl residue with different acyl substituents on the amino group. The cytotoxic activity of these compounds was evaluated in MCF-7 breast cancer cells and HeLa cervical cancer cells. Structure-activity relationship studies show that the disaccharide saponin analogues are in general less active than their corresponding monosaccharide analogues. The incorporation of an aromatic nitro functionality into these saponin analogues does not exhibit significant effect on their cytotoxic activity. PMID:19819703

  3. Carbacaprazamycins: Chemically Stable Analogues of the Caprazamycin Nucleoside Antibiotics.

    PubMed

    Ichikawa, Satoshi; Yamaguchi, Mayumi; Hsuan, Lee Shang; Kato, Yuta; Matsuda, Akira

    2015-04-10

    Carbacaprazamycins, which are chemically stable analogues of caprazamycins, were designed and synthesized. These analogues were active against drug-resistant bacterial pathogens such as methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, and their activities were comparable to those of the parent caprazamycins. The effect of treatment with carbacaprazamycin on morphological changes in S. aureus indicated that the mode of action was completely different from those of existing peptidoglycan inhibitors. PMID:27622529

  4. Analogue and digital linear modulation techniques for mobile satellite

    NASA Technical Reports Server (NTRS)

    Whitmarsh, W. J.; Bateman, A.; Mcgeehan, J. P.

    1990-01-01

    The choice of modulation format for a mobile satellite service is complex. The subjective performance is summarized of candidate schemes and voice coder technologies. It is shown that good performance can be achieved with both analogue and digital voice systems, although the analogue system gives superior performance in fading. The results highlight the need for flexibility in the choice of signaling format. Linear transceiver technology capable of using many forms of narrowband modulation is described.

  5. Amphiphilic Tobramycin Analogues as Antibacterial and Antifungal Agents

    PubMed Central

    Shrestha, Sanjib K.; Fosso, Marina Y.; Green, Keith D.

    2015-01-01

    In this study, we investigated the in vitro antifungal activities, cytotoxicities, and membrane-disruptive actions of amphiphilic tobramycin (TOB) analogues. The antifungal activities were established by determination of MIC values and in time-kill studies. Cytotoxicity was evaluated in mammalian cell lines. The fungal membrane-disruptive action of these analogues was studied by using the membrane-impermeable dye propidium iodide. TOB analogues bearing a linear alkyl chain at their 6″-position in a thioether linkage exhibited chain length-dependent antifungal activities. Analogues with C12 and C14 chains showed promising antifungal activities against tested fungal strains, with MIC values ranging from 1.95 to 62.5 mg/liter and 1.95 to 7.8 mg/liter, respectively. However, C4, C6, and C8 TOB analogues and TOB itself exhibited little to no antifungal activity. Fifty percent inhibitory concentrations (IC50s) for the most potent TOB analogues (C12 and C14) against A549 and Beas 2B cells were 4- to 64-fold and 32- to 64-fold higher, respectively, than their antifungal MIC values against various fungi. Unlike conventional aminoglycoside antibiotics, TOB analogues with alkyl chain lengths of C12 and C14 appear to inhibit fungi by inducing apoptosis and disrupting the fungal membrane as a novel mechanism of action. Amphiphilic TOB analogues showed broad-spectrum antifungal activities with minimal mammalian cell cytotoxicity. This study provides novel lead compounds for the development of antifungal drugs. PMID:26033722

  6. Analogue gravitational phenomena in Bose-Einstein condensates

    NASA Astrophysics Data System (ADS)

    Finazzi, Stefano

    2012-08-01

    Analogue gravity is based on the simple observation that perturbations propagating in several physical systems can be described by a quantum field theory in a curved spacetime. While phenomena like Hawking radiation are hardly detectable in astrophysical black holes, these effects may be experimentally tested in analogue systems. In this Thesis, focusing on Bose-Einstein condensates, we present our recent results about analogue models of gravity from three main perspectives: as laboratory tests of quantum field theory in curved spacetime, for the techniques that they provide to address various issues in general relativity, and as toy models of quantum gravity. The robustness of Hawking-like particle creation is investigated in flows with a single black hole horizon. Furthermore, we find that condensates with two (white and black) horizons develop a dynamical instability known in general relativity as black hole laser effect. Using techniques borrowed from analogue gravity, we also show that warp drives, which are general relativistic spacetimes allowing faster-than-light travel, are unstable. Finally, the cosmological constant issue is investigated from an analogue gravity perspective and relativistic Bose-Einstein condensates are proposed as new analogue systems with novel interesting properties.

  7. Cladribine Analogues via O6-(Benzotriazolyl) Derivatives of Guanine Nucleosides

    PubMed Central

    Satishkumar, Sakilam; Vuram, Prasanna K.; Relangi, Siva Subrahmanyam; Gurram, Venkateshwarlu; Zhou, Hong; Kreitman, Robert J.; Montemayor, Michelle M. Martínez; Yang, Lijia; Kaliyaperumal, Muralidharan; Sharma, Somesh; Pottabathini, Narender; Lakshman, Mahesh K.

    2016-01-01

    Cladribine, 2-chloro-2′-deoxyadenosine, is a highly efficacious clinically used nucleoside for the treatment of hairy cell leukemia. It is also being evaluated against other lymphoid malignancies and has been a molecule of interest for well over half a century. In continuation of our interest on the amide bond-activation in purine nucleosides via the use of (benzotriazol-1yl-oxy)tris(dimethylamino)phosphonium hexafluorophosphate, we have evaluated the use of O6-(benzotriazol-1-yl)-2′-deoxyguanosine as a potential precursor to cladribine and its analogues. These compounds, after appropriate deprotection, were assessed for their biological activities and the data are presented herein. Against hairy cell leukemia (HCL), T-cell lymphoma (TCL), and chronic lymphocytic leukemia (CLL) cladribine was the most active against all. The bromo analogue of cladribine showed comparable activity to the ribose analogue of cladribine against HCL, but was more active against TCL and CLL. The bromo ribo analogue of cladribine possessed activity, but was least active among the C6-NH2-containing compounds. Substitution with alkyl groups at the exocyclic amino group appears detrimental to activity, and only the C6 piperidinyl cladribine analogue demonstrated any activity. Against adenocarcinoma MDA-MB-231 cells, only cladribine and its ribose analogue were most active. PMID:26556315

  8. Bisphenol A and Its Analogues Activate Human Pregnane X Receptor

    PubMed Central

    Sui, Yipeng; Ai, Ni; Park, Se-Hyung; Rios-Pilier, Jennifer; Perkins, Jordan T.; Welsh, William J.

    2012-01-01

    Background: Bisphenol A (BPA) is a base chemical used extensively in many consumer products. BPA and its analogues are present in environmental and human samples. Many endocrine-disrupting chemicals, including BPA, have been shown to activate the pregnane X receptor (PXR), a nuclear receptor that functions as a master regulator of xenobiotic metabolism. However, the detailed mechanism by which these chemicals activate PXR remains unknown. Objective: We investigated the mechanism by which BPA interacts with and activates PXR and examined selected BPA analogues to determine whether they bind to and activate PXR. Methods: Cell-based reporter assays, in silico ligand–PXR docking studies, and site-directed mutagenesis were combined to study the interaction between BPA and PXR. We also investigated the influence of BPA and its analogues on the regulation of PXR target genes in human LS180 cells. Results: We found that BPA and several of its analogues are potent agonists for human PXR (hPXR) but do not affect mouse PXR activity. We identified key residues within hPXR’s ligand-binding pocket that constitute points of interaction with BPA. We also deduced the structural requirements of BPA analogues that activate hPXR. BPA and its analogues can also induce PXR target gene expression in human LS180 cells. Conclusions: The present study advances our understanding of the mechanism by which BPA interacts with and activates human PXR. Activation of PXR by BPA may explain some of the adverse effects of BPA in humans. PMID:22214767

  9. Hydrophobic surfactant proteins and their analogues.

    PubMed

    Walther, Frans J; Waring, Alan J; Sherman, Mark A; Zasadzinski, Joseph A; Gordon, Larry M

    2007-01-01

    Lung surfactant is a complex mixture of phospholipids and four surfactant-associated proteins (SP-A, SP-B, SP-C and SP-D). Its major function in the lung alveolus is to reduce surface tension at the air-water interface in the terminal airways by the formation of a surface-active film enriched in surfactant lipids, hence preventing cellular collapse during respiration. Surfactant therapy using bovine or porcine lung surfactant extracts, which contain only polar lipids and native SP-B and SP-C, has dramatically improved the therapeutic outcomes of preterm infants with respiratory distress syndrome (RDS). One important goal of surfactant researchers is to replace animal-derived therapies with fully synthetic preparations based on SP-B and SP-C, produced by recombinant technology or peptide synthesis, and reconstituted with selected synthetic lipids. Here, we review recent research developments with peptide analogues of SP-B and SP-C, designed using either the known primary sequence and three-dimensional (3D) structure of the native proteins or, alternatively, the known 3D structures of closely homologous proteins. Such SP-B and SP-C mimics offer the possibility of studying the mechanisms of action of the respective native proteins, and may allow the design of optimized surfactant formulations for specific pulmonary diseases (e.g., acute lung injury (ALI) or acute respiratory distress syndrome (ARDS)). These synthetic surfactant preparations may also be a cost-saving therapeutic approach, with better quality control than may be obtained with animal-based treatments. PMID:17575474

  10. Vascular disrupting activity of combretastatin analogues.

    PubMed

    Porcù, Elena; Salvador, Alessia; Primac, Irina; Mitola, Stefania; Ronca, Roberto; Ravelli, Cosetta; Bortolozzi, Roberta; Vedaldi, Daniela; Romagnoli, Romeo; Basso, Giuseppe; Viola, Giampietro

    2016-08-01

    Tubulin binding agents (TBAs) are drugs commonly used in cancer therapy as antimitotics. In the last years it has been described that TBAs, like combretastatin A-4 (CA-4), present also vascular disrupting activity and among its derivatives we identified three analogues endowed with potent microtubule depolymerizing activity, higher than that of the lead compound. In this paper we have investigated the anti-vascular activity of these derivatives. We tested the anti-angiogenic effects in human umbilical endothelial cells (HUVEC) and in vivo in chick chorioallantoic membrane assay (CAM), and in a syngeneic tumor mouse model. The three molecules, compound 1: 1-(3,4,5-trimethoxyphenyl)-5-(4-ethoxyphenyl)-1H-1,2,4-triazole; compound 2: (1-(3,4,5-trimethoxyphenyl)-5-(4-ethoxyphenyl)-1H-tetrazole, compound-3 (4-amino-2-p-tolylaminothiazol-5-yl)-(3,4,5-trimethoxyphenyl)-methanone) showed a moderate effect on the growth of HUVEC cells at concentrations below 200nM. At lower concentrations (5-20nM), in particular compound 2, they induced inhibition of capillary tube formation, inhibition of endothelial cell migration and affected endothelial cell morphology as demonstrated by the alteration of the microfilaments network. Moreover, they also increased permeability of HUVEC cells in a time dependent manner. In addition, compounds 1 and 3, as well as the reference compound CA-4, inhibited VEGF-induced phosphorylation of VE-cadherin and in addition compound 3 prevented the VEGF-induced phosphorylation of FAK. In CAM assay, both compounds 2 and 3 efficiently counteracted the strong angiogenic response induced by bFGF, even at the lowest concentration used (1pmol/egg). Moreover in a syngenic mouse model, compounds 1-3 after a single i.p. injection (30mg/kg), showed a stronger reduction of microvascular density. Altogether our results identified these derivatives as potential new vascular disrupting agents candidates. PMID:27235861

  11. Somatostatin Analogues for Receptor Targeted Photodynamic Therapy

    PubMed Central

    Kaščáková, Slávka; Hofland, Leo J.; De Bruijn, Henriette S.; Ye, Yunpeng; Achilefu, Samuel; van der Wansem, Katy; van der Ploeg-van den Heuvel, Angelique; van Koetsveld, Peter M.; Brugts, Michael P.; van der Lelij, Aart-Jan; Sterenborg, Henricus J. C. M.; ten Hagen, Timo L. M.; Robinson, Dominic J.; van Hagen, Martin P.

    2014-01-01

    Photodynamic therapy (PDT) is an established treatment modality, used mainly for anticancer therapy that relies on the interaction of photosensitizer, light and oxygen. For the treatment of pathologies in certain anatomical sites, improved targeting of the photosensitizer is necessary to prevent damage to healthy tissue. We report on a novel dual approach of targeted PDT (vascular and cellular targeting) utilizing the expression of neuropeptide somatostatin receptor (sst2) on tumor and neovascular-endothelial cells. We synthesized two conjugates containing the somatostatin analogue [Tyr3]-octreotate and Chlorin e6 (Ce6): Ce6-K3-[Tyr3]-octreotate (1) and Ce6-[Tyr3]-octreotate-K3-[Tyr3]-octreotate (2). Investigation of the uptake and photodynamic activity of conjugates in-vitro in human erythroleukemic K562 cells showed that conjugation of [Tyr3]-octreotate with Ce6 in conjugate 1 enhances uptake (by a factor 2) in cells over-expressing sst2 compared to wild-type cells. Co-treatment with excess free Octreotide abrogated the phototoxicity of conjugate 1 indicative of a specific sst2-mediated effect. In contrast conjugate 2 showed no receptor-mediated effect due to its high hydrophobicity. When compared with un-conjugated Ce6, the PDT activity of conjugate 1 was lower. However, it showed higher photostability which may compensate for its lower phototoxicity. Intra-vital fluorescence pharmacokinetic studies of conjugate 1 in rat skin-fold observation chambers transplanted with sst2+ AR42J acinar pancreas tumors showed significantly different uptake profiles compared to free Ce6. Co-treatment with free Octreotide significantly reduced conjugate uptake in tumor tissue (by a factor 4) as well as in the chamber neo-vasculature. These results show that conjugate 1 might have potential as an in-vivo sst2 targeting photosensitizer conjugate. PMID:25111655

  12. Habitability & Astrobiology Research in Mars Terrestrial Analogues

    NASA Astrophysics Data System (ADS)

    Foing, Bernard

    2014-05-01

    We performed a series of field research campaigns (ILEWG EuroMoonMars) in the extreme Utah desert relevant to Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL), or Moon geochemistry (SMART-1, LRO). We shall give an update on the sample analysis in the context of habitability and astrobiology. Methods & Results: In the frame of ILEWG EuroMoonMars campaigns (2009 to 2013) we deployed at Mars Desert Research station, near Hanksville Utah, a suite of instruments and techniques [A, 1, 2, 9-11] including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution affected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. Among the important findings are the diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with significant heterogeneity. An extraordinary variety of putative extremophiles was observed [3,4,9]. A dominant factor seems to be soil porosity and lower clay-sized particle content [6-8]. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples [10, 11]. We compare the 2009 campaign results [1-9] to new measurements from 2010-2013 campaigns [10-12] relevant to: comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life. Keywords: field analogue research, astrobiology, habitability, life detection, Earth-Moon-Mars, organics References [A] Foing, Stoker & Ehrenfreund (Editors, 2011) "Astrobiology field Research in Moon/Mars Analogue Environments", Special Issue of International

  13. Kinetic preference for the 3'-5'-linked dimer in the reaction of guanosine 5'-phosphorylmorpholinamide with deoxyguanosine 5'-phosphoryl-2-methylimidazolide as a function of poly(C) concentration

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.

    1998-01-01

    The formation of the internucleotide bond in diguanylate synthesis was studied in aqueous solution at pH 8 and 0.2 M Mg2+ in the presence and absence of polycytidylate, poly(C). The investigation was simplified by using guanosine 5'-phosphorylmorpholinamide, mor-pG, which can act only as a nucleophile, and deoxyguanosine 5'-phosphoryl-2-methylimidazolide, 2-MeImpdG, which can act only as an electrophile. The time-dependent product distribution was monitored by high-performance liquid chromatography (HPLC) and liquid chromatography mass spectrometry (LC/MS). In the absence of poly(C) the reaction between mor-pG and 2-MeImpdG yielded small amounts of the dimer mor-pGpdG with a regioselectivity of 2'-5':3'-5' = 3.5. In the presence of poly(C) dimer yields increased and a reversal in regioselectivity occurred; both effects were in proportion to the concentration of the polymer. The results can be quantitatively explained with the proposition that poly(C), acting as the template, catalyzes the reaction between template-bound monomers by about a factor of 4-5 over the reaction in solution and yields dimers with a regioselectivity of 2'-5':3'-5' approximately 0.33. These findings illustrate the intrinsic preference of guanosine monomers to correctly self-assemble on the appropriate template.

  14. Incorporation of tryptophan analogues into the lantibiotic nisin.

    PubMed

    Zhou, Liang; Shao, Jinfeng; Li, Qian; van Heel, Auke J; de Vries, Marcel P; Broos, Jaap; Kuipers, Oscar P

    2016-05-01

    Lantibiotics are posttranslationally modified peptides with efficient inhibitory activity against various Gram-positive bacteria. In addition to the original modifications, incorporation of non-canonical amino acids can render new properties and functions to lantibiotics. Nisin is the most studied lantibiotic and contains no tryptophan residues. In this study, a system was constructed to incorporate tryptophan analogues into nisin, which included the modification machinery (NisBTC) and the overexpression of tryptophanyl-tRNA synthetase (TrpRS). Tryptophan and three different tryptophan analogues (5-fluoroTrp (5FW), 5-hydroxyTrp (5HW) and 5-methylTrp (5MeW)) were successfully incorporated at four different positions of nisin (I1W, I4W, M17W and V32W). The incorporation efficiency of tryptophan analogues into mutants I1W, M17W and V32W was over 97 %, while the mutant I4W showed relatively low incorporation efficiency (69-93 %). The variants with 5FW showed relatively higher production yield, while 5MeW-containing variants showed the lowest yield. The dehydration efficiency of serines or threonines was affected by the tryptophan mutants of I4W and V32W. The affinity of the peptides for the cation-ion exchange and reverse phase chromatography columns was significantly reduced when 5HW was incorporated. The antimicrobial activity of IIW and its 5FW analogue both decreased two times compared to that of nisin, while that of its 5HW analogue decreased four times. The 5FW analogue of I4W also showed two times decreased activity than nisin. However, the mutant M17W and its 5HW analogue both showed 32 times reduced activity relative to that of nisin. PMID:26872656

  15. Phosphonate analogues of carboxypeptidase A substrates are potent transition-state analogue inhibitors.

    PubMed

    Hanson, J E; Kaplan, A P; Bartlett, P A

    1989-07-25

    Analogues of tri- and tetrapeptide substrates of carboxypeptidase A in which the scissile peptide linkage is replaced with a phosphonate moiety (-PO2--O-) were synthesized and evaluated as inhibitors of the enzyme. The inhibitors terminated with either L-lactate or L-phenyllactate [designated (O) Ala and (O) Phe, respectively] in the P1' position. Transition-state analogy was shown for a series of 14 tri- and tetrapeptide derivatives containing the structure RCO-AlaP-(O)Ala [RCO-AP(O)A, AP indicates the phosphonic acid analogue of alanine] by the correlation of the Ki values for the inhibitors and the Km/kcat values for the corresponding amide substrates. This correlation supports a transition state for the enzymatic reaction that resembles the tetrahedral intermediate formed upon addition of water to the scissile carbonyl group. The inhibitors containing (O) Phe at the P1' position proved to be the most potent reversible inhibitors of carboxypeptidase A reported to date: the dissociation constants of ZAFP(O)F, ZAAP(O)F, and ZFAP(O)F are 4, 3, and 1 pM, respectively. Because of the high affinity of these inhibitors, their dissociation constants could not be determined by steady-state methods. Instead, the course of the association and dissociation processes was monitored for each inhibitor as its equilibrium with the enzyme was established in both the forward and reverse directions. A phosphonamidate analogue, ZAAPF, in which the peptide linkage is replaced with a -PO2-NH- moiety, was prepared and shown to hydrolyze rapidly at neutral pH (t1/2 = 20 min at pH 7.5). This inhibitor is bound an order of magnitude less tightly than the corresponding phosphonate, ZAAP(O)F, a result that contrasts with the 840-fold higher affinity of phosphonamidates for thermolysin [Bartlett, P. A., & Marlowe, C. K. (1987) Science 235, 569-571], a zinc peptidase with a similar arrangement of active-site catalytic residues. PMID:2790000

  16. Terrestrial research in Mars analogue environments

    NASA Astrophysics Data System (ADS)

    Osipov, G.

    Fatty acids (FA) content was measured by GC-MS SIM technique in Sulfide ores of present day (Mid-Atlantic Ridge and others) and ancient (Ural Paleocene, Russia) black smokers; Early Proterozoic kerites of Volyn; Siberian, Canadian and Antarctic permafrosts and also in rocks of East-European platform Achaean crystalline basement. Analysis was shown presence those and only those fatty acids which are specific to microorganisms. FA with 12 up 19 of carbon atoms are thought to be a bacterial biomass sign. 3-Hydroxy fatty acids also found in samples and are strong specific markers of gram-negative bacteria. Cultivation yield living bacteria in some cases. The East-European platform Achaean crystalline basement rocks opened by Vorotilov Deep Well (VDW) drilled through Puchezh-Katunski impact structure were studied within depths 2575 - 2805 m. 34 microbial lipid markers were detected by GC-MS and 22 species were identified. Bacteria of g. Bacillus reached 6,8 % in subsurface communities. However, members of gg. Clostridium (37,1 - 33,2 %) and Rhodococcus (27,6 - 33,7 %) were absolute dominants within studied depth interval. Some lipid patterns of kerite samples could be assessed to definite genera or, in special cases, to species of contemporary microorganisms. For instance, 2-hydroxylauric acid is specific to Pseudomonas putida group or Acinetobacter spp., and hydroxymyristic together with hydroxypalmitic are specific to P.cepacea and cyanobacteria. 3-hydroxystearic acid was known as component of Acetobacter diazothrophycus and Gloebacter violaceous cyanobacterium. 10-hydroxystearic acid associated with Nocardia spp., which oxidizes oleic acid in organic substrates. 10-methylhexadecanoic (10Me16) acid together with 10Me14, 10Me15 and 10Me17 analogues are markers of actinomycetes. Significant part of Black Smokers organic matter is probably biogenic. Fatty acid features strongly assigns it to bacterial, microeucariotic and planta cells. Par example 3-hydroxy acids are

  17. Spectral analysis of lunar analogue samples

    NASA Astrophysics Data System (ADS)

    Offringa, Marloes; Foing, Bernard

    2016-04-01

    Analyses of samples derived from terrestrial analogue sites are used to study lunar processes in their geological context (Foing, Stoker, Ehrenfreund, 2011). For this study samples from the volcanic region of the Eifel, Germany collected during field campaigns (Foing et al., 2010), are analyzed with a variety of spectrometers. The aim is to obtain a database of analyzed samples that could be used as a reference for future in situ measurements. Equipment used in the laboratory consists of a Fourier Transform Infrared (FTIR) spectrometer, an X-Ray Fluorescence (XRF) spectrometer, a Raman laser spectrometer, as well as UV-VIS and NIR reflectance spectrometers. The Raman, UV-VIS and NIR are also used in combination with the EXoGeoLab mock-up lander during field campaigns (Foing, Stoker, Ehrenfreund, 2011). Calibration of the UV-VIS and NIR reflectance spectrometers is the main focus of this research in order to obtain the clearest spectra. The calibration of the UV-VIS and NIR reflectance spectrometers requires the use of a good light source as well as suitable optical fibers to create a signal that covers the widest range in wavelengths available. To eliminate noise towards the edges of this range, multiple measurements are averaged and data is processed by dividing the signal by reference spectra. Calibration of the devices by creating a new dark and reference spectra has to take place after every sample measurement. In this way we take into account changes that occur in the signal due to the eating of the devices during the measurements. Moreover, the integration time is adjusted to obtain a clear signal without leading to oversaturation in the reflectance spectrum. The typical integration times for the UV-VIS reflectance spectrometer vary between 1 - 18 s, depending on the amount of daylight during experiments. For the NIR reflectance spectrometer the integration time resulting in the best signals is approximately 150 ms in combination with a broad spectrum light

  18. Iron isotopes in an Archean ocean analogue

    NASA Astrophysics Data System (ADS)

    Busigny, Vincent; Planavsky, Noah J.; Jézéquel, Didier; Crowe, Sean; Louvat, Pascale; Moureau, Julien; Viollier, Eric; Lyons, Timothy W.

    2014-05-01

    Iron isotopes have been extensively used to trace the history of microbial metabolisms and the redox evolution of the oceans. Archean sedimentary rocks display greater variability in iron isotope ratios and more markedly negative values than those deposited in the Proterozoic and Phanerozoic. This increased variability has been linked to changes in either water column iron cycling or the extent of benthic microbial iron reduction through time. We tested these contrasting scenarios through a detailed study of anoxic and ferruginous Lac Pavin (France), which can serve as a modern analogue of the Archean ocean. A depth-profile in the water column of Lac Pavin shows a remarkable increase in dissolved Fe concentration (0.1-1200 μM) and δ56Fe values (-2.14‰ to +0.31‰) across the oxic-anoxic boundary to the lake bottom. The largest Fe isotope variability is found at the redox boundary and is related to partial oxidation of dissolved ferrous iron, leaving the residual Fe enriched in light isotopes. The analysis of four sediment cores collected along a lateral profile (one in the oxic layer, one at the redox boundary, one in the anoxic zone, and one at the bottom of the lake) indicates that bulk sediments, porewaters, and reactive Fe mostly have δ56Fe values near 0.0 ± 0.2‰, similar to detrital iron. In contrast, pyrite δ56Fe values in sub-chemocline cores (60, 65, and 92 m) are highly variable and show significant deviations from the detrital iron isotope composition (δ56Fepyrite between -1.51‰ and +0.09‰; average -0.93‰). Importantly, the pyrite δ56Fe values mirror the δ56Fe of dissolved iron at the redox boundary—where near quantitative sulfate and sulfide drawdown occurs—suggesting limited iron isotope fractionation during iron sulfide formation. This finding has important implications for the Archean environment. Specifically, this work suggests that in a ferruginous system, most of the Fe isotope variability observed in sedimentary pyrites can

  19. Review of insulin and its analogues in diabetes mellitus.

    PubMed

    Mane, Krishnappa; Chaluvaraju, Kc; Niranjan, Ms; Zaranappa, Tr; Manjuthej, Tr

    2012-03-01

    Diabetes is a metabolic disorder where in human body does not produce or properly uses insulin, a hormone that is required to convert sugar, starches and other food into energy. Diabetes finally leads to more complications and to prevent these complications insulin and its analogues are used. After more than half a century of treating diabetics with animal insulin's, recombinant DNA technologies and advanced protein chemistry made human insulin preparations available in the early 1980s. As the next step, over the last decade, insulin analogues were constructed by changing the structure of the native protein with the goal of improving the therapeutic properties of it, because the pharmacokinetic characteristics of rapid, intermediate and long-acting preparations of human insulin make it almost impossible to achieve sustained normoglycemia. The first clinically available insulin analogue, lispro, confirmed the hopes by showing that improved glycaemic control can be achieved without an increase in hypoglycaemic events. Two new insulin analogues, insulin glargine and insulin aspart, have recently been approved for clinical use in the United States and several other analogues are being intensively tested. PMID:24826038

  20. Migrastatin analogues target fascin to block tumour metastasis

    SciTech Connect

    Chen, L.; Jakoncic, J.; Yang, S.; Zhang, J.; Huang, X.Y.

    2010-04-15

    Tumour metastasis is the primary cause of death of cancer patients. Development of new therapeutics preventing tumour metastasis is urgently needed. Migrastatin is a natural product secreted by Streptomyces, and synthesized migrastatin analogues such as macroketone are potent inhibitors of metastatic tumour cell migration, invasion and metastasis. Here we show that these migrastatin analogues target the actin-bundling protein fascin to inhibit its activity. X-ray crystal structural studies reveal that migrastatin analogues bind to one of the actin-binding sites on fascin. Our data demonstrate that actin cytoskeletal proteins such as fascin can be explored as new molecular targets for cancer treatment, in a similar manner to the microtubule protein tubulin.

  1. Membrane-permeable Triphosphate Prodrugs of Nucleoside Analogues.

    PubMed

    Gollnest, Tristan; Dinis de Oliveira, Thiago; Rath, Anna; Hauber, Ilona; Schols, Dominique; Balzarini, Jan; Meier, Chris

    2016-04-18

    The metabolic conversion of nucleoside analogues into their triphosphates often proceeds insufficiently. Rate-limitations can be at the mono-, but also at the di- and triphosphorylation steps. We developed a nucleoside triphosphate (NTP) delivery system (TriPPPro-approach). In this approach, NTPs are masked by two bioreversible units at the γ-phosphate. Using a procedure involving H-phosphonate chemistry, a series of derivatives bearing approved, as well as potentially antivirally active, nucleoside analogues was synthesized. The enzyme-triggered delivery of NTPs was demonstrated by pig liver esterase, in human T-lymphocyte cell extracts and by a polymerase chain reaction using a prodrug of thymidine triphosphate. The TriPPPro-compounds of some HIV-inactive nucleoside analogues showed marked anti-HIV activity. For cellular uptake studies, a fluorescent TriPPPro-compound was prepared that delivered the triphosphorylated metabolite to intact CEM cells. PMID:27008042

  2. The metabolic and mitogenic properties of basal insulin analogues

    PubMed Central

    2013-01-01

    Context Retrospective, observational studies have reported an association between diabetes treatment with insulin and a higher incidence of cancer. Objective Overview the literature for in vitro and in vivo studies of the metabolic and mitogenic properties of basal insulin analogues and assess the implications for clinical use. Methods Relevant studies were identified through PubMed and congress abstract database searches; data on metabolic and mitogenic signalling in relation to insulin treatment of diabetes are included in this review. Results The balance of evidence shows that although some analogues have demonstrated mitogenic potency in some in vitro studies in cancer cell lines, these findings do not translate to the in vivo setting in animals or to the clinical setting in humans. Conclusions The current consensus is that there is no clinical or in vivo evidence to indicate that any commercially available insulin analogue has carcinogenic effects. Large-scale, prospective clinical and observational studies will further establish any potential link. PMID:23373726

  3. Synthesis and cytotoxic activities of semisynthetic zearalenone analogues.

    PubMed

    Tadpetch, Kwanruthai; Kaewmee, Benyapa; Chantakaew, Kittisak; Kantee, Kawalee; Rukachaisirikul, Vatcharin; Phongpaichit, Souwalak

    2016-08-01

    Zearalenone is a β-resorcylic acid macrolide with various biological activities. Herein we report the synthesis and cytotoxic activities of 34 zearalenone analogues against human oral epidermoid carcinoma (KB) and human breast adenocarcinoma (MCF-7) cells as well as noncancerous Vero cells. Some zearalenone analogues showed moderately enhanced cytotoxic activities against the two cancer cell lines. We have discovered the potential lead compounds with diminished or no cytotoxicity to Vero cells. Preliminary structure-activity relationship studies revealed that the double bond at the 1' and 2' positions of zearalenone core was crucial for cytotoxic activities on both cell lines. In addition, for zearalenol analogues, the unprotected hydroxyl group at C-2 and an alkoxy substituent at C-4 played key roles on cytotoxic effects of both cell lines. PMID:27311894

  4. Synthesis and Biological Evaluation of New (-)-Englerin Analogues.

    PubMed

    López-Suárez, Laura; Riesgo, Lorena; Bravo, Fernando; Ransom, Tanya T; Beutler, John A; Echavarren, Antonio M

    2016-05-01

    We report the synthesis and biological evaluation of a series of (-)-englerin A analogues obtained along our previously reported synthetic route based on a stereoselective gold(I) cycloaddition process. This synthetic route is a convenient platform to access analogues with broad structural diversity and has led us to the discovery of unprecedented and easier-to-synthesize derivatives with an unsaturation in the cyclopentyl ring between C4 and C5. We also introduce novel analogues in which the original isopropyl motif has been substituted with cyclohexyl, phenyl, and cyclopropyl moieties. The high selectivity and growth-inhibitory activity shown by these new derivatives in renal cancer cell lines opens new ways toward the final goal of finding effective drugs for the treatment of renal cell carcinoma (RCC). PMID:27005578

  5. Analogue peptides for the immunotherapy of human acute myeloid leukemia.

    PubMed

    Hofmann, Susanne; Mead, Andrew; Malinovskis, Aleksandrs; Hardwick, Nicola R; Guinn, Barbara-Ann

    2015-11-01

    The use of peptide vaccines, enhanced by adjuvants, has shown some efficacy in clinical trials. However, responses are often short-lived and rarely induce notable memory responses. The reason is that self-antigens have already been presented to the immune system as the tumor develops, leading to tolerance or some degree of host tumor cell destruction. To try to break tolerance against self-antigens, one of the methods employed has been to modify peptides at the anchor residues to enhance their ability to bind major histocompatibility complex molecules, extending their exposure to the T-cell receptor. These modified or analogue peptides have been investigated as stimulators of the immune system in patients with different cancers with variable but sometimes notable success. In this review we describe the background and recent developments in the use of analogue peptides for the immunotherapy of acute myeloid leukemia describing knowledge useful for the application of analogue peptide treatments for other malignancies. PMID:26438084

  6. Nicorandil analogues containing NO-donor furoxans and related furazans.

    PubMed

    Boschi, D; Cena, C; Di Stilo, A; Fruttero, R; Gasco, A

    2000-07-01

    The synthesis and in vitro vasodilating properties of hybrid compounds in which furoxan (1,2,5-oxadiazole 2-oxide) moieties, endowed with different NO-donor properties, were substituted for the nitroxy function of Nicorandil are reported. The corresponding cyanoguanidine analogues are also considered. This approach has led to a series of vasorelaxing compounds devoid of affinity for K(ATP) channels, whose activity is prevalently due to their ability to activate sGC, at the concentrations of the experiments. Related furazan (1,2,5-oxadiazole) derivatives, unable to release nitric oxide were also prepared and studied for control. The amide analogues of Nicorandil display feeble vasorelaxing action not involving the activation of K+ channels, while in the guanidine analogues, this mechanism seems to underlie this action. PMID:10976520

  7. Analogue modelling of syntectonic leucosomes in migmatitic schists

    NASA Astrophysics Data System (ADS)

    Druguet, Elena; Carreras, Jordi

    2006-10-01

    Migmatites from the Cap de Creus tectonometamorphic belt display a wide variety of structures, from those formed when the leucosomes were melt-bearing, to those developed during solid-state deformation. The observed field structures have been modelled by means of analogue experiments. The materials used in the models are layered plasticine as a schist analogue, and chocolate as analogue of the crystallizing leucosome. A model for the development of syntectonic migmatites is proposed in which initial melt-bearing patches, preferentially formed within fertile pelitic layers, progressively evolve towards lens-shaped veins. Furthermore, heterogeneous deformation of anisotropic metasediments facilitates formation of extensional sites for further melt accumulation and transport. Melt crystallization implies a rapid increase in effective viscosity of leucosomes producing a reversal in competence contrast with respect to the enclosing schists. During the whole process, deformation localizes around crystallizing veins, giving rise to different and contrasting structures for melt-bearing and for solid-state stages.

  8. Relative benefits of linear analogue and advanced digital hearing aids.

    PubMed

    Wood, Sally A; Lutman, Mark E

    2004-03-01

    Speech recognition performance and self-reported benefit from linear analogue and advanced (digital) hearing aids were compared in 100 first-time hearing aid users with mild-to-moderate sensorineural hearing loss fitted monaurally with a behind-the-ear (BTE) hearing aid in a single-blind randomized crossover trial. Subjects used each aid for 5 weeks in turn, with aid order balanced across subjects. Three alternative models of digital hearing aid were assigned to subjects according to a balanced design. Aid type was disguised to keep subjects blind within practical limitations. Aided speech recognition performance in noise was measured at speech levels of 65 and 75dB at a speech-to-noise ratio (SNR) of +2dB for closed sets of single words. Self-rated benefit was measured using the Abbreviated Profile of Hearing Aid Benefit (APHAB) and the Glasgow Hearing Aid Benefit Profile (GHABP). Quality of life, hearing aid use and user preferences were also assessed. Speech recognition scores with the digital aids were significantly better at 75dB than with the analogue aids Self-reported benefit (APHAB, GHABP) and improvement in quality of life were generally not significantly different between analogue and digital aids, although aversiveness measured with the APHAB was significantly lower with digital aids, and satisfaction measured with the GHABP was greater. The digital aids were preferred significantly more often than the analogue aids, with 61 subjects choosing their digital aid, 26 choosing the analogue aid, and nine being equivocal. Overall, this study shows advantages for advanced digital over simple linear analogue aids in terms of both objective and subjective outcomes, although average differences are not large. PMID:15198378

  9. The Object-analogue approach for probabilistic forecasting

    NASA Astrophysics Data System (ADS)

    Frediani, M. E.; Hopson, T. M.; Anagnostou, E. N.; Hacker, J.

    2015-12-01

    The object-analogue is a new method to estimate forecast uncertainty and to derive probabilistic predictions of gridded forecast fields over larger regions rather than point locations. The method has been developed for improving the forecast of 10-meter wind speed over the northeast US, and it can be extended to other forecast variables, vertical levels, and other regions. The object-analogue approach combines the analog post-processing technique (Hopson 2005; Hamill 2006; Delle Monache 2011) with the Method for Object-based Diagnostic Evaluation (MODE) for forecast verification (Davis et al 2006a, b). Originally, MODE is used to verify mainly precipitation forecasts using features of a forecast region represented by an object. The analog technique is used to reduce the NWP systematic and random errors of a gridded forecast field. In this study we use MODE-derived objects to characterize the wind fields forecasts into attributes such as object area, centroid location, and intensity percentiles, and apply the analogue concept to these objects. The object-analogue method uses a database of objects derived from reforecasts and their respective reanalysis. Given a real-time forecast field, it searches the database and selects the top-ranked objects with the most similar set of attributes using the MODE fuzzy logic algorithm for object matching. The attribute probabilities obtained with the set of selected object-analogues are used to derive a multi-layer probabilistic prediction. The attribute probabilities are combined into three uncertainty layers that address the main concerns of most applications: location, area, and magnitude. The multi-layer uncertainty can be weighted and combined or used independently in such that it provides a more accurate prediction, adjusted according to the application interest. In this study we present preliminary results of the object-analogue method. Using a database with one hundred storms we perform a leave-one-out cross-validation to

  10. Naturally occurring crystalline phases: analogues for radioactive waste forms

    SciTech Connect

    Haaker, R.F.; Ewing, R.C.

    1981-01-01

    Naturally occurring mineral analogues to crystalline phases that are constituents of crystalline radioactive waste forms provide a basis for comparison by which the long-term stability of these phases may be estimated. The crystal structures and the crystal chemistry of the following natural analogues are presented: baddeleyite, hematite, nepheline; pollucite, scheelite;sodalite, spinel, apatite, monazite, uraninite, hollandite-priderite, perovskite, and zirconolite. For each phase in geochemistry, occurrence, alteration and radiation effects are described. A selected bibliography for each phase is included.

  11. Halogenase Engineering for the Generation of New Natural Product Analogues.

    PubMed

    Brown, Stephanie; O'Connor, Sarah E

    2015-10-12

    Halogenases catalyze the incorporation of halogen atoms into organic molecules. Given the importance that halogenation has on the biological activity of small molecules, these enzymes have been subjected to intense engineering efforts to make them more suitable for biotechnology applications. The ability to biohalogenate complex molecules provides, in principle, the opportunity for rapid generation of a series of analogues with new or improved properties. Here we discuss the potential and limitations of using halogenases as biocatalysts, including recent advances in engineering halogenases to generate halogenated natural product analogues. PMID:26256103

  12. Analogues of luteinizing hormone-releasing hormone containing cytotoxic groups.

    PubMed Central

    Janáky, T; Juhász, A; Bajusz, S; Csernus, V; Srkalovic, G; Bokser, L; Milovanovic, S; Redding, T W; Rékási, Z; Nagy, A

    1992-01-01

    In an attempt to produce better cytotoxic analogues, chemotherapeutic antineoplastic radicals including an alkylating nitrogen mustard derivative of D-phenylalanine (D-melphalan), reactive cyclopropane, anthraquinone derivatives [2-(hydroxymethyl)anthraquinone and the anticancer antibiotic doxorubicin], and an antimetabolite (methotrexate) were coupled to suitably modified agonists and antagonists of luteinizing hormone-releasing hormone (LH-RH). Analogues with D-lysine6 and D-ornithine6 or N epsilon-(2,3-diaminopropionyl)-D-lysine and N delta-(2,3-diaminopropionyl)-D-ornithine were used as carriers for one or two cytotoxic moieties. The enhanced biological activities produced by the incorporation of D amino acids into position 6 of the agonistic analogues were further increased by the attachment of hydrophobic cytotoxic groups, resulting in compounds with 10-50 times higher activity than LH-RH. Most of the monosubstituted agonistic analogues showed high affinities for the membrane receptors of human breast cancer cells, while the receptor binding affinities of peptides containing two cytotoxic side chains were lower. Antagonistic carriers [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,D-Lys6,D-Ala10] LH-RH [where Nal(2) is 3-(2-naphthyl)alanine], [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Trp3,Arg5,N epsilon-(2,3-diaminopropionyl)-D-Lys6,D-Ala10]LH-RH, and their D-Pal(3)3 homologs [Pal(3) is 3-(3-pyridyl)alanine] as well as [Ac-D-Nal(2)1,D-Phe(4Cl)2,D-Pal(3)3,Tyr5,N epsilon-(2,3-diamino-propionyl)-D-Lys6,D-Ala10]LH-RH were linked to cytotoxic compounds. The hybrid molecules inhibited ovulation in rats at doses of 10 micrograms and suppressed LH release in vitro. The receptor binding of cytotoxic analogues was decreased compared to the precursor peptides, although analogues with 2-(hydroxymethyl)anthraquinone hemiglutarate had high affinities. All of the cytotoxic analogues tested inhibited [3H]thymidine incorporation into DNA in cultures of human breast and prostate cancer cell lines

  13. 12-Amino-andrographolide analogues: synthesis and cytotoxic activity.

    PubMed

    Kasemsuk, Sakkasem; Sirion, Uthaiwan; Suksen, Kanoknetr; Piyachaturawat, Pawinee; Suksamrarn, Apichart; Saeeng, Rungnapha

    2013-12-01

    Andrographolide, a diterpenoid lactone of the plant Andrographis paniculata, has been shown to be cytotoxic against various cancer cells in vitro. In the present study, a series of β-amino-γ-butyrolactone analogues has been synthesized from naturally occurring andrographolide via one pot tandem aza-conjugate addition-elimination reaction. By using economic procedure without any base or catalyst at room temperature, the products obtained were in fair to excellent yields with high stereoselectivity. The cytotoxicity of all new amino analogues were evaluated against six cancer cell lines and revealed their potential for being developed as promising anti-cancer agents. PMID:23709127

  14. Concise synthesis of ether analogues of lysobisphosphatidic acid.

    PubMed

    Jiang, Guowei; Xu, Yong; Falguières, Thomas; Gruenberg, Jean; Prestwich, Glenn D

    2005-09-01

    We describe a versatile, efficient method for the preparation of ether analogues of (S,S)-lysobisphosphatidic acid (LBPA) and its enantiomer from (S)-solketal. Phosphorylation of a protected sn-2-O-octadecenyl glyceryl ether with 2-cyanoethyl bis-N,N-diisopropylamino phosphine and subsequent deprotection generated the bisether LBPA analogues. By simply changing the sequence of deprotection steps, we obtained the (R,R)- and (S,S)-enantiomers of 2,2'-bisether LBPA. An ELISA assay with anti-LBPA monoclonal antibodies showed that the bisether LBPAs were recognized with the same affinity as the natural 2,2'-bisoleolyl LBPA. [reaction: see text] PMID:16119911

  15. Synthesis of Conformationally Locked Versions of Puromycin Analogues

    PubMed Central

    Saneyoshi, Hisao; Michel, Benoît Y.; Choi, Yongseok; Strazewski, Peter; Marquez, Victor E.

    2009-01-01

    Conformationally locked North and South versions of puromycin analogues built on a bicyclo[3.1.0]hexane pseudosugar template were synthesized. The final assembly of the products was accomplished by the Staudinger-Vilarrasa coupling of the corresponding North (2 and 3) and South (6 and 7) 3′-azidopurine carbanucleosides with the Fmoc-protected 1-hydroxybenzotriazole ester of 4-methoxy-L-tyrosine. North azides 2 and 3 were reported earlier. The 3′-azido intermediates 6 and 7 that are necessary for the synthesis of the South puromycin analogues are described herein for the first time. PMID:18991379

  16. Tumor imaging and therapy using radiolabeled somatostatin analogues.

    PubMed

    de Jong, Marion; Breeman, Wout A P; Kwekkeboom, Dik J; Valkema, Roelf; Krenning, Eric P

    2009-07-21

    Molecular imaging plays an essential role in balancing the clinical benefits and risks of radionuclide-based cancer therapy. To effectively treat individual patients, careful assessment of biodistribution, dosimetry, and toxicity is essential. In this Account, we describe advances that combine features of molecular imaging and radionuclide therapy to provide new avenues toward individualized cancer treatment. Selective receptor-targeting radiopeptides have emerged as an important class of radiopharmaceuticals for molecular imaging and therapy of tumors that overexpress peptide receptors on the cell membrane. After such peptides labeled with gamma-emitting radionuclides bind to their receptors, they allow clinicians to visualize receptor-expressing tumors non-invasively. Peptides labeled with beta-particle emitters could also eradicate receptor-expressing tumors. The somatostatin receptors, which are overexpressed in a majority of neuroendocrine tumors, represent the first and best example of targets for radiopeptide-based imaging and radionuclide therapy. The somatostatin analogue (111)In-octreotide permits the localization and staging of neuroendocrine tumors that express the appropriate somatostatin receptors. Newer modified somatostatin analogues, including Tyr(3)-octreotide and Tyr(3)-octreotate, are successfully being used for tumor imaging and radionuclide therapy. Because there are few effective therapies for patients with inoperable or metastasized neuroendocrine tumors, this therapy is a promising novel treatment option for these patients. Peptide receptor imaging and radionuclide therapy can be combined in a single probe, called a "theranostic". To select patients who are likely to benefit from this type of intervention, we first use a peptide analogue labeled with a diagnostic radionuclide to obtain a scan. Selected patients will be treated using the same or a similar peptide analogue labeled with a therapeutic radionuclide. The development of such

  17. Synthesis and Cytotoxicity of Semisynthetic Withalongolide A Analogues

    PubMed Central

    2013-01-01

    The natural product withaferin A exhibits potent antitumor activity and other diverse pharmacological activities. The recently discovered withalongolide A, a C-19 hydroxylated congener of withaferin A, was recently reported to possess cytotoxic activity against head and neck squamous cell carcinomas. Semisynthetic acetylated analogues of withalongolide A were shown to be considerably more cytotoxic than the parent compound. To further explore the structure–activity relationships, 20 new semisynthetic analogues of withalongolide A were synthesized and evaluated for cytotoxic activity against four different cancer cell lines. A number of derivatives were found to be more potent than the parent compound and withaferin A. PMID:24273633

  18. Non-natural acetogenin analogues as potent Trypanosoma brucei inhibitors

    PubMed Central

    Florence, Gordon J.; Fraser, Andrew L.; Gould, Eoin R.; King, Elizabeth F.; Menzies, Stefanie K.; Morris, Joanne C.; Tulloch, Lindsay B.; Smith, Terry K.

    2015-01-01

    A series of novel bis-tetrahydropyran 1,4-triazole analogues based on the acetogenin framework display low micromolar trypanocidal activities towards both bloodstream and insect forms of Trypanosoma brucei, the causative agent of African sleeping sickness. A divergent synthetic strategy was adopted for the synthesis of the key tetrahydropyran intermediates to enable rapid access to diastereochemical variation either side of the 1,4-triazole core. The resulting diastereomeric analogues displayed varying degrees of trypanocidal activity and selectivity in structure activity relationship studies. PMID:25145275

  19. Use of 8-azidoguanosine 5'-(gamma-/sup 32/P)triphosphate as a probe of the guanosine 5'-triphosphate binding protein subunits in bovine rod outer segments

    SciTech Connect

    Kohnken, R.E.; Mc Connell, D.G.

    1985-07-02

    In an in vitro incubation, 8-azidoguanosine 5'-(gamma-/sup 32/P)triphosphate ( (gamma-/sup 32/P)-8-azido-GTP) labeled bleached rhodopsin independent of ultraviolet light. Characterization of this labeling indicated that rhodopsin was phosphorylated with (gamma-/sup 32/P)-8-azido-GTP as a phosphate donor. At low concentrations, ATP increased this labeling activity 5-fold. In the same incubation, (gamma-/sup 32/P)-8-azido-GTP also labeled G alpha (Mr 40 000). This labeling was ultraviolet light dependent. G beta (Mr 35 000) was also labeled dependent for the most part upon ultraviolet light, but a smaller component of labeling appeared to result from phosphorylation. Differential labeling of G alpha and G beta was found to vary intricately with experimental conditions, especially prebleaching of rhodopsin, tonicity of the medium, and the presence or absence of 2-mercaptoethanol. Affinity labeling of G alpha and G beta by (gamma-/sup 32/P)-8-azido-GTP in competition with ATP or GTP was kinetically complex, consistent with possible multiple binding sites for GTP on both subunits. Independent evidence for two or more binding sites on G alpha has been offered by other laboratories, and recently, at least one binding site on G beta and its analogues among the N proteins of adenylate cyclases has been identified.

  20. Crystal structure of a nucleoside model for the inter-strand cross-link formed by the reaction of 2'-de-oxy-guanosine and an abasic site in duplex DNA.

    PubMed

    Catalano, Michael J; Ruddraraju, Kasi Viswanatharaju; Barnes, Charles L; Gates, Kent S

    2016-05-01

    The title compound, 9-[(2R,4S,5R)-4-hy-droxy-5-(hy-droxy-meth-yl)tetra-hydro-furan-2-yl]-2-{[(2R,4S,5R)-4-meth-oxy-5-(meth-oxy-meth-yl)tetra-hydro-furan-2-yl]amino}-1H-purin-6(9H)-one, C17H25N5O7, crystallizes with two independent mol-ecules (A and B) in the asymmetric unit. In the crystal, the guanosine moieties of mol-ecules A and B are linked by N-H⋯N and O-H⋯N hydrogen-bonding inter-actions, forming ribbons which are stacked to form columns along [100]. These columns are then linked by O-H⋯O hydrogen bonds between the ribose moieties and numerous C-H⋯O inter-actions to complete the three-dimensional structure. PMID:27308004

  1. Facile Synthesis of Natural Alkoxynaphthalene Analogues from Plant Alkoxybenzenes.

    PubMed

    Tsyganov, Dmitry V; Krayushkin, Mikhail M; Konyushkin, Leonid D; Strelenko, Yuri A; Semenova, Marina N; Semenov, Victor V

    2016-04-22

    Analogues of the bioactive natural alkoxynaphthalene pycnanthulignene D were synthesized by an efficient method. The starting plant allylalkoxybenzenes (1) are easily available from the plant essential oils of sassafras, dill, and parsley. The target 1-arylalkoxynaphthalenes (5) exhibited antiproliferative activity in a phenotypic sea urchin embryo assay. PMID:26910798

  2. Thymidine analogues to assess microperfusion in human tumors

    SciTech Connect

    Janssen, Hilde L.; Ljungkvist, Anna S.; Rijken, Paul F.; Sprong, Debbie; Bussink, Jan; Kogel, Albert J. van der; Haustermans, Karin M.; Begg, Adrian C. . E-mail: a.begg@nki.nl

    2005-07-15

    Purpose: To validate the use of the thymidine analogues as local perfusion markers in human tumors (no labeling indicates no perfusion) by comparison with the well-characterized perfusion marker Hoechst 33342. Methods and Materials: Human tumor xenografts from gliomas and head-and-neck cancers were injected with iododeoxyuridine (IdUrd) or bromodeoxyuridine (BrdUrd) and the fluorescent dye Hoechst 33342. In frozen sections, each blood vessel was scored for the presence of IdUrd/BrdUrd labeling and Hoechst in surrounding cells. The percentage of analogue-negative vessels was compared with the fraction of Hoechst-negative vessels. Collocalization of the two markers was also scored. Results: We found considerable intertumor variation in the fraction of perfused vessels, measured by analogue labeling, both in the human tumor xenografts and in a series of tumor biopsies from head-and-neck cancer patients. There was a significant correlation between the Hoechst-negative and IdUrd/BrdUrd-negative vessels in the xenografts (r 85, p = 0.0004), despite some mismatches on a per-vessel basis. Conclusions: Thymidine analogues can be successfully used to rank tumors according to their fraction of perfused vessels. Whether this fraction correlates with the extent of acute hypoxia needs further confirmation.

  3. Synthesis, reactivity and biological activity of 5-alkoxymethyluracil analogues

    PubMed Central

    Brulikova, Lucie

    2011-01-01

    Summary This review article summarizes the results of a long-term investigation of 5-alkoxymethyluracil analogues and is aimed, in particular, at methods of syntheses. Most of the presented compounds were synthesized in order to evaluate their biological activity, therefore, a brief survey of biological activity, especially antiviral, cytotoxic and antibacterial, is also reported. PMID:21804865

  4. A Macroscopic Analogue of the Nuclear Pairing Potential

    ERIC Educational Resources Information Center

    Dunlap, Richard A.

    2013-01-01

    A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

  5. Charged Analogues of Henning Knutsen Type Solutions in General Relativity

    NASA Astrophysics Data System (ADS)

    Gupta, Y. K.; Kumar, Sachin; Pratibha

    2011-11-01

    In the present article, we have found charged analogues of Henning Knutsen's interior solutions which join smoothly to the Reissner-Nordstrom metric at the pressure free interface. The solutions are singularity free and analyzed numerically with respect to pressure, energy-density and charge-density in details. The solutions so obtained also present the generalization of A.L. Mehra's solutions.

  6. Synthesis of 4” manipulated Lewis X trisaccharide analogues

    PubMed Central

    Moore, Christopher J

    2012-01-01

    Summary Three analogues of the Lex trisaccharide antigen (β-D-Galp(1→4)[α-L-Fucp(1→3)]-D-GlcNAcp) in which the galactosyl residue is modified at O-4 as a methyloxy, deoxychloro or deoxyfluoro, were synthesized. We first report the preparation of the modified 4-OMe, 4-Cl and 4-F trichloroacetimidate galactosyl donors and then report their use in the glycosylation of an N-acetylglucosamine glycosyl acceptor. Thus, we observed that the reactivity of these donors towards the BF3·OEt2-promoted glycosylation at O-4 of the N-acetylglucosamine glycosyl acceptors followed the ranking 4-F > 4-OAc ≈ 4-OMe > 4-Cl. The resulting disaccharides were deprotected at O-3 of the glucosamine residue and fucosylated, giving access to the desired protected Lex analogues. One-step global deprotection (Na/NH3) of the protected 4”-methoxy analogue, and two-step deprotections (removal of a p-methoxybenzyl with DDQ, then Zemplén deacylation) of the 4”-deoxychloro and 4”-deoxyfluoro protected Lex analogues gave the desired compounds in good yields. PMID:23019441

  7. ON A p-ADIC ANALOGUE OF TATE HEIGHT

    NASA Astrophysics Data System (ADS)

    Berzin'sh, A. A.

    1983-04-01

    This paper is devoted to the study of the Tate height of an elliptic curve and its p-adic analogue. The main result is a series of explicit formulas for computing the local archimedean part of the Tate height. These results are used to obtain a new method for constructing the p-adic Tate height. Bibliography: 5 titles.

  8. Trehalose Analogues: Latest Insights in Properties and Biocatalytic Production

    PubMed Central

    Walmagh, Maarten; Zhao, Renfei; Desmet, Tom

    2015-01-01

    Trehalose (α-d-glucopyranosyl α-d-glucopyranoside) is a non-reducing sugar with unique stabilizing properties due to its symmetrical, low energy structure consisting of two 1,1-anomerically bound glucose moieties. Many applications of this beneficial sugar have been reported in the novel food (nutricals), medical, pharmaceutical and cosmetic industries. Trehalose analogues, like lactotrehalose (α-d-glucopyranosyl α-d-galactopyranoside) or galactotrehalose (α-d-galactopyranosyl α-d-galactopyranoside), offer similar benefits as trehalose, but show additional features such as prebiotic or low-calorie sweetener due to their resistance against hydrolysis during digestion. Unfortunately, large-scale chemical production processes for trehalose analogues are not readily available at the moment due to the lack of efficient synthesis methods. Most of the procedures reported in literature suffer from low yields, elevated costs and are far from environmentally friendly. “Greener” alternatives found in the biocatalysis field, including galactosidases, trehalose phosphorylases and TreT-type trehalose synthases are suggested as primary candidates for trehalose analogue production instead. Significant progress has been made in the last decade to turn these into highly efficient biocatalysts and to broaden the variety of useful donor and acceptor sugars. In this review, we aim to provide an overview of the latest insights and future perspectives in trehalose analogue chemistry, applications and production pathways with emphasis on biocatalysis. PMID:26084050

  9. A new analogue of fatty alcohol from Tamarix hampeana L.

    PubMed

    Aykac, Ahmet; Akgül, Yurdanur

    2010-01-01

    New analogues of a long-chain secondary alcohol (1) and laserine (2) were isolated from the flowers of Tamarix hampeana L. The isolated compounds were identified using 1D and 2D NMR, LCMS/APCI, and chemical methods. Laserine was isolated for the first time from T. hampeana L. PMID:20013470

  10. Cellular Cations Control Conformational Switching of Inositol Pyrophosphate Analogues.

    PubMed

    Hager, Anastasia; Wu, Mingxuan; Wang, Huanchen; Brown, Nathaniel W; Shears, Stephen B; Veiga, Nicolás; Fiedler, Dorothea

    2016-08-22

    The inositol pyrophosphate messengers (PP-InsPs) are emerging as an important class of cellular regulators. These molecules have been linked to numerous biological processes, including insulin secretion and cancer cell migration, but how they trigger such a wide range of cellular responses has remained unanswered in many cases. Here, we show that the PP-InsPs exhibit complex speciation behaviour and propose that a unique conformational switching mechanism could contribute to their multifunctional effects. We synthesised non-hydrolysable bisphosphonate analogues and crystallised the analogues in complex with mammalian PPIP5K2 kinase. Subsequently, the bisphosphonate analogues were used to investigate the protonation sequence, metal-coordination properties, and conformation in solution. Remarkably, the presence of potassium and magnesium ions enabled the analogues to adopt two different conformations near physiological pH. Understanding how the intrinsic chemical properties of the PP-InsPs can contribute to their complex signalling outputs will be essential to elucidate their regulatory functions. PMID:27460418

  11. Synthesis of monophytanyl ether analogues of lysophosphatidic and lysophosphatidyl glycerol.

    PubMed

    Kates, M; Hancock, A J

    1976-10-01

    The chemical synthesis of 3-O-phytanyl-sn-glycero-1-phosphoric acid (monophytanyl ether analogue of lysophosphatidic acid) was effected by condensation of 1-iodo-2-O-benzyl-3-O-phytanyl-sn-glycerol with silver di-p-nitrobenzyl phosphate in anhydrous toluene followed by catalytic hydrogenolysis of the resulting phosphotriester to remove the benzyl and p-nitrobenzyl groups. Synthesis of 3-O-phytanyl-sn-glycero-1-phosphoryl-1'-sn-glycerol (monophytanyl ether analogue of lysophosphatidyl glycerol) was carried out by conversion of the above phosphotriester to the monosilver salt of the suitably blocked lysophosphatidic acid which was condensed with 1-iodo-2-O-t-butyl-3-O-benzyl-sn-glycerol. Removal of the protecting aromatic and t-butyl groups from the resulting blocked triester intermediate gave the desired phytanyl ether analogue of lysophosphatidyl glycerol. Both lyso analogues were isolated as analytically and chromatographically pure potassium salts. Their physical properties and behavior towards acid hydrolysis are described. PMID:991376

  12. New phosphorus analogues of nitrogen classics--no carbon copies.

    PubMed

    Gudat, Dietrich

    2014-05-01

    Getting heavy: The recently prepared phosphorus analogues of two old acquaintances, urea and dinitrogen tetroxide, bear some structural resemblance to their archetypes but are no carbon copies. Their syntheses and chemical properties reveal rather certain peculiarities, which back the doctrine that the electronic properties of the heavier elements in a group differ from those of the lightest congener. PMID:24718995

  13. Synthesis of glycophostones: cyclic phosphonate analogues of biologically relevant sugars

    PubMed

    Hanessian; Rogel

    2000-05-01

    Analogues of L-fucose, N-acetyl-D-glucosamine, N-acetyl-D-mannosamine, and N-acetyl neuraminic acid in which the anomeric carbon atom was replaced by a phosphonyl group (phostones or cyclic phosphonates) were synthesized by stereocontrolled methods relying on the Abramov reaction. PMID:10808439

  14. An Analysis of an Autoclitic Analogue in Pigeons

    ERIC Educational Resources Information Center

    Kuroda, Toshikazu; Lattal, Kennon A.; García-Penagos, Andrés

    2014-01-01

    Using a conditional discrimination procedure, pigeons were exposed to a nonverbal analogue of qualifying autoclitics such as "definitely" and "maybe." It has been suggested that these autoclitics are similar to tacts except that they are under the control of private discriminative stimuli. Instead of the conventional assumption…

  15. q-bosons and the q-analogue quantized field

    NASA Technical Reports Server (NTRS)

    Nelson, Charles A.

    1995-01-01

    The q-analogue coherent states are used to identify physical signatures for the presence of a 1-analogue quantized radiation field in the q-CS classical limits where the absolute value of z is large. In this quantum-optics-like limit, the fractional uncertainties of most physical quantities (momentum, position, amplitude, phase) which characterize the quantum field are O(1). They only vanish as O(1/absolute value of z) when q = 1. However, for the number operator, N, and the N-Hamiltonian for a free q-boson gas, H(sub N) = h(omega)(N + 1/2), the fractional uncertainties do still approach zero. A signature for q-boson counting statistics is that (Delta N)(exp 2)/ (N) approaches 0 as the absolute value of z approaches infinity. Except for its O(1) fractional uncertainty, the q-generalization of the Hermitian phase operator of Pegg and Barnett, phi(sub q), still exhibits normal classical behavior. The standard number-phase uncertainty-relation, Delta(N) Delta phi(sub q) = 1/2, and the approximate commutation relation, (N, phi(sub q)) = i, still hold for the single-mode q-analogue quantized field. So, N and phi(sub q) are almost canonically conjugate operators in the q-CS classical limit. The q-analogue CS's minimize this uncertainty relation for moderate (absolute value of z)(exp 2).

  16. Trehalose Analogues: Latest Insights in Properties and Biocatalytic Production.

    PubMed

    Walmagh, Maarten; Zhao, Renfei; Desmet, Tom

    2015-01-01

    Trehalose (α-D-glucopyranosyl α-D-glucopyranoside) is a non-reducing sugar with unique stabilizing properties due to its symmetrical, low energy structure consisting of two 1,1-anomerically bound glucose moieties. Many applications of this beneficial sugar have been reported in the novel food (nutricals), medical, pharmaceutical and cosmetic industries. Trehalose analogues, like lactotrehalose (α-D-glucopyranosyl α-D-galactopyranoside) or galactotrehalose (α-D-galactopyranosyl α-D-galactopyranoside), offer similar benefits as trehalose, but show additional features such as prebiotic or low-calorie sweetener due to their resistance against hydrolysis during digestion. Unfortunately, large-scale chemical production processes for trehalose analogues are not readily available at the moment due to the lack of efficient synthesis methods. Most of the procedures reported in literature suffer from low yields, elevated costs and are far from environmentally friendly. "Greener" alternatives found in the biocatalysis field, including galactosidases, trehalose phosphorylases and TreT-type trehalose synthases are suggested as primary candidates for trehalose analogue production instead. Significant progress has been made in the last decade to turn these into highly efficient biocatalysts and to broaden the variety of useful donor and acceptor sugars. In this review, we aim to provide an overview of the latest insights and future perspectives in trehalose analogue chemistry, applications and production pathways with emphasis on biocatalysis. PMID:26084050

  17. Non-robust numerical simulations of analogue extension experiments

    NASA Astrophysics Data System (ADS)

    Naliboff, John; Buiter, Susanne

    2016-04-01

    Numerical and analogue models of lithospheric deformation provide significant insight into the tectonic processes that lead to specific structural and geophysical observations. As these two types of models contain distinct assumptions and tradeoffs, investigations drawing conclusions from both can reveal robust links between first-order processes and observations. Recent studies have focused on detailed comparisons between numerical and analogue experiments in both compressional and extensional tectonics, sometimes involving multiple lithospheric deformation codes and analogue setups. While such comparisons often show good agreement on first-order deformation styles, results frequently diverge on second-order structures, such as shear zone dip angles or spacing, and in certain cases even on first-order structures. Here, we present finite-element experiments that are designed to directly reproduce analogue "sandbox" extension experiments at the cm-scale. We use material properties and boundary conditions that are directly taken from analogue experiments and use a Drucker-Prager failure model to simulate shear zone formation in sand. We find that our numerical experiments are highly sensitive to numerous numerical parameters. For example, changes to the numerical resolution, velocity convergence parameters and elemental viscosity averaging commonly produce significant changes in first- and second-order structures accommodating deformation. The sensitivity of the numerical simulations to small parameter changes likely reflects a number of factors, including, but not limited to, high angles of internal friction assigned to sand, complex, unknown interactions between the brittle sand (used as an upper crust equivalent) and viscous silicone (lower crust), highly non-linear strain weakening processes and poor constraints on the cohesion of sand. Our numerical-analogue comparison is hampered by (a) an incomplete knowledge of the fine details of sand failure and sand

  18. Metric optimisation for analogue forecasting by simulated annealing

    NASA Astrophysics Data System (ADS)

    Bliefernicht, J.; Bárdossy, A.

    2009-04-01

    It is well known that weather patterns tend to recur from time to time. This property of the atmosphere is used by analogue forecasting techniques. They have a long history in weather forecasting and there are many applications predicting hydrological variables at the local scale for different lead times. The basic idea of the technique is to identify past weather situations which are similar (analogue) to the predicted one and to take the local conditions of the analogues as forecast. But the forecast performance of the analogue method depends on user-defined criteria like the choice of the distance function and the size of the predictor domain. In this study we propose a new methodology of optimising both criteria by minimising the forecast error with simulated annealing. The performance of the methodology is demonstrated for the probability forecast of daily areal precipitation. It is compared with a traditional analogue forecasting algorithm, which is used operational as an element of a hydrological forecasting system. The study is performed for several meso-scale catchments located in the Rhine basin in Germany. The methodology is validated by a jack-knife method in a perfect prognosis framework for a period of 48 years (1958-2005). The predictor variables are derived from the NCEP/NCAR reanalysis data set. The Brier skill score and the economic value are determined to evaluate the forecast skill and value of the technique. In this presentation we will present the concept of the optimisation algorithm and the outcome of the comparison. It will be also demonstrated how a decision maker should apply a probability forecast to maximise the economic benefit from it.

  19. Biological evaluation of a novel sorafenib analogue, t-CUPM.

    PubMed

    Wecksler, Aaron T; Hwang, Sung Hee; Liu, Jun-Yan; Wettersten, Hiromi I; Morisseau, Christophe; Wu, Jian; Weiss, Robert H; Hammock, Bruce D

    2015-01-01

    Sorafenib (Nexavar®) is currently the only FDA-approved small molecule targeted therapy for advanced hepatocellular carcinoma. The use of structural analogues and derivatives of sorafenib has enabled the elucidation of critical targets and mechanism(s) of cell death for human cancer lines. We previously performed a structure-activity relationship study on a series of sorafenib analogues designed to investigate the inhibition overlap between the major targets of sorafenib Raf-1 kinase and VEGFR-2, and an enzyme shown to be a potent off-target of sorafenib, soluble epoxide hydrolase. In the current work, we present the biological data on our lead sorafenib analogue, t-CUPM, demonstrating that this analogue retains cytotoxicity similar to sorafenib in various human cancer cell lines and strongly inhibits growth in the NCI-60 cell line panel. Co-treatment with the pan-caspase inhibitor, Z-VAD-FMK, failed to rescue the cell viability responses of both sorafenib and t-CUPM, and immunofluorescence microscopy shows similar mitochondrial depolarization and apoptosis-inducing factor release for both compounds. These data suggest that both compounds induce a similar mechanism of caspase-independent apoptosis in hepatoma cells. In addition, t-CUPM displays anti-proliferative effects comparable to sorafenib as seen by a halt in G0/G1 in cell cycle progression. The structural difference between sorafenib and t-CUPM significantly reduces inhibitory spectrum of kinases by this analogue, and pharmacokinetic characterization demonstrates a 20-fold better oral bioavailability of t-CUPM than sorafenib in mice. Thus, t-CUPM may have the potential to reduce the adverse events observed from the multikinase inhibitory properties and the large dosing regimens of sorafenib. PMID:25413440

  20. Convolutamydine A and synthetic analogues have antinociceptive properties in mice.

    PubMed

    Figueiredo, Gabriela S M; Zardo, Renata S; Silva, Bárbara V; Violante, Flávio A; Pinto, Angelo C; Fernandes, Patricia D

    2013-01-01

    Convolutamydine A, an oxindole that originated from a marine bryozoan, has several biological effects. In this study, we aimed to investigate the antinociceptive effects of convolutamydine A and two new synthetic analogues. Convolutamydine A and the two analogues were given orally to assess their ability to induce antinociceptive effects. Formalin-induced licking response, acetic acid-induced contortions, and hot plate models were used to characterize the effects of convolutamydine A and its analogues. Convolutamydine A (4,6-bromo-3-(2-oxopropyl)-3-hydroxy-2-oxindole), compound 1 (3-(2-oxopropyl)-3-hydroxy-2-oxindole), and compound 2 (5-bromo-3-(2-oxopropyl)-3-hydroxy-2-oxindole) caused peripheral antinociceptive and anti-inflammatory effects in the acetic acid-induced contortions and the formalin-induced licking models. Supraspinal effects were also observed in the hot plate model and were similar to those obtained with morphine. The peripheral effects were not mediated by the cholinergic or opioid systems. The antinociceptive effects of convolutamydine A seem to be mediated by all three systems (cholinergic, opioid, and nitric oxide systems), and the mechanism of action of compounds 1 and 2 involved cholinergic and nitric oxide-mediated mechanisms. Convolutamydine A and its analogues (compounds 1 and 2) showed good antinociceptive ability after systemic administration in acute pain models. The antinociceptive action mediated by cholinergic, opioid, and nitric oxide systems could explain why convolutamydine A, compound 1, and compound 2 retained their antinociceptive effects. The doses used were similar to the doses of morphine and were much lower than that of acetylsalicylic acid, the classical analgesic and anti-inflammatory drug. In conclusion, convolutamydine A and the two analogues demonstrated antinociceptive effects comparable to morphine's effects. PMID:23046852

  1. Analogue Sites for Mars Missions - A report from two workshops

    NASA Astrophysics Data System (ADS)

    Hipkin, V.; Voytek, M. A.; Glamoclija, M.

    2014-12-01

    Fieldwork, at terrestrial sites that are analogous in some way to Mars, has a key role in defining questions addressed by Mars missions. For MSL, the question is whether its landing site was habitable, and for Mars 2020, the question is how do we search for and what are signs of life in ancient habitable environments. Implementing these investigations by means of a rover mission on a distant planetary surface has challenges due to a limited set of tools and period of operations. Using this context of planetary missions is important in shaping how analog research can be used to advance planetary science. Following a successful 2010 AGU fall meeting session entitled "Analogue Sites for Mars Missions", two community workshops were held at The Woodlands, TX March 2011 and the Carnegie Institute of Washington in July 2013. These activities represent an ongoing dialogue with the analogue and mission communities. The AGU session solicited presentations of current analogue research relevant to MSL, at which time the landing site selection process was still considering four final sites. The 2011 Woodlands workshop solicited details on representative science questions and analogue sites by means of an abstract template. The output from The Woodlands workshop was an initial metric to assess the utility of analogue sites against specific science questions, as well as recommendations for future activities. The 2013 Carnegie workshop, followed up on some of the recommendations from 2011. Both on-line interactive dialogue and in person discussions targeted broad topics, including 'the advantages and problems of using a great terrestrial analog for field testing', and 'knowing what we currently do about Mars, what would be the best place on the planet to collect the first suite of samples to be returned to Earth? What would be appropriate analog sites on Earth?'. The results and recommendations from both workshops are summarized to publicize and stimulate this ongoing discussion.

  2. An analogue conceptual rainfall-runoff model for educational purposes

    NASA Astrophysics Data System (ADS)

    Herrnegger, Mathew; Riedl, Michael; Schulz, Karsten

    2016-04-01

    Conceptual rainfall-runoff models, in which runoff processes are modelled with a series of connected linear and non-linear reservoirs, remain widely applied tools in science and practice. Additionally, the concept is appreciated in teaching due to its somewhat simplicity in explaining and exploring hydrological processes of catchments. However, when a series of reservoirs are used, the model system becomes highly parametrized and complex and the traceability of the model results becomes more difficult to explain to an audience not accustomed to numerical modelling. Since normally the simulations are performed with a not visible digital code, the results are also not easily comprehensible. This contribution therefore presents a liquid analogue model, in which a conceptual rainfall-runoff model is reproduced by a physical model. This consists of different acrylic glass containers representing different storage components within a catchment, e.g. soil water or groundwater storage. The containers are equipped and connected with pipes, in which water movement represents different flow processes, e.g. surface runoff, percolation or base flow. Water from a storage container is pumped to the upper part of the model and represents effective rainfall input. The water then flows by gravity through the different pipes and storages. Valves are used for controlling the flows within the analogue model, comparable to the parameterization procedure in numerical models. Additionally, an inexpensive microcontroller-based board and sensors are used to measure storage water levels, with online visualization of the states as time series data, building a bridge between the analogue and digital world. The ability to physically witness the different flows and water levels in the storages makes the analogue model attractive to the audience. Hands-on experiments can be performed with students, in which different scenarios or catchment types can be simulated, not only with the analogue but

  3. Inhibition of receptor/G protein coupling by suramin analogues.

    PubMed

    Beindl, W; Mitterauer, T; Hohenegger, M; Ijzerman, A P; Nanoff, C; Freissmuth, M

    1996-08-01

    Suramin analogues act as direct antagonists of heterotrimeric G proteins because they block the rate-limiting step of G protein activation (i.e., the dissociation of GDP prebound to the G protein alpha subunit). We have used the human brain A1 adenosine receptor and the rat striatal D2 dopamine receptor, two prototypical Gi/G(o)-coupled receptors, as a model system to test whether the following analogues suppress the receptor-dependent activation of G proteins: 8-(3-nitrobenzamido)-1,3,5-naphthalenetrisulfonic acid (NF007), 8-(3-(3-nitrobenzamido)-benzamido)-1,3,5-naphthalenetrisulfonic acid (NF018); 8,8'-(carbonylbis(imino-3,1-phenylene))bis-(1,3,5-naphthalenetr isulfonic acid) (NF023); 8,8'-(carbonylbis(imino-3,1-phenylene)carbonylimino-(3,1- phenylene)) bis(1,3,5-naphthalenetrisulfonic acid) (NF037); and suramin. Suramin and its analogues inhibit the formation of the agonist-specific ternary complex (agonist/receptor/G protein). This inhibition is (i) quasicompetitive with respect to agonist binding in that it can be overcome by increasing receptor occupancy but (ii) does not result from an interaction of the analogues with the ligand binding pocket of the receptors because the binding of antagonists or of agonists in the absence of functional receptor/G protein interaction is not affected. In addition to suppressing the spontaneous release of GDP from defined G protein alpha subunits, suramin and its analogues reduce receptor-catalyzed guanine nucleotide exchange. The site, to which suramin analogues bind, overlaps with the docking site for the receptor on the G protein alpha subunit. The structure-activity relationships for inhibition of agonist binding to the A1 adenosine receptor (suramin > NF037 > NF023) and of agonist binding to the inhibition D2 dopamine receptor (suramin = NF037 > NF023 > NF018) differ. Thus, NF037 discriminates between the ternary complexes formed by the agonist-liganded D2 dopamine receptors and those formed by the A1 adenosine

  4. The use of prostaglandins and their analogues for abortion.

    PubMed

    Bygdeman, M

    1984-12-01

    In general, termination of second trimester pregnancy is associated with three to five times higher morbidity and mortality risks than termination during the first trimester. The procedures mainly used are extra- or intra-amniotic administration of solutions such as hypertonic saline, ethacridine lactate, PGF2 alpha and PGE2. In comparison with these procedures, the use of prostaglandin analogues may offer important advantages, the most important one being the possibility of using non-invasive routes of administration. The continuous development of new analogues has now resulted in compounds that are highly effective in stimulating uterine contractility and are associated with a low frequency of side-effects; these compounds are suitable for both vaginal and intramuscular administration and are applicable for termination of pregnancy during both the early and late parts of the second trimester. The most widely used method for termination of first trimester pregnancy is vacuum aspiration. It is a highly effective procedure and the overall complication rate is low. One problem with vacuum aspiration is the mechanical dilatation of the cervical canal which is necessary from at least the 8th week and onwards. Pretreatment with laminaria tents or with prostaglandin analogues eliminates or reduces the need for mechanical dilatation and significantly facilitates the procedure. Pretreatment with prostaglandin analogues also reduces the risk of both operative and postoperative complications. The prostaglandins also offer a possibility as a non-surgical procedure for termination of very early pregnancy. Both vaginal and intramuscular administration of the latest generation of PG analogues have been shown in several studies to be equally as effective as vacuum aspiration if the treatment is restricted to the first three weeks following the first missed menstrual period. Gastrointestinal side-effects are still a problem although of significantly less importance than if natural

  5. Noncommutative analogue Aharonov-Bohm effect and superresonance

    NASA Astrophysics Data System (ADS)

    Anacleto, M. A.; Brito, F. A.; Passos, E.

    2013-06-01

    We consider the idea of modeling a rotating acoustic black hole by an idealized draining bathtub vortex which is a planar circulating flow phenomenon with a sink at the origin. We find the acoustic metric for this phenomenon from a noncommutative Abelian Higgs model. As such the acoustic metric not only describes a rotating acoustic black hole but also inherits the noncommutative characteristic of the spacetime. We address the issues of superresonance and analogue Aharonov-Bohm (AB) effect in this background. We mainly show that the scattering of planar waves by a draining bathtub vortex leads to a modified AB effect and due to spacetime noncommutativity, the phase shift persists even in the limit where the parameters associated with the circulation and draining vanish. Finally, we also find that the analogue AB effect and superresonance are competing phenomena at a noncommutative spacetime.

  6. Analogue Transformations in Physics and their Application to Acoustics

    PubMed Central

    García-Meca, C.; Carloni, S.; Barceló, C.; Jannes, G.; Sánchez-Dehesa, J.; Martínez, A.

    2013-01-01

    Transformation optics has shaped up a revolutionary electromagnetic design paradigm, enabling scientists to build astonishing devices such as invisibility cloaks. Unfortunately, the application of transformation techniques to other branches of physics is often constrained by the structure of the field equations. We develop here a complete transformation method using the idea of analogue spacetimes. The method is general and could be considered as a new paradigm for controlling waves in different branches of physics, from acoustics in quantum fluids to graphene electronics. As an application, we derive an “analogue transformation acoustics” formalism that naturally allows the use of transformations mixing space and time or involving moving fluids, both of which were impossible with the standard approach. To demonstrate the power of our method, we give explicit designs of a dynamic compressor, a spacetime cloak for acoustic waves and a carpet cloak for a moving aircraft. PMID:23774575

  7. Synthesis and α1-adrenoceptor antagonist activity of tamsulosin analogues.

    PubMed

    Sagratini, Gianni; Angeli, Piero; Buccioni, Michela; Gulini, Ugo; Marucci, Gabriella; Melchiorre, Carlo; Poggesi, Elena; Giardinà, Dario

    2010-12-01

    Tamsulosin (-)-1 is the most utilized α(1)-adrenoceptor antagonist in the benign prostatic hyperplasia therapy owing to its uroselective antagonism and capability in relieving both obstructive and irritative lower urinary tract symptoms. Here we report the synthesis and pharmacological study of the homochiral (-)-1 analogues (-)-2-(-)-5, bearing definite modifications in the 2-substituted phenoxyethylamino group in order to evaluate their influence on the affinity profile for α(1)-adrenoceptor subtypes. The benzyl analogue (-)-3, displaying a preferential antagonist profile for α1A-than α1D-and α1B-adrenoceptors, and a 12-fold higher potency at α1A-adrenoceptors with respect to the α1B subtype, may have improved uroselectivity compared to (-)-1. PMID:20934789

  8. New selenium-75 labeled radiopharmaceuticals: selenonium analogues of dopamine

    SciTech Connect

    Sadek, S.A.; Basmadjian, G.P.; Hsu, P.M.; Rieger, J.A.

    1983-07-01

    Selenium-75 labeled selenonium analogues of dopamine, (2-(3,4-dimethoxyphenyl)ethyl)dimethylselenonium iodide and its dihydroxy analogue, were prepared by reducing (/sup 75/Se)selenious acid with sodium borohydride at pH 6.0 and reacting the NaSeH produced with 1-(3,4-dimethoxyphenyl)-2-(p-toluenesulfonyloxy)ethane. Tissue distribution studies in rats given the /sup 75/Se-labeled selenonium agents intravenously demonstrated high initial heart uptake. Prolonged adrenal retention and high adrenal to blood ratio of compound 4 were observed. The high uptake and adrenal to blood ratio suggest the potential use of compound 4 as a radiopharmaceutical for the adrenal gland.

  9. Novel Azetidine-Containing TZT-1027 Analogues as Antitumor Agents.

    PubMed

    Yan, Qi; Wang, Yujie; Zhang, Wei; Li, Yingxia

    2016-05-01

    A conformational restriction strategy was used to design and synthesize nine TZT-1027 analogues. 3-Aryl-azetidine moiety was used to replace phenylethyl group of TZT-1027 at the C-terminus. These analogues exhibited moderate to excellent antiproliferative activities, and the most potent compound 1a showed IC50 values of 2.2 nM against A549 and 2.1 nM against HCT116 cell lines, respectively. However, 1a could not achieve effective inhibition at all the dose levels in the A549 xenograft model (up to 5 mg/kg, injection, once a day), which is only 16%-35% inhibition at the end of the experiment. PMID:27136567

  10. Alligator rivers analogue project an OECD/NEA international project

    SciTech Connect

    Duerden, P.; Airey, P.; Pescatore, C.

    1994-12-31

    The Koongarra uranium deposit in the Alligator Rivers Region of the Northern Territory of Australia was studied as a natural analogue of the far field behaviour of high level waste repositories following groundwater ingress. A number of mathematical modelling approaches were developed for processes as diverse as groundwater transport, host rock weathering, radionuclide sorption, evolution of the uranium dispersion fan and the distribution of uranium series nuclides between mineral assemblages in weathered host rock. Some of these models are relevant to performance assessment at the level of individual processes and subsystem performance. Through the project, new insights into the application of the natural analogue approach to the assessment of potential waste repository sites were obtained.

  11. Stereocontrolled Synthesis of Key Advanced Intermediates toward Simplified Acetogenin Analogues.

    PubMed

    Le Huérou, Yvan; Doyon, Julien; Grée, René L.

    1999-09-01

    The stereo- and enantiocontrolled synthesis of substituted beta-hydroxy ethers based on glycol and catechol bearing an alkyne group and a series of substituents is reported. These substrates were designed to mimic the bis-THF array of annonaceous acetogenins and to provide an access to simplified and modified analogues. The key steps of the synthesis involve the condensation of the nonracemic mesylate of solketal with ethylene glycol and catechol, followed by an alkylation with a glycidyl derivative. Under appropriate conditions, the reaction is completely stereoselective and allows the synthesis of all the diastereomers. After the epoxide was opened with triethylsilylacetylene, the second epoxide was unmasked and reacted with a series of alkyl, aryl, amine, and alcohol reagents. A series of 28 analogues was prepared having a glycol or a catechol core, a stereodefined configuration of the flanking hydroxyl groups, and an acetylenic appendage suitable for a coupling to a lactone-bearing fragment. PMID:11674687

  12. Synthesis of Methylenecyclopropane Analogues of Antiviral Nucleoside Phosphonates

    PubMed Central

    Yan, Zhaohua; Zhou, Shaoman; Kern, Earl R.; Zemlicka, Jiri

    2006-01-01

    Synthesis of methylenecyclopropane analogues of nucleoside phosphonates 6a, 6b, 7a and 7b is described. Cyclopropyl phosphonate 8 was transformed in four steps to methylenecyclopropane phosphonate 16. The latter intermediate was converted in seven steps to the key Z- and E-methylenecyclopropane alcohols 23 and 24 separated by chromatography. Selenoxide eliminations (15 → 16 and 22 → 23 + 24) were instrumental in the synthesis. The Z- and E-isomers 23 and 24 were transformed to bromides 25a and 25b which were used for alkylation of adenine and 2-amino-6-chloropurine to give intermediates 26a, 26b, 26c and 26d. Acid hydrolysis provided the adenine and guanine analogues 6a, 6b, 7a and 7b. Phosphonates 6b and 7b are potent inhibitors of replication of Epstein-Barr virus (EBV). PMID:16758001

  13. Millimeter and Submillimeter Studies of Interstellar Ice Analogues

    NASA Astrophysics Data System (ADS)

    Mesko, AJ; Wagner, Ian C.; Smith, Houston Hartwell; Milam, Stefanie N.; Widicus Weaver, Susanna L.

    2015-06-01

    The chemistry of interstellar ice analogues has been a topic of great interest to astrochemists over the last 20 years. Currently, the models of interstellar chemistry feature icy-grain reactions as a primary mechanism for the formation of many astrochemical species as well as potentially astrobiologically-relevant complex organic molecules. This talk presents new spectral results collected by a millimeter and submillimeter spectrometer coupled to a vacuum chamber designed to study the sublimation or sputtered products of icy-grain reactions initiated by thermal-processing or photo-processing of interstellar ice analogues. Initial results from thermal desorption and UV photoprocessing experiments of pure water ice and water + methanol ice mixtures will be presented.

  14. Neurological Effects of Bisphenol A and its Analogues

    PubMed Central

    Inadera, Hidekuni

    2015-01-01

    The endocrine disrupting chemical bisphenol A (BPA) is widely used in the production of polycarbonate plastics and epoxy resins. The use of BPA-containing products in daily life makes exposure ubiquitous, and the potential human health risks of this chemical are a major public health concern. Although numerous in vitro and in vivo studies have been published on the effects of BPA on biological systems, there is controversy as to whether ordinary levels of exposure can have adverse effects in humans. However, the increasing incidence of developmental disorders is of concern, and accumulating evidence indicates that BPA has detrimental effects on neurological development. Other bisphenol analogues, used as substitutes for BPA, are also suspected of having a broad range of biological actions. The objective of this review is to summarize our current understanding of the neurobiological effects of BPA and its analogues, and to discuss preventive strategies from a public health perspective. PMID:26664253

  15. Glaucine analogues as inhibitors of mouse splenocyte activity.

    PubMed

    Philipov, S; Ivanovska, N; Nikolova, P

    1998-10-01

    The inhibitory effect of 15 semi-synthetic analogues of glaucine (1) on the lipopolysaccharide (LPS)-induced and the concanavalin A (Con A)-induced proliferation of mouse splenocytes was compared in vitro. Isoboldine (3), bracteoline (4) and dehydroglaucine (9) showed a significantly higher potency to suppress LPS-induced proliferation than 1, while 7-hydroxy-4-methylglaucine (8), 7-formyldehydroglaucine (11), 7-acetyldehydroglaucine (13), 7-benzoyldehydroglaucine (14), oxoglaucine (15) and glaucine-quinol (16) were less inhibitory. Compounds 3, 4, boldine (5), 15 and 16 surpassed significantly the inhibition expressed by 1 on Con A-induced proliferative response. The effect was equal to the inhibition determined for mitomycin C (Mit C) with both mitogens. In contrast to all others analogues, thaliporphine (2) stimulated splenocyte proliferation in both assays. Antibody response against sheep red blood cells (SRBC) was lowered most strongly by cataline (6), 7-methyldehydroglaucine (10) and 16. PMID:9812336

  16. Optical analogue of relativistic Dirac solitons in binary waveguide arrays

    SciTech Connect

    Tran, Truong X.; Longhi, Stefano; Biancalana, Fabio

    2014-01-15

    We study analytically and numerically an optical analogue of Dirac solitons in binary waveguide arrays in the presence of Kerr nonlinearity. Pseudo-relativistic soliton solutions of the coupled-mode equations describing dynamics in the array are analytically derived. We demonstrate that with the found soliton solutions, the coupled mode equations can be converted into the nonlinear relativistic 1D Dirac equation. This paves the way for using binary waveguide arrays as a classical simulator of quantum nonlinear effects arising from the Dirac equation, something that is thought to be impossible to achieve in conventional (i.e. linear) quantum field theory. -- Highlights: •An optical analogue of Dirac solitons in nonlinear binary waveguide arrays is suggested. •Analytical solutions to pseudo-relativistic solitons are presented. •A correspondence of optical coupled-mode equations with the nonlinear relativistic Dirac equation is established.

  17. Analogue transformations in physics and their application to acoustics.

    PubMed

    García-Meca, C; Carloni, S; Barceló, C; Jannes, G; Sánchez-Dehesa, J; Martínez, A

    2013-01-01

    Transformation optics has shaped up a revolutionary electromagnetic design paradigm, enabling scientists to build astonishing devices such as invisibility cloaks. Unfortunately, the application of transformation techniques to other branches of physics is often constrained by the structure of the field equations. We develop here a complete transformation method using the idea of analogue spacetimes. The method is general and could be considered as a new paradigm for controlling waves in different branches of physics, from acoustics in quantum fluids to graphene electronics. As an application, we derive an "analogue transformation acoustics" formalism that naturally allows the use of transformations mixing space and time or involving moving fluids, both of which were impossible with the standard approach. To demonstrate the power of our method, we give explicit designs of a dynamic compressor, a spacetime cloak for acoustic waves and a carpet cloak for a moving aircraft. PMID:23774575

  18. A rationally designed CD4 analogue inhibits experimental allergic encephalomyelitis

    NASA Astrophysics Data System (ADS)

    Jameson, Bradford A.; McDonnell, James M.; Marini, Joseph C.; Korngold, Robert

    1994-04-01

    EXPERIMENTAL allergic encephalomyelitis (EAE) is an acute inflammatory autoimmune disease of the central nervous system that can be elicited in rodents and is the major animal model for the study of multiple sclerosis (MS)1,2. The pathogenesis of both EAE and MS directly involves the CD4+ helper T-cell subset3-5. Anti-CD4 monoclonal antibodies inhibit the development of EAE in rodents6-9, and are currently being used in human clinical trials for MS. We report here that similar therapeutic effects can be achieved in mice using a small (rationally designed) synthetic analogue of the CD4 protein surface. It greatly inhibits both clinical incidence and severity of EAE with a single injection, but does so without depletion of the CD4+ subset and without the inherent immunogenicity of an antibody. Furthermore, this analogue is capable of exerting its effects on disease even after the onset of symptoms.

  19. On-chip learning with analogue VLSI neural networks.

    PubMed

    Tarassenko, L; Tombs, J; Cairns, G

    1993-12-01

    Results from simulations of weight perturbation as an on-chip learning scheme for analogue VLSI neural networks are presented. The limitations of analogue hardware are modelled as realistically as possible. Thus synaptic weight precision is defined according to the smallest change in the weight setting voltage which gives a measurable change at the output of the corresponding neuron. Tests are carried out on a hard classification problem constructed from mobile robot navigation data. The simulations show that the degradation in classification performance on a 500-pattern test set caused by the introduction of realistic hardware constraints is acceptable: with 8-bit weights, updated probabilistically and with a simplified output error criterion, the error rate increases by no more than 7% when compared with weight perturbation implemented with full 32-bit precision. PMID:8049803

  20. Excited state dynamics of brightly fluorescent second generation epicocconone analogues.

    PubMed

    Chatterjee, Soumit; Karuso, Peter; Boulangé, Agathe; Franck, Xavier; Datta, Anindya

    2015-05-21

    The natural product epicocconone, owing to its unique fluorescence properties, has been developed into a range of products used in biotechnology, especially proteomics. However, its weak green fluorescence in its native state, while advantageous for proteomics applications, is a disadvantage in other applications that require two-color readouts. Here we report the photophysical characterization of two brightly fluorescent analogues of epicocconone. These analogues, with naphthyl or pyridyl groups replacing the heptatriene chain, resulted in bright fluorescence in both the native state and the long Stokes shifted enamine. Time-resolved fluorescence studies and DFT calculations were carried out to understand the excited state processes involved in fluorescence. Results showed the p-chloro group on the pyridyl is responsible for the high fluorescence of the native fluorophore. The application of one of these compounds for staining electrophoresis gels is exemplified. PMID:25902354

  1. Synthesis and biological activity of polyalthenol and pentacyclindole analogues.

    PubMed

    Marcos, Isidro S; Moro, Rosalina F; Costales, Isabel; Basabe, Pilar; Díez, David; Gil, Ana; Mollinedo, Faustino; Pérez-de la Rosa, Fátima; Pérez-Roth, Eduardo; Padrón, José M

    2014-02-12

    A series of indole sesquiterpenes analogues of polyalthenol and pentacyclindole have been synthesized starting from ent-halimic acid in order to test their biological activity. These analogues include diverse oxidation levels at the sesquiterpenyl moiety and different functionalization on the indole ring. All synthetic derivatives were tested against a representative panel of Gram positive and Gram negative bacterial strains, and the human solid tumour cell lines A549 (non-small cell lung), HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast) and WiDr (colon). Overall, the compounds presented activity against the cancer cell lines. The resulting lead, displaying a polyalthenol scaffold, showed GI50 values in the range 1.2-5.7 μM against all cell lines tested. PMID:24412720

  2. Novel Azetidine-Containing TZT-1027 Analogues as Antitumor Agents

    PubMed Central

    Yan, Qi; Wang, Yujie; Zhang, Wei; Li, Yingxia

    2016-01-01

    A conformational restriction strategy was used to design and synthesize nine TZT-1027 analogues. 3-Aryl-azetidine moiety was used to replace phenylethyl group of TZT-1027 at the C-terminus. These analogues exhibited moderate to excellent antiproliferative activities, and the most potent compound 1a showed IC50 values of 2.2 nM against A549 and 2.1 nM against HCT116 cell lines, respectively. However, 1a could not achieve effective inhibition at all the dose levels in the A549 xenograft model (up to 5 mg/kg, injection, once a day), which is only 16%–35% inhibition at the end of the experiment. PMID:27136567

  3. Naturally-occurring chemical analogues for repository-derived radionuclides

    SciTech Connect

    Miller, B.

    1996-12-01

    Studies of natural systems are a valuable means of gaining information on the behavior of elements and radionuclides in the geosphere or biosphere that may be used to support performance assessments for radioactive waste repositories. However, these natural system studies face the problem that some of the chemical and isotopic species that occur in radioactive wastes do not occur naturally. Therefore, when attempting to study transport processes for these species other, naturally-occurring species must be examined as {open_quote}chemical analogues{close_quote} for the waste species. Chemical analogues are chosen on the basis of some similarity with the chemical behavior of the waste species in relevant physico-chemical environments. This is a tricky procedure and each system must be considered on a case-by-case basis, although some guidelines can be established and these are given here.

  4. Bis(vinylenedithio)tetrathiafulvalene analogues of BEDT-TTF.

    PubMed

    Ertas, Erdal; Demirtas, İlknur; Ozturk, Turan

    2015-01-01

    This review aims to give an overview of the current status of our research on the synthesis of π-electron donor bis(ethylenedithio)tetrathiafulvalene (BEDT-TTF, ET) analogues prepared from 1,8-diketones via a ring forming reaction. The new synthesized π-electron donors have vinyl moieties producing extended π-electron delocalization over the substituent phenyl rings at the peripheries. PMID:25977714

  5. Bis(vinylenedithio)tetrathiafulvalene analogues of BEDT-TTF

    PubMed Central

    Demirtas, İlknur; Ozturk, Turan

    2015-01-01

    Summary This review aims to give an overview of the current status of our research on the synthesis of π-electron donor bis(ethylenedithio)tetrathiafulvalene (BEDT-TTF, ET) analogues prepared from 1,8-diketones via a ring forming reaction. The new synthesized π-electron donors have vinyl moieties producing extended π-electron delocalization over the substituent phenyl rings at the peripheries. PMID:25977714

  6. Synthesis of phosphonate and phostone analogues of ribose-1-phosphates

    PubMed Central

    Nasomjai, Pitak; Slawin, Alexandra M Z

    2009-01-01

    Summary The synthesis of phosphonate analogues of ribose-1-phosphate and 5-fluoro-5-deoxyribose-1-phosphate is described. Preparations of both the α- and β-phosphonate anomers are reported for the ribose and 5-fluoro-5-deoxyribose series and a synthesis of the corresponding cyclic phostones of each α-ribose is also reported. These compounds have been prepared as tools to probe the details of fluorometabolism in S. cattleya. PMID:19777136

  7. Dimerization and DNA recognition rules of mithramycin and its analogues.

    PubMed

    Weidenbach, Stevi; Hou, Caixia; Chen, Jhong-Min; Tsodikov, Oleg V; Rohr, Jürgen

    2016-03-01

    The antineoplastic and antibiotic natural product mithramycin (MTM) is used against cancer-related hypercalcemia and, experimentally, against Ewing sarcoma and lung cancers. MTM exerts its cytotoxic effect by binding DNA as a divalent metal ion (Me(2+))-coordinated dimer and disrupting the function of transcription factors. A precise molecular mechanism of action of MTM, needed to develop MTM analogues selective against desired transcription factors, is lacking. Although it is known that MTM binds G/C-rich DNA, the exact DNA recognition rules that would allow one to map MTM binding sites remain incompletely understood. Towards this goal, we quantitatively investigated dimerization of MTM and several of its analogues, MTM SDK (for Short side chain, DiKeto), MTM SA-Trp (for Short side chain and Acid), MTM SA-Ala, and a biosynthetic precursor premithramycin B (PreMTM B), and measured the binding affinities of these molecules to DNA oligomers of different sequences and structural forms at physiological salt concentrations. We show that MTM and its analogues form stable dimers even in the absence of DNA. All molecules, except for PreMTM B, can bind DNA with the following rank order of affinities (strong to weak): MTM=MTM SDK>MTM SA-Trp>MTM SA-Ala. An X(G/C)(G/C)X motif, where X is any base, is necessary and sufficient for MTM binding to DNA, without a strong dependence on DNA conformation. These recognition rules will aid in mapping MTM sites across different promoters towards development of MTM analogues as useful anticancer agents. PMID:26760230

  8. Inhibition of telomerase by BIBR 1532 and related analogues.

    PubMed

    Barma, D K; Elayadi, Anissa; Falck, J R; Corey, David R

    2003-04-01

    BIBR 1532 has been reported to be a potent, small molecule inhibitor of human telomerase, suggesting it as a lead for the development of anti-telomerase therapy. We confirm the ability of BIBR 1532 to inhibit telomerase and report the discovery of an equally potent analogue. Importantly, IC(50) values in cell extract are considerably higher than those previously reported using assays for purified enzyme, indicating that substantial improvement may be necessary. PMID:12657276

  9. Lysophosphatidylserine analogues differentially activate three LysoPS receptors.

    PubMed

    Uwamizu, Akiharu; Inoue, Asuka; Suzuki, Kensuke; Okudaira, Michiyo; Shuto, Akira; Shinjo, Yuji; Ishiguro, Jun; Makide, Kumiko; Ikubo, Masaya; Nakamura, Sho; Jung, Sejin; Sayama, Misa; Otani, Yuko; Ohwada, Tomohiko; Aoki, Junken

    2015-03-01

    Lysophosphatidylserine (1-oleoyl-2 R-lysophosphatidylserine, LysoPS) has been shown to have lipid mediator-like actions such as stimulation of mast cell degranulation and suppression of T lymphocyte proliferation, although the mechanisms of LysoPS actions have been elusive. Recently, three G protein-coupled receptors (LPS1/GPR34, LPS2/P2Y10 and LPS3/GPR174) were found to react specifically with LysoPS, raising the possibility that LysoPS serves as a lipid mediator that exerts its role through these receptors. Previously, we chemically synthesized a number of LysoPS analogues and evaluated them as agonists for mast-cell degranulation. Here, we used a transforming growth factor-α (TGFα) shedding assay to see if these LysoPS analogues activated the three LysoPS receptors. Modification of the serine moiety significantly reduced the ability of the analogues to activate the three LysoPS receptors, whereas modification of other parts resulted in loss of activity in receptor-specific manner. We found that introduction of methyl group to serine moiety (1-oleoyl-lysophosphatidylallothreonine) and removal of sn-2 hydroxyl group (1-oleoyl-2-deoxy-LysoPS) resulted in reduction of reactivity with LPS1 and LPS3, respectively. Accordingly, we synthesized a LysoPS analogue with the two modifications (1-oleoyl-2-deoxy-lysophosphatidylallothreonine) and found it to be an LPS2-selective agonist. These pharmacological tools will definitely help to identify the biological roles of these LysoPS receptors. PMID:25320102

  10. Evaluation of anti-HIV-1 mutagenic nucleoside analogues.

    PubMed

    Vivet-Boudou, Valérie; Isel, Catherine; El Safadi, Yazan; Smyth, Redmond P; Laumond, Géraldine; Moog, Christiane; Paillart, Jean-Christophe; Marquet, Roland

    2015-01-01

    Because of their high mutation rates, RNA viruses and retroviruses replicate close to the threshold of viability. Their existence as quasi-species has pioneered the concept of "lethal mutagenesis" that prompted us to synthesize pyrimidine nucleoside analogues with antiviral activity in cell culture consistent with an accumulation of deleterious mutations in the HIV-1 genome. However, testing all potentially mutagenic compounds in cell-based assays is tedious and costly. Here, we describe two simple in vitro biophysical/biochemical assays that allow prediction of the mutagenic potential of deoxyribonucleoside analogues. The first assay compares the thermal stabilities of matched and mismatched base pairs in DNA duplexes containing or not the nucleoside analogues as follows. A promising candidate should display a small destabilization of the matched base pair compared with the natural nucleoside and the smallest gap possible between the stabilities of the matched and mismatched base pairs. From this assay, we predicted that two of our compounds, 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine, should be mutagenic. The second in vitro reverse transcription assay assesses DNA synthesis opposite nucleoside analogues inserted into a template strand and subsequent extension of the newly synthesized base pairs. Once again, only 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine are predicted to be efficient mutagens. The predictive potential of our fast and easy first line screens was confirmed by detailed analysis of the mutation spectrum induced by the compounds in cell culture because only compounds 5-hydroxymethyl-2'-deoxyuridine and 5-hydroxymethyl-2'-deoxycytidine were found to increase the mutation frequency by 3.1- and 3.4-fold, respectively. PMID:25398876

  11. Using fuzzy sets for data interpretation in natural analogue studies

    SciTech Connect

    De Lemos, F.L.; Sullivan, T.; Hellmuth, K.H.

    2008-07-01

    Natural analogue studies can play a key role in deep geological radioactive disposal systems safety assessment. These studies can help develop a better understanding of complex natural processes and, therefore, provide valuable means of confidence building in the safety assessment. In evaluation of natural analogues, there are, however, several sources of uncertainties that stem from factors such as complexity; lack of data; and ignorance. Often, analysts have to simplify the mathematical models in order to cope with the various sources of complexity and this ads uncertainty to the model results. The uncertainties reflected in model predictions must be addressed to understand their impact on safety assessment and therefore, the utility of natural analogues. Fuzzy sets can be used to represent the information regarding the natural processes and their mutual connections. With this methodology we are able to quantify and propagate the epistemic uncertainties in both processes and, thereby, assign degrees of truth to the similarities between them. An example calculation with literature data is provided. In conclusion: Fuzzy sets are an effective way of quantifying semi-quantitative information such as natural analogues data. Epistemic uncertainty that stems from complexity and lack of knowledge regarding natural processes are represented by the degrees of membership. It also facilitates the propagation of this uncertainty throughout the performance assessment by the extension principle. This principle allows calculation with fuzzy numbers, where fuzzy input results in fuzzy output. This may be one of the main applications of fuzzy sets theory to radioactive waste disposal facility performance assessment. Through the translation of natural data into fuzzy numbers, the effect of parameters in important processes in one site can be quantified and compared to processes in other sites with different conditions. The approach presented in this paper can be extended to

  12. OptZyme: Computational Enzyme Redesign Using Transition State Analogues

    PubMed Central

    Grisewood, Matthew J.; Gifford, Nathanael P.; Pantazes, Robert J.; Li, Ye; Cirino, Patrick C.; Janik, Michael J.; Maranas, Costas D.

    2013-01-01

    OptZyme is a new computational procedure for designing improved enzymatic activity (i.e., kcat or kcat/KM) with a novel substrate. The key concept is to use transition state analogue compounds, which are known for many reactions, as proxies for the typically unknown transition state structures. Mutations that minimize the interaction energy of the enzyme with its transition state analogue, rather than with its substrate, are identified that lower the transition state formation energy barrier. Using Escherichia coli β-glucuronidase as a benchmark system, we confirm that KM correlates (R2 = 0.960) with the computed interaction energy between the enzyme and the para-nitrophenyl- β, D-glucuronide substrate, kcat/KM correlates (R2 = 0.864) with the interaction energy of the transition state analogue, 1,5-glucarolactone, and kcat correlates (R2 = 0.854) with a weighted combination of interaction energies with the substrate and transition state analogue. OptZyme is subsequently used to identify mutants with improved KM, kcat, and kcat/KM for a new substrate, para-nitrophenyl- β, D-galactoside. Differences between the three libraries reveal structural differences that underpin improving KM, kcat, or kcat/KM. Mutants predicted to enhance the activity for para-nitrophenyl- β, D-galactoside directly or indirectly create hydrogen bonds with the altered sugar ring conformation or its substituents, namely H162S, L361G, W549R, and N550S. PMID:24116038

  13. Endiandric Acid Analogues from the Roots of Beilschmiedia erythrophloia.

    PubMed

    Yang, Ping-Shin; Cheng, Ming-Jen; Peng, Chien-Fang; Chen, Jih-Jung; Chen, Ih-Sheng

    2009-01-01

    Investigation of the roots of Beilschmiedia erythrophloia has led to the isolation of seven new endiandric acid analogues, erythrophloins A-F (1-6) and beilcyclone A (7), together with 11 known compounds. The structures of 1-7 were determined using spectroscopic techniques. Two constituents, erythrophloin C (3) and suberosol B (8), exhibited antitubercular activity against Mycobacterium tuberculosis H37Rv, showing MIC values of 50 and 28.9 microg/mL, respectively. PMID:19072217

  14. Synthesis of thioglycoside-based UDP-sugar analogues.

    PubMed

    Zhu, Xiangming; Stolz, Florian; Schmidt, Richard R

    2004-10-15

    Arbuzov reaction of O-acetyl-protected glycosylthiomethyl chlorides with triethyl phosphite and then phosphonate ethyl ester cleavage with trimethylsilyl bromide afforded glycosylthiomethyl phosphonates 13, 18, 22, and 26. These intermediates could be readily transformed into the O-deprotected phosphonates 7-10 and into title compounds 1-4. Similarly, sulfonomethyl phosphonate moieties containing UDP-sugar analogues 5 and 6 were obtained. PMID:15471496

  15. Contact zones and hydrothermal systems as analogues to repository conditions

    SciTech Connect

    Wollenberg, H.A.; Flexser, S.

    1984-10-01

    Radioactive waste isolation efforts in the US are currently focused on examining basalt, tuff, salt, and crystalline rock as candidate rock types to encompass waste repositories. As analogues to near-field conditions, the distributions of radio- and trace-elements have been examined across contacts between these rocks and dikes and stocks that have intruded them. The intensive study of the Stripa quartz monzonite has also offered the opportunity to observe the distribution of uranium and its daughters in groundwater and its relationship to U associated with fracture-filling and alteration minerals. Investigations of intrusive contact zones to date have included (1) a tertiary stock into Precambrian gneiss, (2) a stock into ash flow tuff, (3) a rhyodacite dike into Columbia River basalt, and (4) a kimberlite dike into salt. With respect to temperature and pressure, these contact zones may be considered "worst-case scenario" analogues. Results indicate that there has been no appreciable migration of radioelements from the more radioactive intrusives into the less radioactive country rocks, either in response to the intrusions or in the fracture-controlled hydrological systems that developed following emplacement. In many cases, the radioelements are locked up in accessory minerals, suggesting that artificial analogues to these would make ideal waste forms. Emphasis should now shift to examination of active hydrothermal systems, studying the distribution of key elements in water, fractures, and alteration minerals under pressure and temperature conditions most similar to those expected in the near-field environment of a repository. 14 refs.

  16. Simulated Milky Way analogues: implications for dark matter direct searches

    NASA Astrophysics Data System (ADS)

    Bozorgnia, Nassim; Calore, Francesca; Schaller, Matthieu; Lovell, Mark; Bertone, Gianfranco; Frenk, Carlos S.; Crain, Robert A.; Navarro, Julio F.; Schaye, Joop; Theuns, Tom

    2016-05-01

    We study the implications of galaxy formation on dark matter direct detection using high resolution hydrodynamic simulations of Milky Way-like galaxies simulated within the EAGLE and APOSTLE projects. We identify Milky Way analogues that satisfy observational constraints on the Milky Way rotation curve and total stellar mass. We then extract the dark matter density and velocity distribution in the Solar neighbourhood for this set of Milky Way analogues, and use them to analyse the results of current direct detection experiments. For most Milky Way analogues, the event rates in direct detection experiments obtained from the best fit Maxwellian distribution (with peak speed of 223–289 km/s) are similar to those obtained directly from the simulations. As a consequence, the allowed regions and exclusion limits set by direct detection experiments in the dark matter mass and spin-independent cross section plane shift by a few GeV compared to the Standard Halo Model, at low dark matter masses. For each dark matter mass, the halo-to-halo variation of the local dark matter density results in an overall shift of the allowed regions and exclusion limits for the cross section. However, the compatibility of the possible hints for a dark matter signal from DAMA and CDMS-Si and null results from LUX and SuperCDMS is not improved.

  17. THE PENA BLANCA NATURAL ANALOGUE PERFORMANCE ASSESSMENT MODEL

    SciTech Connect

    G. Saulnier and W. Statham

    2006-04-16

    The Nopal I uranium mine in the Sierra Pena Blanca, Chihuahua, Mexico serves as a natural analogue to the Yucca Mountain repository. The Pena Blanca Natural Analogue Performance Assessment Model simulates the mobilization and transport of radionuclides that are released from the mine and transported to the saturated zone. The Pena Blanca Natural Analogue Performance Assessment Model uses probabilistic simulations of hydrogeologic processes that are analogous to the processes that occur at the Yucca Mountain site. The Nopal I uranium deposit lies in fractured, welded, and altered rhyolitic ash-flow tuffs that overlie carbonate rocks, a setting analogous to the geologic formations at the Yucca Mountain site. The Nopal I mine site has the following analogous characteristics as compared to the Yucca Mountain repository site: (1) Analogous source--UO{sub 2} uranium ore deposit = spent nuclear fuel in the repository; (2) Analogous geology--(i.e. fractured, welded, and altered rhyolitic ash-flow tuffs); (3) Analogous climate--Semiarid to arid; (4) Analogous setting--Volcanic tuffs overlie carbonate rocks; and (5) Analogous geochemistry--Oxidizing conditions Analogous hydrogeology: The ore deposit lies in the unsaturated zone above the water table.

  18. Noble gas encapsulation: clathrate hydrates and their HF doped analogues.

    PubMed

    Mondal, Sukanta; Chattaraj, Pratim Kumar

    2014-09-01

    The significance of clathrate hydrates lies in their ability to encapsulate a vast range of inert gases. Although the natural abundance of a few noble gases (Kr and Xe) is poor their hydrates are generally abundant. It has already been reported that HF doping enhances the stability of hydrogen hydrates and methane hydrates, which prompted us to perform a model study on helium, neon and argon hydrates with their HF doped analogues. For this purpose 5(12), 5(12)6(8) and their HF doped analogues are taken as the model clathrate hydrates, which are among the building blocks of sI, sII and sH types of clathrate hydrate crystals. We use the dispersion corrected and gradient corrected hybrid density functional theory for the calculation of thermodynamic parameters as well as conceptual density functional theory based reactivity descriptors. The method of the ab initio molecular dynamics (AIMD) simulation is used through atom centered density matrix propagation (ADMP) techniques to envisage the structural behaviour of different noble gas hydrates on a 500 fs timescale. Electron density analysis is carried out to understand the nature of Ng-OH2, Ng-FH and Ng-Ng interactions. The current results noticeably demonstrate that the noble gas (He, Ne, and Ar) encapsulation ability of 5(12), 5(12)6(8) and their HF doped analogues is thermodynamically favourable. PMID:25047071

  19. Natural analogue studies as supplements to biomineralization research

    SciTech Connect

    McNeil, M.B.

    1995-09-01

    Chemical reactions can alter the chemistry and crystal structure of solid objects over archeological or geological times, while preserving external physical shapes. The reactions resulting in these structures offer natural analogues to laboratory experiments in biomineralization and to biologically influenced alteration of nuclear waste packages, and thus, they offer the only available way of validating models that purport waste package behavior over archaeological or geological times. Potential uses of such analogues in the construction and validation of hypothetical mechanisms of microbiological corrosion and biomineralization are reviewed. Evidence from such analogues suggests that biofilms can control materials alteration in ways usually overlooked. The newly hypothesized mechanisms involve control by biofilms of the cation flow near the solid surface and offer plausible mechanisms for the formation of mixed-cation minerals under conditions that would lead to dealloying in abiotic experiments; they also account for the formation of unusual minerals [such as posnjakite, Cu{sub 4}SO{sub 4}(OH){sub 6{center_dot}}H{sub 2}O] and mineral morphologies unusual in corrosion [malachite, Cu{sub 2}CO{sub 3}(OH){sub 2}, rarely forms botryoidally under corrosion conditions and its occasional presence on archaeological objects that appear to have undergone microbiological corrosion may be related to biofilm phenomena].

  20. Stereochemical Assignment of Strigolactone Analogues Confirms Their Selective Biological Activity.

    PubMed

    Artuso, Emma; Ghibaudi, Elena; Lace, Beatrice; Marabello, Domenica; Vinciguerra, Daniele; Lombardi, Chiara; Koltai, Hinanit; Kapulnik, Yoram; Novero, Mara; Occhiato, Ernesto G; Scarpi, Dina; Parisotto, Stefano; Deagostino, Annamaria; Venturello, Paolo; Mayzlish-Gati, Einav; Bier, Ariel; Prandi, Cristina

    2015-11-25

    Strigolactones (SLs) are new plant hormones with various developmental functions. They are also soil signaling chemicals that are required for establishing beneficial mycorrhizal plant/fungus symbiosis. In addition, SLs play an essential role in inducing seed germination in root-parasitic weeds, which are one of the seven most serious biological threats to food security. There are around 20 natural SLs that are produced by plants in very low quantities. Therefore, most of the knowledge on SL signal transduction and associated molecular events is based on the application of synthetic analogues. Stereochemistry plays a crucial role in the structure-activity relationship of SLs, as compounds with an unnatural D-ring configuration may induce biological effects that are unrelated to SLs. We have synthesized a series of strigolactone analogues, whose absolute configuration has been elucidated and related with their biological activity, thus confirming the high specificity of the response. Analogues bearing the R-configured butenolide moiety showed enhanced biological activity, which highlights the importance of this stereochemical motif. PMID:26502774

  1. Design and synthesis of biotin analogues reversibly binding with streptavidin.

    PubMed

    Yamamoto, Tomohiro; Aoki, Kiyoshi; Sugiyama, Akira; Doi, Hirofumi; Kodama, Tatsuhiko; Shimizu, Yohei; Kanai, Motomu

    2015-04-01

    Two new biotin analogues, biotin carbonate 5 and biotin carbamate 6, have been synthesized. These molecules were designed to reversibly bind with streptavidin by replacing the hydrogen-bond donor NH group(s) of biotin's cyclic urea moiety with oxygen. Biotin carbonate 5 was synthesized from L-arabinose (7), which furnishes the desired stereochemistry at the 3,4-cis-dihydroxy groups, in 11% overall yield (over 10 steps). Synthesis of biotin carbamate 6 was accomplished from L-cysteine-derived chiral aldehyde 33 in 11% overall yield (over 7 steps). Surface plasmon resonance analysis of water-soluble biotin carbonate analogue 46 and biotin carbamate analogue 47 revealed that KD values of these compounds for binding to streptavidin were 6.7×10(-6)  M and 1.7×10(-10)  M, respectively. These values were remarkably greater than that of biotin (KD =10(-15)  M), and thus indicate the importance of the nitrogen atoms for the strong binding between biotin and streptavidin. PMID:25691069

  2. Do film soundtracks contain nonlinear analogues to influence emotion?

    PubMed

    Blumstein, Daniel T; Davitian, Richard; Kaye, Peter D

    2010-12-23

    A variety of vertebrates produce nonlinear vocalizations when they are under duress. By their very nature, vocalizations containing nonlinearities may sound harsh and are somewhat unpredictable; observations that are consistent with them being particularly evocative to those hearing them. We tested the hypothesis that humans capitalize on this seemingly widespread vertebrate response by creating nonlinear analogues in film soundtracks to evoke particular emotions. We used lists of highly regarded films to generate a set of highly ranked action/adventure, dramatic, horror and war films. We then scored the presence of a variety of nonlinear analogues in these film soundtracks. Dramatic films suppressed noise of all types, contained more abrupt frequency transitions and musical sidebands, and fewer noisy screams than expected. Horror films suppressed abrupt frequency transitions and musical sidebands, but had more non-musical sidebands, and noisy screams than expected. Adventure films had more male screams than expected. Together, our results suggest that film-makers manipulate sounds to create nonlinear analogues in order to manipulate our emotional responses. PMID:20504815

  3. The UVB1 Vitamin D analogue inhibits colorectal carcinoma progression.

    PubMed

    Ferronato, María Julia; Alonso, Eliana Noelia; Gandini, Norberto Ariel; Fermento, María Eugenia; Villegas, María Emilia; Quevedo, Mario Alfredo; Arévalo, Julián; López Romero, Alejandro; Rivadulla, Marcos Lois; Gómez, Generosa; Fall, Yagamare; Facchinetti, María Marta; Curino, Alejandro Carlos

    2016-10-01

    Vitamin D has been shown to display a wide variety of antitumour effects, but their therapeutic use is limited by its severe side effects. We have designed and synthesized a Gemini vitamin D analogue of calcitriol (UVB1) which has shown to display antineoplastic effects on different cancer cell lines without causing hypercalcemia. The aim of this work has been to investigate, by employing in silico, in vitro, and in vivo assays, whether UVB1 inhibits human colorectal carcinoma progression. We demonstrated that UVB1 induces apoptotic cell death and retards cellular migration and invasion of HCT116 colorectal carcinoma cells. Moreover, the analogue reduced the tumour volume in vivo, and modulated the expression of Bax, E-cadherin and nuclear β-catenin in tumour animal tissues without producing toxic effects. In silico analysis showed that UVB1 exhibits greater affinity for the ligand binding domain of vitamin D receptor than calcitriol, and that several characteristics in the three-dimensional conformation of VDR may influence the biological effects. These results demonstrate that the Gemini vitamin D analogue affects the growth of the colorectal cancer and suggest that UVB1 is a potential chemotherapeutic agent for treatment of this disease. PMID:27208626

  4. Somatostatin and analogues in the treatment of cancer. A review.

    PubMed Central

    Evers, B M; Parekh, D; Townsend, C M; Thompson, J C

    1991-01-01

    Somatostatin is a naturally occurring cyclic tetradecapeptide that inhibits release of growth hormone and all gastrointestinal hormones. The beneficial effect of somatostatin in the treatment of certain hypersecretory disorders of hormone excess in well recognized; however its clinical usefulness has been limited in the past by its extremely short plasma half-life. The development of long-acting somatostatin analogues has provided clinically useful agents for treatment of hormone-producing tumors. In addition to well-known inhibiting effects on hormone release and actions, recent studies using experimental tumor models have demonstrated an antiproliferative effect of somatostatin and its analogues on growth of a variety of neoplasms. The exact role of somatostatin analogues in cancer therapy has yet to be established; however studies suggest that these agents could provide a useful and relatively nontoxic adjuvant therapy in the treatment of certain tumors. In this review, the oncologic application of somatostatin and possible mechanism of action are examined and current clinical and experimental studies are summarized. PMID:1671812

  5. Numerical simulation of an experimental analogue of a planetary magnetosphere

    NASA Astrophysics Data System (ADS)

    Liao, Andy Sha; Li, Shule; Hartigan, Patrick; Graham, Peter; Fiksel, Gennady; Frank, Adam; Foster, John; Kuranz, Carolyn

    2015-12-01

    Recent improvements to the Omega Laser Facility's magneto-inertial fusion electrical discharge system (MIFEDS) have made it possible to generate strong enough magnetic fields in the laboratory to begin to address the physics of magnetized astrophysical flows. Here, we adapt the MHD code AstroBEAR to create 2D numerical models of an experimental analogue of a planetary magnetosphere. We track the secular evolution of the magnetosphere analogue and we show that the magnetospheric components such as the magnetopause, magnetosheath, and bow shock, should all be observable in experimental optical band thermal bremsstrahlung emissivity maps, assuming equilibrium charge state distributions of the plasma. When the magnetosphere analogue nears the steady state, the mid-plane altitude of the magnetopause from the wire surface scales as the one-half power of the ratio of the magnetic pressure at the surface of the free wire to the ram pressure of an unobstructed wind; the mid-plane thickness of the magnetosheath is directly related to the radius of the magnetopause. This behavior conforms to Chapman and Ferraro's theory of planetary magnetospheres. Although the radial dependence of the magnetic field strength differs between the case of a current-carrying wire and a typical planetary object, the major morphological features that develop when a supersonic flow passes either system are identical. Hence, this experimental concept is an attractive one for studying the dynamics of planetary magnetospheres in a controlled environment.

  6. Acyclic nucleoside/nucleotide analogues with an imidazole ring skeleton.

    PubMed

    Chen, H M; Hosmane, R S

    2001-08-01

    Syntheses of a few acyclic nucleoside and acyclic nucleoside phosphonate analogues containing an imidazole ring have been reported. These analogues include methyl 1-(2-hydroxyethoxymethyl)imidazole-4, 5-dicarbo-xylate (1), 4,5-dicarbamoyl-1-(2-hydroxyethoxymethyl)imidazole (2), 4,5-dicyano-1-(2-hydroxyethoxymethyl)imidazole (4), Methyl 1-(2-bromoethoxymethyl)imidazole-4,5-dicarboxylate (7), 4,5-dicyano-(2-bromoethoxymethyl)imidazole (8), and Methyl 1-(2-phosphonomethoxyethyl)imidazole (10). Also reported are a few potential prodrugs of the above compounds, including the acetyl derivatives 5 and 6 (of 1 and 4, respectively), and the diethyl phosphonate ester 9 (of 10). In addition, the corresponding benzyl-protected precursors 11 and 12 (of 1 and 4, respectively), along with their common hydrolysis product, 1-(2-benzyloxy-ethoxymethyl)-4,5-imidazoledicarboxylic acid (3), are reported. Another potential prodrug included in the list is 1-(2-acetoxyethyl)-4,5-dicyanoimidazole (15). The compounds were screened for in vitro antiviral activity against a wide variety of herpes and respiratory viruses. The most active compound was the phosphonate analogue 9 which exhibited an anti-measles virus activity with an EC50 of <2.5 microg/mL and an SI value of > 176. PMID:11554548

  7. THE PENA BLANCA NATURAL ANALOGUE PERFORMANCE ASSESSMENT MODEL

    SciTech Connect

    G.J. Saulnier Jr; W. Statham

    2006-03-10

    The Nopal I uranium mine in the Sierra Pena Blanca, Chihuahua, Mexico serves as a natural analogue to the Yucca Mountain repository. The Pena Blanca Natural Analogue Performance Assessment Model simulates the mobilization and transport of radionuclides that are released from the mine and transported to the saturated zone. the Pena Blanca Natural Analogue Model uses probabilistic simulations of hydrogeologic processes that are analogous to the processes that occur at the Yucca Mountain site. The Nopal I uranium deposit lies in fractured, welded, and altered rhyolitic ash flow tuffs that overlie carbonate rocks, a setting analogous to the geologic formations at the Yucca Mountain site. The Nopal I mine site has the following characteristics as compared to the Yucca Mountain repository site. (1) Analogous source: UO{sub 2} uranium ore deposit = spent nuclear fuel in the repository; (2) Analogous geologic setting: fractured, welded, and altered rhyolitic ash flow tuffs overlying carbonate rocks; (3) Analogous climate: Semiarid to arid; (4) Analogous geochemistry: Oxidizing conditions; and (5) Analogous hydrogeology: The ore deposit lies in the unsaturated zone above the water table. The Nopal I deposit is approximately 8 {+-} 0.5 million years old and has been exposed to oxidizing conditions during the last 3.2 to 3.4 million years. The Pena Blanca Natural Analogue Model considers that the uranium oxide and uranium silicates in the ore deposit were originally analogous to uranium-oxide spent nuclear fuel. The Pena Blanca site has been characterized using field and laboratory investigations of its fault and fracture distribution, mineralogy, fracture fillings, seepage into the mine adits, regional hydrology, and mineralization that shows the extent of radionuclide migration. Three boreholes were drilled at the Nopal I mine site in 2003 and these boreholes have provided samples for lithologic characterization, water-level measurements, and water samples for laboratory

  8. Opioid profiles of Cys2-containing enkephalin analogues.

    PubMed

    Pencheva, Nevena; Milanov, Peter; Vezenkov, Lubomir; Pajpanova, Tamara; Naydenova, Emilia

    2004-09-13

    To elucidate the structural features determining delta-opioid receptor properties of enkephalin analogues containing Cys(O2NH2) in position 2, a series of Cys2-containing derivatives were synthesized and tested for their effectiveness in depressing electrically evoked contractions of the mouse vas deferens (predominantly enkephalin-selective delta-opioid receptors) and the guinea-pig ileum (mu- and kappa-opioid receptors). The peptidase resistance of the compounds was also tested. The ratio IC50 in the guinea-pig ileum/IC50 in the mouse vas deferens, indicating selectivity for delta-opioid receptors, was high for Cys(O2NH2)2-containing analogues and especially for [Cys(O2NH2)2, Leu5]enkephalin, which was about seven times more selective than delta-opioid receptor selective ligand cyclic [D-Pen2, D-Pen5]enkephalin (DPDPE). The dissociation constant (KA) and relative efficacy (e(rel)) of the compounds in the mouse-isolated vas deferens were determined using explicit formulae derived by fitting of the data points with two-parametric hyperbolic function. The obtained values for KA and e(rel) suggest that: (i) incorporation of Cys(O2NH2)2 in the molecule of [Leu5]enkephalin highly increases the efficacy and does not change significantly the affinity of the respective analogues to delta-opioid receptors; [Cys(O2NH2)2, Leu5]enkephalin has higher affinity than DPDPE, but is less resistant to enzyme degradation; the effect of this modification on the efficacy is decreased when methionine is in position 5; (ii) D-configuration of Cys(O2NH2)2-containing analogues increases their peptidase resistance, but reduces efficacy and affinity of the peptides towards delta-opioid receptors; (iii) the substitution of Cys(O2NH2) with Hcy(O2NH2) reduces the efficacy, affinity and potency of the respective analogues and maintains their sensitivity to endogenous peptidases; (iv) the substitution of the sulfonamide group with benzyl group in the molecule of Cys in position 2 decreases their

  9. Past and present of analogue modelling, and its future trend

    NASA Astrophysics Data System (ADS)

    Koyi, Hemin

    2015-04-01

    Since Hull (1815) published his article on modelling, analogue modelling has expanded to simulate both a wider range of tectonic regimes and target more challenging set-ups, and has become an integrated part of the fields of tectonics and structural geology. Establishment of new laboratories testifies for the increased attention the technique receives. The ties between modellers and field geoscientists have become stronger with the focus being on understanding the parameters that govern the evolution of a tectonic regime and the processes that dominate it. Since the first sand castle was built with damp sand on a beach, sand has proven to be an appropriate material analogue. Even though granular materials is the most widely used analogue material, new materials are also (re)introduced as rock analogues. Emphasis has been on more precise measurements of the mechanical properties of the materials and on minimizing the preparation effects, which have a great impact on scaling, interpretations and benchmarking. The analytical technique used to quantify model results has also seen a great deal of improvement. In addition to X-ray tomography used to visualise internal structures of models, new techniques (e.g. PIV, high-resolution laser scanning, and interferometry) have enabled monitoring kinematics with a higher precision. Benchmarking exercises have given modelling an additional checking tool by outlining, in addition to the rheology of the modelling materials, the impact of different preparation approaches, the effect of boundary conditions, and the human factor on model results. However, despite the different approaches and deformation rigs, results of models of different tectonic laboratories have shown a great deal of similarities. Even with the introduction of more sophisticated numerical codes and usage of more powerful computers which enable the simulation of more challenging material properties and combinations of those, and 3D model set-up, analogue modelling

  10. Crystal structure of a nucleoside model for the inter­strand cross-link formed by the reaction of 2′-de­oxy­guanosine and an abasic site in duplex DNA

    PubMed Central

    Catalano, Michael J.; Ruddraraju, Kasi Viswanatharaju; Barnes, Charles L.; Gates, Kent S.

    2016-01-01

    The title compound, 9-[(2R,4S,5R)-4-hy­droxy-5-(hy­droxy­meth­yl)tetra­hydro­furan-2-yl]-2-{[(2R,4S,5R)-4-meth­oxy-5-(meth­oxy­meth­yl)tetra­hydro­furan-2-yl]amino}-1H-purin-6(9H)-one, C17H25N5O7, crystallizes with two independent mol­ecules (A and B) in the asymmetric unit. In the crystal, the guanosine moieties of mol­ecules A and B are linked by N—H⋯N and O—H⋯N hydrogen-bonding inter­actions, forming ribbons which are stacked to form columns along [100]. These columns are then linked by O—H⋯O hydrogen bonds between the ribose moieties and numerous C—H⋯O inter­actions to complete the three-dimensional structure. PMID:27308004

  11. The cystathionine-β-synthase domains on the guanosine 5''-monophosphate reductase and inosine 5'-monophosphate dehydrogenase enzymes from Leishmania regulate enzymatic activity in response to guanylate and adenylate nucleotide levels.

    PubMed

    Smith, Sabrina; Boitz, Jan; Chidambaram, Ehzilan Subramanian; Chatterjee, Abhishek; Ait-Tihyaty, Maria; Ullman, Buddy; Jardim, Armando

    2016-06-01

    The Leishmania guanosine 5'-monophosphate reductase (GMPR) and inosine 5'-monophosphate dehydrogenase (IMPDH) are purine metabolic enzymes that function maintaining the cellular adenylate and guanylate nucleotide. Interestingly, both enzymes contain a cystathionine-β-synthase domain (CBS). To investigate this metabolic regulation, the Leishmania GMPR was cloned and shown to be sufficient to complement the guaC (GMPR), but not the guaB (IMPDH), mutation in Escherichia coli. Kinetic studies confirmed that the Leishmania GMPR catalyzed a strict NADPH-dependent reductive deamination of GMP to produce IMP. Addition of GTP or high levels of GMP induced a marked increase in activity without altering the Km values for the substrates. In contrast, the binding of ATP decreased the GMPR activity and increased the GMP Km value 10-fold. These kinetic changes were correlated with changes in the GMPR quaternary structure, induced by the binding of GMP, GTP, or ATP to the GMPR CBS domain. The capacity of these CBS domains to mediate the catalytic activity of the IMPDH and GMPR provides a regulatory mechanism for balancing the intracellular adenylate and guanylate pools. PMID:26853689

  12. Light- and guanosine 5'-3-O-(thio)triphosphate-sensitive localization of a G protein and its effector on detergent-resistant membrane rafts in rod photoreceptor outer segments.

    PubMed

    Seno, K; Kishimoto, M; Abe, M; Higuchi, Y; Mieda, M; Owada, Y; Yoshiyama, W; Liu, H; Hayashi, F

    2001-06-15

    Detergent-resistant membrane microdomains in the plasma membrane, known as lipid rafts, have been implicated in various cellular processes. We report here that a low-density Triton X-100-insoluble membrane (detergent-resistant membrane; DRM) fraction is present in bovine rod photoreceptor outer segments (ROS). In dark-adapted ROS, transducin and most of cGMP-phosphodiesterase (PDE) were detergent-soluble. When ROS membranes were exposed to light, however, a large portion of transducin localized in the DRM fraction. Furthermore, on addition of guanosine 5'-3-O-(thio)triphosphate (GTPgammaS) to light-bleached ROS, transducin became detergent-soluble again. PDE was not recruited to the DRM fraction after light stimulus alone, but simultaneous stimulation by light and GTPgammaS induced a massive translocation of all PDE subunits to the DRM. A cholesterol-removing reagent, methyl-beta-cyclodextrin, selectively but partially solubilized PDE from the DRM, suggesting that cholesterol contributes, at least in part, to the association of PDE with the DRM. By contrast, transducin was not extracted by the depletion of cholesterol. These data suggest that transducin and PDE are likely to perform their functions in phototransduction by changing their localization between two distinct lipid phases, rafts and surrounding fluid membrane, on disc membranes in an activation-dependent manner. PMID:11319214

  13. Inhibition of insulin release by synthetic peptides shows that the H3 region at the C-terminal domain of syntaxin-1 is crucial for Ca(2+)- but not for guanosine 5'-[gamma-thio]triphosphate-induced secretion.

    PubMed Central

    Martin, F; Salinas, E; Vazquez, J; Soria, B; Reig, J A

    1996-01-01

    Recently, we have described the presence and possible role of syntaxin in pancreatic beta-cells by using monoclonal antibodies [F. Martin, F. Moya, L. M. Gutierrez, J.A. Reig, B. Soria (1995) Diabetologia 38, 860-863]. In order to characterize further the importance of specific domains of this protein, the functional role of a particular region of the syntaxin-1 molecule has now been investigated by using two synthetic peptides, SynA and SynB, corresponding to two portions of the H3 region at the C-terminal domain of the protein, residues 229-251 and 197-219 respectively. Functional experiments carried out in permeabilized pancreatic beta-cells demonstrate that these peptides inhibit Ca(2+)-dependent insulin release in a dose-dependent manner. This effect is specific because peptides of the same composition but random sequence do not show the same effect. In contrast with this inhibitory effect on Ca(2+)-induced secretion, both peptides increase basal release. However, under the same conditions, SynA and SynB do not affect guanosine 5'-[gamma-thio]triphosphate-induced insulin release. These results demonstrate that specific portions of the H3 region of syntaxin-1 are involved in critical protein-protein interactions specifically during Ca(2+)-induced insulin secretion. PMID:8947488

  14. Testing technologies and strategies for exploration in Australian Mars analogues: A review

    NASA Astrophysics Data System (ADS)

    West, Michael D.; D. A. Clarke, Jonathan; Laing, Jennifer H.; Willson, David; Waldie, James M. A.; Murphy, Guy M.; Thomas, Matilda; Mann, Graham A.

    2010-03-01

    Australia is an ideal testing ground in preparation for the robotic and human exploration of Mars. Numerous sites with landforms or processes analogous to those on Mars are present and the deserts of central Australia provide a range of locations for free-ranging Mars analogue mission simulations. The latest developments in testing technologies and strategies for exploration in Australian Mars analogues are reviewed. These include trials of analogue space suits based on mechanical counter pressure technology and the development of an analogue, crewed, pressurized rover for long-range exploration. Field science activities and instrumentation testing relevant to robotic and future crewed missions are discussed. Australian-led human factors research undertaken during expeditions to Mars analogue research stations and expeditions to Antarctica are also reviewed. Education and public outreach activities related to Mars analogue research in Australia are also detailed.

  15. Quantitative comparisons of analogue models of brittle wedge dynamics

    NASA Astrophysics Data System (ADS)

    Schreurs, Guido

    2010-05-01

    Analogue model experiments are widely used to gain insights into the evolution of geological structures. In this study, we present a direct comparison of experimental results of 14 analogue modelling laboratories using prescribed set-ups. A quantitative analysis of the results will document the variability among models and will allow an appraisal of reproducibility and limits of interpretation. This has direct implications for comparisons between structures in analogue models and natural field examples. All laboratories used the same frictional analogue materials (quartz and corundum sand) and prescribed model-building techniques (sieving and levelling). Although each laboratory used its own experimental apparatus, the same type of self-adhesive foil was used to cover the base and all the walls of the experimental apparatus in order to guarantee identical boundary conditions (i.e. identical shear stresses at the base and walls). Three experimental set-ups using only brittle frictional materials were examined. In each of the three set-ups the model was shortened by a vertical wall, which moved with respect to the fixed base and the three remaining sidewalls. The minimum width of the model (dimension parallel to mobile wall) was also prescribed. In the first experimental set-up, a quartz sand wedge with a surface slope of ˜20° was pushed by a mobile wall. All models conformed to the critical taper theory, maintained a stable surface slope and did not show internal deformation. In the next two experimental set-ups, a horizontal sand pack consisting of alternating quartz sand and corundum sand layers was shortened from one side by the mobile wall. In one of the set-ups a thin rigid sheet covered part of the model base and was attached to the mobile wall (i.e. a basal velocity discontinuity distant from the mobile wall). In the other set-up a basal rigid sheet was absent and the basal velocity discontinuity was located at the mobile wall. In both types of experiments

  16. Dynamics of water in prussian blue analogues: Neutron scattering study

    NASA Astrophysics Data System (ADS)

    Sharma, V. K.; Mitra, S.; Thakur, N.; Yusuf, S. M.; Juranyi, Fanni; Mukhopadhyay, R.

    2014-07-01

    Dynamics of crystal water in Prussian blue (PB), Fe(III)4[Fe(II)(CN)6]3.14H2O and its analogue Prussian green (PG), ferriferricynaide, Fe(III)4[Fe(III)(CN)6]4.16H2O have been investigated using Quasielastic Neutron Scattering (QENS) technique. PB and its analogue compounds are important materials for their various interesting multifunctional properties. It is known that crystal water plays a crucial role towards the multifunctional properties of Prussian blue analogue compounds. Three structurally distinguishable water molecules: (i) coordinated water molecules at empty nitrogen sites, (ii) non-coordinated water molecules in the spherical cavities, and (iii) at interstitial sites exist in PB. Here spherical cavities are created due to the vacant sites of Fe(CN)6 units. However, PG does not have any such vacant N or Fe(CN)6 units, and only one kind of water molecules, exists only at interstitial sites. QENS experiments have been carried out on both the compounds in the temperature range of 260-360 K to elucidate the dynamical behavior of different kinds of water molecules. Dynamics is found to be much more pronounced in case of PB, compared to PG. A detailed data analysis showed that localized translational diffusion model could describe the observed data for both PB and PG systems. The average diffusion coefficient is found to be much larger in the PB than PG. The obtained domain of dynamics is found to be consistent with the geometry of the structure of the two systems. Combining the data of the two systems, a quantitative estimate of the dynamics, corresponding to the water molecules at different locations is made.

  17. Dynamics of water in prussian blue analogues: Neutron scattering study

    SciTech Connect

    Sharma, V. K.; Mitra, S.; Thakur, N.; Yusuf, S. M.; Mukhopadhyay, R.; Juranyi, Fanni

    2014-07-21

    Dynamics of crystal water in Prussian blue (PB), Fe(III){sub 4}[Fe(II)(CN){sub 6}]{sub 3}.14H{sub 2}O and its analogue Prussian green (PG), ferriferricynaide, Fe(III){sub 4}[Fe(III)(CN){sub 6}]{sub 4}.16H{sub 2}O have been investigated using Quasielastic Neutron Scattering (QENS) technique. PB and its analogue compounds are important materials for their various interesting multifunctional properties. It is known that crystal water plays a crucial role towards the multifunctional properties of Prussian blue analogue compounds. Three structurally distinguishable water molecules: (i) coordinated water molecules at empty nitrogen sites, (ii) non-coordinated water molecules in the spherical cavities, and (iii) at interstitial sites exist in PB. Here spherical cavities are created due to the vacant sites of Fe(CN){sub 6} units. However, PG does not have any such vacant N or Fe(CN){sub 6} units, and only one kind of water molecules, exists only at interstitial sites. QENS experiments have been carried out on both the compounds in the temperature range of 260–360 K to elucidate the dynamical behavior of different kinds of water molecules. Dynamics is found to be much more pronounced in case of PB, compared to PG. A detailed data analysis showed that localized translational diffusion model could describe the observed data for both PB and PG systems. The average diffusion coefficient is found to be much larger in the PB than PG. The obtained domain of dynamics is found to be consistent with the geometry of the structure of the two systems. Combining the data of the two systems, a quantitative estimate of the dynamics, corresponding to the water molecules at different locations is made.

  18. Radio-protective effect of some new curcumin analogues.

    PubMed

    El-Gazzar, Marwa G; Zaher, Nashwa H; El-Hossary, Ebaa M; Ismail, Amel F M

    2016-09-01

    In the present study, novel symmetrical curcumin analogues (2-7) have been synthesized by substituting the phenolic OH of curcumin with different linkers providing additional keto-enol tautomerism, very essential for radioprotective activity. The structures of the synthesized compounds (2-7) were elucidated by elemental analysis, IR, (1)H-NMR, (13)C-NMR and mass spectral data and were found consistent with the assigned structures. The curative effect of these new compounds, against the oxidative stress due to exposure of rats to the whole body γ-irradiation (7Gy) was investigated. Gamma-irradiated rats exhibited elevations of ALT, AST activities, urea, creatinine, triglycerides, total cholesterol, malondialdehyde (MDA), nitric oxide (NO), Interleukin-6 (IL-6), Tumor Necrosis Factor-α (TNF-α) and Nuclear Factor-kappa B (NF-κB) levels. Contrariwise, the total protein, albumin, total calcium level, SOD, CAT, GSH-Px, GST activities and GSH content were decreased. Treatment of gamma-irradiated rats with the new curcumin analogues (2-7) showed significant amelioration in the in-vivo antioxidant status, liver and kidney functions, as well as the anti-inflammatory markers (IL-6, TNF-α and NF-κB). Inhibition of NF-κB could be responsible for the improvement of the antioxidant and anti-inflammatory status in gamma-irradiated animals, by down-regulation of IL-1β and TNF-α level. In conclusion, the new curcumin analogues (2-7) exhibited post-protective effect on gamma-irradiation, by NF-κB inhibition. PMID:27505300

  19. Migrastatin Analogues Inhibit Canine Mammary Cancer Cell Migration and Invasion

    PubMed Central

    Majchrzak, Kinga; Lo Re, Daniele; Gajewska, Małgorzata; Bulkowska, Małgorzata; Homa, Agata; Pawłowski, Karol; Motyl, Tomasz; Murphy, Paul V.; Król, Magdalena

    2013-01-01

    Background Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6) on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. Results Our results showed that two of six fully synthetic analogues of migrastatin: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6) disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. Conclusion Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6) were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs. However, further in

  20. Reactions of trimethylphosphine analogues of auranofin with bovine serum albumin

    SciTech Connect

    Isab, A.A.; Shaw, C.F. III; Hoeschele, J.D.; Locke, J.

    1988-10-05

    The reactions of bovine serum albumin (BSA) with (trimethylphosphine)(2,3,4,6-tetra-O-acetyl-1-thio-..beta..-D-glucopyranosato-S)gold(I), Me/sub 3/PAuSAtg, and its chloro analogue, Me/sub 3/PAuCl, were studied to develop insights into the role of the phosphine ligand in the serum chemistry of the related antiarthritic drug auranofin (triethylphosphine)(2,3,4,6-tetra-O-acetyl-1-thio-..beta..-D-glucopyranosato-S)gold(I). /sup 31/P NMR spectroscopy, protein modification, and gel-exclusion chromatography methods were employed. Comparison of the reactions of the methyl derivatives to the previously reported reactions of auranofin and Et/sub 3/PAuCl with BSA demonstrated that similar chemical species are formed but revealed three major differences. Despite these differences, the results for the methyl analogues provide important confirmation for previously developed chemical models of auranofin reactions in serum. Me/sub 3/PO was not observed in reaction mixtures lacking tetraacetylthioglucose (AtgSH); this result affirms the role of AtgSH, displaced by the reaction of Me/sub 3/PAuSAtg at Cys-34, in the generation of the phosphine oxide (an important metabolite in vivo). The weak binding sites on albumin react with Me/sub 3/PAuCl, but not Me/sub 3/PAuSAtg, demonstrating the importance of the strength and reactivity of the anionic ligand-gold bond on the reactions of auranofin analogues. The gold binding capacity of albumin is enhanced after Me/sub 3/PO is formed, consistent with reductive cleavage of albumin disulfide bonds by trimethylphosphine. 24 references, 2 figures, 3 tables.

  1. Thiophene-3-carboxamide analogue of annonaceous acetogenins as antitumor drug lead.

    PubMed

    Kojima, Naoto; Fushimi, Tetsuya; Tatsukawa, Takahiro; Tanaka, Tetsuaki; Okamura, Mutsumi; Akatsuka, Akinobu; Yamori, Takao; Dan, Shingo; Iwasaki, Hiroki; Yamashita, Masayuki

    2014-10-30

    Five novel acetogenin analogues with a furan, thiophene, or thiazole ring were synthesized, and their inhibitory activities toward human cancer cell lines were evaluated. The analogues showed more potent activities than natural acetogenin. One of them, the thiophene-3-carboxamide analogue, strongly inhibited the growth of human lung cancer cell line NCI-H23 in the xenograft mouse assay without critical toxicity. PMID:25226228

  2. Synthesis and proteinase inhibitory properties of diphenyl phosphonate analogues of aspartic and glutamic acids.

    PubMed

    Hamilton, R; Walker, B; Walker, B J

    1998-07-01

    The synthesis of diphenyl phosphonate analogues of aspartic and glutamic acid, and their inhibitory activity against S. aureus V8 protease and granzyme B, is described. The study has revealed difficulties with protecting group compatibility in the synthesis of these analogues. Two analogues, Acetyl. AspP (OPh)2 and Acetyl.GluP (OPh)2 were found to function as irreversible inactivators of V8 proteinase, yet exhibit no activity against granzyme B. PMID:9873408

  3. Estimation of analogue pre-filtering characteristics for CORSA standardisation.

    PubMed

    Sun, X Q; Cheetham, B M; Evans, K G; Earis, J E

    1998-11-01

    This paper is concerned with devising a standard procedure for determining the gain and phase responses of the analogue filters used to pre-process pulmonary signals prior to their digitisation. The customary high-pass filtering, in particular, will strongly affect the time-domain wave-shapes of digitised signals and this must be taken into account when analysing the signals. Several means of determining the effect of the high-pass filtering are investigated and a measurement procedure is proposed which may be easily carried out using simple laboratory equipment. PMID:9924955

  4. Analogue Aharonov-Bohm effect in neo-Newtonian theory

    NASA Astrophysics Data System (ADS)

    Anacleto, M. A.; Salako, I. G.; Brito, F. A.; Passos, E.

    2015-12-01

    We address the issues of the scattering of massless planar scalar waves by an acoustic black hole in neo-Newtonian hydrodynamics. We then compute the differential cross section through the use of the partial wave approach in the neo-Newtonian theory which is a modification of the usual Newtonian theory that correctly incorporates the effects of pressure. We mainly show that the scattering of planar waves leads to a modified analogue Aharonov-Bohm effect due to a nontrivial response of the parameters defining the equation of state.

  5. Galaxies and Saturn's rings: Gravitational analogues of nonneutral plasmas

    SciTech Connect

    Mark, J.W.K.

    1985-04-25

    Orbit and collective dynamics in disk galaxies and in Saturn's rings are gravitational analogues of those occurring in nonneutral plasmas. The interesting problems for such ''gravitational plasmas'' are analogous to single-disk studies of transverse dynamics in particle beams. Of particular interest are various orbit-resonances with spiral density and bending waves in these disks which are analogous to electrostatic waves in nonneutral beam plasmas. The background physics, terminology and results of astrophysical investigations in these fields are surveyed in this paper. 53 refs., 19 figs., 1 tab.

  6. Pena blanca natural analogue project: summary of activities

    SciTech Connect

    Levy, Schon S; Goldstein, Steven J; Abdel - Fattah, Amr I

    2010-12-08

    The inactive Nopal I uranium mine in silicic tuff north of Chihuahua City, Chihuahua, Mexico, was studied as a natural analogue for an underground nuclear-waste repository in the unsaturated zone. Site stratigraphy was confirmed from new drill core. Datafrom site studies include chemical and isotopic compositions of saturated- and unsaturated-zone waters. A partial geochronology of uranium enrichment and mineralization was established. Evidence pertinent to uranium-series transport in the soil zone and changing redox conditions was collected. The investigations contributed to preliminary, scoping-level performance assessment modeling.

  7. Synthesis and study of new paramagnetic resveratrol analogues.

    PubMed

    Kálai, Tamás; Borza, Erzsébet; Antus, Csenge; Radnai, Balázs; Gulyás-Fekete, Gergely; Fehér, Andrea; Sümegi, Balázs; Hideg, Kálmán

    2011-12-15

    New resveratrol analogues containing five- and six-membered nitroxides and isoindoline nitroxides were synthesized. These new compounds were compared to resveratrol based on their ABTS radical scavenging ability as well on their capacity to suppress inflammatory process in macrophages induced by lipopolysaccharides. The ABTS and ROS scavenging activities of new molecules were the same or weaker than that of resveratrol, but some of paramagnetic resveratrol derivatives suppressed nitrite and TNFα production more efficiently than resveratrol. Based on these results the new nitroxide and phenol containing hybrid molecules can be considered as new antioxidant and anti-inflammatory agents. PMID:22088309

  8. Interfacing an analogue infrared spectrometer to a microcomputer.

    PubMed

    Adams, M J; Ewen, G J

    1987-02-01

    An Apple microcomputer has been interfaced to a Perkin-Elmer model 577 infrared spectrometer. The spectral data are digitized with the aid of an in-house designed 12-bit analogue-to-digital interface unit. Control and status signals are obtained from the spectrometer and an optical encoder unit is used to provide an accurate wavenumber marker for the conversion and data recording. The digital data are formatted by the microcomputer and then can be manipulated by programs already developed for handling spectral data recorded from digital spectrometers. PMID:18964290

  9. Novel nicotine analogues with potential anti-mycobacterial activity.

    PubMed

    Gandhi, Paresh T; Athmaram, Thimmasandra Narayanappa; Arunkumar, Gundaiah Ramesh

    2016-04-15

    Tuberculosis (TB) is the second leading lethal infectious disease in the world after acquired immuno deficiency (AIDs). We have developed a series of twenty-five novel nicotine analogues with de-addiction property and tested them for their activity against Mycobacterium tuberculosis (MTB). In an effort to increase the specificity of action and directing nicotine analogues to target MTB, four promising compounds were further optimized via molecular docking studies against the Dihydrofolate reductase of MTB. After lead optimization, one nicotine analogue [3-(5-(3fluorophenyl)nicotinoyl)-1-methylpyrrolidin-2-one] exhibited minimum inhibitory concentration of 1μg/mL (2.86nM) against M. tuberculosis (H37Rv strain), a human pathogenic strain of clinically significant importance. Pharmacokinetic analysis of [3-(5-(3fluorophenyl)nicotinoyl)-1methylpyrrolidin-2-one] with lowest MIC value via oral route in Wistar rats revealed that at a dosage of 5mg/kg body weight gave a maximum serum drug concentration (Cmax) of 2.86μg/mL, Tmax of one hour and a half-life (T1/2) of more than 24h and Volume of distribution (Vd) of 27.36L. Whereas the parenteral (intra venous) route showed a Cmax of 3.37μg/mL, Tmax of 0.05h, T1/2 of 24h and Vd equivalent to 23.18L. The acute oral toxicity and repeated oral toxicity studies in female Wistar rats had an LD50>2000mg/kg body weight. Our data suggests that nicotine derivatives developed in the present study has good metabolic stability with tunable pharmacokinetics (PK) with therapeutic potential to combat MTB. However, further in vivo studies for anti-tuberculosis activity and elucidation of mode of action could result in more promising novel drug for treating MTB. To the best of our knowledge this is the first report revealing the anti-mycobacterial potential of nicotine analogue at potential therapeutic concentrations. PMID:26951892

  10. Synthesis, preliminary bioevaluation and computational analysis of caffeic acid analogues.

    PubMed

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  11. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  12. Dynamic Characteristics Analysis of Analogue Networks Design Process

    NASA Astrophysics Data System (ADS)

    Zemliak, Alexander M.

    The process of designing analogue circuits is formulated as a controlled dynamic system. For analysis of such system's properties it is suggested to use the concept of Lyapunov's function for a dynamic system. Various forms of Lyapunov's function are suggested. Analyzing the behavior of Lyapunov's function and its first derivative allowed us to determine significant correlation between this function's properties and processor time used to design the circuit. Numerical results prove the possibility of forecasting the behavior of various designing strategies and processor time based on the properties of Lyapunov's function for the process of designing the circuit.

  13. B38: an all-boron fullerene analogue

    NASA Astrophysics Data System (ADS)

    Lv, Jian; Wang, Yanchao; Zhu, Li; Ma, Yanming

    2014-09-01

    Fullerene-like structures formed by elements other than carbon have long been sought. Finding all-boron (B) fullerene-like structures is challenging due to the geometrical frustration arising from competitions among various structural motifs. We report here the prediction of a B38 fullerene analogue found through first-principles swarm structure searching calculations. The structure is highly symmetric and consists of 56 triangles and four hexagons, which provide an optimal void in the center of the cage. Energetically, it is more favorable than the planar and tubular structures, and possesses an unusually high chemical stability: a large energy gap (~2.25 eV) and a high double aromaticity, superior to those of most aromatic quasi-planar B12 and double-ring B20 clusters. Our findings represent a key step forward towards to the understanding of structures of medium-sized B clusters and map out the experimental direction of the synthesis of an all-B fullerene analogue.Fullerene-like structures formed by elements other than carbon have long been sought. Finding all-boron (B) fullerene-like structures is challenging due to the geometrical frustration arising from competitions among various structural motifs. We report here the prediction of a B38 fullerene analogue found through first-principles swarm structure searching calculations. The structure is highly symmetric and consists of 56 triangles and four hexagons, which provide an optimal void in the center of the cage. Energetically, it is more favorable than the planar and tubular structures, and possesses an unusually high chemical stability: a large energy gap (~2.25 eV) and a high double aromaticity, superior to those of most aromatic quasi-planar B12 and double-ring B20 clusters. Our findings represent a key step forward towards to the understanding of structures of medium-sized B clusters and map out the experimental direction of the synthesis of an all-B fullerene analogue. Electronic supplementary information

  14. Frequency converter implementing an optical analogue of the cosmological redshift.

    PubMed

    Ginis, Vincent; Tassin, Philippe; Craps, Ben; Veretennicoff, Irina

    2010-03-01

    According to general relativity, the frequency of electromagnetic radiation is altered by the expansion of the universe. This effect-commonly referred to as the cosmological redshift--is of utmost importance for observations in cosmology. Here we show that this redshift can be reproduced on a much smaller scale using an optical analogue inside a dielectric metamaterial with time-dependent material parameters. To this aim, we apply the framework of transformation optics to the Robertson-Walker metric. We demonstrate theoretically how perfect redshifting or blueshifting of an electromagnetic wave can be achieved without the creation of sidebands with a device of finite length. PMID:20389549

  15. Integration of inherent and induced chirality into subphthalocyanine analogue

    NASA Astrophysics Data System (ADS)

    Zhao, Luyang; Qi, Dongdong; Wang, Kang; Wang, Tianyu; Han, Bing; Tang, Zhiyong; Jiang, Jianzhuang

    2016-06-01

    Conventional conjugated systems are characteristic of only either inherent or induced chirality because of synthetic challenge in combination of chiral segment into the main chromophore. In this work, chiral binaphthyl segment is directly fused into the central chromophore of a subphthalocyanine skeleton, resulting in a novel type of chiral subphthalocyanine analogue (R/S)-1 of integrated inherent and induced chirality. Impressively, an obviously enhanced optical activity is discerned for (R/S)-1 molecules, and corresponding enhancement mechanism is elucidated in detail. The synthesis strategy based on rational molecular design will open the door towards fabrication of chiral materials with giant optical activity, which will have great potential in chiroptical devices.

  16. Coupling between mantle and surface processes: Insights from analogue modelling

    NASA Astrophysics Data System (ADS)

    Király, Ágnes; Sembroni, Andrea; Faccenna, Claudio; Funiciello, Francesca

    2014-05-01

    Thermal or density anomalies located beneath the lithosphere are thought to generate dynamic topography. Such a topographic signal compensates the viscous stresses originating from the anomaly driven mantle flow. It has been demonstrated that the erosion modulates the dynamic signal of topography changing the uplift rate by unload. The characteristic time for adjustments of dynamic topography due to surface erosion is likely similar to post-glacial rebound time (10000 - 50000 years). Here we present preliminary results of a new set of analogue models realized to study and quantify the contribution given by erosion to dynamic topography, during a process specifically driven by a positively buoyant deep anomaly. The adopted set up consists of a Plexiglas box (40x40x50 cm3) filled with glucose syrup as analogue upper mantle. A silicon plate positioned on the top of the syrup simulates the lithosphere. On the silicone plate is placed a thin layer of a high viscous glucose syrup which reproduces the upper, erodible layer of the crust. To simulate the positively buoyant anomaly we used an elastic, undeformable silicon ball free to rise by buoyancy in the syrup until the floating silicone plate is hit. The changes in topography have been monitored by using a 3D laser scan, while a side-view camera recorded the position of the rising ball in time. Data have been post-processed with image analysis techniques (e.g., Particle Image Velocimetry) in order to obtain the evolution of topography, uplift rate, erosion patterns of the top layer, bulge width and mantle circulation during the experiment. We ran experiments with and without the shallow, erodible crustal layer in order to quantify the effect of erosion on dynamic topography. Preliminary results showed that both the maximum topography and uplift rate are inversely proportional to the lithospheric thickness. The maximum uplift rate and the deformation of the lithospheric plate occurred just before the arrival of the

  17. Towards bottom-up nanopatterning of Prussian blue analogues

    PubMed Central

    Trannoy, Virgile; Faustini, Marco; Grosso, David; Mazerat, Sandra; Brisset, François; Dazzi, Alexandre

    2014-01-01

    Summary Ordered nanoperforated TiO2 monolayers fabricated through sol–gel chemistry were used to grow isolated particles of Prussian blue analogues (PBA). The elaboration of the TiO2/CoFe PBA nanocomposites involves five steps. The samples were characterized by scanning electron microscopy (SEM), atomic force microscopy (AFM), infrared spectroscopy and X-ray photoelectron spectroscopy (XPS) all along the synthesis process. Selected physico-chemical parameters have been varied in order to determine the key steps of the synthesis process and to optimize it. This study is an important step towards the full control of the fabrication process. PMID:25383305

  18. Synthesis and biological evaluation of a beauveriolide analogue library.

    PubMed

    Nagai, Kenichiro; Doi, Takayuki; Sekiguchi, Takafumi; Namatame, Ichiji; Sunazuka, Toshiaki; Tomoda, Hiroshi; Omura, Satoshi; Takahashi, Takashi

    2006-01-01

    Synthesis of beauveriolide III (1b), which is an inhibitor of lipid droplet accumulation in macrophages, was achieved by solid-phase assembly of linear depsipeptide using a 2-chlorotrityl linker followed by solution-phase cyclization. On the basis of this strategy, a combinatorial library of beauveriolide analogues was carried out by radio frequency-encoded combinatorial chemistry. After automated purification using preparative reversed-phase HPLC, the library was tested for inhibitory activity of CE synthesis in macrophages to determine structure-activity relationships of beauveriolides. Among them, we found that diphenyl derivative 7{9,1} is 10 times more potent than 1b. PMID:16398560

  19. Astrobiology Field Research in Moon/Mars Analogue Environments: Preface

    NASA Technical Reports Server (NTRS)

    Foing, B. H.; Stoker, C.; Ehrenfreund, P.

    2011-01-01

    Extreme environments on Earth often provide similar terrain conditions to landing/operation sites on Moon and Mars. Several field campaigns (EuroGeoMars2009 and DOMMEX/ILEWG EuroMoonMars from November 2009 to March 2010) were conducted at the Mars Desert Research Station (MDRS) in Utah. Some of the key astrobiology results are presented in this special issue on Astrobiology field research in Moon/Mars analogue environments relevant to investigate the link between geology, minerals, organics and biota. Preliminary results from a multidisciplinary field campaign at Rio Tinto in Spain are presented.

  20. Pena Blanca Natural Analogue Project: Summary of activities

    SciTech Connect

    Levy, S.; Goldstein, S.; Dobson, P.F.; Goodell, P.; Ku, T.-L.; Abdel-Fattah, A.; Saulnier, G.; Fayek, M.; de la Garza, R.

    2011-02-01

    The inactive Nopal I uranium mine in silicic tuff north of Chihuahua City, Chihuahua, Mexico, was studied as a natural analogue for an underground nuclear-waste repository in the unsaturated zone. Site stratigraphy was confirmed from new drill cores. Data from site studies include chemical and isotopic compositions of saturated- and unsaturated-zone waters. A partial geochronology of uranium enrichment and mineralization was established. Evidence pertinent to uranium-series transport in the soil zone and changing redox conditions was collected. The investigations contributed to preliminary, scoping-level performance assessment modeling.

  1. Stepwise analogue downscaling for hydrology (SANDHY): validation experiments over France

    NASA Astrophysics Data System (ADS)

    Radanovics, Sabine; Vidal, Jean-Philippe; Sauquet, Eric; Ben Daoud, Aurélien; Bontron, Guillaume

    2014-05-01

    Statistical downscaling aims at finding relationships between local precipitation (predictand) and large-scale predictor fields, in various contexts, from medium-term forecasting to climate change impact studies. One of the challenges of statistical downscaling in a climate change context is that the predictor-predictand relationship should still be valid under climate change conditions. A minimum requirement is therefore to test the performance of the downscaling method on independent data under current climate conditions. The downscaling method considered is the Stepwise ANalog Downscaling method for HYdrology (SANDHY). ERA-40 reanalysis data are used as large scale predictors and daily precipitation from the French near surface reanalysis (Safran) as predictand. Two 20-year periods have been selected from the common archive period of the two data sources: 1958-1978 ('early') and 1982-2002 ('late'). SANDHY has been optimised over the late period in terms of geopotential predictor domains individually for 608 target zones covering France. The validation setup consists of 4 experiments, that all use the parameters as optimised for the late period and that are compared in terms of continous ranked probability skill score (CRPSS) with climatology as reference: Reference simulation. A simulation of the late period is performed using the late period as an archive for searching the analogue dates, thus representing the best possible case. The CRPSS shows a spatial distribution similar to the one of the mean precipitation. Out-of-sample validation. The early period is simulated using the late period as an archive for searching the analogue dates. The idea is to simulate a period whose local data is not 'known' by the model as it would be the case in any application. The average skill loss compared to the reference simulation is reasonable with some more skill loss in the northern part of the country and no loss in the southeastern part. Alternative archive. The late

  2. Anisotropic metamaterial as an analogue of a black hole

    NASA Astrophysics Data System (ADS)

    Fernández-Núñez, Isabel; Bulashenko, Oleg

    2016-01-01

    Propagation of light in a metamaterial medium which mimics curved spacetime and acts like a black hole is studied. We show that for a particular type of spacetimes and wave polarization, the time dilation appears as dielectric permittivity, while the spatial curvature manifests as magnetic permeability. The optical analogue to the relativistic Hamiltonian which determines the ray paths (null geodesics) in the anisotropic metamaterial is obtained. By applying the formalism to the Schwarzschild metric, we compare the ray paths with full-wave simulations in the equivalent optical medium.

  3. Analysis of Vitamins D, Their Metabolites and Analogues

    NASA Astrophysics Data System (ADS)

    Makin, Hugh L. J.; Jones, Glenville; Kaufmann, Martin; Calverley, Martin J.

    The analysis of vitamins D and their metabolites and analogues has been reviewed by us on two occasions (Makin et al., 1995; Jones and Makin, 2000) over the last 10-15 years. In this chapter, we have drawn heavily on the 2000 review, up-dating it to take account of the developments in methodology that have occurred in the intervening years, but including elements of our 1995 review so that the reader can get a picture of the historical context as well as the modern developments.

  4. The Canadian space agency planetary analogue materials suite

    NASA Astrophysics Data System (ADS)

    Cloutis, Edward A.; Mann, Paul; Izawa, Matthew R. M.; Applin, Daniel M.; Samson, Claire; Kruzelecky, Roman; Glotch, Timothy D.; Mertzman, Stanley A.; Mertzman, Karen R.; Haltigin, Timothy W.; Fry, Christopher

    2015-12-01

    The Canadian Space Agency (CSA) recently commissioned the development of a suite of over fifty well-characterized planetary analogue materials. These materials are terrestrial rocks and minerals that are similar to those known or suspected to occur on the lunar or martian surfaces. These include: Mars analogue sedimentary, hydrothermal, igneous and low-temperature alteration rock suites; lunar analogue basaltic and anorthositic rock suites; and a generic impactite rock suite from a variety of terrestrial impact structures. Representative thin sections of the materials have been characterized by optical microscopy and electron probe microanalysis (EPMA). Reflectance spectra have been collected in the ultraviolet, visible, near-infrared and mid-infrared, covering 0.2-25 μm. Thermal infrared emission spectra were collected from 5 to 50 μm. Raman spectra with 532 nm excitation, and laser-induced fluorescence spectra with 405 nm excitation were also measured. Bulk chemical analysis was carried out using X-ray fluorescence, with Fe valence determined by wet chemistry. Chemical and mineralogical data were collected using a field-portable Terra XRD-XRF instrument similar to CheMin on the MSL Curiosity rover. Laser-induced breakdown spectroscopy (LIBS) data similar to those measured by ChemCam on MSL were collected for powdered samples, cut slab surfaces, and as depth profiles into weathered surfaces where present. Three-dimensional laser camera images of rock textures were collected for selected samples. The CSA intends to make available sample powders (<45 μm and 45-1000 μm grain sizes), thin sections, and bulk rock samples, and all analytical data collected in the initial characterisation study to the broader planetary science community. Aiming to complement existing planetary analogue rock and mineral libraries, the CSA suite represents a new resource for planetary scientists and engineers. We envision many potential applications for these materials in the

  5. The Relationship Between Water Structure and Blood Compatibility in Poly(2-methoxyethyl Acrylate) (PMEA) Analogues.

    PubMed

    Sato, Kazuhiro; Kobayashi, Shingo; Kusakari, Miho; Watahiki, Shogo; Oikawa, Masahiko; Hoshiba, Takashi; Tanaka, Masaru

    2015-09-01

    Six types of poly(2-methoxyethyl acrylate) (PMEA) analogues were synthesized and the water structure in the hydrated polymers was characterized using differential scanning calorimetry (DSC). The hydrated PMEA analogues exhibited the different amounts of intermediate water. Non-thrombogenicity evaluation was performed on PMEA analogues for platelet adhesion and protein adsorption. Platelet adhesion was suppressed on PMEA analogues. In addition, the protein adsorption and deformation were suppressed by increasing the amount of intermediate water. This study demonstrates that the amount of intermediate water might play a key role in expressing the blood compatibility of polymeric materials. PMID:26017931

  6. New metabolically stabilized analogues of lysophosphatidic acid: agonists, antagonists and enzyme inhibitors.

    PubMed

    Prestwich, G D; Xu, Y; Qian, L; Gajewiak, J; Jiang, G

    2005-12-01

    Lysophosphatidic acid (LPA) is a metabolically labile natural phospholipid with a bewildering array of physiological effects. We describe herein a variety of long-lived receptor-specific agonists and antagonists for LPA receptors. Several LPA and PA (phosphatidic acid) analogues also inhibit LPP (lipid phosphate phosphatase). The sn-1 or sn-2 hydroxy groups have been replaced by fluorine, difluoromethyl, difluoroethyl, O-methyl or O-hydroxyethoxy groups to give non-migrating LPA analogues that resist acyltransferases. Alkyl ether replacement of acyl esters produced lipase and acyltransferase-resistant analogues. Replacement of the bridging oxygen in the monophosphate by an alpha-monofluoromethylene-, alpha-bromomethylene- or alpha,alpha-difluoromethylenephosphonate gave phosphatase-resistant analogues. Phosphorothioate analogues with O-acyl and O-alkyl chains are potent, long-lived agonists for LPA1 and LPA3 receptors. Most recently, we have (i) prepared stabilized O-alkyl analogues of lysobisphosphatidic acid, (ii) explored the structure-activity relationship of stabilized cyclic LPA analogues and (iii) synthesized neutral head group trifluoromethylsulphonamide analogues of LPA. Through collaborative studies, we have collected data for these stabilized analogues as selective LPA receptor (ant)agonists, LPP inhibitors, TREK (transmembrane calcium channel) K+ channel agonists, activators of the nuclear transcription factor PPAR-gamma (peroxisome-proliferator-activated receptor-gamma), promoters of cell motility and survival, and radioprotectants for human B-cells. PMID:16246118

  7. The action of structural analogues of ethidium bromide on the mitochondrial genome of yeast.

    PubMed

    Hall, R M; Mattick, J S; Nagley, P; Cobon, G S; Eastwood, F W; Linnane, A W

    1977-12-01

    We have studied the effects on the yeast mitochondrial genome of four analogues of ethidium bromide, in which the phenyl moieyt has been replaced by linear alkyl chains of lengths varying from seven to fifteen carbon atoms. These analogues are more efficient than ethidium bromide in inducing petite mutants in Saccharomyces cervisiae. The drugs also cause a loss of mtDNA from the cells in vivo; however these analogues are in fact less effective inhibitors of mitochondrial DNA replication per se, as shown by direct in vitro studies. It is concluded that these analogues are more efficient than ethidium bromide in causing the fragmentation of mitochondrial DNA in S. cervisiae. PMID:339057

  8. Synthesis and biological evaluation of analogues of the kinase inhibitor nilotinib as Abl and Kit inhibitors

    PubMed Central

    Duveau, Damien Y.; Hu, Xin; Walsh, Martin J.; Shukla, Suneet; Skoumbourdis, Amanda P.; Boxer, Matthew B.; Ambudkar, Suresh V.; Shen, Min; Thomas, Craig J.

    2013-01-01

    The importance of the trifluoromethyl group in the polypharmacological profile of nilotinib was investigated. Molecular editing of nilotinib led to the design, synthesis and biological evaluation of analogues where the trifluoromethyl group was replaced by a proton, fluorine and a methyl group. While these analogues were less active than nilotinib toward Abl, their activity toward Kit was comparable, with the monofluorinated analogue being the most active. Docking of nilotinib and of analogues 2a–c to the binding pocket of Abl and of Kit showed that the lack of shape complementarity in Kit is compensated by the stabilizing effect from its juxtamembrane region. PMID:23273517

  9. Attenuation of Ischemic Liver Injury by Prostaglandin E1 Analogue, Misoprostol, and Prostaglandin I2 Analogue, OP-41483

    PubMed Central

    Totsuka, Eishi; Todo, Satoru; Zhu, Yue; Ishizaki, Naoki; Kawashima, Yoshiyuki; Jin, Maeng Bong; Urakami, Atsushi; Shimamura, Tsuyoshi; Starzl, Thomas E

    2010-01-01

    Background Prostaglandin has been reported to have protective effects against liver injury. Use of this agent in clinical settings, however, is limited because of drug-related side effects. This study investigated whether misoprostol, prostaglandin E1 analogue, and OP-41483, prostaglandin I2 analogue, which have fewer adverse effects with a longer half-life, attenuate ischemic liver damage. Study Design Thirty beagle dogs underwent 2 hours of hepatic vascular exclusion using venovenous bypass. Misoprostol was administered intravenously for 30 minutes before ischemia and for 3 hours after reperfusion. OP-41483 was administered intraportally for 30 minutes before ischemia (2 μg/kg/min) and for 3 hours after reperfusion (0.5 μg/kg/min). Animals were divided into five groups: untreated control group (n = 10); high-dose misoprostol (total 100 μg/kg) group (MP-H, n = 5); middle-dose misoprostol (50 μg/kg) group (MP-M, n = 5); low-dose misoprostol (25 μg/kg) group (MP-L, n = 5); and OP-41483 group (OP, n = 5). Animal survival, hepatic tissue blood flow (HTBF), liver function, and histology were analyzed. Results Two-week animal survival rates were 30% in control, 60% in MP-H, 100% in MP-M, 80% in MP-L, and 100% in OP. The treatments with prostaglandin analogues improved HTBF, and attenuated liver enzyme release, adenine nucleotrides degradation, and histologic abnormalities. In contrast to the MP-H animals that exhibited unstable cardiovascular systems, the MP-M, MP-L, and OP animals experienced only transient hypotension. Conclusions These results indicate that misoprostol and OP-41483 prevent ischemic liver damage, although careful dose adjustment of misoprostol is required to obtain the best protection with minimal side effects. PMID:9740185

  10. Capillary electrokinetic chromatography of insulin and related synthetic analogues.

    PubMed

    Ortner, K; Buchberger, W; Himmelsbach, M

    2009-04-01

    With the implementation of recombinant DNA technology in the pharmaceutical industry, some synthetic insulins have been developed in order to improve the therapy of diabetes. These analogues differ only slightly in the amino acid sequence, therefore displaying a great challenge for analytical chemistry. Within the work presented in this paper, capillary zone electrophoresis (CZE), micellar electrokinetic chromatography (MEKC) with sodium dodecylsulphate (SDS) as micelle-forming agent, and microemulsion electrokinetic chromatography (MEEKC) with microemulsions consisting of SDS, n-octane and 1-butanol were investigated for the separation of human insulin and five synthetic analogues. Best results were achieved with a solvent-modified MEKC system consisting of 100mM sodium dodecyl sulphate and 15% acetonitrile in 10mM borate buffer (pH 9.2). A similar system based on perfluorooctanoic acid as micelle-forming agent in ammonium acetate (pH 9.2) was successfully employed for the hyphenation with a quadrupole/time-of-flight mass spectrometer via a sheath-flow interface. In this case, detection limits at 10mg/L could be achieved. PMID:19027906

  11. Human cognitive performance in spaceflight and analogue environments.

    PubMed

    Strangman, Gary E; Sipes, Walter; Beven, Gary

    2014-10-01

    Maintaining intact cognitive performance is a high priority for space exploration. This review seeks to summarize the cumulative results of existing studies of cognitive performance in spaceflight and analogue environments. We focused on long-duration (>21 d) studies for which no review has previously been conducted. There were 11 published studies identified for long-duration spaceflight (N = 42 subjects) as well as 21 shorter spaceflight studies (N = 70 subjects). Overall, spaceflight cognitive studies ranged from 6-438 d in duration. Some 55 spaceflight analogue studies were also identified, ranging from 6 to 520 d. The diverse nature of experimental procedures and protocols precluded formal meta-analysis. In general, the available evidence fails to strongly support or refute the existence of specific cognitive deficits in low Earth orbit during long-duration spaceflight, which may be due in large part to small numbers of subjects. The studies consistently suggest that novel environments (spaceflight or other) induce variable alterations in cognitive performance across individuals, consistent with known astronaut experiences. This highlights the need to better quantify the magnitude and scope of this interindividual variability, and understand its underlying factors, when predicting in-flight cognitive functioning for extended periods. PMID:25245904

  12. Bandwidth based electrical-analogue battery modeling for battery modules

    NASA Astrophysics Data System (ADS)

    Li, Jianwei; Mazzola, Michael S.; Gafford, James; Jia, Bin; Xin, Ming

    2012-11-01

    A technique for building a high fidelity electrical-analogue battery model by identifying the model parameters at the module level, as opposed to the cell level, is proposed in this paper. The battery model, which is represented by electrical circuit components, can be easily integrated into popular simulation environments for system level design and predictive analysis. A novel bandwidth based time-domain procedure is introduced for identifying the model parameters by selective assignment of the limited bandwidth of the battery model approximation according to the natural bandwidth of the system that uses the battery. The aim of this paper is to provide an accurate off-line electrical-analogue battery model for simulation of larger systems containing large-format batteries, as opposed to a detailed electrochemical model suitable for simulation of internal battery processes. The proposed procedure has been experimentally verified on a 6.8 Ah Ultralife UBBL10 Li-ion battery module which is a “microcosm” for a modern large-format battery pack. A maximum 0.25% error was observed during a performance test with arbitrary but bandwidth-limited charging and discharging intervals characteristic of a typical battery application.

  13. Historical space psychology: Early terrestrial explorations as Mars analogues

    NASA Astrophysics Data System (ADS)

    Suedfeld, Peter

    2010-03-01

    The simulation and analogue environments used by psychologists to circumvent the difficulties of conducting research in space lack many of the unique characteristics of future explorations, especially the mission to Mars. This paper suggests that appropriate additional analogues would be the multi-year maritime and terrestrial explorations that mapped the surface of the Earth in previous centuries. These, like Mars, often involved a hazardous trek through unknown territory, flanked by extended, dangerous voyages to and from the exploration sites. Characteristic issues included interpersonal relationships under prolonged stress, stretches of boredom interspersed with intense work demands, the impossibility of rescue, resupply, or other help from home, chronic danger, physical discomfort and lack of privacy, and the crucial role of the leader. Illustrative examples of one important factor, leadership style, are discussed. The examination of such expeditions can help to identify the psychological stressors that are likely to be experienced by Mars explorers, and can also indicate countermeasures to reduce the damaging impact of those stressors.

  14. Novel nikkomycin analogues generated by mutasynthesis in Streptomyces ansochromogenes

    PubMed Central

    2014-01-01

    Background Nikkomycins are competitive inhibitors of chitin synthase and inhibit the growth of filamentous fungi, insects, acarids and yeasts. The gene cluster responsible for biosynthesis of nikkomycins has been cloned and the biosynthetic pathway was elucidated at the genetic, enzymatic and regulatory levels. Results Streptomyces ansochromogenes ΔsanL was constructed by homologous recombination and the mutant strain was fed with benzoic acid, 4-hydroxybenzoic acid, nicotinic acid and isonicotinic acid. Two novel nikkomycin analogues were produced when cultures were supplemented with nicotinic acid. These two compounds were identified as nikkomycin Px and Pz by electrospray ionization mass spectrometry (ESI-MS) and nuclear magnetic resonance (NMR). Bioassays against Candida albicans and Alternaria longipes showed that nikkomycin Px and Pz exhibited comparatively strong inhibitory activity as nikkomycin X and Z produced by Streptomyces ansochromogenes 7100 (wild-type strain). Moreover, nikkomycin Px and Pz were found to be more stable than nikkomycin X and Z at different pH and temperature conditions. Conclusions Two novel nikkomycin analogues (nikkomycin Px and Pz) were generated by mutasynthesis with the sanL inactivated mutant of Streptomyces ansochromogenes 7100. Although antifungal activities of these two compounds are similar to those of nikkomycin X and Z, their stabilities are much better than nikkomycin X and Z under different pHs and temperatures. PMID:24751325

  15. Martian Analogues Emissivity Spectra From the Berlin Emissivity Database (BED)

    NASA Astrophysics Data System (ADS)

    Maturilli, A.; Helbert, J.; Moroz, L.

    2006-12-01

    Remote sensing infrared spectroscopy is the principal field of investigation for planetary surfaces composition. Past, present and future missions to bodies in the solar system include in their payload instruments measuring the emerging radiation in the infrared range. For the interpretation of the measured data an emissivity spectral library of planetary analog materials is needed. The Berlin Emissivity Database (BED) currently contains emissivity spectra of plagioclase and potassium feldspars, low Ca and high Ca pyroxenes, olivine, elemental sulphur, and Martian analogue minerals, measured in the wavelength range from 7 to 22 microns as a function of particle size. For each sample we measured the spectra of four particle size separates ranging from 0 to 250 microns. The device we used is built at DLR (Berlin) and is coupled to a Fourier transform infrared spectrometer (Bruker IFS 88), purged with dry air and equipped with a cooled detector (MCT). All spectra were acquired with a spectral resolution of 4 cm-1. We present here the results of our analysis on well knew and characterized Martian analogue minerals: JSC Mars-1, Salten Skov, and Palagonite from Mauna Kea, Hawaii. We are currently working to upgrade our emissivity facility. A new spectrometer (Bruker VERTEX 80v) and new detectors will allow us to measure the emissivity of samples in the wavelength range from 1 to 50 microns, even in a vacuum environment.

  16. Synthesis of a simplified triazole analogue of pateamine A.

    PubMed

    Hemi Cumming, A; Brown, Sarah L; Tao, Xu; Cuyamendous, Claire; Field, Jessica J; Miller, John H; Harvey, Joanne E; Teesdale-Spittle, Paul H

    2016-06-14

    Pateamine A is a naturally occurring metabolite extracted from the marine sponge Mycale hentscheli. It exhibits potent cytotoxicity towards cancer cell lines and has been shown to target protein translation initiation via inhibition of the function of eukaryotic initiation factor 4A proteins. We have synthesised a simplified analogue of pateamine A, consisting of the skeletal core of the natural product but with the thiazole heterocycle replaced by a triazole. The convergent design of the synthesis features a base-induced opening of a δ-valerolactone to access the Z,E-dienoate moiety, Julia-Kocienski olefination and copper-catalysed azide-alkyne cycloaddition. Bioactivity testing of the simplified pateamine A analogue (3) indicated a significant reduction in cytotoxicity, compared to natural pateamine A. We propose that this reduced activity is due mainly to the substitution of the thiazole for the triazole heterocycle. This supports the hypothesis that the thiazole of pateamine A is important for binding to its biological target. PMID:27180995

  17. The antiviral activity of tetrazole phosphonic acids and their analogues.

    PubMed Central

    Hutchinson, D W; Naylor, M

    1985-01-01

    5-(Phosphonomethyl)-1H-tetrazole and a number of related tetrazoles have been prepared and their effects on the replication of Herpes Simplex Viruses-1 and -2 have been investigated as well as their abilities to inhibit the DNA polymerases induced by these viruses and the RNA transcriptase activity of influenza virus A. Contrary to an earlier report, 5-(phosphonomethyl)-1H-tetrazole was not an efficient inhibitor of the replication of HSV-1 and HSV-2 in tissue culture. Analogues of 5-(phosphonomethyl)-1H-tetrazole were also devoid of significant antiviral activity. Only 5-(phosphonomethyl)-1H-tetrazole and 5-(thiophosphonomethyl)-1H-tetrazole inhibited the influenza virus transcriptase, and both were more effective as inhibitors than phosphonoacetic acid under the same conditions. The DNA polymerases induced by HSV-1 and HSV-2 were inhibited slightly by 5-(phosphonomethyl)-1H-tetrazole and to a lesser extent by its N-ethyl analogue and 3-(phosphonomethyl)-1H-1,2,4-triazole. None of these compounds were as effective as phosphonoacetic acid. 5-(Thiophosphonomethyl)-1H-tetrazole was a better inhibitor of the DNA polymerase induced by HSV-1 than 5-(phosphonomethyl)-1H-tetrazole. PMID:2417198

  18. A Bosonic Analogue of a Topological Dirac Semi-Metal

    NASA Astrophysics Data System (ADS)

    Lapa, Matthew; Cho, Gil Young; Hughes, Taylor

    We construct a bosonic analogue of a two-dimensional topological Dirac Semi-Metal (DSM). The low-energy description of the most basic 2D DSM model consists of two Dirac cones at positions +/-k0 in momentum space. The local stability of the Dirac cones is guaranteed by a composite symmetry Z2, where  is time-reversal and  is inversion. This model also exhibits interesting time-reversal and inversion symmetry breaking electromagnetic responses. In this work we construct a bosonic analogue of a DSM by replacing each Dirac cone with a copy of the O (4) Nonlinear Sigma Model (NLSM) with topological theta term and theta angle θ = +/- π . One copy of this NLSM also describes the gapless surface termination of the 3D Bosonic Topological Insulator (BTI). We compute the time-reversal and inversion symmetry breaking electromagnetic responses for our model and show that they are twice the value one gets in the DSM case. We also investigate the local stability of the individual O (4) NLSM's in the BSM model. Along the way we clarify many aspects of the surface theory of the BTI including the electromagnetic response, the charges of vortex excitations, and the stability to symmetry-allowed perturbations. Nsf CAREER DMR-1351895.

  19. New experimental protocols for tensile testing of abdominal aortic analogues.

    PubMed

    Bailly, L; Deplano, V; Lemercier, A; Boiron, O; Meyer, C

    2014-06-01

    This work proposes an in vitro tensile testing protocol that is able to characterize abdominal aortic (AA) analogues under physiologically inspired mechanical loadings. Kinematic parameters are defined in agreement with in vivo measurements of aortic dynamics. A specific focus is given to the choice of the applied loading rates, deriving from the knowledge of aortic Peterson modulus and blood pressure variations from diastolic to systolic instants. The influence of physiological elongation rates has been tested on both porcine AAs and a thermoplastic polyurethane (TPU) material used to elaborate AA analogues. The diastolic and systolic elongation rates estimates vary between orders of magnitude O(10(-2)) and O(10(-1))s(-1). Negligible differences are obtained when comparing stress-elongation responses between both physiological elongation rates. In contrast, a noticeable stiffening of the TPU mechanical response is observed compared to that obtained under the common low traction rate of O(10(-3))s(-1). This work shows how relevant physiological elongation rates can be evaluated as a function of age, gender and pathological context. PMID:24613685

  20. Carbon storage at defect sites in mantle mineral analogues

    NASA Astrophysics Data System (ADS)

    Wu, Jun; Buseck, Peter R.

    2013-10-01

    A significant fraction of Earth's carbon resides in the mantle, but the mode of carbon storage presents a long-standing problem. The mantle contains fluids rich in carbon dioxide and methane, carbonate-bearing melts, carbonate minerals, graphite, diamond and carbides, as well as dissolved carbon atoms in metals. However, it is uncertain whether these can sufficiently account for the total amount of carbon thought to be stored in the mantle and the volume of carbon degassed from the mantle at volcanoes. Moreover, such carbon hosts should significantly affect the physical and chemical behaviour of the mantle, including its melting temperature, electrical conductivity and oxidation state. Here we use in situ transmission electron microscopy to measure the storage of carbon within common mantle mineral analogues--nickel-doped lanthanum chromate perovskite and titanium dioxide--in laboratory experiments at high pressure and temperature. We detect elevated carbon concentrations at defect sites in the nanocrystals, maintained at high pressures within annealed carbon nanocages. Specifically, our experiments show that small stacking faults within the mantle analogue materials are effective carbon sinks at mantle conditions, potentially providing an efficient mechanism for carbon storage in the mantle. Furthermore, this carbon can be readily released under lower pressure conditions, and may therefore help to explain carbon release in volcanic eruptions.

  1. All-dielectric metasurface analogue of electromagnetically induced transparency.

    PubMed

    Yang, Yuanmu; Kravchenko, Ivan I; Briggs, Dayrl P; Valentine, Jason

    2014-01-01

    Metasurface analogues of electromagnetically induced transparency (EIT) have been a focus of the nanophotonics field in recent years, due to their ability to produce high-quality factor (Q-factor) resonances. Such resonances are expected to be useful for applications such as low-loss slow-light devices and highly sensitive optical sensors. However, ohmic losses limit the achievable Q-factors in conventional plasmonic EIT metasurfaces to values <~10, significantly hampering device performance. Here we experimentally demonstrate a classical analogue of EIT using all-dielectric silicon-based metasurfaces. Due to extremely low absorption loss and coherent interaction of neighbouring meta-atoms, a Q-factor of 483 is observed, leading to a refractive index sensor with a figure-of-merit of 103. Furthermore, we show that the dielectric metasurfaces can be engineered to confine the optical field in either the silicon resonator or the environment, allowing one to tailor light-matter interaction at the nanoscale. PMID:25511508

  2. 1'-Homonucleosides and their structural analogues: A review.

    PubMed

    Wróblewski, Andrzej E; Głowacka, Iwona E; Piotrowska, Dorota G

    2016-08-01

    Nucleoside analogues belong to an important class of antiviral and anticancer drugs. Insertion of a methylene fragment between the anomeric carbon and pyrimidine or purine bases transforms nucleosides into 1'-homonucleosides. When compared with nucleosides this modification lengthens the separation between HO-C5' of pentofuranoside fragments and nitrogen (N1 or N9) atoms of nucleobases, lowers the steric and electronic interactions between nucleobases and sugar rings, introduces greater flexibility around a CH2-Base bond and thus allows for more rotational freedom, and since the anomeric effect no longer operates any sugar or pseudosugar moiety exists in its unique conformation and experiences specific conformational mobility and hydrolysis of the C1'-CH2Base bond by cellular enzymes is no longer feasible. This review covers 1'-homonucleosides with a tetrahydrofuran ring and its nitrogen and sulfur analogues as well as those containing a cyclopentane moiety as a sugar replacer. Achievements in syntheses of sugar or pseudosugar scaffolds are of primary interest since pathways to install nucleobases are well recognized. Whenever possible, the biological activity, mostly antiviral and antitumor but sometimes as inhibitors of specific enzymes, will be presented and discussed to help identify structural features responsible for the particular mode of action and thus possible therapeutic significance. PMID:27128178

  3. Membrane structure and interactions of a short Lycotoxin I analogue.

    PubMed

    Adão, R; Seixas, R; Gomes, P; Pessoa, J Costa; Bastos, M

    2008-04-01

    Lycotoxin I and Lycotoxin II are natural anti-microbial peptides that were identified in the venom of the Wolf Spider Lycosa carolinensis. These peptides were found to be potent growth inhibitors for bacteria (Escherichia coli) and yeast (Candida glabrata) at micromolar concentrations. Recently, shortened analogues of LycoI and LycoII have been reported to have decreased haemolytic effects. A shorter Lyco-I analogue studied, LycoI 1-15 (H-IWLTALKFLGKHAAK-NH2), was active only above 10 microM, but was also the least haemolytic. On the basis of these findings, we became interested in obtaining a deeper insight into the membrane activity of LycoI 1-15, as this peptide may represent the first major step for the future development of selective, i.e. non-haemolytic, Lycotoxin-based antibiotics. The interaction of this peptide with liposomes of different composition was studied by microcalorimetry [differential scanning calorimetry (DSC) and isothermal titration calorimetry (ITC)] and CD. The results obtained from the calorimetric and spectroscopic techniques were jointly discussed in an attempt to further understand the interaction of this peptide with model membranes. PMID:18098329

  4. A low-dimensional analogue of holographic baryons

    NASA Astrophysics Data System (ADS)

    Bolognesi, Stefano; Sutcliffe, Paul

    2014-04-01

    Baryons in holographic QCD correspond to topological solitons in the bulk. The most prominent example is the Sakai-Sugimoto model, where the bulk soliton in the five-dimensional spacetime of AdS-type can be approximated by the flat space self-dual Yang-Mills instanton with a small size. Recently, the validity of this approximation has been verified by comparison with the numerical field theory solution. However, multi-solitons and solitons with finite density are currently beyond numerical field theory computations. Various approximations have been applied to investigate these important issues and have led to proposals for finite density configurations that include dyonic salt and baryonic popcorn. Here we introduce and investigate a low-dimensional analogue of the Sakai-Sugimoto model, in which the bulk soliton can be approximated by a flat space sigma model instanton. The bulk theory is a baby Skyrme model in a three-dimensional spacetime with negative curvature. The advantage of the lower-dimensional theory is that numerical simulations of multi-solitons and finite density solutions can be performed and compared with flat space instanton approximations. In particular, analogues of dyonic salt and baryonic popcorn configurations are found and analysed.

  5. Identification of Ebsulfur Analogues with Broad-Spectrum Antifungal Activity.

    PubMed

    Ngo, Huy X; Shrestha, Sanjib K; Garneau-Tsodikova, Sylvie

    2016-07-19

    Invasive fungal infections are on the rise due to an increased population of critically ill patients as a result of HIV infections, chemotherapies, and organ transplantations. Current antifungal drugs are helpful, but are insufficient in addressing the problem of drug-resistant fungal infections. Thus, there is a growing need for novel antimycotics that are safe and effective. The ebselen scaffold has been evaluated in clinical trials and has been shown to be safe in humans. This makes ebselen an attractive scaffold for facile translation from bench to bedside. We recently reported a library of ebselen-inspired ebsulfur analogues with antibacterial properties, but their antifungal activity has not been characterized. In this study, we repurposed ebselen, ebsulfur, and 32 additional ebsulfur analogues as antifungal agents by evaluating their antifungal activity against a panel of 13 clinically relevant fungal strains. The effect of induction of reactive oxygen species (ROS) by three of these compounds was evaluated. Their hemolytic and cytotoxicity activities were also determined using mouse erythrocytes and mammalian cells. The MIC values of these compounds were found to be in the range of 0.02-12.5 μg mL(-1) against the fungal strains tested. Notably, yeast cells treated with our compounds showed an accumulation of ROS, which may further contribute to the growth-inhibitory effect against fungi. This study provides new lead compounds for the development of antimycotic agents. PMID:27334363

  6. Process standardization for rennet casein based Mozzarella cheese analogue.

    PubMed

    Shah, Rahul; Jana, Atanu H; Aparnathi, K D; Prajapati, P S

    2010-10-01

    A process for manufacture of Mozzarella cheese analogue (MCA) using rennet casein and plastic cream as protein and fat sources respectively was standardized. The formulation comprised of 25% plastic cream (72% fat), 27% rennet casein along with 3% tri-sodium citrate as emulsifying salt, 2% maltodextrin as binder, 0.55% lactic acid as pH regulator, 1% common salt for seasoning, 1% Mozzarella cheese bud as flavouring and 40.4% water. The process involved (a) dissolving the dry mixture of casein, maltodextrin, flavouring and common salt in hot emulsifying salt solution, (b) incorporation of half the quantity of acid solution in casein-maltodextrin dough, followed by addition and emulsification of plastic cream, and (c) addition of remaining half of the acid solution and heating the mass to 80 °C until a plastic cheese mass was obtained. The analogue was shaped in ball form, cooled and packaged in polyethylene bag. The MCA conformed to the PFA requirements for pizza cheese and had all the requisite baking characteristics expected of pizza cheese topping. PMID:23572688

  7. Transdermal iontophoresis of gonadotropin releasing hormone (LHRH) and two analogues.

    PubMed

    Miller, L L; Kolaskie, C J; Smith, G A; Rivier, J

    1990-06-01

    Gonadotropin releasing hormone (GnRH), as well as an antagonist [Ac-D2Nal,1 D4ClPhe,2 D3Pal,3 NicLys,5 DNicLys,6 ILys,8 DAla10] GnRH.HOAc (1) and a superagonist [DTrp6, Pro9-NHEt]GnRH (2), have been electrochemically driven across excised hairless mouse skin. Determined by HPLC analysis, the delivery rate from aqueous solution into isotonic saline at 0.5 mA cm-2 was as high as 19 nM cm-2 h-1 for 2. Because of its insolubility in water, analogue 1 could only be delivered from an acidic donor solution. Analogue 2 was also delivered in pulsatile fashion using current on/off cycles. For all three peptides, passive transport was negligible and stability is evident when in contact with the stratum corneum. Slow metabolism occurs when GnRH contacts the dermal side of hairless mouse skin. PMID:2203894

  8. Towards an ideal blood analogue for Doppler ultrasound phantoms.

    PubMed

    Oates, C P

    1991-11-01

    If a phantom is to produce Doppler spectral waveforms accurately matching those that would be obtained in vivo, it is necessary to use a fluid that behaves like blood in vivo, both acoustically and rheologically. The use of blood itself is undesirable and an analogue is required. Blood exhibits non-Newtonian behaviour as a result of aggregation of erythrocytes at low shear rates. This behaviour affects flow not only in sub-millimetre diameter vessels, but also in large scale structures. An alternative to blood is described that uses finely powdered nylon suspended in a mixture of glycerol and water. The nylon particles used have dimensions and density close to those of erythrocytes and they aggregate at low shear rates to give non-Newtonian behaviour. Viscosity may be varied over a wide range by the addition of liquid detergent. Consideration is given to the importance of haematocrit in modelling pulsatile and disturbed flows as it affects the haemodynamics of flow and the backscattered power of an ultrasound beam. This adaptable blood analogue is suitable for use in models of both large structures and fine vessels. PMID:1754614

  9. Glucocorticoid analogues: potential therapeutic alternatives for treating inflammatory muscle diseases.

    PubMed

    Reeves, Erica K M; Rayavarapu, Sree; Damsker, Jesse M; Nagaraju, Kanneboyina

    2012-03-01

    Glucocorticoids (GCs) have been prescribed to treat a variety of diseases, including inflammatory myopathies and Duchenne muscular dystrophy for over 50 years. However, their prescription remains controversial due to the significant side effects associated with the chronic treatment. It is a common belief that the clinical efficacy of GCs is due to their transrepression of pro-inflammatory genes through inhibition of inflammatory transcription factors (i.e. NF-κB, AP-1) whereas the adverse side effects are attributed to the glucocorticoid receptor (GR)-mediated transcription of target genes (transactivation). The past decade has seen an increased interest in the development of GR modulators that maintain the effective anti-inflammatory properties but lack the GR-dependent transcriptional response as a safe alternative to traditional GCs. Many of these analogues or "dissociative" compounds show potential promise in in vitro studies but fail to reach human clinical trials. In this review, we discuss molecular effects of currently prescribed GCs on skeletal muscle and also discuss the current state of development of GC analogues as alternative therapeutics for inflammatory muscle diseases. PMID:22214335

  10. Optical Dust Characterization in Manned Mars Analogue Research Stations

    NASA Technical Reports Server (NTRS)

    Bos, B. J.; Krebs, Carolyn (Technical Monitor)

    2003-01-01

    Martian dust has been identified as a potentially serious hazard to any manned Mars landing mission. NASA and other organizations realize this risk and continue to support Martian dust research through the Matador project led by researchers at the University of Arizona. The Mars Society can contribute to this work by beginning a regimen of monitoring and measuring dust properties at its Mars analogue research stations. These research facilities offer the unique opportunity to study the transport and distribution of dust particles within a crewed habitat supporting active geologic exploration. Information regarding the amount, location and size of dust particles that may accumulate in a Mars habitat will be required to design a real Mars habitat and habitat equipment. Beginning such an effort does not require a large outlay of equipment and can be accomplished using crewmembers experienced with station operations. Various optical techniques, such as dark-field illumination, coupled with image processing algorithms enable the collection of dust grain relative size and frequency information. Such approaches can be applied in several different zones within the research stations to evaluate the various dust reduction and isolation procedures implemented during a particular crew rotation. As the stations simulation fidelity increases, the applicability of such data to a functional Mars lander will increase. This presentation describes the optical equipment and procedures for measuring dust properties in Mars analogue research stations that can be implemented during the next field season.

  11. Analogue Missions on Earth, a New Approach to Prepare Future Missions on the Moon

    NASA Astrophysics Data System (ADS)

    Lebeuf, Martin

    Human exploration of the Moon is a target by 2020 with an initial lunar outpost planned in polar regions. Current architectures maintain a capability for sorties to other latitudes for science activities. In the early stages of design of lunar outpost infrastructure and science activity planning, it has been recognized that analogue missions could play a major role in Moon mission design. Analogue missions, as high fidelity simulations of human and robotic surface operations, can help field scientists and engineers develop and test strategies as well as user requirements, as they provide opportunities to groundtruth measurements, and for the team to share understanding of key science needs and key engineering trades. These types of missions also provide direct training in planning science operations, and in team building and communication. The Canadian Space Agency's Exploration Core Program targets the development of technology infrastructure elements in key areas of science, technology and robotics in preparation for its role in the future exploration of the Moon and Mars. Within this Program, Analogue Missions specifically target the operations requirements and lessons learned that will reduce costs and lower the risk of planetary surface missions. Analogue missions are simulations of planetary surface operations that take place at analogue sites on Earth. A terrestrial analogue site resembles in some key way: eg. geomorphologically or geochemically, a surface environment of another planet. An analogue mission can, therefore, be defined as an integrated set of activities that represent (or simulate) entire mission designs or narrowly focus on specific aspects of planned or potential future planetary exploration missions. Within the CSA's Exploration Core Program, Analogue Missions facilitate the maturation of science instruments and mission concepts by integrating ongoing space instrument and technology development programs with science and analogue elements. As

  12. Induction of Viral, 7-Methyl-Guanosine Cap-Independent Translation and Oncolysis by Mitogen-Activated Protein Kinase-Interacting Kinase-Mediated Effects on the Serine/Arginine-Rich Protein Kinase

    PubMed Central

    Brown, Michael C.; Bryant, Jeffrey D.; Dobrikova, Elena Y.; Shveygert, Mayya; Bradrick, Shelton S.; Chandramohan, Vidyalakshmi; Bigner, Darell D.

    2014-01-01

    ABSTRACT Protein synthesis, the most energy-consuming process in cells, responds to changing physiologic priorities, e.g., upon mitogen- or stress-induced adaptations signaled through the mitogen-activated protein kinases (MAPKs). The prevailing status of protein synthesis machinery is a viral pathogenesis factor, particularly for plus-strand RNA viruses, where immediate translation of incoming viral RNAs shapes host-virus interactions. In this study, we unraveled signaling pathways centered on the ERK1/2 and p38α MAPK-interacting kinases MNK1/2 and their role in controlling 7-methyl-guanosine (m7G) “cap”-independent translation at enterovirus type 1 internal ribosomal entry sites (IRESs). Activation of Raf-MEK-ERK1/2 signals induced viral IRES-mediated translation in a manner dependent on MNK1/2. This effect was not due to MNK's known functions as eukaryotic initiation factor (eIF) 4G binding partner or eIF4E(S209) kinase. Rather, MNK catalytic activity enabled viral IRES-mediated translation/host cell cytotoxicity through negative regulation of the Ser/Arg (SR)-rich protein kinase (SRPK). Our investigations suggest that SRPK activity is a major determinant of type 1 IRES competency, host cell cytotoxicity, and viral proliferation in infected cells. IMPORTANCE We are targeting unfettered enterovirus IRES activity in cancer with PVSRIPO, the type 1 live-attenuated poliovirus (PV) (Sabin) vaccine containing a human rhinovirus type 2 (HRV2) IRES. A phase I clinical trial of PVSRIPO with intratumoral inoculation in patients with recurrent glioblastoma (GBM) is showing early promise. Viral translation proficiency in infected GBM cells is a core requirement for the antineoplastic efficacy of PVSRIPO. Therefore, it is critically important to understand the mechanisms controlling viral cap-independent translation in infected host cells. PMID:25187541

  13. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  14. Carbocyclic nucleoside analogues: classification, target enzymes, mechanisms of action and synthesis

    NASA Astrophysics Data System (ADS)

    Matyugina, E. S.; Khandazhinskaya, A. P.; Kochetkov, Sergei N.

    2012-08-01

    Key biological targets (S-adenosyl-L-homocysteine hydrolase, telomerase, human immunodeficiency virus reverse transcriptase, herpes virus DNA polymerase and hepatitis B virus DNA polymerase) and the mechanisms of action of carbocyclic nucleoside analogues are considered. Structural types of analogues are discussed. Methods of synthesis for the most promising compounds and the spectrum of their biological activities are described. The bibliography includes 126 references.

  15. Unusual tubulin-clustering ability of specifically c7-modified colchicine analogues.

    PubMed

    Zefirova, Olga N; Lemcke, Heiko; Lantow, Margareta; Nurieva, Evgeniya V; Wobith, Birgit; Onishchenko, Galina E; Hoenen, Antje; Griffiths, Gareth; Zefirov, Nikolay S; Kuznetsov, Sergei A

    2013-08-19

    Highly cytotoxic C7-modified colchicine analogues, exemplified by tubuloclustin, promote microtubule disassembly followed by the formation of very stable tubulin clusters, both in vitro and in cells. The proposed mechanism of action of tubuloclustin and its analogues, beyond that of colchicine, includes additional specific interactions with the α-tubulin subunit. PMID:23843347

  16. Synthesis and acetylcholinesterase inhibitory activity of several pyrimidone analogues of huperzine A

    SciTech Connect

    Kozlkowski, A.P.; Campiani, G.; Saxena, A.; Doctor, S.P.

    1995-12-31

    Synthesis of four new pyrimidone analogues of the acetyicholinesterase (AChE) inhibitor huperzine A are reported together with the inhibitory potendes of these compounds for foetal bovine calf serum AChE; t3-lactone formation followed by a thermal cycloreversion reaction serves as the key step for introduction of the ethylidene appendage of analogue 12 in the stereochemically correct form.

  17. How Analogue Research Can Advance Descriptive Evaluation Theory: Understanding (and Improving) Stakeholder Dialogue

    ERIC Educational Resources Information Center

    Campbell, Bernadette; Mark, Melvin M.

    2015-01-01

    Evaluation theories can be tested in various ways. One approach, the experimental analogue study, is described and illustrated in this article. The approach is presented as a method worthy to use in the pursuit of what Alkin and others have called descriptive evaluation theory. Drawing on analogue studies conducted by the first author, we…

  18. Tetrodotoxin and its analogues in extracts from the toad Atelopus oxyrhynchus (family: Bufonidae).

    PubMed

    Yotsu-Yamashita, M; Mebs, D; Yasumoto, T

    1992-11-01

    Tetrodotoxin and its analogues, 4-epitetrodotoxin and 4,9-anhydrotetrodotoxin, were detected in the toad Atelopus oxyrhynchus by HPLC analysis. The toxin and its analogues were still present in a specimen which lived 3.5 years in captivity. PMID:1336632

  19. Making Connections in Math: Activating a Prior Knowledge Analogue Matters for Learning

    ERIC Educational Resources Information Center

    Sidney, Pooja G.; Alibali, Martha W.

    2015-01-01

    This study investigated analogical transfer of conceptual structure from a prior-knowledge domain to support learning in a new domain of mathematics: division by fractions. Before a procedural lesson on division by fractions, fifth and sixth graders practiced with a surface analogue (other operations on fractions) or a structural analogue (whole…

  20. Interleukin 6 is a cause of flu-like symptoms in treatment with a deoxycytidine analogue.

    PubMed Central

    Masuda, N.; Negoro, S.; Takeda, K.; Kurata, N.; Kuwabara, T.; Kobayashi, S.; Fukuoka, M.

    1998-01-01

    The precise mechanism of fever and flu-like syndrome that occurs in treatment with deoxycytidine analogues remains unclear. This study demonstrated a strong correlation between plasma interleukin 6 levels and fever in treatment with oral (E)-2'-deoxy-2'(fluoromethylene)cytidine, another deoxycytidine analogue. PMID:9703288

  1. Farnesyl Diphosphate Analogues with Aryl Moieties are Efficient Alternate Substrates for Protein Farnesyltransferase

    PubMed Central

    Subramanian, Thangaiah; Pais, June E.; Liu, Suxia; Troutman, Jerry M.; Suzuki, Yuta; Subramanian, Karunai Leela; Fierke, Carol; Andres, Douglas A.; Spielmann, H. Peter

    2012-01-01

    Farnesylation is an important post-translational modification essential for proper localization and function of many proteins. Transfer of the farnesyl group from farnesyl diphosphate (FPP) to proteins is catalyzed by protein farnesyltransferase (FTase). We employed a library of FPP analogues with a range of aryl groups substituting for individual isoprene moieties to examine some of the structural and electronic properties of analogue transfer to peptide catalyzed by FTase. Analysis of steady-state kinetics for modification of peptide substrates revealed that the multiple turnover activity depends on the analogue structure. Analogues where the first isoprene is replaced by a benzyl group and an analogue where each isoprene is replaced by an aryl group are good substrates. In sharp contrast with the steady-state reaction, the single turnover rate constant for dansyl-GCVLS alkylation was found to be the same for all analogues, despite the increased chemical reactivity of the benzyl analogues and the increased steric bulk of other analogues. However, the single turnover rate constant for alkylation does depend on the Ca1a2X peptide sequence. These results suggest that the isoprenoid transition state conformation is preferred over the inactive E•FPP• Ca1a2X ternary complex conformation. Furthermore, these data suggest that the farnesyl binding site in the exit groove may be significantly more selective for the farnesyl diphosphate substrate than the active site binding pocket and therefore might be a useful site for design of novel inhibitors. PMID:22989235

  2. Properties of granular analogue model materials: A community wide survey

    NASA Astrophysics Data System (ADS)

    Klinkmüller, Matthias; Schreurs, Guido; Rosenau, Matthias; Kemnitz, Helga

    2016-04-01

    We report the material properties of 26 granular analogue materials used in 14 analogue modelling laboratories. We determined physical characteristics such as bulk density, grain size distribution, and grain shape, and performed ring shear tests to determine friction angles and cohesion, and uniaxial compression tests to evaluate the compaction behaviour. Mean grain size of the materials varied between (c. 100 and 400 micrometer). Analysis of grain shape factors show that the four different classes of granular materials (14 quartz sands, 5 dyed quartz sands, 4 heavy mineral sands and 3 size fractions of glass beads) can be broadly divided into two groups consisting of 12 angular and 14 rounded materials. Grain shape has an influence on friction angles, with most angular materials having higher internal friction angles (between c. 35° and 40°) than rounded materials, whereas well-rounded glass beads have the lowest internal friction angles (between c. 25° and 30°). We interpret this as an effect of intergranular sliding versus rolling . Most angular materials have also higher basal friction angles (tested for a specific foil) than more rounded materials, suggesting that angular grains scratch and wear the foil., Most materials have a cohesion in the order of 10-100 Pa except for well-rounded glass beads, which show a trend towards a quasi-cohesionless (C <10 Pa) Coulomb-type material. The uniaxial confined compression tests reveal that rounded grains generally show less compaction than angular grains. We interpret this to be related to the initial packing density reached during sieving which is higher for rounded grains than for angular grains. Ring-shear test data show that angular grains undergo a longer strain-hardening phase than more rounded materials. This might explain why analogue models consisting of angular grains accommodate deformation in a more distributed manner prior to strain localisation than models consisting of rounded grains. Also, models

  3. Charged analogues of Schwarzschild interior solution in terms of pressure

    NASA Astrophysics Data System (ADS)

    Bijalwan, Naveen

    2011-12-01

    Recently, Bijalwan (Astrophys. Space Sci., doi:10.1007/s10509-011-0691-0, 2011a) discussed charged fluid spheres with pressure while Bijalwan and Gupta (Astrophys. Space Sci. 317, 251-260, 2008) suggested using a monotonically decreasing function f to generate all possible physically viable charged analogues of Schwarzschild interior solutions analytically. They discussed some previously known and new solutions for Schwarzschild parameter u( =GM/c^{2a} ) le 0.142, a being radius of star. In this paper we investigate wide range of u by generating a class of solutions that are well behaved and suitable for modeling Neutron star charge matter. We have exploited the range u≤0.142 by considering pressure p= p( ω) and f = ( f0(1 - R2(1 - ω )/a2) +faR2(1 - ω )/a2 ), where ω = 1 -r2/R2 to explore new class of solutions. Hence, class of charged analogues of Schwarzschild interior is found for barotropic equation of state relating the radial pressure to the energy density. The analytical models thus found are well behaved with surface red shift z s ≤0.181, central red shift z c ≤0.282, mass to radius ratio M/ a≤0.149, total charge to total mass ratio e/ M≤0.807 and satisfy Andreasson's (Commun. Math. Phys. 288, 715-730, 2009) stability condition. Red-shift, velocity of sound and p/ c 2 ρ are monotonically decreasing towards the surface while adiabatic index is monotonically increasing. The maximum mass found to be 1.512 M Θ with linear dimension 14.964 km. Class of charged analogues of Schwarzschild interior discussed in this paper doesn't have neutral counter part. These solutions completely describe interior of a stable Neutron star charge matter since at centre the charge distribution is zero, e/ M≤0.807 and a typical neutral Neutron star has mass between 1.35 and about 2.1 solar mass, with a corresponding radius of about 12 km (Kiziltan et al., arXiv:1011.4291 [astro-ph.GA], 2010).

  4. Spectral Characterization of Phobos Analogues Under Simulated Environmental Conditions

    NASA Astrophysics Data System (ADS)

    Donaldson Hanna, K. L.; Bowles, N. E.; Edwards, C. S.; Glotch, T. D.; Greenhagen, B. T.; Pieters, C. M.; Thomas, I.

    2014-12-01

    The surface of Phobos holds many keys for understanding its formation and evolution as well as the history and dynamics of the Mars-Phobos system. Visible to near infrared (VNIR) observations suggests that Phobos' surface is compositionally heterogeneous with 'redder' and 'bluer' units that both appear to be anhydrous in nature. Lunar highland spectra have been identified as spectral analogues for the 'redder' and 'bluer' units while thermally metamorphosed CI/CM chondrites, lab-heated carbonaceous chondrites and highly space weathered mafic mineral assemblages have been identified as the best analogues for the 'bluer' surface units. Additionally, thermal infrared emissivity spectra indicate that if Phobos' surface is optically mature it may be rich in feldspar, which is consistent with VNIR observations of Phobos' surface being spectrally similar to lunar highland spectra. While remote observations provide key insights into the composition and evolution of planetary surfaces, a fundamentally important component to any remote compositional analysis of planetary surfaces is laboratory measurements of well-characterized samples measured under the appropriate environmental conditions. The vacuum environment of airless bodies creates a steep thermal gradient in the upper hundreds of microns of regolith. Lab studies of particulate rocks and minerals as well as selected lunar soils under vacuum and lunar-like conditions have identified significant effects of this thermal gradient on thermal infrared (TIR) spectral measurements. However recent lab measurements of carbonaceous chondrites demonstrated that simulated asteroid conditions do not affect the resulting emissivity spectra to the degree observed in lunar soils and is highly dependent on composition. Such lab studies demonstrate the high sensitivity of TIR emissivity spectra to environmental conditions under which they are measured and indicate that the near surface environment of all airless bodies do not

  5. Isoelectronic analogues of PN: Remarkably stable multiply charged cations

    SciTech Connect

    Wong, Ming Wah; Radom, L. )

    1990-01-25

    The structures and stabilities of PN and its 27 isoelectronic analogues, CS, SiO, BCl, AlF, BeAr, MgNe, Sn{sup +}, PO{sup +}, CCl{sup +}, SiF{sup +}, BAr{sup +}, AlNe{sup +}, SO{sup 2+}, NCl{sup 2+}, PF{sup 2+}, CAr{sup 2+}, SiNe{sup 2+}, OCl{sup 3+}, SF{sup 3+}, NAr{sup 3+}, PNe{sup 3+}, FCl{sup 4+}, OAr{sup 4+}, SNe{sup 4+}, FAr{sup 5+}, ClNe{sup 5+}, and ArNe{sup 6+}, have been examined by ab initio molecular orbital theory. The CASSCF/6-311G(MC)(d) level was used to determine the ground-state potential energy curves and spectroscopic constants for the 28 diatomic systems. Equilibrium structures were also obtained with the 6-311G(MC)(d) basis set at the MP3 and ST4CCD levels, and dissociation energies were determined at the MP4/6-311 + G(MC)(2df) and MP4/6-311 + G(MC)(3d2f) levels. For the neutral and monocation analogues of PN, the calculated equilibrium geometries (at MP3/6-311G(MC)(d)) and dissociation energies (at MP4/6-311 + G(MC)(3d2f)) are in very good agreement with available experimental values. All the dication analogues of PN, namely, SO{sup 2+}, NCl{sup 2+}, PF{sup 2+}, CAr{sup 2+}, and SiNe{sup 2+}, are predicted to be experimentally observable species. Of these, the SO{sup 2+}, NCl{sup 2+}, and CAr{sup 2+} dications are calculated to be kinetically stable species, with large barriers associated with the exothermic charge-separation reactions, while the PF{sup 2+} and SiNe{sup 2+} dications are predicted not only to be kinetically stable but also to be thermodynamically stable species.

  6. The Ketamine Analogue Methoxetamine and 3- and 4-Methoxy Analogues of Phencyclidine Are High Affinity and Selective Ligands for the Glutamate NMDA Receptor

    PubMed Central

    Roth, Bryan L.; Gibbons, Simon; Arunotayanun, Warunya; Huang, Xi-Ping; Setola, Vincent; Treble, Ric; Iversen, Les

    2013-01-01

    In this paper we determined the pharmacological profiles of novel ketamine and phencyclidine analogues currently used as ‘designer drugs’ and compared them to the parent substances via the resources of the National Institute of Mental Health Psychoactive Drug Screening Program. The ketamine analogues methoxetamine ((RS)-2-(ethylamino)-2-(3-methoxyphenyl)cyclohexanone) and 3-MeO-PCE (N-ethyl-1-(3-methoxyphenyl)cyclohexanamine) and the 3- and 4-methoxy analogues of phencyclidine, (1-[1-(3-methoxyphenyl)cyclohexyl]piperidine and 1-[1-(4-methoxyphenyl)cyclohexyl]piperidine), were all high affinity ligands for the PCP-site on the glutamate NMDA receptor. In addition methoxetamine and PCP and its analogues displayed appreciable affinities for the serotonin transporter, whilst the PCP analogues exhibited high affinities for sigma receptors. Antagonism of the NMDA receptor is thought to be the key pharmacological feature underlying the actions of dissociative anaesthetics. The novel ketamine and PCP analogues had significant affinities for the NMDA receptor in radioligand binding assays, which may explain their psychotomimetic effects in human users. Additional actions on other targets could be important for delineating side-effects. PMID:23527166

  7. Memory amplification for trauma: Investigating the role of analogue PTSD symptoms in the laboratory.

    PubMed

    Oulton, Jacinta M; Takarangi, Melanie K T; Strange, Deryn

    2016-08-01

    Victims of trauma often remember their experience as being more traumatic later, compared to immediately after, the event took place. This finding-the "memory amplification effect"-is associated with increased re-experiencing symptoms. However, the effect has been found almost exclusively in field-based studies. We examined whether the effect could be replicated in the laboratory. In two studies, we exposed participants to negative photographs and assessed their memory for the photographs and analogue PTSD symptoms on two occasions. In Study 1, analogue symptoms at follow-up were positively associated with remembering more negative photos over time. In Study 2, we focused on "memory amplifiers": people whose memory of the photos amplified over time. Consistent with field research, analogue re-experiencing symptoms were associated with memory amplification. Overall, our findings confirm that analogue PTSD symptoms are also associated with an amplified memory for a trauma analogue. PMID:27328014

  8. Biodegradation of bisphenol A and its halogenated analogues by Cunninghamella elegans ATCC36112.

    PubMed

    Keum, Young Soo; Lee, Hye Ri; Park, Hee Won; Kim, Jeong-Han

    2010-11-01

    Bisphenol A and its halogenated analogues are commonly used industrial chemicals with strong toxicological effects over many organisms. In this study, metabolic fate of bisphenol A and its halogenated analogues were evaluated with Cunninghamella elegans ATCC36112. Bisphenol A and related analogues were rapidly transformed into several metabolites by C. elegans within 2-4 days. Detailed analysis of metabolites reveals that both phase I and II metabolism occurred in C. elegans. Cytochrome P450-dependent hydroxylation was observed in BPA. However, major reaction with bisphenol A and analogues with 1-2 halogen atoms were the formation of glucose-conjugate, not being inhibited by cytochrome P450 inhibitor. Overall metabolic rates decreased with increasing number of substitution at 2- and 6-position of BPA structures, which may be consequences of limited bioavailability or steric hindrance to conjugate-forming reaction. Information from the current study will provide detailed insights over the fungal metabolism of BPA and analogues. PMID:20455075

  9. A computational study of open-chain epothilone analogue

    NASA Astrophysics Data System (ADS)

    Kamel, Karol; Rusinska-Roszak, Danuta

    Molecular mechanics (MM/Ambers) calculations were applied to probe the conformational profile of open-chain epothilone analogue [Org Lett 2006, 8, 685], cytotoxic against some cell lines. Geometries of the most stable conformers were optimized at DFT level using the B3LYP functional and then compared to known both experimental and virtual conformers of epothilone. One of the most stable structures is III (1.47 kcal/mol above global minimum) which represents high similarity to the appropriate fragment of the Taylor's model of epothilone A, but two other conformers: XIV and XX, although they have almost the same conformation as the mother structure, are very unstable (6.7 and 12.4 kcal/mol above the global minimum).0

  10. Micromechanics of compaction in an analogue reservoir sandstone

    SciTech Connect

    DIGIOVANNI,ANTHONY A.; FREDRICH,JOANNE T.; HOLCOMB,DAVID J.; OLSSON,WILLIAM A.

    2000-02-28

    Energy production, deformation, and fluid transport in reservoirs are linked closely. Recent field, laboratory, and theoretical studies suggest that, under certain stress conditions, compaction of porous rocks may be accommodated by narrow zones of localized compressive deformation oriented perpendicular to the maximum compressive stress. Triaxial compression experiments were performed on Castlegate, an analogue reservoir sandstone, that included acoustic emission detection and location. Initially, acoustic emissions were focused in horizontal bands that initiated at the sample ends (perpendicular to the maximum compressive stress), but with continued loading progressed axially towards the center. This paper describes microscopy studies that were performed to elucidate the micromechanics of compaction during the experiments. The microscopy revealed that compaction of this weakly-cemented sandstone proceeded in two phases: an initial stage of porosity decrease accomplished by breakage of grain contacts and grain rotation, and a second stage of further reduction accommodated by intense grain breakage and rotation.

  11. Encoding complexity within supramolecular analogues of frustrated magnets.

    PubMed

    Cairns, Andrew B; Cliffe, Matthew J; Paddison, Joseph A M; Daisenberger, Dominik; Tucker, Matthew G; Coudert, François-Xavier; Goodwin, Andrew L

    2016-05-01

    The solid phases of gold(I) and/or silver(I) cyanides are supramolecular assemblies of inorganic polymer chains in which the key structural degrees of freedom-namely, the relative vertical shifts of neighbouring chains-are mathematically equivalent to the phase angles of rotating planar ('XY') spins. Here, we show how the supramolecular interactions between chains can be tuned to mimic different magnetic interactions. In this way, the structures of gold(I) and/or silver(I) cyanides reflect the phase behaviour of triangular XY magnets. Complex magnetic states predicted for this family of magnets-including collective spin-vortices of relevance to data storage applications-are realized in the structural chemistry of these cyanide polymers. Our results demonstrate how chemically simple inorganic materials can behave as structural analogues of otherwise inaccessible 'toy' spin models and also how the theoretical understanding of those models allows control over collective ('emergent') phenomena in supramolecular systems. PMID:27102677

  12. Analogue of cosmological particle creation in an ion trap.

    PubMed

    Schützhold, Ralf; Uhlmann, Michael; Petersen, Lutz; Schmitz, Hector; Friedenauer, Axel; Schätz, Tobias

    2007-11-16

    We study phonons in a dynamical chain of ions confined by a trap with a time-dependent (axial) potential strength and demonstrate that they behave in the same way as quantum fields in an expanding or contracting Universe. Based on this analogy, we present a scheme for the detection of the analogue of cosmological particle creation which should be feasible with present day technology. In order to test the quantum nature of the particle creation mechanism and to distinguish it from classical effects such as heating, we propose to measure the two-phonon amplitude via the 2nd red sideband transition and to compare it with the one-phonon amplitude (1st red sideband). PMID:18233131

  13. Analogue of Cosmological Particle Creation in an Ion Trap

    SciTech Connect

    Schuetzhold, Ralf; Uhlmann, Michael; Petersen, Lutz; Schmitz, Hector; Friedenauer, Axel; Schaetz, Tobias

    2007-11-16

    We study phonons in a dynamical chain of ions confined by a trap with a time-dependent (axial) potential strength and demonstrate that they behave in the same way as quantum fields in an expanding or contracting Universe. Based on this analogy, we present a scheme for the detection of the analogue of cosmological particle creation which should be feasible with present day technology. In order to test the quantum nature of the particle creation mechanism and to distinguish it from classical effects such as heating, we propose to measure the two-phonon amplitude via the 2nd red sideband transition and to compare it with the one-phonon amplitude (1st red sideband)

  14. High-pressure neutron scattering of Prussian blue analogue magnets

    NASA Astrophysics Data System (ADS)

    Pajerowski, Daniel

    Pressure sensitive magnetism is known to be useful in sensors, and while applications tend to use metallic alloys, molecule based magnets (MBMs) have been shown to have large inverse magnetostrictive (IMS) response. A promising group of MBMs are the Prussian blue analogues (PBAs), in which magnetic ordering can be tuned by external stimuli such as light, electric field, and pressure. Previously, high pressure neutron scattering of nickel hexacyanochromate hydrate has shown direct evidence for isomerization of the cyanide linkage with applied pressure. Other probes have suggested a similar effect in iron hexacyanochromate hydrate, although there has yet to be direct crystallographic evidence. Neutron diffraction is sensitive to organic elements, even while in the presence of metals, and we have performed experiments above 1 GPa to look for linkage isomerism in iron hexacyanochromate. These results are supported by bulk probes and calculations.

  15. Integration of inherent and induced chirality into subphthalocyanine analogue

    PubMed Central

    Zhao, Luyang; Qi, Dongdong; Wang, Kang; Wang, Tianyu; Han, Bing; Tang, Zhiyong; Jiang, Jianzhuang

    2016-01-01

    Conventional conjugated systems are characteristic of only either inherent or induced chirality because of synthetic challenge in combination of chiral segment into the main chromophore. In this work, chiral binaphthyl segment is directly fused into the central chromophore of a subphthalocyanine skeleton, resulting in a novel type of chiral subphthalocyanine analogue (R/S)-1 of integrated inherent and induced chirality. Impressively, an obviously enhanced optical activity is discerned for (R/S)-1 molecules, and corresponding enhancement mechanism is elucidated in detail. The synthesis strategy based on rational molecular design will open the door towards fabrication of chiral materials with giant optical activity, which will have great potential in chiroptical devices. PMID:27294871

  16. [The Biological Activity of the Sevanol and Its Analogues].

    PubMed

    Osmakov, D I; Koshelev, S G; Belozerova, O A; Kublitski, V S; Andreev, Ya A; Grishin, E V; Kozlov, S A

    2015-01-01

    Previously, from the plant Thymus armeniacus a new lignan sevanol was isolated, it's structure was elucidated and was shown that it effectively inhibits the acid-sensing channel ASIC3 and also exhibits a pronounced analgesic and anti-inflammatory effect. In this work biological activity of the sevanol analog obtained by chemical synthesis from simple precursors, the stereoisomer of sevanol and a precursor molecule represents a half of sevanol was measured in electrophysiological experiments on human ASIC3 channels expressed in Xenopus laevis oocytes. Measured inhibitory activity of a synthetic analogue coincided with the activity ofthe natural molecule. Stereoisomer showed inhibitory activity drop by about a third part, and the precursor molecule showed much less significant activity. In result the significance of functional groups and a spatial configuration of sevanol in order to biological activity was shown that is important to take into account for the optimal synthesis design as well as for new drugs development on its base. PMID:26762099

  17. [Antioxidant properties of 3-oxypyridine analogues: mexidol, emoxipin, proxipin].

    PubMed

    Klebanov, G I; Liubitskiĭ, O B; Vasil'eva, O V; Klimov, Iu V; Penzulaeva, O B; Tepliashin, A S; Tolstykh, M P; Promorenko, V K; Vladimirov, Iu A

    2001-01-01

    Using three chemiluminescent model systems of oxidation (suspension of phospholipid liposomes, a geous solution of haemoglobin-hydrogen peroxide-luminol and a geous solution 2,2'-azo-bis-(2-methylpropionamidine)dihydrochloride-luminol) the antioxidant activity and mechanism of antioxidant action of three 3-oxypyridine analogues: (mexidol, emoxipin and proxipin) were studied. These compounds were shown: a) to interact with catalitically active two valency iron ions (Fe2+), that causes elimination of ions from the model system; b) to scavenge reactive oxygen species and/or luminol radicals produced in the model systems. Their activity reduced in the following order: mexidol > emoxipin > proxipin. The antioxidant activity of 3-oxypyridines may underline known clinical effects of these compounds. PMID:11558311

  18. Characterizing the magnetic fields of the first τ Sco analogues

    NASA Astrophysics Data System (ADS)

    Petit, V.; Kochukhov, O.; Massa, D. L.; Marcolino, W. L. F.; Wade, G. A.; Ignace, R.

    2012-05-01

    The B0.2 V magnetic star τ Sco stands out from the larger population of massive OB stars due to its high X-ray activity, peculiar wind diagnostics and complex magnetic field. Recently, Petit et al. [1] presented the discovery of the first two τ Sco analogues - HD66665 and HD63425, identified by the striking similarity of their UV spectra to that of τ Sco. ESPaDOnS and Narval spectropolarimetric observations were obtained by the Magnetism in Massive Stars CFHT and TBL Large Programs, in order to characterize the stellar and magnetic properties of these stars. A magnetic field of similar surface strength was found on both stars, reinforcing the connection between the presence of a magnetic field and wind peculiarities. We present additional phaseresolved observations secured by the MiMeS collaboration for HD66665 in order to measure its magnetic geometry, and correlate that geometry with diagnostics of mass-loss.

  19. Two-dimensional inorganic analogues of graphene: transition metal dichalcogenides.

    PubMed

    Jana, Manoj K; Rao, C N R

    2016-09-13

    The discovery of graphene marks a major event in the physics and chemistry of materials. The amazing properties of this two-dimensional (2D) material have prompted research on other 2D layered materials, of which layered transition metal dichalcogenides (TMDCs) are important members. Single-layer and few-layer TMDCs have been synthesized and characterized. They possess a wide range of properties many of which have not been known hitherto. A typical example of such materials is MoS2 In this article, we briefly present various aspects of layered analogues of graphene as exemplified by TMDCs. The discussion includes not only synthesis and characterization, but also various properties and phenomena exhibited by the TMDCs.This article is part of the themed issue 'Fullerenes: past, present and future, celebrating the 30th anniversary of Buckminster Fullerene'. PMID:27501969

  20. Inhibition of plant and mammalian diamine oxidase by substrate analogues.

    PubMed

    Biegański, T; Osińska, Z; Masliński, C

    1982-04-01

    Imidazoles, aliphatic substrate analogues and the natural dipeptides, carnosine and anserine, were investigated as inhibitors of diamine oxidase from the pig kidney, human pregnancy plasma and pea seedlings. Imidazole, methylimidazoles, N-acetylimidazole, histamine and N tau-methylhistamine are relatively potent inhibitors of mammalian diamine oxidase showing no influence on plant enzymes. Anserine and carnosine are inhibitors of pig kidney and pea seedling enzymes. Ki values are 2 microM and 10 microM respectively. Investigated natural derivatives of putrescine and cadaverine have no influence on diamine oxidase of different origin. In conclusion, we present some evidence to suggest that mammalian diamine oxidase, despite a high reaction rate with putrescine, is better adapted to histamine oxidation, whereas for plant enzymes the diamines are preferred substrates. PMID:6805264

  1. Remarks on a gravitational analogue of the Casimir effect

    NASA Astrophysics Data System (ADS)

    Bezerra, V. B.; Mota, H. F.; Muniz, C. R.

    2016-06-01

    We consider the Casimir effect, by calculating the Casimir energy and its corrections for nonzero temperatures, of a massless scalar field in the spacetime with topology S3 × R1 (Einstein universe) containing an idealized cosmic string. The obtained results confirm the role played by the identifications imposed on the quantum field by boundary conditions arising from the topology of the gravitational field under consideration and illustrate a realization of a gravitational analogue of the Casimir effect. In this backgorund, we show that the vacuum energy can be written as a term which corresponds to the vacuum energy of the massless scalar field in the Einstein universe added by another term that formally corresponds to the vacuum energy of the electromagnetic field in the Einstein universe, multiplied by a parameter associated with the presence of the cosmic string, namely, λ = (1/α) ‑ 1, where α is a constant related to the cosmic string tension, Gμ.

  2. Hexaethylsubporphyrins: β-alkyl analogues in the subporphyrin family.

    PubMed

    Chandra, Brijesh; Kumar, B Sathish; Mondal, Navendu; Samanta, Anunay; Panda, Pradeepta K

    2015-12-14

    Two new subporphyrins were synthesized for the first time from a β-substituted pyrrole i.e. 3,4-diethylpyrrole via pyridine-tri-N-(3,4-diethylpyrrolyl)borane as building blocks. These β-hexaethylsubporphyrins are true contracted congeners of β-octaethylporphyrin (OEP). While the meso-triphenyl derivative of hexaethylsubporphyrin could be synthesized by following the reported method, the meso-free analogue could only be synthesized by condensation with trioxane, in the presence of catalytic methanesulfonic acid. These contracted macrocycles display interesting absorption, and emission behaviour including substituent dependent S2 fluorescence owing to the presence of flexible electron donating ethyl groups at their β-positions. The optical response and ultrafast S2 state dynamics of these systems suggest that it may be possible to tune the properties of the subporphyrin to develop efficient systems for solar energy capture and conversion processes. PMID:26524153

  3. Screening of bromotyramine analogues as antifouling compounds against marine bacteria.

    PubMed

    Andjouh, Sofyane; Blache, Yves

    2016-09-01

    Rapid and efficient synthesis of 23 analogues inspired by bromotyramine derivatives, marine natural products, by means of CuSO4-catalysed [3+2] alkyne-azide cycloaddition is described. The final target was then assayed for anti-biofilm activity against three Gram-negative marine bacteria, Pseudoalteromonas ulvae (TC14), Pseudoalteromonas lipolytica (TC8) and Paracoccus sp. (4M6). Most of the synthesised bromotyramine/triazole derivatives are more active than the parent natural products Moloka'iamine (A) and 3,5-dibromo-4-methoxy-β-phenethylamine (B) against biofilm formation by the three bacterial strains. Some of these compounds were shown to act as non-toxic inhibitors of biofilm development with EC50 < 200 μM without any effect on bacterial growth even at high concentrations (200 μM). PMID:27450150

  4. Quasinormal modes and classical wave propagation in analogue black holes

    SciTech Connect

    Berti, Emanuele; Cardoso, Vitor; Lemos, Jose P.S.

    2004-12-15

    Many properties of black holes can be studied using acoustic analogues in the laboratory through the propagation of sound waves. We investigate in detail sound wave propagation in a rotating acoustic (2+1)-dimensional black hole, which corresponds to the 'draining bathtub' fluid flow. We compute the quasinormal mode frequencies of this system and discuss late-time power-law tails. Because of the presence of an ergoregion, waves in a rotating acoustic black hole can be superradiantly amplified. We also compute superradiant reflection coefficients and instability time scales for the acoustic black hole bomb, the equivalent of the Press-Teukolsky black hole bomb. Finally we discuss quasinormal modes and late-time tails in a nonrotating canonical acoustic black hole, corresponding to an incompressible, spherically symmetric (3+1)-dimensional fluid flow.

  5. Measurement of stimulated Hawking emission in an analogue system.

    PubMed

    Weinfurtner, Silke; Tedford, Edmund W; Penrice, Matthew C J; Unruh, William G; Lawrence, Gregory A

    2011-01-14

    Hawking argued that black holes emit thermal radiation via a quantum spontaneous emission. To address this issue experimentally, we utilize the analogy between the propagation of fields around black holes and surface waves on moving water. By placing a streamlined obstacle into an open channel flow we create a region of high velocity over the obstacle that can include surface wave horizons. Long waves propagating upstream towards this region are blocked and converted into short (deep-water) waves. This is the analogue of the stimulated emission by a white hole (the time inverse of a black hole), and our measurements of the amplitudes of the converted waves demonstrate the thermal nature of the conversion process for this system. Given the close relationship between stimulated and spontaneous emission, our findings attest to the generality of the Hawking process. PMID:21405217

  6. Synthesis of Dihydropyridine Analogues for Sperm Immobilizing Activity

    NASA Astrophysics Data System (ADS)

    Sadeghipour Roodsari, H. R.; Amini, M.; Naghibi Harat, Z.; Daneshgar, P.; Vosooghi, M.; Shafiee, A.

    In the present study, the activity of seven newly synthesized dihydropyridine analogues on the motility of sperm were determined and compared to nifedipine activity that was used as standard. Sperm motility reduced value for test compounds 6a-g shows a gradual increase proportional to the size elongation of alkyl ester groups. Consequently the size of alkyl is important in the activity of test compounds and finally increase in the lipophil size of hydrocarbon`s ester (R1) is inversely related to the activity of the synthetic compounds. As a result, the methyl ester of the test compounds with 50% of nifedipine activity (in two hours group) is the most active test compound.

  7. Novel C-Ring-Hydroxy-Substituted Controlled Deactivation Cannabinergic Analogues.

    PubMed

    Kulkarni, Shashank; Nikas, Spyros P; Sharma, Rishi; Jiang, Shan; Paronis, Carol A; Leonard, Michael Z; Zhang, Bin; Honrao, Chandrashekhar; Mallipeddi, Srikrishnan; Raghav, Jimit Girish; Benchama, Othman; Järbe, Torbjörn U C; Bergman, Jack; Makriyannis, Alexandros

    2016-07-28

    In pursuit of safer controlled-deactivation cannabinoids with high potency and short duration of action, we report the design, synthesis, and pharmacological evaluation of novel C9- and C11-hydroxy-substituted hexahydrocannabinol (HHC) and tetrahydrocannabinol (THC) analogues in which a seven atom long side chain, with or without 1'-substituents, carries a metabolically labile 2',3'-ester group. Importantly, in vivo studies validated our controlled deactivation approach in rodents and non-human primates. The lead molecule identified here, namely, butyl-2-[(6aR,9R,10aR)-1-hydroxy-9-(hydroxymethyl)-6,6-dimethyl-6a,7,8,9,10,10a-hexahydro-6H-benzo[c]chromen-3-yl]-2-methylpropanoate (AM7499), was found to exhibit remarkably high in vitro and in vivo potency with shorter duration of action than the currently existing classical cannabinoid agonists. PMID:27367336

  8. Integration of inherent and induced chirality into subphthalocyanine analogue.

    PubMed

    Zhao, Luyang; Qi, Dongdong; Wang, Kang; Wang, Tianyu; Han, Bing; Tang, Zhiyong; Jiang, Jianzhuang

    2016-01-01

    Conventional conjugated systems are characteristic of only either inherent or induced chirality because of synthetic challenge in combination of chiral segment into the main chromophore. In this work, chiral binaphthyl segment is directly fused into the central chromophore of a subphthalocyanine skeleton, resulting in a novel type of chiral subphthalocyanine analogue (R/S)-1 of integrated inherent and induced chirality. Impressively, an obviously enhanced optical activity is discerned for (R/S)-1 molecules, and corresponding enhancement mechanism is elucidated in detail. The synthesis strategy based on rational molecular design will open the door towards fabrication of chiral materials with giant optical activity, which will have great potential in chiroptical devices. PMID:27294871

  9. Laval nozzle as an acoustic analogue of a massive field

    NASA Astrophysics Data System (ADS)

    Cuyubamba, M. A.

    2013-10-01

    We study a gas flow in the Laval nozzle, which is a convergent-divergent tube that has a sonic point in its throat. We show how to obtain the appropriate form of the tube, so that the acoustic perturbations of the gas flow in it satisfy any given wave-like equation. With the help of the proposed method we find the Laval nozzle, which is an acoustic analogue of the massive scalar field in the background of the Schwarzschild black hole. This gives us a possibility to observe in a laboratory the quasinormal ringing of the massive scalar field, which, for special set of the parameters, can have infinitely long-living oscillations in its spectrum.

  10. Synthesis, Receptor Binding, and CNS Pharmacological Studies of New Thyrotropin-Releasing Hormone (TRH) Analogues

    PubMed Central

    Monga, Vikramdeep; Meena, Chhuttan L.; Rajput, Satyendra; Pawar, Chandrashekhar; Sharma, Shyam S.; Lu, Xinping; Gershengorn, Marvin C.

    2012-01-01

    As part of our search for selective and CNS-active thyrotropin-releasing hormone (TRH) analogues, we synthesized a set of 44 new analogues in which His and pGlu residues were modified or replaced. The analogues were evaluated as agonists at TRH-R1 and TRH-R2 in cells in vitro, and in vivo in mice for analeptic and anticonvulsant activities. Several analogues bound to TRH-R1 and TRH-R2 with good to moderate affinities, and are full agonists at both receptor subtypes. Specifically, analogue 21 a (R = CH3) exhibited binding affinities (Ki values) of 0.17 μM for TRH-R1 and 0.016 μM for TRH-R2; it is 10-fold less potent than TRH in binding to TRH-R1 and equipotent with TRH in binding to TRH-R2. Compound 21 a, the most selective agonist, activated TRH-R2 with a potency (EC50 value) of 0.0021 μM, but activated TRH-R1 at EC50 = 0.05 μM, and exhibited 24-fold selectivity for TRH-R2 over TRH-R1. The newly synthesized TRH analogues were also evaluated in vivo to assess their potencies in antagonism of barbiturate-induced sleeping time, and several analogues displayed potent analeptic activity. Specifically, analogues 21 a,b and 22 a,b decreased sleeping time by nearly 50 % more than TRH. These analogues also displayed potent anticonvulsant activity and provided significant protection against PTZ-induced seizures, but failed to provide any protection in MES-induced seizures at 10 μmol kg−1. The results of this study provide evidence that TRH analogues that show selectivity for TRH-R2 over TRH-R1 possess potent CNS activity. PMID:21302359

  11. Reversible lipidization of somatostatin analogues for the liver targeting.

    PubMed

    Yuan, Liyun; Wang, Jeff; Shen, Wei-Chiang

    2008-10-01

    Tyr(3)-octreotide (TOC), a somatostatin analogue, is reversibly lipidized for passive delivery to the liver with the aim of increasing its association with hepatocytes. The reversibly lipidized TOC (REAL-TOC) was formed by the conjugation of the N-palmitoyl cysteinyl moiety to the cysteinyl residues of reduced TOC through disulfide linkages and characterized by matrix-assisted laser desorption/ionization (MALDI)-time of flight (TOF) analysis. The measured mass of REAL-TOC (M+H)(+) is 1752.31 Da (calculated mass: 1752.78), confirming that two molecules of N-palmitoyl cysteines are linked to TOC via disulfide bonds. TOC and REAL-TOC were radioiodinated and administered to mice. Their biodistribution and intrahepatic distribution were subsequently investigated. The area under the curve (AUC) of (125)I-REAL-TOC in the liver was 3.8-fold greater than that of (125)I-TOC, with 20.5% and 5.8% of the injected dose (ID)/g of (125)I-REAL-TOC remaining in the liver at 2 and 24h post injection, respectively. Within the liver, TOC was primarily distributed to parenchymal cells (PC). Nevertheless, TOC was quickly excreted out and only 2.4% ID per 100mg protein remained in the PC at 2h post injection. (125)I-REAL-TOC was retained in PC for up to 2h with a constant concentration of around 6% ID/100mg protein. (125)I-REAL-TOC was also highly associated with nonparenchymal cells (NPC) at significantly higher levels than (125)I-TOC at 10min, 1h and 2h post injection. Since somatostatin analogues have been evaluated for treating late-stage hepatocellular carcinoma (HCC), the reversibly lipidized conjugates may possess enhanced therapeutic efficacy due to the liver-targeting effect. PMID:18614343

  12. Synthesis and pharmacological studies of new pyrazole analogues of podophyllotoxin.

    PubMed

    Umesha, B; Basavarajuk, Y B

    2014-01-01

    The pyrazole analogues of podophyllotoxin were synthesized by the chalcone route. This route attracts the attention because of its simple operating conditions and easy availability ofthe chemicals. Initially, benzylide-neacetophenones (chalcones) were prepared in high yields by Claisen-Schmidt reaction of acetophenones with 4-(methylthio)benzaldehyde. The cyclopropyl ketones were prepared in good yields by the reaction of chalcones with trimethylsulfoxonium iodide. Tetralones were prepared in good yields by the Friedel-Craft's intramolecular cyclization reaction of cyclopropyle ketones in the presence of anhyd. stannic chloride and acetic anhydride. The tetralones on formylation to give substituted hydroxylmethylene tetralones. Condensation of substituted hydroxylmethylene tetralones with hydrazine hydrate afforded target compounds. The structures of the synthesized compounds were confirmed by IR, 'H-NMR and Mass spectral technique. The title compounds were screened for their antimitotic and antimicrobial activities. Among the synthesized compounds cyclopropyl ketones and pyrazole analogues of podophyllotoxin, compound 7-(Methytthio)-5-(4-(methylthio)phe- nyl)-4,5.-dihydro-2H-benzo[g]indazole is more active than 5-(4-(Methylthio)phenyl)-4,5-dihydro-2H-ben- zo[g]indazole, 7-Methyl-5-(4-(methylthio)phenyl)-4,5-dihydro-2H-benzo[g]indazole, 7-Methoxy-5-(4-(meth- ylthio)phenyl)-4,5-dihydro-2H-benzo[g]indazole and the key intermediate tetralones in 100, 200 and 400 ppm at 12, 18 and 24 hrs and also showed very good activity against screened bacteria and fungi compared to their standard. PMID:25898761

  13. A novel nucleic acid analogue shows strong angiogenic activity

    SciTech Connect

    Tsukamoto, Ikuko; Sakakibara, Norikazu; Maruyama, Tokumi; Igarashi, Junsuke; Kosaka, Hiroaki; Kubota, Yasuo; Tokuda, Masaaki; Ashino, Hiromi; Hattori, Kenichi; Tanaka, Shinji; Kawata, Mitsuhiro; Konishi, Ryoji

    2010-09-03

    Research highlights: {yields} A novel nucleic acid analogue (2Cl-C.OXT-A, m.w. 284) showed angiogenic potency. {yields} It stimulated the tube formation, proliferation and migration of HUVEC in vitro. {yields} 2Cl-C.OXT-A induced the activation of ERK1/2 and MEK in HUVEC. {yields} Angiogenic potency in vivo was confirmed in CAM assay and rabbit cornea assay. {yields} A synthesized small angiogenic agent would have great clinical therapeutic value. -- Abstract: A novel nucleic acid analogue (2Cl-C.OXT-A) significantly stimulated tube formation of human umbilical endothelial cells (HUVEC). Its maximum potency at 100 {mu}M was stronger than that of vascular endothelial growth factor (VEGF), a positive control. At this concentration, 2Cl-C.OXT-A moderately stimulated proliferation as well as migration of HUVEC. To gain mechanistic insights how 2Cl-C.OXT-A promotes angiogenic responses in HUVEC, we performed immunoblot analyses using phospho-specific antibodies as probes. 2Cl-C.OXT-A induced robust phosphorylation/activation of MAP kinase ERK1/2 and an upstream MAP kinase kinase MEK. Conversely, a MEK inhibitor PD98059 abolished ERK1/2 activation and tube formation both enhanced by 2Cl-C.OXT-A. In contrast, MAP kinase responses elicited by 2Cl-C.OXT-A were not inhibited by SU5416, a specific inhibitor of VEGF receptor tyrosine kinase. Collectively these results suggest that 2Cl-C.OXT-A-induces angiogenic responses in HUVEC mediated by a MAP kinase cascade comprising MEK and ERK1/2, but independently of VEGF receptor tyrosine kinase. In vivo assay using chicken chorioallantoic membrane (CAM) and rabbit cornea also suggested the angiogenic potency of 2Cl-C.OXT-A.

  14. Transitional lava flows as potential analogues for lunar impact melts

    NASA Astrophysics Data System (ADS)

    Neish, Catherine; Hughes, Scott; Hamilton, Christopher; Kobs Nawotniak, Shannon; Garry, William Brent; Skok, John Roma; Elphic, Richard; Carter, Lynn; Bandfield, Joshua; Osinski, Gordon; Lim, Darlene; Heldmann, Jennifer

    2015-11-01

    Lunar impact melt deposits are among the roughest surface materials on the Moon at the decimeter scale, even though they appear smooth at the meter scale. These characteristics distinguish them from well-studied terrestrial analogues, such as Hawaiian pāhoehoe and ´a´ā lava flows. The morphology of impact melt deposits can be related to their emplacement conditions, so understanding the origin of these unique surface properties will inform us as to the circumstances under which they were formed. Although there is no perfect archetype for lunar impact melts on Earth, certain terrestrial environments lend themselves as functional analogues. Specifically, a variety of transitional lava flow types develop if the surface of a pāhoehoe-like flow is disrupted, producing ‘slabby’ or ‘rubbly’ flows that are extremely rough at the decimeter scale. We investigated the surface roughness of transitional lava flows at Craters of the Moon (COTM) National Monument, comparing radar imagery and high-resolution topographic profiles to similar data sets acquired by the Lunar Reconnaissance Orbiter for impact melt deposits on the Moon. Results suggest that the lava flows at COTM have similar radar properties to lunar impact melt deposits, but the terrestrial flows are considerably rougher at the meter scale. It may be that lunar impact melts represent a unique lava type not observed on Earth, whose surface texture is influenced by their high emplacement temperatures and/or cooling in a vacuum. Information about the surface properties of lunar impact melt deposits will be critical for future landed missions that wish to sample these materials.

  15. Using analogues to quantify geological uncertainty in stochastic reserve modelling

    SciTech Connect

    Wells, B.; Brown, I.

    1995-08-01

    The petroleum industry seeks to minimize exploration risk by employing the best possible expertise, methods and tools. Is it possible to quantify the success of this process of risk reduction? Due to inherent uncertainty in predicting geological reality and due to changing environments for hydrocarbon exploration, it is not enough simply to record the proportion of successful wells drilled; in various parts of the world it has been noted that pseudo-random drilling would apparently have been as successful as the actual drilling programme. How, then, should we judge the success of risk reduction? For many years the E&P industry has routinely used Monte Carlo modelling to generate a probability distribution for prospect reserves. One aspect of Monte Carlo modelling which has received insufficient attention, but which is essential for quantifying risk reduction, is the consistency and repeatability with which predictions can be made. Reducing the subjective element inherent in the specification of geological uncertainty allows better quantification of uncertainty in the prediction of reserves, in both exploration and appraisal. Building on work reported at the AAPG annual conventions in 1994 and 1995, the present paper incorporates analogue information with uncertainty modelling. Analogues provide a major step forward in the quantification of risk, but their significance is potentially greater still. The two principal contributors to uncertainty in field and prospect analysis are the hydrocarbon life-cycle and the geometry of the trap. These are usually treated separately. Combining them into a single model is a major contribution to the reduction risk. This work is based in part on a joint project with Oryx Energy UK Ltd., and thanks are due in particular to Richard Benmore and Mike Cooper.

  16. Early Earth rock analogues for Martian subsurface processes

    NASA Astrophysics Data System (ADS)

    Bishop, J. L.; Grosch, E. G.; Maturilli, A.; Helbert, J.

    2015-12-01

    Sub-surface mafic-ultramafic crustal and hydrothermal environments on early Earth and Mars may have been very similar [1]. Hydrogen production from low-temperature alteration of ultramafic and basaltic rocks has been proposed to support early microbial life in Earth's earliest subsurface environments [1]. Similarly, evidence for microbial sulphate reduction has been reported from early Archean metabasaltic pillow lavas [2]. As such, Archean terrestrial rock environments preserved in greenstone belts may play an important role in understanding early Martian subsurface environments, which in turn may have led to preservation of early traces of life. In this context, the rock sequences of the Paleoarchean Barberton greenstone belt of South Africa provide unique Martian analogues as these rocks are exceptionally well preserved and record early Earth (and perhaps Martian-type) subsurface processes. In-situ exploration by rovers, remote sensing studies, and meteorite evidence has indicated the presence of altered gabbros, olivine-/pyroxene-bearing basalts and possible felsic porphyries on Mars. In this study we present a range of relevant 3.5 billion year old Archean greenstone belt analogue samples that include altered tholeiitic basalts, basaltic komatiites, serpentinized ultramafic komatiites and a felsic tonalite. The petrography and mineralogy of the samples are presented in terms of relic igneous phases and clay mineral alteration. We are acquiring visible/near-infrared reflectance and mid-IR emission spectra on these early Archean samples with the aim of using the hyperspectral data for ground truthing remote sensing data and mineral identification/environments on Mars.[1]. Grosch et al. (2014). Microscale mapping of alteration conditions and potential biosignatures in basaltic-ultramafic rocks on early Earth and beyond, Astrobiology 14 (3), 216-228. [2]. McLoughlin et al. (2012) Sulfur isotope evidence for a Paleoarchean subseafloor biosphere, Barberton, South

  17. The Arctic Mars Analogue Svalbard Expedition 2010. (Invited)

    NASA Astrophysics Data System (ADS)

    Steele, A.; Benning, L. G.; Fogel, M. L.; Amundsen, H.; Schmitz, N.; Amase 2010 Team

    2010-12-01

    The Arctic Mars Analogue Svalbard Expeditions (AMASE) 2010 was the latest of a series of expeditions that are NASA ASTEP and ESA funded and have as their primary goals 1) testing portable instruments for their robustness as field instruments for life detection, 2) assessing Mars analogue environments for abiosignatures and biosignatures, 3) refining protocols for contamination reduction, 4) defining a minimal instrument suite for Astrobiology science on Mars and 5) sample acquisition, collection and caching of suitable samples by rover platforms containing sample acquisition hardware: first Cliffbot, then Athena. As well as testing ESA instrumentation for the ExoMars mission and NASA instruments for Mars Science Laboratory, the goals and technologies used during this 2010 campaign are very similar to that proposed by the current MEPAG MAX-C mission concept and therefore set the stage for future sample return missions. As such the field-tested technologies, procedures and protocols can be used to address specific science objectives proposed for the 2018 Mars mission opportunity. As NASA and ESA enter a new era of collaboration, AMASE has provided and will continue to provide, a test bed for both current in-situ robotic missions and Mars Sample Return mission architectures. AMASE has proved to be a unique platform to build understanding and collaboration amongst scientists and engineers from Europe and the USA. AMASE 2010 team (other than those mentioned above): Ivar Midtkandal, Kjell Ove Storvik, Garret Huntress, Verena Starke, Pan Conrad, Francis McCubbin, Tor Viscor, Antonio Sensano, Laureline Josset, Jean-Luc Josset, Mihaela Glamoclija, Steve Squyres, Inge Loes Ten Kate, Kyong Hou, Jen Stern, Amy McAdam, Dave Blake, Dick Morris, Claire Cousins, Arnold Bauer, Carole Phillippon, Eckhard Steinmetz, Dave Potts, Dominique Tobler, Guillermo Lopez.

  18. Mapping Densities in Analogue Laboratory Turbulent Plumes Using Dye Concentration

    NASA Astrophysics Data System (ADS)

    Fisher, M. A.; Kobs-Nawotniak, S. E.

    2014-12-01

    Changing tephra concentration in volcanic eruption columns is difficult to measure in the field due to fluid opacity. The bulk fluid erupted may be higher density than the surrounding atmosphere at the vent and then transition to positive buoyancy through the ingestion and heating of ambient air; thus, the concentration of the plume fluid as it rises is critical to determining whether the material rises in a sustained plume or collapses into a pyroclastic density current. We evaluate the changing concentration of an analogue plume via tracer dye intensity and relate it to plume radius expansion and vent distance. To calibrate our concentration metric, we calculated the density and dye concentration of pre-determined tracer-water mixtures. The density of the solution was directly measured using a micropipette and high precision balance. The calculated density falls within the standard error of the measured density for each step. Five photographs were taken of each concentration using a mounted Ex-FH100 digital camera with identical lighting. Using a MATLAB script, the RGB (Red-Green-Blue) color value was extracted from five pixels located at the same coordinates in each image, confirming that there was no inherent error caused by the camera and that the RGB value was the same across an entire image. We created a color map to convert from the RGB color value of a pixel in an image to its corresponding concentration. This method algorithm can then be applied to an analogue volcanic tank model, using the color variations in the plume eddies to determine the tracer concentration, and thereby density distribution, in the plume.

  19. The uptake of HNO3 on meteoric smoke analogues

    NASA Astrophysics Data System (ADS)

    Frankland, Victoria L.; James, Alexander D.; Feng, Wuhu; Plane, John M. C.

    2015-05-01

    The uptake of HNO3, H2O, NO2 and NO was studied on meteoric smoke particle analogues using a low-pressure Knudsen cell operating at 295 K. The analogues used were olivine (MgFeSiO4) and a haematite/goethite (Fe2O3/FeO(OH)) mixture synthesised by the sol-gel process. For uptake on MgFeSiO4, the following uptake coefficients were obtained: γ(HNO3)=(1.8±0.3)×10-3, γ(H2O)=(4.0±1.3)×10-3, γ(NO2)=(5.7±0.2)×10-4 and γ(NO)<3×10-4. γ(HNO3) did not show a dependence on the mass of MgFeSiO4 in the Knudsen cell (when varied by a factor of 6) implying that, because of relatively efficient uptake, HNO3 is removed only by near-surface particles. This was corroborated by application of a surface uptake model. Saturating the MgFeSiO4 particles with water vapour before exposing them to NO2 increased γ(NO2) to (2.1±0.7)×10-3, but had a very small effect on γ(HNO3). For uptake on Fe2O3/FeO(OH), γ(HNO3)=(1.5±0.2)×10-3. These results were then included in a whole atmosphere chemistry-climate model, which shows that the heterogeneous removal on meteoric smoke particles in the winter polar vortex between 30 and 60 km appears to provide an important sink for HNO3.

  20. Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

    PubMed Central

    Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

    2009-01-01

    8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

  1. Synthesis, biological activity, and conformational study of N-methylated allatostatin analogues inhibiting juvenile hormone biosynthesis.

    PubMed

    Xie, Yong; Zhang, Li; Zhang, Chuanliang; Wu, Xiaoqing; Deng, Xile; Yang, Xinling; Tobe, Stephen S

    2015-03-25

    An allatostatin (AST) neuropeptide mimic (H17) is a potential insect growth regulator, which inhibits the production of juvenile hormone (JH) by the corpora allata. To determine the effect of conformation of novel AST analogues and their ability to inhibit JH biosynthesis, eight insect AST analogues were synthesized using H17 as the lead compound by N-methylation scanning, which is a common strategy for improving the biological properties of peptides. A bioassay using JH production by corpora allata of the cockroach Diploptera punctata indicated that single N-methylation mimics (analogues 1-4) showed more activity than double N-methylation mimics (analogues 5-8). Especially, analogues 1 and 4 showed roughly equivalent activity to that of H17, with IC50 values of 5.17 × 10(-8) and 6.44 × 10(-8) M, respectively. Molecular modeling based on nuclear magnetic resonance data showed that the conformation of analogues 1 and 4 seems to be flexible, whereas analogues 2 and 3 showed a type IV β-turn. This flexible linear conformation was hypothesized to be a new important and indispensable structural element beneficial to the activity of AST mimics. PMID:25751662

  2. Presence and formation of cobalamin analogues in multivitamin-mineral pills.

    PubMed Central

    Kondo, H; Binder, M J; Kolhouse, J F; Smythe, W R; Podell, E R; Allen, R H

    1982-01-01

    Because the origin of cobalamin (vitamin B12) analogues in animal chows and animal and human blood and tissues is unknown, we investigated the possibility that multivitamin interactions might convert cobalamin to cobalamin analogues. We homogenized three popular multivitamin-mineral pills in water, incubated them at 37 degrees C for 2 h, and isolated the cobalamin. Using paper chromatography we observed that 20-90% of the cobalamin was present as cobalamin analogues. Studies using CN-[57Co]cobalamin showed that these analogues were formed due to the concerted action of vitamin C, thiamine, and copper on CN-cobalamin. These cobalamin analogues are absorbed from the gastrointestinal tract of mice and either fail to stimulate or actually inhibit cobalamin-dependent enzymes when injected parenterally. We conclude that CN-cobalamin can be converted to potentially harmful cobalamin analogues by multivitamin-mineral interactions and that these interactions may be responsible for the presence of cobalamin analogues in animal chows and animal and human blood and tissues. PMID:6126492

  3. Analogue Models Of Volcanic Spreading At Mt. Vesuvius

    NASA Astrophysics Data System (ADS)

    De Matteo, Ada; Castaldo, Raffaele; D'Auria, Luca; James, Michael; Lane, Steve; Massa, Bruno; Pepe, Susi; Tizzani, Pietro

    2015-04-01

    Somma-Vesuvius is a quiescent strato-volcano of the Neapolitan district, southern Italy, for which various geophysical and geological evidences (e.g. geodetic measurements, geological and structural data, seismic profiles interpretations and surface deformation analysis with Differential Interferometric Synthetic Aperture Radar (DInSAR)) indicate ongoing spreading deformation. In this research we investigate the spreading deformation and associated surface deformation pattern by performing analogue experiments and comparing the results with actual ground deformation as measured using DInSAR data recorded between 1992 and 2010. Somma-Vesuvius consists of a volcanic cone (Gran Cono) lying within an asymmetric caldera (Somma). The Somma caldera is the result of at least 7 Plinian eruptions, the last of which was the 79 CE. Pompeii eruption. The current cone of Mt. Vesuvius grew within the caldera in the following centuries as the effect of continued explosive and effusive activity of the volcano. The volcano lies on a substratum consisting of a Mesozoic carbonatic basement, overlapped by Holocene clastic sediments and volcanic rocks. Our analogue models were built to simulate the shape of the Somma-Vesuvius top a scale of about 1:100000, emplaced on a sand layer (brittle behaviour) laid on a silicone layer (ductile behaviour). Models are based on the Fluid-dynamics Dimensionless Analysis (FDA), according to the Buckingham-Π theorem. In this context, we considered few dimensionless parameters that allowed the setting of a reliable scaled model. To represent the complex Somma-Vesuvius geometry, an asymmetric model was built by setting a truncated cone (mimicking the topography of Somma edifice) topped by another small cone (mimicking the Gran Cono) shifted off the axis of the main cone. Different experiments were carried out in which the thickness of the basal sand layer and of the silicone one were varied. To quantify the vertical and horizontal displacements the

  4. Analogue modelling of salt diapirism induced by differential loading

    NASA Astrophysics Data System (ADS)

    Warsitzka, Michael; Kley, Jonas; Kukowski, Nina; Jähne, Fabian

    2010-05-01

    In salt tectonics, two general concepts exist to explain salt diapirism. First, the theory of active piercement by Trusheim (1960) states that salt rises up and pierces its overburden autonomously by buoyancy forces. Second, the theory of reactive piercement by Vendeville and Jackson (1992) considers a tectonic stress field responsible for initiation of salt uplift and has been tested in many analogue experiments. In this study, we investigated the hypothesis in which salt diapir formation is activated by sedimentary processes alone, i.e. without a tectonic trigger. Our models consisted of a viscous silicone layer simulating rock salt overlain by layers of sand that mimic brittle behaviour in natural overburden sediments. The experiments were monitored with a high-resolution strain analysis tool based on digital image correlation (particle image velocimetry, PIV). Deformation in the silicone was initiated by a lateral variation in the thickness or density of the overburden, which established a differential loading on the silicone layer. Subsequent sedimentation in certain time intervals forced the silicone to rise up and break through the initial sand layer by buoyancy forces. The model results support the hypothesis of active piercement of diapirs. Uplift of the silicone and creation of a pillow structure with a significant elevation can be achieved if the overburden does not exceed a critical thickness and if the load gradient in the overburden reaches a minimum value. Then, ongoing sedimentation in adjacent areas increases the lateral load gradient until the buoyancy force in the silicone is high enough to overcome the shear strength of the sand. Synkinematic sedimentation produces some typical strata geometries in the sand layer that can also be observed in nature, e.g. drag folds bordering the diapirs and layer thickening in the peripherical rim synclines. The creation of one diapir and its peripherical sinks induces a lateral migration of the deformation to

  5. Correlation between vibrational frequencies and hydrogen bonding states of the guanine ring studied by UV resonance Raman spectroscopy of 2'-deoxy-3',5'-bis(triisopropylsilyl)guanosine dissolved in various solvents

    NASA Astrophysics Data System (ADS)

    Toyama, Akira; Hamuara, Mutsuo; Takeuchi, Hideo

    1996-06-01

    Ultraviolet resonance Raman spectra of 2'-deoxy-3',5'-bis(triisopropylsilyl)guanosine (TPS-dGuo) were recorded in non-hydrogen bonding, proton acceptor, and proton donor/acceptor solvents. Raman spectral changes observed on going from inert to proton acceptor solvents were ascribed to the hydrogen bonding at the proton donor sites of the guanine ring (N1H and C2NH 2), and the spectral changes associated with the solvent change from proton acceptor to donor/acceptor were ascribed to the hydrogen bonding at the proton acceptor sites (N3, C6O, and N7). A Raman band appearing at 1624 cm -1 in inert solvents is assigned mainly to the NH 2 scissors mode and its frequency changes to ≈ 1640 cm -1 in acceptor solvents, reflecting the hydrogen bonding at C2NH 2. Another band at 1581 cm -1, arising largely from the N1H bend, shows an upshift of ≈ 10 cm -1 upon hydrogen bonding at either N1H or acceptor sites. Hydrogen bonding at the acceptor sites also produces frequency shifts of other Raman bands (at 1710, 1565, 1528, 1481, and 1154 cm -1 in 1,2-dichloroethane solution). Among the Raman bands listed above, the 1710 cm -1 band due to the C6O stretch decreases in frequency, whereas the others increase. The downshift of the C6O stretching frequency is correlated with the strength of hydrogen bonding at C6O. The frequency of the 1481 cm -1 band increases with a decrease of the C6O stretching frequency, indicating that the 1481 cm -1 band is also a marker of hydrogen bonding at C6O. This finding is in sharp contrast to the previously proposed correlation with the hydrogen bonding at N7. The 1565 cm -1 band is assigned to a vibration mainly involving the N1C2N3 linkage, and its frequency increases with increasing strength of the hydrogen bond at N3. Three bands around 1315, 1180, and 1030 cm -1, which are known to be sensitive to the ribose ring puckering and glycosidic bond orientation, also show small frequency changes upon hydrogen

  6. Adenosine A1( )receptors are selectively coupled to Gα(i-3) in postmortem human brain cortex: Guanosine-5'-O-(3-[(35)S]thio)triphosphate ([(35)S]GTPγS) binding/immunoprecipitation study.

    PubMed

    Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; García-Sevilla, Jesús A

    2015-10-01

    By means of guanosine-5'-O-(3-[(35)S]thio)triphosphate ([(35)S]GTPγS) binding assay combined with immunoprecipitation using anti-Gα subunit antibody, we recently reported 5-HT2A receptor- and M1 muscarinic acetylcholine receptor-mediated Gαq activation in rat cerebral cortical membranes (Odagaki et al., 2014). In the present study, this method has been applied to postmortem human brains, with focusing on adenosine receptor-mediated G-protein activation. In the exploratory experiments using a series of agonists and the antibodies specific to each Gα subtypes in the presence of low (10 nM) or high (50 μM) concentration of GDP, the most prominent increases in specific [(35)S]GTPγS binding in the membranes prepared from human prefrontal cortex were obtained for the combinations of adenosine (1mM)/anti-Gαi-3 in the presence of 50 μM GDP as well as 5-HT (100 μM)/anti-Gαq and carbachol (1mM)/anti-Gαq in the presence of 10nM GDP. Adenosine-induced activation of Gαi-3 emerged only when GDP concentrations were increased higher than 10 μM, and the following experiments were performed in the presence of 300 μM GDP. Adenosine increased specific [(35)S]GTPγS binding to Gαi-3 in a concentration-dependent manner to 251.4% of the basal unstimulated binding, with an EC50 of 1.77 μM. The involvement of adenosine A1 receptor was verified by the experiments using selective agonists and antagonists at adenosine A1 or A3 receptor. Among the α subunits of Gi/o class (Gαi-1, Gαi-2, Gαi-3, and Gαo.), only Gαi-3 was activated by 1mM adenosine, indicating that human brain adenosine A1 receptor is coupled preferentially, if not exclusively, to Gαi-3. PMID:26213104

  7. Sex Difference in κ-Opioid Receptor (KOPR)-Mediated Behaviors, Brain Region KOPR Level and KOPR-Mediated Guanosine 5′-O-(3-[35S]Thiotriphosphate) Binding in the Guinea Pig

    PubMed Central

    Wang, Yu-Jun; Rasakham, Khampaseuth; Huang, Peng; Chudnovskaya, Darina; Cowan, Alan

    2011-01-01

    We examined whether sex differences in κ-opioid receptor (KOPR) pharmacology exist in guinea pigs, which are more similar to humans in the expression level and distribution of KOPR in the brain than rats and mice. The KOPR agonist trans-(±)-3,4-dichloro-N-methyl-N-(2-[1-pyrrolidinyl]-cyclohexyl)benzeneacetamide methanesulfonate (U50,488H) produced a dose-dependent increase in abnormal postures and immobility with more effects in males than females. Males also showed more U50,488H-induced antinociception in the paw pressure test than females. Pretreatment with the KOPR antagonist norbinaltorphimine blocked U50,488H-induced abnormal body postures and antinociception. In contrast, inhibition of cocaine-induced hyperambulation by U50,488H was more effective in females than males. Thus, sex differences in the effects of U50,488H are endpoint-dependent. We then examined whether sex differences in KOPR levels and KOPR-mediated G protein activation in brain regions may contribute to the observed differences using quantitative in vitro autoradiography of [3H](5a,7a,8b)-(−)-N-methyl-N-(7-(1-pyrrolidinyl)1-oxaspiro(4,5)dec-8-yl)benzeacetamide ([3H]U69,593) binding to the KOPR and U50,488H-stimulated guanosine 5′-O-(3-[35S]thiotriphosphate ([35S]GTPγS) binding. Compared with females, males exhibited more [3H]U69,593 binding in the deep layers of somatosensory and insular cortices, claustrum, endopiriform nucleus, periaqueductal gray, and substantial nigra. Concomitantly, U50,488H-stimulated [35S]GTPγS binding was greater in males than females in the superficial and deep layers of somatosensory and insular cortices, caudate putamen, claustrum, medial geniculate nucleus, and cerebellum. In contrast, compared with males, females showed more U50,488H-stimulated [35S]GTPγS binding in the dentate gyrus and a trend of higher [35S]GTPγS binding in the hypothalamus. These data demonstrate that males and females differ in KOPR expression and KOPR-mediated G protein activation

  8. Mitomycin C and porfiromycin analogues with substituted ethylamines at position 7.

    PubMed

    Iyengar, B S; Sami, S M; Remers, W A; Bradner, W T; Schurig, J E

    1983-01-01

    A series of 7-(2-substituted-ethyl)amino analogues of mitomycin C and porfiromycin was prepared and screened in standard antitumor systems. Certain of these analogues showed better activity than mitomycin C against P-388 leukemia, L-1210 leukemia, and/or B-16 melanocarcinoma in mice. Compounds also tested for their leukopenic effects in mice, the limiting toxicity of mitomycin C. Some of them were less leukopenic and some were more leukopenic than this clinical agent. No statistically significant correlations could be made between physicochemical properties and antitumor activities of the analogues. PMID:6827524

  9. Isolation and structural elucidation of a new tadalafil analogue in health supplements: bisprenortadalafil.

    PubMed

    Lee, Ji Hyun; Park, Han Na; Ganganna, Bogonda; Jeong, Ji Hye; Park, Sung-Kwan; Lee, Jongkook; Baek, Sun Young

    2016-06-01

    A new tadalafil analogue was found, along with nortadalafil, using HPLC-DAD during the inspection of a health product sold without official approval. The analogue was separated using a semi-preparative HPLC system and its structure was determined by a combination of mass spectrometry and NMR spectroscopy. The compound was identified as a tadalafil analogue in which the N-methyl group of tadalafil was replaced with a tadalafil precursor moiety. Nuclear Overhauser effect spectroscopy experiments suggested a cis-relationship between the substituents on a piperidine ring in the tadalafil moiety. PMID:27167568

  10. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  11. Synthesis and Antimicrobial Evaluation of Nitazoxanide-Based Analogues: Identification of Selective and Broad Spectrum Activity

    PubMed Central

    Ballard, T. Eric; Wang, Xia; Olekhnovich, Igor; Koerner, Taylor; Seymour, Craig; Salamoun, Joseph; Warthan, Michelle; Hoffman, Paul S.; Macdonald, Timothy L.

    2011-01-01

    A library composed of Nitazoxanide-based analogues was synthesized and assayed for increased antibacterial efficacy against the pyruvate:ferredoxin oxidoreductase (PFOR) utilizing microorganisms Helicobacter pylori, Campylobacter jejuni and Clostridium difficile. Derivatives were found to recapitulate and improve activity against these organisms and select analogues were tested for their ability to disrupt the PFOR enzyme directly. The library was also screened for activity against staphylococci and resulted in the identification of analogues capable of inhibiting both staphylococci and all PFOR organisms at low μM MIC concentrations with low toxicity to human foreskin cells. PMID:21275058

  12. Hierarchically superstructured prussian blue analogues: spontaneous assembly synthesis and applications as pseudocapacitive materials.

    PubMed

    Yue, Yanfeng; Zhang, Zhiyong; Binder, Andrew J; Chen, Jihua; Jin, Xianbo; Overbury, Steven H; Dai, Sheng

    2015-01-01

    Hierarchically superstructured Prussian blue analogues (hexacyanoferrate, M=Ni(II) , Co(II) and Cu(II) ) are synthesized through a spontaneous assembly technique. In sharp contrast to macroporous-only Prussian blue analogues, the hierarchically superstructured porous Prussian blue materials are demonstrated to possess a high capacitance, which is similar to those of the conventional hybrid graphene/MnO2 nanostructured textiles. Because sodium or potassium ions are involved in energy storage processes, more environmentally neutral electrolytes can be utilized, making the superstructured porous Prussian blue analogues a great contender for applications as high-performance pseudocapacitors. PMID:25385481

  13. Peptide Receptor Radionuclide Therapy (PRRT) of Medullary and Nonmedullary Thyroid Cancer Using Radiolabeled Somatostatin Analogues.

    PubMed

    Salavati, Ali; Puranik, Ameya; Kulkarni, Harshad R; Budiawan, Hendra; Baum, Richard P

    2016-05-01

    As therapeutic options in advanced medullary and non-iodine avid differentiated (nonmedullary) thyroid cancers are limited and associated with significant toxicity, targeting of somatostatin receptors (SSTRs) for internal radiation therapy provides a promising option. Theranostics (therapy and diagnosis) using radiolabeled somatostatin analogues has proved to be a milestone in the management of SSTR-expressing tumors. Peptide receptor radionuclide therapy using (177)Lu-labeled or (90)Y-labeled somatostatin analogues may have a significant role in the management of medullary and nonmedullary thyroid cancers in those patients where PET/CT with (68)Ga-labeled somatostatin analogues demonstrates significant SSTR expression. PMID:27067502

  14. Expeditious synthesis of Mycobacterium tuberculosis sulfolipids SL-1 and Ac2SGL analogues.

    PubMed

    Sarpe, Vikram A; Kulkarni, Suvarn S

    2014-11-01

    M. tuberculosis sulfoglycolipids SL-1 and Ac2SGL are highly immunogenic and potential vaccine candidates. A short and efficient methodology is reported for the synthesis of SL-1 and Ac2SGL analogues via regioselective functionalization of α,α-D-trehalose employing a highly regioselective late stage sulfation, as a key step. The SL-1 analogues 3a and 4 were obtained in 10 and 9 steps in 13.4% and 23.9% overall yields, respectively. The Ac2SGL analogue 5 was synthesized in 5 steps in 18.4% yield. PMID:25322198

  15. Synthetic analogues of chymostatin. Inhibition of chymotrypsin and Streptomyces griseus proteinase A.

    PubMed Central

    Tomkinson, N P; Galpin, I J; Beynon, R J

    1992-01-01

    A series of analogues of chymostatin, including Z-Arg-Leu-Phe-aldehyde (Z-Arg-Leu-Phe-H), have been synthesized. Analysis of the inhibitory potential of these analogues permits identification of residues and interactions that are important for inhibitory activity. Moreover, the structure-function relationship for Z-Arg-Leu-Phe-H and chymostatin inhibition of chymotrypsin and Streptomyces griseus proteinase A (SGPA) was probed further with the aid of molecular mechanics. This analysis identified interactions that provide an explanation for the enhanced activity of the natural product, chymostatin, over the synthetic analogues in the inhibition of chymotrypsin but not SGPA. PMID:1530579

  16. Quality of casein based Mozzarella cheese analogue as affected by stabilizer blends.

    PubMed

    Jana, A H; Patel, H G; Suneeta, Pinto; Prajapati, J P

    2010-03-01

    Suitability of xanthan gum (XG)-locust bean gum (LBG), carrageenan (CAR)-LBG, and XG-CAR in 1:1 proportion at 0.42% in the formulation was assessed in the manufacture of Mozzarella cheese analogue. The stabilizer blends did not significantly influence the composition, texture profile, organoleptic, baking qualities and pizza-related characteristics of cheese analogues. Considering the influence of stabilizer blend on the sensory quality of analogue and sensory rating of pizza pie, XG-LBG blend (1:1) was preferred over XG-CAR and CAR-LBG. PMID:23572632

  17. Synthesis and biological evaluation of cyclopropyl analogues of fosmidomycin as potent Plasmodium falciparum growth inhibitors.

    PubMed

    Devreux, Vincent; Wiesner, Jochen; Goeman, Jan L; Van der Eycken, Johan; Jomaa, Hassan; Van Calenbergh, Serge

    2006-04-20

    A series of fosmidomycin analogues featuring restricted conformational mobility has been synthesized and evaluated as inhibitors of 1-deoxy-D-xylulose 5-phosphate (DOXP) reductoisomerase and as growth inhibitors of P. falciparum. The enantiomerically pure trans-cyclopropyl N-acetyl analogue 3b showed comparable inhibitory activity as fosmidomycin toward E. coli DOXP reductoisomerase and proved equally active when tested in vitro for P. falciparum growth inhibition. Conversely, the alpha-phenyl cis-cyclopropyl analogue 4 showed virtually no inhibition of the enzyme. PMID:16610809

  18. Hierarchically Superstructured Prussian Blue Analogues: Spontaneous Assembly Synthesis and Applications as Pseudocapacitive Materials

    DOE PAGESBeta

    Yue, Yanfeng; Zhang, Zhiyong; Binder, Andrew J.; Chen, Jihua; Jin, Xianbo; Overbury, Steven; Dai, Sheng

    2014-11-10

    Hierarchically superstructured Prussian blue analogues (hexa- conventional hybrid graphene/MnO2 nanostructured textiles. cyanoferrate, M = NiII, CoII and CuII) are synthesized through Because sodium or potassium ions are involved in energy stor- a spontaneous assembly technique. In sharp contrast to mac- age processes, more environmentally neutral electrolytes can roporous-only Prussian blue analogues, the hierarchically su- be utilized, making the superstructured porous Prussian blue perstructured porous Prussian blue materials are demonstrated analogues a great contender for applications as high-per- to possess a high capacitance, which is similar to those of the formance pseudocapacitors.

  19. Hierarchically Superstructured Prussian Blue Analogues: Spontaneous Assembly Synthesis and Applications as Pseudocapacitive Materials

    SciTech Connect

    Yue, Yanfeng; Zhang, Zhiyong; Binder, Andrew J.; Chen, Jihua; Jin, Xianbo; Overbury, Steven; Dai, Sheng

    2014-11-10

    Hierarchically superstructured Prussian blue analogues (hexa- conventional hybrid graphene/MnO2 nanostructured textiles. cyanoferrate, M = NiII, CoII and CuII) are synthesized through Because sodium or potassium ions are involved in energy stor- a spontaneous assembly technique. In sharp contrast to mac- age processes, more environmentally neutral electrolytes can roporous-only Prussian blue analogues, the hierarchically su- be utilized, making the superstructured porous Prussian blue perstructured porous Prussian blue materials are demonstrated analogues a great contender for applications as high-per- to possess a high capacitance, which is similar to those of the formance pseudocapacitors.

  20. Asymmetric gravitational spreading - Analogue experiments on the Svecofennian orogen

    NASA Astrophysics Data System (ADS)

    Nikkilä, Kaisa; Korja, Annakaisa; Koyi, Hemin; Eklund, Olav

    2015-04-01

    Over-thickened orogenic crust may suffer from rheological, gravitational and topographical unbalancing resulting in discharging via gravitational spreading. If the thickened orogen is also hot, then increased temperature may reduce the viscosity of the crust that may induce large-scale horizontal flow. The effect of flow on the crustal architecture has previously been modeled with symmetric two-way spreading or asymmetric one- or two-way spreading (like channel flow) experiments. Most models do not take into account of the contrasting mechanical properties of the juxtaposed terranes. We have made analogue experiments to study gravitational one-way spreading and the interplay between two crustal blocks with contrasting rheological properties. The models are 3 cm thick replicas of 60 km thick crust. They have three horizontal layers representing strong lower, weak middle and brittle upper crust. The models have cuts to study the effect of inherited crustal-scale weakness zones. The experiments have been conducted within a large centrifuge in the Hans Ramberg Tectonic Laboratory at Uppsala University. The analogue models propose that asymmetric, unilateral flow has different effect on the contrasting crustal units, in both horizontal and vertical directions. The laterally heterogeneous crust flows towards the direction of extension, and it rotates and extends the pre-existing weakness zones. The weakness zones facilitate exhumation and they increase strain rate. The weakness zones split the crust into subblocks, which stretch individually and which may show signatures of compression or rotation. The changes in thickness of the model reflect changes in the layers, which may thin or thicken depending on the mechanical properties of crustal layers. A consequence of this the total amount of flattening is less than the model extension. The results are compared to geophysical and geological data from Precambrian Svecofennian orogen in Fennoscandia. The comparison suggest

  1. Efficacy of Antimicrobials on Bacteria Cultured in a Spaceflight Analogue

    NASA Technical Reports Server (NTRS)

    Nickerson, CA; Wotring, Virginia; Barrila, Jennifer; Crabbe, Aurelie; Castro, Sarah; Davis, Richard; Rideout, April; McCarthy, Breanne; Ott, C. Mark

    2014-01-01

    As humans travel in space, they will interact with microbial flora from themselves, other crewmembers, their food, and the environment. While evaluations of microbial ecology aboard the Mir and ISS suggest a predominance of common environmental flora, the presence of (and potential for) infectious agents has been well documented. Likewise, pathogens have been detected during preflight monitoring of spaceflight food, resulting in the disqualification of that production lot from flight. These environmental and food organisms range from the obligate pathogen, Salmonella enterica serovar Typhimurium (S. Typhimurium), which has been responsible for disqualification and removal of food destined for ISS and has previously been reported from Shuttle crew refuse, to the opportunistic pathogen Staphylococcus aureus, isolated numerous times from ISS habitable compartments and the crew. Infectious disease events have affected spaceflight missions, including an upper respiratory infection that delayed the launch of STS-36 and an incapacitating Pseudomonas aeruginosa urinary tract infection of a crewmember during Apollo 13. These observations indicate that the crew has the potential to be exposed to obligate and opportunistic pathogens. This risk of exposure is expected to increase with longer mission durations and increased use of regenerative life support systems. As antibiotics are the primary countermeasure after infection, determining if their efficacy during spaceflight missions is comparable to terrestrial application is of critical importance. The NASA Rotating Wall Vessel (RWV) culture system has been successfully used as a spaceflight culture analogue to identify potential alterations in several key microbial characteristics, such as virulence and gene regulation, in response to spaceflight culture. We hypothesized that bacteria cultured in the low fluid shear RWV environment would demonstrate changes in efficacy of antibiotics compared to higher fluid shear controls

  2. Thalidomide analogue CC1069 inhibits development of rat adjuvant arthritis

    PubMed Central

    Oliver, S J; Freeman, S L; Corral, L G; Ocampo, C J; Kaplan, G

    1999-01-01

    The cytokine tumour necrosis factor-alpha (TNF-α) has been implicated in the aetiology of rheumatoid arthritis in humans as well as of experimental arthritis in rodents. Thalidomide, and to a greater extent the new thalidomide analogue CC1069, inhibit monocyte TNF-α production both in vitro and in vivo. The aim of the present study is to establish whether these drugs block production of TNF-α as well as IL-2 by rat leucocytes and whether this inhibition affects the development of rat adjuvant arthritis (AA). Cultured splenocytes were stimulated with either lipopolysaccharide (LPS) or concanavalin A (Con A) in the presence of thalidomide, CC1069, or solvent, and the production of TNF-α and IL-2 were compared. Next, adjuvant was injected into the base of the tail of rats without or with daily intraperitoneal injections with 100–200 mg/kg per day thalidomide or 50–200 mg/kg per day CC1069. Disease activity, including ankle swelling, hind limb radiographic and histological changes, weight gain, and ankle joint cytokine mRNA levels, were monitored. CC1069, but not the parent drug thalidomide, inhibited in vitro production of TNF-α and IL-2 by stimulated splenocytes in a dose-dependent manner. In vivo, a dose-dependent suppression of AA disease activity occurred in the CC1069-treated animals. In contrast, thalidomide-treated rats experienced comparable arthritis severity to placebo-treated animals. There was also a reduction in TNF-α and IL-2 mRNA levels in the ankle joints of CC1069-treated rats compared with thalidomide- and placebo-treated arthritic rats. Early initiation of CC1069 treatment suppressed AA inflammation more efficiently than delayed treatment. We conclude that thalidomide, which did not suppress TNF-α or IL-2 production in vitro by Lewis rat cells, did not suppress development of rat AA. However, the development of rat AA can be blocked by the thalidomide analogue CC1069, which is an efficient inhibitor of TNF-α production and IL-2 in vitro

  3. Synthesis of a des-B-ring bryostatin analogue leads to an unexpected ring expansion of the bryolactone core.

    PubMed

    Kraft, Matthew B; Poudel, Yam B; Kedei, Noemi; Lewin, Nancy E; Peach, Megan L; Blumberg, Peter M; Keck, Gary E

    2014-09-24

    A convergent synthesis of a des-B-ring bryostatin analogue is described. This analogue was found to undergo an unexpected ring expansion of the bryolactone core to generate the corresponding 21-membered macrocycle. The parent analogue and the ring-expanded product both displayed nanomolar binding affinity for PKC. Despite containing A-ring substitution identical to that of bryostatin 1 and displaying bryostatin-like biological function, the des-B-ring analogues displayed a phorbol-like biological function in cells. These studies shed new light on the role of the bryostatin B-ring in conferring bryo-like biological function to bryostatin analogues. PMID:25207434

  4. Synthesis of a des-B-Ring Bryostatin Analogue Leads to an Unexpected Ring Expansion of the Bryolactone Core

    PubMed Central

    2015-01-01

    A convergent synthesis of a des-B-ring bryostatin analogue is described. This analogue was found to undergo an unexpected ring expansion of the bryolactone core to generate the corresponding 21-membered macrocycle. The parent analogue and the ring-expanded product both displayed nanomolar binding affinity for PKC. Despite containing A-ring substitution identical to that of bryostatin 1 and displaying bryostatin-like biological function, the des-B-ring analogues displayed a phorbol-like biological function in cells. These studies shed new light on the role of the bryostatin B-ring in conferring bryo-like biological function to bryostatin analogues. PMID:25207434

  5. Chemistry of group 9 dimetallaborane analogues of octaborane(12).

    PubMed

    Barik, Subrat Kumar; Roy, Dipak Kumar; Ghosh, Sundargopal

    2015-01-14

    We report the synthesis, isolation and structural characterization of several moderately air stable nido-metallaboranes that represent boron rich open cage systems. The reaction of [Cp*CoCl]2, (Cp* = η(5)-C5Me5), with [BH3·thf] in toluene at ice cold temperature, followed by thermolysis in boiling toluene produced [(Cp*Co)B9H13], 1 [(Cp*Co)2B8H12], 2 and [(Cp*Co)2B6H10] 3. Building upon our earlier reactivity studies on rhodaboranes, we continue to explore the reactivity of dicobalt analogues of octaborane(12) cluster 3 with [Fe2(CO)9] and [Ru3(CO)12] at ambient conditions that yielded novel fused clusters [Fe2(CO)6(Cp*Co)2B6H10], 4 and [Ru4(CO)11(Cp*Co)2B3H3], 5 respectively. In an attempt to synthesize a heterometallic metallaborane compound we performed the reaction of [(Cp*Rh)2B6H10], 6 with [Cp*IrH4] that yielded a Ir-Ir double bonded compound [(Cp*Ir)2H3][B(OH)4], 7. All the new compounds have been characterized by IR, (1)H, (11)B, (13)C NMR spectroscopy, and the molecular structures were unambiguously established by X-ray diffraction analysis. PMID:25385503

  6. Robenidine Analogues as Gram-Positive Antibacterial Agents.

    PubMed

    Abraham, Rebecca J; Stevens, Andrew J; Young, Kelly A; Russell, Cecilia; Qvist, Anastasia; Khazandi, Manouchehr; Wong, Hui San; Abraham, Sam; Ogunniyi, Abiodun D; Page, Stephen W; O'Handley, Ryan; McCluskey, Adam; Trott, Darren J

    2016-03-10

    Robenidine, 1 (2,2'-bis[(4-chlorophenyl)methylene]carbonimidic dihydrazide), was active against MRSA and VRE with MIC's of 8.1 and 4.7 μM, respectively. SAR revealed tolerance for 4-Cl isosteres with 4-F (8), 3-F (9), 3-CH3 (22), and 4-C(CH3)3 (27) (23.7-71 μM) and with 3-Cl (3), 4-CH3 (21), and 4-CH(CH3)2 (26) (8.1-13.0 μM). Imine carbon alkylation identified a methyl/ethyl binding pocket that also accommodated a CH2OH moiety (75; 2,2'-bis[1-(4-chlorophenyl)-2-hydroxyethylidene]carbonimidic dihydrazide). Analogues 1, 27 (2,2'-bis{[4-(1,1-dimethylethyl)phenyl]methylene}carbonimidic dihydrazide), and 69 (2,2'-bis[1-(4-chlorophenyl)ethylidene]carbonimidic dihydrazide hydrochloride) were active against 24 clinical MRSA and MSSA isolates. No dose-limiting cytotoxicity at ≥2× MIC or hemolysis at ≥8× MIC was observed. Polymyxin B addition engendered Escherichia coli and Pseudomonas aeruginosa Gram-negative activity MIC's of 4.2-21.6 μM. 1 and 75 displayed excellent microsomal stability, intrinsic clearance, and hepatic extraction ratios with T1/2 > 247 min, CLint < 7 μL/min/mg protein, and EH < 0.22 in both human and mouse liposomes for 1 and in human liposomes for 75. PMID:26765953

  7. Photophysical properties of pyrrolocytosine, a cytosine fluorescent base analogue.

    PubMed

    Nguyen, Quynh L; Spata, Vincent A; Matsika, Spiridoula

    2016-07-27

    The photophysical behavior of pyrrolocytosine (PC), a fluorescent base analogue of cytosine, has been investigated using theoretical approaches. The similarities between the PC and cytosine structures allow PC to maintain the pseudo-Watson-Crick base-pairing arrangement with guanine. Cytosine, similar to the other natural nucleobases, is practically non-fluorescent, because of ultrafast radiationless decay occurring through conical intersections. PC displays a much higher fluorescence quantum yield than cytosine, making it an effective fluorescent marker to study the structure, function, and dynamics of DNA/RNA complexes. Similar to 2-aminopurine, a constitutional isomer of adenine that base-pairs with thymine, PC's fluorescence is quenched when it is incorporated into a dinucleotide or a trinucleotide. In this work we examine the photophysical properties of isolated PC, microhydrated PC, as well as, complexes where PC is either base-stacked or hydrogen-bonded with guanine. Our results indicate that hydration affects the radiationless decay pathways in PC by destabilizing conical intersections. The calculations of dimers and trimers show that the radiative decay is affected by π stacking, while the presence of charge transfer states between PC and guanine may contribute to radiationless decay. PMID:27251599

  8. Assessment of capsiconinoid composition, nonpungent capsaicinoid analogues, in capsicum cultivars.

    PubMed

    Tanaka, Yoshiyuki; Hosokawa, Munetaka; Otsu, Keigo; Watanabe, Tatsuo; Yazawa, Susumu

    2009-06-24

    Capsiconinoid is a group of nonpungent capsaicinoid analogues produced in Capsicum fruits, which we recently identified. Capsiconinoids have agonist activity for transient receptor potential vanilloid type 1 (TRPV1), which is reported to be a receptor for capsaicin. It is, therefore, important to screen cultivars containing high levels of capsiconinoid for their use as a vegetable or dietary supplement. This study describes the quantitative analysis of capsiconinoid content in fruits of 35 Capsicum cultivars: 18 cultivars of C. annuum, 7 of C. baccatum, 5 of C. chinense, 4 of C. frutescens, and 1 of C. pubescens. Using high-performance liquid chromatography (HPLC), we found that 10 cultivars contained capsiconinoids. Capsiconinoid Baccatum (CCB) (C. baccatum var. praetermissum) showed the highest capsiconinoid content (3314 microg/g DW) and Charapita (C. chinense) had the second highest content. The other 8 cultivars had much lower capsiconinoid content than these two cultivars (<300 microg/g DW). Time-course analysis during fruit development clarified that capsiconinoid content in CCB fruits increased until 30 days after flowering (DAF) and then decreased rapidly until 40 DAF. PMID:19489540

  9. Therapeutic use of vitamin D and its analogues in autoimmunity.

    PubMed

    Fletcher, Jean M; Basdeo, Sharee A; Allen, Aideen C; Dunne, Padraic J

    2012-01-01

    In recent years, there has been great interest in the role of vitamin D in a number of diverse human diseases including autoimmunity, allergy, infection, cardiovascular disease, chronic lung disease, transplantation and cancer. Vitamin D is best known for its role in calcium metabolism; however it also has potent immunomodulatory effects. Epidemiological studies suggest that vitamin D deficiency may be a significant risk factor for many diseases. Furthermore, there is accumulating evidence from experimental studies that vitamin D has anti-inflammatory effects. Recent studies have indicated that a surprisingly high proportion of people are vitamin D deficient, suggesting that vitamin D supplementation may be of benefit to human health. This review will focus on the role of vitamin D in autoimmune diseases, including multiple sclerosis, rheumatoid arthritis and diabetes. We will review the epidemiological and experimental evidence for the protective effects of vitamin D in autoimmunity, as well as the preliminary vitamin D intervention studies and the most recent patented vitamin D analogues. PMID:22122009

  10. Combined treatment of somatostatin analogues with pegvisomant in acromegaly.

    PubMed

    Franck, S E; Muhammad, A; van der Lely, A J; Neggers, S J C M M

    2016-05-01

    Treatment of acromegaly with monotherapy long-acting somatostatin analogues (LA-SSA) as primary treatment or after neurosurgery can only achieve complete normalization of insulin-like growth factor I (IGF-I) in roughly 40 % of patients. Recently, one of the acromegaly consensus groups has recommended switching to combined treatment of LA-SSA and pegvisomant (PEGV) in patients with partial response to LA-SSAs. This combination of LA-SSA and PEGV, a growth hormone receptor antagonist, can normalize IGF-I levels in virtually all patients, requiring that the adequate dose of PEGV is used. The required PEGV dose varies significantly between individual acromegaly patients. One of the advantages of the combination therapy is that tumor size control or even tumor shrinkage can be observed in a vast majority of patients. The main side effects of the combination treatment are gastrointestinal symptoms, lipohypertrophy and transient elevated liver transaminases. In this review we provide an overview of the efficacy and safety of the combined treatment of LA-SSAs with PEGV. PMID:26661938

  11. BCN: a graphene analogue with remarkable adsorptive properties.

    PubMed

    Raidongia, Kalyan; Nag, Angshuman; Hembram, K P S S; Waghmare, Umesh V; Datta, Ranjan; Rao, C N R

    2010-01-01

    A new analogue of graphene containing boron, carbon and nitrogen (BCN) has been obtained by the reaction of high-surface-area activated charcoal with a mixture of boric acid and urea at 900 degrees C. X-ray photoelectron spectroscopy and electron energy-loss spectroscopy reveal the composition to be close to BCN. The X-ray diffraction pattern, high-resolution electron microscopy images and Raman spectrum indicate the presence of graphite-type layers with low sheet-to-sheet registry. Atomic force microscopy reveals the sample to consist of two to three layers of BCN, as in a few-layer graphene. BCN exhibits more electrical resistivity than graphene, but weaker magnetic features. BCN exhibits a surface area of 2911 m(2) g(-1), which is the highest value known for a B(x)C(y)N(z) composition. It exhibits high propensity for adsorbing CO(2) ( approximately 100 wt %) at 195 K and a hydrogen uptake of 2.6 wt % at 77 K. A first-principles pseudopotential-based DFT study shows the stable structure to consist of BN(3) and NB(3) motifs. The calculations also suggest the strongest CO(2) adsorption to occur with a binding energy of 3.7 kJ mol(-1) compared with 2.0 kJ mol(-1) on graphene. PMID:19946909

  12. Graphene analogues of BN: novel synthesis and properties.

    PubMed

    Nag, Angshuman; Raidongia, Kalyan; Hembram, Kailash P S S; Datta, Ranjan; Waghmare, Umesh V; Rao, C N R

    2010-03-23

    Enthused by the fascinating properties of graphene, we have prepared graphene analogues of BN by a chemical method with a control on the number of layers. The method involves the reaction of boric acid with urea, wherein the relative proportions of the two have been varied over a wide range. Synthesis with a high proportion of urea yields a product with a majority of 1-4 layers. The surface area of BN increases progressively with the decreasing number of layers, and the high surface area BN exhibits high CO(2) adsorption, but negligible H(2) adsorption. Few-layer BN has been solubilized by interaction with Lewis bases. We have used first-principles simulations to determine structure, phonon dispersion, and elastic properties of BN with planar honeycomb lattice-based n-layer forms. We find that the mechanical stability of BN with respect to out-of-plane deformation is quite different from that of graphene, as evident in the dispersion of their flexural modes. BN is softer than graphene and exhibits signatures of long-range ionic interactions in its optical phonons. Finally, structures with different stacking sequences of BN have comparable energies, suggesting relative abundance of slip faults, stacking faults, and structural inhomogeneities in multilayer BN. PMID:20128601

  13. The degree of biogenicity of micrites and terrestrial Mars analogues .

    NASA Astrophysics Data System (ADS)

    D'Elia, M.; Blanco, A.; Orofino, V.; Fonti, S.; Mastandrea, A.; Guido, A.; Tosti, F.; Russo, F.

    A number of indications, as the past presence of water, a denser atmosphere and a mild climate on early Mars, suggest that environmental conditions favorable to the emergence of life must have been present on that planet in the first hundred million years, or even more recently. If life actually existed on Mars, biomarkers could be still preserved with some degree of degradation. In previous laboratory works we have investigated the infrared spectral modifications induced by thermal processing on different carbonate samples, in the form of recent shells and fossils of different ages, whose biogenic origin is indisputable. The goal was to develop a method able to discriminate carbonate biogenic samples from their abiogenic counterparts. The method has been successfully applied to microbialites, i.e. bio-induced carbonates deposits, and particularly to stromatolites, the laminated fabric of microbialites, some of which can be ascribed among the oldest traces of biological activity known on Earth. This result is of valuable importance since such carbonates are linked to primitive living organisms which can be considered as good analogues for putative Martian life forms. In this work we show that, studying different parts of the same carbonate rock sample, we are able to distinguish, on the base of the degree of biogenicity, the various micrite types (i.e. detrital vs autochthonous).

  14. Upheaval Dome, An Analogue Site for Gale Center

    NASA Technical Reports Server (NTRS)

    Conrad, P. G.; Eignebrode, J. L.

    2011-01-01

    We propose Upheaval Dome in southeastern Utah as an impact analogue site on Earth to Mars Science Laboratory candidate landing site Gale Crater. The genesis of Upheaval Dome was a mystery for some time--originally thought to be a salt dome. The 5 km crater was discovered to possess shocked quartz and other shock metamorphic features just a few years ago, compelling evidence that the crater was formed by impact, although the structural geology caused Shoemaker and Herkenhoff to speculate an impact origin some 25 years earlier. The lithology of the crater is sedimentary. The oldest rocks are exposed in the center of the dome, upper Permian sandstones, and progressively younger units are well exposed moving outward from the center. These are Triassic sandstones, siltstones and shales, which are intruded by clastic dikes. There are also other clay-rich strata down section, as is the case with Gale Crater. There is significant deformation in the center of the crater, with folding and steeply tilted beds, unlike the surrounding Canyonlands area, which is relatively undeformed. The rock units are well exposed at Upheaval Dome, and there are shatter cones, impactite fragments, shocked quartz grains and melt rocks present. The mineral shock features suggest that the grains were subjected to dynamic pressures> 10 GPa.

  15. DNA information: from digital code to analogue structure.

    PubMed

    Travers, A A; Muskhelishvili, G; Thompson, J M T

    2012-06-28

    The digital linear coding carried by the base pairs in the DNA double helix is now known to have an important component that acts by altering, along its length, the natural shape and stiffness of the molecule. In this way, one region of DNA is structurally distinguished from another, constituting an additional form of encoded information manifest in three-dimensional space. These shape and stiffness variations help in guiding and facilitating the DNA during its three-dimensional spatial interactions. Such interactions with itself allow communication between genes and enhanced wrapping and histone-octamer binding within the nucleosome core particle. Meanwhile, interactions with proteins can have a reduced entropic binding penalty owing to advantageous sequence-dependent bending anisotropy. Sequence periodicity within the DNA, giving a corresponding structural periodicity of shape and stiffness, also influences the supercoiling of the molecule, which, in turn, plays an important facilitating role. In effect, the super-helical density acts as an analogue regulatory mode in contrast to the more commonly acknowledged purely digital mode. Many of these ideas are still poorly understood, and represent a fundamental and outstanding biological question. This review gives an overview of very recent developments, and hopefully identifies promising future lines of enquiry. PMID:22615471

  16. Biological targets for isatin and its analogues: Implications for therapy

    PubMed Central

    Medvedev, Alexei; Buneeva, Olga; Glover, Vivette

    2007-01-01

    Isatin and its metabolites are constituents of many natural substances. They are also components of many synthetic compounds exhibiting a wide range of effects, including antiviral activity, antitumor and antiangiogenic activity, antibacterial, antitubercular, antifungal, antiaptotic, anticonvulsant and anxyolytic activities. Isatin itself is an endogenous oxidized indole with a wide spectrum of behavioral and metabolic effects. It has a distinct and discontinuous distribution in the brain, peripheral tissues and body fluids and isatin binding sites are widely distributed also. Its output is increased during stress. Its most potent known in vitro actions are as an antagonist of atrial natriuretic peptide (ANP) function and NO signaling. As we understand more about its function and sites of action we may be able to develop new pharmacological agents to mimic or counteract its activity. We consider here the most promising biological targets for various isatin analogues and/or metabolites, which are employed for the development of various groups of therapeutics. It is also possible that the level of endogenous isatin may influence the in vivo pharmacological activity of compounds possessing the isatin moiety. PMID:19707325

  17. Detecting Pyrolysis Products from Bacteria in a Mars Soil Analogue

    NASA Technical Reports Server (NTRS)

    Glavin, D. P.; Cleaves, H. J.; Schubert, M.; Aubrey, A.; Buch, A.; Mahaffy, P. R.; Bada, J. L.

    2004-01-01

    One of the primary objectives of the 1976 Viking missions was to determine whether organic compounds, possibly of biological origin, were present in the Martian surface soils. The Viking gas chromatography mass spectrometry (GCMS) instruments found no evidence for any organic compounds of Martian origin above a few parts per billion in the upper 10 cm of surface soil, suggesting the absence of a widely distributed Martian biota. However, it is now known that key organic compounds important to biology, such as amino acids, carboxylic acids and nucleobases, would likely have been missed by the Viking GCMS instruments. In this study, a Mars soil analogue that was inoculated with approx. 10 billion Escherichia coli cells was heated at 500 C under Martian ambient pressure to release volatile organic compounds from the sample. The pyrolysis products were then analyzed for amino acids and nucleobases using high performance liquid chromatography (HPLC) and GCMS. Our experimental results indicate that at the part per billion level, the degradation products generated from several million bacterial cells per gram of Martian soil would not have been detected by the Viking GCMS instruments. Upcoming strategies for Mars exploration will require in-situ analyses by instruments that can assess whether any organic compounds, especially those that might be associated with life, are present in Martian surface samples.

  18. Onboard Detection of Active Canadian Sulfur Springs: A Europa Analogue

    NASA Technical Reports Server (NTRS)

    Castano, Rebecca; Wagstaff, Kiri; Gleeson, Damhnait; Pappalardo, Robert; Chien, Steve; Tran, Daniel; Scharenbroich, Lucas; Moghaddam, Baback; Tang, Benyang; Bue, Brian; Doggett, Thomas; Mandl, Dan; Frye, Stuart

    2008-01-01

    We discuss a current, ongoing demonstration of insitu onboard detection in which the Earth Observing-1 spacecraft detects surface sulfur deposits that originate from underlying springs by distinguishing the sulfur from the ice-rich glacial background, a good analogue for the Europan surface. In this paper, we describe the process of developing the onboard classifier for detecting the presence of sulfur in a hyperspectral scene, including the use of a training/testing set that is not exhaustively labeled, i.e.not all true positives are marked, and the selection of 12, out of 242, Hyperion instrument wavelength bands to use in the onboard detector. This study aims to demonstrate the potential for future missions to capture short-lived science events, make decisions onboard, identify high priority data for downlink and perform onboard change detection. In the future, such capability could help maximize the science return of downlink bandwidth-limited missions, addressing a significant constraint in all deep-space missions.

  19. Modern freshwater microbialite analogues for ancient dendritic reef structures

    NASA Technical Reports Server (NTRS)

    Laval, B.; Cady, S. L.; Pollack, J. C.; McKay, C. P.; Bird, J. S.; Grotzinger, J. P.; Ford, D. C.; Bohm, H. R.

    2000-01-01

    Microbialites are organosedimentary structures that can be constructed by a variety of metabolically distinct taxa. Consequently, microbialite structures abound in the fossil record, although the exact nature of the biogeochemical processes that produced them is often unknown. One such class of ancient calcareous structures, Epiphyton and Girvanella, appear in great abundance during the Early Cambrian. Together with Archeocyathids, stromatolites and thrombolites, they formed major Cambrian reef belts. To a large extent, Middle to Late Cambrian reefs are similar to Precambrian reefs, with the exception that the latter, including terminal Proterozoic reefs, do not contain Epiphyton or Girvanella. Here we report the discovery in Pavilion Lake, British Columbia, Canada, of a distinctive assemblage of freshwater calcite microbialites, some of which display microstructures similar to the fabrics displayed by Epiphyton and Girvanella. The morphologies of the modern microbialites vary with depth, and dendritic microstructures of the deep water (> 30 m) mounds indicate that they may be modern analogues for the ancient calcareous structures. These microbialites thus provide an opportunity to study the biogeochemical interactions that produce fabrics similar to those of some enigmatic Early Cambrian reef structures.

  20. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  1. The Disk and Planets of Solar Analogue τCeti

    NASA Astrophysics Data System (ADS)

    Lawler, S. M.; Francesco, J. Di; Kennedy, G.; Sibthorpe, B.; Booth, M.; Vandenbussche, B.; Matthews, B.; Tuomi, M.

    2015-01-01

    τ Ceti is a nearby, mature star very similar to our Sun, with a massive Kuiper belt analogue tep{Greavesetal2004} and possible multiplanet system tep{Tuomietal2013} that has been compared to our Solar System. We present infrared and submillimeter observations of the debris disk from the Herschel Space Observatory and the James Clerk Maxwell Telescope (JCMT). We find the best model of the disk is a wide annulus ranging from 5-55 AU, inclined from face-on by 30°. tet{Tuomietal2013} report five possible super-Earths tightly nestled inside 1.4 AU, and we model this planetary system and place dynamical constraints on the inner edge of the disk. We find that due to the low masses and fairly circular orbits of the planets, the disk could reach as close to the star as 1.5 AU, with some stable orbits even possible between the two outermost planets. The photometric modelling cannot rule out a disk inner edge as close to the star as 1 AU, though 5-10 AU produces a better fit to the data. Dynamical modelling shows that the 5 planet system is stable with the addition of a Saturn-mass planet on an orbit outside 5 AU, where the Tuomi et al. analysis would not have detected a planet of this mass.

  2. Conformational behavior of insect pheromones and analogues. Part II

    NASA Astrophysics Data System (ADS)

    Koča, Jaroslav; Carlsen, Per H. J.

    1992-04-01

    The conformational potential energy surface paths of the sex pheromone, Ipsenol, to the Bark Beetle, Ips typographus, and of a series of analogues have been elucidated using the program DAISY. The following structures were calculated: 2-methyl-6-methylene-7-octen-4-ol (Ipsenol, ( II)), 2-methyl-6-methylene-2,7-octadiene-4-ol acetate ( III), 2-methyl-6-methylene-3,7-octadien-2-ol ( IV), 2-methyl-6-methylene-1,7-octadien-3-ol ( V), 5-(3-furanyl)-2-methyl-1-penten-3-ol ( VI) and 1-(3-furanyl)-4-methyl-3-penten-2-ol ( VII). As a measure of the conformational flexibility of the molecules the flexibility coefficients, f, were determined. The f values for the molecules were determined to be: II, 0.145; III, 0.144; IV, 1.240; V, 0.133; VI, 0.825; and VII, 0.451. The molecular mechanics method was used for energy calculations in conjunction with DAISY. Low-energy conformations (conformational channels) together with energy barriers for conformational changes are presented.

  3. Synthesis and metabolism of pheromones and pheromone analogues

    SciTech Connect

    Ding, Y.S.

    1987-01-01

    (9, 10-/sup 3/H/sub 2/)Z9-14:Ac was synthesized at high specific activity (/sup 3/H, 58 Ci/mmole) by partial tritiation of the corresponding alkyne and was converted to the labeled Z9-14:OH and Z9-14:Al to study tissue specificity of acetate esterase (E), alcohol oxidase (OX), and aldehyde dehydrogenase (ALDH) in male and female Heliothis virescens. Soluble and membrane-associated enzyme activities were determined by radio-TLC assays. Compounds of the tritium-labeled Z11-16 series were synthesized and their in vitro fates examined as well. In order to achieve an alternative approach in which (1) pheromone receptor proteins would be stoichiometrically and irreversibly modified, or (2) pheromone-catabolizing enzymes are inactivated by tight-binding or irreversible inhibitors, we have designed analogues of pheromones of lepidopterous insect pests and assayed their biological activity in vitro and in vivo. Various fluorinated molecules such as acyl fluorides, fluoroolefins, 2-fluoro aldehydes, 2,2-difluoro aldehydes and trifluoromethyl ketones were synthesized. The synthesis of some other functional groups such as cyclopropanones, cyclopropanols, cyclopropyl carbinols, cyclopropyl aldehydes and Michael acceptors will also be discussed.

  4. Solar analogues and solar twins in the HARPS archive

    NASA Astrophysics Data System (ADS)

    Datson, Juliet; Flynn, Chris; Portinari, Laura

    2014-03-01

    We present 63 solar analogues and twins for which high signal-to-noise ratio (S/N) archival data are available for the High Accuracy Radial velocity Planet Searcher (HARPS) high-resolution spectrograph at the European Southern Observatory (ESO) 3.6-m telescope. We perform a differential analysis of these stellar spectra relative to the solar spectrum, similar to previous work using ESO 2.2-m/fiber-fed extended range optical spectrograph (FEROS) data, and expand our analysis by introducing a new method to test the temperature and metallicity calibration of Sun-like stars in the Geneva-Copenhagen Survey (GCS). The HARPS data are significantly better than the FEROS data, with improvements in S/N, spectral resolution and number of lines we can analyse. We confirm the offsets to the photometric scale found in our FEROS study. We confirm three solar twins found in the FEROS data as solar twins in the HARPS data, as well as identify six new twins.

  5. Stability studies of a somatostatin analogue in biodegradable implants.

    PubMed

    Rothen-Weinhold, A; Besseghir, K; Vuaridel, E; Sublet, E; Oudry, N; Gurny, R

    1999-02-15

    In recent years, peptides and proteins have received much attention as drug candidates. For many polypeptides, particularly hormones, it is desirable to release the drug continuously at a controlled rate over a period of weeks or even months, and thus a controlled release system is needed. Polylactic acid (PLA) is a biocompatible and biodegradable material with wide utility for many applications, including the design of controlled release systems for pharmaceutical agents. Pharmaceutical development of these delivery systems presents new problems in the area of stability assessment, especially for peptide drugs. In this study, we aimed to investigate the influence of different steps, during the manufacturing of an implant, on peptide stability in the polymeric matrix. Polylactic acid implants containing vapreotide, a somatostatin analogue, were prepared by extrusion. The effects of time, extrusion and temperature on the peptide stability were studied. The influence of various gamma sterilization doses, as well as the conditions under which the implants were irradiated, were also investigated. Peptide stability in the polymeric matrix was evaluated at various temperatures and at various time intervals up to 9 months. PMID:10205641

  6. Laboratory simulation on EUV photolysis of inorganic interstellar ice analogues

    NASA Astrophysics Data System (ADS)

    Chen, Y. J.; Nuevo, M.; Yih, T. S.; Ip, W. H.; Wu, C. Y.; Fung, H. S.; Lee, Y. Y.; Cheng, C.; Tsai, H. R.

    In this report we focused on the formation of large organic molecules from most simple cosmic inorganic ice analogues consisting of H 2 O CO 2 and NH 3 irradiated by extreme ultraviolet EUV photons We employed an ultra-high vacuum chamber equipped with a closed- cycle helium cryostat to simulate the environment of the space beyond the atmosphere The necessary intense simulation of solar radiation is provided by a synchrotron beam in the wide 4 -- 20eV range at National Synchrotron Radiation Research Center in Hsinchu Taiwan After exposure to 10 20 photon dose the icy sample was warmed up to room temperature under dynamic vacuum then we deposited another icy sample as well as last one and EUV irradiated and warmed up to room temperature again and again for six times the KBr substrate was then removed in an environment filled with argon gas After removed into laboratory the sample was washed with distilled water and hydrolyzed in a standard procedure the residue was then analyzed by HPLC The result shows that we could clearly identify 8 amino acids such as glycine Banaline Bserine ldots etc which were left over in the residue Associated with those basic amino acids are several other large molecules that could be tentatively identified as basic organic materials evolved from photolysis process

  7. An analogue experimental model of depth fluctuations in lava lakes

    NASA Astrophysics Data System (ADS)

    Witham, Fred; Woods, Andrew W.; Gladstone, Charlotte

    2006-07-01

    Lava lakes, consisting of molten degassing lava in summit craters of active basaltic volcanoes, sometimes exhibit complex cycles of filling and emptying on time-scales of hours to weeks such as recorded at Pu’u’O’o in Hawaii and Oldoinyo Lengai in Tanzania. Here we report on a new series of analogue laboratory experiments of two-phase flow in a reservoir-conduit-lava lake system which spontaneously generates oscillations in the depth of liquid within the lake. During the recharge phase, gas supplied from a subsurface reservoir of degassing magma drives liquid magma up the conduit, causing the lake to fill. As the magmastatic pressure in the lake increases, the upward supply of magma, driven by the gas bubbles, falls. Eventually the upflow becomes unstable, and liquid drains downwards from the lake, driven by the magmastatic pressure of the overlying lake, suppressing the ascent of any more bubbles from the chamber. At a later stage, once the lake has drained sufficiently, the descent speed of liquid through the conduit decreases below the ascent speed of the bubbles, and the recharge cycle resumes. Application of a quantitative model of the experiments to the natural system is broadly consistent with field data.

  8. Resonance IR: a coherent multidimensional analogue of resonance Raman.

    PubMed

    Boyle, Erin S; Neff-Mallon, Nathan A; Handali, Jonathan D; Wright, John C

    2014-05-01

    This work demonstrates the use of triply resonant sum frequency (TRSF) spectroscopy as a "resonance IR" analogue to resonance Raman spectroscopy. TRSF is a four-wave-mixing process where three lasers with independent frequencies interact coherently with a sample to generate an output at their triple summation frequency. The first two lasers are in the infrared and result in two vibrational excitations, while the third laser is visible and induces a two-quantum anti-Stokes resonance Raman transition. The signal intensity grows when the laser frequencies are all in resonance with coupled vibrational and electronic states. The method therefore provides electronic enhancement of IR-active vibrational modes. These modes may be buried beneath solvent in the IR spectrum and also be Raman-inactive and therefore inaccessible by other techniques. The method is presented on the centrosymmetric complex copper phthalocyanine tetrasulfonate. In this study, the two vibrational frequencies were scanned across ring-breathing modes, while the visible frequency was left in resonance with the copper phthalocyanine tetrasulfonate Q band, resulting in a two-dimensional infrared plot that also reveals coupling between vibrational states. TRSF has the potential to be a very useful probe of structurally similar biological motifs such as hemes, as well as synthetic transition-metal complexes. PMID:24707979

  9. Encoding complexity within supramolecular analogues of frustrated magnets

    NASA Astrophysics Data System (ADS)

    Cairns, Andrew B.; Cliffe, Matthew J.; Paddison, Joseph A. M.; Daisenberger, Dominik; Tucker, Matthew G.; Coudert, François-Xavier; Goodwin, Andrew L.

    2016-05-01

    The solid phases of gold(I) and/or silver(I) cyanides are supramolecular assemblies of inorganic polymer chains in which the key structural degrees of freedom—namely, the relative vertical shifts of neighbouring chains—are mathematically equivalent to the phase angles of rotating planar (‘XY’) spins. Here, we show how the supramolecular interactions between chains can be tuned to mimic different magnetic interactions. In this way, the structures of gold(I) and/or silver(I) cyanides reflect the phase behaviour of triangular XY magnets. Complex magnetic states predicted for this family of magnets—including collective spin-vortices of relevance to data storage applications—are realized in the structural chemistry of these cyanide polymers. Our results demonstrate how chemically simple inorganic materials can behave as structural analogues of otherwise inaccessible ‘toy’ spin models and also how the theoretical understanding of those models allows control over collective (‘emergent’) phenomena in supramolecular systems.

  10. Hydrogen adsorption in thin films of Prussian blue analogue

    SciTech Connect

    Yang, Dali; Ding, Vivian; Luo, Junhua; Currier, Robert P; Obrey, Steve; Zhao, Yusheng

    2008-01-01

    Quartz crystal microbalance with dissipation (QCM-D) measurement was used to investigate the kinetics of the molecular hydrogen adsorption into thin films of prussian blue analogues - Cu{sub 3}[Co(CN){sub 6}]{sub 2} at ambient conditions. Although the equilibrium adsorption seems to be independent of the thickness, the adsorption rate substantially decreases with the thickness of the films. In addition, the reversibility of H{sub 2} adsorption into the Cu{sub 3}[Co(CN){sub 6}]{sub 2} films was investigated. The results indicate that the Cu{sub 3}[Co(CN){sub 6}]{sub 2} maily interacts with H{sub 2} molecules physically. The highest H{sub 2} uptake by the Cu{sub 3}[Co(CN){sub 6}]{sub 2} films is obtained when the gas phase is stagnant inside the testing cell. However, the unusual high H{sub 2} uptake obtained from the QCM-D measurement makes us question how reliable this analytic methodology is.

  11. Effects of melatonin and its analogues on neural stem cells.

    PubMed

    Chu, Jiaqi; Tu, Yalin; Chen, Jingkao; Tan, Dunxian; Liu, Xingguo; Pi, Rongbiao

    2016-01-15

    Neural stem cells (NSCs) are multipotent cells which are capable of self-replication and differentiation into neurons, astrocytes or oligodendrocytes in the central nervous system (CNS). NSCs are found in two main regions in the adult brain: the subgranular zone (SGZ) in the hippocampal dentate gyrus (DG) and the subventricular zone (SVZ). The recent discovery of NSCs in the adult mammalian brain has fostered a plethora of translational and preclinical studies to investigate novel approaches for the therapy of neurodegenerative diseases. Melatonin is the major secretory product synthesized and secreted by the pineal gland and shows both a wide distribution within phylogenetically distant organisms from bacteria to humans and a great functional versatility. Recently, accumulated experimental evidence showed that melatonin plays an important role in NSCs, including its proliferation, differentiation and survival, which are modulated by many factors including MAPK/ERK signaling pathway, histone acetylation, neurotrophic factors, transcription factors, and apoptotic genes. The purpose of this review is to summarize the beneficial effects of melatonin on NSCs and further to discuss the potential usage of melatonin and its derivatives or analogues in the treatment of CNS neurodegenerative diseases. PMID:26499395

  12. Computational study of Met-Car analogue heterofullerenes

    NASA Astrophysics Data System (ADS)

    Domingos, H. S.

    2006-06-01

    Structural, chemical and electronic properties of a number of Met-Car analogue heterofullerenes were investigated using a combination of ab initio and semi-empirical quantum mechanical calculations.Met-Car clusters of known structure and chemistry were studied together with some new hypothetical configurations. In particular, the stability of clusters of the form Y8C12 (Y = Al, S, Si, Ti, As, Bi, Sb, P, N, B, Sn, Sc, Cr, V), XY7C12 (X, Y = B, N, Si) and Y8Z12 (Y, Z = N, B, Si) were investigated based on computed binding energies, Mulliken charges, bond orders and ionization potentials. The results indicate that some novel clusters are due for observation. Clusters of this type are known to form the building blocks of new polymerized solids and may exhibit some novel dielectric, magnetic and superconducting properties. Isomers of D3d symmetry, which are possible global energy minima for Cr, V and Sc carbide clusters, were also identified.

  13. Antimicrobial Activity of Xanthohumol and Its Selected Structural Analogues.

    PubMed

    Stompor, Monika; Żarowska, Barbara

    2016-01-01

    The objective of this study was to evaluate the antimicrobial activity of structural analogues of xanthohumol 1, a flavonoid compound found in hops (Humulus lupulus). The agar-diffusion method using filter paper disks was applied. Biological tests performed for selected strains of Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria, fungi (Alternaria sp.), and yeasts (Rhodotorula rubra, Candida albicans) revealed that compounds with at least one hydroxyl group-all of them have it at the C-4 position-demonstrated good activity. Our research showed that the strain S. aureus was more sensitive to chalcones than to the isomers in which the heterocyclic ring C is closed (flavanones). The strain R. rubra was moderately sensitive to only one compound: 4-hydroxy-4'-methoxychalcone 8. Loss of the hydroxyl group in the B-ring of 4'-methoxychalcones or its replacement by a halogen atom (-Cl, -Br), nitro group (-NO₂), ethoxy group (-OCH₂CH₃), or aliphatic substituent (-CH₃, -CH₂CH₃) resulted in the loss of antimicrobial activity towards both R. rubra yeast and S. aureus bacteria. Xanthohumol 1, naringenin 5, and chalconaringenin 7 inhibited growth of S. aureus, whereas 4-hydroxy-4'-methoxychalcone 8 was active towards two strains: S. aureus and R. rubra. PMID:27187329

  14. Dimerization of truncated melittin analogues results in cytolytic peptides.

    PubMed Central

    Rivett, D E; Kirkpatrick, A; Hewish, D R; Reilly, W; Werkmeister, J A

    1996-01-01

    A synthetic peptide with the sequence of the first 20 residues of melittin and terminating with an additional cysteine amide was found to have cytolytic activity similar to that of melittin. It was apparent from MS data that the cysteine-terminating peptides had formed disulphide dimers. A peptide in which the thiol was blocked by iodoacetate showed no activity, whereas the same peptide blocked by acetamidomethyl showed activity marginally less haemolytic than that of melittin. Cytolytic activity of melittin analogues comprising the full 26 residues could be obtained with wide sequence permutations providing that a general amphipathic helical structure was preserved. In contrast, the activity of the dimers was dependent not only on retention of an amphipathic helix but also on certain individual residues and a free positive charge. A free N-terminus was essential for haemolytic activity. In addition, a lysine or arginine residue at position 7 and a proline at position 14 were found to be necessary for activity, although it was apparent that additional residues are important for retention of the full lytic potential. PMID:8687396

  15. The Mojave vadose zone: a subsurface biosphere analogue for Mars.

    PubMed

    Abbey, William; Salas, Everett; Bhartia, Rohit; Beegle, Luther W

    2013-07-01

    If life ever evolved on the surface of Mars, it is unlikely that it would still survive there today, but as Mars evolved from a wet planet to an arid one, the subsurface environment may have presented a refuge from increasingly hostile surface conditions. Since the last glacial maximum, the Mojave Desert has experienced a similar shift from a wet to a dry environment, giving us the opportunity to study here on Earth how subsurface ecosystems in an arid environment adapt to increasingly barren surface conditions. In this paper, we advocate studying the vadose zone ecosystem of the Mojave Desert as an analogue for possible subsurface biospheres on Mars. We also describe several examples of Mars-like terrain found in the Mojave region and discuss ecological insights that might be gained by a thorough examination of the vadose zone in these specific terrains. Examples described include distributary fans (deltas, alluvial fans, etc.), paleosols overlain by basaltic lava flows, and evaporite deposits. PMID:23848498

  16. Short acting insulin analogues in intensive care unit patients

    PubMed Central

    Bilotta, Federico; Guerra, Carolina; Badenes, Rafael; Lolli, Simona; Rosa, Giovanni

    2014-01-01

    Blood glucose control in intensive care unit (ICU) patients, addressed to actively maintain blood glucose concentration within defined thresholds, is based on two major therapeutic interventions: to supply an adequate calories load and, when necessary, to continuously infuse insulin titrated to patients needs: intensive insulin therapy (IIT). Short acting insulin analogues (SAIA) have been synthesized to improve the chronic treatment of patients with diabetes but, because of the pharmacokinetic characteristics that include shorter on-set and off-set, they can be effectively used also in ICU patients and have the potential to be associated with a more limited risk of inducing episodes of iatrogenic hypoglycemia. Medical therapies carry an intrinsic risk for collateral effects; this can be more harmful in patients with unstable clinical conditions like ICU patients. To minimize these risks, the use of short acting drugs in ICU patients have gained a progressively larger room in ICU and now pharmaceutical companies and researchers design drugs dedicated to this subset of medical practice. In this article we report the rationale of using short acting drugs in ICU patients (i.e., sedation and treatment of arterial hypertension) and we also describe SAIA and their therapeutic use in ICU with the potential to minimize iatrogenic hypoglycemia related to IIT. The pharmacodynamic and pharmachokinetic characteristics of SAIA will be also discussed. PMID:24936244

  17. Digitally Programmable Analogue Circuits for Sensor Conditioning Systems

    PubMed Central

    Zatorre, Guillermo; Medrano, Nicolás; Sanz, María Teresa; Aldea, Concepción; Calvo, Belén; Celma, Santiago

    2009-01-01

    This work presents two current-mode integrated circuits designed for sensor signal preprocessing in embedded systems. The proposed circuits have been designed to provide good signal transfer and fulfill their function, while minimizing the load effects due to building complex conditioning architectures. The processing architecture based on the proposed building blocks can be reconfigured through digital programmability. Thus, sensor useful range can be expanded, changes in the sensor operation can be compensated for and furthermore, undesirable effects such as device mismatching and undesired physical magnitudes sensor sensibilities are reduced. The circuits were integrated using a 0.35 μm standard CMOS process. Experimental measurements, load effects and a study of two different tuning strategies are presented. From these results, system performance is tested in an application which entails extending the linear range of a magneto-resistive sensor. Circuit area, average power consumption and programmability features allow these circuits to be included in embedded sensing systems as a part of the analogue conditioning components. PMID:22412331

  18. Synthesis and Properties of Group IV Graphane Analogues

    NASA Astrophysics Data System (ADS)

    Goldberger, Joshua

    Similar to how carbon networks can be sculpted into low-dimensional allotropes such as fullerenes, nanotubes, and graphene with fundamentally different properties, it is possible to create similar ligand terminated sp3-hybridized honeycomb graphane derivatives containing Ge or Sn that feature unique and tunable properties. Here, we will describe our recent success in the creation of hydrogen and organic-terminated group IV graphane analogues, from the topochemical deintercalation of precursor Zintl phases, such as CaGe2. We will discuss how the optical, electronic, and thermal properties of these materials can be systematically controlled by substituting either the surface ligand or via alloying with other Group IV elements. Additionally, we have also developed an epitopotaxial approach for integrating precise thicknesses of germanane layers onto Ge wafers that combines the epitaxial deposition of CaGe2 precursor phases with the topotactic interconversion into the 2D material. Finally, we will describe our recent efforts on the synthesis and crystal structures of Sn-containing graphane alloys in order to access novel topological phenomena predicted to occur in these graphanes.

  19. Mechanism of cis-prenyltransferase reaction probed by substrate analogues

    SciTech Connect

    Lu, Yen-Pin; Liu, Hon-Ge; Teng, Kuo-Hsun; Liang, Po-Huang

    2010-10-01

    Research highlights: {yields} The extremely slow trans-OPPS reaction using 2-Fluoro-FPP supports the sequential mechanism with the carbocation intermediate. {yields} The similar UPPS reaction rate under single turnover supports the concerted mechanism, without the carbocation intermediate. {yields} The secondary kinetic isotope effect also supports associate transition state for UPPS reaction, without the carbocation intermediate. -- Abstract: Undecaprenyl pyrophosphate synthase (UPPS) is a cis-type prenyltransferases which catalyzes condensation reactions of farnesyl diphosphate (FPP) with eight isopentenyl pyrophosphate (IPP) units to generate C{sub 55} product. In this study, we used two analogues of FPP, 2-fluoro-FPP and [1,1-{sup 2}H{sub 2}]FPP, to probe the reaction mechanism of Escherichia coli UPPS. The reaction rate of 2-fluoro-FPP with IPP under single-turnover condition is similar to that of FPP, consistent with the mechanism without forming a farnesyl carbocation intermediate. Moreover, the deuterium secondary KIE of 0.985 {+-} 0.022 measured for UPPS reaction using [1,1-{sup 2}H{sub 2}]FPP supports the associative transition state. Unlike the sequential mechanism used by trans-prenyltransferases, our data demonstrate E. coli UPPS utilizes the concerted mechanism.

  20. Synthesis and Cytotoxicity Studies of Titanocene C Analogues

    PubMed Central

    Hogan, Megan; Claffey, James; Fitzpatrick, Eoin; Hickey, Thomas; Pampillón, Clara; Tacke, Matthias

    2008-01-01

    From the carbolithiation of 6-N,N-dimethylamino fulvene (3) and 2,4[bis(N,N-dimethylamino)methyl]-N-methylpyrrolyl lithium (2a), N-(N′,N′-dimethylaminomethyl)benzimidazolyl lithium (2b), or p-(N,N-dimethylamino)methylphenyl lithium (2c), the corresponding lithium cyclopentadienide intermediate (4a–c) was formed. These three lithiated intermediates underwent a transmetallation reaction with TiCl4' resulting in N,N-dimethylamino-functionalised titanocenes 5a–c. When these titanocenes were tested against a pig kidney epithelial cell line (LLC-PK), the IC50 values obtained were of 23, and 52  μM for titanocenes 5a and 5b, respectively. The most cytotoxic titanocene in this paper, 5c with an IC50 value of 13 μM, was found to be approximately two times less cytotoxic than its analogue Titanocene C (IC50=5.5 μM) and almost four times less cytotoxic than cisplatin, which showed an IC50 value of 3.3 μM when tested on the LLC-PK cell line. PMID:18274663